text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
[ 0022 ] fig1 illustrates , in its part shown as fig1 a in the drawings , schematically certain functions of a radio access network 101 according to an embodiment of the invention . the radio access network 101 is called the ran for short . it is equipped for receiving both speech frames and updating messages from mobile stations . to comply with the customary terminology in the field , the updating messages are in the following called the sid_update messages . the reception means for speech frames and sid_update messages are shown separately in fig1 a as blocks 102 and 103 respectively , although physically there is typically only one receiver that receives whatever there is to be received . there is , within the ran 101 , a certain functional unit 104 the task of which is to know , whether actual payload transmission is on in the uplink direction or whether there is a pause caused by discontinuous transmission . these situations are known as the ul dtx off and ul dtx on conditions respectively . in the functional diagram of fig1 a this unit 104 uses a switch 105 to couple the output of either the speech reception means 102 or the sid_update reception means 103 to uplink signal quality measurement 106 and reception of quality reports 107 . the latter means the reception of reports that describe signal quality observed by a mobile station in the downlink direction . from the uplink signal quality measurement function 106 there is a coupling to the generation of uplink fast power control commands at block 108 that are to be conveyed to the mobile station . from the reception of quality reports function 107 there is a coupling to the selection of downlink transmission power at block 109 . the compilation of downlink transmissions is schematically shown in fig1 a as block 110 . it receives , among others , as input information the uplink fpc commands originating from block 108 . correspondingly to unit 104 there is , within the ran 101 , a certain functional unit 111 the task of which is to know , whether actual payload transmission is on in the downlink direction or whether there is a pause caused by discontinuous transmission . in the functional diagram of fig1 a this unit 111 uses a switch 112 to couple the output of the downlink transmission compiler 110 either to the transmission of speech frames at functional block 113 or to the transmission of downlink sid_update messages at functional block 114 . [ 0025 ] fig1 illustrates also , in its part shown as fig1 b in the drawings , schematically certain functions of a mobile station 121 according to an embodiment of the invention . the mobile station 121 is called the ms for short . it is equipped for receiving both speech frames and updating messages from radio access networks . the updating messages are again called the sid_update messages . the reception means for speech frames and sid_update messages are shown separately in fig1 b as blocks 122 and 123 respectively , although physically there is typically only one receiver that receives whatever there is to be received . there is , within the ms 121 , a certain functional unit 124 the task of which is to know , whether actual payload transmission is on in the downlink direction or whether there is a pause caused by discontinuous transmission . these situations are known as the dl dtx off and dl dtx on conditions respectively . in the functional diagram of fig1 b this unit 124 uses a switch 125 to couple the output of either the speech reception means 122 or the sid_update reception means 123 to downlink signal quality measurement 126 and reception of fpc commands 127 . the latter means the reception of the commands that a ran has generated on the basis of the uplink signal quality measurements that it has performed . from the downlink signal quality measurement function 126 there is a coupling to the generation of downlink signal quality reports at block 128 . from the reception of fpc commands function 127 there is a coupling to the selection of uplink transmission power at block 129 . the compilation of uplink transmissions is schematically shown in fig1 b as block 130 . it receives , among others , as input information the downlink signal quality reports originating from block 128 . correspondingly to unit 124 there is , within the ms 121 , a certain functional unit 131 the task of which is to know , whether actual payload transmission is on in the uplink direction or whether there is a pause caused by discontinuous transmission . in the functional diagram of fig1 b this unit 131 uses a switch 132 to couple the output of the uplink transmission compiler 130 either to the transmission of speech frames at functional block 133 or to the transmission of downlink sid_update messages at functional block 134 . in order to give some additional background to the insertion of fpc - related information into sid_update messages , fig2 is discussed briefly . according to prior art , comfort noise parameters 201 , an identification marker 202 and in - band data for the purpose of link adaptation 203 were combined ( multiplexed ) 210 in a certain order to produce a sid_update block 211 . this combined block was subjected to channel coding 220 at a coding ratio of approximately ½ . the channel coded sid_update block 221 was split and interleaved in a burst formatting operation 230 to produce four sid_update bursts 231 , 232 , 233 and 234 . gmsk modulation 240 was used to modulate a carrier wave in the transmission of the bursts . according to the invention , fpc - related information is combined with the sid_update bursts . several possibilities exist for accomplishing this task . fig3 shows an alternative where in addition to a channel coded sid_update block 221 ′, also fpc - related information 322 is given as input information to the burst formatting step 230 ′. in the latter the fpc - related information 322 is mapped into the stealing symbol positions to produce the fpc - carrying bursts 331 , 332 , 333 and 334 . these are used in an 8psk modulation step 340 to produce the actual rf transmission bursts . the three - fold bit capacity of 8psk means that a different coding ratio must be used at the channel coding step 221 ′, making the coding ratio now to be approximately ⅙ . this decrease in coding ratio , which means that heavier channel coding is used , compensates for the fact that when modulation order is increased , the c / i ( carrier to interference ) requirements at reception get more difficult . in the known structure of a gmsk - modulated sid_update burst there are two stealing symbols in each burst . in gmsk this means that each stealing symbol is the equivalent of one bit in transmission . tripling the bit capacity means that also each stealing symbol may now convey the equivalent of three bits . there are four bursts related to each sid_update block , which means that the method of fig3 allows 24 fpc - related bits to be transmitted per each sid_update block . taken that the sid_update blocks are transmitted according to the known timetable where the first sid_update block occurs t = 2 * 20 ms after the dtx on condition has been reached and subsequent sid_update blocks occur at t = 2 * 20 ms + n * 8 * 20 , where n = 1 , 2 , 3 . . . , this embodiment of the invention enables the transmission of enough fpc - related bits per unit time for implementing effective fast power control . [ 0031 ] fig4 illustrates another alternative where the additional bit capacity resulting from the use of 8psk modulation 340 is partly used to convey the fpc - related information in the payload parts of the bursts 431 , 432 , 433 ja 434 . in this case the fpc - related information is another piece of input information already into the multiplexing step 410 . if the amount of fpc - related information per burst is limited , then also the method shown in fig5 is applicable . here the procedure is otherwise the same as in fig3 but instead of using the values of the stealing symbols , the burst formatting block 230 ′ maps the fpc - related information into the training sequences of the bursts 531 , 532 , 533 and 544 by selecting into each burst an appropriate one from a limited number of allowable training sequences . if the number of allowable training sequences is k , the number of discrete fpc - related values that can be conveyed per sid_update block by using the method of fig5 is k 4 . if this method is used for conveying the fpc - related information , any modulation method can be used for the sid_update bursts . when either a mobile station or a network element in a radio access network is executing a method according to the invention , its operation may be coarsely characterised by the states shown in fig6 . a kind of a basic state is state 601 where dtx is not on in either direction and all fpc - related information is transmitted in the speech frames . if uplink dtx goes on , a transition to state 602 occurs where fpc - related information to be transmitted in the uplink direction goes into the sid_update messages . uplink dtx going off causes a return to state 601 . a transition from state 601 to state 603 is a result of downlink dtx going on ; in state 603 fpc - related information to be transmitted in the downlink direction goes into the sid_update messages . again dtx going off causes a return to state 601 . if , during state 602 or 603 also the dtx in the other direction goes on , there occurs a transition to state 604 where all fpc - related information goes into the sid_update messages . the occurrence of exactly simultaneous dtx on / off transitions ( e . g . uplink dtx going off simultaneously with downlink dtx going on ) is not shown in fig6 because such occurrences are rare ; however it is straightforward for the person skilled in the art to see also the state transitions they would cause in fig6 . [ 0033 ] fig7 and 8 are simple flow diagrams that illustrate the operation of either a mobile station or a network element in a radio access network in transmitting ( fig7 ) or receiving ( fig8 ) fpc - related information . in fig7 whenever the device has fpc - related information to transmit according to step 701 , it examines at step 702 whether dtx is on in the direction concerning transmission . if no , it inserts the piece of fpc - related information into a speech frame at step 703 and transmits the speech frame at step 704 . if dtx was on , the device inserts the piece of fpc - related information into a sid_update message at step 705 and transmits the message at step 706 . in fig8 when the device is about to receive fpc - related information it examines according to step 801 , whether dtx is on in the direction concerning reception . if no , it receives a speech frame at step 802 and extract the piece of fpc - related information from the speech frame at step 803 . if dtx was on , the device receives a sid_update message at step 804 and extract the piece of fpc - related information from the sid_update message at step 805 . the hardware components required to implement the method according to the invention in a mobile station or a network element in a radio access network are basically similar to known hardware elements , with the exception that a control block that controls the placing of pieces of fpc - related information and the possibly associated changes in modulation and channel coding arrangements must be programmes to execute the methods described above . such programming is as such believed to be within the capabilities of a person skilled in the art . the exemplary embodiments of the invention presented in this patent application are not to be interpreted to pose limitations to the applicability of the appended claims . the verb “ to comprise ” is used in this patent application as an open limitation that does not exclude the existence of also unrecited features . the features recited in depending claims are mutually freely combinable unless otherwise explicitly stated . | 7 |
the invention will now be described by way of reference only to the following examples . all peptides were produced either by solid - phase synthesis under contract by invitrogen - evoquest , carlsbad , calif ., usa or were obtained from a peptide supplier neomps sa ( strasbourg , france ) or sigma - aldrich chemical company ltd . ( poole , uk ). for tests with fungi , lyophilized peptide was prepared as a stock solution of 1 , 000 μg / ml in assay buffer . where explicitly stated in experiments from which fig2 - 8 and fig1 were generated , acetic acid was added as a solvent to a final concentration of 0 . 5 %. trichophyton interdigitale ( ncpf 117 ) and trichophyton rubrum ( ncpf 335 ) strains were obtained from the national collection of pathogenic fungi , bristol and maintained in culture by transfer at approximately monthly intervals on slopes of sabuoraud &# 39 ; s agar and potato dextrose agar at 30 ° c . candida albicans strain 3179 ( obtained from the national collection of type cultures [ nctc ], colindale ) was maintained in oxoid mueller hinton broth at 37 ° c . streptococcus pyogenes strain 8198 , staphylococcus aureus strain 10642 ( methicillin - resistant ), and e . coli 0157 strain 12900 were obtained from the nctc , colindale and maintained in oxoid mueller hinton . broth at 37 ° c . to determine the sensitivity of fungal strains to each of the test peptides , their impact on fungal growth was assessed as follows . suspensions of t . interdigitale and t . rubrum conidia and hyphal fragments were prepared by adding 10 ml of fresh nutrient glucose broth ( ngb ) ( oxoid nutrient broth containing 2 % w / v glucose ) to a slope culture and agitating with a spatula . the resulting conidial / hyphal fragment suspension was filtered through 2 layers of sterile surgical gauze to remove large hyphal mats and pieces of agar . 20 μl of this suspension ( absorbance at 540 nm around 0 . 1 , corresponding to approx 10 6 propagules / ml ) was inoculated into each well of sterile , 96 well microtitre plates to which a total volume 80 μl of nutrient medium ( ngb ) and the appropriate amount of peptide solution had previously been added . control wells were those in which the final assay volume of 100 μl was made up with ngb medium alone , plus solvent ( if applicable and at the same concentration as the peptide samples if so ). fungal growth within the plates was monitored by absorbance at 540 nm in a microtek plate reader after 24 h , 4 day and 7 day incubations at 30 ° c . to determine the sensitivity of fungal strains to each of the test peptides , their impact on candida survival was assessed as follows . c . albicans cultures were grown for 18 - 24 h then stored at 4 ° c . prior to use . fresh cultures grown overnight were centrifuged at 2000 × g for 10 min and washed with fresh mueller hinton broth , adjusting the number of viable cells to between 5 × 10 6 and 1 × 10 7 / ml . assay buffer was prepared by adding 100 μl of ngb medium to 6 . 9 ml of 10 mm sodium phosphate buffer , ph 7 . 7 . 35 μl of assay buffer with or without a range of peptide concentrations was added to a sterile polypropylene screw - capped vial and 15 μl of the candida albicans inoculum described above was added . the vials were incubated at 37 ° c . in a water bath for 2 h , and the number of candida spp . surviving was determined by serial dilution in sterile phosphate buffered saline ( pbs ) and plating out onto 9 cm petri dishes containing oxoid sabouraud &# 39 ; s agar ( 20 ml ). counts were made after incubation of these plates at 37 ° c . for 18 - 24 h . streptococcus pyogenes strain 8198 , staphylococcus aureus strain 10642 ( methicillin - resistant ), and e . coli 0157 strain 12900 ( all obtained from the nctc , colindale ) were grown for 18 - 24 h then stored at 4 ° c . prior to use . fresh cultures grown overnight were centrifuged at 2000 × g for 10 min and washed with fresh mueller hinton broth . sensitivity to each of the four peptides was assayed as per c . albcans described above . for e . coli and s . aureus , the starting number of cells for the peptide sensitivity assay was 10 8 / ml and the medium used for enumeration was nutrient agar ( oxoid ). str . pyogenes grew less well than the other strains on mueller hinton agar and so the starting number of cells for these assays was lower than that for the other strains , at 10 6 / ml . str . pyogenes survival was determined using oxoid tryptose soya agar in place of nutrient agar . table 2 , below , details the peptides which correspond to the amino acid polymer codes shown in the results and figures . two clinically relevant dermal fungal pathogens , trichopyton rubrum and trichopyton interdigitale , were cultured , as described previously in the materials and methods section , in growth medium alone ( control cultures ) or in growth medium containing 50 μg / ml of peptide 1 , 2 , 3 or 4 ( seq id no : 7 - 10 , respectively ; shown in fig1 ). growth of t . interdigitale and t . rubrum was assessed by measuring the optical density ( absorbance at 540 nm ) after 4 and 7 days in culture . compared to control , un - treated samples , each peptide tested significantly inhibited t . interdigitale ( fig2 ) and t . rubrum ( fig3 ) growth at day 4 and 7 . control cultures of each test strain continued to grow , as indicated by increases in od readings , between days 4 and 7 . inhibition of candida spp . growth and survival by peptides 1 - 4 the yeast candida albicans was cultured , as described previously in the materials and methods section , in growth medium alone ( control cultures ) or in growth medium containing 50 μg / ml or 100 μg / ml and 300 μg / ml or 500 μg / ml of peptide 1 , 2 , 3 or 4 . growth of c . albicans was assessed by measuring optical density ( absorbance at 540 nm ) after 24 h ( fig4 a ) and 48 h ( fig4 b ) in culture . compared to control , un - treated samples , each peptide tested significantly inhibited c . albicans growth in both a time and dose - dependent fashion . dose - dependency of growth inhibition was further confirmed in experiments in which c . albicans growth was assessed optically after 24 h in culture under control ( growth medium alone ) conditions or in the presence of a range of concentrations of peptide 1 , from 50 μg / ml to 500 μg / ml ( fig5 ). in a separate experiment , c . albicans survival was assessed after 18 - 24 h in cultures grown in medium alone ( controls ) or those including a range of concentrations of peptide 4 spanning 1 μg / ml to 1000 μg / ml ( fig6 ). survival of the c . albicans organisms , as assessed by viability counts after 24 h in culture , decreased in a dose - dependent manner ( fig6 ). three clinically relevant bacterial pathogens , e . coli 0157 , methicillin - resistant staphylococcus aureus ( masa ) and streptococcus pyogenes were exposed , as described previously in the materials and methods section , to a range of concentrations of peptide 4 . after a period of 3 h , samples of each bacterial culture were transferred to appropriate solid phase growth media plates and the numbers of viable colonies in control ( growth medium only ) and treated ( growth medium containing peptide 4 ) samples assessed after 18 - 24 h . after 3 h of exposure , peptide 4 significantly inhibited survival of each bacterial strain ( fig7 ) compared to control , untreated cultures , in a dose dependent manner as both control ( non peptide ) and test ( containing peptide 1 , 2 , 3 or 4 ) media in experiments shown in fig2 and 3 contained 0 . 5 % acetic acid as a peptide solvent ( detailed in materials and methods section ), a separate experiment was set up to ascertain whether the acetic acid itself might play a role in peptide activity and / or fungal survival . to this end , t . rubrum growth experiments were established as per methods and materials section , with growth medium only , growth medium containing only 0 . 01 % acetic acid , growth medium containing 1 mg / ml peptide 4 and growth medium containing 1 mg / ml peptide 4 plus 0 . 01 % acetic acid . growth of the fungus was determined by od as described previously after 3 days in culture . as expected , peptide 4 inhibited t . rubrum growth . 0 . 01 % acetic acid alone had no significant effect on t . rubrum growth ( fig8 ), but when included in the medium with peptide 4 , the presence of 0 . 01 % acetic acid significantly inhibited t . rubrum growth more than 1 mg / ml of peptide 4 alone . inhibition of t . interdigitale and t . rubrum growth by peptide 4 the inhibitory effects of peptide 4 on the growth of trychophyton spp . was determined by fungal growth assay as per materials and methods . t . rubrum and t . interdigitale were cultured in medium alone or in medium containing 3 different concentrations of peptide 4 . no acetic acid was present in any samples . medium only controls were used to illustrate background absorbance of the media . growth of the fungus was determined by the od as described previously after 96 hours of incubation at 30 ° c . as shown in fig9 , these assays confirmed the inhibitory effect of peptide 4 on the growth of both species of fungi , with t . interdigitale consistently more susceptible to the inhibitory effects of peptide 4 treatment than t . rubrum . growth of t . interdigitale was inhibited at peptide concentrations of 0 . 55 mg / ml . effects of peptides 3 and 4 on t . interdigitale growth the antifungal potential of peptide 3 and peptide 4 on t . interdigitale was assessed . growth inhibition assays were performed as per materials and methods in the absence of acetic acid . as peptides 1 - 3 are highly hydrophobic and therefore insoluble they had only previously been tested against trichophyton spp . in acetic acid as solvent . when t . interdigitale cultures were grown for 7 days in the presence of peptide 3 , peptide 4 or medium alone with no acetic acid solvent and growth measured by od , peptide 4 was seen to significantly inhibit fungal growth ( fig1 ), whereas peptide 3 showed no inhibitory activity ( fig1 ). this increased activity of the cationic peptide 4 over the hydrophobic peptide 3 in the absence of 0 . 5 % acetic acid suggested a significant contribution of the acetic acid to the activity seen for the hydrophobic peptides previously . the inhibition of growth of t . interdigitale by acetic acid was assessed by establishing fungal growth experiments as per the materials and methods section . t . interdigitale cultures were either grown untreated or treated with 3 different concentrations of acetic acid at 30 ° c . for 96 hours ( fig1 ). this illustrates that there is a significant effect of 0 . 5 % acetic acid the same concentration as was used with peptides 1 - 4 previously as solvent . this experiment together with the lack of activity of peptide 3 in the absence of acetic acid suggests that peptide 4 is the most active compound against trichophyton spp . as peptide 4 is a highly cationic peptide comprising lysine and arginine residues , the antifungal activity of poly - l forms of these amino acids was tested against t . interdigitale using growth inhibition assays as detailed in materials and methods in the absence of acetic acid . control , untreated t . interdigitale cultures and those containing between 1 mg / ml and 50 μg / ml of poly - l - lysine molecules ranging from 27 - 100 residues and 100 - 200 residues in length were established . growth of the t . interdigitale in each culture was assessed after 96 hours at 30 ° c . both sizes of poly - l - lysine molecules inhibited the growth of the t . interdigitale ( fig1 ) but whereas the larger molecule inhibited growth at all concentrations tested , inhibitory activity was seen with the molecule of 27 - 100 amino acids in length only at higher concentrations ( fig1 ). this suggests that growth inhibition effects of lysine on trichophyton spp . is both size and dose - dependent . effects of poly - l - arginine and poly - l - lysine on the growth of t . rubrum the antifungal activity of poly - l - arginine versus poly - l - lysine was then tested against t . rubrum . the inhibition of growth was determined as per materials and methods in the absence of acetic acid . t . rubrum was cultured in medium alone , in medium containing poly - l - arginine ( 28 - 86 amino acids in length ) and poly - l - lysine ( 100 - 200 amino acids ). an uninoculated medium only control was also established . cultures were maintained and growth monitored for 96 hours at 30 ° c . poly - l - arginine and poly - l - lysine both inhibited the growth of t . rubrum ( fig1 ). poly - l - arginine was more active in its inhibitory impact against t . rubrum than poly - l - lysine when tested at equivalent doses , totally inhibiting growth at 1 mg / ml ( fig1 ). the inhibition of growth of trychophyton spp . by poly - l - arginine was tested by setting up fungal growth experiments as per the materials and methods section . t . rubrum and t . interdigitale cultures were either grown in medium alone or in medium containing 3 different concentrations of poly - l - arginine . no acetic acid was present in any samples . medium controls were used to illustrate background absorbance of the media . growth of the fungus was determined by the od as described previously after 96 hours of incubation at 30 ° c . ( fig1 ). polyarginine is seen to be active against both species of fungi down to 0 . 55 mg / ml ( fig1 ). effect of reduced concentration ( 100 μg / ml ) of polyarginine on t . rubrum and t . interdigitale the inhibition of growth of trychophyton spp . by polyarginine was tested by setting up fungal growth experiments as per the materials and methods section . t . rubrum and t . interdigitale cultures were either grown untreated or treated with a single concentration of polyarginine ( 100 μg / ml ), with no acetic acid present in any samples . medium controls were used to illustrate background absorbance of the media . growth of the fungus was determined by the od as described previously after 96 hours of incubation at 30 ° c . ( fig1 ). the reduced concentration leads to a loss of activity , this illustrates the dose effect of the polyarginine on the trychophyton spp . the effect of peptide trimers ( 3 amino acids ) on the growth of t . rubrum the activity of peptide trimers of poly - l - lysine , poly - l - arginine , poly - l - histidine and poly - l - tryptophan on the growth of t . rubrum was tested . the inhibition of growth was set up as per the materials and methods and t . rubrum was either left untreated or exposed to 2 mg / ml of each of the trimers . cultures were maintained for 96 hours at 30 ° c . fungal growth was measured by od and the results displayed as a percentage of the growth in the untreated culture ( fig1 ). poly - l - arginine was the most active peptide against t . rubrum with only a 3 amino acid polypeptide required to elicit a significant reduction in growth of t . rubrum . effect of peptide 4 ( 1 . 2 mg / ml ) and nacl on growth of t . interdigitale the impact of various salt concentrations on the antifungal activity of peptide 4 towards t . interdigitale was investigated . t . interdigitale growth inhibition assays were set up as per the materials and methods in the absence of acetic acid . cultures were left untreated or exposed to peptide 4 plus a range of nacl concentrations from 100 mm to 500 mm . t . interdigitale cultures were maintained for 96 h at 30 ° c . and growth assessed by od as described previously ( fig1 ). the antifungal activity of peptide 4 was not affected by to salt concentrations close to or in excess of those found under physiological conditions ( fig1 ). the antimicrobial activities of endogenous β - defensins are well - reported as being inhibited by even low salt concentrations . effect of peptide 4 against candida albicans at high salt concentrations survival of c . albicans was assessed as detailed in methods and materials following a 2 h incubation at 37 ° c . with a range of concentrations of peptide 4 . two concentrations of nacl were introduced into the growth medium to ascertain the impact of physiological and very high salt conditions ( known to inhibit endogenous β - defensin peptide activity ). significant killing activity of peptide 4 was observed at even very high salt concentrations ( fig1 ). as the concentration of peptide 4 is increased it can be seen that the impact of the higher salt concentration is reduced ( fig1 ). therefore , the fungicidal activity of peptide 4 is not inhibited by salts . activity of poly - l lysine , poly - d - lysine and poly - d - arginine against candida albicans the antifungal activity of poly - l arginine versus lysine and poly - l versus poly - d lysine was assessed in order to determine , which if any of these peptide variants demonstrated enhanced activity against candida albicans . candida spp . was incubated as described in the materials and methods section for 2 hours at 37 ° c . in the presence of 100 μg / ml , 1 mg / ml and 10 mg / ml poly - d - lysine , poly - l - lysine and poly - l - arginine . survival was assessed as detailed previously and demonstrates increased antifungal activity of poly - l - arginine over the poly - l - lysine ( fig1 ). it also demonstrates that the poly - d - lysine has very similar antifungal activity to the poly - l - lysine . | 2 |
the present invention provides a technique for enabling a user to handle a liquid package , especially a flexible beverage package , such as a juice box without displacing the contents thereof . flexible packages such as juice boxes may be filled under a vacuum . the box may have a variety of dispensing openings including a fold out spout , an opening covered by a removable cap , or a pucturable opening into which a straw is inserted . for example , a straw may be inserted into the package through an opening therethrough . the user may consume the beverage through the straw . however , especially where the walls of the package are flexible and the contents are filled under a vacuum , there is a tendency to inadvertently spill the contents of the beverage upon over squeezing the package . such a problem is particularly evident with children who have not acquired the requisite manual dexterity to use the package . the present invention therefore provides displaceable handles which may be folded out from the package itself to allow holding of the container without need to squeeze the package . additionally , the present invention provides that the fold out handles may be incorporated into graphic depictions place on the container . the present invention contemplates a wide variety of pictorial indicia which may be placed on the package and which may incorporate thereinto foldable handles . it is further contemplated that the dispensing opening may be incorporated into the pictorial design . with embodiments in which a straw is inserted into the package for consumption , the straw may also be incorporated into the graphic depiction . an example of the present invention is shown in fig1 where a plurality of packages are shown . each package may include a beverage container , such as a juice box 10 . the juice boxes 10 are arranged in one or more longitudinal arrays forming a multi - pack 11 for shipping , display and sales purposes . in the present illustrative embodiment , eight juice boxes 10 are shown arranged in two rows of four . as may be appreciated , this array may be covered in shrink wrapping ( not shown ) or other coverings to allow ease of handling . other arrays of packages ( e . g ., 1 × 4 , 3 × 3 ) are also contemplated . each juice box 10 includes pictorial indicia 12 which in this example represents an animal . the pictorial indicia may be formed by a photograph , drawing or the like and may be placed or printed on the package in conventional fashion . the pictorial indicia 12 included on each juice box 10 may be identical or as in the case of fig1 may be different . as specifically shown in fig1 , the pictorial indicia 12 on the boxes 10 may include a variety of different animals . other indicia such as information relating to the contents of the package as well as advertising and brand name information may also be included on the package . turning now to fig2 and 3 , one juice box 10 of the plurality is shown . juice box 10 is a conventional rectangular structure having opposed front and rear faces 14 and 16 , opposed side faces 18 and 20 and top and bottom faces 22 and 24 . pictorial indicia 12 , particularly shown on juice box 10 in fig2 , is that of an elephant having the face of the elephant on the front face 14 of box 10 . portions of the body , including especially the ears of the elephant extend onto side faces 18 and 20 . a portion of the ears of the elephant form fold out handles 26 which are displaceable from the sides 18 and 20 of juice box 10 . the handles 26 are positioned so that when they are displaced , as shown in fig3 , they form a continuation of the pictorial indicia 12 of the elephant . in some embodiments , the handles 26 may be adhesively secured to the box 10 with a releaseable adhesive so as to allow easy fold out of the handles from the box . alternatively , in some embodiments , the handles 26 may form a portion of the outer layer of the box 10 . as may be appreciated , once the handles 26 are folded out from the box 10 , the handles may be used to hold the juice box thereby preventing inadvertent squeezing of the walls of the box and displacing the contents therefrom . a further feature of the present invention is shown in fig3 where a straw 30 is inserted into the upper face 22 of juice box 10 . as is well known , juice boxes are typically provided with individual straws 30 which may be releasably attached to each individual juice box container . the straws are insertable through a puncturable opening 32 in one of the faces of the box to allow consumption . the present invention further provides that the straw 30 may be incorporated into the pictorial indicia on the box . as particularly shown in fig3 , pictorial indicia 12 of the face of an elephant on box face 14 includes a trunk extending upwardly . the straw 30 which extends out of upper face 22 may be positioned to represent a continuation of the elephant &# 39 ; s trunk . therefore , the displaced handles 26 , as well as the extending straw 30 , all are incorporated into the pictorial indicia 12 contained on the box 10 . turning now to fig4 and 5 , a further pictorial embodiment of the present invention is shown . box 110 includes pictorial indicia 112 representing a monkey . in this instance , the arms of the money extend as handles 126 being displaceable from the box 110 . moreover , the extending straw 130 which is inserted into the box may be incorporated into and form part of the extending tail of the monkey . as may be appreciated , other animal pictorial indicia may also be included , such as , for example , a bird or a snake as shown in fig1 . the present invention , however , is not limited to animal depictions . for example , as shown in fig6 , the pictorial indicia on the box may include inanimate objects . as shown in fig6 the box 210 may include a pictorial representation 212 of a video game controller having handles 226 which fold out and form the handles of the controller . similarly , as shown in fig7 , box 310 may include the pictorial indicia of a steering wheel 312 where the handles 326 form portions of the steering wheel . the present invention is designed to provide a flexible beverage package including a container having deformable walls which accommodate the beverage therein . the pictorial indicia on the container walls is not limited to any particular form . the handles which are displaceable from the box to allow holding of the box are incorporated into the pictorial indicia on the box . the specific embodiment shown herein should not be deemed as limiting . for example , with respect to the handles , the handles may be provided in a pair or merely a single handle may extend from the box . further , the handles may extend from adjacent or opposed side surfaces or any other surface of the box including being folded around and attached to multiple surfaces of the box . the handles may be symmetric or asymmetric . in some embodiments , different handles for a box may be shaped differently and positioned differently relative to the box . the handles may themselves be completely detachable from the box and , where completely detachable , may be reattachable thereto by use of an appropriate adhesive . where the handles are desired not to be detachable , they may be formed of tear proof or tear resistant materials . the handles themselves can be formed of a variety of materials which may be similar or dissimilar to the materials forming juice box and may be of one or multiple layers . furthermore , it is contemplated that the handles when displaced from the box for use may admit an audio signal . such signal would be provided by an embedded computer chip or other mechanism where the audio signal may be associated with the pictorial representation on the box . for example , with animal representations , it could be a noise made by an animal and with , for example , with the steering wheel of fig7 , it could be engine sounds . use of the straw as shown in fig3 and 5 , it also designed to be incorporated into the pictorial indicia of the box . therefore , the straw might be colored or have designs thereon which relate to the images on the box . further , the straw may be bendable to more fully incorporate the straw into the pictorial indicia . while the present invention is shown preferably for use with a juice box , it is not limited to a box configuration . flexible pouches , bags or the like may also be used in accordance with the present invention . furthermore , the size and shape of the package is not limited to that shown herein . other features may be incorporated into the juice box itself , such as an erasable message board or a mirror where the handles portions may include or form part of the mirror . the package may also include other detachable components such as game pieces or collectable cards . as shown in fig1 , a plurality of packages are sold in an array . the images may cross over multiple individual boxes in a multi - pack arrangement . moreover , the themes may cross over in multiple packs . still further , the outer wrapping of the array may be of the type that only exposes the theme after the wrapping is removed . various themes may be used for the individual boxes or multiple boxes . such themes may include zoos , circus , sports , dolls or action figures , food , fruits or vegetables , manners , princes , fairies , castles , plants , flowers or trees , monsters , technology , holidays and seasonal , various forms of transportation , playground components , video games , and collectible cards . furthermore , the themes may be educational highlighting grammar , spelling , geography , mathematics , science or history . various changes to the foregoing described and shown structures would now be evident to those skilled in the art . accordingly , the particularly disclosed scope of the invention is set forth in the following claims . | 1 |
the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the disclosed embodiments will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . fig2 illustrates a computer system 200 in accordance with an embodiment of the present invention . computer system 200 can generally include any type of computer system , including , but not limited to , a computer system based on a microprocessor , a mainframe computer , a digital signal processor , a portable computing device , a personal organizer , a device controller , and a computational engine within an appliance . as is illustrated in fig2 , computer system 200 includes processors 202 and 203 . processors 202 and 203 access code and data from l1 caches 204 and 205 , respectively . note that l1 caches 204 and 205 can include unified instruction / data caches , or alternatively , separate instruction caches and data caches . processors 202 and 203 are associated with translation lookaside buffers ( tlbs ) 214 and 215 , which facilitate translating virtual addresses into physical addresses for non - object references . l1 cache 204 and l1 cache 205 make use of an extended address encoding procedure that enables l1 cache 204 to function as both a conventional cache and an object cache . for example , during a conventional load operation , a virtual address is sent from processor 202 to tlb 214 . tlb 214 translates the virtual address into a physical address , which is subsequently used by l1 cache 204 . in contrast , during a load operation involving a portion of an object , processor 202 obtains the corresponding object id ( oid ) and offset and combines them to create an object address . this object address is embedded into an unused portion of the physical address space to produce an encoded address . note that the higher order bits of this encoded address are typically different than the higher order bits of any physical address . this allows the system to distinguish an encoded address from a physical address . when the encoded address is subsequently sent from processor 202 to l1 cache 204 , the encoded address bypasses tlb 214 and directly enters l1 cache 204 . note that only minor modifications are required to conventional cache designs in order to provide object caching using the above - described technique . in order to request a non - object data item , such as a value from a normal virtual address , processor 202 generates a virtual address that is sent to tlb 214 . tlb 214 translates this virtual address into a physical address , which is sent to l1 cache 204 . note that after an object address is translated into an encoded address l1 cache 204 , l1 cache 205 and l2 cache 206 can treat the encoded address in the same manner as a normal physical address . if a given data item ( or instruction ) is not located within l1 cache 204 or l1 cache 205 , it is retrieved from l2 cache 206 . if it is not located within l2 cache 206 , it is pulled into l2 cache 206 from main memory 210 . unlike in a conventional memory hierarchy , a translator 208 is interposed between l2 cache 206 and main memory 210 . translator 208 converts an object address , comprising an object id and an offset , into a corresponding physical address , which is sent to main memory 210 . if an object is not present within l2 cache 206 , the encoded address is forwarded to translator 208 . translator 208 uses an object table 209 to translate the encoded address into a corresponding physical address . each entry in object table 209 associates a given object id with a corresponding physical address in main memory where the object resides . in one embodiment of the present invention , object table 209 is a hierarchical object table comprised of object table objects as is described in more detail below with reference to fig3 through 6 . when a cache miss for an object occurs in l2 cache 206 , translator 208 intercepts the encoded address and extracts the object id . next , translator 208 uses the object id to index into the object table 209 for a corresponding physical address . once the physical address is found , translator 208 converts the load request for the object into a load request for a physical address in main memory 210 . the system uses the physical address and the offset to locate a specific cache line ( or cache lines ) in main memory 210 . fetching circuitry within translator 208 directs the normal load hardware to issue a load instruction to main memory 210 . this fetching circuitry subsequently receives the cache line corresponding to the physical address . the fetching circuitry then forwards the cache line to l2 cache 206 . object cache lines differ from conventional physical cache lines because object cache lines can start on arbitrary word boundaries , whereas physical cache lines are delineated by larger power - of - two address boundaries . hence , physical cache lines and object cache lines may not always align . for example , a physical cache line with a length of 64 bytes typically starts at a physical address that is a multiple of 64 . objects , however , may start on any physical address which is a multiple of four in a 32 - bit system . thus , a 64 - byte object cache line starting at address 44 includes addresses ( 440 . . . 107 ). this overlaps with physical cache lines ( 0 . . . 63 ) and ( 64 . . . 127 ). in this case , the object is split across two physical cache lines . hence , two load operations are required to retrieve the entire object cache line . once both physical cache lines have been retrieved , the portions of the cache lines containing the object cache line , ( 44 . . . 63 ) and ( 64 . . . 107 ), are concatenated together to form the object cache line ( 44 . . . 107 ). other portions of the physical cache lines are discarded . in the event of an eviction from l2 cache 206 , translator 208 converts the encoded address containing the object id and the offset into a physical address . the fetching circuitry subsequently uses the physical address to generate a store operation to store the evicted cache line in main memory 210 . note that during the process of evicting an object line , it may be necessary to perform a read - modify - write operation on two physical cache lines . note that processors 202 and 203 are configured to handle the extended address encoding procedure described above . in one embodiment of the present invention , a platform - independent virtual machine , such as a java virtual machine , is modified to generate requests for portions of an object using an object id and an offset . moreover , in one embodiment of the present invention , processors 202 and 203 are configured to execute special instructions for performing load and store operations involving an object id and an offset — in addition to normal load and store instructions that use virtual addresses . although the present invention is described with reference to a computer system 200 with two levels of cache , the present invention can generally be used with any single - level or multi - level caching structure . furthermore , although computer system 200 includes two processors , the present invention can generally be used with any number of processors . fig3 illustrates how a hierarchically structured object table 209 ( from fig2 above ) is mapped into cache partitions in accordance with an embodiment of the present invention . in fig3 , a cache 300 is divided into eight disjoint partitions ( 0 - 7 ). this partitioning of cache 300 can be based on three address bits associated with the cache lines that are stored in cache 300 . for example , the three lowest order bits of the address for a given cache line ( which are above the cache line offset bits ) can be used to determine whether the given cache line belongs to a specific partition ( 0 - 7 ). as is illustrated in fig3 , object table 209 includes eight root tables ( 0 - 7 ), which are each associated with corresponding partitions ( 0 - 7 ). each of these root tables ( 0 - 7 ) is also associated with a tree of object table objects . for purposes of clarity , fig3 only illustrates the tree for root table 7 , although similar trees exist ( but are not shown ) for the other root tables ( 0 - 6 ). the tree associated with root table 7 includes a number of objects 301 - 304 , which have corresponding object table entries in object table objects ( otos ) 305 - 307 . object table objects 305 - 307 have corresponding object table entries in object table table objects ( ottos ) 308 - 309 . object table table objects 308 - 309 have corresponding object table entries in object table table table object ( ottto ) 310 . finally , object table table table object 310 has a corresponding object table entry in root table 7 . note that although this example illustrates three levels of object tables , the present invention can generally be applied to object tables with fewer levels or more levels . note that there exists a mapping function that maps objects to corresponding object table objects . moreover , this same mapping function also maps object table objects to higher - level object table objects . the mapping function ensures that objects and objects table objects in one partition are always mapped to higher - level object table objects in another partition . for example , in fig3 , objects 301 - 304 are mapped to partition 3 , while the corresponding object table objects 305 - 307 are mapped to partition 4 . furthermore , the higher - level object table table objects 308 - 309 are mapped to partition 5 , while the next level object table table table object 310 is mapped to partition 6 . finally , at the highest - level , root table 7 is mapped to partition 7 . note that so long as this tree is less than eight levels deep , no higher - level object will ever occupy the same cache line as an associated lower - level object . this ensures that a cache line for an object will never collide with a cache line for an associated object table entry . fig4 illustrates the structure of address generation circuit 400 in accordance with an embodiment of the present invention . address generation circuit 400 generates an address for references to a cache 300 . as is illustrated in fig4 , address generation circuit 400 receives an object identifier 402 that uniquely identifies an object , and an object offset 404 that specifies an offset of a target field within the object . address generation circuit 400 uses object identifier 402 and object offset 404 to produce an address 405 that is used to access cache 300 . in the embodiment of the present invention illustrated in fig4 , object identifier 402 is divided into three fields [ 42 : 9 ], [ 8 : 3 ] and [ 2 : 0 ]. the field [ 2 : 0 ] contains the three lowest order bits of object identifier 402 . these three lowest order bits [ 2 : 0 ] specify a partition ( 0 - 7 ) to which the associated object belongs . for example , referring to fig2 , if the three lower bits [ 2 : 0 ] of object identifier 402 are “ 111 ,” the associated object belongs to partition 7 . note that these lowest order three bits [ 2 : 0 ] of object identifier 402 pass through address generation circuit 400 to become the lowest order three bits [ 2 : 0 ] of address 405 . the next field [ 8 : 3 ] of object identifier 402 contains six bits , which are exclusive - ored with six corresponding bits [ 11 : 6 ] of object offset 404 to produce bits [ 8 : 3 ] of address 405 . note that this exclusive oring operation serves to randomize bits [ 11 : 6 ] of object offset 404 so that object offsets are distributed evenly throughout sets of cache 300 . bits [ 8 : 3 ] of object identifier 402 are also duplicated in bits [ 48 : 43 ] of address 405 to ensure that the mapping performed by address generation circuit 400 is invertible . the next field [ 42 : 9 ] of object identifier 402 passes straight through address generation circuit 400 to become bits [ 42 : 9 ] of address 405 . finally , bits [ 52 : 49 ] of address 405 are used to determine whether address 405 is a physical address , or alternatively , an object address generated from an object identifier and an object offset . note that bits [ 52 : 49 ] of address 405 can be predetermined . note that the respective widths of oid 402 ( 43 bits ), address 405 ( 53 bits ) and object offset 404 ( 12 bits ) have been selected for purposes of illustration only . in general , many other widths are possible . for example , oid 402 may be padded out to 64 bits with zeros . as is illustrated in fig4 , the lower - order bits of address 405 comprise an index 416 that feeds into cache 300 . moreover , the remaining higher - order bits of address 405 comprise a tag 424 that also feeds into cache 300 . index 416 is used to retrieve a tag 419 from tag array 418 . it is also used to retrieve a cache line 428 from data array 420 . tag 424 ( from address 405 ) is compared against tag 419 ( retrieved from tag array 418 ) in comparator 422 . this produces cache hit signal 426 , which indicates whether tags 424 and 419 match . note that although the present invention is described in the context of a direct - mapped cache , the present invention can also be applied to other types of caches , such as a set - associative cache . the operation of the circuitry illustrated in fig4 is described in more detail below with reference to fig5 - 6 . fig5 illustrates a mapping function , f , that generates an object table object identifier ( otoid ) 504 and a corresponding object table object ( oto ) offset 506 from an object identifier ( oid ) 502 in accordance with an embodiment of the present invention . the three lower - order bits of object identifier 502 contain a partition number , p , which specifies a partition of the cache to which the object belongs . the higher - order bits are a number , x . during the mapping process , the partition number , p , is incremented so that the resulting object table object identifier is ensured to be associated with a different partition , p + 1 , of the cache . at the same time , the number x is shifted by eight bits . this shifting process discards the lower order eight bits of x , and shifts zeros into the higher order eight bits of x . hence , the function f can be represented as : fig5 also illustrates a mapping function , g , which generates an offset 506 for an object table entry ( associated with oid 402 ) within the object table object . note that the function g performs an anding operation with the number 255 to isolate the lower order 8 bits of x . ( note that the number is shifted right by eight bits because there are 256 entries in each oto , otto , etc .) hence , the function g can be represented as : note that the above - described mapping function can be used throughout the hierarchical object table 209 illustrated in fig3 to determine an identifier for higher - level object table from an identifier for an object or a lower level object table . moreover , the fact that a single function can be used for all levels of hierarchical object table 209 greatly simplifies the design of circuitry that is used to perform this mapping function . also note that the mappings f and g that map between an object identifier to a corresponding object table entry can be implemented in hardware as part of translator 208 in fig2 , along with the inverse mapping functions to extract the object identifier and the offset for translation . fig6 is a flow chart illustrating the process of generating an object table identifier for an object identifier in accordance with an embodiment of the present invention . during this process , the system receives an object identifier ( oid ) 502 ( step 602 ). next , the system increments the partition number , p , to form a new partition number , p + 1 ( step 604 ). the system also shifts the remaining bits , x , of the object identifier 502 as is described above with reference to fig5 ( step 606 ). the system additionally extracts the lower eight bits of x to produce the offset 506 as is described above with reference to fig5 ( step 608 ). the system subsequently uses the resulting object table object identifier ( otoid ) 504 and offset 506 to access the corresponding object table entry ( step 610 ). the foregoing descriptions of embodiments of the present invention have been presented for purposes of illustration and description only . they are not intended to be exhaustive or to limit the present invention to the forms disclosed . accordingly , many modifications and variations will be apparent to practitioners skilled in the art . additionally , the above disclosure is not intended to limit the present invention . the scope of the present invention is defined by the appended claims . | 6 |
hereinafter , a method for manufacturing an image sensor according to an embodiment will be described with reference to the accompanying drawings . in the description of embodiments , it will be understood that when a layer ( or film ) is referred to as being ‘ on ’ another layer or substrate , it can be directly on another layer or substrate , or intervening layers may also be present . further , it will be understood that when a layer is referred to as being ‘ under ’ another layer , it can be directly under another layer , or one or more intervening layers may also be present . in addition , it will also be understood that when a layer is referred to as being ‘ between ’ two layers , it can be the only layer between the two layers , or one or more intervening layers may also be present . referring to fig1 , a passivation layer 130 can be formed on a substrate 110 including a pad region 120 and a pixel region . in addition , although not illustrated in the figures , persons of ordinary skill in the art will appreciate that the substrate 110 can include structures such as metal interconnections , interlayer dielectric layers , transistors , diffusion regions , and so forth . the passivation layer 130 can be formed of any suitable material known in the art . in one embodiment , the passivation layer 130 can include an oxide film 132 and a nitride film 134 . for example , the oxide film 132 can be formed of tetraethylorthosilicate ( teos ) and can have a thickness of about 1 , 000 å to about 5 , 000 å . in addition , the nitride film 134 can have a thickness of about 1 , 000 å to about 10 , 000 å . then , a color filter layer 140 can be formed on the passivation layer 130 . the color filter layer 140 can be formed by any suitable process known in the art . for example , a dyeable resist can be coated on the passivation layer 130 , and then subjected to exposure and development processes to form the color filter layer 140 . the color filter layer 140 can be red , green , and blue color filter layers filtering light according to wavelength band . according to embodiments , a coating of a polymer - based planarization material for mitigating a step difference of a color filter layer 140 can be omitted . instead , a first low temperature oxide ( lto ) 150 can be directly formed on the color filter layer 140 . in one embodiment , the first low temperature oxide 150 can be deposited at a temperature of between about 150 ° c . and about 300 ° c . for example , the first low temperature oxide 150 can be formed at a temperature of about 180 ° c . of course , embodiments are not limited thereto . the first low temperature oxide 150 can include any suitable material known in the art and can be formed by any suitable process known in the art . for example , the first low temperature oxide can be formed of silicon dioxide ( sio 2 ). additionally , the first low temperature oxide 150 can be formed by , for example , chemical vapor deposition ( cvd ), physical vapor deposition ( pvd ), or plasma enhanced chemical vapor deposition ( pecvd ). in certain embodiments , there may be an irregularity ( not shown ) in the first low temperature oxide 150 . that is , a step difference may exist at a surface of the first low temperature oxide 150 due to the color filter layer 140 . accordingly , the first low temperature oxide 150 can be planarized . according to an embodiment , one method for planarizing the first low temperature oxide 150 can include a chemical dry etching . for example , a method for planarizing the first low temperature oxide 150 can be a chemical dry etching using c x f y gas ( where x and y are integers ). in one embodiment , the chemical dry etching can be preformed using cf 4 gas . in a further embodiment , the chemical dry etching can include forming plasma at several mtorr using a microwave . in another embodiment , a method for planarizing the first low temperature oxide 150 can include a plasma etching . for example , the plasma etching can be an isotropic etch applying only a capacitively coupled plasma ( ccp ) type source power . for example , the plasma etching can utilize an enhanced isotropic characteristic by applying the source power of several tens to several hundreds of watts . the plasma etching can also use c x f y based gas ( where x and y are integers ) while using pressure of several hundreds of mtorr . referring to fig2 , an organic microlens pattern 260 can be formed on the first low temperature oxide 150 . the organic microlens pattern 260 can be formed using any suitable method known in the art . for example , an organic photosensitive film pattern ( not shown ) can be formed on the first low temperature oxide 150 . then , the organic photosensitive pattern can be subjected to a reflowing process by a heat treatment at a temperature of 150 ° c . or more using , for example , a hot plate to form a semi - spherical shaped microlens pattern 260 . then , referring to fig3 , the first low temperature oxide 150 can be selectively etched using the organic microlens pattern 260 as an etch mask to form a seed microlens 160 a in the pixel region . during the forming of the seed microlens 160 a in the pixel region by selectively etching the first low temperature oxide 150 , the selective etch of the first low temperature oxide 150 can be progressed in an atmosphere of about 40 sccm to about 120 sccm of cf 4 and about 2 sccm to about 20 sccm of o 2 . in an embodiment , the seed microlens 160 a can be formed by etching the first low temperature oxide 150 by about 1 , 000 å to about 19 , 000 å by using an etching gas of c x h y f z ( where x , y , and z are non - negative integers , i . e ., 0 , 1 , 2 , etc .) and atoms or molecules of o 2 or an inert gas such as ar , he , and / or n 2 . in certain embodiments , the etching selectivity ( ratio ) of the organic microlens pattern 260 and the first low temperature oxide film layer 150 can be between about 1 : 0 . 7 to about 1 : 1 . 3 . for example , the etching selectivity of the first low temperature oxide layer 150 to the organic microlens pattern 260 can have a margin of about +/− 30 %. in one embodiment , the seed microlens 160 a can have a height to between about 2 , 000 å and about 6 , 000 å . referring to fig4 , a second low temperature oxide 160 b can be formed on the seed microlens 160 a in the pixel region to form the low temperature oxide film microlens 160 . in an embodiment , the second low temperature oxide 160 b can be formed to a thickness of about 500 å to about 20 , 000 å . according to embodiments , the second low temperature oxide 160 b can be deposited to form a gapless microlens . the second low temperature oxide 160 b can be used to reduce any gaps remaining between seed microlenses 160 a . next , referring to fig5 , the oxide film microlens 160 can be subjected to a plasma surface treatment ( p ). because the oxide film microlens 160 can be formed at a low temperature of 300 ° c . or less , the oxide film microlens 160 may have a high surface morphology . if the surface morphology of the microlens is high , photodiodes in adjacent pixels can be affected by a scattering of light by the high surface morphology of the microlens , and the transfer efficiency of the photodiodes can be degraded . therefore , by subjecting the oxide film microlens 160 to the surface treatment ( p ) as described in embodiments of the present invention , the surface morphology can be mitigated to reduce the scattering of light , making it possible to improve condensing efficiency of the microlens . in one embodiment , the plasma surface treatment p can be performed by injecting an inert gas , such as ar , he , and / or xe , into a chamber for applying the plasma surface treatment , ionizing the injected gases to provide the plasma , and etching the surface of the oxide microlens 160 by about 5 å to about 5 , 000 å , making it possible to mitigate the surface morphology of the oxide film microlens 160 . the etching can be accomplished using the ionized gases . in another embodiment , the plasma treatment p can be performed by injecting halogen gas , such as cl , f , and / or br , into a chamber for applying the plasma surface treatment , ionizing the injected gases to provide the plasma , and etching the surface of the oxide microlens 160 by about 5 å to about 5 , 000 å , making it possible to mitigate the surface morphology of the oxide film microlens 160 . the etching can be accomplished using the ionized gases . in yet another embodiment , the plasma treatment p can be performed by injecting and ionizing inert gases and halogen gases to provide the plasma for the plasma surface treatment , and etching the surface of the oxide microlens 160 by about 5 å to about 5 , 000 å , making it possible to mitigate the surface morphology of the oxide film microlens 160 . the etching can be accomplished using the ionized gases . next , referring to fig6 , a pad mask pattern 270 can be formed to open the pad region 120 . for example , a pad mask pattern 270 exposing the first low temperature oxide 150 above the pad can be formed . next , referring to fig7 , the exposed first low temperature oxide 150 can be selectively etched using the pad mask pattern 270 as an etch mask , making it possible to open the pad region 120 . for example , the etching condition for opening the pad region 120 can depend on the etching conditions of the seed microlens 160 a . that is , an etching gas of c x h y f z ( where x , y , and z are non - negative integers , i . e ., 0 , 1 , 2 , etc .) and atoms or molecules of o 2 or an inert gas such as ar , he , and / or n 2 can be used in certain embodiments . the method for manufacturing the image sensor according to an embodiment can omit a polymer - based planarization layer . also , according to an embodiment , a gapless microlens can be formed by using the oxide film , making it possible to reduce photon loss . in addition , a hard microlens can be provided by using oxide film , making it possible to inhibit defect occurrence caused by a package process or a bump process . further , a continuous type microlens can be formed , making it possible to provide the same focal length in all directions . according to embodiments of the present invention , the surface morphology of the microlens can be mitigated by performing a plasma treatment on the oxide microlens to reduce the scattering of light , making it possible to improve the condensing efficiency of the oxide microlens . any reference in this specification to “ one embodiment ,” “ an embodiment ,” “ example embodiment ,” etc ., means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the invention . the appearances of such phrases in various places in the specification are not necessarily all referring to the same embodiment . further , when a particular feature , structure , or characteristic is described in connection with any embodiment , it is submitted that it is within the purview of one skilled in the art to effect such feature , structure , or characteristic in connection with other ones of the embodiments . although embodiments have been described with reference to a number of illustrative embodiments thereof , it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this disclosure . more particularly , various variations and modifications are possible in the component parts and / or arrangements of the subject combination arrangement within the scope of the disclosure , the drawings and the appended claims . in addition to variations and modifications in the component parts and / or arrangements , alternative uses will also be apparent to those skilled in the art . | 7 |
fig1 sets forth a perspective view of a baby pacifier constructed in accordance with the present invention . the view in fig1 sets forth the present invention baby pacifier in the closed position in which the nipple member is protected within the pacifier . accordingly , the present invention pacifier generally referenced by numeral 10 includes a concave top member 12 formed of a resilient elastic material and defining a generally domed or spherical portion 16 which in turn defines an elongated longitudinal slot 12 . top 11 further defines a downwardly extending collapsalbe side wall 13 . in accordance with an important aspect of the present invention , side wall 13 further defines a plurality of circular side ribs 15 which , as set forth below in greater detail , form a collapsable accordion structure . side walls 13 terminate in a downwardly facing edge 14 and further define a trio of equally spaced slots 25 , 26 and 27 ( slot 27 better seen in fig2 ). a generally convex base member 20 defines a domed - shaped member 19 which terminates in a circular edge 21 . a pair of handle sections 30 and 31 extend through base member 20 and by means shown below , attach to the interior of spherical portion 16 . handle sections 30 and 31 further define a pair of finger ring members 32 and 33 respectively . ring members 32 and 33 are joined at seam 34 . fig2 sets forth a top view of the present invention baby pacifier in the closed position shown in fig1 . as can be seen , top 11 forms a generally circular dome - shaped member having an elongated slot 12 extending laterally across its center portion . a trio of outwardly extending tabs 22 , 23 and 24 are equally spaced about the perimeter of base member 20 ( seen in fig1 ) and extend beyond top 11 . as is set forth below in greater detail , top 11 further defines a corresponding plurality of slots 26 , 25 and 27 through which tabs 22 , 23 and 24 respectively extend through . as can also be seen in fig2 and as is set forth below in greater detail , a nipple member 50 is positioned directly beneath slot 12 in the closed position shown in fig1 and 2 . in accordance with an important aspect of the present invention and as is shown below in fig4 nipple member 50 extends through slot 12 when the present invention baby pacifier is configured in the open position shown in fig4 and described below in greater detail . fig3 sets forth a section view of the present invention baby pacifier taken along section lines 3 -- 3 in fig1 . as set forth above , the present invention baby pacifier is shown in fig1 and 3 in the closed position . with respect to fig3 top member 11 defines a generally domed or spherical portion 16 which further defines an elongated slot 12 . a downwardly extending side wall 13 terminates in an edge 14 and as set forth above , defines a plurality of slots 25 through 27 . ( slots 26 and 27 seen in fig2 ). base member 20 defines a domed member 19 terminating in an upper edge 21 and defining a pair of slots 40 and 41 . a nipple member 50 is formed of a resilient material and comprises a generally rounded nipple end 51 and a generally cylindrical nipple stem 52 . in accordance with the invention , nipple stem 52 is joined to the interior of base 20 and extends upwardly therefrom . in further accordance with the present invention nipple member 50 is positioned beneath the center of elongated slot 12 . a pair of handle sections 30 and 31 define respective generally annular finger rings 32 and 33 . in accordance with an important aspect of the present invention , finger ring 33 defines a recessed snap well 43 while finger ring 32 defines an inwardly extending generally cylindrical snap projection 42 . snap projection 42 is sized and configured to fit tightly within snap well 43 and provide a snap attachment between finger rings 32 and 33 . handle 30 defines a pair of arms 53 and 55 which extend upwardly from finger ring 32 . arm 55 extends through slot 40 and is attached or joined to the interior of domed portion 16 . correspondingly , handle section 31 defines a pair of arms 54 and 56 which extend upwardly from finger ring 33 . arm 56 extends through slot 41 in base 20 and is joined or attached to the interior of domed member 16 . in the configuration shown , top member 11 is secured to base member 20 by the cooperation of tabs 22 , 23 and 24 and slots 26 , 25 and 27 respectively . in accordance with an important aspect of the present invention , top 11 may be collapsed and drawn downwardly against base member 20 by drawing handle sections 30 and 31 downwardly through slots 40 and 41 to the position shown in fig4 . with the downward motion of handle sections 30 and 31 , spherical portion 16 is drawn downwardly against base member 20 . as spherical member 16 is drawn downwardly , nipple member 50 is forced through slot 12 which in turn causes slot 12 to deform and permit nipple member 50 to pass through slot 12 and emerge beyond top 11 . with continued downward drawing of the handle sections 30 and 31 , side walls 13 of top 11 collapse and spherical portion 16 conforms to the interior surface of base member 20 . fig4 sets forth the present invention baby pacifier configured in the open position in which spherical portion 16 of top 11 has been drawn downwardly against base member 20 . in the position shown , handle sections 32 and 33 have been drawn through base 20 . as described above , side wall 13 has been compressed by the drawing of handle sections 32 and 33 and nipple member 50 extends through slot 12 in spherical portion 16 and extends beyond top 11 . as can be seen in fig4 the exposure of nipple member 50 permits the infant to utilize the present invention pacifier in its normal manner . in addition , the present invention pacifier in the open position of fig4 may be handled by the convenient handle formed by the snapped assembly of handle sections 32 and 33 . as a result of forcing handle sections 32 and 33 upwardly , spherical section 16 is forced upwardly and slot 12 therein is passed about nipple stem 52 and rounded end 51 of nipple member 50 . the continued upward motion of handle sections 32 and 33 reconfigures the present invention baby pacifier in the closed position shown in fig1 and slot 12 due to the resilience of top 11 , returns to the elongated slot configuration shown in fig1 . as a result , the present invention pacifier completely encloses nipple member 50 in a protective environment which maintains the sanitation thereof . the present invention pacifier may be returned from the open position shown in fig4 to the closed position shown in fig1 by reversing the above - described process and forcing handle sections 32 and 33 upwardly with respect to base 20 . fig5 sets forth a detail partial section view of tab 23 and slot 25 . it should be understood that the structure of tab 22 and slot 26 as well as tab 24 and slot 27 are identical to tab 23 and slot 25 . as can be seen in fig5 tab 23 in base member 20 extends through slot 25 and captivates top 11 with respect to base member 20 . in accordance with an important aspect of the present invention , top 11 may be completely removed from base 20 by pasisng slots 24 , 25 and 26 over their respective tabs whereby top 11 may be completely removed from the present invention pacifier by unsnapping handle sections 32 and 33 and drawing them through slots 40 and 41 . as a result , the entire pacifier may be disassembled for easy cleaning and reassembled using the reverse of the above - described disassembly procedure . fig6 sets forth a bottom perspective view of an alternate embodiment of the present invention baby pacifier . a pair of handle sections 71 and 72 are constructed in accordance with and identical to handle sections 31 and 32 of the embodiment shown in fig1 through 5 . in further similarity to the embodiment of fig1 through 5 , the embodiment of fig6 defines a domed base member 70 and a spherical top portion 73 . top portion 73 is identical to spherical portion 16 in the prior embodiment and accordingly defines an accordian wall section 74 which extends to and meets base member 70 in further similarity to the above - described embodiment . it should be understood that the embodiment of fig6 defines the same internal construction having a nipple member ( not shown ) identical to nipple member 50 which cooperates with a similar slot ( not shown ) to slot 12 in the prior embodiment . it should be further understood that in similarity to the above embodiment , the structure shown in fig6 is operative by drawing handle sections 71 and 72 downwardly to cause the nipple member therein to extend upwardly through top 73 in the same operation as set forth above for the embodiment of fig1 through 5 . examination of base member discloses the sole operative difference between the alternate embodiment shown in fig6 and the embodiment shown in fig1 through 5 in that base member 70 defines a trio of post recesses 63 , 64 and 65 which extend downwardly therethrough and which receive a corresponding trio of catch posts 60 through 62 respectively . as is set forth below in fig7 catch posts 60 through 62 cooperate with post recesses 63 through 65 respectively to replace and perform the closing functions of the tab and slot arrangements shown in the prior embodiment . accordingly and with reference to fig7 which shows a section view of catch post 62 within post recess 65 , top 73 is shown in preparation for mating to and attachment to base member 70 . as can be seen , base 70 defines an inwardly extending boss 85 which in turn defines a post recess 65 . an inwardly extending projection 80 is formed in the wall portion of post recess 65 . catch post 62 defines a lip 75 . as can be seen , lip 75 is positioned and configured to cooperate with projection 80 to secure catch post 72 within post recess 65 . top 73 further defines a nesting rim 82 and an accordian wall 74 . base 70 defines a nesting recess 83 positioned and configured to receive nesting rim 82 such that the combination of catch post 62 and nesting rim 82 are received respectively within post recess 65 and nesting recess 83 to properly position top 73 with respect to base 70 . in the position shown , accordian wall 74 is in contact with edge 81 of base 70 and thus completes closure of the cavity formed by top 73 and base 70 . in addition , the position of top 73 and base 70 shown in fig7 comprises the position resulting prior to the locking of post 62 within post recess 65 to complete the assembly of top 73 to base 70 . the assembly is completed by forcing top 73 downwardly against base 70 and thereby causing catch post 62 to move downwardly within post recess 65 until lip 75 passes across and is brought into contact with projection 80 . when so positioned , lip 75 and projection 80 cooperate to secure catch post 62 within recess 65 . in addition , the nesting of nesting rim 82 within nesting recess 83 further assists in the positive positioning of top 73 with respect to base 70 . it should be understood that while fig7 shows the structure of catch post 62 and post recess 65 in detail , they are also exemplary of the structures formed by catch posts 60 and 61 and post recesses 63 and 64 respectively . what has been shown is an improved baby pacifier which provides for configuration in a closed position in which the nipple member is completely protected and thereby remains free of contamination . the inventive pacifier shown is alternatively configured into an open position in which the pacifiers nipple member is exposed for use by the baby in the normal manner . while particular embodiments of the invention have been shown and described , it will be obvious to those skilled in the art that changes and modifications may be made without departing from the invention in its broader aspects . therefore , the aim in the appended claims is to cover all such changes and modifications as fall within the true spirit and scope of the invention . | 0 |
fig1 shows a semiconductor radiation source 10 in schematic plan view . a base body 12 is provided , which carries two chips in a central region 14 . in this case , a first light source 16 is provided , which is arranged in an optical axis . in this exemplary embodiment , both light sources 16 and 18 are arranged directly in the central region of the base body 12 on which they are mounted , and which simultaneously serves for dissipating the heat generated by the chips . in this exemplary embodiment , the two chips are in each case arranged in a manner directly adjoining the optical axis 22 . they have a gap 20 between them , which is kept as small as is technically and electrically possible in order to avoid short circuits , in which case the distance may be a few micrometers . each chip is formed in square fashion in a manner known per se . a further embodiment of the semiconductor radiation source 10 according to the invention can be seen from fig2 . here and also in the further figs ., identical reference symbols denote identical or corresponding elements . in the exemplary embodiment in accordance with fig2 , the first light source 16 is provided directly in the optical axis 22 . the second light source 16 comprises four chips 24 , 26 , 28 and 30 arranged in cruciform fashion around the chip of the first light source 18 . all the chips have the same dimensions , so that the edge lengths correspond to one another . markedly narrow gaps 20 are again provided , which enable electrical isolation but do not influence the spatial proximity of all the chips in the central region 14 . in this case , too , the first and second light sources 16 and 18 can be switched independently of one another and occupy the central region 14 of the base body 12 , a significantly larger region remaining free . a further embodiment of a radiation source 10 according to the invention can be seen from fig3 . in the case of this embodiment , which is illustrated in side view in fig4 , a projection 31 is provided , which carries the first and second light sources 16 and 18 . the form of the projection 31 follows the cross formed by the first and second light sources 16 and 18 , the junctions of the limbs at 32 each having radii and in this respect being somewhat rounded and enlarged . this enables simplified mounting of the chips onto the base body 12 and good heat dissipation from the chips to said base body . the base body 12 preferably essentially comprises copper and is coated with a nickel - gold layer in particular on its front side , that is to say adjacent to the light sources . in modified refinement , the base body is completely coated with said layer on the outside . it can be seen from fig3 that the base body 12 has a bevel 34 at one corner . the bevel 34 serves to facilitate mounting in order to ensure that the contact areas discussed with reference to the subsequent figs . are connected correctly . it can be seen from fig4 that the thickness of the chips is significantly smaller than the thickness of the base body , for example by a factor of 10 . moreover , the thickness of the chips for the light sources 16 and 18 is also somewhat smaller than the height of the projection 31 . fig5 shows that the central region 14 may be surrounded by a ring area 40 , which is preferably formed by a printed circuit board 41 bearing on the base body 12 . an annulus fitted into the essentially square form of the base body 12 is preferably formed . it is particularly expedient that four contact zones 42 , 44 , 46 and 48 spaced apart from one another are formed on the other side of the ring area 40 . the contact zones 42 to 48 serve for making contact with connection wires or bonding wires for the chips of the light sources 16 , 18 . accordingly , the bonding wires ( also cf . fig7 ) extend across the ring area 40 . this also benefits the concentration of the light emission on the actually important central region 14 . it can be seen from fig6 that the printed circuit board 41 can extend essentially at the same height as the projection 31 . it goes without saying that a height adaptation can be performed in an arbitrary manner , so that the printed circuit board or the projection may also be thicker . in this embodiment , series resistors are additionally provided for the led chips , and a series resistor 49 can be seen from fig6 . with these series resistors , their calibration can be performed when led chips are connected in parallel , so that it is also possible to use unsorted led chips , which are cost - effective . the way in which the bonding wires 50 extend for making contact with the individual chips can be seen from fig7 . the corresponding contact - making ensures separate driving of the chips 24 to 30 on the one hand , and of the light source 16 , on the other hand . it goes without saying that the electrical insulation of the chips 24 to 30 and of the chip of the light source 16 can be realized in a manner known per se , for example by means of a corresponding oxidation layer of the semiconductor material used . this is not in conflict with the fact that the chips can be securely fixed on the projection 31 or the base body 12 . it can be seen from fig7 that a spacer 40 can surround the central region 14 . the spacer 40 may be formed from plastid or light metal , for example , and protect the light sources 16 and 18 . in the exemplary embodiment illustrated , it is annular and provided for receiving the covering lens 52 that can be seen from fig1 and 11 . whereas in the embodiment in accordance with fig8 and 9 , a space 54 remains above the light sources 16 and 18 , this space 54 is closed and filled with a particular substance in the embodiment in accordance with fig1 and 11 . in the exemplary embodiment illustrated , silicone gel 56 provided with yellow phosphorus particles is provided for this purpose . this ensures that the emitted light acquires a higher proportion of white without the light power being appreciably impaired . in a particularly preferred refinement which can be seen from fig1 and in modified form from fig1 , the radiation source according to the invention is incorporated into a partially illustrated combined illumination and light curing device . for this purpose , a converging lens 60 is provided , which is mounted by means of an optical holder 62 in such a way that it extends above the covering lens 52 , to be precise in a manner overlapping and covering the latter . in the embodiment in accordance with fig1 , an optical waveguide 64 extends in the radiation direction adjacent to the converging lens 60 . the light curing device , as indicated schematically in fig1 has a housing 70 and is formed as a hand held device . as can be seen from fig1 and 13 , the light sources 16 , 18 and also the covering lens 52 , but also the converging lens 60 and the optical waveguide 64 are arranged along the optical axis 22 . this enables a particularly good yield and easy focusing on the desired focal point . fig1 shows a further embodiment of a radiation source according to the invention . in this embodiment , the led chips 16 , 18 are surrounded by a spacer 72 , which simultaneously serves for supporting the covering lens 52 . adjacent to the spacer 72 there is a reflector 74 , which expands parabolically and simultaneously forms a support for the converging lens 60 at a shoulder 76 . adjacent to the converging lens , the reflector 74 further extends parabolically or conically obliquely outward in order thus to ensure optimum concentration of the emitted light . while a preferred form of this invention has been described above and shown in the accompanying drawings , it should be understood that applicant does not intend to be limited to the particular details described above and illustrated in the accompanying drawings , but intends to be limited only to the scope of the invention as defined by the following claims . in this regard , the term “ means for ” as used in the claims is intended to include not only the designs illustrated in the drawings of this application and the equivalent designs discussed in the text , but it is also intended to cover other equivalents now known to those skilled in the art , or those equivalents which may become known to those skilled in the art in the future . | 8 |
as required , detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention which may be embodied in various forms . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed structure . reference is now made to the drawings , wherein like characteristics and features of the present invention shown in the various figures are designated by the same reference numerals . referring to fig1 - 6 , a brake light system s is disclosed which includes the usual fuse 10 connected to the positive terminal 11 of the vehicle battery ahead of the brake light 12 . for the sake of simplicity only a single brake light 12 is shown but , of course , on a typical car or truck there are two . in accordance with the present invention , connected between the fuse 10 and the brake light 12 is a voltage - varying device 20 , here shown for purposes of illustrating the principle of the invention as a rheostat having a resistance 15 engaged by a slidable contact 13 connected to the fuse 10 . at the left end of the rheostat resistance 15 in fig1 an open - circuited contact 14 is positioned to be engaged by the slidable contact 13 when the vehicle brake pedal p of the brake activation means is in its normal ( i . e . not depressed ) position . the opposite end of the rheostat resistance 15 is connected to the brake light 12 . with this arrangement , normally the voltage varying device 20 is open and brake light 12 is not energized . when the driver depresses the brake pedal p , this brings the slidable contact 13 of the voltage varying device 20 into engagement with the rheostat resistance 15 to apply a voltage from the vehicle battery to a brake light 12 , turning on brake light 12 . the farther the brake pedal p is depressed , the farther the slidable contact 13 moves to the right along the rheostat resistance 15 in fig1 and the higher the voltage applied to the brake light 12 and the brighter it shines . [ 0026 ] fig2 shows a known type of voltage varying device 20 arrangement in which the voltage varying device actuator 13 a is positioned behind the brake pedal p and is depressed in response to depression of the brake pedal p by the driver of the vehicle . in accordance with the present invention , this voltage varying device actuator 13 a is mechanically coupled in any desired manner to the slidable contact 13 of the voltage varying device 20 in fig1 such that the brake light 12 shines more brightly the farther the brake pedal p is depressed . [ 0027 ] fig3 shows another known type of voltage varying device 20 arrangement in which the voltage varying device actuator 13 b is in front of the brake pedal p . in this case , the voltage varying device actuator 13 b may be a plunger that is spring - biased into engagement with the brake pedal p in all positions of the latter . fig4 shows the actuator 13 b as a plunger reciprocally received in a cylindrical housing 16 and projecting out of one end of the housing into engagement with the brake pedal p . a coil spring 17 is under compression between the opposite end of the housing and transverse member 18 on plunger actuator 13 b . plunger actuator 13 b is mechanically coupled in any desired fashion to the slidable contact 13 of the voltage varying device 20 in fig1 such that this device 20 is open when the brake pedal p is in its normal , non - depressed position and is closed in response to depression of the brake pedal p to provide an energizing voltage for the brake light 12 that varies with the position of the brake pedal p , as described . an example of a mechanical means for operating a brake light circuit rheostat is shown in fig5 and 6 , in which the slidable contact 13 angles at its distal end into a port 21 in a rheostat resistor element 15 radial lever extending from a rheostat wheel 22 . it is contemplated that the voltage varying element , whether a rheostat or other mechanism , might preferably be constructed to start illumination at a certain clearly visible level , so that there is a voltage step from zero to a pre - set magnitude . it is to be understood that the voltage - varying brake light switch 12 may differ from the rheostat - type voltage varying device shown schematically in fig1 to illustrate the principle of operation of this system s . also , the energization circuit for the brake light 12 may differ from the one shown in fig1 and instead of sensing the brake pedal &# 39 ; s p position mechanically , an optical or infrared sensor arrangement might be provided to control the energization of the brake light 12 in accordance with the sensed position of the brake pedal p . while the invention has been described , disclosed , illustrated and shown in various terms or certain embodiments or modifications which it has assumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended . | 1 |
referring to the drawings , fig1 , 11 and 12 show a back and bail assembly 10 having a back member 20 and a bail or handle portion 30 pivotally coupled to back member 20 . bail 30 has a generally u - shaped configuration including generally parallel leg members 31 and 41 each having inner sides 33 and 43 , respectively , and an outer side 32 and 42 , respectively . on each outer side 32 and 42 near the extremity of each leg member 31 and 41 are cylindrical pins or stud projections 34 and 44 , respectively , extending only to one side of the leg , formed integrally with the leg members and extending beyond outer sides 32 and 42 , respectively ( fig2 - 5 ). cylindrical pins 34 and 44 are generally coaxial with each other and provide a pivot axis for bail 30 which is rotated thereabout by grasping bail 30 at an indentation 21 within back member 20 when bail 30 is assembled with back member 20 . back member 20 includes a channel or recess 22 generally shaped to receive bail 30 with the aforementioned indentation 21 to provide easy grasping access to bail 30 . each leg of channel 22 has a pair of opposing side walls 23 and 24 ( fig1 ). as best seen in fig2 - 5 , leg members 31 and 41 of bail 30 lie in the same plane and have a front face 35 . cylindrical pins 34 and 44 are positioned on and extend outwardly from the outer sides 32 and 42 , respectively . cylindrical pin 34 has a planar inclined end 45 generally in the shape of an ellipse . as a result , cylindrical pin 34 has a rear portion extending further outwardly from side 32 than the front portion of cylindrical pin 44 . advantageously , for reasons further discussed below , the shortest side of pin 34 faces forward when bail 30 is located in the recess 22 . the inner side 33 includes a relief 46 which is more clearly seen in fig6 and 8 . thus , while legs 31 and 41 have a generally rectangular cross section , the presence of relief 46 removes one corner of leg 31 along a longitudinal portion of leg 41 best seen in fig5 where the generally triangular shape of relief 46 is visible . outer side 42 and inner side 43 of leg member 41 are generally parallel so leg member 41 has a generally constant cross section ( fig3 ). in contrast , leg member 31 has a generally trapezoidal cross section ( fig7 and 8 ) which tends toward a generally rectangular cross section as sections are taken further down leg member 31 away from cylindrical pin 34 . if desired , relief 46 can be curvilinear and have a concave surface extending into leg member 41 . as shown in fig5 a connecting portion 36 between leg members 31 and 41 has a generally triangular cross section to facilitate grasping of bail 30 . as best seen in fig1 back member 20 has a front face 25 wherein is formed a recess or channel 22 . each outer wall 24 of the recess or channel 22 has an opening 26 for receiving cylindrical pins 34 and 44 . referring to fig1 and 9 , the width dimension x of channel 22 at the position of recessed opening 26 is less than the combined width ( y ) of front face 35 and the length of cylindrical pin 34 . as disclosed in fig6 recessed openings 26 have sufficient depth , in a direction perpendicular to front face 25 , so that back member 20 can be in the same plane as front face 35 of bail 30 . additionally , as disclosed in phantom lines in fig6 recessed opening 26 extends far enough so front face 35 of bail 30 can extend somewhat forward of front face 25 of back member 20 . referring to fig7 it will be noted that once the edge e of bail leg 31 passes the edge a of channel 22 , the combined length of cylindrical pin 34 and the width of leg member 31 at the rearmost section measured at z is less than the width of channel 22 measured at w . referring to fig1 , 11 , and 12 , a pair of hollow screw receiving posts 27 extend backward from the rear of back member 20 for receiving screws to attach back member 20 to a furniture component . posts 27 have internal threads and are spaced along the length of back member 20 . preferably , bail 30 and back member 20 are die cast from zinc or a similar metal . casting allows the various projections to be easily and inexpensively formed without time consuming and expensive machinery and milling operations . installing of bail 30 to back member 20 starts by installing leg member 41 into recessed opening 26 so that cylindrical pin 44 goes into recessed opening 26 as shown in fig1 . this is relatively easy to accomplish because bail 30 is unattached at the other end and can be easily oriented to obtain such an insertion . after leg 41 is pivotally secured , leg 31 is to be inserted . however , because bail 30 is no longer free to orient as desired , it is through use of this invention that leg 41 can be easily installed to back member 20 . this invention also facilitates removal of bail 30 from back member 20 so that leg member 31 is first removed from back member 20 and then leg member 41 is removed . such assembly and disassembly of bail 30 with back member 20 is most easily discussed when referring to fig6 , 7a , 8 and 9 . the installing and removal of leg member 31 to back member 20 occurs when bail 30 is in a position shown in phantom in fig1 so that bail 30 is generally down in a position where a pulling force would not be typically applied . in such position the bail is spaced from back member 20 to facilitate grasping of leg 41 . assuming leg member 31 is already installed , leg member 31 is moved forward to the position shown in phantom in fig6 so that the forward surface of cylindrical pin 34 abuts the forward extremity of recessed opening 26 . in this position , the front face 35 of bail 30 is spaced forward of front face 25 of back member 20 so that the edge e of relief 46 can clear the edge a of recess 22 when a force to leg 31 , as indicated at arrow 50 of fig7 a , is applied to flex leg 31 and relief 46 toward side wall 23 . continued flexing of leg 31 permits the leg and its pin 34 to slide forwardly out of the channel or recess 22 . as already noted , the distance z is less than the distance w and leg 31 can be removed by applying a forward force . fig6 and 7 also clearly show the cooperation between end 45 and relief 46 . that is , although it is possible to remove leg 31 without having an angled end such as 45 , the angle helps cylindrical pin 34 slide with respect to the boundaries of recessed openings 26 . similarly , when leg 31 is being inserted , the rearmost extremity of pin 34 can be initially easily first hooked into recessed opening 26 thereby facilitating insertion of leg 31 . installation of bail 30 to back member 20 requires performing the above mentioned removal steps in reverse order . briefly , leg member 41 is installed by positioning cylindrical pin 44 into recessed opening 26 . leg 31 is flexed so that pin 34 slides into channel or recess 22 . as leg 31 proceeds into recess 22 , relief 46 slides along edge a of recess 22 until edge e of relief 46 is adjacent edge a . leg 31 is no longer flexed and bail 30 is secured to back member 20 . even though there can be relatively easy installation and removal of bail 30 and back member 20 when bail 30 is in a relatively lowered position , the pivoting of the bail to a position of 30 degrees or more prevents the bail from being removed . this is best shown in fig8 and 9 where bail 30 is shown pivoted upwardly approximately 30 and 90 degrees , respectively . as disclosed in fig8 when the bail is pivoted upwardly , the edge e of the bail leg 31 moves into the channel while the pin 34 remains in its original position . thus , the edge e cannot clear the edge a which prevents flexing of leg 31 and prevents withdrawal of the leg and its pin 34 from the channel . this is accentuated as the bail is pivoted to 90 degrees as is illustrated by fig9 . an alternative embodiment of the invention is shown in fig1 through 17 where there is shown a bail 60 of generally u - shaped construction having a pair of legs 62 and 64 each of which includes a pintle 63 and 66 extending outwardly from the upper ends of the legs . pintle 63 , as best seen in fig1 , is a solid , generally cylindrical pin with a flat end while pintle 66 , as best seen in fig1 and 16 , is solid and cylindrical but its end has a pair of beveled surfaces 68 and 69 joining at a generally vertically extending intersection 70 . as seen in fig1 , each of the beveled faces 68 and 69 form angles α and β , respectively , with an axis 71 perpendicular to the longitudinal axis of the pintle 66 . the angle α in the preferred embodiment was approximately 20 degrees while angle β was approximately 30 degrees . in fig1 , a fragmentary portion of a backing plate 80 is also shown . plate 80 can be of conventional construction or similar to that shown in the previous embodiments but modified in dimension to receive the different shaped bail 60 . the only significant change pertains to the right end bail receiving structure now described . plate 80 includes a front wall 84 having an aperture 86 formed therein to receive the pintle 66 . on opposite sides of aperture 86 are a pair of rearwardly projecting vertically extending side walls 81 and 83 . wall 83 includes a semi - circular recess 85 formed to receive the pintle 66 . the left side ( not shown ) of plate 80 is similarly constructed to pivotally receive pintle 63 . such construction permits the bail with pintle 66 to be relatively easily snapped into an assembled position since surface 69 has a sharper bevel and the pintle is relieved at surface 68 such that once edge 70 clears end 82 of the plate , the pintle easily fits into recess 83 of the side wall . when , however , the bail is lifted , the lineally extending edge 70 is rotated to provide a positive obstruction preventing removal of the pintle 66 from recess 83 of the backing plate . thus , in all respects , the alternative embodiment functions in the same manner as the previous embodiments but is significantly easier to install by virtue of the intersecting vertically extending beveled surfaces . although the above described embodiments describe the relief on only one of the legs of the bail , it is possible to have such reliefs on both legs . further , the relative positions of the cylindrical pins and reliefs can be reversed so that the pins point inwardly . still further , the position of the recesses and the pins can be reversed so that the pin is a part of the back member and the recess is a part of the bail . further modifications and variations will no doubt occur to those skilled in the art to which this invention pertains . these and all other variations which basically rely on the teachings through which this disclosure has advanced the art are properly considered within the spirit and broader aspects of this invention . | 8 |
a pressure sensitive label application system consists of equipment that applies pressure sensitive labels which are coated with a adhesive , successively , to the surfaces of a series of containers . a system of this invention is capable of supporting at least from 1 to 4 label application stations , thus applying from one to four separate labels to one container or similar object , in independent mode , and two combinations of the same label on 4 stations in redundant mode . the most general configuration 20 of this system is shown in fig1 . this two label application station machine 20 is defined as a synchronous “ rotary ” machine because the position of each container is governed by the position of the machine . containers moving down a conveyor 26 are captured and spaced apart by infeed screw 24 . infeed screw 24 is driven by a gear train that originates at the bottle table 32 . as a container travels down the feed screw 24 it is detected by an electronic sensing device , i . e ., a “ bottle present sensor ” 25 . the infeed screw 24 will transfer containers in a synchronous fashion and in mechanical coordination with pockets in an infeed star 28 . the infeed star 28 is geared to the bottle table 32 . as the infeed star 28 rotates , each container will travel along the radius of the centering guide 30 to transfer , in mechanical coordination , to a bottle support plate 34 . as the bottle table 32 rotates on its main bearing 44 , containers on bottle plates 34 are carried to the first label application station 36 (“ head # 1 ”). in the event that the application station 36 is to apply a label , as a container passes the application station , a label will be applied while the container continues to travel with the bottle table 32 . after label application , the container continues through an outside brush station 37 and an inside brush station 39 . the brush stations 37 and 39 wipe the label down onto the surface of the container . to assist in the wipe down of the labels , the bottle table 32 contains a mechanical cam track with cam followers attached to the bottle plates . the cam track will cause the bottle plates to rotate during label wipe down through the brush stations . after label application and wipe down , the containers continue to travel to application station 38 (“ head # 2 ”). after the label application process is complete at label application station 38 and related wipe down brush stations 37 and 39 , the container continues onto discharge star 40 . as the container approaches the discharge star 40 , which is geared to the bottle table 32 , the container is captured by the centering guide 30 to be transferred synchronously to the discharge star 40 . the container will travel along the radius of the centering guide 30 to transfer from the discharge star 40 to a discharge conveyor 22 . the position of the bottle turntable 32 is monitored by encoder 274 ( fig6 ) which serves as a position feedback device . such devices , generally include encoders and resolvers , as will be recognized by those skilled in the art . such devices are , for convenience and by way of example , rather than by way of limitation , referred to herein as “ encoders .” a second general configuration 49 of a labeling system is shown in fig2 . this machine 49 is defined as a non - synchronous “ inline ” machine . such inline machines are considered non - synchronous because the position of the container is random with respect to known pre - defined positions of the machine . the container - handling portion of machine 49 consists of a conveyor 50 and , usually , container - engaging timing belts 51 , which are not part of this invention . it will be noted that the machine base encoder 53 is geared to the conveyor drive motor 54 and its gearbox 52 and conveyor 50 , such that the encoder 53 will make at least 1 revolution per container . containers travel down the conveyor 50 in the direction indicated by the arrow 56 near the infeed of the machine 49 . the timing belts 51 capture the containers 58 upon entry to the machine . the timing belts 51 turn traveling generally in the same direction as conveyor 50 , and maintain position control of the containers . if desired , the timing belts 51 may be used to manipulate the containers 58 , for example , by rotating them , if required in a particular labeling sequence . containers 58 continue to travel into the machine 49 where the leading edge of each container 58 is detected by an electronic sensing device , which is usually a photoelectric cell , i . e ., the bottle present sensor 60 and its retroreflector 62 . the electronic bottle present sensor 60 will electronically identify the position of the container with respect to the machine base encoder 53 . such identification or “ position stamping ” of the leading edge of the container establishes the physical position of the container within the machine 49 . as container 58 continues into the machine towards the application station 68 (“ head # 1 ”), an electronic sensing device , the “ position latch sensor ” 64 , detects the leading edge of the container 58 and identifies or “ position stamps ” its location with respect to the machine encoder 53 . this new position stamp enables correction of position error of the container 58 prior to labeling . such errors may be caused by irregularities in the container configuration or dimensions , positioning on the machine base , etc . the container will then continue on to the label application station 68 (“ head # 1 ”). in the event that the application station 68 is to apply a label as a particular container that passes the application station , a label will be applied while the container continues to travel with the conveyor 50 . after label application , the container continues through the brush station 70 which wipes the label down onto the surface of the container 58 as the container rotates across a brush . on inline machines of this type , each label application head 68 or 78 applies the same label , with one head being active and the other in standby . if label application 78 (“ head # 2 ”) is active , while label application head 68 is inactive , the sequence of operation remains the same . the label application head 68 or 78 is responsible for the motion of the web 80 and the transfer of the leading edge of a label 306 to the surface of a container . as shown in fig3 a and 3 b , web 79 which carries labels 80 enters a push - pull actuator assembly 82 shown in detail in fig4 c . the web 79 with labels 80 passes around a first idler roller 180 and then proceeds around the smooth “ push ” capstan roller 160 . the web 79 with labels 80 leaves the push - pull unit and proceeds to spender arm assembly 81 . the spender arm assembly 81 of a type know to the art , is composed of the spender arm mounting bracket 88 , spender arm pivot bracket 90 , spender arm pivot groove 92 , spender arm upper rod 94 , and lower rod 95 , spender plate 96 , spender plate foot 98 , web guide assembly 100 , and sensor mounting assembly 102 . the web 79 with labels 80 will pass across the front of the spender arm to and around the edge of the spender plate 96 thereby causing the labels to separate from the web , in know fashion . the web 79 without labels will then continue on to and around another idler roller 180 to the “ pull ” capstan 158 . the web continues around the “ pull ” capstan 158 and continues on to the rewind dancer assembly rollers 108 . after the web passes through the rewind dancer assembly 109 , the web is rewound onto the rewind capstan 130 , as a roll 146 . the rewind dancer is constructed of a series of rollers . one set of rollers are stationary , with the other set mounted to a dancer arm 134 connected to a pivot shaft that is in turn connected to the rewind proportioning disk 110 . an electronic signal generator 112 monitors the position of the proportioning disk 110 . as material leaves the push - pull assembly 84 , the dancer arm 134 moves toward an open position to provide for storage of the material due to the force applied by the spring tension device 111 . the electronic signal generator 112 monitors the position change of the proportioning disk 110 and outputs an analog electronic signal to the motor drive 114 that feeds power to the dc unwind motor 116 . the dc unwind motor 116 drives its gearbox 118 through a right angle shaft adapter 120 to drive the rewind capstan 130 and disk 126 . as the rewind capstan 130 rewinds material , the dancer arm 134 will move towards a closed position thus causing the electronic signal generator 112 to reduce the analog signal to the rewind drive 114 , thus reducing the speed of the motor 116 . the smooth “ push ” capstan 160 is attached to its drive gear 156 ( fig4 b ), with the knurled “ pull ” capstan 158 being also attached to a drive gear 154 . the servomotor 150 through the servomotor drive gear 152 drives the gears 160 and 156 . rubber coated nip rollers 164 and 162 have eccentric shafts that are actuated by the nip pressure actuation levers 166 and 170 . spring 172 applies tension to the “ push ” capstan nip pressure actuator lever 170 . this actuation causes the rubber coated nip roller 164 to apply pressure to the smooth “ push ” capstan 160 . spring 168 applies tension to the “ pull ” capstan nip pressure actuation lever 166 . this actuation causes the rubber coated nip roller 162 to apply pressure to the knurled “ pull ” capstan 158 . the nips between the capstans 160 and 156 and the rubber coated nip rollers 164 and 162 , respectively , pinch the web 80 such that there is no web slip across the knurled capstan 158 , and there is nip pressure controlled slip across the smooth capstan 160 . the circumference of the smooth capstan 160 is slightly less than the circumference of the knurled capstan 158 . the drive gears for the capstans 160 and 158 are the same size . as the servomotor 150 drives the capstans 158 and 160 which move the web material across the spender plate 96 . the mismatch in circumference between the two capstans causes the web to acquire tension . web tension is dictated by the frictional component of the web 80 to the surface of the smooth capstan 160 . the applied pressure of the rubber nip roller 164 dictates the quantity of friction to the smooth capstan 160 . the web tension controls the peel angle of the label as it leaves the web , as the web is pulled around the sharp edge of the spender plate 96 . the unwind station shown in fig5 a and 5 b is a stand - alone system that functions to provide web material 79 with labels 80 to the label application head 68 or 78 from a roll of label material . the unwind station also provides an inertia buffer between the high acceleration web drive assembly 84 , fig4 a , 4 b and 4 c , and the large inertial load of the material reel 204 . a supply roll of unused label material 204 is mounted onto the unwind hub 202 and fixtured between the unwind disks 206 . the web material 79 with labels 80 is pulled from roll 204 by the nip 212 created by the nip roller assemble 214 and a rubber coated unwind drive roller 216 . the unwind drive roller 216 is connected to the dc motor 219 and controlled by the electronic signaling device 220 . as the label application head dispenses labels , the web inertia buffer gravity loop bobbin 220 will move up as web material is pulled from the buffer zone 218 . an electronic signaling device 222 signals the motor 219 to turn on . the motor 219 drives the unwind drive roller 216 which in turn pulls web material across the web guide idler roller 208 and from the material roll 204 . as the unwind drive roller 216 pulls material from the material roll 204 into the buffer zone 218 , the bobbin 220 will move down until the electronic sensing device 222 detects the bobbin 220 thus turning the motor 219 off . the web tension brushes 234 and 240 apply tension to the web 80 to stabilize the web path . the machine base 20 , shown , in elevation in fig6 is responsible for the flow of containers and their positions with respect to the application heads 36 and 38 . a rotary encoder 274 geared to the bottle table 258 through main bull gear 260 . the main bull gear 260 is driven by main drive gear 262 , which in turn is driven by gearbox 264 and the main drive motor 266 . the master encoder 274 is geared to the machine such that it makes one revolution per container . this is accomplished by the correct selection of intermediary encoder gears 271 and 272 . the master encoder 274 provides feedback to the computer control systems on each containers physical location on the machine . bull gear 260 drives main bearing shaft 261 , which in turn drives the rotating components including the bottle table assembly 258 and carrier assembly 286 . the main bearing housing 254 supports the rotating components and the non - rotating bottle table cam housing assembly 268 . the containers in the machine are fixtured by the bottle plates 270 and the centering bells 282 which are connected to the spring loaded centering head 284 , that is affixed to the carrier assembly 286 . as containers are processed through the machine , cam segments in the bottle table cam housing assembly 268 , turn the containers to the correct kinematic positions that relate to the needs of the appropriate process . the kinematics include presentations and motion for labeling , label wipe down and other process such as inspection or coding . fig6 includes examples of the wipe down brush stations including the outside brush station mount 269 , the outside brush mount assembly 292 , the wipe down brush 290 and the inside brush mount 298 , with its associated inside wipe down brush 296 . the support columns 255 affix the non - rotating portions of the machine head 280 and cam carrier housing 256 . the brush station bearing 294 is affixed to the outside of the machine base table plate 250 and affix the inside brush stations to the non - rotation machine base . the table plate support assembly 252 supports the machine table plate 250 . the correlation of the encoder 274 to the machine base position is defined as the machine master axis . on rotary machines , the centerline distance between two containers is defined as one pitch . label application control is accomplished with a multiprocessor computer controlled servo system or motion control system . see fig1 . the motion control processor 520 with its corresponding servo amplifier 524 and servomotor 526 are responsible for the actual motion of the label carrying web 80 . computer host processor 536 is responsible for the system background tasks , internal machine process shift register and process rules . the container tracking processor 528 is responsible for all machine position controls . as a container enters the machine an electronic signaling device the bottle present sensor 538 signals the container tracking processor 528 that a container is entering the machine . the container tracking processor 528 electronically notifies the computer host processor 536 that a container is present . the computer host processor 536 enters a valid container into the internal labeling process shift register . as the machine continues to rotate the z axis pulse of the master encoder 522 providing electronic position signals to the container tracking processor 528 , indicates the beginning of the next pitch cycle . the container tracking processor 528 will electronically indicate to the computer host processor 536 that a new pitch has started . the computer host processor 536 will increment the internal labeling process shift register . the labeling process shift register pitch increment process will continue as the container moves through the machine , until the container reaches the label application head or a container / label position correction sensor 534 . in the event that the machine incorporates the use of the optional container / label position correction sensor 308 , the position of a surface artifact such as a surface embossment on a container or a previously applied label 306 ( fig7 ), may be used as a position reference for a container 58 which is , thus , independent of the container fixtures 34 of the bottle table 32 . when the beam 310 of the electronic signaling device 308 is interrupted by the leading edge of the label 306 a signal is generated . as seen in fig1 , the electronic signal generated by the container / label position correction sensor 308 provides a position locating electronic signal or “ stamp ” to the container tracking processor 528 which relates to the exact position of the master encoder 274 . the stamped position of the master encoder 274 , is then electronically compared to a preset application parameter in the container tracking processor 528 , which specifies the predicted position of the tracked artifact thus generating a label contact point position offset . the label contact point position offset is turn used to edit , electronically , the preset label contact point position parameter which dictates the position on the container to which the label is to be applied . as the container proceeds to the position on the machine where the label is to be applied , the computer host processor 536 indicates electronically to the container tracking processor 528 that a container is to be labeled . as the container enters the labeling zone the container tracking processor 528 electronically signals the motion control processor 520 to begin the labeling process . referring to fig1 , the correlation of the motion control system &# 39 ; s internal position feedback ; that is the servo loop closed around the web drive motor feedback 411 , with respect to the label carrying web position feedback 410 , is defined as the labeling axis . to successfully complete the labeling process , the leading edge of each label must applied to a precise position on the associated container and the velocity of the label during application must match the surface velocity of the container . between label applications , the motion profile is required to prepare itself for the next labeling process as well as to correct for any registration error which may have occurred . the means of performing the label application motion is through a position slaved move profile . that is , a move profile where the labeling axis position is based on the position of the master axis encoder 400 , of the machine base . the servo loop of the labeling axis 412 is also a closed position loop with the label &# 39 ; s leading edge used as a registration mark where and in feedback is provided by electronic signaling device 414 , the registration sensor , which electronically position stamps the labeling axis position at the point of the registration mark . this correction can only be allowed to occur when the actual labeling process is not being performed in order to reduce label - to - container surface velocity mismatch which would result from attempted position correction during label application . the process of motion control referred to as position slaving relies fundamentally on the use of a master axis and a slave axis . the master axis indicated by encoder 274 provides feedback for computing the commanded position of the servo system of the slave or labeling axis . for each master position feedback unit or count , the slave axis is assigned a corresponding position . in the preferred example , the master feedback relates to the position of the machine base and is mechanically geared such that the feedback period is one machine pitch in length . note that the period is measured in distance instead of time since this is not a time based motion controller , but a position based controller . using a position slaved servo loop can be described , in general , by means of a block diagram of the basic components of the servo loop . referring again to fig1 , we see that the main reference bench mark that dictates the motion is the position of the machine base encoder 400 . this position is signaled to processor 528 which utilizes a profile - generating algorithm 402 such that the desired position of the label web is directly related to the machine base position based on the algorithm &# 39 ; s mathematical equation . the resulting motion profile ideally can be generated and updated continually if the processing power of the servo controller is sufficient . if this is not possible , the motion profile could also be generated , only upon receiving new setup information relating to the geometry of the label , web , container , or machine which is stored in a look up table . the position slaved servo system would then generate its motion profile by referencing the look up table and utilizing the master feedback as an index to the table . then , only the servo loop update and registration correction algorithm calculation are performed in real time . the remaining blocks in the diagram fig1 , describe a general type of high performance positioning servo system . the system utilizes the torque controlled servo amplifier 404 closed around a proportional , integral , derivative ( pid ) servo loop 406 utilizing velocity and acceleration feedforward terms 408 to essentially eliminate following error in the system . the position slaved motion profile , illustrated graphically in fig1 and 12 , will implement a piecewise continuous function comprised of a minimum of three separate functions . these functions are represented by mathematical equations wherein the mathematical expression is a function of master feedback counts . the three basic portions of the illustrated complete function are : the label application function , which is based on the geometry of the machine and the container . the pre - labeling move which primarily is the portion of the move that accelerates the web so that it has reached labeling velocity at the precise position of label placement on the surface of the container while making a smooth transition to the label application function ; the post - labeling move which handles the deceleration , the recording of any registration error , and the preparation of the web position for the next label application , taking into account any observed registration error . it should also be noted that each of the basic portions of the function may be comprised of multiple sub - functions . the total function of the move profile , f t ( i ), is expressed as follows : f t ( i ) = ∑ s = 1 n f s ( i ) the plots shown in fig1 and fig1 illustrate such a motion profile , which is comprised of 6 functions pieced together to form a single continuous function . the functions shown in fig1 and 12 of the curve denoted as f s ( 0 ) 420 or 432 and f s ( 5 ) 430 or 442 are regions where the label web axis is in servo lock but no motion is commanded . this would represent the position between containers where no labeling action is required . the function denoted as f s ( 1 ) 422 or 434 is the region of acceleration of the web . the function denoted as f s ( 2 ) 424 or 436 represents a region of the curve where the labeling process is occurring . as can be clearly seen in fig1 , the illustrated curve in this case is a constant velocity function . this is not , however , generally the case for applications with complicated container geometry or special labeling requirements . referring again to fig1 and 12 , the function denoted as f s ( 3 ) 426 or 438 is the region of deceleration of the web . the example shown utilized a sinusoidal profile generator in both the position ( fig1 ) and velocity ( fig1 ) domain of the profile . the function denoted as f s ( 4 ) 428 or 440 is optional as shown . function f s ( 4 ) 428 or 440 would be used to back the web up to allow for more web material to be made available in the event that the servo system does not have the acceleration capabilities to achieve the surface velocity of the container within the constraints of the label application travel distance . the label application travel distance is comprised of the label length plus the gap between adjacent labels on the web . a situation requiring f s ( 4 ) presently occurs on pressure sensitive labeling machines where the application requires short labels on high surface velocity machines . note that these functions can not be performed on prior art velocity slaved system . the example shown utilizes a sinusoidal profile generation utilizing a half period in the position domain as shown in fig1 . region f s ( 4 ) 428 , 440 or f s ( 5 ) 430 , 442 will also be utilized as the regions where registration error correction is accomplished . this is necessary to account for the outer position loop 410 , fig1 to be closed around the web material itself . it is desirable to perform the correction here since the label application has been completed and the system is simply preparing for the next application . the concept of a position slaved motion control system has been defined and its benefits have been explained . next , the manner in which this motion control system relates to a pressure sensitive labeling process on a machine , will be explained . there are several basic building blocks in the motion control system which are necessary for position slaved control . they are shown in fig1 as follows : a motion control processor 520 that incorporates the use of microprocessors capable of performing math intensive functions at a very high rate is provided . recent technological advances in microprocessor architectures has made available today , devices that provide the needed computational speed to perform complex mathematical position loop closure . this technology includes digital signal processors such as the advanced or modified harvard architecture processor . because microprocessor technology continues to advance , the nature of the microprocessor is not directly a part of the invention except in so far as the ability to process and calculate complex mathematical equations that relate to the position of a label to be applied to a container has been made possible by the present level of computer technology . the motion control processor 520 must perform at a rate of at least one position loop update every 125 microseconds for the pressure sensitive label application . this is necessary to maintain the placement accuracy of the labels at very high linear web speeds and accelerations . an encoder 274 or , alternatively , a rotary resolver , which serves as a feedback device on the machine base serves as the master feedback position index . this provides the index through which the motion control processor 520 produces the position - slaved motion profiles . a high performance web drive servomotor and amplifier 150 , 404 . the system must have a very high torque to inertia ratio to achieve the necessary accelerations for a machine running in excess of 750 cycles per minute . a high speed input 532 into the motion controller 520 , which performs a hardware capture of the slave axis position is necessary . this input should be able to identify the axis position in less than 20 microseconds . this input is connected to the electronic signal device 530 utilized for registration error correction of the labels on the web material . the container tracking processor 528 is responsible for identifying the container position and the computer host processor 536 is responsible for the process overhead , diagnostics , and rules . the container tracking processor 528 and the computer host processor 536 will be discussed in detail later . the manner in which these components of the system operate together in the system is as follows : a known parameter , the point 362 on the container 58 where the label 306 must initially make contact for accurate placement is a known parameter see fig9 . this is referred to herein as the contact point . this point is a predetermined position on the surface of a container that is subject to customer quality placement specifications . the drawing fig9 illustrates a method to coordinate the selected label contact point to a fixed object that exists on the container 58 . with respect to the application of multiple labels to a single container , using the example of a front label and back label application to a single container , as indicated in fig9 a problem exists with machines that use a master index machine reference position of the machine bottle table 350 , with containers in pre - positioned holders 34 to determine the placement of the labels 306 and 358 . customer specifications on label placement generally refer to the distance , edge to edge , between the two labels . because the motion control system incorporates the use of the machine master index signaled by encoder 274 to indicate the contact point 362 of the second label 358 , tolerance stackup occurs between the 2 labels during application . to achieve high accuracy placement between two labels on a container 58 , the position of the first label applied 306 must be determined and used to reference the position of the application of the second label 358 . the secondary position detection system shown in fig7 adds an important feature to the system . this function allows the label application system to reference the position of an object such as label 306 on the surface of the actual physical container 58 , not a theoretical position on the container surface of a container positioned on the machine base , as is the case with other labelers . the bottle table 32 is connected to the master encoder 274 . the bottle 58 is captured by the bottle plate 34 . the label 306 leading edge 310 is detected by an electronic signal generator 308 . the electronic signal is used to identify a corrected first label position which thus identifies any deviation or offset from the machine master index position prior to label application . fig8 indicates this function on an inline machine with respect to container position . inline machines generally have problems with accurate container handing due to the fact that there are no fixtures to hold the container positions . in the case of timing belts , container slip for any reason results in position error with respect to the master encoder position . containers are moving in the machine on conveyor 320 . bottle present sensor 60 will electronically signal the master index position of a container 72 when the container breaks the sensor beam 65 . the containers as they move through the system may develop error as to their position . the containers leading edge 72 is detected by an electronic signal generator 64 when the container breaks sensor beam 65 . the electronic signal is used to identify or “ position stamp ” a corrected first container position offset from the container &# 39 ; s machine master index position just prior to label application . the motion control processor uses the master encoder counts as an index . this index acts as a time component which a non - position slaved motion control algorithm uses to generate the move profile . in the position slaved motion control algorithm , the motion control processor does not have any time component in the move profile algorithm . this unique feature enables the contact point to be consistent through all speed ranges . this is accomplished by virtue of the fact that the position feedback index acts as a variable time component resulting in variable acceleration of the slave axis , which is driving the label web . as the machine speeds up , the feedback counts enter the motion control processor at a higher rate , which in turn results in a higher acceleration rate . this variable acceleration in the position slaved motion control system is crucial to repeatable label placement accuracy of the pressure sensitive labeling head . this is because the master and the slave axes are linked together by an exact function relating the position of the master to the position of the slave . accuracy is thus maintained at any machine speed up to the physical constraints detected by maximum achievable acceleration . as an example , we will utilize a simple move profile , which is trapezoidal as to velocity since this is a very common move . because this is a position - based system , the profile will be defined as position of the slave as a function of the master feedback index . for the example , we will limit the scope to the first portion of the move , the acceleration , up to the constant velocity portion . if we integrate the trapezoidal function shown in fig1 with respect to the master index , the position profile is readily shown to be a second order polynomial where the acceleration occurs and a positive sloping line during constant velocity as shown in fig1 . note that the units of the vertical axis is position of the slave axis and the units of the horizontal axis is position of the master feedback index . the following graph , fig1 , shows the relationship between the machine speed in containers per minute and the number of index counts of the master feedback versus time . we note the linear relationship of the two . this relationship is fairly obvious , and is the reason why the position slaved system works so well for the labeling process . the relationship between the master feedback index and the slave position is a constant , and the relationship between machine speed and the master feedback index is constant . therefore , the relationship between the machine speed and the slave , or labeling axis , is constant as illustrated in fig1 . this results in the application of a pressure sensitive label by the labeling head to an actual position , rather than to a theoretical point in space . to develop a position slaved move profile for an axis we have four distinct constraints . these constraints are : to solve for such a system , the system need to be mathematically represented by four coefficients 50 that there are enough constraints to explicitly solve the equation . to have the four coefficients a third order equation is used to represent the position of the profile . the velocity of the profile is then the first derivative of the position profile . since the system will have an upper limit on the acceleration , the second derivative will eventually be used in determining the viability of the specific application . vel ( i )= d / di ( a · i 3 + b · i 2 + c · i + d )→ vel ( i )= 3 · a · i 2 + 2 · b · i + c these boundary condition result in four equations and four unknowns . therefore the coefficients may be solved explicitly . [ v 0 = 3 · a · 0 2 + 2 · b · 0 + c v f = 3 · a · n 2 + 2 · b · n + c 0 = a · 0 3 + b · 0 2 + c · 0 + d accel — length = a · n 3 + b · n 2 + c · n + d ] solve , [ a b c d ] → [ root · v 0 = root · c root · v f = root · ( 3 · a · n 2 + 2 · b · n + c ) 0 = root · d root · accel — length = root · ( a · n 3 + b · n 2 + c · n + d ) ] 0 = a / 3 · 0 3 + b / 2 · 0 2 + c · 0 + d equation 3 : in general purpose applications we ensure that the velocity never goes negative , we will solve for the ‘ b ’ coefficient to be zero . given 0 = - 2 · ( n · v f - 3 · accel — length + 2 · v 0 · n ) n 2 0 = a / 3 · 0 3 + b / 2 · 0 2 + c · 0 + d equation 3 : accel_length = a / 3 · n 3 + b / 2 · n 2 + c · n + d equation 4 : pos_cam ( i reg ):= ⅓ · a ·( i reg ) 3 + ½ · b ·( reg ) 2 + c ·( i reg )+ d the physical properties of the move profile are calculated in the time domain to determine if the required acceleration can physically be performed by the selected motion control system . for now , we will use the standard encoder with 1000 counts per pitch and let us use 300 containers per minute to start . web drive motor encoder resolution pos — cam — m m ( i reg ) := pos — cam ( i reg ) · roller — dia motor — res · π the velocity of the profile is calculated by taking the first derivative of the position profile and then the acceleration of the profile by taking the second derivative of the position profile . the functions are graphed out below . vel — cam ( i reg ) := i reg pos — cam ( i reg ) · enc — res · mach — speed · roller — dia · π 60 · motor — res accel — cam ( i reg ) := i reg vel — cam ( i reg ) · enc — res · mach — speed 60 as was previously discussed , the position of the applied label to the surface of a container in many customer applications is subject to specified placement tolerances . a typical placement tolerance is plus / minus 0 . 5 millimeters . the design specification for this machine exceeds 100 , 000 millimeters per minute maximum container surface velocity . if the time domain is calculated for the placement tolerance , we find that the maximum system accumulated latency equals 300 microseconds per 0 . 5 millimeter of surface travel . to accomplish the final placement tolerance , it is found that the control system can contribute no more than 50 % of the maximum allowable error . the remaining error will come from material and mechanical system sources . the two systems susceptible to critical time issues are the motion control system , fig1 , ( also shown in component blocks 521 , 522 , 524 , 526 , 530 in fig1 ) and the position control processor 522 , 528 , 534 . the timing issues are critical for the digital signals connecting the position control processor to the motion control processor . the specification for the maximum accumulated interrupt service routine latency of the motion control processor 520 , fig1 and 19 , which includes high speed input reaction time , and motion algorithm “ math intensive task ” completion is 125 microseconds . the specification for the position control processors position command latency is 25 microseconds . because of the demanding requirements of this system , the following details relating to the position control processor 520 are included herein . with reference to fig1 there is shown an pls / encoder fpga 446 which accepts signals from a quadrature encoder 464 and various sensors 466 , processes these signals , and in conjunction with a micro processor 456 , generates a set of control outputs 468 . the pls / encoder fpga 446 takes advantage of the fact that although a mechanical device may be operating at a high rate of speed the time required for an encoder to move from one discrete position to the next is relatively long when compared to the clock rate capability of high speed logic devices . the pls / encoder fpga 446 uses the time between encoder steps to manipulate a set of control outputs 468 and to warn the system microprocessor 456 of impending significant events by use of an interrupt signal 470 . a more detailed description of the operation of the pls / encoder fpga 446 will follow . the pls / encoder fpga 446 is responsible for driving the outputs , 472 and 474 , which are scheduled to occur within the next full rotation ( pitch ) of the encoder . the system microprocessor is responsible for scheduling output events that must be delayed for one or more full encoder rotations . the pls / encoder fpga can provide multiple interrupts 470 to the system micro processor 456 during a single encoder rotation such that the microprocessor 456 will have ample opportunity to configure the output control circuits of the pls / encoder fpga when delayed output events now falls within the current encoder rotation ( pitch ). splitting the responsibility for the inter and intra pitch events between the microprocessor 456 and the pls / encoder fpga 446 greatly reduces the processing requirements imposed on the microprocessor 456 and increases the achievable system performance . all of the signals which are input to the pls / encoder fpga 446 are connected at a header 440 and are sensed and esd protected by an input buffer 444 . all of the signals which are output from the pls / encoder fpga 446 are buffered and esd protected by an output buffer 442 and are made available at a header 440 . also shown in fig1 is a general - purpose microprocessor system which consists of a microprocessor ic 456 , flash type program memory 452 , and sram data memory 454 . the microprocessor 456 works in conjunction with the pls / encoder fpga 446 to generate the various control signals 468 . the micro processor 456 also generates a clock signal 450 which is used by the pls / encoder fpga 446 to sample and filter the sensor inputs 466 and the encoder inputs 464 . as shown in fig1 a host system bus interface consisting of an interface ic 458 , the board address select switch 460 , and a bus interface connector 462 is provided . the interface ic 458 provides a bridge between the host system bus and the native bus protocol of the microprocessor 456 . although an isa bus is indicated in fig1 , any host bus could be utilized by simply reconfiguring the function provided by the interface ic 458 . in addition to the bus bridge function , the interface ic 458 also implements a direct connection 448 to the pls / encoder fpga 446 , this provides high speed access to hardware based information , such as encoder position , without requiring intervention by the system micro processor 456 . fig1 provides a more detailed view of the pls / encoder fpga 446 , in order to simplify this diagram all address decoding and chip select functions which are performed in order to access the various hardware resources have been omitted . as shown in fig1 , all sensor 466 , and encoder 464 signals which are input to the pls / encoder fpga 446 are digitally filtered . the signals are filtered in order to minimize the detection of false signal transitions due to the noise inherent in most installations . the digital filter 480 consist of an n bit shift register connected to each input , where n is typically a small integer . the input signal is continuously shifted on the active edge of the filter clock 450 , when all n bits of the shift register are at the same logic level the digital filter output is switched to that level . the output level is held until all n bits of the shift register are detected to be at the opposite logic level . the filter clock used by the digital filter is sourced from the system microprocessor 456 ( fig1 ). the digital filter 480 also synchronizes the filtered outputs to the high frequency clock that drives all of the remaining logic of the pls / encoder fpga 446 . the three encoder signals 464 that have been filtered 478 are passed to the encoder processor 482 . the z_ph input is a reference pulse from the encoder which is active once during every rotation ( pitch ) of the encoder . the other two inputs , ( a_ph & amp ; b_ph ), are the quadrature signals from the encoder , the phase relationship between these two signals is used to determine the direction of encoder rotation , the edge transitions of these two signals are used to derive an absolute angular position measurement . the encoder processor 482 tracks the a_ph and b_ph inputs , and monitors the z_ph input 478 in order to generate control signals for a position counter 484 which tracks the absolute angular position of the encoder shaft . the operation of the control signals depends on the direction of rotation , when the a_ph signal leads the b_ph signal by 90 degrees the encoder is considered to be rotating in the forward direction , when b_ph leads a_ph by 90 degrees the direction of rotation is considered to be backwards . the encoder processor 482 also contains a z delay register , which is loaded by the on board microcontroller 456 . this function allows the set of position referenced system parameters to remain constant when a new encoder is installed . the new encoder will almost certainly be installed with a rotational offset relative to the old encoder . the rotational offset is compensated for by delaying the reset of the encoder position count by ‘ n ’ a_ph and b_ph edges after a z_ph 478 input is detected , ‘ n ’ is the value stored in the z delay register . it should be noted that up to one complete revolution of the encoder is required for a new z delay to become effective . as previously noted , the filtered encoder signals 478 are used to generate control signal to a position counter 484 which tracks the absolute angular position of the encoder shaft . in order to track the angular position the counter 484 must be capable of counting up , counting down , clearing to zero , and loading to the maximum count value . the maximum count value is defined to be equal to the number of counts per revolution of the encoder times 4 a_ph and b_ph edges per encoder count . for example a 1000 count encoder will have a maximum count of 4000 edges per revolution . the specific operation of the counter control signals generated by the encoder processor 482 is as follows : the encoder processor will issue a down , or a load if the z delay has expired , when one of the following is true : b_ph is logic 0 and a_ph has a high to low transition . b_ph is logic 1 and a_ph has a low to high transition . a_ph is logic 0 and b_ph has a low to high transition . a_ph is logic 1 and b_ph has a high to low transition . the encoder processor will issue an up , or a clear if the z delay has expired , when one of the following is true : b_ph is logic 0 and a_ph has a low to high transition . b_ph is logic 1 and a_ph has a high to low transition . a_ph is logic 0 and b_ph has a high to low transition . a_ph is logic 1 and b_ph has a low to high transition . the encoder processor 482 will issue a one system clock cycle wide new_count signal 512 on any change in count , this is essentially a logical ‘ or ’ of load , clear , up , and down . a direction signal 524 is maintained by the encoder processor 482 , the signal will be at a logic low when the rotation direction is forward and logic high when the rotation direction is backward . the input filter 480 and the encoder processor 482 provide a set of signals 478 which allow external motion control systems to have access to the angular position information generated by the pls / encoder fpga 446 . the a , b , and z outputs are copies of the encoder inputs delayed by the digital input filter 480 , the z_clear output will go active approximately 100 ns before an a or b output edge at which the encoder position counter will be reset . the z_clear output is required since the use of the z delay feature precludes the use of the three encoder phases to determine the zero reference point of the system . as previously noted the control signals output from the encoder processor 482 are used to control a position counter 484 which maintains a value which represents the absolute angular position of the encoder shaft . since the position counter 484 is changed at every edge transition of both the a_ph and b_ph signals the angular position measurement resolution is equal to one fourth of an encoder count . for example the angular position of a 1000 count per revolution encoder can be tracked down to { fraction ( 1 / 4000 )} of a revolution which is 0 . 0016 radians ( 0 . 09 °). since the number of counts per revolution of an encoder is typically not a power of two the position counter 484 must be designed to count down from zero to the maximum count and count up from the maximum count to zero . as previously noted the maximum count is four times the number of counts per revolution of the encoder . this maximum count values can either be hard wired into the hardware design or implemented as a configurable register located within the position counter 484 circuit . the absolute angular position output 504 from the position counter 484 is used by the clock gen circuit 486 to generate a set of position based periodic signals . all of the signals output from the clock gen circuit 486 are driven to logic 0 when the absolute angular position 504 equals 0 . two of the signals 476 generated by the clock gen circuit 486 are used by external control systems as position references , the pitch_clk signal provides one cycle per encoder revolution while the fine_clk signal provides 10 cycles per revolution . two of the signals issued by the clock gen circuit 486 are used to interrupt the system micro controller 456 at various reference positions within one revolution of the encoder . one of the signals 526 will provide two interrupts per revolution while the second signal 528 will provide five interrupts per revolution . in addition to the two position based signals , 526 and 528 , generated by the clock gen circuit 486 , the pls / encoder fpga 446 can generate an interrupt to the micro processor 456 whenever the encoder position 504 changes and when an active edge is detected at any of the sensor inputs 466 . the interrupt signal 470 is generated by the transition detect circuit 488 when an active edge transition is detected at any of the inputs 516 . a status register is maintained within the transition detect circuit 488 , the register 506 can be read by the system microprocessor 456 so that the source of the interrupt can be determined . any of the inputs to the transition detect circuit 488 can be masked in order to block the activation of the interrupt 470 for that source , this register is written by the system microprocessor 456 . when the system micro processor 456 reads data from the pls / encoder fpga 446 the data buffer 494 routes the desired data from the pls / encoder fpga &# 39 ; s internal data bus to the system processor &# 39 ; s data bus based on the address used for the access . the system microprocessor can either read the state of the transition detect 488 status register 506 , or the current encoder position 504 and the current encoder rotation direction 524 . whenever the encoder processor 482 issues a new_count signal 512 to indicate that the encoder position has changed the list select circuit 490 will sequence though a series of 24 addresses 518 . the time required to scan through the 24 addresses and perform the operations associated with each determines the encoder resolution and rotational speed , which can be handled by the pls / encoder fpga 446 . for example if the pls / encoder fpga 446 is operating at 25 mhz and each address requires 8 clock cycles to process the address scan will take 7 . 7 us , so a 4000 edge encoder ( 1000 cnts / rev ) can be processed in abut 31 msec which correlates to a rotational speed of about 1900 rpm . the preceding example assumes no software over head for scheduling output events , it is expected that the actual obtainable rotational velocity will be about one half of the base hardware speed or 950 rpm for a 4000 edge encoder ( 1000 cnts / rev ). the output group , pls 496 or one shot 498 , to operate on . the specific output within the selected group , one of 472 or 474 . the state to which a selected pls output 472 is to be driven . the on time ( dwell ) for a selected one shot output , 474 . the encoder position 508 at which the output operation is to occur . the encoder position at which the output event is to occur 508 is read from a list of target counts 492 and compared to the current encoder position 504 by the equality compare circuit 500 . if the current position 504 is equal to the target position 508 , as indicated by signal 521 becoming active , the selected output event will occur . each pls output 472 is associated with two list select addresses 518 which access target encoder positions 508 stored in the list of target counts 492 . one address selects the target encoder position 508 at which the output 472 is to be driven active , the second address selects the target encoder position 508 at which the output is to be driven inactive . each one shot output 474 is associated with a single list select address 518 , this address selects the encoder position at which the output 474 is to be driven active from the list of target counts 492 . the same address 518 also selects the on time ( dwell ) for the output from the list of target counts 492 . the list of target counts 492 is stored in on chip dual port ram . the write port is connected to the on board micro controller 456 bus , the values in the ram can be updated on a random access basis at any time . the read side of the dual port ram is controlled by the list select circuit 490 , as previously described . the one shot outputs control circuit 498 shown in fig1 requires that the an output be rearmed after each operation , this is accomplished by having the system micro processor 456 rewrite the on time ( dwell ) value for the particular one shot output 474 . this was done to allow the system microprocessor to make adjustments to the firing position and on ( dwell ) time for these outputs 474 while operating at full speed . the ksa 16 reg circuit 502 provides for direct access to the encoder position and several mailbox registers from the host backplane interface 458 . this direct access scheme allows the host system to quickly access the most frequently required data without impacting the performance of the system processor 456 . | 8 |
referring to fig1 and 2 , a preferred embodiment of the present inventiontakes the form of an articulated vessel 10 of variable configuration comprised of three sections , an intermediate section 12 and identical end sections 14 at either end thereof , the articulated vessel being of a type shown in the referenced patent . in this respect , the end sections 14 are essentially identical to section 1 of fig1 of u . s . pat . no . 3 , 661 , 290 and in that respect , the end sections upon contraction and reduced volume of the aircraft 10 develop pointed ends markedly reducing drag on the aircraft regardless of its direction of movement . the aircraft 10 is illustrated as including paired landing gear assemblies 16 at respective ends of section 12 at the bottom thereof , the assemblies 16 also being provided with propulsion means such as hydrocarbon fuel driven turbo - engines 18 driving propellers 20 for propelling the aircraft in a longitudinal direction either by pushing or pulling the aircraft , depending upon the configuration and nature of the propulsion system . vertical legs 22 of the assemblies 16 carry wheels as at 24 for supportingthe aircraft on the ground . extending longitudinally beneath section 12 is an elongated storage tank 26which is of tubular configuration carries and acts to house a mass of wateremployable as a component of the variable density system of the present invention . in fig2 a fragmentary portion of hull section 12 may be seen as comprised of four essentially rigid rectangular panels 28 hinge joined at their edges to form a rectangular expansible and contractible boxlike assembly , the interior of the hull section 12 being separated , respectively , into chambers or compartments a , b and c by a pair of flexible sheets 30 and 32 . the sheets are formed of gas impervious pliablefilm formed of plastic or the like which is non - stretchable and non - expandable . the sheets are joined at their ends and fixed to opposed lateral corners 34 and 36 of the section 12 , while the lower corner 38 of the hull supports the tubular storage tank 26 . the flexible or pliable film sheets 30 and 32 are of a width such that depending upon the relativepressures within chambers a , b and c , defined by the panels 28 and the flexible sheets 30 and 32 , the sheets may in fact be pressed against the inner walls of the panels and of course may be pressed together whereby any one of the chambers a , b and c may be selectively and totally compressed . preferably , chamber b carries a lifting gas such as helium or hydrogen , while compartment c preferably carries a hydrocarbon fuel gas having approximately the same density as air so that the weight of the vehicle will not change with fuel consumption . the present invention involves the utilization of chamber or compartment a within which the ammonia gas is fed or extracted to perform the function of changing the density of the aircraft and its configuration , this being effected by change in volume but without change in mass . advantageously , the ammonia gas 44 within compartment or chamber a may pass to and from the storage tank 26 which also functions , as mentioned previously , as the keel for theaircraft providing attitude stability by means of gravity effect . under the preferred operation of the aircraft 10 of the present invention , compartment b is provided with a given mass of a lifting gas such as hydrogen or helium as at 40 to just barely support the vehicle in empty weight configuration . under this arrangement compartment c would carry a payload in terms of a hydrocarbon fuel gas 42 having a density ratio of 1 with air and thus as fuel is used during transfer of the ammonia gas 44 from compartment a , to the water storage tank 26 and vice versa , and for propelling the aircraft 10 , and its utilization would not vary the densityof the aircraft . under such circumstances , the hydrogen or helium lifting gas 40 is of constant mass and the essence of the invention , therefore , isthe employment of the change in volume of the ammonia gas 44 within chambera as the means for changing the density of the aircraft , particularly , to change the aircraft from an hta on the ground to an lta , totally eliminating the necessity of diving of the craft during descent and the utilization of mooring lines and the like to hold the craft down , since itwould slowly change from lta to hta during descent and vice versa . in order to effect this variation in density in a reversible fashion , the present invention preferably makes use of the system illustrated in fig3 . in that regard , the block form schematic diagram shows compartment a asa large rectangular block which forms a part of the aircraft 10 and houses ammonia gas 44 , while the lower rectangular block schematically illustrates the tubular storage tank 26 . the system incorporates a first line or conduit 46 leading from compartment a to the storage tank 26 and being provided with a high volume , low pressure compressor 48 , preferably of the axial flow variety , line 46 being closed off by a check valve 50 soas to prevent return of ammonia gas from the storage tank 26 to compartmenta by way of line 46 . the line 46 terminates within the water storage tank 26 in a diffuser section 46a which may , for illustrative purposes , simply constitute a perforated pipe . of course , more sophisticated means may be provided for diffusing the ammonia gas within the aqua - ammonia solution 52 . the solution 52 may fill the major portion of the storage tank 26 at least to the extent where it covers the evaporator coil 54 of a refrigeration circuit which employs the ammonia 44 as the refrigerant working fluid . the storage tank 26 is further provided with an outlet or return line or conduit 56 permitting gaseous ammonia 44 after being given up by the solution to return to compartment a after being driven therefrom . a closed loop refrigeration system is identified generally at 58 and as a compartment thereof includes compartment a as it utilizes the ammonia gas 44 as the refrigerant . within the closed loop refrigeration system 58 , in series fashion , and connected by a conduit or line 60 , in the direction ofammonia gas flow from compartment a , in order , is a compressor 62 which maybe powered by an electric motor 64 through a mechanical gear train 66 for instance . preferably , the power unit for the compressor comprises an internal combustion engine using the fuel gas 42 as its power source . the ammonia gas 44 is compressed from the relatively low pressure of compartment a into a much higher pressure for delivery to a condenser 68 downstream thereof , the condenser 68 being positioned in heat exchange relation with the ambient air , external of the aircraft for condensing of the high pressure refrigerant into liquid form , where it subsequently expands through expansion valve 70 and removes heat from the aqua - ammonia solution 52 within storage tank 26 by way of heat transfer within the coils of the evaporator 54 , prior to returning through line 61 to compartment a after vaporization . the gaseous ammonia has its temperature reduced or increased by heat exchanger 72 located external of the aircraft10 for heat exchange with the ambient air . the closed loop refrigeration system 58 is quite standard with the compressor , condenser , expansion valve , evaporator and heat exchanger , all being standard refrigeration components . the purpose of the closed loop refrigeration system 58 is to chill the solution 52 within the storage tank 26 which permits the gas transferred through line 46 from compartment a to the water storage tank 26 to go into solution with the water and become ammonia hydroxide . by keeping the aqua - ammonia solution and the water ( when there is no ammonia in it ) at a temperature near 32 ° f , it will absorb the maximum amount of ammonia gas possible . a main outlet valve 74 is positioned within the line 56 leading from the storage tank 26 to compartment a for controling the flow of ammonia gas from the storage tank 26 , after separation from the aqua - ammonia solution 52 , to compartment a . in order to drive the ammonia gas from the aqua - ammonia solution 52 within the storage tank 26 and thus increase the volume of the aircraft by expanding the chambers within panels 28 , changing the configuration of section 12 of the chamber from a flattened configuration to a rectangle incross - section , the aqua - ammonia solution 52 must have its temperature raised . this is advantageously effected by bleeding fuel gas 42 within chamber c defined by the flexible sheet 30 and 32 from that chamber and burning the same beneath the storage tank 26 . schematically , the fuel gas 42 within compartment c passes by way of fuel line 76 , a control valve 78 and a fuel pump 80 to a gas heater 82 . again , the heater is conventional , with the exception that due to the nature of the configuration of the aircraft in fig1 the heater is such that it extends longitudinally , preferably the complete length of the tubular storage tank 26 so as to effect optimization of heat transfer from the heater 82 to the aqua - ammonia solution within the storage tank 26 . further , the fuel compartment c may have a second fuel line 84 extending therefrom , within which is positioned a control valve 86 , with line 84 terminating at the multiple internal combustion engines 18 acting to drivethe propellers 20 which propel the craft . thus , the ignition of the fuel 42within the heater 82 elevates the temperature of the solution 52 within thetank 26 and drives the ammonia gas 44 from the storage tank 26 back into compartment a through main outlet valve 74 and line 56 . once the desired quantity of ammonia gas is driven out of the aqua - ammonia solution 52 , themain outlet valve 74 is closed and with the check valve 50 closed , the ammonia vapor separated from the aqua - ammonia solution is simply maintained above the level of the solution 52 within tank 26 . reabsorptioncan take place only in terms of that amount of ammonia gas within the storage tank above the level of solution 52 unless the high volume compressor 48 is energized to force ammonia vapor from compartment a through check valve 50 and back to the storage tank 26 . while the illustrated embodiment shows the various compartments a , b and c , taking place within the central section 12 of the aircraft 10 , it is obvious that the individual compartments a , b and c may extend into the end sections 14 or the articulated vehicle can have separate storage compartments wtihin all three sections . the illustrated embodiment provides a natural application of a variable density aircraft in the transport for transport of a lighter than air commodity such as natural gas . during the transport mission , the natural gas is used both as the fuel for propulsion and the lifting gas . since thenatural gas is lighter than air , the full volume of the hull , absent compartment a , may be occupied by natural gas evenly divided between compartments b and c . this results in a safety feature for the aircraft inthe event of holing of either the upper or lower hull panels . during the unloading of the gas from chambers b and c , the variable density mixture in the storage tank 26 would be depressurized and heated to expand it to the extent necessary to compensate for the loss of weight being experienced by the extraction of the natural gas . when the quantity of gasremaining in the aircraft hull is that required for the return trip to the natural gas pick up point , the variable density aircraft 10 is ready for the return flight . if returned unloaded , it will do so in a greatly reduced frontal area configuration resulting from the unloading of the natural gas . at the natural gas pick up point , the process is reversed andthe variable density mixture is absorbed and compressed back into the chilled water forming the solution 52 . the worldwide availability of waterand ammonia at reasonable expense enchances the practicability of the mixture . even more importantly , the rapidity at which chilled water absorbs ammonia when properly exposed to it allows its use as a means for volumetric reduction in the event that a load is dropped inadvertently or has been dropped because of some unfortunate circumstance . while the illustration of the aircraft 10 in fig1 is purposely schematic , it is envisioned that for adequate low or zero air speed control , the variable density aircraft 10 would utilize power plant , rudder and elevator controlpods ( not shown ) mounted at both ends of the lower keel of the hull centralsection 12 , the keel of course being the storage tank for the mixture 52 . the rudders and elevators would be directly behind the propellers for maximum effect . cargo / passenger pods and external sling and winching provisions ( not shown ) would be mountable to the storage tank or kneel 26 or through the storage tank 26 to an internal keel in some configurations . from tables 1 and 2 below , it may be seen that by applying a lighter than air gas ammonia , 1 cubic foot of saturated aqua - ammonia at 0 ° c under 1 atm contains 1 . 4 times as much ammonia as 1 cubic foot of pure ammonia liquid at the same temperature when under more than four times as much pressure . table 3__________________________________________________________________________solubility of nh . sub . 3 in water 0 ° c 20 ° c 40 ° cpressnh . sub . 3 mm 9 / 9 cm . sup . 3 / cm . sup . 3 9 / 9 cm . sup . 3 / cm . sup . 3 9 / 9 cm . sup . 3 / cm . sup . 3__________________________________________________________________________atms . 92700 0 . 497 652 . 91 . 05800 0 . 544 714 . 6 0 . 329 429 . 61 . 18900 . 997 1312 0 . 588 772 . 41 . 32 1000 1 . 094 1440 0 . 629 826 . 2 0 . 386 504 . 01 . 45 1100 1 . 192 1569 0 . 669 878 . 81 . 58 1200 1 . 288 1695 0 . 707 928 . 8 0 . 433 565 . 41 . 71 1300 1 . 388 1827 0 . 745 978 . 71 . 84 1400 1 . 488 1958 0 . 781 1025 . 9 0 . 472 616 . 31 . 97 1500 1 . 588 2090 0 . 815 1070 . 62 . 11 1600 1 . 688 2221 0 . 847 1112 . 6 0 . 508 663 . 32 . 24 1700 1 . 788 2340 0 . 877 1152 . 12 . 37 1800 1 . 847 2431 0 . 906 1190 . 1 0 . 543 709 . 02 . 5 1900 0 . 934 1226 . 92 . 63 2000 0 . 959 1259 . 7 0 . 577 753 . 42 . 76 2100 0 . 984 1292 . 62 . 89 2200 1 . 007 1322 . 8 0 . 611 797 . 83 . 04 2300 1 . 029 1351 . 7__________________________________________________________________________ table 4______________________________________solubility of gases in water ( by volume at atmospheric pressure ) ______________________________________t ( deg f ) 32 68 212______________________________________air 0 . 032 0 . 020 0 . 012ammonia 1250 700 -- hydrogen 0 . 023 0 . 020 0 . 018______________________________________ this high solubility of ammonia in water , as seen from table 3 is enhanced by the fact that light pressurization results in considerably larger concentrations of ammonia in the solution . the rate of absorption of the ammonia gas into the water varies with the amount of water surface exposedto the gas , the temperature of the water and the gas , and the pressure under which the solution is prepared . the rate of absorption can be rapid where the gas is diffused into the water or the water sprayed into the gas . the illustrated embodiment of invention shows gas diffusion in the water . however , the system could be modified to incorporate a pump within the storage tank for spraying of the water ( solution ) into the vapor . an additional useful characteristic of the solution 52 is that by elevating its temperature to 100 ° c , all of the ammonia gas is driven out of the solution and can be isolated as a gas under normal atmospheric conditions . by varying the temperature from zero to 100 ° c and the pressure from 2 . 3 atms to 1 atm , the volume of one cubic foot of saturatedaqua - ammonia increase to 2 , 431 cubic feet of gas and one cubic foot of water . this represents a density variation or change from 175 pounds per cubic foot to 0 . 0707 pounds per cubic foot which is 0 . 0047 pounds per cubic foot lta . furthermore , under the operation of the present system , the 1 cubic foot of water is still on board the aircraft within the storage tank for use as disposable ballast in an emergency . the operation of the present invention can be best appreciated by a brief description of a preferred mode . prior to flight , the aircraft 10 is initially positioned on the ground surface resting on wheels 24 as the compartment b is filled with an insufficient amount of lta gas such as hydrogen or helium as at 40 to place the aircraft in equilibrium , thus leaving it slightly hta . additionally , compartment a is empty and the film30 is lying against the lower surfaces against the internal surfaces of thelower two panels 28 of the diamond shaped hull 12 . the storage tank 26 contains a saturated aqua - ammonia solution 52 and compartment c contains fuel both for the burner 82 and for the aircraft propulsion engines 18 . all components of the system and the fluid contents are at ambient temperature including the aqua - ammonia solution 52 within storage tank 26 . when ascent is desired , the valve 78 is opened and the fuel pump 80 energized to pump fuel from the compartment c to the heater 82 . burning ofthe fuel by the heater 82 causes the temperature of the aqua - ammonia solution 52 to increase . opening of the main outlet valve 74 permits the ammonia gas driven from the solution 52 to enter compartment a , this gas increases the volume within compartment a , causing the hinged panels 28 topivot . the upper panels move away from the lower panels expanding the totalchamber volume as defined by the four panels with the upper two panels 28 moving away from the pivot axis 38 of the lower two panels and the storagetank 26 and in that regard , the central section 12 of the aircraft hull displaces more air . as the hull increases in displacement , there is an increase or gain in buoyancy of 100 % of the air displaced , and after the displacement increases sufficiently , the aircraft will start to ascend . when the aircraft has reached a desired altitude , ascent is stopped by shutting off the burner 82 and by closing off valve 74 . reabsorption of the ammonia gas 44 by the solution within compartment a is prevented unless energization of the compressor 48 within line 46 is initiated , which actually pumps ammonia gas 44 from compartment a to the tank 26 . theaircraft 10 has actually changed and assumed a new density and can maintainthis new density , and its corresponding altitude position indefinitely withno further energy input . when descent is desired , the ammonia gas 44 withincompartment a is pumped by means of pump 48 through line 50 ( permitted by check valve 50 ) to the diffuser 46a , where it diffuses in the solution 52 . the ammonia gas readily diffuses in the weak aqua - ammonia solution 52 ( or water if all the ammonia has been previously displaced from the solution 52 ). as the ammonia is reabsorbed into the solution 52 , the displacement of the aircraft hull and in particular section 12 decreases , causing an increase in density of the aircraft and resulting in descent to a lower density altitude . continued descent results in landing of the craft . when a lower desired altitude is reached or when the landing is effected , compressor 48 is turned off and flow of ammonia gas 44 from compartment a to tank 26 is terminated . while the present invention makes application of the great absorption affinity of water for ammonia , and employs thermal energy input to the aqua - ammonia solution for driving the ammonia gas from the liquid and permits upon cooling of the water or weak aqua - ammonia solution , the recapture of the ammonia in a reversible , easily controlled system , similar results both in a reversible and non - reversible process may be achieved by using appropriate materials . for instance , in a reversible process , hydrazene which comprises n 2 h 4 and which normally takes the form of liquid at atmospheric pressure and temperature may be employed as the system working fluid with the hydrazene decomposing under the application of heat to form nitrogen and hydrogen gases . further , lithium borohydride in powder form may be employed in a non - reversible process which material , when mixed with water , results in a chemical process with hydrogen evolving therefrom . unfortunately , when using lithium borohydride , while a satisfactory volumetric change can be effected to readily provide a variable density aircraft , there is no knownmethod of reversing the process and recreating the lithium borohydride . while the invention has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention . | 1 |
the invention is described more fully hereinafter with reference to the accompanying drawings , in which exemplary embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the exemplary embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . in the drawings , the size and relative sizes of layers and regions may be exaggerated for clarity . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . embodiments of the invention are described herein with reference to illustrations that are schematic illustrations of idealized embodiments ( and intermediate structures ) of the invention . as such , variations from the shapes of the illustrations as a result , for example , of manufacturing techniques and / or tolerances , are to be expected . thus , embodiments of the invention should not be construed as limited to the particular shapes of regions illustrated herein but are to include deviations in shapes that result , for example , from manufacturing . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein . fig1 is a perspective view of a refrigerated display case 50 having a lcd 200 . generally , the display case includes a housing 105 , to which a front window assembly 100 is fastened . in this embodiment , a cavity 110 is provided below the front window assembly 100 where various electronic devices 111 for operating the lcd assembly 200 can be located . fig2 is a perspective view of the refrigerated display case of fig1 where the door has been opened . in this embodiment , the front window assembly 100 is hingedly fastened to the housing 105 , although this is not required . the lcd 200 is preferably sandwiched between a front glass 225 and rear glass 205 . also preferably sandwiched between the front and rear glass 225 / 205 is an upper plate 216 and a lower plate 215 , each of which are preferably attached to the rear glass 225 such that heat from the plates can be conductively transferred to the rear glass 225 and removed by natural or forced convection . in an exemplary embodiment , the upper and lower plates are preferably bonded to the rear glass 205 through adhesive transfer tape . an exemplary adhesive transfer tape for this purpose would be 468 mp , available commercially from 3mtm of st . paul , minn . www . 3m . com / converter . in order to illuminate the lcd 200 , one or more printed circuit boards ( pcbs ) each containing a plurality of leds is preferably in conductive thermal communication with either the upper , lower , or both plates . in this way , heat that is generated by the leds can be transmitted to the pcb and eventually transferring to the rear glass 205 where the heat can dissipate through natural or forced convection . fig3 is a simplified side view of the various layers within an exemplary front window assembly 100 . various electronic components 400 for operating the lcd 200 and communicating with the front window assembly 100 can be placed within the sealed assembly . in some embodiments , the electronic components 400 can be mounted to the front glass 225 or the rear glass 205 . a light guide 300 and the lcd 200 are preferably sealed between the front glass 225 and rear glass 205 . the sealed enclosure is preferably filled with argon gas . a plurality of leds 350 may be arranged along opposing edges of the light guide 300 . in an exemplary embodiment , an optional additional linear polarizer 375 is positioned behind the light guide 300 . the optional additional linear polarizer 375 could be attached to the rear surface of the light guide 300 , front surface of the rear glass 205 , or the rear surface of the rear glass 205 . as noted above , the lcd 200 is preferably a normally - black lcd . fig4 is a block diagram for an exemplary embodiment of the electronic components 400 within the front window assembly as well as the electronic components 111 in the cavity 110 below the front window assembly . the antennas 115 can be cellular network antennas or can be wi - fi receiving devices . in some embodiments , the modem may be connected through a hard - wired internet connection rather than cellular or wireless . preferably , the video signal from the media player is transmitted to the receiving board 117 through wireless communication , although this is not required . the board 116 and the receiver board 117 each contain a wireless device for communicating back and forth between the two boards and can operate under any form of wireless networking technology , including but not limited to : wpan , wlan , a wireless mesh network , or gan . specifically regarding the architecture for a wlan network , these could include but are not limited to stations , basic service set , extended service set , and a distribution system . further regarding the types of wireless lans , these could include but are not limited to peer - to - peer , bridge , and a wireless distribution system . any form of general encryption method can be used with the exemplary embodiments herein . the board 116 and the receiver board 117 each preferably contain a microprocessor and a storage device ( ram ). the cooler base 700 preferably contains electrical circuitry to communicate various attributes of the cooler to the board 116 . the cooler attributes that can be communicated include , but are not limited to : evaporator temperature , cooler temperature , door open / close status , energy saving mode status , compressor status , evaporator fan status , and defrost status . the board 116 can then transmit the cooler attributes to a remote user through the modem . the board 116 can also record and transmit various attributes of the board 116 as well as the media player . these attributes can include but are not limited to : video input status , video resolution , voltage / current , and board temperature . the board 116 can also communicate several alarm conditions , including but not limited to : temperature sensor failures , receiver board 117 communication failures , invalid defrost temperature , defrost timeout , missed defrost cycle , high / low temp exceeded , invalid video input , and video input stalled . also shown in this figure is the temperature sensor 620 which is in electrical communication with the electronic devices 111 . also shown here is a door sensor 600 which is positioned to determine whether the front window assembly is currently open or not ( if using a hinging front window assembly 100 ). a timing and control board ( tcon ) 420 is shown in electrical communication with the receiver board 117 and the lcd 200 . it should be noted that the leds 350 are not required , as some embodiments may utilize ambient lighting or lighting within the display case to backlight the lcd 200 . the lcd 200 may operate various pixels by applying a voltage to them . during normal operations , the lcd 200 may display pixels at various transparency levels in order to generate colored pixels that assemble to display a graphic . in exemplary embodiments , the modem may receive transparency data that is transmitted to the lcd 200 by way of the board 116 . the transparency data may include data that instructs the lcd 200 to drive each pixel at substantially the same transparency level . an exemplary embodiment of the method for preventing damages to the products of the display case 50 may include the step of operating each sub - pixel of the lcd 200 at a predetermined uniform transparency level by way of the controller and according to the transparency data . in other words , in some embodiments , each sub - pixel of the lcd 200 is generally driven to substantially the same level of transparency ( sometimes this means applying the same sub - pixel voltages to each sub - pixel ). fig5 is a flow chart for a first embodiment for operating the method to prevent damage to products . a user may input a schedule for the retail hours and the after hours . this schedule can be accepted and stored in a number of ways . the schedule can be a weekly hour - by - hour schedule , which is uploaded only once and gives the schedule for monday - sunday to be performed by the software every week . in other embodiments , the schedule may be a daily schedule , which is uploaded for a single 24 hour period and is repeated for every single day . in other embodiments , the schedule may be a full calendar with daily specifics as to what the retail hours and the after hours will be specifically for each day . other embodiments may have the system simply presume retail hours and only accept after hours data for each specific day , weekly schedule , or daily schedule . in some embodiments , during retail hours the lcd 200 is simply controlled to be substantially transparent , i . e . enough voltage is sent from the tcon 420 to the lcd 200 to obtain a desired level of transparency . in other embodiments , during retail hours the lcd 200 may be driven as transparent and may also contain images and advertisements , sent from the media player to the board 116 and ultimately to the tcon 420 . the images and advertisements can be transmitted to the media player from the board 116 , after being received at the modem . the user may communicate the various retail and after hours data to the board 116 in a number of ways . first , the user can physically connect to the modem 115 ( using a cable , ex . ethernet / dsl cable ). second , the user can communicate though the modem 115 by using any internet connection with a remote device . third , the user can communicate through the modem 115 by using cellular antennas 115 ( shown in electrical communication with the modem 115 ) and a cellular device . the logic is preferably operated by the microprocessor located on the board 116 . fig6 is a screen shot of an exemplary user interface for operating a method for preventing damage to products when using an optional led 350 backlight with the lcd 200 . the product protection mode can be ‘ enabled ’ or ‘ disabled .’ the user can select a backlight reduction percent level 1 , which provides the percentage of power reduction to the backlight when level 1 power saving is detected . in this example , the level 1 power reduction is 34 %. the user can also select how long the door remains closed before initiating level 1 power saving . in this embodiment , level 1 power saving is initiated once the door has been closed for 300 seconds . optionally , the user can select a number of backlight reduction levels . here , the embodiment permits the selection of backlight reduction percent level 2 , which provides the percentage of power reduction to the backlight when level 2 power saving is detected . in this example , the level 2 power reduction is 73 %. the user can also select how long the door remains closed before initiating level 2 power saving . in this embodiment , level 2 power saving is initiated once the door has been closed for 1800 seconds . in this embodiment , the user can also select how long the door should be closed before the lcd is turned off to protect the products ( shown in this figure as level 3 ). here , the lcd would be turned off with no power sent to the tcon 420 once the door has been closed for 3600 seconds . fig7 is a flow chart for an exemplary logic structure for operating the optional product protect mode . the system first checks the sensor 600 to determine if the door is open . if yes , the current time is stored as the previous opening time ( po ) and the backlight is driven at full power . if the door is closed , the present time is compared to the po to determine how much time has elapsed since the previous door opening . if the time elapsed is not greater than time level 1 ( ex . 300 seconds ), the backlight continues to be driven at full power . if the time elapsed is greater than time level 1 , the system moves on to compare the time elapsed with time level 2 ( ex . 1800 seconds ). if the time elapsed is less than time level 2 , the backlight is driven at reduced level 1 ( ex . 34 % of full power ). if the time elapsed is greater than time level 2 , the system moves on to compare the time elapsed with time level 3 ( ex . 3600 seconds ). if the time elapsed is less than time level 3 , the backlight is driven at reduced level 2 ( ex . 73 % of full power ). if the time elapsed is greater than time level 3 , the lcd is turned off ( ex . no power is sent to the tcon 420 ). fig8 is a flow chart for another exemplary logic structure for operating the optional product protect mode . the system preferably begins by driving the backlight at full power . next , the sensor 600 is checked to determine if the door has gone from opened to closed . if not , the system continues to drive the backlight at full power and continues to monitor the sensor 600 . if yes , the current time is stored as the previous opening time ( po ) and the logic moves forward to determine how much time has elapsed since the po . if the time elapsed is less than time level 1 , the door sensor 600 is again checked and if the door is still closed the system will return to measure the elapsed time since the po , if however the door has been opened the system will return to the start where the backlight is driven at full power . if the time elapsed is greater than time level 1 , the system then preferably compares the elapsed time since the po and compares it to time level 2 . if the elapsed time is less than time level 2 , the backlight is preferably driven at reduced level 1 . if the elapsed time is greater than time level 2 , the system preferably then compares the elapsed time since the po and compares it to time level 3 . if the elapsed time is less than time level 3 , the backlight is preferably driven at reduced level 2 . if the elapsed time is greater than time level 3 , the lcd is turned off . in either scenario the system will preferably again check the sensor 600 and if the door has been opened the system will return to the start where the backlight is driven at full power . if however the door remains closed , the system will preferably return to the logic step of comparing the elapsed time since the po with time level 1 . fig9 is an electrical schematic representation of an exemplary embodiment of the system for preventing damage to products . here , a plurality of display cases 50 are in communication with an internet / cellular network 70 . here , an operations center contains at least one cpu 40 which can communicate with the plurality of display cases 50 through the internet / cellular network 70 . the embodiments of the wireless communication and lcd system described herein can be used with any number of display case designs , either temperature controlled or not , and with doors that open or glass that remains stationary . having shown and described a preferred embodiment of the invention , those skilled in the art will realize that many variations and modifications may be made to affect the described invention and still be within the scope of the claimed invention . additionally , many of the elements indicated above may be altered or replaced by different elements which will provide the same result and fall within the spirit of the claimed invention . it is the intention , therefore , to limit the invention only as indicated by the scope of the claims . | 0 |
this document describes systems and techniques for inferring the gender of a face in an image . a network , such as the internet or a wide area network , can include servers hosting images of people and / or other animals . in general , an image of a female face may have similarities with images of other female faces and an image of a male face may have similarities with images of other male faces . in certain implementations , a gender determination system analyzes the similarities between the faces , including faces having a known gender and faces having an unknown gender . the gender determination system can use the similarities and the known genders to infer a gender of one or more faces having an unknown gender . in certain implementations , a face having an unknown gender may have little or no direct similarities with the faces having a known gender . the gender determination system may determine that the face having the unknown gender has similarities with one or more other unknown gender faces . the gender determination system may also determine that one or more of the other unknown gender faces have similarities with one or more faces having known genders . the gender determination system can use the chain of intermediate faces to infer the gender of the face having an unknown gender by indirectly relating the unknown gender face to a face having a known gender . fig1 is a schematic diagram showing an example of a system 100 for inferring the gender of a face in an image . the system 100 includes a gender determination system 102 and multiple publisher systems 104 a - c , such as a web logging ( blogging ) server , an image hosting server , and a company web server , respectively . the gender determination system 102 communicates with the publisher systems 104 a - c using one or more networks , such as the internet , and one or more network protocols , such as hypertext transport protocol ( http ). in the case of http communication , the publisher systems 104 a - c can include multiple web pages 106 a - c , respectively . for example , the web page 106 a published by the blogging system is a celebrity gossip blog , the web page 106 b published by the image hosting system is an image gallery , and the web page 106 c published by the web server system is a homepage for the acme corporation . the web pages 106 a - c each include one or more images 108 a - e . the images 108 a - e include faces of people and / or other animals . the gender determination system 102 retrieves the images 108 a - e from the publisher systems 104 a - c and stores the images 108 a - e in a data storage 110 . the gender determination system 102 includes an inferred gender label generator 112 that performs processing to infer the gender of the faces in the images . the inferred gender label generator 112 includes a face detector 114 and a similarity calculator 116 . the face detector 114 uses face detection algorithms known to those skilled in the art to detect faces in the images 108 a - e . in certain implementations , the face detector 114 stores the portions of the images 108 a - e that include faces in the data storage 110 . alternatively , the face detector 114 may store information that describes the location of the face portions within the images 108 a - e . the face detector 114 passes the face information to the similarity calculator 116 or otherwise notifies the similarity calculator 116 of the face information . the similarity calculator 116 calculates similarity scores between pairs of faces . the similarity calculator 116 uses facial analysis algorithms known to those skilled in the art . for example , one such facial analysis algorithm is discussed in a paper entitled “ transformation , ranking , and clustering for face recognition algorithm comparison ,” by stefan leigh , jonathan phillips , patrick grother , alan heckert , andrew ruhkin , elaine newton , mariama moody , kimball kniskern , susan heath , published in association with the third workshop on automatic identification advanced technologies , tarrytown , march 2002 . the inferred gender label generator 112 includes or has access to predetermined gender information for one or more of the faces . for example , a user may make an input indicating that a face in the image 108 a has a gender of female and a face in the image 108 b has a gender of male . alternatively , the inferred gender label generator 112 may generate predetermined gender information based on an algorithm , such as associating a distinguishing feature within a face as male or female . the inferred gender label generator 112 uses the predetermined gender information and the similarity scores between the faces to link each of the faces directly or indirectly to the faces having predetermined or known genders . the inferred gender label generator 112 uses the links to infer a gender for the faces . the inferred gender label generator 112 stores the similarity scores and inferred genders in the data storage 110 as a gender label value table 118 . the gender determination system 102 can output genders of the faces as gender label information 120 a - e for the images 108 a - e , respectively , to the publisher systems 104 a - c . in another implementation , the gender determination system 102 can include , or provide gender information to , an image search engine . for example , a user may make an input indicating a search for images of people or animals having a particular gender . the gender determination system 102 , or another image search system , uses the gender label information 120 a - e to provide images having the requested gender . fig2 is a block diagram showing an example of a system 200 for inferring the gender of a face in an image . the system 200 includes the gender determination system 102 as previously described . the inferred gender label generator 112 receives the images 108 a - e and may store the images 108 a - e in the data storage 110 . the inferred gender label generator 112 uses the face detector 114 to locate faces within the images 108 a - e . subsequently or concurrently , the inferred gender label generator 112 uses the similarity calculator 116 to calculate similarity scores between faces . in the system 200 , the similarity calculator 116 is included in a graph generator 202 . the graph generator 202 generates a graph of the faces in the images 108 a - e . each face represents a node in the graph . the graph generator 202 represents the similarity scores between faces as edges that link the nodes . each edge is associated with its similarity score . the edges linking the nodes may be undirected , bi - directional , or uni - directional . for the purposes of clarity , the edges in the following examples are undirected unless otherwise specified . the inferred gender label generator 112 associates each face with one or more gender labels and each gender label may have a gender label value . in some implementations , the gender label values are numeric values , such as decimal numbers . for example , the face in the image 108 a may have gender labels of “ male ” and “ female ” with associated gender label values of “ 0 . 00 ” and “ 1 . 00 ,” respectively . the inferred gender label generator 112 stores the gender label values in the gender label value table 118 . in some implementations , the gender determination system 102 includes a data storage 204 that stores one or more predetermined gender label values 206 . the gender determination system 102 may receive the predetermined gender label values , for example , from a user input . the graph generator 202 associates the predetermined gender label values 206 with corresponding nodes in the graph . for example , a user may input the gender label values of “ 0 . 00 ” male and “ 1 . 00 ” female for the face in the image 108 a . the graph generator 202 associates the gender label values with the node in the graph that represents the face from the image 108 a . the inferred gender label generator 112 subsequently uses the predetermined gender label values 206 as a starting point , or seed , for the algorithm to infer other gender label values of faces included in other images . fig3 a shows examples of the images 108 a - e used for inferring a gender of a face in an image . the gender determination system 102 may use images such as the images 108 a - e or other images . the gender determination system 102 may also use fewer or more images than are shown here . the images 108 a - e all include a person having a face . in some implementations , an image may include multiple people or animals . in this example , the image 108 a is an adult female , the image 108 b is an adult male , the image 108 c is a female child , the image 108 d is a male child , and the image 108 e is a picture of a somewhat androgynous adult . fig3 b shows examples of comparisons and similarities between multiple faces 302 a - e in the images 108 a - e . the face detector 114 identifies regions within the images 108 a - e that represent the faces 302 a - e . the similarity calculator 116 compares features between faces to determine similarity scores between faces . in some implementations , the similarity calculator 116 compares pairs of faces and determines a similarity score for each pair of faces . in some implementations , the similarity score is a decimal number in the range from zero to one , where zero indicates no similarity and one indicates that the faces are identical or indistinguishable . for example , the similarity calculator 116 may determine similarity scores of “ 0 . 7 ” between the faces 302 b and 302 d , “ 0 . 5 ” between the faces 302 b and 302 e , and “ 0 . 7 ” between the faces 302 a and 302 c . the similarity scores of “ 0 . 7 ” indicate that the faces 302 b and 302 d are significantly similar and the faces 302 a and 302 c are significantly similar . the similarity score of “ 0 . 5 ” indicates that the faces 302 b and 302 e are only somewhat similar . the similarity calculator 116 may perform the comparison and calculate a similarity score for each pair of images . the graph generator 202 uses the similarity scores to generate the graph representing similarities between the faces 302 a - e . fig3 c shows an example of a weighted undirected graph 310 of the similarities between the faces 302 a - e in the images 108 a - e . the graph generator 202 represents the faces 302 a - e with multiple nodes 312 a - e , respectively . the graph generator 202 links pairs of nodes with edges that represent a similarity score between the linked pair of nodes . for example , the graph generator 202 links the nodes 312 b and 312 d with an edge having an associated similarity score of “ 0 . 7 .” in some implementations , the graph generator 202 generates an edge between each pair of nodes in the weighted undirected graph 310 . in some implementations , the graph generator 202 links a portion of the pairs of nodes with edges . for example , the graph generator 202 can link pairs of nodes having a threshold similarity score . in another example , the graph generator 202 can link a threshold number of nodes to a particular node , such as the five nodes having the highest similarity scores with the particular node . for the purposes of clarity in explanation , the weighted undirected graph 310 only includes edges between neighboring nodes . fig3 d shows an example of manually identified gender values for a portion of the weighted undirected graph 310 . as previously described , the gender determination system 102 includes the predetermined gender label values 206 . the graph generator 202 associates the predetermined gender label values 206 with corresponding nodes . for example , the graph generator 202 associates gender label values of “ 1 . 0 ” male and “ 0 . 0 ” female with the node 312 b and “ 0 . 0 ” male and “ 1 . 0 ” female with the node 312 a . in this example of a weighted undirected graph , each node eventually has a male gender label and a female gender label ( e . g ., either predetermined or inferred ). the nodes 312 a - b have predetermined male and female gender labels and label values . as described below , the inferred gender label generator 112 uses the weighted undirected graph 310 to infer male and female gender label values for the nodes 312 c - e . although this example describes two gender labels , in other implementations , a node may have zero , three , or more gender labels as well . in some implementations , the inferred gender label generator 112 also infers gender label values for nodes having predetermined gender label values . inferred gender label values for nodes having predetermined gender label values can be used to check the accuracy of the inferred gender label generator 112 and / or to check for possible errors in the predetermined gender label values 206 . fig4 is a flow chart showing an example of a method 400 for constructing a weighted undirected graph of similarities between faces in images . in some implementations , the face detector 114 , the similarity calculator 116 , and the graph generator 202 can include instructions that are executed by a processor of the gender determination system 102 . the method 400 can start with step 402 , which identifies face regions using a face detector . for example , the inferred gender label generator 112 can use the face detector 114 to locate the regions of the images 108 b and 108 d that include the faces 302 b and 302 d , respectively . in step 404 , the method 400 compares two faces and generates a similarity score representing the similarity between the two faces . for example , the similarity calculator 116 compares the faces 302 b and 302 d and calculates the similarity score of “ 0 . 7 ” between the faces 302 b and 302 d . if at step 406 there are more faces to compare , then the method 400 returns to step 404 and compares another pair of faces . otherwise , the method 400 constructs a weighted undirected graph at step 408 , where the faces are nodes and the similarity scores are edges that link the nodes . for example , the graph generator 202 constructs the nodes 312 b and 312 d representing the faces 302 b and 302 d . the graph generator 202 links the nodes 312 b and 312 d with an edge associated with the similarity score of “ 0 . 7 ” between the nodes 312 b and 312 d . at step 410 , the method 400 receives a user input labeling a subset of the face nodes as either male or female . for example , the gender determination system 102 may receive a user input including the predetermined gender label values 206 . the predetermined gender label values 206 indicate that the node 312 b has gender label values of “ 1 . 0 ” male and “ 0 . 0 ” female . the inferred gender label generator 112 uses the weighted undirected graph 310 and the predetermined gender label values 206 to infer the gender of one or more faces represented by nodes in the weighted undirected graph 310 . fig5 is a flow chart showing an example of a method 500 , referred to here as an “ adsorption ” algorithm , for inferring the gender of a face in an image using a weighted undirected graph of similarities between faces in images . in some implementations , the inferred gender label generator 112 can include instructions that are executed by a processor of the gender determination system 102 . the adsorption algorithm 500 can be executed using information from the graphs shown in fig3 c - d and can be executed for every node in the graphs . the adsorption algorithm 500 can start with step 502 , which determines if a specified number of iterations have run for a graph . if the number is not complete , step 504 is performed . in step 504 , a node representing a face is selected . for example , the inferred gender label generator 112 can select a node that has gender label values that may be modified by the algorithm , such as “ male ” or “ female .” in step 506 , a gender label is selected from the selected node . for example , the inferred gender label generator 112 can select the gender label “ male ” if present in the selected node . in step 508 , a gender label value for the selected gender label is initialized to zero . for example , the inferred gender label generator 112 can set the gender label value for “ male ” to zero . in step 510 , a neighboring node of the selected node can be selected . for example , the selected node may specify that a neighboring node has a similarity score of “ 0 . 7 ” with the selected node . the inferred gender label generator 112 can select the neighboring node . in step 512 , a corresponding weighted gender label value of a selected neighbor is added to a gender label value of the selected gender label . for example , if the selected neighboring node has a gender label value for the gender label “ male ,” the inferred gender label generator 112 can add this value to the selected node &# 39 ; s gender label value for “ male .” in certain implementations , the gender label value retrieved from a neighboring node can be weighted to affect the contribution of the gender label value based on the degree of distance from the selected node ( e . g ., based on whether the neighboring node is linked directly to the selected node , linked by two edges to the selected node , etc .) in some implementations , the gender label value can also be based on a weight or similarity score associated with the edge . in step 514 , it is determined whether there is another neighbor node to select . for example , the inferred gender label generator 112 can determine if the selected node is linked by a single edge to any additional neighbors that have not been selected . in another example , a user may specify how many degrees out ( e . g ., linked by two edges , three edges , etc .) the inferred gender label generator 112 should search for neighbors . if there is another neighbor that has not been selected , steps 510 and 512 can be repeated , as indicated by step 514 . if there is not another neighbor , step 516 can be performed . in step 516 , it is determined whether there is another gender label in the selected node . for example , the selected node can have multiple gender labels , such as “ male ” and “ female .” if these additional gender labels have not been selected , the inferred gender label generator 112 can select one of the previously unselected gender labels and repeat steps 506 - 514 . if all the gender labels in the node have been selected , the gender label values of the selected node can be normalized , as shown in step 518 . for example , the inferred gender label generator 112 can normalize each gender label value so that it has a value between 0 and 1 , where the gender label value &# 39 ; s magnitude is proportional to its contribution relative to all the gender label values associated with that node . in step 520 , it can be determined whether there are additional nodes in the graph to select . if there are additional nodes , the method can return to step 504 . if all the nodes in the graph have been selected , the method can return to step 502 to determine whether the specified number of iterations has been performed on the graph . if so , the adsorption algorithm 500 can end . in certain implementations , the adsorption algorithm 500 can include the following pseudo code : for each node used to label other nodes , n , in the similarity graph , g : for each node to be labeled , n , in the similarity graph , g : // where n t , injection is a node having a static assigned value for each node , m , that has an edge with similarity s mn , to n : normalize the weight of the gender labels at each n , so that the sum of in certain implementations , after “ x ” iterations , the inferred gender label generator 112 can examine one or more of the nodes of the graph and probabilistically assign a gender label to each node based on the weights of the gender labels ( e . g ., a label with the maximum label value can be assigned to the node ). in some implementations , the number of the iterations is specified in advance . in other implementations , the algorithm terminates when the gender label values for the gender labels at each node reach a steady state ( e . g ., a state where the difference in the label value change between iterations is smaller than a specified epsilon ). in another alternative method , gender label values for nodes can be inferred by executing a random walk algorithm on the graphs . more specifically , in some implementations , given a graph , g , the inferred gender label generator 112 can calculate gender label values , or label weights , for every node by starting a random walk from each node . the random walk algorithm can include reversing the direction of each edge in the graph if the edge is directed . if the edge is bi - directional or undirected , the edge can be left unchanged . the inferred gender label generator 112 can select a node of interest and start a random walk from that node to linked nodes . at each node where there are multiple - out nodes ( e . g ., nodes with links to multiple other nodes ), the inferred gender label generator 112 can randomly select an edge to follow . if the edges are weighted , the inferred gender label generator 112 can select an edge based on the edge &# 39 ; s weight ( e . g ., the greatest weighted edge can be selected first ). if during the random walk , a node is selected that is a labeling node ( e . g ., used as a label for other nodes ), the classification for this walk is the label associated with the labeling node . the inferred gender label generator 112 can maintain a tally of the labels associated with each classification . if during the random walk , a node is selected that is not a labeling node , the inferred gender label generator 112 selects the next random path , or edge , to follow . the inferred gender label generator 112 can repeat the random walk multiple times ( e . g ., 1000s to 100 , 000s of times ) for each node of interest . after completion , the inferred gender label generator 112 can derive the gender label values based on the tally of labels . this process can be repeated for each node of interest . additionally , in some implementations , the inferred gender label generator 112 generates a second data structure , such as a second graph . the second graph can include nodes substantially similar to the weighted undirected graph 310 . in one example , the weighted undirected graph 310 includes male gender label values and a second graph includes female gender label values . in some implementations , the adsorption algorithm 500 can also be performed on the second graph . the inferred gender label generator 112 can select and compare the resulting label value magnitudes for a corresponding node from both the first and second graphs . in some implementations , the inferred gender label generator 112 can combine the gender label value magnitudes from each graph through linear weighting to determine a final gender label value magnitude ( e . g ., the first graph &# 39 ; s gender label value contributes 0 . 7 and the second graph &# 39 ; s gender label value contributes 0 . 3 ). in other implementations , the gender label values can be weighed equally to determine the final gender label value ( e . g ., 0 . 5 , 0 . 5 ), or the inferred gender label generator 112 can give one gender label value its full contribution while ignoring the gender label value from the other graph ( e . g ., [ 1 . 0 , 0 . 0 ] or [ 0 . 0 , 1 . 0 ]). in other implementations , the inferred gender label generator 112 can use a cross - validation method to set the contribution weights for gender label value magnitudes from each graph . for example , the inferred gender label generator 112 can access nodes in a graph , where the nodes have gender label value magnitudes that are known . the inferred gender label generator 112 can compare the actual gender label value magnitudes with the known gender label value magnitudes . the inferred gender label generator 112 can then weight each graph based on how closely its gender label values match the known gender label values . in certain implementations , the inferred gender label generator 112 can compare the gender label value magnitudes to an expected a priori distribution , instead of or in addition to examining the final gender label magnitudes . for example , if a summed value of a first gender label across all nodes is 8 . 0 and the summed value of a second gender label across all of the nodes is 4 . 0 , the a priori distribution suggests that first gender label may be twice as likely to occur as the second gender label . the inferred gender label generator 112 can use this expectation to calibrate the gender label value magnitudes for each node . if in a particular node , the first gender label value is 1 . 5 and the second gender label value is 1 . 0 , then the evidence for the first gender label , although higher than the second gender label , is not as high as expected because the ratio is not as high as the a priori distribution . this decreases the confidence that the difference in magnitudes is meaningful . a confidence factor can be translated back into the rankings . in some implementations , if the difference in magnitudes is below a confidence threshold , the inferred gender label generator 112 can rank a gender label with a lower value above a gender label with a higher value ( e . g ., manipulate the lower value so that it is increased to a gender label value greater than the higher value ). for example , if the first gender label &# 39 ; s value is expected to be three times the value of the second gender label , but was only 1 . 1 times greater than the second gender label , the inferred gender label generator 112 can rank the second gender label above the first gender label . in some implementations , the confidence factor can be kept as a confidence measure , which can be used , for example , by machine learning algorithms to weight the resultant label value magnitudes . in yet other implementations , instead of or in addition to comparing the gender label value magnitudes based on the a priori distribution of the nodes , the inferred gender label generator 112 can compare the gender label value magnitudes based on an end distribution of magnitudes across all nodes . for example , the inferred gender label generator 112 can measure how different a particular node &# 39 ; s distribution is from an average calculated across all nodes in a graph . fig6 a - d show examples of gender values in a weighted undirected graph 600 before performing a gender inferring process and after one iteration , two iterations , and four iterations of the gender inferring process , respectively . referring to fig6 a , the weighted undirected graph 600 includes predetermined and initial gender values for the nodes 312 a - e . the weighted undirected graph 600 only shows male gender labels for the sake of clarity . other gender labels may be included in the weighted undirected graph 600 or another graph having nodes corresponding to nodes in the weighted undirected graph 600 . the weighted undirected graph 600 includes predetermined gender label values for the nodes 312 a - b of “ 0 . 00 ” male and “ 1 . 00 ” male , respectively . the nodes 312 c - e have initial gender label values of “ 0 . 50 ” male . in some implementations , an initial gender label value may be a predetermined value , such as “ 0 . 50 .” alternatively , the initial gender label value may be based on the average of the predetermined gender label values 206 or another set of gender label values . referring to fig6 b , the weighted undirected graph 600 now shows the male gender label values of the nodes 312 a - e after one iteration of the inferred gender label generator 112 . in this example , the male gender label values of the nodes 312 a - b are fixed at “ 0 . 00 ” and “ 1 . 00 ,” respectively . the male gender label values of the nodes 312 c - e are now “ 0 . 25 ,” “ 0 . 73 ,” and “ 0 . 53 ,” respectively . the relatively high similarity between the nodes 312 a and 312 c as compared to other nodes gives the node 312 c a male gender label value (“ 0 . 25 ”) close to the male gender label value of the node 312 a (“ 0 . 00 ”). similarly , the relatively high similarity between the nodes 312 b and 312 d as compared to other nodes gives the node 312 d a male gender label value (“ 0 . 73 ”) close to the male gender label value of the node 312 b (“ 1 . 00 ”). the node 312 e has slightly higher similarity with the nodes 312 b and 312 d leading to a male gender value (“ 0 . 53 ”) that leans toward male . referring to fig6 c , the weighted undirected graph 600 now shows the gender label values for the nodes 312 a - e after two iterations of the inferred gender label generator 112 . the male gender label value of the node 312 c has increased by “ 0 . 01 ” to “ 0 . 26 .” the male gender label value of the node 312 d has increased by “ 0 . 01 ” to “ 0 . 74 .” the male gender label value of the node 312 e has increased by “ 0 . 01 ” to “ 0 . 54 .” in some implementations , the inferred gender label generator 112 may stop processing a graph after the change in each gender label value is below a particular threshold , such as “ 0 . 01 .” referring to fig6 d , the weighted undirected graph 600 now shows the gender label values for the nodes 312 a - e after four iterations of the inferred gender label generator 112 . the male gender label value of the node 312 d has increased by “ 0 . 01 ” to “ 0 . 75 .” the male gender label values of the nodes 312 a - e have now converged within “ 0 . 01 .” the inferred gender label generator 112 stops processing the weighted undirected graph 600 and outputs the male gender label values . alternatively , the inferred gender label generator 112 may stop processing after a predetermined number of iterations , such as five iterations . in some implementations , the inferred gender label generator 112 infers female gender label values for the nodes 312 a - e in addition to the male gender label values previously described . the inferred gender label generator 112 can compare and / or combine the male and female gender label values to determine a gender for the faces 302 a - e associated with the nodes 312 a - e . for example , if the male gender label value of a node is larger than its female gender label value than the corresponding face is determined to be male and vice versa for female . fig7 a shows an example of a table 700 that stores gender values for the faces 302 a - e . the weighted undirected graphs 310 and 600 may stored in the data storage 110 or structured in a memory module as tables , such as the table 700 . in particular , the table 700 includes an identifier 702 for each of the faces 302 a - e , an indication 704 of where similarity scores to other faces can be found , a male gender label value 706 , and a female gender label value 708 . the entry in the table 700 for face a indicates that the similarity scores associated with face can be found in table a . fig7 b shows an example of a table 710 that stores similarity scores between a first face and other faces . in particular , the table 710 represents table a , which includes the similarity scores associated with face a from the table 700 . the table 710 includes an identifier 712 for each of the associated faces and a corresponding similarity score 714 . fig8 shows an example of a weighted undirected graph 800 including dummy labels . in certain implementations , dummy labels can be used in the weighted undirected graph 800 to reduce effects of distant neighboring nodes . when the label value of a node is determined based on , for example , the label with the greatest label value , the weight assigned to the dummy label can be ignored and the remaining weights used in the determination . for example , the dummy labels &# 39 ; contribution can be removed from the calculation of the label values at the end of the algorithm ( e . g ., after the label values have reached a steady state or a specified number of iterations have occurred ). in certain implementations , dummy labels can be used in all of the graphs generated by the inferred label generator . in other implementations , a user may specify for which graph ( s ) the dummy labels may be used . the example of dummy labels shown here associates a dummy node with each of the nodes 312 a - e in the weighted undirected graph 800 . in other implementations , dummy labels are assigned to a small number of nodes , such as nodes that are not associated with initial gender label values . fig9 is a schematic diagram of a generic computing system 900 . the generic computing system 900 can be used for the operations described in association with any of the computer - implement methods described previously , according to one implementation . the generic computing system 900 includes a processor 902 , a memory 904 , a storage device 906 , and an input / output device 908 . each of the processor 902 , the memory 904 , the storage device 906 , and the input / output device 908 are interconnected using a system bus 910 . the processor 902 is capable of processing instructions for execution within the generic computing system 900 . in one implementation , the processor 902 is a single - threaded processor . in another implementation , the processor 902 is a multi - threaded processor . the processor 902 is capable of processing instructions stored in the memory 904 or on the storage device 906 to display graphical information for a user interface on the input / output device 908 . the memory 904 stores information within the generic computing system 900 . in one implementation , the memory 904 is a computer - readable medium . in one implementation , the memory 904 is a volatile memory unit . in another implementation , the memory 904 is a non - volatile memory unit . the storage device 906 is capable of providing mass storage for the generic computing system 900 . in one implementation , the storage device 906 is a computer - readable medium . in various different implementations , the storage device 906 may be a floppy disk device , a hard disk device , an optical disk device , or a tape device . the input / output device 908 provides input / output operations for the generic computing system 900 . in one implementation , the input / output device 908 includes a keyboard and / or pointing device . in another implementation , the input / output device 908 includes a display unit for displaying graphical user interfaces . the features described can be implemented in digital electronic circuitry , or in computer hardware , firmware , software , or in combinations of them . the apparatus can be implemented in a computer program product tangibly embodied in an information carrier , e . g ., in a machine - readable storage device or in a propagated signal , for execution by a programmable processor ; and method steps can be performed by a programmable processor executing a program of instructions to perform functions of the described implementations by operating on input data and generating output . the described features can be implemented advantageously in one or more computer programs that are executable on a programmable system including at least one programmable processor coupled to receive data and instructions from , and to transmit data and instructions to , a data storage system , at least one input device , and at least one output device . a computer program is a set of instructions that can be used , directly or indirectly , in a computer to perform a certain activity or bring about a certain result . a computer program can be written in any form of programming language , including compiled or interpreted languages , and it can be deployed in any form , including as a stand - alone program or as a module , component , subroutine , or other unit suitable for use in a computing environment . suitable processors for the execution of a program of instructions include , by way of example , both general and special purpose microprocessors , and the sole processor or one of multiple processors of any kind of computer . generally , a processor will receive instructions and data from a read - only memory or a random access memory or both . the essential elements of a computer are a processor for executing instructions and one or more memories for storing instructions and data . generally , a computer will also include , or be operatively coupled to communicate with , one or more mass storage devices for storing data files ; such devices include magnetic disks , such as internal hard disks and removable disks ; magneto - optical disks ; and optical disks . storage devices suitable for tangibly embodying computer program instructions and data include all forms of non - volatile memory , including by way of example semiconductor memory devices , such as eprom , eeprom , and flash memory devices ; magnetic disks such as internal hard disks and removable disks ; magneto - optical disks ; and cd - rom and dvd - rom disks . the processor and the memory can be supplemented by , or incorporated in , asics ( application - specific integrated circuits ). to provide for interaction with a user , the features can be implemented on a computer having a display device such as a crt ( cathode ray tube ) or lcd ( liquid crystal display ) monitor for displaying information to the user and a keyboard and a pointing device such as a mouse or a trackball by which the user can provide input to the computer . the features can be implemented in a computer system that includes a back - end component , such as a data server , or that includes a middleware component , such as an application server or an internet server , or that includes a front - end component , such as a client computer having a graphical user interface or an internet browser , or any combination of them . the components of the system can be connected by any form or medium of digital data communication such as a communication network . examples of communication networks include , e . g ., a lan , a wan , and the computers and networks forming the internet . the computer system can include clients and servers . a client and server are generally remote from each other and typically interact through a network , such as the described one . the relationship of client and server arises by virtue of computer programs running on the respective computers and having a client - server relationship to each other although a few implementations have been described in detail above , other modifications are possible . for example , image or facial labels other than gender may be used , such as ethnicity or complexion . in addition , the logic flows depicted in the figures do not require the particular order shown , or sequential order , to achieve desirable results . in addition , other steps may be provided , or steps may be eliminated , from the described flows , and other components may be added to , or removed from , the described systems . accordingly , other implementations are within the scope of the following claims . | 6 |
fig1 and 2 show a printed circuit board 10 with electronic components 12 mounted thereon . a shield assembly including a base 14 and a cover 16 encloses the components 12 and shields them from electromagnetic and radio frequency interference . thus , the base 14 is a metallic rectilinear box having an open side . the base 14 is secured to the circuit board 10 by being surface mounted to surface mount solder pads 18 , as is known in the art . this securement places the open side of the base 14 against the circuit board 10 . the side 20 of the base 14 which is opposite the circuit board 10 is formed with an enlaced opening 22 to provide access to the shielded components 12 . the cover 16 is a metallic rectilinear box having an open side . the cover 16 , like the base 14 , has an open side defined by distal edges 24 of lateral sides 26 . the lateral sides 26 of the cover 16 are sized so that the cover 16 fits snugly around the base 14 . to assist in providing and maintaining a snug fit , the lateral sides 26 are formed with slits 28 and small openings 30 between the slits 28 , and the lateral sides 32 of the base 14 are formed with outwardly extending bumps 34 corresponding in location to the openings 30 . the openings 30 and bumps 34 act as detents when the cover 16 is installed on the base 14 . the lateral sides 26 of the cover 16 are dimensioned so that when the cover 16 is installed on the base 14 , there is a gap between the distal edges 24 and the surface of the circuit board 10 , as best shown in fig1 . referring now to fig3 - 6 , the inventive tool , designated generally by the reference numeral 40 , includes a first body member 42 and a second body member 44 . the first body member 42 has a front face 46 and a mating face 48 . similarly , the second body member 44 has a front face 50 and a mating face 52 . preferably , the faces 46 , 48 , 50 , 52 are all substantially planar . as best shown in fig6 the body member 42 is formed with a pair of spaced bores 54 extending therein from the mating face 48 and orthogonal thereto . similarly , the body member 44 is formed with a pair of spaced bores 56 extending therein from the mating face 52 and orthogonal thereto . the bores 54 , 56 are spaced the same distance from the front faces 36 , 50 , respectively , and are equally spaced from the side walls of the body members 42 , 44 so that when the body members 42 , 44 are aligned , as shown in fig3 the bores 54 are aligned with the bores 56 . a pin 58 is installed in each bore pair 54 , 56 to act as a guide member which orients the body members 42 , 44 with respect to each other so that the mating faces 48 , 52 face each other while at the same time allowing the body members 42 , 44 to move relative to each other along a line of movement orthogonal to the mating faces 48 , 52 . each pin 58 must be free to move in at least one of the corresponding bores 54 , 56 . as shown in fig6 the first body member 42 is formed with a bore 60 extending therein from the mating face 40 along an axis parallel to the line of movement , with the distal ( innermost ) end of the bore 60 being internally threaded . the bore 60 has an enlarged region 62 open to the mating face 48 . the second body member 44 is formed with a bore therethrough coaxial with the bore 60 . the bore through the second body member 44 includes an enlarged region 64 open to the mating face 52 , a central region 66 , and a further enlarged region 68 open at the side of the body member 44 opposite the mating face 52 . a shoulder screw 70 extends through the bore of the second body member 44 and is threadedly secured in the bore 60 of the first body member 42 . a helical spring 72 surrounds the shoulder screw 70 within the enlarged regions 62 , 64 . thus , the spring 72 provides a force to yieldably bias the body members 42 , 44 away from each other along the line of movement and the head of the shoulder screw 70 abuts against the inner wall of the enlarged region 68 to provide an upper limit on the separation between the mating faces 48 , 52 . secured to the first body member 42 , as by screws 74 , is a gripper member 76 . similarly , a gripper member 78 is secured to the body member 44 , as by screws 74 . the gripper members 76 , 78 are identical and therefore only the gripper member 76 will be described in detail . as shown , the gripper member 76 is substantially planar and is secured to its body member 42 on the side opposite the mating face 48 . the gripper member 76 extends in a plane forwardly beyond the front face 46 to a shoulder 80 formed on the gripper member 76 on the side facing the gripper member 78 . the shoulder 80 extends along the length of the gripper member 76 parallel to the front face 46 and is spaced from the front face 46 by a distance at least as great as the dimension of the shield cover 16 lateral side 26 orthogonally to the distal edge 24 . the distance from the shoulder 80 to the distal end 82 of the gripper member 76 , which distal end 82 runs parallel to the shoulder 80 , is less than the gap between the distal edge 24 of the cover 16 and the circuit board 10 when the cover 16 is installed on the base 14 . as shown , the planes of the gripper members 76 , 78 are parallel to each other with the shoulders 80 of the gripper members 76 , 80 facing each other and being aligned along a line parallel to the line of movement . the body members 42 , 44 are dimensioned so that they can be separated sufficiently that the gripper members 76 , 78 can be moved along opposed lateral sides 26 of the cover 16 toward the circuit board until the shoulders 80 pass the distal edges 24 . the body members 42 , 44 can then be moved toward each other against the force of the spring 72 until the shoulders 80 are separated by a distance less than the distance between the opposed lateral sides 26 of the cover 16 . accordingly , subsequent movement of the tool 40 away from the circuit board 10 causes the shoulders 80 to engage the distal edges 24 to remove the cover 16 from the base 14 . this removal does not cause any damage to either the base 14 or the cover 16 since all forces are applied over a relatively large area without deforming either the base 14 or the cover 16 . accordingly , there has been disclosed an improved tool for removing the cover from an emi / rfi shield assembly . while an illustrative embodiment of the present invention has been disclosed herein , it is understood that various modifications and adaptations to the disclosed embodiment will be apparent to one of ordinary skill in the art and it is therefore intended that this invention be limited only by the scope of the appended claims . | 8 |
with reference to fig1 - 6 two embodiments of processes for evacuating excess toner from repaired or remanufactured laser printer toner cartridges after the post - test will be described . the first process is referred to as the exit pull seal port method and the second is referred to as the exit vacuum hole method . referring to fig1 , the exit vacuum hole method involves drilling a hole at location ( 22 ) that is big enough to vacuum the excess toner in a reasonable amount of time out of the toner cartridge . specifically , the toner found on the outer surface of the cartridge on one end of the roller is removed . that end is preferably the same end as is the exit pull seal port ( 24 ). the port ( 24 ) penetrates to or opens into the inside of the developing section of the cartridge . optionally , the cartridge can be vibrated during the vacuuming process in order to increase the rate at which the toner will be removed from the toner cartridge and maximize removal of excess toner . referring to fig2 , the hole is preferably drilled into the cartridge at the disassembly stage of the cartridge repair or remanufacturing process , in order to prevent damage to the internal components in the developing section . furthermore , drilling the hole at this stage provides the ability to clean excess plastic burrs from the inside of the developing section before the cartridge is assembled . as shown in fig2 , the hole 28 has been drilled or otherwise made at location ( 22 ) shown in fig1 . after the hole ( 28 ) has been drilled , it is temporarily sealed during the rest of the remanufacturing process in order to prevent leakage of toner through the hole in the post - print test stage . the hole is preferably and temporarily covered with a piece of tape , of any variety , so long as the tape functions to prevent leakage during post - test . after the post - print test has been completed , the temporary tape seal is removed . the excess toner is then vacuumed . with reference to fig3 a , 3 b and 3 c , vacuuming of the cartridge after post - test is accomplished by placing the cartridge on a holding fixture , preferably in a vertical orientation and then vacuuming out the excess toner . the vertical orientation tends to permit gravity to force the toner to drop to the bottom and thus closer to the exit hole 28 during vacuuming , as shown at location ( 32 ) in fig3 b . a vacuum nozzle ( 36 ) is used to vacuum out the excess toner from the cartridge ( 26 ) in the direction of the arrow ( 30 ) as shown in fig3 a . the hole ( 28 ) is located on the bottom side ( 32 ) of the cartridge as shown in fig3 b . a vacuum nozzle ( 36 ) is positioned around and over the hole ( 28 ) and this is where the toner is to be removed , as shown at ( 34 ) in fig3 c . the vacuum process can either be accomplished on a vibrating fixture ( not shown ) to enhance the flow of toner to the vacuum nozzle , or be accomplished without vibration , for toner removal . referring to fig6 , once the excess toner has been removed , the area around the drilled hole ( 28 ) is cleaned and a seal patch ( 48 ) is applied to close and seal the hole ( 28 ). any seal , cover , plug or cap can be used to cover and seal the hole from leakage , as long as it doesn &# 39 ; t interfere or damage the internal components of the printer , i . e ., so long as it functions as a seal or plug only . with reference to fig4 , and alternate method of removing excess toner from a laser printer cartridge will be described . this alternate method is referred to as the exit pull seal port method . in this method for removing the post - test toner from the developing section of a cartridge , toner is removed from the toner hopper exit pull seal port . in this method the toner cartridge preferably is placed vertically . alternatively , the cartridge can be placed at any angle that is convenient in relation to the fixture that holds the cartridge in place . also , preferably , the cartridge is vibrated in order to agitate and shake loose any toner that might be retained on post - test toner cartridge . alternative , tapping the cartridge by hand will also cause the toner to fall to one end of the cartridge , thus , allowing for maximum removal of the excess toner to be removed by the vacuum nozzle as shown at ( 38 ). during this method the vacuum nozzle ( 38 ) is slipped into the toner hopper seal port ( 40 ) above the seal strip ( 44 ). care must be taken that the nozzle does not damage or push the strip ( 44 ) back into the cartridge . at this point , vacuum is applied to suck out toner in the direction shown by arrow ( 42 ) to remove the excess post - test toner through the hopper seal port ( 40 ). optionally , the nozzle ( 38 ) can be custom shaped to correspond to the shape of the exit port of specific toner cartridge models or designs , by either machining or molding a generic design nozzle . the specific cartridge customized nozzle is slipped into the exit pull seal port ( 40 ) to allow the toner to be removed faster than with a generic nozzle . to illustrate the general toner evacuation process as presently described for two different embodiments , reference is made to fig5 a and 5b . a simplified section view of a laser printer cartridge toner hopper tank ( 52 ) and waste section ( 54 ) is shown . also , post - test toner ( 58 ) is shown lying on top of a toner hopper tank with the toner hopper pull seal strip ( 50 ) and hopper gasket seal dividing the two sections at ( 56 ). fig5 b is a side perspective view of a toner cartridge , and includes the hopper section ( 52 ), the roller section ( 54 ) and the pull seal ( 50 ). the post - test toner ( 58 ) shown on top of the toner hopper gasket at ( 56 ) and pull seal strip assembly ( 50 ) is to be evacuated . in fig5 a both of the two different , and alternate vacuum nozzles ( 62 ), ( 64 ) are shown to graphically show the removal ( 58 ) of toner in simplified and comparative manner . the arrows ( 66 ) and ( 68 ) at the end of the vacuum nozzles show the direction of vacuum removal of toner from the toner waste tank hopper ( 54 ). in both process the addition of vibration agitates the toner , and / or vertical orientation provides for quicker and better removal of post - test toner . although specific embodiments of the invention have been described , various modifications , alterations , alternative constructions , and equivalents are also encompassed within the scope of the invention . the specification and drawings are , accordingly , to be regarded in an illustrative rather than a restrictive sense . it will , however , be evident that additions , subtractions , deletions , and other modifications and changes may be made thereunto without departing from the broader spirit and scope of the invention as set forth in the claims . | 6 |
it is contemplated that systems , devices , methods , and processes of the claimed invention encompass variations and adaptations developed using information from the embodiments described herein . adaptation and / or modification of the systems , devices , methods , and processes described herein may be performed by those of ordinary skill in the relevant art . throughout the description , where articles , devices , and systems are described as having , including , or comprising specific components , or where processes and methods are described as having , including , or comprising specific steps , it is contemplated that , additionally , there are articles , devices , and systems of the present invention that consist essentially of , or consist of , the recited components , and that there are processes and methods according to the present invention that consist essentially of , or consist of , the recited processing steps . it should be understood that the order of steps or order for performing certain action is immaterial so long as the invention remains operable . moreover , two or more steps or actions may be conducted simultaneously . the mention herein of any publication , for example , in the background section , is not an admission that the publication serves as prior art with respect to any of the claims presented herein . the background section is presented for purposes of clarity and is not meant as a description of prior art with respect to any claim . fig1 is a flow chart of an illustrative method for automated detection and analysis of data peaks in raw data acquired by an icp - ms system , where at least some of the peaks have multiple points and each peak corresponds to a nanoparticle of a sample , according to an illustrative embodiment . method 100 of fig1 begins with accessing raw data comprising a sequence of pulse count values ( e . g ., intensity values ) acquired by an icp - ms system ( 102 ). the raw data is analyzed to determine a background level , wherein the background level corresponds to the level at which the raw data does not exceed a meaningful threshold value ( 104 ). in some implementations , the background level is determined using a multi - pass algorithm , wherein the algorithm is iteratively executed until the background threshold converges to be within acceptable tolerance . the data is then analyzed to determine peaks in excess of the background level ( 106 ). the data points corresponding to the peaks are then used to determine the peak area intensities , corresponding to the area under the peaks which exceed the background level ( 108 ). an intensity histogram is constructed from the peak area intensities ( 110 ). a size histogram is constructed from the intensity histogram ( 112 ). the size histogram is analyzed to determine statistical data for the particle sample ( 114 ). fig2 is an illustrative embodiment of a flow chart depicting steps in the background determination block of the method of fig1 . background determination method 200 begins by loading raw data , e . g ., all of the data points acquired by the icp - ms system ( 202 ). this raw data is used in the initial iteration of the background determination method 200 ( i . e ., i = 0 , the 0th iteration ) ( 204 , 222 ). the threshold approximation for the initial iteration is calculated by the average of the data points plus three times the standard deviation of the data set ( e . g ., the threshold function , t ( i )= average ( i )+( 3 * standard dev . ( i )) ( 206 ). in subsequent iterations , the threshold approximation is calculated by the same threshold function t ( 206 ), but uses a reduced data set consisting only of those data points which were less than or equal to the threshold approximation of the previous iteration ( 214 , 216 , 218 , 220 , 226 , 228 , 230 ). the most recent iteration of the threshold approximation is compared to the threshold approximation of the previous iteration to determine if they are approximately equal ( i . e ., the threshold level has converged ). based on a positive determination , the final threshold level is calculated by the threshold function of the final iteration of the data set , and the final background level is calculated by the average of the final iteration of the data set . based on a negative determination , the data set is further processed ( 208 ) to reduce the data set to those data points which are less than or equal to the most recent iteration of threshold approximation , according to steps 214 , 216 , 218 , 220 , 226 , 228 , 230 . fig3 is a flow chart depicting steps in the peak detection block of the method of fig1 , according to the illustrative embodiment . peak detection method 300 begins by loading raw data acquired by the icp - ms system ( 304 ). a five point averaged data array is constructed from the raw data , wherein each consecutive set of five points is averaged ( e . g ., average ( points 1 - 5 ), average ( points 6 - 10 ), etc .) and these averages are used to construct a new array ( 304 , 306 , 308 , 310 , 312 ). in some implementations , the size of the new array will be approximately one fifth of the size of the raw data array ( 330 ). the five point averaged data array is then analyzed to detect those points which represent peaks , wherein a point is determined to be a peak if the value of the point is greater than both the preceding point and the following point in the array , and the value of the point exceeds the threshold level determined in the background determination method 200 ( 316 , 318 , 322 , 324 , 326 ). these peak positions are stored in a new array representing the position of the peaks detected ( 318 ). the number of times a peak is detected is counted to determine the total number of peaks ( 320 ). fig4 is a flow chart depicting steps in the peak area determination block and the constructing intensity histogram block of the method of fig1 , according to the illustrative embodiment . peak area determination method 400 begins by loading the peak position array constructed in peak detection method 300 ( 402 ). each entry in the peak position array indicates that an actual peak occurs within a five point subarray of the raw data acquired by the icp - ms system , wherein the five point subarray corresponds to the five consecutive points within the raw data which are centered on the indicated peak position ( 404 ). the peak data point contained in the five point subarray is then determined by finding the maximum value within the five point subarray ( 406 ). a summation of area corresponding to the peak is initiated by populating a summation variable with the value of the peak point , less the background level determined in background determination method 200 ( 408 ). this background level corresponds to the contribution of the dissolved analyte and is subtracted from the value of any point that is added to the summation variable ( 416 , 422 ). each point to the right of the peak is iteratively added to the area summation until a point is determined to be less than or equal to the threshold level determined in background determination method 200 ( 414 ), or the end of the raw data is reached ( 420 ). subsequently , each point to the left of the peak is iteratively added to the area summation until a point is determined to be less than or equal to the threshold level ( 424 ), or the beginning of the raw data is reached ( 430 ). thus , a value less than or equal to the threshold , or the end of the data , comprise the limits to the area considered to correspond to a particular peak value . in certain implementations , the horizontal component ( e . g ., time steps ) of the area may be recorded in a separate array , but although such information may be useful , it is not necessary to record this information . the described summation of area is calculated for each of the peaks in the peak position array and the summations are added to a new peak summation array ( 434 ). the peak summation array is rounded to a whole number and used to construct an intensity histogram , wherein the intensity histogram corresponds to the frequency of any particular peak intensity ( area ). fig5 is a flow chart depicting steps in the constructing size histogram block and the calculating statistical data block of the method of fig1 , according to the illustrative embodiment . the intensity histogram constructed using the peak area determination method 400 is used to construct a two - dimensional array comprising the whole - number rounded intensities from one to the maximum detected peak intensity in the first dimension , and the corresponding frequency of each intensity in the second dimension ( 502 ). these whole - number rounded intensities are referred to as bins and all whole - number rounded intensities will correspond to a particular bin . the number of whole - number rounded intensities assigned to a bin is defined as the frequency for that particular bin . to convert intensity to mass , and then size , dissolved solution calibration method 504 may be used if the transport efficiency value has been specified and a dissolved solution calibration for the analyte exists ( 504 a ). a mass flux calibration is constructed based on the dissolved solution calibration , transport efficiency value , dwell time , and flow rate of the analysis ( 504 b ). the mass of dissolved analyte per dwell time is calculated by w = concentration * dwell time * flow rate * transport efficiency . the mass flux calibration is thus obtained by plotting intensity versus w for different dissolved solution concentrations . in some implementations , the dissolved solution calibration specifies the relation between the observed intensity and analyte concentration . in certain implementations , the mass flux calibration specifies the relation between the observed intensity and the mass of a nanoparticle . the mass flux calibration , mass fraction of analyte in the nanoparticle , and ionization efficiency are used to convert the peak area intensity of the histogram to mass , wherein mass - bin =[ intensity - bin / slope of mass flux calibration ]*[ 1 / mass fraction ]*[ 1 / ionization efficiency ] ( 504 c ). alternatively , to convert intensity to mass , and then size , standard particle method 514 may be used if a standard particle for the analyte exists ( 514 a ). the standard nanoparticle with known size is run through analysis and a peak detection is performed , followed by construction of an intensity histogram ( 514 b ). the most common intensity in the histogram is found using a method of lognormal / gaussian / max intensity fit . the specified density and size / shape are used to calculate the mass that the most common intensity refers to . the intensity versus mass of the nanoparticle ( s ) and blank ( i . e ., mass = 0 ) is used to construct an intensity versus mass calibration ( 514 c ). the resulting intensity versus mass calibration , the mass fraction of the analyte in the nanoparticle sample , and the ionization efficiency are used to convert the peak area intensity of the histogram to mass ( 514 d ). once intensity has been converted to mass by steps 514 d or 504 c , a size histogram is created by converting the mass to size using the user input density and nanoparticle shape ( e . g ., solving for the size in the formula of density = mass / volume , where volume is cube , sphere , etc .) ( 510 ). the most frequent size is then obtained by finding the maximum in the size - histogram array using a user input method of finding the maximum in the histogram , or alternatively finding the max in the fitted lognormal or gaussian fit . other statistically useful parameters are also extracted , such as number of peaks detected , particle concentration , mean particle size , median particle size , and dissolved concentration ( 522 ). fig6 a is a portion of a plot showing experimental results of background determination for sp - icp - ms data per the method of fig1 , according to the illustrative embodiment . plot 600 is a plot of the data points acquired by the sp - icp - ms system , wherein the horizontal access depicts time , and the vertical axis depicts the magnitude of the reading . following a background determination method such as background determination method 200 , those points which are less than or equal to the threshold level are identified as representing background data , and are represented by the background data indicator 602 . those data points which are not determined to be background data correspond to data that lies on a peak , and consist of those points indicated by raw data indicator 604 which are not obscured by a background data indicator . fig6 b is a small portion of the data set showing iterations performed for background determination of sp - icp - ms data per the method of fig1 , and result obtained , according to an illustrative embodiment . the first column of table 620 includes the raw data obtained by the sp - icp - ms system . the first row of calculations in table 640 corresponds to the raw data , and indicates the threshold approximation corresponding to the initial iteration of background determination . the data set is iteratively reduced according to the background determination method , wherein after each threshold approximation , those values which are less than or equal to the approximation are removed from the data set ( e . g ., the 1st iteration column of table 620 comprises all data points of the raw data which are less than or equal to the threshold approximation calculated in the 0th iteration shown in table 640 , etc .). the data set continues to be iteratively reduced until the threshold approximation of the most recent iteration and the threshold approximation of the previous iteration are approximately equal , as indicated in the 6th iteration and 7th iteration of table 640 ( i . e ., the threshold has converged ). once the threshold has converged , the threshold ( calculated using the threshold formula of the most recent data set iteration ) and the background level ( calculated using the average of the most recent data set iteration ) are finalized ( 650 ). fig7 a is a portion of a plot showing experimental results of peak detection from sp - icp - ms data per the method of fig1 , according to an illustrative embodiment . plot 700 is a plot of the data points acquired by the sp - icp - ms system , wherein the horizontal access depicts time , and the vertical axis depicts the magnitude of the reading . the data set is used with a peak detection method such as peak detection method 300 to identify the location of those points which correspond to a peak in the data . the points which correspond to a particular peak are indicated by the max peak detected indicator 704 . all other points , as well as the remaining points along the already identified peaks are indicated with the raw data indicator 702 . fig7 b is a small portion of data set showing steps performed for peak detection of sp - icp - ms experimental data per the method of fig1 , according to an illustrative embodiment . the first column of data in table 720 shows the raw data 722 acquired by the sp - icp - ms system . using a peak detection method such as peak detection method 300 , a five point averaged data set 724 is constructed from the raw data 722 , wherein each consecutive set of five points is averaged and used to construct the data set 724 . where a point in the five point averaged data set 724 is greater than both the previous and following point in the data set , the presence of a peak is indicated within that five point range by peak position data 726 . the maximum point from the raw data within the five point range identified by peak position data 726 is used to construct the maximum peaks data 728 ( i . e ., the maximum value identified from the five points of raw data comprising the value from the position directly indicated by the peak position data , the previous two data points , and the following two data points is used as the maximum value of the peak ). fig8 a is an intensity histogram computed for experimental sp - icp - ms data per the method of fig1 , according to an illustrative embodiment . plot 800 is an intensity histogram , wherein the horizontal axis depicts the whole - number rounded intensity data constructed using a peak area determination method such as peak area determination method 400 , and the vertical axis depicts the frequency at which each intensity was detected in the analysis . fig8 b is a small portion of data used to prepare the intensity histogram of fig8 a , according to an illustrative embodiment . the first column of table 820 comprises the peak intensity data 822 corresponding to each peak within the data set . the peak intensity data 822 is rounded to whole - number rounded intensity data 824 . table 830 shows intensity bins 832 which correspond to all whole - number values from one to the highest detected intensity , and the frequency of detection of a particular whole - number rounded intensity is defined as frequency data 834 . fig9 a is a particle size histogram computed for experimental sp - icp - ms data per the method of fig1 , according to an illustrative embodiment . plot 900 is a particle size histogram , wherein the horizontal axis depicts the size of particles calculated from intensity bins 826 ( i . e ., the size calculated from the unique entries in whole - number rounded intensity data 824 ), and the vertical axis depicts the frequency at which each size was detected in the analysis . fig9 b , 9c , 9d , and 9e depict computations , a size histogram , an intensity histogram , and calibrations used in performing mass and size calculations and producing the size histogram for experimental sp - icp - ms data per the method of fig1 , according to an illustrative embodiment . table 920 is an example of mass flux calibration ( specifies relation between observed intensity and the mass of a nanoparticle ) using the dissolved solution calibration method 504 , based on dissolved solution calibration , transport efficiency value , dwell time , and flow rate as described in blocks 504 , 506 , 508 , 510 . as described in block 504 b , mass flux 924 is calculated by concentration 922 * dwell time 928 * flow rate 930 * transport efficiency 932 . mass flux calibration is then calculated by linear fit of intensity 926 versus mass flux 924 to give slope 934 and intercept 946 . table 950 shows mass and size calculations between intensity data 952 and particle size 956 . as described in block 504 c , particle mass 954 is calculated by [ intensity 952 / mass flux calibration slope 934 ]*[ 1 / mass fraction 942 ]*[ 1 / ionization efficiency 944 ]. as described in block 510 , particle size 956 is calculated from density 946 and particle shape ( spherical ) by [[ 6 * particle mass 944 / pi ]*[ 1 / density 946 ]]̂[ 1 / 3 ]. plot 970 shows a size histogram of frequency data versus particle size , indicating the frequency at which a particular size of particle occurred in the analysis . plot 980 shows an intensity histogram of frequency data versus intensity , indicating the frequency at which a particular intensity occurred in the analysis . plot 990 is a plot of mass flux calibration calculated by linear fit of intensity 996 versus mass flux 994 to give mass flux calibration 998 . fig1 shows a size histogram computed for sp - icp - ms - run samples having known dissolved concentration to demonstrate detection of correct suspended nanoparticle size without interference from the dissolved analyte per the method of fig1 , according to an illustrative embodiment . plot 1000 shows detected size of particle contained in diw 1020 , 2 ppb 1022 , and 10 ppb 1024 dissolved analyte concentration . the peak at 60 nm 1026 is clearly indicated by the size histogram constructed in accordance with the methods described herein , which corresponds to the actual measured size 1028 of the sample . fig1 a , 11b , and 11c show computations of average particle size and standard deviation for known samples from sp - icp - ms experimental data to demonstrate accuracy and precision of the method of fig1 for determining average particle size and differentiating analyte in solid particle form from dissolved analyte , according to an illustrative embodiment . plots 1110 and 1130 show detected sample with relatively high ( 13 ppb ) and low ( 0 . 44 ) dissolved analyte concentration . in both examples , relatively low standard deviations 1112 and 1132 indicate high precision throughout the collected data . tables 1150 and 1170 show further consistency between sample readings and dissolved standard solution . fig1 is a schematic diagram of components of an icp - ms system , according to an illustrative embodiment . the icp - ms system 1200 is an instrument for performing trace metal analysis on a sample . sample introduction system 1202 is composed of a nebulizer and spray chamber which introduce the sample into an argon plasma as aerosol droplets . using rf coil 1206 , icp torch 1204 generates the argon plasma that serves as the ion source , which dries the aerosol , dissociates the molecules , then removes an electron from the components , thereby forming singly - charged ions . interface 1208 links the atmospheric pressure icp ion source to high vacuum mass spectrometer 1216 . mass spectrometer 1216 acts as a mass filter to sort ions by their mass - to - charge ratio ( m / z ). vacuum system 1210 creates the vacuum for ion optics 1214 , which guides the desired ions into a quadrupole while assuring that neutral species and photons are discarded from the ion beam . collision / reaction cell 1212 precedes the mass spectrometer and is used to remove interferences that can degrade achievable detection limits . detector 1218 counts individual ions exiting the quadrupole . processor 1220 is used to control aspects of instrument control and data handling for use in obtaining final concentration results . fig1 shows an illustrative network environment 1300 for use in the methods and systems for analysis of spectrometry data corresponding to particles of a sample , as described herein . in brief overview , referring now to fig1 , a block diagram of an exemplary cloud computing environment 1300 is shown and described . the cloud computing environment 1300 may include one or more resource providers 1302 a , 1302 b , 1302 c ( collectively , 1302 ). each resource provider 1302 may include computing resources . in some implementations , computing resources may include any hardware and / or software used to process data . for example , computing resources may include hardware and / or software capable of executing algorithms , computer programs , and / or computer applications . in some implementations , exemplary computing resources may include application servers and / or databases with storage and retrieval capabilities . each resource provider 1302 may be connected to any other resource provider 1302 in the cloud computing environment 1300 . in some implementations , the resource providers 1302 may be connected over a computer network 1308 . each resource provider 1302 may be connected to one or more computing device 1304 a , 1304 b , 1304 c ( collectively , 1304 ), over the computer network 1308 . the cloud computing environment 1300 may include a resource manager 1306 . the resource manager 1306 may be connected to the resource providers 1302 and the computing devices 1304 over the computer network 1308 . in some implementations , the resource manager 1306 may facilitate the provision of computing resources by one or more resource providers 1302 to one or more computing devices 1304 . the resource manager 1306 may receive a request for a computing resource from a particular computing device 1304 . the resource manager 1306 may identify one or more resource providers 1302 capable of providing the computing resource requested by the computing device 1304 . the resource manager 1306 may select a resource provider 1302 to provide the computing resource . the resource manager 1306 may facilitate a connection between the resource provider 1302 and a particular computing device 1304 . in some implementations , the resource manager 1306 may establish a connection between a particular resource provider 1302 and a particular computing device 1304 . in some implementations , the resource manager 1306 may redirect a particular computing device 1304 to a particular resource provider 1302 with the requested computing resource . fig1 shows an example of a computing device 1400 and a mobile computing device 1450 that can be used in the methods and systems described in this disclosure . the computing device 1400 is intended to represent various forms of digital computers , such as laptops , desktops , workstations , personal digital assistants , servers , blade servers , mainframes , and other appropriate computers . the mobile computing device 1450 is intended to represent various forms of mobile devices , such as personal digital assistants , cellular telephones , smart - phones , and other similar computing devices . the components shown here , their connections and relationships , and their functions , are meant to be examples only , and are not meant to be limiting . the computing device 1400 includes a processor 1402 , a memory 1404 , a storage device 1406 , a high - speed interface 1408 connecting to the memory 1404 and multiple high - speed expansion ports 1410 , and a low - speed interface 1412 connecting to a low - speed expansion port 1414 and the storage device 1406 . each of the processor 1402 , the memory 1404 , the storage device 1406 , the high - speed interface 1408 , the high - speed expansion ports 1410 , and the low - speed interface 1412 , are interconnected using various busses , and may be mounted on a common motherboard or in other manners as appropriate . the processor 1402 can process instructions for execution within the computing device 1400 , including instructions stored in the memory 1404 or on the storage device 1406 to display graphical information for a gui on an external input / output device , such as a display 1416 coupled to the high - speed interface 1408 . in other implementations , multiple processors and / or multiple buses may be used , as appropriate , along with multiple memories and types of memory . also , multiple computing devices may be connected , with each device providing portions of the necessary operations ( e . g ., as a server bank , a group of blade servers , or a multi - processor system ). the memory 1404 stores information within the computing device 1400 . in some implementations , the memory 1404 is a volatile memory unit or units . in some implementations , the memory 1404 is a non - volatile memory unit or units . the memory 1404 may also be another form of computer - readable medium , such as a magnetic or optical disk . the storage device 1406 is capable of providing mass storage for the computing device 1400 . in some implementations , the storage device 1406 may be or contain a computer - readable medium , such as a floppy disk device , a hard disk device , an optical disk device , or a tape device , a flash memory or other similar solid state memory device , or an array of devices , including devices in a storage area network or other configurations . instructions can be stored in an information carrier . the instructions , when executed by one or more processing devices ( for example , processor 1402 ), perform one or more methods , such as those described above . the instructions can also be stored by one or more storage devices such as computer - or machine - readable mediums ( for example , the memory 1404 , the storage device 1406 , or memory on the processor 1402 ). the high - speed interface 1408 manages bandwidth - intensive operations for the computing device 1400 , while the low - speed interface 1412 manages lower bandwidth - intensive operations . such allocation of functions is an example only . in some implementations , the high - speed interface 1408 is coupled to the memory 1404 , the display 1416 ( e . g ., through a graphics processor or accelerator ), and to the high - speed expansion ports 1410 , which may accept various expansion cards ( not shown ). in the implementation , the low - speed interface 1412 is coupled to the storage device 1406 and the low - speed expansion port 1414 . the low - speed expansion port 1414 , which may include various communication ports ( e . g ., usb , bluetooth ®, ethernet , wireless ethernet ) may be coupled to one or more input / output devices , such as a keyboard , a pointing device , a scanner , or a networking device such as a switch or router , e . g ., through a network adapter . the computing device 1400 may be implemented in a number of different forms , as shown in the figure . for example , it may be implemented as a standard server 1420 , or multiple times in a group of such servers . in addition , it may be implemented in a personal computer such as a laptop computer 1422 . it may also be implemented as part of a rack server system 1424 . alternatively , components from the computing device 1400 may be combined with other components in a mobile device ( not shown ), such as a mobile computing device 1450 . each of such devices may contain one or more of the computing device 1400 and the mobile computing device 1450 , and an entire system may be made up of multiple computing devices communicating with each other . the mobile computing device 1450 includes a processor 1452 , a memory 1464 , an input / output device such as a display 1454 , a communication interface 1466 , and a transceiver 1468 , among other components . the mobile computing device 1450 may also be provided with a storage device , such as a micro - drive or other device , to provide additional storage . each of the processor 1452 , the memory 1464 , the display 1454 , the communication interface 1466 , and the transceiver 1468 , are interconnected using various buses , and several of the components may be mounted on a common motherboard or in other manners as appropriate . the processor 1452 can execute instructions within the mobile computing device 1450 , including instructions stored in the memory 1464 . the processor 1452 may be implemented as a chipset of chips that include separate and multiple analog and digital processors . the processor 1452 may provide , for example , for coordination of the other components of the mobile computing device 1450 , such as control of user interfaces , applications run by the mobile computing device 1450 , and wireless communication by the mobile computing device 1450 . the processor 1452 may communicate with a user through a control interface 1458 and a display interface 1456 coupled to the display 1454 . the display 1454 may be , for example , a tft ( thin - film - transistor liquid crystal display ) display or an oled ( organic light emitting diode ) display , or other appropriate display technology . the display interface 1456 may comprise appropriate circuitry for driving the display 1454 to present graphical and other information to a user . the control interface 1458 may receive commands from a user and convert them for submission to the processor 1452 . in addition , an external interface 1462 may provide communication with the processor 1452 , so as to enable near area communication of the mobile computing device 1450 with other devices . the external interface 1462 may provide , for example , for wired communication in some implementations , or for wireless communication in other implementations , and multiple interfaces may also be used . the memory 1464 stores information within the mobile computing device 1450 . the memory 1464 can be implemented as one or more of a computer - readable medium or media , a volatile memory unit or units , or a non - volatile memory unit or units . an expansion memory 1474 may also be provided and connected to the mobile computing device 1450 through an expansion interface 1472 , which may include , for example , a simm ( single in line memory module ) card interface . the expansion memory 1474 may provide extra storage space for the mobile computing device 1450 , or may also store applications or other information for the mobile computing device 1450 . specifically , the expansion memory 1474 may include instructions to carry out or supplement the processes described above , and may include secure information also . thus , for example , the expansion memory 1474 may be provided as a security module for the mobile computing device 1450 , and may be programmed with instructions that permit secure use of the mobile computing device 1450 . in addition , secure applications may be provided via the simm cards , along with additional information , such as placing identifying information on the simm card in a non - hackable manner . the memory may include , for example , flash memory and / or nvram memory ( non - volatile random access memory ), as discussed below . in some implementations , instructions are stored in an information carrier and , when executed by one or more processing devices ( for example , processor 1452 ), perform one or more methods , such as those described above . the instructions can also be stored by one or more storage devices , such as one or more computer - or machine - readable mediums ( for example , the memory 1464 , the expansion memory 1474 , or memory on the processor 1452 ). in some implementations , the instructions can be received in a propagated signal , for example , over the transceiver 1468 or the external interface 1462 . the mobile computing device 1450 may communicate wirelessly through the communication interface 1466 , which may include digital signal processing circuitry where necessary . the communication interface 1466 may provide for communications under various modes or protocols , such as gsm voice calls ( global system for mobile communications ), sms ( short message service ), ems ( enhanced messaging service ), or mms messaging ( multimedia messaging service ), cdma ( code division multiple access ), tdma ( time division multiple access ), pdc ( personal digital cellular ), wcdma ( wideband code division multiple access ), cdma2000 , or gprs ( general packet radio service ), among others . such communication may occur , for example , through the transceiver 1468 using a radio - frequency . in addition , short - range communication may occur , such as using a bluetooth ®, wi - fi ™, or other such transceiver ( not shown ). in addition , a gps ( global positioning system ) receiver module 1470 may provide additional navigation - and location - related wireless data to the mobile computing device 1450 , which may be used as appropriate by applications running on the mobile computing device 1450 . the mobile computing device 1450 may also communicate audibly using an audio codec 1460 , which may receive spoken information from a user and convert it to usable digital information . the audio codec 1460 may likewise generate audible sound for a user , such as through a speaker , e . g ., in a handset of the mobile computing device 1450 . such sound may include sound from voice telephone calls , may include recorded sound ( e . g ., voice messages , music files , etc .) and may also include sound generated by applications operating on the mobile computing device 1450 . the mobile computing device 1450 may be implemented in a number of different forms , as shown in the figure . for example , it may be implemented as a cellular telephone 1480 . it may also be implemented as part of a smart - phone 1482 , personal digital assistant , or other similar mobile device . various implementations of the systems and techniques described here can be realized in digital electronic circuitry , integrated circuitry , specially designed asics ( application specific integrated circuits ), computer hardware , firmware , software , and / or combinations thereof . these various implementations can include implementation in one or more computer programs that are executable and / or interpretable on a programmable system including at least one programmable processor , which may be special or general purpose , coupled to receive data and instructions from , and to transmit data and instructions to , a storage system , at least one input device , and at least one output device . these computer programs ( also known as programs , software , software applications or code ) include machine instructions for a programmable processor , and can be implemented in a high - level procedural and / or object - oriented programming language , and / or in assembly / machine language . as used herein , the terms machine - readable medium and computer - readable medium refer to any computer program product , apparatus and / or device ( e . g ., magnetic discs , optical disks , memory , programmable logic devices ( plds )) used to provide machine instructions and / or data to a programmable processor , including a machine - readable medium that receives machine instructions as a machine - readable signal . the term machine - readable signal refers to any signal used to provide machine instructions and / or data to a programmable processor . to provide for interaction with a user , the systems and techniques described here can be implemented on a computer having a display device ( e . g ., a crt ( cathode ray tube ) or lcd ( liquid crystal display ) monitor ) for displaying information to the user and a keyboard and a pointing device ( e . g ., a mouse or a trackball ) by which the user can provide input to the computer . other kinds of devices can be used to provide for interaction with a user as well ; for example , feedback provided to the user can be any form of sensory feedback ( e . g ., visual feedback , auditory feedback , or tactile feedback ); and input from the user can be received in any form , including acoustic , speech , or tactile input . the systems and techniques described here can be implemented in a computing system that includes a back end component ( e . g ., as a data server ), or that includes a middleware component ( e . g ., an application server ), or that includes a front end component ( e . g ., a client computer having a graphical user interface or a web browser through which a user can interact with an implementation of the systems and techniques described here ), or any combination of such back end , middleware , or front end components . the components of the system can be interconnected by any form or medium of digital data communication ( e . g ., a communication network ). examples of communication networks include a local area network ( lan ), a wide area network ( wan ), and the internet . the computing system can include clients and servers . a client and server are generally remote from each other and typically interact through a communication network . the relationship of client and server arises by virtue of computer programs running on the respective computers and having a client - server relationship to each other . while the invention has been particularly shown and described with reference to specific preferred embodiments , it should be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
if an oxy - acetylene torch flame is directed to concrete that has been colored with yellow iron oxide , within the flame core one can quite soon see an area in which the concrete displays the characteristics of fusion ; this area is followed by a black area , then by a yellowish - white phase , again followed by black , then red , and finally by the original yellow . the concentric arrangement of these color areas around the centerpoint of the flame indicates that these color effects are temperature - dependent and also whether the surface so treated lies in the oxidizing or in the reducing areas of the flame . the effect that is desired can be made more or less pronounced by using the appropriate temperatures , that is , by burner control . additional control over the depth into which the coloration penetrates into the structural element can be exerted by the duration of the temperature effect . in addition to aesthetic criteria , the important advantage of this color formation lies in the fact that it cannot separate from a base of different kind , as this is the case with application to a bonding agent . a multicolor surface formation also entails the additional advantage that undesired color shadings , as they often occur as a result of the effects of separating agents , of vibration , and of variations in the water : cement ratio , are concealed on uni - colored surfaces . subsequent concrete treatment in the sense of surface protection can be applied at little cost and with no coloration , in the form of surface sealants or dirt - repellant waterproofing . the selection of pigments and mixtures of pigments that match with regard to their sensitivity to temperature -- for reasons of cost , usually iron oxide -- results in attractive possibilities of surface formation , be this in the way of surface shading or according to any desired scheme of ornamentation . in this regard , an individual character can be imparted to mass - produced elements , or stencils can be used to give a uniform appearance to such elements . electrical resistance heating , directly fastened to the construction element , lends itself to generate the temperature , with the heaters attached directly to the structural element so as to allow any sort of graphic structures . the most efficient radiation temperature of such resistance heaters or heating wire alloy lies around 1 , 250 to 1 , 400 k . changes in coloration are also possible by using sufficiently heated air , particularly gas - air or gas - oxygen flames . the relatively high temperatures make it possible to work fast and thus permit more superficial temperature stress in the interest of lower temperature stresses within the structural element . the possibility of varying the temperature by controlling the feed rate or the burner stand - off , as well as the reducing flame , extends the scope of the color scale that can be achieved . the multi - colored ornamentation of the contrete surface can also be influenced by its shape and contours , as on the one hand raised or depressed areas are subjected to different temperature stresses , and on the other hand the depressed areas can be covered , with sand , for example , so that the effect of the temperature is confined to the exposed areas . of course , all other possibilities for applying sufficient temperature feed , such as are known , for example , from welding technology or pyrotechnics , can also be used . a heating wire from an electrical radiant heater is applied to a cement mortar sample colored with 5 % yellow iron oxide ( relative to the weight of cement ), and then heated for 1 - 5 minutes until red hot . this will result in a red stripe on the contact surface of the yellow colored concrete . the flame of an autogenous welding torch is directed to a concrete sample colored with 5 % red iron oxide . black and yellowish - white recoloration is achieved by varying the distance between the torch and the surface of the concrete , and / or by varying the time the torch is applied onto the same place . a concrete sample colored with 5 % black iron oxide is heated with a gas torch , as in example 2 . this will generate a yellow - white color that becomes black as the heat is increased , with the black being much deeper and stronger than the original color . a concrete mixture colored with 5 % yellow iron oxide is hardened on an air - cushion wrapping foil serving as shuttering . the resulting negative impression displays depressions which are covered with sand after the piece has been placed in a horizontal position . when treated with an oxy - acetylene torch only the raised areas between the covered depressions are colored as desired . an electric resistance heating conductor is applied to a cement mortar sample colored with 5 % yellow iron oxide . in the contact area the color changes from yellow to red after a short period of action . | 2 |
aspects of the invention are disclosed in the following description and related drawings directed to specific embodiments of the invention . alternate embodiments may be devised without departing from the spirit or the scope of the invention . additionally , well - known elements of exemplary embodiments of the invention will not be described in detail or will be omitted so as not to obscure the relevant details of the invention . further , to facilitate an understanding of the description discussion of several terms used herein follows . as used herein , the word “ exemplary ” means “ serving as an example , instance or illustration .” the embodiments described herein are not limiting , but rather are exemplary only . it should be understood that the described embodiments are not necessarily to be construed as preferred or advantageous over other embodiments . moreover , the terms “ embodiments of the invention ”, “ embodiments ” or “ invention ” do not require that all embodiments of the invention include the discussed feature , advantage or mode of operation . further , many of the embodiments described herein may be described in terms of sequences of actions to be performed by , for example , elements of a computing device . it should be recognized by those skilled in the art that the various sequence of actions described herein can be performed by specific circuits ( e . g ., application specific integrated circuits ( asics )) and / or by program instructions executed by at least one processor . additionally , the sequence of actions described herein can be embodied entirely within any form of computer - readable storage medium such that execution of the sequence of actions enables the processor to perform the functionality described herein . thus , the various aspects of the present invention may be embodied in a number of different forms , all of which have been contemplated to be within the scope of the claimed subject matter . in addition , for each of the embodiments described herein , the corresponding form of any such embodiments may be described herein as , for example , “ a computer configured to ” perform the described action . referring to fig1 generally , a photographic media puzzle game played on an electronic social media network may be disclosed . the electronic social media network or game may consist of multiple devices using non - transitory computer readable mediums , such as a smart phone , tablet , or other similarly situated device to play a photographic media puzzle game . the photographic media puzzle game may consist of a first device 102 , a second device , 104 and an electronic social media network 100 . the first device 102 may operate a first non - transitory computer readable medium . the second device 104 may operate a second non transitory computer readable medium . a first device 102 may select 106 an image . the image may be a photograph taken by an electronic smart phone , tablet , or other similarly situated device that can take a photograph . the image may also be a stock image that the device may have downloaded to an electronic smart phone , tablet , or other similarly situated device . next , the first device 102 may edit 108 the image . the step of editing 108 the image may be any type of image editing options common to electronic smart phones , tablets , and other similarly situated devices known in the art such as applying a filter . next , the device may create 110 a disassembled photographic media puzzle . the device may create 110 the disassembled photographic media puzzle through manipulation on a display interface such as a touch screen . for example , the device may partition the image into unique puzzle pieces by finger swiping across a display interface . alternatively , the device may partition the image into unique puzzle pieces automatically . alternatively , the device may allow a user to manually manipulate the location , size , and type of puzzle piece . the disassembled photographic media puzzle may be stored in a first memory location . the disassembled photographic media puzzle may be an edited 108 image or it may be the original selected 106 image . the disassembled photographic media puzzle may be a matrix of any number of uniform pieces . the disassembled photographic media puzzle may be a plurality of any number of non - uniform pieces . the device may transmit 112 the disassembled photographic media puzzle by a transceiver to a second device . the transceiver may be a local area network , cell phone signal , wireless signal , or any other hardware element capable of transmitting data elements from a first memory location to a second memory location . the disassembled photographic media puzzle may be transmitted 112 across the electronic social media network to a second device 104 . the second device 104 may be a native contact of the first device 102 that may store the second devices 104 information in the contacts menu of an electronic smart phone , tablet , or any other similarly situated device known in the art . the second device 104 may receive 114 the disassembled photographic media puzzle that a first device 102 transmit 112 . next , the second device 104 may store 116 the disassembled photographic media puzzle in a second memory location . next , the second device may re - assemble 118 the disassembled photographic media puzzle into a re - assembled photographic media puzzle . the re - assembled photographic media puzzle may be verified 120 automatically on a puzzle piece by puzzle piece basis for correctness against a solution . the re - assembled photographic media puzzle may be verified 120 by displaying the re - assembled photographic media puzzle on the first device thereby allowing the first device to verify 120 the re - assembled photographic media puzzle manually . the disassembled photographic media puzzle may be automatically verified 120 for correctness against a solution on a puzzle piece by puzzle piece basis . the electronic social media network may verify the puzzle against a database of solutions . the solution may be established by the first device 102 . the solution may originate on the electronic social media network or the solution may be established by the first device 102 . referring to fig2 generally , a photographic media puzzle game on an electronic social media network may be disclosed . an at least one device 204 may be in communication with an electronic social media network 200 . the electronic social media network 200 may be in communication with an at least one non - transitory computer database 202 . the at least one non - transitory computer database 202 may physically store data elements of the electronic social media network . the at least one non - transitory computer database 202 may transmit 207 a disassembled photographic media puzzle by a transceiver . any number of optional additional devices 206 and optional computer databases 205 may be in communication with an electronic social media network 200 . the at least one device 204 may be in communication with an electronic social media network 200 such that the at least one device 204 may receive 208 a puzzle by a transceiver . the at least one device 204 may chose a disassembled photographic media puzzle based on a category , sub - category , or group of interest . additionally , the at least one device 204 may choose the difficulty of the puzzle . the difficulty may correspond to the number of unique pieces that make up the disassembled photographic media puzzle . the puzzle may have been previously disassembled by the electronic social media network or an optional additional device 206 or an optional database 205 . alternatively the disassembled photographic media puzzle may have originated from any unique location such that it may be reducible to a stored location on the electronic social media network . the at least one device 204 may re - assemble 212 the puzzle . the at least one device 204 may move pieces of the puzzle into a location by manually dragging the pieces of the puzzle into the desired virtual location on a display interface such as a touch screen . the at least one device 204 may move pieces of the puzzle through any desired form of manipulation commonly known in the art of computer , tablet , and electronic smart phone interaction . the re - assembled photographic media puzzle may be verified 214 automatically on a puzzle piece by puzzle piece basis for correctness against a solution . the disassembled photographic media puzzle may be automatically verified 214 for correctness against a solution on a puzzle piece by puzzle piece basis . the electronic social media network may verify the puzzle against a database of solutions that may be stored on the computer database . referring to fig3 , a set of instructions to play a photographic media puzzle game may be disclosed . the set of instructions may be stored and carried out by a first non - transitory computer readable medium and a second non transitory computer readable medium or any number of additional non transitory computer readable mediums . the non - transitory computer readable mediums may be a smart mobile device , smart phone , tablet , or other similarly situated device known in the art . additionally , the set of instructions may begin or resume at any unique step . the set of instructions may be limited to a single actor or multiple actors . the set of instructions may begin with starting 300 . a first device may take a photograph 302 with a camera lens . the first device may store 304 a photograph in a first memory location . the first device may manipulate 306 the electronic photograph on a first display interface . the first device may apply any filter or perform any photo manipulation or editing that may commonly be known within the art of electronic photography . next , the first device may create 308 a disassembled photographic media puzzle on a first device . the disassembled photographic media puzzle may be created from a photograph , image , or other manipulated image or photograph . the disassembled photographic media puzzle may be a matrix of any number of uniform pieces . the disassembled photographic media puzzle may be a plurality of any number of non - uniform pieces . next , the first device may transmit 310 the disassembled photographic media puzzle to a second non - transitory computer readable medium by a transceiver . the second device may receive 312 the disassembled photographic media puzzle . the second device may store 314 the disassembled photographic media puzzle . the second device may re - assemble 316 the disassembled photographic media puzzle . finally , the disassembled photographic media puzzle may be automatically verified 318 for correctness against a solution on a puzzle piece by puzzle piece basis , where each of the puzzle pieces of the re - assembled photographic media puzzle is compared to the corresponding position of a solution for correctness . the electronic social media network may verify the puzzle against a database of solutions . referring generally to fig4 , an exemplary embodiment of a disassembled photographic media puzzle may be disclosed . a device 401 may be an electronic smart phone , tablet , or any other similarly situated device known in the art . the device 401 may have a display screen 402 , an electronic camera 444 , and an electronic flash system 446 . the device may take a photograph with the electronic camera 444 . the electronic flash system 446 may or may not be used . the photograph may be used as the basis for creating a disassembled photographic media puzzle . optionally , the image used to create the disassembled photographic media puzzle may be downloaded from a database or a stock photo stored on the device . a solution may be created by storing the initial presentation of the puzzle pieces . the solution may later be used as the basis for comparison and verification of the re - assembled photographic media puzzle . groups of rectangular cells 403 through 408 may be displayed by the display screen 402 . the groups of rectangular cells 403 through 408 may represent a disassembled photographic media puzzle . the disassembled photographic media puzzle may consist of a first row of three cells 403 , a second row of three cells 405 , and a third row of three cells 407 . the disassembled photographic media puzzle may consist of a first column of three cells 404 , a second column of three cells 406 , and a third column of three cells 408 . the three rows of three cells 403 , 405 and 407 respectively in combination with the three columns of three cells 404 , 406 , and 408 respectively may be arranged such that a total of nine cells may represent a disassembled photographic media puzzle . referring generally to fig5 , an exemplary embodiment of a disassembled photographic media puzzle may be disclosed . a device 501 may be an electronic smart phone , tablet , or any other similarly situated device known in the art . the device 501 may have a display screen 502 , an electronic camera 555 , and an electronic flash system 556 . the device 501 may take a photograph with the electronic camera 555 . additionally the electronic flash system 556 may or may not be used . the photograph may be used as the basis for creating a disassembled photographic media puzzle . optionally , the image used to create the disassembled photographic media puzzle may be downloaded from a database or a stock photo stored on the device . a solution may be created by storing the initial presentation of the puzzle pieces . the solution may later be used as the basis for comparison and verification of the re - assembled photographic media puzzle . groups of rectangular cells 503 through 510 may be displayed by the display screen 502 . the groups of rectangular cells 503 through 510 may represent a disassembled photographic media puzzle . the disassembled photographic media puzzle may consist of a first row of four cells 503 , a second row of four cells 505 , a third row of four cells 507 , and a fourth row of four cells 509 . the disassembled photographic media puzzle may consist of a first column of four cells 504 , a second column of four cells 506 , a third column of four cells 508 , and a fourth column of four cells 510 . the four rows of four cells 503 , 505 , 507 , and 509 respectively and in combination with the four columns of four cells 504 , 506 , 508 , and 510 respectively may be arranged such that a total of sixteen cells may represent a disassembled photographic media puzzle . referring generally to fig6 , an exemplary embodiment of a disassembled photographic media puzzle may be disclosed . a device 601 may be an electronic smart phone , tablet , or any other similarly situated device known in the art . the device 601 may have a display screen 602 , an electronic camera 666 , and an electronic flash system 667 . the device 601 may take a photograph with the electronic camera 666 . additionally , the electronic flash system 667 may or may not be used . the photograph may be used as the basis for creating a disassembled photographic media puzzle . optionally , the image used to create the disassembled photographic media puzzle may be downloaded from a database or a stock photo stored on the device . a solution may be created by storing the initial presentation of the puzzle pieces . the solution may later be used as the basis for comparison and verification of the re - assembled photographic media puzzle . groups of rectangular cells 603 through 612 may be displayed by the display screen 602 . the groups of rectangular cells 603 through 612 may represent a disassembled photographic media puzzle . the disassembled photographic media puzzle may consist of a first row of five cells 603 , a second row of five cells 605 , a third row of five cells 607 , a fourth row of five cells 609 and a fifth row of five cells 611 . the disassembled photographic media puzzle may consist of a first column of five cells 604 , a second column of five cells 606 , a third column of five cells 608 , a fourth column of five cells 610 , and a fifth column of five cells 612 . the five rows of five cells 603 , 605 , 607 , 609 and 611 respectively and in combination with the five columns of five cells 604 , 606 , 608 , 610 , and 612 respectively may be arranged such that a total of twenty five cells may represent a disassembled photographic media puzzle . referring generally to fig7 , an exemplary embodiment of a photographic media puzzle and a corresponding messaging method of an electronic social media network may be disclosed . a first device 700 may input a first message 704 and transmit the message 710 to a second device 702 by a transceiver . the second device 702 may store 714 the first message 704 . the second device 702 may display the message 712 . the second device 702 may display the message on the display screen of any device such as an electronic smart phone , tablet , or any other similarly situated device known in the art . the first message 704 may display prior to the second devices 702 attempt to re - assemble the puzzle 716 . alternatively , the first message may be intended as an invitation to join the electronic social media network . a first device 700 may input a second message 706 and a third message 708 . the first device 700 may transmit 710 the messages to a second device 702 . the second device 702 may be a native contact of the first device 700 who may store the second devices 702 information in the contacts menu of an electronic smart phone , tablet , or any other similarly situated device known in the art . the second device 702 may store 714 the second message 706 and the third message 708 . the second device 702 may re - assemble the puzzle 716 . the disassembled photographic media puzzle may be automatically verified 718 for correctness against a solution on a puzzle piece by puzzle piece basis , each of the puzzle pieces of the re - assembled photographic media puzzle may be compared to the corresponding position of a solution for correctness . the electronic social media network may verify the puzzle against a database of solutions . correct conditional operator 720 may be a yes / no conditional operation . the yes / no correct conditional operator 720 may be an additional step that may be dependent upon the verify puzzle 718 step . if the puzzle is verified as correct against a pre - determined solution a second message 724 may be displayed . if the message is not verified as correct a third message 726 may be displayed . the first 704 , second 706 , and third 708 messages may be multimedia messages that may contain data elements that may be used to play sound and movies . the first 704 , second 706 , and third 708 messages may be multimedia messages that may contain the solution to a disassembled photographic media puzzle . the first 704 , second 706 , and third 708 messages may be hyperlinks to e - commerce websites that may reward a user for playing the social media game . the first 704 , second 706 , and third 708 messages may be hyperlinks to send an sms message to an original device or a new device . the first 704 , second 706 , and third 708 messages may be hyperlinks to any type of external computer implemented program , website , blog , or digital platform . referring generally to fig8 , an exemplary embodiment of a photographic media puzzle and a corresponding time recordation system may be disclosed . a device 800 may re - assemble 802 a disassembled photographic media puzzle , which may initiate a first time recordation 804 . after re - assembling the disassembled photographic media puzzle a verify 808 step may be performed . the disassembled photographic media puzzle may be automatically verified 808 for correctness against a solution on a puzzle piece by puzzle piece basis , each of the puzzle pieces of the re - assembled photographic media puzzle may be compared to the corresponding position of a solution for correctness . the electronic social media network may verify the puzzle against a database of solutions . correct conditional operator 810 may be a yes / no conditional operation . the correct conditional operator 810 may be an additional step that may be dependent upon the verify puzzle 808 step . if the puzzle is verified as correct against a pre - determined solution a second time recordation 805 may occur . additionally , if the puzzle is verified as correct against a pre - determined solution a calculate total time 811 step may be performed . the calculate total time 811 step may calculate the total time by determining the difference between the first time recordation 804 and the second time recordation 805 . the time may be recorded in any time display format commonly known in the art . additionally , the time may be recorded 812 and displayed 814 on a social media network database 801 . the method of display may be a leaderboard or other method to display player statistics . the leaderboard may be organized by puzzle , category , or sub category . if the correct conditional operator 810 is not correct than the system may not calculate the total time 811 and may not record the total time 812 . optionally , throughout the duration of playing the photographic media puzzle a timer conditional operator 820 may keep track of the total time a device has been re - assembling the disassembled photographic media puzzle . timer conditional operator 820 may be a yes / no conditional operator . the timer conditional operator 820 may be an additional step that may be dependent upon a pre - determined device input . the timer conditional operator 820 may be configured for any range of time . the timer conditional operator 820 may be configured by a first device or by the social media network database . if the timer conditional operator 820 is not exceeded than the timer will do nothing . if the timer conditional operator 820 is exceeded than the game may end . the foregoing description and accompanying figures illustrate the principles , preferred embodiments and modes of operation of the invention . however , the invention should not be construed as being limited to the particular embodiments discussed above . additional variations of the embodiments discussed above will be appreciated by those skilled in the art . therefore , the above - described embodiments should be regarded as illustrative rather than restrictive . accordingly , it should be appreciated that variations to those embodiments can be made by those skilled in the art without departing from the scope of the invention as defined by the following claims . | 0 |
the system and devices of the present invention are useful to isolate and protect a piece of equipment , or other structure , from shocks and vibration , including those associated with seismic activity . as an example , fig1 illustrates a portion of a telecommunications antennae structure 10 that is disposed on a support surface 12 . the depicted arrangement is representative of the placement of such antenna structures on the rooftops of buildings . it is an object of the invention to reduce or dampen the amount of vibration or shocks that are transmitted from the support surface 12 to the antenna structure 10 . the antenna structure 10 has a central mounting shaft 14 with three support legs 16 , 18 , 20 that support the mounting shaft 14 . as can be seen , each of the legs 16 , 18 , 20 has a circular base plate 52 at its lower end . the base plate 52 is the portion of the structure 10 that is ground - contacting , or intended to contact the ground or support surface 12 . base plates of this type are described in u . s . pat . no . 5 , 816 , 554 entitled “ equipment support base ” and issued to mccracken . that patent is incorporated herein by reference . the base plates 52 each reside within a seismic isolation pad 22 which is disposed upon the support surface 12 . the seismic isolation pads 22 may have one of several constructions , which are understood with reference to fig2 - 6 and the following descriptions . these different constructions are described separately as pads 50 , 70 and 90 . fig2 depicts a first seismic isolation pad 50 that is used to isolate and protect base plate 52 . the substantially square isolation pad 50 is formed of a resilient , energy absorbent material . preferably , the pad 50 is formed of molded elastomer . in a currently preferred embodiment , the pad 50 is made up of crumb rubber that is compression molded . it has been found that this type of material is readily available from recycled tires and can be easily compression molded and formed . additionally , the crumb rubber may be easily colored using dyes or paints during the molding process . the pad 50 has a substantially flat base portion 54 upon which the base plate 52 is seated . the base portion 54 of the pad 50 has a thickness of approximately 1 inch . an upwardly protruding flange 56 is disposed along the perimeter of the pad 54 , thereby making the base portion 54 recessed with respect to the flange 56 . the lower portion of fig2 is a partial cutaway with a portion of the flange 56 not visible . it is preferred that the pad 50 be sized so that there is always a slight gap between the inner wall 58 of the flange 56 and the outer edge 60 of the base plate 52 . the flange 56 preferably has a height ( as measured upwardly from the base portion 54 ) of 1 inch . the flange 56 helps ensure that the base plate 52 does not inadvertently slide off of the pad 50 . the pad 50 has four comer portions 62 . there are perforations , scoring or other lines of structural weakness 64 disposed within the material of the pad 50 so that the corner portions 62 may be easily broken away and removed from the pad 50 . one of the four corner portion 62 is shown broken away in fig2 . when the corner portions 62 are removed , openings 66 ( one shown ) are formed that allow water within the pad 50 to drain out of the interior of the pad 50 . fig3 a and 4 depict an alternative , and currently preferred , isolation pad 70 that is also being used to isolate and protect a base plate 52 . the pad 70 is similar in many respects to the pad 50 described previously . there are some differences , however . the pad 70 includes a recessed base portion 72 having a substantially flat surface from which a number of frustoconical support cones 74 project upwardly . one of the support cones 74 is shown in cross - section in fig3 a . it is preferred that the support cones 74 be integrally molded with the base portion 72 during fabrication of the pad 70 . each of the support cones 74 has a tapered side surface 76 and a flat top surface 78 upon which the base plate 52 or other structure may rest . the lower end of each support cone 74 is wider than the upper end by virtue of the tapered side surface 76 . in the currently preferred embodiment , the upper end of the cone 74 has a diameter of one inch while the lower end of the cone 74 has a diameter of 1¼ inches . like the first isolation pad 50 , the isolation pad 70 has a flange 80 that surrounds the perimeter of the pad 70 . in a currently preferred embodiment , the flange 80 has a total height ( as measured from its top end to its bottom end ) of four inches . the base portion 72 has a thickness of 1 inch and each of the support cones 74 has a height of 1½ inches . breakaway corner portions 82 , similar to the corner portions 62 are provided as well to allow drainage of the pad 70 . unlike the pad 50 , the pad 70 contains a sheet 84 of reinforcing material that is embedded or molded into the base portion 72 . the sheet is formed of a woven cloth material to resist tensile forces that might tend to rupture the pad 70 . the pad 70 is also sized so that a gap is provided between the inner surface 86 of the flange 80 and the outer rim 60 of the base plate 52 . the base plate 52 , therefore , rests entirely on the support cones 74 of the pad 70 . fig5 and 6 illustrate a third exemplary embodiment for an isolation pad 90 . the isolation pad 90 is actually an assembly of three separate components and , thus , is illustrated using an exploded view . the pad 90 includes a base pad member 92 , dowel plate 94 and cover pad 96 . the base pad member 92 and cover pad 96 are both formed of the same resilient shock absorbent material as the pads 50 and 70 described earlier . the dowel plate 94 is formed of wood , metal or another rigid material . the base pad 92 is the part of the isolation pad 90 that rests on the support surface . the base pad 92 includes a square , recessed central area 98 and a raised lip 99 that surrounds that recessed area 98 . the base pad 92 is the part of the isolation pad 90 that rests on the support surface . the base pad 92 includes a square , recessed central area 98 and a raised lip 99 that surrounds that recessed area 98 . the dowel plate 94 has a flat plate portion 100 and a centrally located dowel 102 that projects upwardly from the plate portion 100 . the cover pad 96 has a centrally located aperture 104 through which the dowel 102 is disposed when the cover pad 96 is placed over the dowel plate 94 . when the pad 90 is assembled , the dowel 102 projects upwardly and is disposed through the central cavity 108 of base plate 52 and fit within the center 110 of a support leg 112 . ( see fig5 ). in this manner , the dowel 102 contacts at least the leg 112 of the supported structure and stabilizes it with respect to the support surface below . in use , individual base plates 52 or other ground - contacting portions of a structure to be isolated are disposed upon pads having constructions such as those shown in fig2 - 5 . shocks and vibrations are substantially absorbed by the pads . a plurality of pads are placed under a plurality of ground contacting portions of a machine or other load in order to provide a system that will isolate the machine or load from the support structure as well as environmental shocks and vibrations . the ground - contacting portion of the supported structure is stabilized with respect to the pad by a structure on the pad itself to help ensure that the structure does not indvertently slide off of the pad . when pads having the construction of the pads 50 or 70 are used , the side flanges 56 , 80 help to stabilize the base plate 52 . when the pad 90 is used , the dowel 102 stabilizes the base plate 52 . the pads 50 , 70 and 90 are modular , preformed and lightweight . they are also essentially maintenance - free . the pads may be easily stacked and transported . while the invention has been shown or described in only some of its forms , it should be apparent to those skilled in the art that it is not so limited , but is susceptible to various changes within departing from the scope of the invention . | 5 |
liquid sealant compositions that may be dispensed according to this invention include polymeric components as stated above of a thermoplastic , thermosetting , plastisol or organosol nature . a &# 34 ; thermoplastic material &# 34 ;, as that term is used and understood to those skilled in the art , includes any natural or synthetic thermoplastic polymer or polymeric composition . a thermoplastic material is a normally solid or semi - solid material at use temperatures and it melts or liquifies upon heating to a higher temperature . upon cooling , the material solidifies or returns to a solid or semi - solid state . as also used in this description , the term &# 34 ; thermoplastic hot melt adhesive &# 34 ; or &# 34 ; hot melt adhesive &# 34 ; is a term which is well known in the art and this material has the same characteristics of liquification upon heating and , upon cooling , solidification to a solid , semi - solid or tacky state . a &# 34 ; thermosetting material ,&# 34 ; as that term is used and understood to those skilled in the art , includes any natural or synthetic thermosetting polymer or polymeric compositions . thermosetting resins are often liquids at some stage of processing , which are cured by heat , catalyst or other chemical means . after being fully cured , thermosets are substantially infusible and insoluble and cannot be liquified by heat . examples of thermoplastic materials include polymers of ethylenically unsaturated monomers , such as polyethylene , polypropylene , polybutylenes , polystyrenes , poly α - methyl styrene ), polyvinyl chloride , polyvinyl acetate , polymethyl methacrylate , polyethyl acrylate , polyacrylonitrile and the like ; copolymers of ethylenically unsaturated monomers such as co - polymers of ethylene and propylene , ethylene and styrene , and polyvinyl acetate , styrene and maleic anhydride ; styrene and methyl methacrylate ; styrene and ethyl acrylate ; styrene and acrylonitrile ; methyl methacrylate and ethyl acrylate and the like ; and polymers and copolymers of conjugated dienes such as polybutadiene , polyisoprene , and polychloroprene . examples of thermosetting materials useful in this invention include synthetic butyl rubbers , synthetic isoprene rubbers , silicone rtv ( room temperature vulcanizing ) rubbers , styrenebutadiene rubber , ethylene - propylene - diene rubber , acrylonitrile - styrene - butadiene rubber and the like ; saturated and unsaturated polyesters including alkyds and other polyesters ; nylons and other polyamides ; polyesteramides and polyurethanes ; chlorinated polyethers , epoxy polymers , cellulose esters such as cellulose acetate butyrate , and the like . these materials can have viscosities extending above 1 , 000 , 000 cps . the term &# 34 ; thermoplastic material &# 34 ; is sometimes used herein interchangeably with &# 34 ; hot melt ,&# 34 ; &# 34 ; melt ,&# 34 ; &# 34 ; hot melt thermoplastic &# 34 ; or &# 34 ; hot melt adhesive .&# 34 ; it is , of course , to be appreciated that all these compositions are characterized by their thermoplastic nature as above defined . examples of thermoplastic or hot melt adhesive compositions having markedly different viscosities ( as measured by the brookfield viscometer ) employed in the operating examples which follow are conventional polyethylene - based adhesive compositions . another example of a thermoplastic material is a polyisobutylene - based thermoplastic sealing and caulking material sold by tremco company under the name tremco butyl sealant js - 792 . this material has a viscosity in the range of 740 , 000 cps at 375 ° f . and 970 , 000 cps at 350 ° f . an example of a thermosetting material is a relatively highly viscous polymer material , dow corning 732 rtv manufactured by dow corning company , which is a thermosetting rtv silicone rubber . another class of liquid polymeric compositions which may be dispensed with apparatus of this invention includes plastisols or organosols . a plastisol is a suspension or dispersion of small particles of a polymeric substance in a liquid plasticizer for the polymeric substance . a plastisol contains no volatile thinners or diluents . plastisols often contain stabilizers , fillers and pigments , but all ingredients have low volatility during processing and end use . as mentioned above , vinyl plastisols are widely used as autobody sealants presently and are fused by heating usually coincidentally with paint baking . closely associated with plastisols are organosols . organosols are dispersions extended with organic volatiles which are removed during fusion of the polymeric material . the most commonly useful polymeric substance for plastisols is polyvinyl chloride and its copolymers such as vinylacetate , acrylate and maleate . further examples of plastisol systems include polyvinyl butyral , cellulose acetate butyrate , polyvinylidene fluoride , polymethyl methacrylate and others form the list of polymers described above . a reference on plastisol and organosol compositions in general , for inclusion herein , is &# 34 ; plastisols and organosols &# 34 ;, edited by herald a . savetnick , van nostrand reinhold company , 1972 library of congress catalog no . 75 - 151258 , chapter 6 , pages 83 - 105 . in addition to the variability in polymer formulations , different types of gases may be employed in the practice of this invention including air , nitrogen , oxygen , carbon dioxide , methane , ethane , butane , propane , helium , argon , neon , fluorocarbons such as dichlorodifluoroethane and monochlorotrifluoromethane , or other gases , or mixtures of any of these gases . such gases can be varied again according to the types of polymeric materials and other additives employed . referring now to fig1 of the drawings , a schematic illustration of a system for performing the method of this invention is shown . this apparatus employs a pump 10 capable of delivering the polymeric material from a bulk source such as a bucket or barrel 11 at a metered rate from about 10 to 1 , 000 pounds per hour at a pressure normally in the range of 500 to 1 , 200 psig but of up to 5 , 000 psig without doing an undue amount of work on the polymeric material thus avoiding raising the polymer temperature . a suitable pump is a double acting piston pump driven by an air motor 13 , such as a johnstone pump . however , any pump capable of providing sufficient pressure to pump the material from the bulk container 11 is suitable . the pump 10 is fitted with a device such as a linear potentiometer 14 to generate a signal proportional to polymer flow rate . the material to be foamed is conveyed through line 16 , which may be a hose capable of conveying liquid material under pressure , through an accumulator 17 to the upstream or inlet end 19 of a disk mixer 18 where it is injected into the mixer . the foaming gas is supplied to the disk mixer 18 from a pressurized gas supply through a gas line 20 . a gas metering valve 22 and a differential pressure valve 24 in line 20 permit control of gas pressure and flow rate to the mixer 18 independent of system pressure and proportional to polymer flow rate . a suitable valve 22 is a model 5850e flow controller manufactured by brooks instrument division , emerson electric co ., hatfield , pa . the gas is supplied to the mixer 18 close to the polymer material inlet 119 . a check valve 25 prevents flow of polymer material into line 20 . the polymer and gas are introduced to the mixer 18 at an elevated pressure , e . g ., 500 to 1 , 200 psig . the gas flow path 20 introduces gas bubbles into the mixer close to the line 16 supplying the polymeric material to the mixer 18 such that the gas and polymer enter the mixer together and completely fill it for placing the gas into solution in the polymer in the mixer . mixer 18 is driven by a motor and reducer 26 controlled by a standard motor controller 28 . at the downstream end of the mixer 18 is an outlet 30 through which the polymer / gas solution passes out of the mixer through a line 32 to a dispensing nozzle 34 . the temperature of the polymer / gas solution exiting the mixer is monitored by a thermocouple 36 . the temperature of the mixer may be controlled by circulating cooling water through a jacket 37 ( fig2 ) surrounding the mixer 18 as controlled by a valve 38 responsive to a valve input signal from the thermocouple 36 . generally , the materials described above are unaffected by a temperature rise of up to 20 ° f . and can withstand a 30 ° to 50 ° f . temperature rise . coolant can be used to maintain these parameters . referring now to fig2 and 3 , the construction of the disk mixer 18 is shown in detail . the mixer 18 comprises a tubular housing or barrel 40 which is supported on a mount by means of bolts ( not shown ). extending along the long axis of the housing 40 is a shaft 46 . downstream and upstream end caps 48 and 50 , respectively , are secured to the respective opposite ends of the housing 40 by suitable means such as bolts 52 . the end caps 48 and 50 close the housing 40 ends and include suitable thrust bearings 54 and journals 56 for supporting the shaft 46 for rotation . since the interior of housing 40 is under pressure and since some applications such as the foaming of hot melt adhesives takes place at elevated temperatures , e . g ., 350 ° f . or higher , the seals must be able to withstand these elevated pressures and temperatures without leaking . alternatively , small grooves can be placed in the shaft 46 to pump material back to chamber or center core 47 . as shown in fig1 the shaft 46 is driven by an electric motor through a reducer 26 . a constant rpm controller 28 can be used to control motor speed . in this specific embodiment , which is for purposes of illustration and not by way of limitation , the shaft 46 is machined to provide a series of spaced disks 58 which are substantially perpendicular to the axis of the shaft 46 . as best seen in fig3 the disks 58 have a series of spaced teeth 60 on the outer circumference separated by slots 62 . moreover , the teeth 60 extend substantially almost to the inner wall 64 of the housing 40 creating individual spaced compartments between the teeth 60 , the slots 62 , and the housing wall 64 while permitting rotation of the shaft and disks within the housing 40 . operation of the drive motor 26 causes rotation of the shaft 46 which in turn causes rotation of the spaced disks 58 and movement of the teeth 60 and slots 62 with respect to the fixed housing inner wall 64 . the polymeric material enters the housing 40 through a port 19 in the upstream end of the housing communicating with the center bore 47 of housing 40 . line 16 is connected to port 19 by a suitable fitting ( not shown ). the foaming gas delivered to the housing through line 20 enters through an opening ( not shown ) in the housing wall close to port 19 . line 20 is connected to the opening by a suitable pressurized hose fitting . a material outlet port 30 extends through the housing wall 40 at the downstream end of the housing . the port 30 is connected with line 32 and permits the polymer material having gas mixed in solution and being under pressure in the housing 40 to exit the mixer 18 and be conveyed to the dispensing nozzle 34 . the housing 40 may be cooled if desired , for example , by circulating cooling water through the space 70 between the jacket 37 and the outer wall of the housing 40 . ports 72 , 74 may be provided for cooling water inlet and outlet , respectively . alternatively , in sealant applications requiring heating of the polymeric material , e . g ., in foaming hot melt adhesive seals , the jacket 37 may be removed and band heaters applied for heating the housing 40 to a desired temperature . in operation of this embodiment of the invention , the gas and the polymeric material ( e . g . vinyl plastisol ) are introduced into the mixer 18 under a pressure in the range from about 500 to 1200 psi . the disks 58 are rotated at a speed of 50 to 200 rpm , preferably in the range of 100 to 200 rpm . as the gas comes into contact with the rotating disks , several phenomena occur . first , as the gas bubbles hit the the teeth 60 , they are broken up into smaller bubbles . second , as the gas and the polymer enter and pass through the slots 62 between the teeth 60 , which form small chambers rotating with respect to the fixed inner wall 64 of the housing 40 , the gas and polymer material are sheared . this action continues as the gas and polymer pass along the length of the housing . third , as the gas / polymer mixture continually enters and exits subsequent downstream disks as it passes through the housing bore 47 , it is cut , sheared , and twisted to provide a high interfacial area between the gas and the polymer . at the end of the mixer outlet 30 , the gas is thoroughly mixed and in solution with the polymer . although the accompanying figures show the orientation of the mixer to be one where the shaft on which the disks are mounted is substantially horizontally disposed , that particular orientation is not critical . the mixer could be on a vertical axis with either the upstream or downstream end at the higher elevation or in any orientation therebetween since the polymer material fills the interior of the housing . a disk mixer as shown in fig2 and 3 was employed to foam automotive body sealant compositions . the disk mixer was built of 41l40 steel . the length of the bore 47 was 8 inches , and the bore 47 had a radius of 1 . 008 inches . the housing had an external water jacket 37 permitting it to be cooled in the range of 30 ° to 70 ° f . polymer material inlet temperatures were in the range of 65 °- 70 ° f . the shaft 46 extended through the barrel 40 , as shown in fig2 of the drawings . the shaft diameter ( 2 ) was 1 . 5 inches . the shaft 46 included sixteen steel disks 2 . 0 inches in diameter and 0 . 25 inch in disk width ( 6 ). the groove width ( 7 ) between disks was 0 . 25 inch and the groove depth ( 9 ) was also 0 . 25 inch . each disk had 15 teeth and 15 slots referring to fig3 the slot depth ( 3 ) was 0 . 125 inch and the slot width ( 12 ) was 0 . 356 inch . the clearance ( 8 ) between the teeth 60 and the wall 64 was 0 . 008 inch . fifteen percent of the disk circumference was comprised of the land area of the teeth 60 . the shaft was driven by an electric motor operated typically at about 0 . 25 horsepower . the shaft was typically rotated in the 100 to 200 rpm range . all materials were foamed with n 2 gas . the polymer material and gas were introduced into the mixer at a pressure in the range of 500 to 1000 psi . the material was delivered to a nozzle for dispensing which varied between 0 . 060 and 0 . 125 inch in internal diameter and 0 . 5 and 3 inches in length depending on the material and pressures involved . using the apparatus described immediately above , a white silicone rtv sealant sold by stouffer - wacker silicone co . under the designation 931 was foamed under the following conditions set out in table i . table i______________________________________flow rate ( g / min ) 87 . 5power ( hp ) . 171power ( cal / min ) 1 , 800torque ( in - lb . sub . f ) 108pressure mixer inlet ( psig ) 688pressure mixer outlet ( psig ) 679pressure loss ( psig ) 9pressure at pump outlet ( psig ) 714pressure at gun inlet ( psig ) 583sealant temp . @ mixer inlet (° f .) 69 . 6sealant temp . @ mixer outlet (° f .) 68 . 8temperature rise (° f .) - 0 . 8 * cooling water @ mixer inlet (° f .) 60 . 0cooling water @ mixer outlet (° f .) 60 . 9temperature rise coolant (° f .) 0 . 9approximate water flow ( 1 / min ) 3 . 7approx . calories to coolant ( cal / min ) 1 , 870______________________________________ * due to cooling water . table ii shows the results of foaming different commercially available polymers with the mixer shown in fig1 - 3 . in each case the resulting product was a continuous , creamy , very homogenous foam with fine cells contained therein for forming the automotive body seam seals of this invention . table ii______________________________________ max . density output reduction ( lbs / hr .) ______________________________________ii . dow corning 732 rtv 50 % 65 siliconeiii . tremco spectrem 2 rtv 57 % 65 siliconeiv . tremco proglaze rtv 45 % 65 siliconev . stouffer - wacker silicone co . 60 % 65 930 series rtv siliconevi . essex chemical co . 70 % 65 polyurethane b390vii . allied koch materials inc . 50 % 65 products 8040 or 8082 pvc plastisolviii . ohio sealer corp . 50 % 65 product 2278 pvc plastisolix . protective treatments inc . 50 % 65 product e - 642 pvc plastisol______________________________________ the foams produced by the method and apparatus above described may be injected or foamed in place to seal the seams and / or cracks in an automotive body and , as used herein , and in the claims the term &# 34 ; seam &# 34 ; is meant to cover all such body openings . with reference to fig4 a - d , types of automotive body joints are shown . fig4 a shows a partial plan view of metal body sheets 6 spot welded together leaving gaps 7 in between the welds 6a . the gaps 7 need to be sealed at 8 to keep out dust , moisture and noise . fig4 b is a cross - sectional view of a gap 7 and the foam seal 8 representative of a coach joint with only a small number of actual closed cells containing gas represented in magnified form at 9 . fig4 c - d are similar to 4b except they are modified profiles of a lap joint and a butt joint , respectively , with the closed cell foam seals 8a shown in each gap 7a for metal body sheets 6b . utilizing the system and apparatus shown in fig1 - 3 , viscous foam sealant materials are dispensed onto welded seams or joints of the types shown in fig4 a - d of an automobile . in a most preferred form , as mentioned above , the system of u . s . pat . no . 4 , 682 , 711 is used for dispensing the viscous sealant material from the mixer of fig2 - 3 . the system of the mentioned u . s . pat . no . 4 , 682 , 711 is not shown , but detailed reference may be had thereto and , as stated above , such disclosure is incorporated herein by reference because this system allows uniform application of material resulting in the greatest material savings over other types of application methods . of course , other methods of application may be employed ; for instance , by manual means or by robots with extrusion guns . in addition , the foam sealant can be applied manually with extrusion guns . as developed above , plastisol compositions are currently widely employed , but not foamed for sealing seams . using the method and apparatus described above , vinyl plastisols may be formed into closed cell foam seams for automotive body joints . as a bead is extruded in place into the seam or joint from a dispensed solution , it foams . the bead is controlled to the desired width and amount for filling the seam . foaming takes place by expansion of the gas ( n 2 ) from solution . gas is trapped in the matrix of the polymer to provide a fine closed cell structure and the foam expands to fill the seam . where the foaming composition is a vinyl plastisol or elastomer , the foam is flexible or elastomeric . a number of advantages are secured . considerable reduction in quantity of sealant materials is achieved without sacrificing sealant effectiveness . weight reduction and reduction in material usage by foams having 50 % by volume cell structure also produces cost savings . better seam filling properties are obtained with the closed cell foam seal construction because foaming in place allows for a slight expansion to fill seams more effectively . furthermore , curable plastisol or elastomeric seam compositions may be foamed and foam curing with expansion to fill seams can be achieved coincidentally with oven paint curing processes currently employed . viscosities of foamed polymeric sealants are lowered and hence greater seam penetration is obtained in the automotive joints . having described this invention , its various parameters and best mode of operation , other modifications will become apparent to a person of skill in this art , and such are within the scope hereof . | 1 |
fig1 depicts an exemplary layout of the delivery end of a rolling mill producing hot rolled steel bars . the hot rolled product is delivered from the rolling mill ( not shown ) along a path 10 leading to shears 12 which serve to crop and subdivide the product into customer lengths . the subdivided lengths are then subjected to cooling in a water box 14 before being alternately directed by a switch 16 to one or the other of two pouring reels 18 which form the product lengths into upstanding coils at a coil forming station a . a rotary table 20 then transfers the coils to the first leg 22 a of a conveyor system 22 defining a transport path . the conveyor system comprises a series of individually driven conveyor sections indicated typically at 24 which preferably will comprise short roller tables . because the conveyor sections are individually driven , their transport speeds can be adjusted to accommodate a wide range of thermal treatments for the product coils . a rotary roller table 26 serves to transfer the coils from the conveyor leg 22 a to a second perpendicular leg 22 b leading through a heat treating station b . with additional reference to fig2 , it will be seen that station b includes a tunnel enclosure 28 internally provided with a series of forced air cooling installations 30 . at each installation 30 , a motor driven fan 32 serves to drive ambient air through a duct 34 upwardly into the interior of a coil 36 . at station a , each coil is formed around a central stem 36 projecting upwardly from a pallet 40 on which the coil is supported . the stem 36 provides a central support which lends stability to the coil as it progresses along the transport path . a vertically adjustable louvered cap 42 serves to redirect the air flow radially outwardly through the coil , and external louvers 44 in the tunnel walls and roof serve to further control air flow . an external drive 46 serves to manipulate the louvers over a range of adjustments between fully open and fully closed positions . with the louvers 44 fully open and the fans 32 in operation , the coils 36 are subjected to cooling at an accelerated maximum rate . conversely with the fans 32 shut down and the louvers 44 closed , the coils undergo retarded cooling at a greatly reduced minimum rate . a myriad of cooling rates are possible between these two extremes . with reference again to fig1 , side shift transfer cars 48 receive the coils from station b and serve either to transfer them to any one of several processing lines 50 a , 50 b , 50 c , and 50 d at a second heat treating station c , or to bypass station c and transfer the coils to a conveyor leg 22 c which leads to remote hook carriers and packaging equipment ( not shown ). side shift transfer cars 49 receive coils from the process lines 50 a , 50 b , 50 c , and 50 d and also serve to convey them to the conveyor leg 22 c . it will be seen from fig3 that the processing lines 50 a , 50 b , 50 c , and 50 d each comprise louvered tunnel enclosures of the type provided at station b , but without associated cooling stations fed by forced air fans . for illustrative purposes , the louvers of processing line 50 a are shown fully open , those of processing line 50 b are shown partially open , and those of processing lines 50 c and 50 d are shown fully closed . these different adjustments respectively achieve progressively slower cooling rates . by subdividing the conveyor system into individually driven segments , transport times between heat treating stations can be different from and beneficially faster than the transport times through the stations , the latter times being selected to coact with the rate of cooling at each station in order to achieve desired metallurgical properties in the coiled products . thus , as shown in fig4 , the transport time t 1 between heat treating stations a and b can be relatively brief in order to limit uncontrolled cooling during that interval . the transport time t 2 through station b can be selected to achieve the desired metallurgical objective , and transport time t 3 between stations b and c can again be beneficially brief . transport time t 4 at station c can be prolonged to again achieve the desired metallurgical objectives , and transport time t 5 can be selected to dovetail with prior process steps and to insure that the coils are delivered in a timely and coordinated sequence to the downstream hook carriers and packaging equipment . in a typical mill environment , and by way of example only , hot rolled steel bar products are received along path 10 at temperatures on the order of 1000 ° c . the products are formed into coils at station a at temperatures ranging from 800 °- 1000 ° c ., and are cooled to temperatures of about 600 °- 700 ° c . at station b . retarded cooling at rates of between 0 . 2 ° to 0 . 5 ° c ./ sec . may then take place at station c for extended periods of up to twenty four hours . in light of the foregoing , it will be understood by those skilled in the art that the layout shown in fig1 is merely exemplary and is not intended to be limiting in the number and type of equipment components , the manner in which they are arranged , or their method of employment . although the conveyor system has been shown as a series of individually driven roller tables , other individually driven segments such as short chain conveyor sections and short carryover beam sections could serve as equivalents . similarly , although the tunnel enclosures have been shown with louvered openings , other mechanisms for adjusting the openings could serve as equivalents , non limiting examples being slidable doors , mutually slidable foraminous plates , etc . also , for certain metallurgical treatments , heat may be added to the tunnel enclosures , either to further retard cooling rates or to maintain a desired soaking temperature for prolonged periods . | 2 |
the compositions contain as a pyrethroidal active ingredient 1stransr - alpha - cyano - 3 - phenoxy - benzyl - 3 -( 2 , 2 - dichlorvinyl )- 2 , 2 - dimethyl - cyclopropane carboxylate of the formula i ## str4 ## and tetramethrin or trans - tetramethrin of the formula ii ## str5 ## and optionally a further pyrethroidal substance as well as piperonyl butoxide of the formula iii and , optionally , additives . ## str6 ## the compound of the formula i amounts to 0 . 1 - 20 % by weight and the compound of the formula ii to 0 . 05 - 10 % by weight and the piperonyl butoxide of the formula iii amounts to 0 . 1 - 40 % by weight . the remaining amount up to 100 % consists of additives . the composition according to the invention may be used in all those locations wherein only such substances may be applied which are substantially not toxic to warm - blooded organisms , such as agricultural and horticultural pests , i . e . pests occurring in the preserved food industry and refrigerating industry . various parasitic arthropodal pests cause significant harm in stock breeding . by disquieting the animals the pests cause a reduction of their yield capacity , their gain in weight , they disturb their behavior and their technology tolerance , increasing thereby the number of compulsory slaughterings . significant yield losses are caused by the storage arthropoda as well , and this is worsened by the fact that these crops are already produced ( i . e . costs are already involved ) and the protection is needed for the entire storing period during the utilization of the crops to avoid the presence of substances harmful to a man and animals . during the protection against diseases propagated by various arthropoda such as malaria , yellow fever , sleeping fever , dysentery , plague , it is important that only such agents may be applied which are not toxic to warm - blooded organisms , are nontoxic dermally , and do not cause dermal irritation and allergy . as the most widely used insecticides are neuroactive substances ( nerve poison ), the function of nerves is damaged in both lower and higher animals ( f . matsumura : differential toxicities of insecticides and halogenated aromatics , pergamon press 1984 ). consequently , the selectivity of most of the compositions is not sufficient . the compositions according to the invention have an outstanding activity against the following pests : flies such as hydrotaea irritans , morellia simples , m . horitorum , haematobla spp ., stomoxys calcitrans , musca domestica , m . autumnalis , glossina app ., simulium spp ., culicoides , phlebotomus spp ., tabanidae ; fleas such as xenopsylla spp ., pulex spp ., ctenocephalides app ; bugs such as cemex spp ., iriatoma spp ., rhodnius spp ., triatoma spp ; lice such as pediculus spp ., phthirius pubis , damalinia , haematophinus ; ticks or mites such as ixodes , sporoptes spp ., scabiei ; mosquitoes such as anopheles spp ., aedes spp ., culex spp ., mansonia spp . ; cockroaches such as blattella germanica , blatta orientalis , periplaneta americana , periplaneta australasie , supella longipalpa ; various storage pests such as iribolium spp ., trogoderma spp ., stegobium spp ., sitophilus spp ., ienebrio spplk , stagobium paniceum , sitotroga cerealella , zaorotes subfasciatus , rhyzopertha dominica , ptinus spp ., cryzaephilus surinamensis , o . mercator , lasioderma serricorne , necrobia spp ., dermestes spp ., carpopohilus spp ., dryptolestes spp ., mezium spp ., alphitobius diapersinus , a . laevigatus , callosobruchus spp ., bruchus spp ., anthrenus verbasci , ephestia spp ., plodia interpunctella , acaris siro , tyrophagus putres , t . centiale , t . longinor , tyrolichus casei and ; agricultural pests belonging to genera lepidoptera , coleoptera , heteroptera , homoptera , hymenoptera , diptera and acariformes . a preferred form of the composition according to the present invention contains as a further active ingredient 1rtranss - alpha - cyano - 3 - phenoxy - benzyl - 3 -( 2 , 2 - dichlorvinyl )- 2 , 2 - dimethyl - cyclopropane - carboxylate in an amount of 0 . 1 - 20 % by weight . the ratio of 1stransr to 1rtranss amounts to 0 . 7 - 1 . 3 : 1 . 3 - 0 . 7 , preferably 1 : 1 . we have now found that 1stransr isomer hitherto considered to be the least active of the 4 trans isomers of cypermethrin can be transformed to a synergistic active and stable composition when combined with tetramethrin and piperonyl butoxide . thus the advantages of the very low toxicity against warm - blooded animals can be utilized and outstanding selective arthropodicidal composition may be prepared . the data relating to synergistic compositions are shown in table 1 . table 1______________________________________interaction of transmix isomers and piperonyl butoxideon house fly ( musca domestica ) tested by topical method activity without activity withisomers and pbo pboactive ingredient ld . sub . 50m ( 1 : 2 ). sup . xmixtures resp . ng / fly ng / fly sf______________________________________1rtranss 5 . 78 4 . 58 1 . 261stransr 571 . 50 278 . 62 2 . 05trx 6 . 70 3 . 76 1 . 78trx + tet ( 10 : 1 ) 8 . 02 2 . 97 2 . 70trx + tet ( 10 : 5 ) 8 . 41 2 . 87 2 . 93______________________________________ x = calculated to trans cypermethrins as excipients anionic tensides , such as calcium alkyl aryl sulfonate , calcium dodecyl benzene sulfonate or non - ionic surfactants such as nonyl or dinonyl phenol ethoxylates ( eo = 16 - 20 ) are used . the composition may contain further non - ionic components such as tristyryl phenol ethoxylates ( ed = 20 ) etc . as a filling agent the composition may contain solvents such as xylene , aromatic solvent mixture , aliphatic hydrocarbon mixtures , alkyl benzene , mineral or vegetable oil and solid carriers . in order to prepare emulsifiable compositions anionic tensides , non - ionic surfactants and other non - ionic components and solvents are preferable admixed to the mixture . as anionic tensides 2 to 5 % by weight of calcium alkyl aryl sulfonate , and as non - ionic surfactant 1 to 2 % by weight of nonyldinonyl phenol ethoxylates ( eo = 16 - 20 ) and as further non - ionic components 0 . 5 - 2 % by weight of tristyryl phenol ethoxylates ( eo = 20 ) and as the solvent xylene may preferably be used . a transparent emulsifiable composition may be prepared by using as anionic tenside 2 . 5 - 9 % by weight of a calcium salt of alkyl aryl sulfonate , and as non - ionic surfactant 1 . 25 - 3 . 5 % by weight of nonly -, dinonyl phenol ethoxylates ( eo = 16 - 20 ) and as further non - ionic component 0 . 7 - 3 . 5 % by weight of tri - styryl phenol ethoxylates ( eo = 20 ) and as solvent preferably 5 - 10 % by weight of xylene , 1 - 3 % by weight of ethylene glycol and water up to 100 % by weight . wettable powders can also be prepared by adding dispersing agents and carriers . according to a preferred feature as dispersing agent 1 - 2 % by weight of dioctyl sulfosuccinate and 6 - 8 % by weight of polymerized sodium naphthalene sulfonate and as carrier silicic acid and talc may be used . pests to be found at the waterside or in large fields , such as mosquitoes , can be combatted by using the composition according to the invention in ulv form by aeroplane or helicopter spraying . such compositions contain apart from the active ingredient an aliphatic hydrocarbon mixture and mineral or vegetable oil at a ratio of 1 : 100 - 1 : 2 as filling agent . the composition of the invention can be formulated according to other methods as well , such as hungarian patent applications nos . 3245 - 87 , 3246 - 87 , 4975 - 87 , 4974 - 87 . the active ingredients may be prepared by methods known per se such hu - ps 152 558 and epa 86900 830 etc . known pyrethroidal combinations are e . g . mixtures of permethrin and decamethrin ( ep no . 5826 ) and mixtures of permethrin and tetramethrin ( hu - ps 184 614 , dos 2704 066 ). the compositions of the present invention are more efficient than the known compositions and are also active against certain strains which are resistant to said known compositions ( see biological example 3 .). the details of the invention can be illustrated by the following non - limiting examples . test animal : in laboratory cultivated 3 - 5 day old female house fly ( musca domestica ) who / srs images . the active ingredient and n - butenol or ethoxy ethanol are dissolved in ( cellosolve ) and the solution is applied in 0 . 22 μl drops on the dorsal cuticule of the flies moderately narcotized with carbon dioxide . the treated flies are provided with sugar and water ad libitum in plastic glasses and evaluated after 24 hours . the ratio of killed flies is expressed in percentage ( morality %). the ld 50 values are calculated from the obtained data by probit analysis . the combinative interaction is given as a ratio of the expected activity ( e ) and the measured activity ( m ) calculated on the basis of the activity of the components per se . if the measured activity surpasses the expected activity then the activity is synergistic and if the activities are the same then the activity is additive , whereas if the measured activity does not achieve the expected activity then there is an antagonistic activity between the two components . the synergistic factor can be expressed as a ratio of the expected and measured values : ## equ2 ## wherein sf stands for synergistic factor , a and b stand for the amount of the components ( or ratio thereof ) and in the index they relate to the corresponding ld 50 values . the obtained results show the outstanding synergistic activity of the 1 : 1 mixture of 1rtranss + 1stransr ( transmix ) isomers compared to the different behavior of the various cypermethrin isomers ( see table 1 ). in case of the piperonylbutoxide which itself is not very active the synergistic activity an be deduced from the decreasing number of the ld 50 values . the effect of piperonyl butoxide on the activity of some cypermethrin isomers on the house fly ( musca domestica / srs ) measured by topical method is shown in the following table . table 2______________________________________dose activity change of ( ng × fly . sup .- 1 ) per se with pbo . sup . x activity______________________________________1rciss mortality % 0 . 50 5 5 00 . 72 15 20 + 51 . 03 30 30 01 . 47 50 65 + 152 . 10 80 75 - 5ld . sub . 50 1 . 37 1 . 301rtranss mortality % 1 . 56 10 10 02 . 59 20 30 + 104 . 32 40 50 + 107 . 20 60 65 + 512 . 00 75 85 + 10ld . sub . 50 5 . 78 4 . 581stransr mortality % 118 0 5 + 5168 0 15 + 15240 0 35 + 35343 20 70 + 50490 45 85 + 40700 60 100 + 401000 80 100 + 20ld . sub . 50 571 . 5 278 . 61rtranss + 1stransr ( 1 : 1 ) mortality % 1 . 56 0 15 + 152 . 59 10 30 + 204 . 32 30 55 + 257 . 20 50 80 + 3012 . 00 80 95 + 15ld . sub . 50 6 . 70 3 . 76______________________________________ . sup . x ratio of pyrethroide and piperonyl butoxide = 1 : 2 mixtures of transmix + tetramethrin of different ratio were tested by applying the above methods with piperonyl butoxide and without . the obtained results ( table 3 ) indicate a moderate antagonism in the case of simple combinations of two components : transmix and transmethrin . table 4 , however , shows an unexpected synergistic activity of the double combination admixed with piperonyl butoxide , which cannot be explained with any synergistic activity of the two pyrethroids per se and piperonyl butoxide . tet per se is ineffective at the used dose . table 3______________________________________effect of mixtures of transmix and tetramethrin of variousratio on house fly ( musca domestica / srs ) measuredby topical method trx + dose ( ngxfly . sup .- 1 ) trx tet tet expected ac - change oftrx tet measured activity tivity (%) activity______________________________________trx : tet = 10 : 1 mortality % 1 . 7 0 . 17 10 0 0 10 - 102 . 4 0 . 24 25 0 0 25 - 253 . 4 0 . 34 35 0 10 35 - 254 . 8 0 . 48 45 0 20 45 - 256 . 9 0 . 69 55 0 35 55 - 209 . 8 0 . 98 80 0 70 80 - 10ld . sub . 50 5 . 16 - 8 . 49trx : tet = 10 : 5 mortality % 1 . 7 0 . 82 10 0 0 10 - 102 . 4 1 . 18 25 0 0 25 - 253 . 4 1 . 68 35 0 10 35 - 254 . 8 2 . 40 45 0 25 45 - 206 . 9 3 . 43 55 0 35 55 - 209 . 8 4 . 90 80 0 65 80 - 15ld . sub . 50 5 . 16 - 8 . 41______________________________________ table 4______________________________________total effect of piperonyl butoxide , transmix andtetramethrin on house fly musca domestica / srsmeasured by topical method expected changedose ( ng × fly . sup .- 1 ) trx tet trx + tet effect oftrx tet measured effect (%) effect______________________________________trx : tet : pbo = 10 : 1 : 20 mortality % 1 . 7 0 . 17 10 0 15 10 + 52 . 4 0 . 24 25 0 35 25 + 103 . 4 0 . 34 35 0 60 35 + 254 . 8 0 . 34 45 0 80 45 + 356 . 9 0 . 69 55 0 95 55 + 409 . 8 0 . 98 80 0 100 80 + 20ld . sub . 505 . 16 - 2 . 97trx : tet : pbo = 10 : 5 : 20 mortality % 1 . 7 0 . 82 10 0 20 10 + 102 . 4 1 . 18 25 0 40 25 + 153 . 4 1 . 68 35 0 60 35 + 254 . 8 2 . 40 45 0 80 45 + 356 . 9 3 . 43 55 0 90 55 + 359 . 8 4 . 90 80 0 100 80 + 20ld . sub . 505 . 16 - 3 . 0______________________________________ house fly larvae ( musca domestica / ntr ) collected from a pigfarm were bred to developed insects . the permethrin &# 39 ; s activity was tested by enhanced increase of the ld 50 values , whereafter a great heterogenicity was observed , resulting in a levelling out of the dose - effect curve and in the enhanced increase of the ld 95 . in order to strengthen resistance and to ensure the homogenicity of the population and an appropriate amount of test insects , the collected fly population was subjected to selection pressure for 5 generations at a level of ld 60 , by treating 2000 male and 2000 female flies in each generation with the given dosage ( ld 70 ) topically . the surviving flies gave the parent generation . the culturing was carried out by sawicki as follows . the insects were examined according to the method given in before example 1 . the ld 50 values were obtained by probit analysis . table 5______________________________________efficiency of transmix : tetramethrin combinations onhouse fly ( musca domestica / ntr ) tested by topical methodactive ingredients ld . sub . 50 ( ngxfly . sup .- 1 ) resistance factorand mixtures p . sub . 0 f . sub . 6 ld . sub . 50f . sbsb . 6 / ld . sub . 50p . sbsb . 0______________________________________permethrin 28 . 5 290 . 7 10 . 2tetramethrin 450 & gt ; 5000 & gt ; 11tet + pbo ( 1 : 20 ) 310 1500 5 . 2transmix 8 . 6 17 . 5 2 . 2transmix + tet ( 10 : 1 ) 9 . 5 21 . 2 2 . 2transmix + tet + pbo 5 . 8 7 . 2 1 . 2 ( 10 : 1 : 20 ) transmix + tet + pbo 5 . 3 7 . 1 1 . 3 ( 10 : 1 : 40 ) transmix + transtet + pbo 4 . 9 5 . 9 1 . 2 ( 10 : 1 : 20 ) ______________________________________ p . sub . 0 = parent generation f . sub . 6 = offspring generation the results indicate that the effect of transmix + tetramethrinpiperonyl butoxide mixtures on resistant flies is significant . emulsifiable concentrates prepared according to examples 3 or 4 were diluted with 200 - 400 - 800 - 1600 - 3200 - 6400 fold water and the obtained emulsions were sprayed with a 2 layer pulverizer in 0 . 5 ml portions at a pressure of 2 bar into petri - dishes of a diameter of 9 cm . after drying 3 - 5 days old female flies ( musca domestica / srs ) were placed to petri - dishes ( 10 to each dish ) in 4 replicates for each dosage . after 60 minutes the knocked down flies were calculated and their ratio was expressed in percent ( see table 6 ). table 6______________________________________ dilutioncomposition 200 400 800 1600 3200 6400______________________________________ knockdown (%) emulsion of formu - 100 100 75 50 30 10lation example 4emulsion of formu - 100 100 85 60 35 10lation example 3stomosan ® 100 80 40 15 0 0______________________________________ stomosan ® = composition containing 200 g / l of commercially available permethrin the table shows that the knock - down effect is considerable even at a great dilution . 20 male cockroaches obtained from a 1 - 2 weeks continuous laboratory culture were treated topically in a mild carbon dioxide narcosis with 0 . 22 μl n - butanol solution of the test - compounds of a suitable concentration . 3 days after the treatment the insects , which were provided ad libitum with water and commercially available dogfood in plastic glasses , were evaluated . the ratio of the killed insects was expressed in percent . the results are shown in table 7 . table 7______________________________________ dosage ( ngxcockroach . sup .- 1 ) test components 4 . 5 9 18 39 78______________________________________ mortality (%) trx 0 0 35 60 90tet 0 0 0 0 0tet + pbo ( 1 : 20 ) 0 0 0 0 0trx + tet ( 10 : 1 ) 0 5 30 60 90trx + tet + pbo ( 10 : 1 : 20 ) 15 55 85 100 100______________________________________ 20 images obtained from a 1 - 2 weeks continuous laboratory culture were treated for each dosage with 0 . 22 μl of n - butanol solution of the tested compounds topically . the treated insects were held in a glass vial sealed with a cotton wool stopper . the percent of the killed insects after 24 hours is shown in table 8 . table 8__________________________________________________________________________ dose ( ngxinsect . sup .- 1 ) test compounds 0 . 78 1 . 56 3 . 13 6 . 25 12 . 5 25 50 100__________________________________________________________________________transmix ( trx ) 0 0 15 25 45 60 70 85tetramethrin ( tet ) 0 0 0 0 0 0 0 0tetramethrin + pbo 0 0 0 0 0 0 0 0 ( 1 : 20 ) transmix + pbo ( 1 : 2 ) 0 0 20 40 60 75 90 100trx + tet + pbo 10 35 50 65 80 90 100 100 ( 10 : 1 : 20 ) __________________________________________________________________________ piperonyl butoxide , calcium salt of alkyl aryl sulfonate , nonyl phenol - and dinonyl phenol ethoxylate and tristyryl phenol ethoxylate are dissolved in 500 ml of xylene at 40 ° c . and the pyrethroides are added under stirring and the solution is completed to 1000 ml at 20 ° c . ( see table 9 ). the compositions according to 1 to 8 in table 9 were tested for stability in cipac a and d water at + 30 ° c . in 0 . 2 , 1 and 5 % by volume . the samples were subjected to heat treatment for 14 days at 54 °± 2 ° c . and at the given temperature emulsion stability and redispersion tests were carried out in the above cipac waters . the 8 samples showed similar behavior within 10 % standard deviation like the freshly prepared sample . table 9__________________________________________________________________________emulsifiable concentrates amounts in g / lexample numbers 1 2 3 4 5 6 7 8__________________________________________________________________________transmix 20 20 50 50 10 10 10 10tetramethrin 2 2 5 5 1 1 2 2pbo 40 80 200 100 20 40 20 40nonylphenolethoxylate 10 5 20 15 6 6 8 4 ( eo = 20 ) dinonylphenolethoxylate 20 10 20 15 10 10 15 12 ( eo = 16 ) tristyrylphenolethoxylate 10 15 20 5 10 5 8 8ca salt of alkyl - aryl - 40 35 50 45 20 30 25 20sulfonatexylene 1000 ml 1000 ml 1000 ml 1000 ml 1000 ml 1000 ml 1000 ml 1000 ml__________________________________________________________________________ piperonyl butoxide , calcium salt of alkyl aryl sulfonate , alkyl phenol ethoxylates and tristyryl phenol ethoxylate are dissolved in an aromatic solvent mixture of a suitable amount whereafter transmix and tetramethrin are added at 40 ° c . the obtained solution is poured into 500 ml of ion exchanged water containing 8 % ethylene glycol and it is completed to 1000 ml at 20 ° c . with water containing 8 % ethylene glycol ( see table 10 , examples 9 - 16 ). table 10__________________________________________________________________________transparent solutionsamounts in g / lexample numbers 9 10 11 12 13 14 15 16__________________________________________________________________________transmix 20 20 50 50 10 10 10 10tetramethrin 2 2 5 5 1 1 2 2pbo 40 80 200 100 20 40 20 40nonylphenolethoxylate 30 10 5 -- 5 5 -- --( eo = 20 ) dinonylphenolethoxylate 5 -- 10 15 -- -- 15 10 ( eo = 16 ) tristyrylphenolethoxylate 20 30 45 55 80 60 55 45 ( eo = 20 ) ca salt of alkyl - aryl - 60 60 70 60 45 45 60 60sulfonatearomatic solvent mixture 90 90 100 100 50 50 50 508 % ethyleneglycol water 1000 ml 1000 ml 1000 ml 1000 ml 1000 ml 1000 ml 1000 ml 1000 mlsolution__________________________________________________________________________ the above transparent solutions were examined by the method described for the emulsifiable concentrates . the stability of the samples before and after the storage was found to be suitable . 20 g of piperonyl butoxide , 10 g of transmix and 1 g of tetramethrin were completely dissolved in 250 ml solvesso 150 and it is completed to 1000 ml at 20 ° c . with paraffin oil . 10 g of piperonyl butoxide , 5 g of transmix and 1 g of tetramethrin are dissolved in 250 ml of solvesso 150 whereafter it is completed with sunflower oil to 1000 ml at 20 ° c . in a two layer pulverizer laboratory fluidization drying equipment on 745 g of silicic acid at 40 ° c ., under 2 bar liquid pressure and 3 bar air pressure a solution of 200 ml xylene , 100 g of piperonyl butoxide , 50 g of transmix and 5 g of tetramethrin is pulverized . to the dried powder 20 g of dioctyl sulfosuccinate and 80 g of polymerized sodium salt of alkyl naphthalene sulfonic acid are mixed . the homogeneous powder mixture is ground to a size below 20 micrometer by using an ultraplex mill . moisturization time : 16 sec . floatability according to cipac : 86 %. a solution of 150 ml of xylene , 20 g of piperonyl butoxide , 10 g of transmix and 1 g of tetramethrin is sprayed on 894 g of silicic acid according to example 19 . 15 g of dioctyl sulfosuccinate and 60 g of polymerized sodium alkyl naphthalene sulfonate are added to the dry powder mixture in a homogenizer , and the mixture is ground . moisturization time of the powder mixture : 12 sec ., floatability : 88 %. a solution of 75 ml of xylene , 2 g pbo , 1 g of transmix , and 0 . 1 g of tetramethrin is sprayed on 996 g of silicic acid by a method given in example 19 . the product can be used without grinding as a dusting agent . a solution of 100 ml of xylene , 10 g of piperonyl butoxide , 5 g of transfix and 0 . 5 g of tetramethrin is applied to 985 g of silicic acid as given in example 19 . dusting agent is obtained . | 0 |
while this invention is susceptible of embodiments in many different forms , there is described in detail herein a preferred embodiment of the invention with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the broad aspect of the invention to embodiments described . the disclosed composition contains an effective amount of hoodia gordonii combined with several other ingredients . it is believed that the combination of these additional ingredients creates a synergy in the efficacy of the hoodia . that is , the additional ingredients are believed to permit the use of less hoodia in the total composition to achieve the same appetite suppressant success as that of a larger dosage of pure hoodia . the additional ingredients used in the embodiments of the present composition are as follows : guarana comes from the amazon rainforest and is used to improve mental sharpness , reduce fatigue , increase stamina and endurance , and may even lift depressed spirits . guarana is a shrubby , climbing vine that is native to south america , with compound leaves , yellow - flowered panicles , and pear - shaped fruit , filled with seeds like a small horse chestnut . it thrives in moist , humus - rich soil in the partial shade of the rainforest at a minimum temperature of sixty - five degrees fahrenheit . guarana is made by the guaranis , a tribe of south american indians , in a long and complicated process . the seeds are shelled , washed , roasted , and pounded into a fine powder that is mixed with water to make dough . the dough is then rolled and sun - dried ( or over a slow fire ) until it hardens and is cut into cylindrical pieces . the result is a bitter , chocolate - flavored substance ( without chocolate &# 39 ; s oiliness ) that is used in refreshing teas or as a tasty , coffee - like drink that is said to increase energy and mental acuity , combat fatigue and promote endurance and stamina . guarana is said to be the richest source of caffeine worldwide , well - known for its stimulating effects due to that high caffeine content . some of the constituents in guarana include adenine , caffeine , d - catechin , saponin , tannins , theobromine , theophylline , starch and a fixed oil , and a crystallizable principle in the seeds called guaranine . guarana is a stimulating tonic that is believed to improve physical stamina and endurance . because guaranine is almost identical to caffeine in its actions , athletes have been known to take it to stimulate and improve their performance and increase their strength and endurance . it is also thought to reduce fatigue and exhaustion . the combination of guarinine , theobromine and theophyline act to stimulate the central nervous system and also act to enhance the metabolic rate , which may be helpful in weight loss programs . as a “ nervine ,” guarana is also said to strengthen functional activity of the nervous system . the alkaloids theobromine , and theophylline act to stimulate the central nervous system and are thought to be useful in cases of neuralgia , paralysis , migraine and nervous headache and the distress that sometimes accompanies menstruation . guarana is considered a gentle excitant that is said to be good for depression and mental exertion where there is fatigue or even exhaustion from hot weather . it is also thought to increase mental sharpness and concentration , which may also be a result of its guarinine content . the tannins in guarana act as an astringent and are said to help ease mild forms of leucorrhoea ( vaginal discharge ) and diarrhea . as a mild diuretic , guarana is thought to promote urine flow and act as febrifuge that helps to reduce mild fevers . it is also said to alleviate urinary tract irritation . chá de bugre ( cordia salicifolia — brazil , cordia ecalyculata - paraguay ) is a small tree growing 8 - 12 meters in height with a trunk 30 - 40 cm in diameter . it is indigenous to brazil and can be found growing predominately in the brazilian states of minas gerais , bahia , acre and goias . it is also found in tropical forest areas of argentina and paraguay . in brazil , it is commonly called café do mato ( coffee of the woods ) because it produces a red fruit resembling a coffee bean which is roasted and brewed into tea as a coffee substitute . chá de bugre products are highly commercialized as a weight loss aid in brazil where tea bags , fluid extracts and tinctures of chá de bugre are commonly seen in pharmacies , stores , and even in the beach - front eateries and refreshment stands along rio de janeiro &# 39 ; s beaches . it has long been a popular weight loss product which has been marketed as a diuretic , appetite suppressant , and believed to help prevent or reduce fatty deposits and cellulite . dr . c . l . cruz in his book , dictionary of the plants used in brazil , recommends chá de bugre as an excellent diuretic and weight loss aid as well as a good general heart tonic which can help stimulate circulation . it is also used in brazil and haiti as a tea to help relieve coughs , regulate renal function , reduce uric acid and , used externally , to heal wounds . despite the popularity of chá de bugre in brazil very little has been done to analyze the phytochemicals in the plant . at present it is known to contain caffeine , potassium , allantoin and allantoic acid . the red fruits or berries of chá de bugre ( resembling a coffee bean ) contain caffeine . the allantoin and allantoic acid may explain the traditional use of the plant for wound healing . main plant chemicals include allantoin , allantoic acid , caffeine , potassium . very little clinical research is thought to exist on chá de bugre . however , some possible uses for chá de bugre include reducing herpes virus penetration , inhibition of cancer cells , and a as a heart tonic . as an appetite suppressant , rather than cutting off appetite all together ( then causing intense hunger when it wears off at the wrong time ) chá de bugre gives one a sense of being full and satiated after eating only a few bites of food . this seems to promote much smaller meals , more often , which is what many practitioners believe is better for sustained weight loss and keeping the metabolism going throughout the day . the use of ginseng is thought to be an excellent way to improve the body &# 39 ; s resistance to infection and damaging environmental influences . it is also used by many athletes for overall body strengthening and endurance . ginseng has been used for treatment of bronchitis , circulatory problems , diabetes and infertility . some believe it may even be helpful in lowering cholesterol and possibly even inhibiting the growth of tumors . it has long been used as an aphrodisiac and is especially helpful to weak or elderly people . american ginseng is a smaller version of its more famous asian ( korean / chinese ) cousin but has many of the same benefits . it is a slow - growing perennial plant with a large fleshy root ( the part used in herbal medicine ) and a stem that grows to two feet . it is found from maine to georgia and from oklahoma to minnesota , and it is endangered in much of this area . generally speaking , ginseng normalizes body functions during stressful situations which tend to alter those functions . this “ normalization ” helps the body to adapt and return to an overall sense of well - being . it also improves mental and physical vigor and is used by athletes for overall body strengthening and endurance . ginseng helps to combat stress because it appears to protect a portion of the brain known as the hippocampus from the effects of stress hormones . this prevents memory problems and loss of cognitive ability in people who suffer from bipolar disorder and even depression . it may be used to relieve fatigue , stress and nervousness , especially after acute illness . ginseng is believed to promote a good appetite , stimulate fertility in women , and is helpful for rheumatism , headaches , colds , coughs , bronchitis , constipation , cystitis and symptoms of menopause . it has anti - inflammatory properties which may be useful in reducing fevers and lung problems . taken in low doses , it acts as a mild sedative ; in large doses , it acts as a stimulant . it has been used to reduce cholesterol , high blood pressure , and may be useful to inhibit the growth of cancerous tumors . researchers also believe that it may be a viable alternative to conventional forms of treatment for type - 2 diabetes . ginseng is said to increase vitality and improve the body &# 39 ; s resistance to a wide variety of illnesses and damaging external influences . it strengthens the adrenal and reproductive glands , enhances immune functions and promotes lung and respiratory health . citrus aurantium , a fruit commonly known as bitter orange , has been used in traditional chinese medicine to treat chest congestion and indigestion , stimulate gastrointestinal function and improve circulation and liver function . in traditional western medicine , citrus aurantium has been used to treat digestive and circulatory problems . citrus aurantium is widely used for stimulating the breakdown of fat , by causing the release of noradrenaline ( a stress hormone ) at beta - 3 receptor sites creating chemical reactions that increase fat breakdown . beta - 3 receptors in the body increase the rate at which fat is released from the body stores ( lipolysis ) and increase resting metabolic rate ( thermogenesis ). physical activity tends to increase this thermogenic effect and further enhances the thermogenic effect of citrus aurantium towards healthy and permanent weight loss . in chinese medicine magnolia bark has been associated with the stomach , lungs , spleen , and large intestine for over two thousand years and has been used to treat abdominal bloating , gas , nausea , diarrhea , menstrual cramps , and indigestion . recent studies have found that the herb inhibits the production of cortisol ( the substance that encourages fat storage ) and may be effective in weight loss programs . magnolia is a magnificent family of forest trees that are revered for their beautiful , large , showy , and fragrant flowers . magnolias may be both evergreen and deciduous with luxuriant foliage and rich flowers and can reach a height of more than eighty feet , with some species much smaller . magnolias can survive in both moist and dry soils that can be neutral - to - acid - to - alkaline , in sun or partial shade with shelter from cold winds and late frosts . when growing in warmer climates , the trees reach their greatest development . magnolia bark is collected in the autumn , and the unopened flowers are harvested in the springtime and used in herbal medicines . some of the constituents in magnolia bark include volatile oils ( eudesmol , bornyl - acetate , etc . ), alkaloids , tannin , magnolol , honokiol , zinc , copper , calcium , potassium , iron , magnesium , and manganese . magnolia bark has been used in chinese herbal medicine for at least two thousand years as an aromatic , pungent , and warming stimulant that treats various disorders of the digestive system and strengthens stomach function . it is a bitter relaxant herb that acts as a tonic and improves digestion ; relieves stomach pains , gastroenteritis , and flatulence ; calms diarrhea and vomiting associated with indigestion ; stimulates poor appetite ; and alleviates fullness and distension of the abdomen . as a mild diaphoretic , magnolia bark is said to increase perspiration and sweating and thus reduce fevers and cool the body . it has been used in cases of malarial fevers and fevers of a typhoid type . magnolia bark is believed to have antiseptic , antibacterial , antifungal , antispasmodic , expectorant , and anti - inflammatory properties . as such , the bark is thought to relieve the pain and inflammation of rheumatism ; counteract yeast infections ( such as leukhorrea ); combat upper respiratory tract infections and spasms , such as asthma , coughs , profuse phlegm in the lungs , shortness of breath , and fullness and pressure in the chest area . in the fight against obesity and weight management , magnolia bark has recently been recognized as an efficient fat burner . it is said that the magnolol and honokial in the herb effectively inhibit the body &# 39 ; s production of cortisol , the substance that liberates fat from adipose cells and thus suppresses fat storage , particularly in the abdominal and belly area . black pepper has been used for years as a stimulant for taste . use in the present composition is to give the user a warm and biting reaction to taking the capsule . it is not intended to produce dietary results , only the feeling that something good is happening . obviously , other taste stimulators known by those skilled in the art may be used to provide the same or similar sensation . given these components , a dosage of between about 300 and 700 mg , preferably about 575 mg , using varied amounts of each within specified ranges can be composed to offer various synergistic effects . the formula ranges shown in table 1 are general weight loss formulas for obtaining the benefits of each component while still avoiding the potential side effects of having too much of any one component . note that the “ preferred percent (%) by weight ” column only totals 99 . 6 %. the non - active ingredients used to prepare the dosage form , such as magnesium stearate which is widely used as a lubricant in the manufacture of pharmaceutical solid dosage forms , have not been accounted for . those skilled in the art would understand the use of such ingredients to produce the desired dosage form . to suppress appetite , the preferred dosage of 575 mg should be administered to the individual twice daily , once in the morning ( at least one hour before breakfast ) and once in the afternoon ( at least one hour before dinner ) being the preferred dosage schedule . the total dosage may be within the range of from about 300 mg to about 700 mg , with the daily dosing being adjusted accordingly . that is , if using smaller dosages , e . g ., 300 mg tablets , then in some cases it may be desirable to administer two tablets ( i . e ., 600 mg total ) at each of the prescribed times . the matter set forth in the foregoing description is offered by way of illustration only and not as a limitation . while particular embodiments have been described , it will be apparent to those skilled in the art that changes and modifications may be made without departing from the broader aspects of applicants &# 39 ; contribution . the actual scope of the protection sought is intended to be defined in the following claims when viewed in their proper perspective based on the prior art . | 0 |
persons of ordinary skill in the art will realize that the following description of the present invention is illustrative only and not in any way limiting . other embodiments of the invention will readily suggest themselves to such skilled persons . referring now to fig5 , a block diagram shows an illustrative ramp generator circuit 60 including a plurality of unit elements 62 , 64 , 66 , 68 , 70 , and 72 in accordance with another aspect of the present invention . while fig5 shows six unit elements for purposes of illustration only , persons of ordinary skill in the art actual embodiments of the invention may include differing numbers of unit elements according to the needs of the particular application . each of unit elements 62 , 64 , 66 , 68 , 70 , and 72 may be configured as shown in the illustrative unit element 12 of fig2 . the unit elements 62 , 64 , 66 , 68 , 70 , and 72 are all coupled to v ref source 74 and to the inverting input of operational amplifier 76 . feedback capacitor ( c fb ) 78 is coupled between the output 80 and the inverting input of operational amplifier 76 . in an illustrative embodiment of the present invention that will be used to show the operation of the present invention , sixteen unit elements are employed . a 50 ff capacitor and a 24 mv input voltage are used order to achieve a 1 . 2 fc step size . since sixteen unit elements are used in this example , the step sizes for a given ramp may vary by a 16 : 1 ratio . in order to generate a ramp having a unit step size , the circuit will operate by using one unit element at a time , but rotating through all sixteen of the unit elements . for example , on the first step , the capacitor in the first unit element 62 is charged , then that charge is deposited onto the input of the amplifier . the next step uses only the second unit element 64 . this is followed by using one at a time the succeeding unit elements 66 , 68 , 70 , up to and including the last ( sixteenth ) unit element 72 . this completes a single charge cycle . after the last unit element 72 is used , the next step starts back with the first unit element 62 . the foregoing description in which the unit elements 62 through 72 are used in order is illustrative only , and persons of ordinary skill in the art will appreciate that any algorithm that uses all unit elements equally within each charge cycle could be employed . decoding and control of switches to place the unit elements in and out of the circuit is well known in the art . following the preceding example , the charge from the first step is q step = v in * c 1 + q err1 . after sixteen steps , the total charge is q total = v in *( c 1 + c 2 + . . . + c 16 )+ q err1 + q err2 + . . . + q err16 , where q err1 to q err16 represent the total error in the charge for steps 1 to 16 , respectively . the circuit of fig5 may be operated to produce different step sizes . for example , a step size of 2 units may be produced by operating the unity elements in simultaneous groups of two . this step size is double the size of the unit step size described above , and employs two unit elements at a time using the same input voltage v ref . this eliminates the error due to voltage mismatch caused by imprecise reference voltage scaling . as in the generation of the unit step size , each of the unit elements 62 through 72 are used in a rotating fashion . in one non - limiting example , the first step may be generated using the first two unit elements together . the next step could use the third and fourth , and so on . it should be noted that after eight steps , all elements are used , whereas generating the unit step size uses all unit elements after sixteen steps . following this example , the charge from the first step is q step = v in *( c 1 + c 2 )+ q err1 + q err2 . after eight steps , the total charge is q total = v in *( c 1 + c 2 + . . . + c 16 )+ q err1 + q err2 + . . . + q err16 . the step size may be doubled again by using four unit elements at a time , again by using eight unit elements at a time , and doubled one more by using all sixteen unit elements simultaneously . each time , the same input voltage v ref is employed . in this example , the charge from the first step ( assuming a perfect amplifier ) is q step = v in *( c 1 + c 2 + . . . + c 16 )+ q err1 + q err2 + . . . + q err16 . this sum is exactly equal to the q total for the unit step size after sixteen steps , the 2 × step size after eight steps , and the 4 × step size after four steps . referring now to fig6 , a graph illustrates the ramp slope obtained by using 1 ×, 2 ×, 4 ×, 8 ×, and 16 × step sizes in operating the ramp generator 60 according to the present invention . the overall slope of the ramp may be changed by changing the input voltage v ref . this may be done by configuring the v ref source as a variable voltage source . no accurate method of scaling the input voltage is proposed here . however , it will be understood by persons of ordinary skill in the art that , even with an accurate scaled voltage , the charge errors described earlier will prevent linear scaling of the step size using a voltage - based scaling . fortunately , the system of the present invention is tolerant to such errors between scaled ramps but is not tolerant of scale inaccuracies within an accelerated ramp . therefore , the system of the present invention may be advantageously employed using voltage scaling to vary the ramp shape in where the system can tolerate error and using unit element scaling to scale the step size where extreme scale accuracy is required . a major deleterious effect of charge injection is circumvented by using the charge injection method of the present invention . after 16 unit steps , the total charge injection is q inj1 + q inj2 + . . . q inj16 . this is identical to the charge injection expected if all unit elements switch at once , creating a single step . by using the same voltage for both cases , the effects of reference voltage scaling errors are also eliminated . according to another aspect of the present invention , fractional gains may be achieved . fractional gains can be achieved by dithering the step size . in the proposed implementation , a delta sigma modulator precedes the unit element ramp generator to facilitate fractional gains . a low pass filter follows the modulator in order to smooth out the fractional steps . a block diagram for a ramp generator system 90 for producing fractional gains is shown in fig7 . n integer bits and m fractional bits are input to delta - sigma modulator 92 . the output of delta - sigma modulator 92 selects / enables unit elements in the ramp generator 94 , which outputs a raw analog ramp signal . low pass filter 96 smoothes the modulated ramp signal . table 1 illustrates this aspect of the present invention . each box in the table represents one time slot . for simplicity , sixteen time slots are shown , but persons of ordinary skill i the art will appreciate that this aspect of the present invention is not so limited . any number of unit elements a , b , c , and d can be turned on during each time slot . in the illustrative embodiment shown in table 1 , zero , 1 , or 2 elements are turned on during each time slot . all unit elements should be used exactly once per charge cycle to preserve precise gain ratios . the low pass filter 96 smoothes the modulated ramp signal . fig8 is a graph showing the effects of the low pass filter 96 on the ramp waveform . fig8 shows a fractional step size of 0 + ¼ . the ramp generator 94 would output a stepped waveform . after the low pass filter 96 , the waveform is smoothed . if the ratio of the ramp clock frequency to the low pass filter bandwidth is high compared to the fractional pattern length , then the error caused by the truncation in the modulator and finite number of unit elements becomes less than the desired fractional step size . in this way , the resolution of the system is increased from the nominal step size of the raw ramp generator to the fractional resolution ( from n bits to n + m bits ). if the bandwidth of the low pass filter is around 3 mhz and the ramp clock frequency is greater than 100 mhz , the ratio of bandwidth to sample clock frequency is 3 / 100 . the maximum pattern length for the 4 - bit word is 16 . therefore , the ratio of the sample clock frequency to low pass filter is about 33 : 1 . this is greater than the maximum pattern length of 16 samples . therefore , the ramp system should operate with a resolution that approaches the fractional resolution , 16 times greater than the nominal step size . the low pass filter may be implemented by a bandwidth - limited voltage buffer between the raw ramp generator output and the comparator 46 in fig4 . implementing an amplifier with a bandwidth equal to the ramp clock frequency would actually be prohibitive due to the power required . so , the amplifier as low pass filter is advantageous to low power ramp designs . while embodiments and applications of this invention have been shown and described , it would be apparent to those skilled in the art that many more modifications than mentioned above are possible without departing from the inventive concepts herein . the invention , therefore , is not to be restricted except in the spirit of the appended claims . | 6 |
although the invention applies to any type of air conditioner as well as to the separate functions of this climate control , a window installation type of unit is shown having the combined functions of the invention in one unit to more simply illustrate how the invention differs from conventional dehumidifiers and air conditioners . the climate control unit invention in the drawing functions in a very contrary fashion to conventional self contained , central , or window air conditioners . for example , conventional air conditioners constantly circulate room air through the evaporator coil and the temperature of the room is controlled by cycling the refrigeration system on and off to give the amount of cold required for a given situation of room heat input . when the coil has cooled the room sufficiently the coil is allowed to be warmed up to room temperature by the room air constantly circulating through the coil and , undesirably whatever moisture is on the coil , evaporates back into the room as room humidity . the invention , on the contrary , in its preferred form , provides a temperature and air protected evaporator coil which is constantly maintained at or below a desired dew point temperature , and the temperature in the dwelling space is controlled by cycling the room air blower to blow the needed volume of room air through the cold evaporator coil and back into the room to get the amount of cold required for a given situation of room heat , after which room air ceases to be blown through the evaporator coil thus ending the cooling effect and thus preventing any condensed moisture on the coil from evaporating back into the room air . looking now at fig1 the unit sets partly inside 44 of the house and partly outside 42 of the house as illustrated by the representative house wall 42 , 44 . it could set all inside or all outside with appropriate duct work to channel the hot or cold air where desired . in a self contained or central air conditioner , proper evaporation coil location with the proper pipes to the condenser coil would be employed , or proper ductwork , would be employed . on the inside side 44 of the house wall is the refrigeration evaporator coil 2 . this evaporation coil 2 in the preferred form is maintained at a selected cool or dew point temperature all the time the unit is in operation , regardless of whether it is cooling the room at the time or not . therefore to aid maintaining the evaporator coil at constantly cold temperatures , the coil is temperature protected by an insulated enclosure 8 . a swinging door 6 is pivoted at 7 to protect it from undesired air flow and remains normally closed . it can be weight counterbalanced or spring assisted . it opens only when the room air thermostat requests the room be cooled which the thermostat then turns on the fan motor 20 that revolves the fan 18 which suction pulls the door 6 open to pump room air 4 through the cold evaporator 2 and blow it out into the room as cold air 12 . an extra volume of uncooled room air 13 is mixed with the cold air 12 to alleviate its extreme cold before it is blown out through the room . a second but smaller volume fan 22 driven by a small fan motor 24 pumps a certain preselected volume of outside fresh air 14 in from the outside of the dwelling . a fresh air volume limiter shown as a butterfly valve 23 , or other conventional system , is used to control the desired volume of fresh outside air 14 brought in from the outside through opening 10 , which small volume of fresh air passes through the cold evaporator coil 2 , passes up through the operating or non - operating fan 18 and out into the room as dehumidified fresh air 16 . this air 16 can also be mixed with uncooled room air 13 . a stale air outlet elsewhere in the dwelling or space allows the exit of the used air . this is accomplished by the normal cracks and crevices in the building , by operating an exhaust fan , by a slightly opened window , or by some other suitable air exit . in the cooling cycle when fan 18 pumps a large volume of room air 4 through the evaporator coil 2 , to cool the room with chilled air 12 and also in the fresh cycle when only the fresh air fan 22 pumps a much smaller volume of outside fresh air 14 in through opening 10 and evaporator 2 and out into the room as dehumidified fresh air 16 , the evaporator coil 2 is held by the refrigeration system to some selected cold temperature range employing the dew point principle to provide the relative humidity desired in the dwelling . the water condensed from the air falls from the condenser 2 and collects as water 38 in the bottom of the cold chamber 46 . the condensed water passes through a water trap 36 , to prevent cold air leakage at this point , and drains out into the base of the unit and is slung and blown through the condenser coil 34 by the fan slinger 28 and fan 32 , which is revolved by fan motor 40 , or simply drains out of the bottom of the unit . the conventional connecting refrigeration pipes are not shown to avoid confusion , and the compressor 26 in the drawing is illustrated as a sealed unit type , but it could be any suitable type . this compressor 26 pumps the refrigerant around through the evaporator 2 and condenser 34 coils so that the various parts act as a refrigerating system to cool the evaporator coil 2 surfaces and cold chamber 46 . the sensing controls and the electrical system is shown in the preferred form in fig2 where line voltage is supplied by lines 66 , 68 , connected to the various parts of the unit . the compressor 26 is turned on and off to constantly maintain the evaporator coil 2 at a selected cold temperature range by an evaporator coil temperature sensor 56 or by an evaporator coil 2 pressure sensor or by any other suitable method , to control the coil 2 temperature . a room air temperature sensing thermostat 50 or other conventional room air temperature sensing device when necessary , calls for cold and turns on the room air circulating fan 18 motor 20 . in the preferred form it does not directly control the compressor 26 of the refrigerating system to cool the room as is conventionally done . the selected evaporator coil 2 temperature is chosen in relation to the relative humidity desired in the dwelling . the temperature in the room is controlled by the amount of room air 4 , fig1 blown through the cold evaporator coil 2 , fig2 . a colder evaporator coil 2 condenses more humidity out of moist air giving a lower relative humidity at room temperature than does a warmer evaporator coil 2 temperature . if a properly designed evaporator coil is held at 35 ° f and the fresh air fan 22 of fig1 brings in fresh humid outside air 14 to pass through the evaporator coil 2 , it will enter the room as fresh air 16 having a relative humidity of less than 25 % after the fresh air temperature has been raised in the room to 75 ° f . with a properly designed evaporator coil these same relative humidities are provided during the cooling cycle . such humidity control during cooling is often needed under conditions where a large amount of humidity and heat is generated within the dwelling itself . the evaporator coil 2 fig2 and condenser coil 34 are connected by the compressor 26 pipes on one side of the coils and by a capillary tube 62 , or some other type of expansion valve control on the second side of the coils . thus in the preferred form of the invention we see in fig2 that the evaporator coil 2 temperature sensor 56 closes contacts to start the compressor 26 whenever the evaporator coil 2 gets warmer than desired and opens whenever it gets colder than desired . the room air thermostat or temperature sensor 50 contacts close when the room gets too warm and the blower motor 20 , fan 18 recirculates the warm room air past door 6 ( fig1 ) and through the coil 2 and back into the room to cool the room air . when the room air gets cold enough the room air temperature sensor 50 contacts open and the blower fan 18 stops blowing and the swinging door 6 closes . looking now at fig2 the power supply lead lines 66 , 68 have line switches 67 , 71 . the fresh air fan 22 , motor 24 is energized by closing switch 71 , and fresh air is pumped in from the outside . if dehumidification of that air is desired as in the humid summertime , switch 67 is also closed to activate the refrigeration system to cause the compressor to maintain the evaporator coil at the desired dew point temperature range by the coil temperature sensor switch or control 56 . the condenser coil 34 can be cooled by a fan in a conventional manner . no fan is shown to avoid confusion . fig3 shows a modified sensing and electrical system which does essentially the same thing that the system does in fig2 . that is , both systems limit the room air from being blown through the coil 2 until the compressor 26 has cooled the coil 2 to the desired dew point temperature chosen to give the desired relative humidity to the cooled room air . here in fig3 the room air temperature sensor 50 contacts close when the room air needs to be cooled and the compressor 26 motor starts and refrigerant is liquified to cool the evaporator coil 2 . when the evaporator coil 2 becomes sufficiently cold to be at the desired dew point temperature , the coil temperature sensor 64 contacts close and the blower motor 20 is turned on and drives the blower fan 18 which blows room air through the cold coil 2 until the room is sufficiently cool . at this time the room air temperature sensor 50 contacts open the compressor stops , and the coil 2 begins to warm up from the room air being blow through it . when the evaporator coil 2 is warmed up to the chosen dew point temperature , the coil temperature sensor 64 contacts open and the fan 18 stops blowing room air through coil 2 . in fig3 where electrical power supply lines 66 , 68 are shown it should be noted that the fresh air fan 22 operated by its motor 24 is shown connected to the same electrical leads that operate the recirculation fan motor 20 . the on and off temperature sensor control 64 of the recirculation fan motor 20 also turns the fresh air fan motor 24 on and off at the same time , namely when and only when the coil has been cooled to the desired dew point to control the humidity of the incoming fresh air . here again as in fig2 no condenser coil 34 fan is shown , but can optionally be employed in a conventional manner . a separate electrical power lead to operate the fresh air motor 24 and fan 22 of fig3 is shown whereby , when switch 67 is opened to turn off the refrigeration capability of the climate control unit , the fresh air fan 22 can be operated by closing switch 73 to blow fresh air into the dwelling if desired when neither cooling nor dehumidification is wanted , as for example , in dry and / or cold weather . as in the preferred form the temperature sensor 64 fig3 can be replaced by other coil temperature controls . switches 73 , 67 of fig3 can be mechanically connected to permit the closure of only one switch at a time . a word of explanation may be necessary concerning the stated non - cooling effect during the time chilled and dehumidified fresh air is being supplied to the dwelling . it is generally agreed that as little as 71 / 2 cubic feet per minute of fresh air may be sufficient for each occupant of a dwelling , where smoking is not present . it is interesting to note that as little as 25 cubic feet per minute of fresh air will change the air in a average sized residence 2 times to 3 times in 24 hours dependent of course on house size , but it is surprising to discover that to re - heat 25 cubic feet per minute of 30 ° f saturated air , to 80 ° f air , requires less electrical heat than the electricity consumed by an average sized household light bulb . therefore , such a small cold input of 25 cubic feet per minute of 30 ° f air blown into a residence can for all practical purposes be considered only as dehumidified fresh air , while ignoring the very very small cooling effect . this small amount of dehumidified fresh air does however effectively ventilate and dehumidify . as this invention comprises a dehumidified fresh air capability a dehumidifying cooling capability , and a capability which is the combination of both capabilities it is understood that each of these capabilities alone as described and claimed are part of this invention . the compressor 26 may be divided into two compressors where one is used in the fresh air cycle and the other or both compressors are used in the cooling cycle . additionally , a compressor may be used having a two speed motor to drive the compression pump portion at two different speeds to achieve two levels of evaporator coil capacity , and this two speed effect can be achieved by changing the number of poles activated in the compressor motor , as well as any other suitable motor speed control . other advantageous conventional controls can be applied to this invention to enchance its capability . for example , the volume of fresh air which flows into the evaporator coil can be limited during the cooling cycle to avoid excessive fresh air flow due to the operation of the large volume cooling fan 18 by restricting the air flow through opening 10 by a closure vane activated by the swinging door 6 or by any other suitable means . also , the fresh air flow limiter 23 may be adapted to be negated or bypassed to let in a larger volume of fresh air when desired , as for example when a bathroom or kitchen range exhaust vent fan is being operated . in the preferred form of the invention a coil temperature sensor turns the compressor on and off to hold the evaporator coil at a selected dew point temperature range all the time the unit is employed regardless of whether the unit is cooling the room at the time or not . also , in the preferred form of the invention , outside fresh air is pumped through this cold evaporator coil to condense any excess moisture from the fresh air , both when the cooling cycle is in operation as well as when the cooling cycle is not in operation . if for any reason , however , the evaporator coil should be allowed to warm up above that desired dew point temperature range during part or even all of the cooling cycle , or during part of the fresh air ventilating action , does not depart from the scope of this invention as long as the temperature of the evaporator coil is low enough in temperature sufficiently long enough in time during the total period that outside fresh air , and / or recirculated room air is passed over the evaporator coil such as to provide the desired control over the humidity of the space or dwelling without excessively cooling the dwelling . in addition to turn off the flow of outside fresh air during the cooling cycle , or , to permit outside fresh air to flow into the unit and on into the room only during the cooling cycle , does not depart from the intent and spirit of this invention . the fan 18 can run continuously , or a second room air fan can be employed , to continuously circulate room air in and out of the climate control unit or just blow air around in the room to more evenly mix the space air provided it does not circulate this air through the evaporator coil except when cooling is desired . appropriate deflectors , gates and / or ductworks , or other suitable means , can be employed to direct this room air so it bypasses the air pathway through the evporator coil to achieve this desired mixing result . the room air recirculating fan 18 for example can also by employed to bring in fresh outside air concurrently or alternately to recirculating room air to cool the room if proper air flow pathway controls are employed , thus eliminating the fresh air or outside air ventilating fan . the swinging door 6 could for example be weighted , spring loaded , or otherwise controlled to not open when a slower fresh air fan 18 speed is in effect and to only open when a higher speed room air cooling action was initiated by fan 18 . the room air recirculating fan 18 could for example be employed to bring in fresh air only when the unit is in its cooling cycle , with a switching arrangement to bring in outside air alone when cooling is not desired or needed , as in the winter . a liquified refrigerant , or collector , tank can be employed with an expansion vlave in place of the capillary tube 62 , fig2 . other conventional air conditioner control systems can be employed also , such as the room air temperature sensor being located in the room remote from the unit or being located somewhere along the pathway of air 13 as it goes from the room to the air recirculation fan 18 , if that flow pathway continues during non - cooling action . one form of this invention comprises the preceeding described means to control the humidity and freshness of air in a dwelling without appreciably cooling the dwelling by passing a limited volume of outside fresh air across or through a refrigeration evaporator coil maintained at a desired dew point temperature range to condense undesired moisture from the fresh air where the volume of induced and chilled fresh air is insufficient to appreciably cool the dwelling . although i have described an evaporator coil whose temperature is controlled by cycling the compressor on and off , the temperature of the evaporator coil can also be controlled by several other conventional means including sensing the pressure drop across the compressor , by overcharging the system with refrigerant to prevent the coil from freezing up , and by providing a compressor bypass system or cut out system to be used to prevent pumping more refrigerant than needed at the time , and thus prevent over cooling the evaporator coil . any system which prevents the coil from freezing up may be used including pumping a sufficient volume of room and / or outside fresh air through the coil to prevent coil freeze up by exceeding the compressor capacity , may be used so that the compressor can be run continuously along with continuously recirculating room air through the coil . thus the use of a thermostat control can be eliminated . this is especially useful and is a part of this invention where the b . t . u . capacity of the unit is below the cooling needs of the room at the time it is employed to provide both cool and dehumidified air . in some cases a separate independent thermostatically controlled cooling unit can be employed which turns on or off to provide the extra b . t . u . capacity as needed for the space being controlled . appropriate air filters are anticipated to be employed to filter fresh and / or recirculated air . electric resistance heaters can be employed to warm the incoming cold fresh air during cold weather , when fresh air is needed without any cooling and dehumidification , or of course whenever re - heating is desired during the fresh air dehumidification action . it is also understood that other latent heat and sensible heat system other than the one described here , or absorbtion systems , may be used to achieve the cold chamber and cooling coil here described to accomplish the climate control system embodied in this invention . the preferred embodiments of the invention have been illustrated and described , along with several modifications thereon but other changes and modifications can be made and some features can be used in different combinations , without departing from the invention as defined in the claims . | 5 |
as will be illustrated in detail below , the present invention introduces techniques for modifying the output speech of an automatic dialog system in accordance with the detected context of incoming speech , by conveying the appropriate information from a context detector to a natural language generator and speech synthesis system of the automatic dialog system . referring initially to fig1 , a detailed block diagram illustrates a text - to - speech ( tts ) system utilized in an automatic dialog system , according to an embodiment of the present invention . a caller 102 initiates communication with the automatic dialog system , through a spoken message or request . a speech recognition engine 104 receives the sounds sent by caller 102 and associates them with words , thereby recognizing the speech of caller 102 . the words are sent from speech recognition engine 104 to a natural language understanding ( nlu ) unit 106 , which determines the meanings behind the words of caller 102 . these meanings are used to determine what information is desired by caller 102 . a dialog manager 108 in communication with nlu unit 106 retrieves the information requested by caller 102 from a database . dialog manager 106 may also be implemented as a translation system . the retrieved information is sent from dialog manager 108 to a natural language generation ( nlg ) block 110 , which forms a message in response to communication from caller 102 , having the requested information . once the sentence is formed , a speech synthesis system 112 , plays , outputs , or speaks the sentence to the caller with the requested information . nlg block 110 and speech synthesis system 112 may be considered the tts system of the automatic dialog system . it is also in nlg block 110 and speech synthesis system 112 where the present invention is implemented through , for example , the modification of words chosen in nlg block 110 and the adjustment of volume and articulation of output speech in speech synthesis system 112 , in accordance with the detected context of communication received from caller 102 . referring now to fig2 , a detailed block diagram illustrates a tts system utilized in another automatic dialog system , according to an embodiment of the present invention . a caller 202 , a speech recognition engine 204 , a natural language understanding ( nlu ) unit 206 , a dialog manager 208 , a natural language generation ( nlg ) block 210 and a speech synthesis system 212 operate in similar manners to those described above with regard to their respective counterparts in fig1 . the automatic dialog system provided in the embodiment of the invention shown in fig2 also includes a context detector 214 . context detector 214 is shown in communication with caller 202 , speech recognition engine 204 and nlu unit 206 . this communication enables context detector 214 to receive the sounds , words and meanings of the communication so that a context of the incoming communication may be determined . the context of the incoming communication may include , but is not limited to the ambient noise level , the age and gender of caller 202 , the location of caller 202 , the time and date of the call , and the emotional state of caller 202 . context detector 214 is also in communication with nlg block 210 and speech synthesis engine 212 . this communication enables context detector 214 to modify an outgoing message in accordance with any detected context of the communication . for example , as described above , context detector 214 may modify or substitute words chosen in nlg block 210 for the output speech through a markup language generated in context detector 214 . speech components such as , for example , volume and articulation may also be adjusted in speech synthesis system 212 in accordance with a detected context of the incoming communication . referring now to fig3 , a flow diagram illustrates a speech output production methodology in an automatic dialog system , according to an embodiment of the present invention . in block 302 , an incoming communication is received from a user at an automatic dialog system . typically a user of an automatic dialog system is a caller attempting to obtain specific information . in block 304 , words in the communication from the user to the automatic dialog system are transcribed in a speech recognition engine of the automatic dialog system . in block 306 , the meaning of these words are determined through a natural language understanding unit in communication with the speech recognition engine in the automatic dialog system . in block 308 , information is retrieved from a database in accordance with the meaning of the words . the information is typically that which is sought by the user or caller to the automatic dialog system . the database is in communication with the natural language understanding unit in the automatic dialog system . in block 310 , the context the communication from a user to the automatic dialog system is detected in a context detector of the automatic dialog system . the context detector is in communication with the user , the speech recognition engine and the natural language understanding unit so that the context detector may analyze sounds , word choice , word meaning and purpose in determining the context of the communication . as described above , the context of the communication may include but is not limited to the ambient noise level , the age and gender of the caller , the location of the caller , the time and date of the call , and the emotional state of the caller . in block 312 , the requested information is sent from the database to a natural language generator . in block 314 , a message containing the requested information is created in the natural language generator for communication to the caller . the natural language generator is also in communication with the context detector . the creation of the message in the natural language generator may be affected by the context detector . the context detector may , for example , influence the word choice in the composition of the message depending on the context of the communication . this control over the natural language generator is enabled by the sending of a command in a markup language from the context detector to the natural language generator . in block 316 , the message is conveyed to the user through a speech synthesis system that is in communication with the natural language generator . the speech synthesis system is also in communication with the context detector , so that the context detector may affect the speech synthesis of the message . the context detector may adjust the volume , pronunciation , or articulation of the message depending on the determined context of the communication . the context detector may affect one or both of the natural language generator and the speech synthesis system , depending on the detected context of the communication from the user . returning now to the “ lombard ” example presented above , if the context detector determines that the caller is in a noisy location , it could , using markup , inform the nlg system to use maximally intelligible words for easier understanding by the caller . for example , the context detector may program the nlg system to use “ negative ” rather than “ no ,” since “ negative ” would be less confusable with other words . the context detector may also inform the speech synthesis system to adjust the volume and articulation of the engine to speak louder and slower than normal . as another example , the language style of the automatic dialog system could be adapted to fit that of the caller . for example , a caller from the southern part of the united states could be responded to in a southern accent . further , if the context detector estimated the emotional state of the caller to be angry , the output speech could be rendered in a soothing or understanding tone as an attempt at appeasement . while the example has illustrated a telephone - based system , the invention is easily applied in other scenarios such as kiosks and internet - based applications . additional embodiments of the present invention may include different automatic dialog system and tts system components and configurations . the invention may be implemented in any system in which it is desirable to adapt output speech in accordance with the context of the communication . referring now to fig4 , a block diagram illustrates an illustrative hardware implementation of a computing system in accordance with which one or more components / methodologies of the invention ( e . g ., components / methodologies described in the context of fig1 - 3 ) may be implemented , according to an embodiment of the present invention . for instance , such a computing system in fig4 may implement the automatic dialog system and the executing program of fig1 - 3 . as shown , the computer system may be implemented in accordance with a processor 410 , a memory 412 , i / o devices 414 , and a network interface 416 , coupled via a computer bus 418 or alternate connection arrangement . it is to be appreciated that the term “ processor ” as used herein is intended to include any processing device , such as , for example , one that includes a cpu ( central processing unit ) and / or other processing circuitry . it is also to be understood that the term “ processor ” may refer to more than one processing device and that various elements associated with a processing device may be shared by other processing devices . the term “ memory ” as used herein is intended to include memory associated with a processor or cpu , such as , for example , ram , rom , a fixed memory device ( e . g ., hard drive ), a removable memory device ( e . g ., diskette ), flash memory , etc . in addition , the phrase “ input / output devices ” or “ i / o devices ” as used herein is intended to include , for example , one or more input devices for entering speech or text into the processing unit , and / or one or more output devices for outputting speech associated with the processing unit . the user input speech and the tts system annotated output speech may be provided in accordance with one or more of the i / o devices . still further , the phrase “ network interface ” as used herein is intended to include , for example , one or more transceivers to permit the computer system to communicate with another computer system via an appropriate communications protocol . software components including instructions or code for performing the methodologies described herein may be stored in one or more of the associated memory devices ( e . g ., rom , fixed or removable memory ) and , when ready to be utilized , loaded in part or in whole ( e . g ., into ram ) and executed by a cpu . although illustrative embodiments of the present invention have been described herein with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments , and that various other changes and modifications may be made by one skilled in the art without departing from the scope or spirit of the invention . | 6 |
the improved soft powdered vinylic filler products are made following the procedures given in u . s . pat . nos . 3 , 190 , 850 and 3 , 423 , 358 with the additional incorporation into the manufacturing step , prior to the isolation from the aqueous phase , of the necessary materials and procedures provided for by the present invention . it has been found helpful , although not essential , to modify the equipment utilized at this point by incorporating into the vessel used for the treatment , baffles to increase the agitation and produce a turbulent flow of material to effect more efficient and intimate mixing of the component ingredients thereof . it has also been found useful to ensure intimate and effective association of the soft powdering ingredients with the vinylic filler particles and the treatment therewith take place for a sufficient period of time at a temperature sufficiently high to ensure the adequate conditioning of the vinylic filler or vinylic pigment particles . typical procedures for practice of the invention are fully disclosed in the following examples , wherein examples a , b , and c are non - colored vinylic filler examples and examples 1 - 33 are colored vinylic filler examples . such detailed procedures show in each case the inclusion of the soft powdering ingredients and the addition of coagulant to cause the primary or colloidal particles of the latex to agglomerate into clusters of filterable size so that the product may be filtered , washed and dried into the soft friable form provided by the present invention . it is to be understood that the term &# 34 ; drying &# 34 ; as used herein connotes both oven type or drum drying by convection or hot air currents and / or heating coils and also spray drying of the treated product either prior to filtration or subsequent thereto , that the term &# 34 ; primary particles &# 34 ; as defined and used herein has its accepted meaning in the field of colloidal chemistry , which is set forth for examples in &# 34 ; the colloidal chemistry of silica and silicates &# 34 ; by ralph k . iler ( cornell unversity press , 1955 ) at pages 129 - 130 , and in &# 34 ; colloidal dispersions &# 34 ; by earl k . fischer of the national bureau of standards , washington , d . c . ( john wiley & amp ; sons , inc ., new york ) at pages 3 - 7 . to a vessel equipped with stirrer , temperature controls and baffles for inducing turbulent flow agitation was charged 500 ml . of vinylic filler latex of the aforesaid type i - b containing 26 . 8 % solids and 1000 ml . of water . the mixture was stirred for 10 minutes at 28 ° c . and then 40 ml . of a 20 % solution of a dioctyl ester of sodium sulfosuccinic acid dissolved in solvesso 140 was added , followed by 50 grams of glacial acetic acid dissolved in 150 ml . of water . the coagulated slurry was heated to 80 ° c . and held at this temperature for 5 hours , then filtered , washed acid free and oven dried . a yield of 140 grams of soft white vinylic filler product was obtained which was found to give excellent reinforcing properties when mill incorporated into rubber compounding formulations , yielding tensiles of over 3 , 000 p . s . i ., comparable to the tensiles obtained from specimens produced by wet masterbatching of the same rubber in the same proportions , dry basis by weight , with never dried type i - b vinylic filler latex . the procedure of the preceding example was followed with the exception that in place of the 50 grams of glacial acetic acid was used 50 grams of sodium hydroxide dissolved in 170 ml . of water . the product on filtering , washing alkali free and drying was found to be extremely soft and had similar excellent reinforcing characteristics when mill or banbury incorporated into rubber compounding formulations . the procedure of example a was followed with the exception that , after filtering and washing the product acid free , the essentially salt free presscake was reslurried in 700 ml . of water and the slurry so formed was then spray dried . the soft powdering product in particulate spray dried form , had similar utility to that of the oven dried example . to a vessel equipped with stirrer , temperature controls and baffles for inducing turbulent flow agitation was charged 150 ml . of acidic vinylic filler latex of the aforesaid type i - d containing 26 . 9 % dry solids , 10 grams of croceine scarlet 3ba conc . ( acid red 73 - ci no . 27290 ) dissolved in 200 ml . of water . the mixture was stirred for 30 minutes at 28 °- 30 ° c . and the temperature then raised to 50 ° c . and 5 grams of sodium tungstate dissolved in 200 ml . of water then run in during 10 minutes . 15 ml . of a 20 % solution of a dioctyl ester of sodium sulfosuccinic acid in solvesso 140 was then added and the vinylic pigment heated during 1 hour to 80 ° c ., acidified to a ph of 5 - 6 with acetic acid , and held at this temperature for 4 hours . on filtering a bright red vinylic pigment was obtained which on drying became extremely soft and friable and could be readily dispersed in oil based systems , elastomers and plastomers . to a vessel equipped as in example 1 was charged 200 ml . of basic vinylic filler latex of the aforesaid type i - g , 300 ml . of water and a solution of 10 grams of alizarin sapphirol b , ( acid blue 45 , ci no . 63010 ) run in at 25 °- 30 ° c . the temperature was raised to 45 °- 50 ° c . during 30 minutes and then 10 ml . of hydroxy acetic acid added drop - wise , followed by a solution of 10 grams of barium chloride dissolved in 100 ml . of water . the reaction was stirred for 20 minutes at 45 °- 50 ° c . and then 15 ml . of a 20 % solution of diamyl sodium sulfosuccinate in solvesso 140 added , and the reaction heated to 80 °- 85 ° c . and held at this temperature for 4 - 5 hours . the water soluble salts were removed by filtration and washing , and the product was then oven dried . an extremely soft bright blue vinylic pigment resulted , which could be packaged without comminution , and was suitable for incorporation directly into oil based and thermoplastic systems . to a vessel equipped as in the preceding examples was charged 200 ml . of acid vinylic filler latex of the aforesaid type i - d , 500 ml . of water , and a solution of 30 grams of yellow t extra ( acid yellow 23 , ci no . 19140 ) dissolved in 300 ml . of warm water was run in with agitation . the reaction was then stirred and heated to 70 °- 75 ° c . and held 1 hour at that temperature , at which point 30 ml . of glacial acetic acid diluted with 300 ml . of water were run in to coagulate and precipitate the bright yellow vinylic pigment . 25 ml . of a 10 % solution of sorbitan monolaurate in solvent naphtha were added and the temperature held at 75 °- 80 ° c . for 5 hours . the vinylic pigment product was isolated as in the preceding example , forming an extremely soft textured pigment immediately suitable for packaging and for use in oil based systems . the procedure of example 3 was followed with the exception that during the initial heating step 10 grams of lead nitrate dissolved in 100 ml . of water were added to further insolubilize the dyestuff . the dried product had similar advantages . to a vessel equipped as in the preceding experiments was charged 100 ml . of acidic type filler latex of the aforesaid type i - d containing 26 . 4 % solids , 300 ml . of water and 10 grams of chrysophenine g ( direct yellow 12 , ci no . 24895 ) dissolved in 200 ml . of warm water . the mixture was stirred for 10 minutes at 28 °- 30 ° c . and then 20 grams of barium chloride dissolved in 100 ml . of water added to insolubilize the dye . the reaction was then heated to 75 °- 80 ° c . during 2 hours and at this point 20 ml . of a 10 % solution of octylphenoxymethoxyethanol in solvesso 140 was added and the reaction held at 80 ° c . for a further 4 hours . the vinylic pigment was then filtered , washed and dried in an oven at 70 ° c . and gave a bright yellow pigment which was extremely soft and ready for packaging and incorporation in oil based systems and plastomers , and as a reinforcing and coloring filler for elastomers . to a vessel equipped as in the preceding examples was charged 100 ml . of a basic vinylic filler latex of the aforesaid type i - g containing 26 . 9 % solids , 300 ml . of water and 10 grams of fast blue ffb ( direct blue 71 , ci no . 34140 ) dissolved in 150 ml . of water . the mixture was stirred for 10 minutes followed by the addition of 10 grams of zinc chloride dissolved in 200 ml . of water . stirring was continued and the temperature raised to 80 ° c . during 2 hours at which time 15 ml . of 20 % solution of bis ( tridecyl ) ester of sodium sulfosuccinic acid in solvent naphtha was added and the reaction held for 3 hours longer at 80 °- 85 ° c . the product was filtered and washed to give a bright blue vinylic pigment presscake which on drying was extremely soft and friable and ready for packaging and for use in thermoplastic and oil based systems . to a vessel equipped as in the preceding examples was charged 150 ml . of vinylic filler latex of the aforesaid type ii - d containing 14 . 9 % solids , 10 grams of diazine scarlet a conc . 200 % dissolved in 200 ml . of water at 90 ° c ., 250 grams of ice and agitated for 5 minutes , then was added 6 ml . of 37 % hydrochloric acid and 0 . 7 grams of sodium nitrate dissolved in 10 ml . of water . at the end of 15 minutes the diazotization was complete and during this time ice was added to hold the temperature at 15 ° c . then 2 grams of beta naphthol and 1 gram of potassium hydroxide was dissolved in 30 ml . of water at 90 ° c . and this solution was added to the reaction vessel while agitating , and for 15 minutes the temperature was maintained at 15 ° c . with ice , then over the next half allowed to rise to 22 ° c . after another 30 minutes of agitation , coupling was complete . a drop of the mix on filter paper showed no bleeding and a filtered sample developed no color in the filtrate . 20 ml . of a 20 % solution of bis ( tridecyl ) ester of sodium sulfosuccinate dissolved in solvent naphtha was then added together with 200 ml . of water and the temperature raised during 1 hour to 75 °- 80 ° c . and held at this temperature for 5 hours . the bright red vinylic pigment was then filtered , washed and dried in the oven at 75 °- 80 ° c . the product was extremely soft and required no crushing or grinding to ready it for packaging or for use in oil based systems as a colorant . to a vessel equipped as in the preceding examples was charged 200 ml . of basic vinylic filler latex of the aforesaid type ii - g with 26 . 9 % solids content , 10 grams of diazine scarlet a conc . 200 % dissolved in 200 ml . of water at 90 ° c . and 5 ml . of triethanolamine . after agitating for 15 minutes 10 grams of aluminum chloride dissolved in 50 ml . of water was added and the red vinylic pigment was formed . 40 ml . of a 10 % solution of sorbitan monolaurate in solvesso 140 was added and the temperature raised to 80 °- 85 ° c . and held within this range for 4 hours . the slurry was filtered , washed and dried to give a bright red vinylic pigment , which like the preceding example was extremely soft and friable and required no crushing or grinding to ready it for packaging or for use as a pigment . the aforesaid publications of burke show that if azo colors , formed from soluble materials to yield the insoluble azo colors , are formed in the presence of vinylic filler particles , then even though the vinylic filler is completely insoluble , the azo color will form on the surface of the vinylic filler , yielding vinylic pigment particles of colloidal size . the field of azo colors is very broad , thus the examples here , as elsewhere in this description , are meant to be illustrative of the soft powdering of said azo vinylic pigments and are not to be construed as limiting . to a vessel equipped as in the preceding examples was charged 7 grams of p - nitroaniline , 200 ml . of cold water and 20 ml . of 37 % hcl . as soon as a solution formed , 100 ml . of vinylic filler latex of the aforesaid type ii - d containing 26 . 4 % solids were added . to this mix were added 300 grams of ice and the temperature dropped to 0 ° c . with ice still present . then 6 ml . of glacial acetic acid followed by 3 . 5 grams of sodium nitrite dissolved in 20 ml . of water were added . the diazotization took place rapidly and was completed in about 15 minutes . a solution wwas prepared of 7 grams of beta - naphthol , 5 grams of caustic soda , and 100 ml . of water , and this solution was added to the water dispersion . ice was added from time to time holding the coupling temperature at about 5 ° c . for 30 minutes ; then the temperature was allowed to rise to 45 ° c . over the next 30 minutes . from time to time a sample was taken and filtered and the filtrate observed to determine whether additional coupling was taking place . after another half - hour at a temperature of from 45 °- 50 ° c . coupling was complete . 30 ml . of a 10 % solution of a dioctyl ester of sodium sulfosuccinic acid in solvesso 140 were added and the temperature raised to 75 °- 80 ° c . during 1 hour and held at this range for a further 3 - 4 hours . the resulting red vinylic pigment was then filtered , washed and dried in an oven at 60 °- 70 ° c ., producing a soft , friable dry pigment ready for packaging and for incorporation into oil based color systems . to a vessel equipped as in the preceding examples were charged 150 ml . of vinylic filler latex of the aforesaid type i - b containing 26 . 8 % solids , 200 ml . of water , a solution consisting of 7 . 4 grams of beta naphthol and 2 . 2 grams of caustic soda and 50 ml . of water , a solution of 8 . 6 grams of tobias acid and 2 . 2 grams of caustic soda and 50 ml . of water , followed by 300 grams of ice to drop the temperature to 0 ° c . with high speed agitation 12 . 5 ml . of 37 % hydrochloric acid and 2 . 5 ml . of glacial acetic acid were added and the temperature rose 5 ° c . then 3 . 5 grams of sodium nitrate ws added ; the color changed to yellow and the diazotization was allowed to proceed for 5 minutes , then 30 ml . of 10 % sodium hydroxide were added and the color turned orange . over a 15 minute period thte temperature was allowed to rise to 40 ° c . and the color was still orange . then a solution of 10 grams of barium chloride dissolved in 100 ml . of water was added and the color changed to deep orange . rapid agitation was continued for 30 minutes during which time the temperature rose to 60 ° c . and the color deepened to a typical lithol red r shade . the resulting vinylic pigment was carefully filtered , reslurried in water and again filtered . three filtrations and reslurryings removed the soluble salts and the product was finally reslurried in 700 ml . of water ; 20 ml . of a solution of sorbitan monolaurate dissolved in solvent naphtha was added , and the mixture was heated to 80 ° c . the temperature was held at 80 ° c . for 4 hours and then spray dried to yield a red vinylic pigment that was extremely soft and ready for packaging and for use in thermoplastic and oil based systems . to a vessel equipped as in the preceding examples was charged 200 ml . of vinylic filler latex containing surface carboxylic groups above designated as type i - d latex having 26 . 4 % solids content . following was added 10 grams of alizarien red s ( mordant red ii , ci no . 5800 ) dissolved in 200 ml . of water at 50 ° c . containing 3 grams of caustic soda . then were added 4 grams of aluminum acetate , 4 . 7 grams of calcium acetate 5 . 7 grams of stannous chloride , and 10 grams of sodium sulfite , each dissolved in 50 ml . of water . after stirring for 5 minutes , 3 ml . of 90 % formic acid were added , followed by 3 grams of oxalic acid added dry to the mix while agitating , and then heated , by means of a steam tube to introduce live steam , to 95 ° c . for 5 minutes . thereafter the mass was diluted with an equal volume of water , filtered and washed carefully to remove all salts . the product was reslurried in 500 ml . of water and 20 ml . of a 20 % solution of octylphenoxydimethoxyethanol in solvesso 140 , added . with agitation the temperature was raised during 7 hours to 80 °- 85 ° c . and held there for 5 hours . the red alizarine vinylic pigment cake was then filtered , washed and dried . an extremely soft powdery product was obtained suitable for packaging and use in oil based systems . to a reaction vessel equipped as in the preceding examples were charged 400 ml . of water , 10 grams of caustic soda , 10 grams of sodium hydrosulfite , and 10 grams of the indanthrene blue designated as carbanthrene ptg . blue gcd dbl . pdr . ( vat blue 14 , ci no . 69810 ). during 10 minutes the dyes reduced to the leuco form while stirring very slowly and by means of a steam tube , slowly raising the temperature to 60 ° c . then were added 100 ml . of a neutral vinylic filler type i - b aforesaid of 26 . 8 % solids content . the leuco vat dye in the presence of the vinylic filler latex was now oxidized by adding to the mix 10 grams of potassium persulfate . the oxidation was carried out with vigorous agitation and in another 10 minutes the product was completely oxidized , for the filtrate of a sample was colorless . the vinylic pigment suspension was diluted with an equal volume of water and 30 ml . of a 20 % solution of diamyl sodium sulfosuccinate in solvent naphtha were added . the temperature was then raised to 75 °- 80 ° c . and held there for 4 - 5 hours . the bright blue vinylic pigment was then filtered , and the filter cake carefully washed until all water soluble salts were removed . a portion of the treated filter cake was dried in an oven at 70 ° c . a further portion of the treated filter cake was reslurried in sufficient water to give a 20 % solids content and spray dried . when isolated in the dry form either by oven or spray drying the pigment was extremely soft and friable and could be redispersed in the vehicle of intended use with the minimum of mechanical effort , giving a fully developed coloration of same , free of undesirable specks or agglomerations . in place of the neutral vinylic filler an acid vinylic filler is used and the dye prepared according to the preceding example . alternatively , in this case , the vinylic filler can be surfaced with a heavy metal salt which will in some cases effect the shade . for example , to 100 grams of vinylic filler containing free carboxylic groups above designated as ii - d with 26 . 4 % solids , was added 5 grams of caustic soda and 400 ml . of water in the reaction vessel and then 7 grams of aluminum chloride and 7 grams of calcium chloride each dissolved in 50 ml . of water were added . the latex thickened , but experience had shown that this would not prevent the leuco vat dye from being oxidized on the surface of these vinylic filler particles . the leuco dye of the indanthrene blue was prepared in the same manner as the previous example , and the metal salted vinylic filler latex was added thereto and the mix oxidized to coat the insoluble vinylic pigment with insoluble vat dyestuff . the soft powdering procedure of example 12 was then carried out and the product isolated and oven dried as in the previous example , and had similar utility . the first example of a vinylic pigment from carbanthrene ptg . blue gcd dble . pdr . was prepared according to example 12 except that a basic vinylic filler latex designated at type i - g containing 26 . 9 % solids was used in place of type i - b . this example yielded comparable results . this example was the same as the preceding example , except that a graft vinylic filler type ii - a with 22 . 6 % solids was used in place of the type i - g vinylic filler latex . the results were similar . to the reaction vessel was charged 400 ml . of water , 10 grams of caustic soda , 10 grams of sodium hydrosulfite , 10 grams of carbanthrene red bn dble . flakes , and then with very slow agitation the mix was heated by the steam tube and at 45 ° c . a clear blue solution was formed . to this leuco dye solution was added 100 ml . of the above vinylic filler latex type i - g of 26 . 9 % solids , and for 5 minutes this was rigidly agitated . then 10 grams of potassium persulfate were added and the color changed from blue to red . after 10 minutes of agitation a sample was tested for bleeding and the filtrate was clear , indicating all the leuco dye was converted to the insoluble vat form on the surface of the vinylic filler particles . the mix was diluted with an equal part of water and 30 ml . of the soft powdering agent added as in example 12 . the pigment dispersion was then heated to 80 ° c . and held at this temperature for 4 hours . the red vinylic pigment was then filtered , washed free of soluble salts and oven dried , which yielded a soft powdered pigment ready for packaging and use . this example was prepared in the same manner as the preceding example , except acidic vinylic filler latex type i - d of 26 . 4 % solids was used in place of i - g vinylic filler latex . the results were similar . the examples given hereafter illustrate that never previously dried vinylic pigments from basic dyestuffs can also be treated to render the ensuing pigment particle soft and readily redispersible after drying . to a reaction vessel equipped as in the preceding examples was charged 200 ml . of vinylic filler of the aforeseaid type latex i - d containing 26 . 4 % solids , 15 grams of propylene glycol 1024 , 200 ml . of water , a solution of 5 grams of victoria green wb crystal ( basic green 4 , ci no . 4200 ) dissolved in 200 ml . of water at 80 °- 90 ° 0 c . after stirring for 15 minutes no color bleeding was observed on spot testing on filter paper . 30 ml . of a 10 % solution of polyethylene sorbitan monolaurate in solvesso 140 was added and the suspension of vinylic pigment heated for 4 hours at 85 °- 90 ° c . on filtering , washing , and drying a soft , bright green vinylic pigment was obtained which was extremely soft and required no further mechanical grinding to be ready for packaging and incorporation into pigment formulations . this is similar to the previous example except instead of the basic dye victoria green wb crystals , 5 grams of fuchsine y fine crystals was used ( basic violet 14 , ci . 42510 ). the results were similar . to a reaction vessel equipped as in the foregoing examples was charged 200 ml . of graft vinylic filler latex of the aforesaid type ii - a containing 22 . 6 % solids and 500 ml . of water ; then 10 grams of auramine o conc . 130 % ( basic yellow 2 , ci no . 41000 ) dissolved in 200 ml . of water at 95 ° 0 c . was added and stirred well . a solution of 8 grams of tannic acid to 40 ml . of water was prepared and added followed by 12 grams of antimony potassium tartrate dissolved in 50 ml . of water . after mixing , the never previously dried vinylic pigment was treated with a soft powdering agent as in example 19 . a bright yellow vinylic pigment was obtained on separation of the coagulum from the serum by filtration and washing . when dried this soft powdered pigment product was suitable for packaging and use as a pigment . to the reaction vessel was charged 200 ml . of vinyl filler latex type i - g containing 26 . 9 % solids and 400 ml . of water . with rapid stirring was further added 10 grams of methyl violet 2b conc . 125 % ( basic violet 1 , ci no 42535 ), dissolved in 100 ml . of water at 95 ° c . ; after agitating for 10 minutes there was added a solution of 5 grams of ammonium molybdate dissolved in 50 ml . of water and 2 ml . of conc . hydrochloric acid dissolved in 20 ml . of water . after stirring for 5 minutes the reaction was heated to 90 ° c . during 1 hour and 20 ml . of a 20 % solution of a dioctyl ester of sodium sulfosuccinic acid in solvesso 140 was added . the mixture was held at 85 °- 90 ° c . for 4 hours , filtered , washed and dried to yield a dry extremely soft textured pigment suitable for use , e . g . for reinforcing and coloring elastomers and for coloration of nonrigid or rigid thermoplastic material . this example was prepared in a quantity and a manner similar to the preceding example except that in place of the methyl violet there was used 10 grams of crystal violet super fine ( basic violet 3 , ci no . 42555 ) and in addition to the ammonium molybdate was added 2 grams of disodium phosphate dissolved in 20 ml . of water . the treated vinylic pigment was carefully filtered and washed and during this filtration operation no color was present in the filtrate indicating a stable pigment had formed . the presscake was dried to yield a product useful as indicated in the preceding example . this example was prepared in quantity and in a manner similar to the previous example except that in place of the crystal violet there was used 10 grams of calcozine blue r ex . conc . ( victoria blue b ) ( basic blue 7 , ci no . 42595 ) and as metallic mordant for this basic dyestuff in place of the ammonium molybdate and disodium phosphate , was used 5 grams of sodium tungstate dissolved in 50 ml . of water . the blue vinylic pigment formed with complete exhaustion of color from the water , and was treated isolated and dried as in the preceding example to yield a soft deep blue pigment with the same uses . this example was prepared in a manner and quantity similar to the previous example except in place of the basic dyestuff victoria blue , was used 10 grams of calcozine red 6g ex . ( rhodamine 6g ) ( basic red 1 , ci no . 45160 ) and as the mordant in addition to the sodium tungstate there was added 2 grams of disodium phosphate dissolved in 20 ml . of water . the red vinylic pigment formed with complete exhaustion of the basic color from the water medium , and the treated vinylic pigment , as in the preceding examples , was extremely soft on drying , and had similar utility in thermoplastic systems . to a reaction vessel equipped as in the preceding examples was charged 200 ml . of graft vinylic filler latex designated as type ii - a , 500 ml . of water , 10 grams of rhodamine b conc . 500 % ( basic violet 10 , ci no . 45170 ) dissolved in 200 ml . of water at 90 ° c ., and the mix was well agitated . the metallic mordant solution was prepared by dissolving 1 . 7 grams of sodium molybdate , 3 . 0 grams of sodium tungstate and 1 . 1 grams of disodium phosphate in 50 ml . of warm water . following the addition of the mordant solution there was added 5 ml . of concentrated hydrochloric acid ( 37 % hcl ) diluted with 30 ml . of water . during 15 minutes the mix was heated to 90 ° c ., during which period it was vigorously agitated . the violet red vinylic pigment formed with complete exhaustion of the basic color from the water . 20 ml . of a 10 % solution of polyethylene sorbitan monolaurate in solvesso 140 was then added and the reaction held at 85 °- 90 ° c . for 5 hours . the product was then filtered , washed and oven dried , yielding an extremely soft pigment ready for packaging and use , e . g . for reinforcing and coloring elastomers and for coloration in nonrigid and rigid thermoplastic systems . to a reaction vessel equipped as in the previous examples was charged 400 ml . of water 10 grams of sodium hydroxide and 10 grams of sulfur bordeaux 9r ( sulfur red 6 , ci no . 53720 ). after heating to 60 ° c . the dye was in solution and at this point 100 ml . of acidic vinylic filler latex type i - d , containing 26 . 4 % solids was run in . after 5 minutes 110 ml . of 10 % sulfuric acid was added and the color changed to reddish purple . the slurry was then heated to 85 °- 90 ° c . and 20 ml . of a 20 % solution of a dioctyl ester of sodium sulfosuccinic acid in solvesso 140 was added and heating continued at 85 °- 90 ° c . for 4 hours . the so treated vinylic pigment was filtered , washed and oven dried and yielded a soft friable pigment product ready to use in pigment applications . in a manner similar to the preceding example , a dark blue , soft powdering vinylic pigment was prepared using 10 grams of sulfur direct blue n conc . ( sulfur blue 15 , ci no . 53540 ), which had similar advantages . we have discovered that vinylic pigments having pigmentation of inorganic origin , can be conditioned according to the present invention with advantage . the graft - formed vinylic filler latex used in the following examples was prepared according to the following recipe : a polymeric emulsifier was prepared by polymerizing 70 grams of styrene , 80 grams of maleic anhydride in 1300 grams of benzene using 2 . 25 grams of benzoyl peroxide as catalyst and 1 . 5 grams of tertiary dodecyl mercaptan as modifier . the polymerization was carried out over a 3 hour period at the reflux temperature of benzene . the co - polymer as a white powder was filtered from the benzene and dried . with this polymeric emulsifier graft - formed vinylic fillers were prepared as exemplified by the following recipe according to this recipe there was charged to a pressure bottle 10 grams maleic anhydride - styrene co - polymer prepared as heretofore described dissolved in 620 ml . of water containing 14 . 5 ml . of 28 % aqueous ammonia and 0 . 5 grams of lauryl sodium sulfonate ( duponol me ). then there were charged 85 grams of styrene , 15 grams of ethyleneglycoldimethacrylate and as catalyst 1 gram of ammonium persulfate and 0 . 5 gram of sodium hydrogen sulfite . the polymerization was carried out at 60 ° c . for 12 hours and the conversion of the monomers to polymer was complete . this graft - formed vinylic filler latex was used in the following examples 28 to 30 . while only a single type of vinylic filler was used in the following examples as the basis for forming the vinylic pigments with inorganic pigmentation , it is understood that any of the vinylic and graft vinylic fillers can be used . it is cautioned that in forming a pigment like the vinylic cadmium orange pigment it is important that the vinylic fillers be prepared from recipes free of iron or any other heavy metal salts capable of forming dark sulfides which would contaminate the orange color of the cadmium sulfide vinylic pigment . in this example a vinylic filler pigmented with lead chromate is treated in accordance with this invention . to a reaction vessel equipped as in the preceding examples was charged 100 ml . of the graft formed vinylic filler latex prepared as heretofore described and such latex had been heated to 95 ° c . first , a solution was prepared by adding 30 . 4 grams of lead acetate to 160 ml . of boiling water and this was added to the latex followed by a solution consisting of 12 grams of potassium bichromate dissolved in 160 ml . of boiling water . during the addition of the lead acetate solution to the vinylic filler latex thickened and the agitation was continued for 2 minutes and then potassium bichromate solution was added and agitation continued for 15 minutes . the golden yellow vinylic pigment was filtered and the filter cake was redispersed in 500 ml . of water and 20 ml . of a 20 % solution of diamyl sodium sulfosuccinate in solvesso 140 was added . the temperature was raised to 80 °- 85 ° c . with vigorous agitation and held at this range for 4 hours . on filtering , washing and oven drying of the treated vinylic filler pigment , a soft powdered vinylic chrome yellow pigment was obtained which was suitable for pigment use in oil based and thermoplastic systems . in this example a vinylic filler pigmented with cadmium sulfide is subjected to the treatment of this invention and dried . to a reaction vessel equipped as in the preceding examples was charged 100 ml . of the vinylic filler latex prepared by the foregoing recipe and 100 ml . of water . with vigorous agitation was added 17 grams of cadmium nitrate dissolved in 50 ml . of water followed by 5 ml . of glacial acetic acid . then 12 grams of sodium sulfide dissolved in 50 ml . of water was added to form the bright orange vinylic pigment . the resulting vinylic pigment was filtered and the filter cake redispersed in 500 ml . of water containing 20 ml . of a 20 % solution of diamyl sodium sulfosuccinate in solvent naphtha . with vigorous agitation the temperature was raised to 80 ° c . and held there for 4 hours . on filtering , washing and drying a bright orange vinylic cadmium pigment was obtained which was extremely soft and ready for use as in the preceding example . in this example a vinylic filler pigmented with a prussian blue type compound , is subjected to the treatment of this invention and dried . to a reaction vessel equipped as in the preceding examples was charged 100 ml . of the vinylic filler latex prepared as heretofore described and this latex was agitated . then a solution of 13 grams of ferrous sulfate dissolved in 100 ml . of water was added followed by a solution of 10 grams of potassium ferrocyanide dissolved in 100 ml . of water . as agitation continued the greyish color mix began to turn green and then 7 . 5 ml . of concentrated nitric acid dissolved in 20 ml . of water was added and the color began to change to blue . after 30 minutes of agitation the deep prussian blue vinylic pigment had formed which was diluted with water and filtered . the filter cake was reslurried in 500 ml . of water to which 2 ml . of concentrated nitric acid was added and filtered and again the filter cake was dispersed in 500 ml . of water and 20 ml . of a 20 % solution of dioctyl ester of sodium sulfosuccinic acid in solvesso 140 added . the reaction was heated with good agitation to 75 °- 80 ° c . and held at this temperature for 4 - 5 hours . on filtering , washing and drying a bright blue soft vinylic pigment was obtained ready for use as a color pigment . to a vessel equipped as in example 1 was charged with stirring 500 ml . of acidic vinylic filler latex type i - d containing 26 . 9 % dry solids and 1000 ml . of water . sufficient crushed ice was added to lower the temperature to 5 ° c . - 10 ° c . and 100 ml . of titanium tetrachloride slowly added drop - wise during a period of 30 minutes , maintaining the temperature of the reaction between 5 ° and 7 ° c . with additional crushed ice as required . when the addition of the titanium tetrachloride was completed the finely divided strongly acidic precipitate of titanium dioxide on vinylic filler was stirred for 1 hour concurrently heating the slurry to 40 ° c . the product was then filtered and the cake immediately reslurried in 2000 ml . of 28 ° c . water . 40 ml . of a 20 % solution of diamyl sodium sulfosuccinate dissolved in solvent naphtha were run in and the slurry heated during 1 hour to 80 ° c . and held at that temperature for 5 hours . the product was then filtered , washed acid free and oven dried to yield 220 grams of a very soft intensely white vinylic filler pigment ready for packaging for use in oil based and thermoplastic systems . to a vessel equipped as in example 1 was charged with stirring 500 ml . of vinylic filler latex type i - b containing 26 . 8 % dry solids and 700 ml . of water . 100 grams of 28 % &# 34 ; n &# 34 ; sodium silicate diluted with 200 ml . of water was run in followed by sufficient 10 % aqueous sulfuric acid to adjust the ph to 5 . 0 , added slowly during a 2 hour period . the precipitated silicon dioxide / vinylic filler composite was stirred for 30 minutes and then 40 ml . of a 20 % solution of a dioctyl ester of sodium sulfosuccinic acid dissolved in solvent naphtha added . the temperature was raised to 80 ° c . during 1 hour and the slurry held at this temperature for a further 5 hours . the product was separated from the serum by filtration , and the filter cake washed acid free and oven dried to yield 160 grams of an extremely soft vinylic filler composition with the silicon dioxide precipitated thereon and adhered to the surface of the particles thereof . this soft powdered vinylic filler pigment was ready for use , without further treatment , in oil based and thermoplastic systems . the procedure of example 31 was followed with the exception that , after filtering and washing the product acid free , the essentially salt free presscake was reslurried in 1100 ml . of water and the slurry so formed was then spray dried to yield the product in particulate spray dried soft powdered form , with similar utility as in the oven dried example . while there have been described herein what are at present considered preferred embodiments of the invention , it will be obvious to those skilled in the art that modifications and changes may be made therein without departing from the essence of the invention . it is , therefore , to be understood that the exemplary embodiments are illustrative and not restrictive of the invention , the scope of which is defined in the appended claims , and that all modifications that come within the meaning and range of equivalents of the claims are intended to be included therein . | 2 |
i have discovered that higher boiling carboxylic acids , either alone or in mixtures , will effectively enhance the relative volatility of formic acid to acetic acid and permit the separation of formic acid from acetic acid by rectification when employed as the agent in extractive distillation . table 2 lists several carboxylic acids and their mixtures and the approximate proportions that i have found to be effective . the data in table 2 was obtained in a vapor - liquid equilibrium still . in each case , the starting material was a mixture containing 40 % water , 32 % formic acid and 28 % acetic acid . the ratios are the parts by weight of extractive agent used per part of water - formic acid - acetic acid mixture . the relative volatilities are listed for each of the two ratios employed . the compounds which are effective when used alone are hexanoic acid , heptanoic acid , octanoic acid , pelargonic acid and neodecanoic acid . the compounds which are effective when used in mixtures are m - toluic acid , itaconic acid , methyl benzoate , methyl salicylate , nitrobenzene and acetophenone . the relative volatlities shown in table 2 correspond to the two different ratios investigated . for example , in table 2 , two parts of hexanoic acid mixed with one part of the water - formic acid - acetic acid mixture give a relative volatility of 1 . 5 ; 12 / 5 parts of hexanoic acid give 1 . 4 . one part of pelargonic acid plus one part of hexanoic acid mixed with one part of the water - formic acid - acetic acid mixture gives a relative volatility of 1 . 5 ; 6 / 5 parts of pelargonic acid plus 6 / 5 parts of hexanoic acid give a relative volatility of 1 . 8 . with no agent present , the relative volatility of formic acid to acetic acid is 1 . 15 . one of the compounds , pelargonic acid , listed in table 2 and whose relative volatility had been determined in the vapor liquid equilibrium still , was then evaluated in a glass perforated plate rectification column possessing 4 . 5 theoretical plates and the results listed in table 3 . the data in table 3 was obtained in the following manner . the charge was 40 % water , 32 % formic acid and 28 % acetic acid and after one hour of operation in the 4 . 5 theoretical plate column to establish equilibrium , pelargonic acid at 95 ° c . and 20 ml / min . was pumped in . the rectification was continued with sampling after one - half hour , one hour and 1 . 5 hours . the analysis is shown in table 3 and after 1 . 5 hours was 75 % water , 14 % formic acid and 11 % acetic acid in the overhead and 12 % water , 15 % formic acid and 73 % acetic acid in table 2__________________________________________________________________________effective agents for separating formic acid from acetic acidcompounds ratios relative volatilities__________________________________________________________________________none 1 . 15hexanoic acid 1 6 / 5 1 . 5 1 . 4hexanoic acid , pelargonic acid ( 1 / 2 ). sup . 2 ( 3 / 5 ). sup . 2 1 . 5 1 . 8hexanoic acid , heptanoic acid &# 34 ; &# 34 ; 1 . 3 1 . 8hexanoic acid , neodecanoic acid &# 34 ; &# 34 ; 1 . 7 1 . 9hexanoic acid , neodecanoic acid , acetophenone ( 1 / 3 ). sup . 3 ( 2 / 5 ). sup . 3 1 . 5 1 . 4heptanoic acid 1 -- 1 . 3 -- octanoic acid &# 34 ; -- 1 . 4 -- octanoic acid , itaconic acid ( 1 / 2 ). sup . 2 ( 3 / 5 ). sup . 2 2 . 2 1 . 7pelargonic acid 1 -- 1 . 5 -- pelargonic acid , methyl benzoate ( 1 / 2 ). sup . 2 ( 3 / 5 ). sup . 2 1 . 5 1 . 5pelargonic acid , nitrobenzene &# 34 ; &# 34 ; 1 . 7 1 . 8pelargonic acid , nitrobenzene , itaconic acid ( 1 / 3 ). sup . 3 ( 2 / 5 ). sup . 3 1 . 9 1 . 6pelargonic acid , nitrobenzene , acetophenone &# 34 ; &# 34 ; 1 . 3 1 . 5neodecanoic acid 1 6 / 5 1 . 5 2 . 0m toluic acid , methyl salicylate ( 1 / 2 ). sup . 2 ( 3 / 5 ). sup . 2 1 . 8 2 . 1hexanoic acid , nitrobenzene &# 34 ; &# 34 ; 2 . 0 1 . 5__________________________________________________________________________ table 3__________________________________________________________________________data from run made in rectification column weight % weight % weight % relativeagent column time , hrs . water formic acid acetic acid volatility__________________________________________________________________________none overhead 0 . 5 40 . 5 29 . 5 30 1 . 165 bottoms 28 24 48 &# 34 ; overhead 1 39 . 5 30 30 . 5 1 . 15 bottoms 27 25 48pelargonic overhead 0 . 5 70 16 14 1 . 137acid bottoms 34 . 5 26 39 . 5pelargonic overhead 1 71 16 13 1 . 31acid bottoms 12 24 64pelargonic overhead 1 . 5 75 14 11 1 . 51acid bottoms 12 15 73__________________________________________________________________________ the bottoms which gives a relative volatility of 1 . 51 of formic acid to acetic acid . this indicates that the formic acid -- water maximum azeotrope has been negated and separation accomplished . table 3 shows that with no extractive agent , after one hour , the overhead analysis was 40 % water , 30 % formic acid and 30 % acetic acid and the bottoms analysis of 27 % water , 25 % formic acid , 48 % acetic acid , which gives a relative volatility of 1 . 15 . the usefulness or utility of this invention can be demonstrated by referring to the data presented in tables 1 , 2 and 3 . all of the successful extractive agents show that formic acid can be separated from acetic acid by means of distillation in a rectification column and that the ease of separation as measured by relative volatility is considerable . without these extractive distillation agents , only slight improvement will occur in the rectification column . the data also show that the most attractive agents will operate at a boilup rate low enough to make this a useful and efficient method of recovering high purity formic acid from any mixture with acetic acid and water . the stability of the compounds used and the boiling point difference is such that complete recovery and recycle is obtainable by a simple distillation and the amount required for make - up is small . twenty - five grams of aqueous formic acid and 25 grams of acetic acid were charged to an othmer type vapor - liquid equilibrium still and refluxed for 12 hours . analysis by gas chromatography gave a vapor composition of 40 . 4 % water , 31 . 9 % formic acid and 27 . 7 % acetic acid ; a liquid composition of of 38 . 8 % water , 30 . 6 % formic acid and 30 . 6 % acetic acid . this indicates a relative volatility of formic acid to acetic acid of 1 . 15 . eighty grams of water - formic acid - acetic acid mixture and fifty grams of pelargonic acid were charged to the othmer type vapor - liquid equilbrium still and refluxed for seven hours . analysis gave a vapor composition of 32 % water , 18 % formic acid and 50 % acetic acid ; a liquid composition of 11 % water , 18 . 5 % formic acid and 70 . 5 % acetic acid . this indicates a relative volatility of 1 . 5 . eighty grams of water - formic acid - acetic acid mixture , 25 grams of pelargonic acid and 25 grams of hexanoic acid were charged to the vapor - liquid equilibrium still and refluxed for 12 hours . analysis indicated a vapor composition of 32 % water , 26 % formic acid and 42 % acetic acid ; a liquid composition of 9 % water , 26 . 5 % formic acid and 64 . 5 % acetic acid which is a relative volatility of 1 . 5 . five grams of pelargonic acid and five grams of hexanoic acid were added and refluxing continued for another 12 hours . analysis indicated a vapor composition of 35 % water , 25 % formic acid and 40 % acetic acid ; a liquid composition of 7 . 5 % water , 24 % formic acid and 68 . 5 % acetic acid which is a relative volatility of 1 . 8 . eighty grams of water - formic acid - acetic acid mixture , 17 grams of pelargonic acid , 17 grams of itaconic acid and 17 grams of nitrobenzene were charged to the vapor - liquid equilibrium still and refluxed for four hours . analysis indicated a vapor composition of 36 % water , 17 % formic acid and 47 % acetic acid ; a liquid composition of 39 % water , 10 % formic acid and 51 % acetic acid which is a relative volatility of 1 . 9 . three grams each of pelargonic acid , itaconic acid and nitrobenzene were added and refluxing continued for another five hours . analysis indicated a vapor composition of 37 . 5 % water , 15 . 5 % formic acid and 47 % acetic acid ; a liquid composition of 28 . 5 % water , 12 % formic acid and 59 . 5 % acetic acid which is a relative volatility of 1 . 6 . a glass perforated plate rectification column was calibrated with ethylbenzene and p - xylene which possesses a relative volatility of 1 . 06 and found to have 4 . 5 theoretical plates . a solution comprising 250 grams of a mixture containing 40 % water , 32 % formic acid and 28 % acetic acid was placed in the stillpot and heated . after a half hour of refluxing a total reflux , analysis of overhead and bottoms gave a relative volatility of 1 . 165 ( see table 3 ). after one hour at total reflux , the relative volatility was 1 . 15 . these data confirm the value obtained in the vapor - liquid equilibrium still reported in example 1 . after one hour of operation with the water - formic acid - acetic acid mixture , an extractive agent consisting of pure pelargonic acid was pumped into the column at a rate of 20 ml / min . the temperature of the extractive agent as it entered the column was 95 ° c . after establishing the feed rate of the extractive agent , the heat input to the water - formic acid - acetic acid mixture in the stillpot was adjusted to give a total reflux rate of 10 - 20 ml / min . after a half hour of operation , the overhead and bottoms samples of approximately two ml . were collected and analysed by gas chromatography . the overhead analysis was 70 % water , 16 % formic acid and 14 % acetic acid and the bottoms analysis was 34 . 5 % water , 26 % formic acid and 39 . 5 % acetic acid . using these compositions in the fenske equation with the theoretical plates in the column being 4 . 5 , gave an average relative volatilty of formic acid to acetic acid of 1 . 137 for each theoretical plate . after one hour of total operating time , the overhead and bottoms were again sampled and analysed . the overhead composition was 71 % water , 16 % formic acid and 13 % acetic acid and the bottoms was 12 % water , 24 % formic acid and 64 % acetic acid . this gave an average relative volatility of 1 . 31 for each theoretical plate . after 1 . 5 hours of total operating time , the overhead and bottoms were again sampled and analysed . the overhead composition was 75 % water , 14 % formic acid and 11 % acetic acid ; the bottoms was 12 % water , 15 % formic acid and 73 % acetic acid . this gave an average relative volatility of 1 . 51 for each theoretical plate . this agrees with the value obtained with the vapor - liquid equilibrium still and reported in example 3 . it also shows that it takes about 1 . 5 hours for the column to attain equilibrium conditions . | 2 |
conventional optical filters are relatively wide band filters as compared to atomic line filters ; however , they can be simple , cheap and generally present no operational problems . a comparison of some of the principal features of these two types of filters is made in the following table : preferred embodiments of the present invention can be described by reference to the drawings . fig1 is a block diagram of a first preferred embodiment of the present invention . laser transmitter 2 transmits a free space laser beam which is matched in wavelength to the very narrow pass band of atomic line filter 8 . the beam is substantially diminished in power when it reaches the receiver consisting of a background optical filter 4 , an optical amplifier 6 , the atomic line filter 8 and a fast photo diode 10 . fig2 is a second preferred embodiment . in this embodiment the beam travels in optical fiber 12 and no background optical filter is provided . fig3 gives qualitative representations : ( a ) of the signal 14 as it enters the optical fiber 12 of fig2 ( b ) of the diminished signal 16 at the receiver end of the optical fiber , ( c ) of the amplified signal 18 after it has been amplified by optical amplifier 6 , and ( d ) of the filtered amplified signal 20 after it has been filtered by atomic line filter 8 . the effect of the optical amplifier is to greatly amplify the signal , but it also produces a large amount of interfering broadband noise . a preferred transmitter is shown in fig4 . as stated above , the transmitter must transmit a signal beam having a spectrum matching the atomic line filter passband . a distributed bragg reflector semiconductor laser designed to operate at a wavelength near 852 is a good match . such lasers are commercially available . one preferred laser is a 150 mwatt diode laser 40 model no . sl - 5722 - h1 supplied by sdl . this laser operates nominally at 852 nm wavelength . in this preferred embodiment , we lock the laser 40 at one of the precise wavelengths at or very near 852 . 11 nm , which corresponds to the 6s 1 / 2 - 6p 3 / 2 transition in cesium . one way to do this , is to configure the laser system into a wavelength controlled unit as shown in fig4 . this control is achieved using temperature control and current control of the laser and an alf . a feedback circuit 63 is provided to control the diode current and maintain the output at the selected precise wavelength . the temperature of the diode is regulated by thermoelectric heat pumps 41 . the heat pumps are driven by a wavelength electronics fpt 2000 thermoelectric cooler controller 66 . the temperature of the laser diode is maintained to within ± 0 . 05 ° c . of the required temperature for optimum wavelength stability . the laser diode is driven by a low noise , voltage controlled current source 64 . the current source used to drive the cw laser diode is wavelength electronics fpl 250 . the laser diode output is collimated with a rodenstock 1403 . 108 lens 42 . direct modulation of the laser at multi - gbaud rates can be accomplished using an optical waveguide modulator 17 such as the united technologies phonic mach - zehnder modulator . these modulators preserve polarization and are supplied with fiber pigtails 19 at the input and output . light is coupled into the fiber using a microscopic objective 21 . in this example the transmitted information is provided from computer 24 through data transceiver 18 . the microcontroller 68 is used to implement a digital frequency control loop . to set the laser frequency , the microcontroller will ramp the laser diode drive current up and down thereby ramping the laser frequency . the counters output is connected to a digital to analog converter whose output drives the input of the voltage controlled current source . output monitor photo diode 62 samples a small portion of the beam form diode 40 which is directed through atomic line filter 44 . the signal from diode 62 is digitized and sent to the micro controller 68 . the micro controller will drive the laser diode current up or down searching for the peak output as sensed by the output monitor photo diode . once the maximum output is detected the micro controller will then control the output drive current to maintain maximum light output from the laser assembly . the output of the laser is sampled every ten seconds . the principal element of a preferred receiver unit are shown in block and cross section form in fig5 . signal beam 1 enters background optical filter unit 4 which could any good optical filter . in this particular embodiment the filter is a faraday atomic line filter ( preferably the same model atomic line filter as is used in the transmitter to tune the laser diode transmitter ). the signal beam enters through polarizer 70 which polarizes the light in a horizontal direction . an axial magnetic field of about 150 gauss created by magnet ( not shown ) operating on cesium vapor heated to about 111 ° c . by heater 76 in vapor cell 74 causes a rotation of only that portion of the light spectrum at wavelengths at sharp cs absorption lines near 852 nm . that light which was so rotated passes through vertical polarizer 72 and is turned by prism 78 . other light is blocked by vertical polarizer 72 and 852 nm narrow band filter ( andover # 850fs40 - 12 . 5 ) 82 . ( please note that in some applications [ such as at night of if the field of view can be tightly controlled and when the optical signal is transmitted with an optical fiber ] this background optical filter may not be needed .) the detected signal is amplified , by optical amplifier 6 . the amplifier is a high power tapered stripe semiconductor amplifier that acts as a traveling wave amplifier . this amplifier with gain at the atomic line filter wavelength of 852 nm is provided by a modified off - the - shelf laser . the sdl inc . model 8630 is an external cavity tunable laser which uses a tapered amplifier semiconductor chip as the active medium . it is easy to open the laser cavity with the insertion of a mirror to access the amplifier chip for a single pass of the signal beam . the laser cavity itself is formed by one facet of the chip ( the uncoated facet serves as the output coupler ), and a grating placed several centimeters away . the signal beam is directed through the uncoated facet of the amplifier , and then turned out of the cavity by the mirror . we have observed overall single pass gains of about 500 using this instrument . the output of optical amplifier 6 enters atomic line filter 8 . in this embodiment the atomic line filter is also a faraday filter exactly like the one shown at 4 . the filter consists of an atomic vapor in a cell located between a pair of crossed polarizers . a magnetic field is applied to the cell which zeeman splits the energy levels resulting in different absorption lines for left and right circularly polarized light . near these lines the filter acts as a faraday rotator providing rotary power only in the vicinity of an absorption line , which provides the 90 degree rotation necessary to pass the second polarizer . at higher fields and vapor densities multiple rotations lead to rapid modulation sin the transmission spectrum . away from the absorption line the filter provides an out of band rejection that is determined by the extinction ratio of the crossed polarizers . the output of atomic line filter 8 is detected by fast photo diode 10 . for a nominal 15 ghz photo receiver , high speed off - the - shelf photodiodes are available from newport b corporation . the d - 15 detector provides a bandwidth of 29 ghz . when applying the present invention as a receiver or relayer in a fiber optic system , the diminished signal from the optical fiber is fed into optical amplifier 6 as shown in fig5 . optical amplifier 6 and the components shown in fig5 downstream of optical amplifier 6 are applicable to demonstrate the fiber - optic embodiment of the present invention . both embodiments discussed above are designed for a data transmission rate of about 15 ghz . we use a cesium faraday filter designed to provide a 15 ghz pass band at 852 nm to remove the broad band amplified spontaneous emissions from the signal beam . operational principles of our faraday filter can be understood by reference to fig7 . crossed polarizers 90 and 91 serve to block out background light with a rejection ratio better than 10 − 5 . we use high transmission polarizers which have a transmission of higher than 95 %. because these polarizers only work over a limited wavelength region in the infrared , a broad band interference filter is used in conjunction with the faraday filter . between the polarizers an atomic vapor ( in this case cesium having a strong resonance near the wavelength of the beacon beam ) in a magnetic field axially aligned with the path of the beam rotates the polarization of the beacon laser signal by 90 °, while leaving other wavelengths unrotated , and thus blocked by the polarizers . the path of the transmitted light is unaffected , so spatial information is maintained . polarization rotation is due to the separation in optical absorption frequencies for right and left circularly polarized light in the magnetic field due to the zeeman effect . the index of refraction of the vapor near an absorption is different from 1 , and the absorption separation causes the index to be different for right and left circular polarization at a given frequency , and thus those polarizations travel through the vapor with a different phase velocity . the effect of this is to cause a frequency dependent rotation in the polarization of the incoming linearly polarized light which only occurs near the atomic absorption peak . transmission through the filter is maximum where the polarization rotation is 90 °, 270 °, etc ., provided that the frequency of the beam is far enough away from the atomic resonance not to be absorbed . the voigt filter is similar to the faraday filter . in the voigt filter , a magnetic field is arranged so that the field lines are perpendicular to the beam direction . the vapor acts like a half wave plate rather than a faraday rotation to achieve 90 ° polarization rotation . transmission spectra in the range of 852 nm for cesium for the faraday filter is shown in fig8 a . fig6 a and 6b describe an alternate preferred method of controlling the transmission wavelength of the transmitter to match the known pass band of the receiving unit &# 39 ; s faraday atomic line filter . a sketch showing the passband is shown in fig6 b . in this setup an sdl 5712 - h1 distributed bragg reflector laser diode 154 is controlled with temperature controller 156 and current controller 158 . temperature controller 156 controls the temperature of the laser at a constant ( within 0 . 050 degrees c .) temperature in the range of about 25 degrees c . feedback control is achieved with current controller 158 . microcontroller 160 keeps the current at a value , as indicated by the vertical dashed line in fig6 b to match a known transmission peak in the receive unit &# 39 ; s atomic line filter . a portion of the laser beam is sampled and run through cesium absorption cell 162 and detected by photo diode 152 . as shown in fig6 b a current matching the second alf transmission peak is about ⅘ the distance between the cesium cell two absorption peaks of the cesium cell as detected during periodic ( once per 10 seconds ) calibration scans of photo diode 152 . the scans take about 10 ms . while the above description contains many specifics , the reader should not construe these as limitations on the scope of the invention , but merely as exemplification &# 39 ; s of preferred embodiments thereof . those skilled in the art will envision many other possible variations are within its scope . one such variation is the application to satellite laser communications , where an optical doppler shift is present . in that case , the laser frequency may be locked to a frequency which is offset by the doppler shift from the passband peak , such that the signal received matches the receiver filter passband . accordingly the reader is requested to determine the scope of the invention by the appended claims and their legal equivalents , and not by the examples which have been given . | 7 |
fig5 illustrates a block diagram of a pressurized system 53 according to an embodiment of the invention . the pressurized system 53 comprises a first pressurized device 40 configured to be coupled to a second pressurized device 42 through a pressurized passage 49 . the pressurized passage 49 is configured to be coupled to the first pressurized device 40 through a first releasable interface 44 and to the second pressurized device 42 through a second interface 70 . the second interface 70 comprises an automatic bleed valve ( not shown ) which is configured to seal a vent hole ( not shown ) when the second interface 70 is attached to the second pressurized device 42 and to unseal the vent hole before the second interface 70 is detached from the second pressurized device 42 . by way of example , the pressurized system 53 may be used to fill scuba tanks or other pressurized devices with a compressible fluid such as air . thus , for example , the first pressurized device 40 may comprise a pressurized air source used to fill or pressurize the second pressurized device 42 which in turn may comprise , for example , a scuba tank . as another example , the first pressurized device 40 may comprise a large scuba tank used to fill a smaller scuba tank ( i . e ., the second pressurized device 42 ) with compressed air . however , an artisan will recognize from the disclosure herein that the adapter of the present invention may be used to fill scuba tanks of any size and that the relative sizes of the first pressurized device 40 and the second pressurized device 42 are not limiting . in an exemplary embodiment , the second pressurized device 42 comprises a miniature scuba tank for storing approximately three cubic feet of air and having a length of approximately 13 . 4 inches , a diameter of approximately 2 . 25 inches , and a pressure rating of approximately 3000 psi . in another exemplary embodiment , the second pressurized device 42 comprises a miniature scuba tank for storing approximately 1 . 7 cubic feet of air and having a length of approximately 8 . 75 inches , a diameter of approximately 2 . 25 inches , and a pressure rating of approximately 3000 psi . an artisan will recognize from the disclosure herein that the pressurized system 53 can be adapted to accommodate a wide range of fluid volumes and pressures . fig6 is a schematic diagram of an adapter assembly 12 according to an embodiment of the invention . the adapter assembly 12 comprises a screw 1 , a yoke 10 , an adapter fitting 2 , a swivel fitting 3 , a swivel nut 4 , a ring vent or cam ring 5 , and a retaining ring 6 . fig7 illustrates the interconnection of various components of the adapter assembly shown in fig6 . the adapter fitting 2 and swivel fitting 3 are configured to couple together to form a fluid passage 24 having a first end 16 and a second end 18 . as shown in fig7 , the swivel fitting 3 comprises a resealable vent 14 configured to release pressure from the fluid passage 24 when unsealed . the screw 1 and yoke 10 are configured to secure the adapter assembly 12 to a first pressurized device ( not shown ), such as a scuba tank , so that the adapter fitting 2 may interface with the first pressurized device . the swivel nut 4 is configured to slide over the swivel fitting 3 and to thread onto the adapter fitting 2 to secure the adapter fitting 2 to the swivel fitting 3 and yoke 10 . thus , the swivel nut 4 holds the flange of the adapter fitting 2 firmly against the opening of the yoke 10 while allowing the swivel fitting 3 to rotate . a washer 7 and a seal 8 , such as an o - ring , are placed at the interface of the adapter fitting 2 and swivel fitting 3 to allow the swivel fitting 3 to rotate freely while maintaining a pressure seal for the fluid passage 24 between the adapter fitting 2 and the swivel fitting 3 . the swivel fitting 3 is configured to interface with a second pressurized device ( not shown ), such as a miniature scuba tank , at the second end 18 of the fluid passage 24 . in operation , the adapter assembly 12 is configured to automatically seal the vent 14 when attached to the second pressurized device and to automatically unseal the vent 14 before being detached from the second pressurized device . thus , the adapter assembly 12 can be safely used to transfer fluid in a pressurized system . for example , the adapter assembly 12 shown in fig6 and 7 can be used to fill a small scuba tank with compressed air from a larger scuba tank . the adapter fitting ( not shown ) is attached to the scuba tank by the yoke 10 and screw 1 . the swivel fitting 3 is attached to a one way check valve ( not shown ) of a regulator 66 that is attached to the small scuba tank . in an embodiment , the small scuba tank is a “ spare air ” tank available from submersible systems , inc . of huntington beach , calif . the adapter assembly 12 is attached to the small scuba tank by turning the cam ring 5 which causes the swivel fitting 3 to rotate and thread onto the check valve . as discussed in more detail below , turning the cam ring 5 to attach the adapter assembly 12 to the check valve of the regulator 66 automatically seals a vent hole . thus , the cam ring 5 is simultaneously used to seal the vent 14 ( shown in fig7 ) and to screw the adapter assembly 12 to the check valve . with the vent sealed , the small scuba tank can then be filled with compressed air from the scuba tank . after filling the small scuba tank , the adapter 12 is detached from the regulator 66 by turning the same cam ring 5 to unscrew the swivel fitting 3 from the check valve . as discussed in more detail below , turning the cam ring 5 to detach the swivel fitting 3 from the regulator 66 automatically unseals the vent 14 and releases the pressure on the threads of the swivel fitting 3 . by continuing to turn the cam ring 5 , the swivel fitting 3 is unscrewed from the check valve . thus , turning the cam ring 5 automatically releases the pressure in the adapter assembly 12 before unscrewing the swivel fitting 3 from the check valve . although the adapter assembly 12 can be used to fill a small scuba tank with compressed air from a larger scuba tank , an artisan will recognize from the disclosure herein that the invention is not so limited . in fact , the adapter assembly can be used to transfer fluids between pressurized devices regardless of the relative sizes of the devices . referring again to fig6 and 7 , the vent 14 in the swivel fitting 3 selectively allows a pressurized fluid ( not shown ) to flow in or out of the fluid passage 24 . the swivel fitting 3 further comprises a moveable pin 9 formed from a semi - elastic material such as nylon configured , sized and positioned in the vent 14 so as to prevent fluid from flowing through the vent 14 when the pin 9 is pressed into the vent 14 . an embodiment of the pin 9 is described in greater detail below with respect to fig1 . the cam ring 5 is configured to slide over the swivel fitting 3 and the vent 14 . the cam ring 5 is held in place with the retaining ring 6 positioned in slot 30 so that the cam ring 5 is allowed to rotate over the swivel fitting 3 . as will be discussed in more detail below , the cam ring 5 is configured to press down on the pin 9 as it is rotated over the swivel fitting 3 . the attached appendix includes a presentation with photographs and text demonstrating a use of the adapter assembly according to an embodiment of the invention . the appendix forms a part of the application . fig8 is a detailed schematic of the adapter fitting 2 shown in fig7 , according to an embodiment of the invention . the adapter fitting 2 comprises an adapter interface 22 configured to engage a first pressurized device ( not shown ) and to allow a fluid ( not shown ) to pass between the first pressurized device and the first end 16 of the fluid passage 24 . fig9 is a detailed schematic of the swivel nut 4 shown in fig7 , according to an embodiment of the invention . the swivel nut 4 may comprise internal screw threads 26 configured to engage the threads of the adapter fitting 2 shown in fig7 . fig1 is a detailed schematic of the swivel fitting 3 shown in fig7 , according to an embodiment of the invention . fig1 illustrates the slot 30 and the fluid passage 24 through the swivel fitting 3 . fig1 also shows an approximate representation of the shape and size of the vent 14 through the side of the swivel fitting 3 . in an exemplary embodiment , the upper diameter of the vent 14 is approximately 0 . 25 inches or larger and is configured to receive and to be sealed by the pin shown in fig1 . fig1 is a cross - sectional ( through the center ) side view schematic of the pin 9 shown in fig7 , according to an embodiment of the invention . the dimensions are in inches and are for exemplary purposes . as shown , the pin 9 is configured and sized so as to be positioned into the vent hole 14 shown in fig1 and to seal the vent hole 14 when pressed into the vent hole 14 by the cam action of the cam ring 5 shown in fig7 . although not shown , a top view of the entire pin 9 ( i . e ., not a cross - section of the pin 9 ) shown in fig7 would be circular having a diameter of approximately 0 . 25 inches . in a preferred embodiment , the pin 9 comprises nylon . fig1 is a detailed schematic of the cam ring 5 shown in fig7 , according to an embodiment of the invention . a portion of the inside diameter of the cam ring 5 is removed to form a recessed area 20 configured to fit over the pin 9 shown in fig7 . the cam ring 5 can also be formed or molded to create the recessed area 20 . the recessed area 20 is tapered or formed in the shape of a “ half moon ” so as to provide a cam action wherein rotating the cam ring 5 around the swivel fitting 3 presses the pin 9 into the vent 14 shown in fig1 and prevents the fluid ( not shown ) from passing between the vent 14 and the fluid passage 24 . fig1 is a cross - sectional cut view of the swivel fitting 3 shown in fig7 illustrating the cam ring 5 positioned around the swivel fitting 3 and over the pin 9 and vent 14 . as shown , the recessed area 20 of the cam ring 5 is positioned so as to allow fluid ( not shown ) flowing in the fluid passage 24 to flow around the pin 9 and out of the vent 14 . fig1 is a cross - sectional cut view of the swivel fitting 3 shown in fig7 illustrating the cam ring 5 positioned around the swivel fitting 3 and over the pin 9 and vent 14 . as shown , the recessed area 20 of the cam ring 5 is positioned so as to push down on the pin 9 and prevent fluid flowing in the fluid passage 24 from flowing out of the vent 14 . although the foregoing invention has been described in terms of certain preferred embodiments , other embodiments will be apparent to those of ordinary skill in the art . additionally , other combinations , omissions , substitutions and modifications will be apparent to the skilled artisan in view of the disclosure herein . accordingly , the present invention is not intended to be limited by the reaction of the preferred embodiments , but is to be defined by reference to the appended claims . | 1 |
although the following detailed description contains many specifics for the purposes of illustration , anyone of ordinary skill in the art will appreciate that many variations and alterations to the following details are within the scope of the invention . accordingly , the following preferred embodiment of the invention is set forth without any loss of generality to , and without imposing limitations upon , the claimed invention . fig1 a shows a cleaning head 50 configured with rows bristle sections 12 , 14 , 16 and 18 protruding from a surface 19 of a support member 10 . protruding in a similar direction to the rows of bristle section , are squeegee segments 13 , 15 and 17 . the bristle sections 12 , 14 , 16 and 18 and the squeegee segments 13 , 15 and 17 are preferably capable of contacting a surface ( not shown ) simultaneously during a cleaning operation . fig1 b illustrates a dentition cleaning device 100 according to one embodiment of the current invention . the dentition cleaning device 100 employs a cleaning head configuration with a design that is similar to that shown in fig1 a . the bristle sections 50 , 52 , 54 and 56 protrude from a surface or support 59 in a bristle protruding direction . the bristles are preferably made of synthetic or natural bristle materials well known in the art , such as plastics or natural course hair . the dentition cleaning device 100 also has squeegee members 53 , 55 and 57 that protrude from the surface 59 in a squeegee protruding direction that is substantially similar to the bristle protruding direction . preferably , the bristles and squeegee members are both capable of connecting surfaces of dentition during cleaning operations . fig1 b is set forth herein for illustrative purposes and a number of different bristle section configurations and squeegee configurations are considered to be within the scope of the current invention . again referring to fig1 b , in one embodiment of the current invention an outer continuous squeegee member ( not shown ) encircles the bristle sections 50 , 52 , 54 and 56 and / or the linear squeegee members 53 , 55 and 57 to help prevent the bristles sections 50 52 , 54 and 56 from contacting the surfaces of gum tissues during cleaning of the teeth , while the outer continuous squeegee member messages gum tissue . a continuous outer squeegee member also serves the purpose of containing or holding low viscosity cleaning solutions as described in later embodiments . alternatively , squeegee segments ( not shown ) protrude from or near the edges of the surface 59 , for the purpose of protecting the gums from contact with the bristle and for messaging the gums while cleaning the teeth . still referring to fig1 b , in a particular embodiment of the invention the surface 59 of a support section 60 is made from a soft malleable material to which the bristle sections and the squeegee section are attached . the support section 60 is then attached to the toothbrush body 51 by any means known in the art . the support section 60 provides a suspension for the bristle sections 50 , 52 , 54 and 56 and for the squeegees 53 , 55 and 57 such that the bristle sections and squeegees are capable of being partially displaced from their resting positions when pressure is applied to the cleaning tips of the bristles or cleaning edges of the squeegees . the support section 60 thus provides a mechanism for the bristle sections and the squeegees to conform to irregular surfaces of dentition during cleaning . again referring to fig1 b , the dentition cleaning device 100 , as shown , has a handle 49 integrated with a body 51 . while the dentition cleaning device 100 is shown as a monolithic unit , it will be clear to one of average skill in the art that the handle 49 and body 51 may be configured to be detachable so that several dentition cleaning heads can be used with a single handle 49 . further , the body head 51 maybe configured to be detachably fastened to a motorized handle ( not shown ) for providing agitation to dentition similar to an electric toothbrush . it should also be noted that the support member 60 may be detachably fastened to the body head 51 such that the support member 60 and its attached cleaning elements ( i . e . bristles and squeegees ) are replaceable . fig2 a shows a perspective view of a squeegee structure 99 with a squeegee member 98 that protrudes from a support member 102 in a protruding direction 108 . the squeegee member 98 has a protruding edge , or cleaning edge , 101 that contacts a surface during a cleaning operation . the squeegee member 98 is elongated in an elongation direction 107 with two elongated squeegee walls 103 / 104 . at any point on the surface of the squeegee walls 103 / 104 , the squeegee member 98 has a squeegee wall thickness 105 . the primary squeegee direction 109 is defined , herein , as any co - linear direction that is normal to the elongation direction 107 at each point along elongation direction 107 . strictly speaking , for any elongated squeegee there will be at least two wiping directions , corresponding to a back and forth cleaning motion along the line of primary squeegee direction 109 . for the sake of simplicity and for this description , squeegee action along any straight line of motion is referred to as a single direction . thus , the linear elongated squeegee 98 provides for one primary squeegee direction , regardless of a protruding angle 97 or curvature of the squeegee wall in the protruding direction 108 . further , for clarity and descriptive purpose , elongated squeegees and squeegee supports are usually described as separated elements herein . however , it is clear that squeegees and squeegee supports may be monolithic and made of the same or different materials . further , the shapes of supports are not limited to circles or squares as generally described herein ; squeegee supports may take any shape or form that is reasonable for the application at hand . the current invention utilizes elongated squeegees in the numerous configurations described below to provide an effective dentition cleaning device . the elongated squeegees are preferably made from a soft flexible , pliable or malleable material such as rubber , latex , urethane , silicone and the like . the flexibility , pliability or malleability of the squeegees are preferably in the range between 10 to 50 shore a durometers as measured with durometer gauges well known in the art . the dimensions of the squeegees can vary in the numerous ways described below but preferably protrude from a support surface by an average distance of 0 . 1 to 3 . 0 cm in the squeegee protruding direction 108 . further , while the squeegee wall thickness 105 can vary at any point between the squeegee walls 103 and 104 , the squeegee wall thicknesses are preferably within the range of 0 . 1 to 5 . 0 mm . fig2 b illustrates a squeegee structure 110 with a curved squeegee member 121 that is curved in the elongation directions 127 . curved squeegee members , such as 121 are particularly useful in the current invention . geometric considerations will reveal that each point on the curved squeegee wall 122 / 123 corresponds to a primary squeegee direction in the direction that is normal to a tangent line of the squeegee curvature . for example points 131 , 133 and 135 have tangent lines of curvature 151 , 153 and 155 , respectively , and corresponding primary squeegee directions 141 , 143 and 145 . fig2 c compares the primary squeegee directions provided by the linear squeegee member of fig2 a and the curved squeegee member of fig2 b . it can be seen from fig2 c , that the curved squeegee member 121 can be moved in a set of directions 165 normal to the protruding direction 128 to contact a single point 163 in a primary squeegee direction . however , the linear squeegee 98 can only be moved in one direction 160 normal to the elongation direction 128 to contact a point 161 in a primary squeegee direction . for descriptive purposes squeegees are classified as the following : squeegee segments have at least two terminus ends ; continuous squeegees have no ends ; and squeegee networks have squeegee walls that are shared by one or more adjacent squeegee enclosures or compartments . squeegees can also have a single terminus end , wherein the squeegee forms and squeegee enclosure or compartment , but does not connect end - to - end . fig3 a – o illustrate top perspective views of several alternative squeegee configurations that provide for a plurality of primary squeegee directions . fig3 a shows a squeegee configuration 200 with two elongated squeegee members 199 / 201 that protrude from a support member 21 . because the squeegee members 199 / 201 are positioned in an angled fashion , the squeegee configuration 200 provides for two primary squeegee directions that are substantially normal to the two corresponding elongation directions of the squeegee members 199 and 201 . fig3 b shows a squeegee configurations 202 with a plurality of linear squeegee segment members 203 / 205 positioned at alternating angles and protruding from several positions of a support member 23 . fig3 c illustrates a squeegee configuration 204 with a curved elongated squeegee member 207 that protrudes from a support member 25 . the curved or cupped squeegee configuration 204 provides for primary squeegee directions all directions of a plane substantially containing the squeegee member 207 elongation directions . however , the squeegee configuration 204 does not provide for equal squeegee actions in all directions , because the squeegee member 207 will squeegee a surface twice each time the squeegee member 207 is moved with a sideways cleaning motion , but will squeegee a surface once for each up or down cleaning motion . thus , the squeegee configuration 204 provides for a plurality of directionally dependent primary squeegee directions . fig3 d illustrates a squeegee configuration 206 with several cupped squeegee members 209 / 211 that protrude from a support member 27 with the squeegee members 209 and 211 cupped in opposite directions . fig3 e shows a squeegee configuration 208 with a continuous circular squeegee member 213 protruding from a support member 22 . the continuous circular squeegee member 213 forms an inner squeegee region 232 and an outer squeegee region 234 . like the cupped squeegee configuration 204 , the squeegee configuration 208 provides for primary squeegee directions in all directions of a plane substantially parallel to the elongation directions of the circular squeegee member 213 . however , the circular squeegee configuration provides for a plurality of directionally independent primary squeegee directions . fig3 f illustrates a squeegee configuration 210 with several continuous circular squeegee members 215 , 217 and 219 protruding from a support member 24 that form a concentric set of squeegees with continuous circular channels 236 and 236 ′. the set of concentric continuous circular squeegee members provide for a plurality of primary squeegee directions in all directions of a plane substantially normal to the squeegee elongation directions . fig3 g shows a squeegee configuration 212 with a spiraling squeegee member 221 protruding from a squeegee support member 26 . the spiraling squeegee member 221 forms a spiraling squeegee channel 238 and provides for a plurality of primary squeegee directions in all directions of a plane substantially normal to the squeegee elongation directions . fig3 h shows a squeegee configuration 214 with a plurality of spiraling squeegee members , such as 223 and 225 protruding from a squeegee support member 28 to provide a plurality of primary squeegee directions in all directions of a plane substantially normal to the squeegee elongation directions . fig3 i also shows a squeegee configuration 216 with a spiraling squeegee member 227 protruding from a squeegee support member 32 . the squeegee member 227 spirals in a substantially rectangular fashion and forms a rectangular - like squeegee channel 240 . the squeegee configuration 216 provides for directionally dependent squeegee action , wherein a diagonal cleaning motion will give a different squeegee action than a sideways or up and down cleaning motion . fig3 j and fig3 k illustrate squeegee configurations 218 and 220 that have squeegee segments protruding from squeegee support members 34 and 36 , respectively , where the squeegee segments are positioned at varying angles on the squeegee support members 34 / 36 . fig3 j shows linear squeegee segments 229 and 231 positioned at or near to right angles relative to each other and forming a rectangular segmented squeegee configuration 218 . fig3 k shows squeegee configuration 220 comprising squeegee segments 235 that are positioned within an inner squeegee region of a larger circular squeegee member 233 . fig3 l and fig3 m illustrate yet other squeegee configurations 222 and 224 that have squeegee members protruding from squeegee support members 38 and 42 . in fig3 l the squeegee configuration 222 has cross - type squeegee segments 237 . the squeegee configuration 222 can also have a major squeegee member 239 , wherein the major squeegee member 239 comprises a long squeegee segment 243 intersected short squeegee segments 241 that are positioned at near to right angles relative to the long squeegee segment 243 . the squeegee configuration 224 of fig3 m has a squiggling squeegee member 245 protruding from a squeegee support member 42 to provide several primary squeegee directions . portions of squiggling squeegee member 245 ′ is configured to enclose inner squeegee regions 247 and 247 ′. squiggling squeegee 245 ″ is configured to form a set of connected squeegee compartments 246 , 246 ′, 246 ″ and 246 ′″. in fig3 n and fig3 o , squeegees are configured to produce a variety of squeegee compartments . the squeegee configuration 226 illustrates a complex arrangement of squeegees that form scale - shaped squeegee compartments 249 within a circular squeegee 248 and with squeegees flaring out 251 from the circular squeegee 248 to add other cleaning features . the configuration 228 illustrates a continuous network of squeegee walls 255 that protrude from the support 46 and that forms an array of symmetrical squeegee compartments 253 . fig4 a – d illustrate several squeegee configurations that provide for directionally dependent squeegee action . fig4 a shows a squeegee configuration 300 with several circular squeegee members 303 , 303 ′ and 303 ″ protruding from a circular squeegee support member 301 . within the inner squeegee region of the circular squeegee members 303 , 303 ′ and 303 ″ are linear squeegee segments 305 , 305 ′ and 305 ″, respectively . the linear squeegee segments 305 , 305 ′ and 305 ″ only provide for primary squeegee actions when the squeegee configuration 300 is moved on a surface with an upward or a downward cleaning motion , as indicated by the arrow w 1 . the linear squeegee segments 305 , 305 ′ and 305 ″ do not , however , provide primary squeegee actions when the squeegee configuration 300 is moved on the surface with a sideways cleaning motion , as indicated by the arrow w 2 . fig4 b illustrates an alternative squeegee configuration 302 that provides for directionally dependent primary squeegee action . linear squeegee segments 306 are positioned in the squeegee channel 308 of a spiraling rectangular squeegee member 309 . the squeegee segments 306 and the spiraling squeegee 309 protrude from a squeegee support member 307 . in this example , the linear segments 306 provide for primary squeegee actions when the squeegee configuration 302 is moved on a surface with a sideways cleaning motion , as indicated by the arrow w 2 , but do provide for primary squeegee action when the squeegee configuration 302 is moved on the surface with an upward or a downward cleaning motion , as indicated by the arrow w 1 . fig4 c shows a squeegee configuration 304 with two non - concentrically positioned circular squeegee members 315 and 317 protruding from a circular squeegee support member 313 . in the squeegee configuration 304 , it is the non - uniform channel spacing 314 between the squeegee members 315 and 317 that provides for directionally dependent primary squeegee actions , wherein the number of squeegees edges that contact a surface by moving the squeegee configuration 304 in with a sideways cleaning motion , as indicated by the arrow w 2 , is different that the number of squeegee edges that contact the surface by moving the squeegee configuration 304 in a sideways cleaning motion , as indicated by the arrow w 2 . fig4 d shows a different squeegee configuration 306 that provides for directionally dependent squeegee action . the squeegee configuration 306 comprises two rectangular squeegee members 320 and 322 . the longer squeegee walls 321 and 323 of the rectangular squeegees , 320 and 322 , are thinner than the shorter squeegee walls , 319 and 325 . in this way the primary squeegee action is made to be different by virtue of alternating squeegee wall thicknesses or physical properties of the squeegees 320 and 322 . in this embodiment , the thicker squeegees 319 and 325 exhibit primary squeegee action by moving the squeegee configuration 306 in an upward or downward cleaning motion , as indicated by the arrow w 1 , but do not provide for primary cleaning action when the squeegee configuration 306 is moved in with a sideways cleaning motion , as indicated by the arrow w 2 . it will be clear to one skilled in the art that there are many alternative squeegee configurations that can provide for directionally dependent squeegee actions . these variations can be achieved by varying squeegee geometries , squeegee configurations , squeegee thickness , squeegee materials and combinations thereof . fig5 a – d show top views of several dentition cleaning heads configured with squeegee sections and bristles . fig5 a shows a substantially rectangular cleaning head portion 400 with a spiraling rectangular squeegee 403 protruding from a rectangular support member 401 . in the rectangular - like squeegee channel 404 there are several brush sections such as 405 , 405 ′ and 405 ″ protruding from the surface 402 . fig5 b illustrates an oval cleaning head configuration 410 with circular squeegee members 409 , 409 ′ and 409 ″ protruding from the surface 414 of a circular support member 413 . within the inner squeegee region of the circular squeegee members 409 , 409 ′ and 409 ″ there are bristles sections 411 , 411 ′ and 411 ″. fig5 c shows an elongated cleaning head configuration 415 comprising squeegee segments such as 416 and 417 protruding from a rectangular support member 418 and forming a segmented rectangular squeegee configuration . within the segmented rectangular squeegee configuration , there is a substantially rectangular brush section 419 protruding from the support member 415 . fig5 d illustrates a cleaning head configuration 420 with a spiraling squeegee member 423 protruding from a circular support member 421 and forming a spiral channel 422 . there are several medium ports 425 , 425 ′ and 425 ″ positioned within the spiraling channel 422 . the medium ports 425 , 425 ′ and 425 ″ provide a means for directing a medium to dentition surfaces during cleaning or alternately for drawing a vacuum near a surface of dentition . the cleaning configuration 420 further includes a brush section 427 attached substantially central to the support member 421 . the configuration 420 is particularly useful where a cleaning medium such water is required or where vacuum convection is needed to remove cleaning solutions , saliva and the like . the cleaning configuration 420 can also be configured to attached to a rotary device to provide a rotary cleaning action to the surfaces of dentition during a cleaning operation . it is clear that any of the cleaning head configurations described herein are adaptable to have ports or apertures through which oral cleaning solutions can be delivered or through which a vacuum can be drawn to facilitate cleaning of dentition . fig6 a – d show cross - sectional views of several dentition cleaning head configurations with a squeegee member having continuous elongated squeegees . fig6 a shows a cross - sectional view of a dentition cleaning head 602 with a squeegee member 622 attached to a support 62 . the squeegee member has four substantially circular protruding squeegee edges 619 , 621 , 623 and 625 . positioned substantially in the center of the squeegee member 622 , is a brush section 620 . fig6 b shows cross - sectional view of a dentition cleaning head 604 with a squeegee member 632 attached to a support 64 . the squeegee member 632 has four substantially circular protruding squeegee edges 631 , 633 , 635 and 637 . the protruding squeegee edges protrude in an alternating fashion with the cleaning edges of squeegees 633 and 637 protruding farther than the cleaning edges of squeegee 631 and 635 . positioned substantially in the center of the squeegee member 632 is a brush section 630 . fig6 c shows cross - sectional view of a dentition cleaning head 606 with a squeegee member 642 attached to a support 66 . the squeegee member 642 has four continuous protruding squeegees 641 , 643 , 645 and 647 . the cleaning edges of the squeegees 641 , 643 , 645 and 647 protrude in a cascade fashion with the edge of squeegee 641 protruding farthest and the edge of squeegee 647 protruding the least . positioned substantially in the center of the squeegee member 642 is a brush section 640 . fig6 d shows a cross - sectional view of a dentition cleaning head 608 with a squeegee member 652 attached to a support 68 . the squeegee member 652 has three continuous and substantially circular protruding squeegee edges 651 , 653 , and 655 . the edges of the squeegees edges 651 , 653 , and 655 are spatially displaced such that the distance between the squeegees 651 and 653 is greater than the distance between the squeegees 653 and 655 . the dentition cleaning head configuration 608 has two brush section 650 and 660 . the brush section 650 is positioned substantially in the center squeegee member 652 while the brush section 660 is a continuous and substantially circular brush section that is positioned in the squeegee channel defined by protruding squeegees 651 and 653 . all of the dentition cleaning heads detailed and described , herein can be configured to have bristles or bristle sections integrated into the cleaning head , attached to the squeegee members themselves or attached to another portion of the cleaning device . for some applications of the invention the combination of a squeegee or squeegees and bristles is preferred . in one embodiment of the invention a squeegee section encircle bristle sections or portions thereof to reduce potential contact of the bristles with soft gum tissue while messaging the gums during cleaning of the teeth . fig7 a – f illustrate squeegee segments with contoured squeegee cleaning edges that are useful in the dentition cleaning device and system of the current invention . fig7 a shows a squeegee segment 75 with a planar protruding edge 76 . fig7 b illustrates a squeegee segment 77 with a v - shaped cleaning edge 78 ; fig7 c illustrates a squeegee segment 79 with a curved , convex contoured cleaning edge 80 ; fig7 d shows a squeegee segment 81 with a concave contoured squeegee edge 82 ; fig7 e shows a squeegee segment 83 with a diagonally contoured cleaning edge 84 ; and fig7 f shows a squeegee segment 85 with a pointed cleaning edge 86 . fig8 a – f illustrate several squeegee segments with contoured squeegee walls . fig8 a illustrates a squeegee segment 170 with a planar protruding edge 171 and a concave squeegee wall 172 ; fig8 b illustrates a squeegee segment 173 with a planar pointed protruding edge 174 and tapered squeegee walls 175 / 184 ; fig8 c illustrates a squeegee segment 177 with a planar protruding edge 178 and concave v - shaped squeegee walls 179 / 180 ; fig8 d illustrates a squeegee segment 181 with a jagged protruding edge 182 and a grooved squeegee wall 183 grooved in the squeegee protruding direction ; fig8 e illustrates a squeegee segment 184 with a planar cleaning edge 185 and walls 186 / 187 , with smaller squeegees 188 , 188 ′ and 188 ″ attached to the wall 187 ; and fig8 f shows a squeegee segment 189 with a planar cleaning edge 190 and planar squeegee walls 192 / 193 with bristles 194 , 194 ′ and 194 ″ attached to and protruding from the squeegee wall 193 . fig9 a – b show a continuous squeegee with a contoured squeegee cleaning edge and contoured squeegee walls . fig9 a shows a perspective view of a substantially circular squeegee member 261 with a contoured protruding squeegee edge 262 and a contoured squeegee wall 263 / 264 . the squeegee cleaning edged 262 and the squeegee walls 263 / 264 are contoured in a corrugated wave - like fashion . fig9 b shows a top view of the squeegee member 261 illustrating the corrugated wave - like contouring of the squeegee member walls 263 / 264 . fig1 illustrates an electric dentition cleaning device 270 that utilizes a dentition squeegee cleaning head 271 according with a preferred embodiment of the invention . the dentition cleaning head 271 several continuous squeegee members positioned in a substantially concentric fashion wherein smaller squeegee members are positioned within the next larger squeegee element as shown . the dentition cleaning head 271 is attached to a body 272 . the body 272 is attached to a motorized handle 273 that provides agitation to the cleaning head 271 through the body 272 . the motorized handle 273 is preferably capable of being turned on and off through the switch 275 and is powered by an internal battery ( not shown ) that is rechargeable through the contacts 276 and 276 ′ with a properly configured battery charger ( also not shown ). fig1 a – d illustrate several views of a dentition cleaning head configured according to a preferred embodiment of the current invention . fig1 a shows a top view of a dentition cleaning head 350 . the dentition cleaning head has a base portion 353 , a continuous outer squeegee member 351 , two curved squeegee segments 355 / 355 ′, and two oval squeegee members 357 / 359 with the smaller squeegee member 359 positioned concentrically within the inner squeegee region of the larger squeegee member 357 . fig1 b illustrates a side view 370 of the squeegee cleaning head 350 . the outer squeegee member 351 preferably extends farther from the base 353 than the inner squeegee members 355 , 355 ′, 357 , and 359 and has a squeegee cleaning edge 356 that is contoured as shown . the contoured squeegee cleaning edge 356 facilitates the ability of the squeegee 351 to penetrate grooves of teeth and spaces between teeth . further , its is believed that a contoured squeegee cleaning edge 356 will facilitate the ability of the squeegee 351 to penetrates spaces between the gum line and teeth during a cleaning operation . the cleaning head 350 may also have a cavity 363 to increase the flexibility of the dentition cleaning head 350 . fig1 c illustrates a cross sectional view 380 of the cleaning head 350 shown in fig1 a . all of the squeegee members 351 , 355 , 355 ′, 357 and 359 preferably have tapering wall thicknesses , being thicker near the surface 373 and thinner near the cleaning edges . the length of the dentition cleaning head 368 is preferably in a range of 1 . 0 to 4 . 0 cm . the outer squeegees squeegee member 351 preferably does not protrude a distance 362 father than 1 . 5 cm from the bottom of the base support 353 or a distance 364 more than 1 . 0 cm from the inner surface 373 . the tops of the squeegee cleaning edges are preferably less than 0 . 5 mm in thickness and most preferably less than 0 . 2 mm . the average separation 360 between adjacent squeegee members is preferably in the range of 1 . 0 cm to 0 . 05 cm and most - preferably between 0 . 3 and 0 . 1 cm . however , the preferred separation 360 will vary depending on the cleaning solution used . the average separation 360 is preferably chosen such that water or a liquid oral cleaner is retained in the squeegee channels of the dentition cleaning head 350 even when the dentition cleaning head 350 is inverted , but such that cleaning solutions and debris are easily rinsed away under running water . fig1 d shows an end view 390 of the dentition cleaning head 350 . the width of the dentition cleaning head 366 is preferably in the range of 0 . 5 cm to 2 . 0 cm . side squeegee edge 358 of the squeegee member 351 is also preferably contoured as shown . fig1 a – d are set forth as an example of the preferred embodiment . it is clear that the dimensions of the dentition cleaning head 350 can altered in many ways depending on the application at hand . for example , larger devices are useful for providing oral care for other animals including horses and dogs , while smaller devices are useful for cleaning the gums and teeth of infants or small children . fig1 illustrates a perspective view of a hand - held manual dentition cleaning device 450 configured with a cleaning head 451 similar to that described in fig1 a – d . the dentition cleaning head 451 is preferably formed from soft flexible non - toxic material such as rubber , latex , silicon or polyurethane . the dentition cleaning head 451 is attached to a handle 453 by any suitable method known in the art , but is preferably co - molded to the handle during manufacturing of the device 450 . holes may be provided in the preformed plastic handle 453 prior to co - molding the dentition cleaning head 450 to the handle 453 to ensure that dentition cleaning head 451 remains secured to the handle 453 . a second smaller dentition cleaning head may also be attached to the opposite side of the handle or the device may be equipped with a bristle section on the opposite end of the handle 453 or on the other side of the handle ( not shown ) to provide a multi - functional dentition cleaning device . fig1 a – b illustrate a cleaning system according to the present invention . fig1 a shows a perspective view 500 of the dentition cleaning device 450 described in fig1 being prepared for a cleaning operation . oral cleaning solution 501 is dispensed by a conventional pump device onto the cleaning head 451 with the cleaning head 451 in an upright position as shown . fig1 b shows a perspective view 510 of the oral cleaning device 450 having the oral cleaning solution 501 held within the squeegee cavity of the cleaning head 451 . because the cleaning head 451 provides a containing structure , the device 450 can be used with low viscosity oral cleaning solutions . low viscosity oral cleaning solution have several advantages over conventional tooth pastes including being easier to clean from a sink and / or counter surfaces . further , because low viscosity oral cleaning solutions can be dispensed from a conventional pump device , as shown , the solution can be sold in bulk and the container can be refilled , thus providing potential economic and environmental benefits . while the preferred system of the invention utilizes a low viscosity oral cleaning solutions , the dentition cleaning device 450 can be used with conventional tooth pastes known in the art . fig1 a – b illustrate a dentition cleaning device that is similar to the device 450 shown in fig1 which is further equipped with a removable cover 521 . fig1 a shows a dentition cleaning device 520 with a cleaning head 523 that is configured with continuous outer squeegee . the inner portion of the cleaning head is sealed with a removable cover 521 . preferably , the inner portion of the cleaning head 523 is sealed with the cover 521 by a sticky adhesive that sticks to the edge 524 of the outer squeegee to hold the cover 521 in place . the cover 521 has a tab 522 that can be grabbed to remove the cover 521 from the cleaning head 523 . the adhesive preferentially remains attached to the cover 521 when it is removed from the edge 524 of the outer squeegee . in fig1 b , the cover 521 is partially removed form the head 523 by pulling the tab 522 as shown . the cover 521 keeps the interior portion 526 of the head 523 sanitary during storage or while transporting the device 520 . prior to sealing the cover 521 on the head 523 , cleaning substances , including liquids or powders , can be placed in the interior portion 526 of the head 523 and stored there until the device 520 is ready for use . this embodiment is particular useful for as travel dentition care kit . the device 520 can be made to be disposable after a single used or made to be reusable . further , the cover 521 may be made to be resealed on the head 523 after use or the device 520 may be equipped with a more elaborate cover . fig1 a – b illustrate an embodiment of the current invention that is particularly useful in clinical environments . fig1 a shows a perspective view of a device 800 that has applications for cleaning wounds and incisions before , during or after medical procedures . the device 800 has a cleaning head 803 with several continuous squeegee members 805 , 807 , 809 , 811 and 813 . the squeegee members 805 , 807 , 809 , 811 and 813 are preferably positioned concentricity with the smaller squeegees positioned inside of the wall of the next largest squeegee member . the cleaning device 800 is attachable by the end 801 of its neck 806 to a solution delivery system or a vacuum suction system ( not shown ). fig1 b illustrates a cross sectional view 810 of the device 800 . solution or vacuum is delivered to the cleaning head 803 through the channel 804 and the reservoir 802 . solution or vacuum is then delivered between the squeegee members 811 and 183 through the apertures 817 , 819 and 821 . a health care profession or user contacts the squeegee portion of the device against the wounds or incision and applies a cleaning solution or a vacuum depending on the intended outcome of the procedure . the cleaning device 800 shown in fig1 a – b is also useful as a dentition cleaning device or for oral procedures where solution and vacuum must be applied to dentition . embodiments illustrated in the preceding figures have shown squeegee walls that protrude in direction substantially parallel with respect to each other . such devices provided a plurality of primary squeegee cleaning actions in a plurality of wiping directions contained in a single wiping plane or in a plurality of co - linear wiping planes . however , it will be clear from the following description that these embodiments previously described can also include squeegee walls that protrude at nonzero angles relative to each other in order to provide for primary squeegee cleaning action in a plurality of non - coincident wiping planes . further , it will be clear for the following description that oral cleaning devices and other cleaning devices can be configured with squeegee elements that provide for a plurality of squeegees cleaning actions in a plurality of wiping directions within a plurality of non - coincident wiping planes . fig1 a illustrates a cross - sectional view of a squeegee configuration 925 with squeegee walls 929 , 931 , 933 and 935 that protrude from a squeegee support member 927 . the squeegee walls 929 and 935 protrude in a squeegee protruding direction that is at an angle θ 1 from the squeegee support member 927 and provide for primary squeegee directions in the non - coincident squeegee wiping planes indicated by the arrows 930 and 928 , respectively . the angle θ 1 , can be any angle between 180 and 90 degrees . the squeegees walls 931 and 933 protrude from the squeegee support 927 in a squeegee protruding direction that is at an angle θ 2 relative to the squeegee support 927 to provide for a primary squeegee direction in the wiping plane indicated by the arrow 926 . angle θ 2 can also be any angle between 90 and 180 degrees that is different from angle θ 1 such as to provide primary squeegee directions in a plurality of non - coincident wiping planes 930 , 926 and 928 . fig1 b illustrates a cross - sectional view of an alternative squeegee configuration 950 . the squeegee configuration 950 has squeegee walls 954 , 956 , 958 and 960 that protrude in squeegee protruding directions at the angles θ 1 , θ 2 , θ 3 and θ 2 relative to a contoured squeegee support member 952 . the squeegee configuration provides primary squeegee direction in the wiping planes indicated by the arrows 953 , 955 , 957 and 959 , respectively . the squeegee walls described in fig1 a – b can belong to individual squeegee segments , continuous squeegees , squeegee networks , squeegee elements with a single terminus end or any combination thereof . squeegee configurations with squeegee walls that protrude in non - parallel squeegee protruding directions are utilized in cleaning devices that provide for primary squeegee directions in a plurality of non - coincident wiping planes . extending , the principles illustrated in fig1 a – b , squeegee configurations that have a plurality of squeegee walls that protrude in each of a plurality of squeegee protruding directions provide for a plurality of primary squeegee directions in each of the plurality of non - coincident wiping planes . fig1 illustrates a perspective view of a general tissue massager 900 in accordance with the current invention . the tissue massager 900 has a network squeegee cleaning edge surfaces 903 and depressed inner squeegee regions 901 . the continuous squeegee walls 906 protrude from a mushroom shaped squeegee support 905 . continuous squeegee walls 906 extend from the recessed inner squeegee regions 901 to form the network squeegee edge surfaces 903 . portions of the network squeegee edge surface 903 between any adjacent depressed inner squeegee regions , indicated by the arrows 902 and 904 , provide for squeegee edges that contact and squeegee surfaces during use . the squeegee configuration 900 is one of a number of squeegee configurations that provided for a plurality primary squeegee directions in a plurality of non - coincident planes . other embodiments are round or have any other three dimensional shapes suitable for the application at hand . further , three dimensional devices with squeegee segments , continuous squeegee elements , squeegee elements with a single terminus end and combinations thereof , are used within devices to provide for a plurality primary squeegee directions in a plurality of non - coincident wiping planes . a handle ( not shown ) can be attached to the massager 900 to enhance the functionality or use of the device 900 . in a particular embodiment of the invention the device 900 is made from a hard rubber material and is a chewing toy and tooth cleaning device for pets such as dogs . alternatively , the device 900 is made of soft rubber , silicone of latex and is a gum massager / chewing toy for teething babies . it will be clear to one skilled in the art that the above embodiment may be altered in many ways without departing from the scope of the invention . for example the dentition cleaning heads can be made to be any variety of color that make the particularly attractive for children . accordingly , the scope of the invention should be determined by the following claims and their legal equivalents . | 0 |
an ordinary commercial si 3 n 4 powder a containing 800 ppm metal impurities ( of which 600 ppm is fe ) or a high - purity si 3 n 4 powder b produced by imido decomposition process containing 30 ppm metal impurities , each of which consists of 95 % α alpha !- phase crystals , and commercial sintering aids al 2 o 3 and y 2 o 3 are combined in proportions of 93 %, 2 %, and 5 % by weight , respectively ; the combined powder was wet mixed in ethanol for two hours and dried to obtain the powder mixture samples . the amount of metal impurities measured were 1100ppm for the sample using the ordinary si 3 n 4 powder a and 350 ppm for the sample using the high - purity si 3 n 4 powder b . of the two si 3 n 4 powders mentioned above , the per kilogram unit price of the high - purity powder b was four times as much as the ordinary powder a . the powder mixtures obtained were sintered under the conditions shown in table 1 in a nitrogen gas flow atmosphere with 20 mpa uniaxial pressure . plasma sintering ( ps sintering ) used pulsed current heating of electrodes of upper and lower punch pressuring the powder mixture , and hot press sintering ( hp sintering ) used high - frequency induction heating . in compliance with jis r1601 specimens ( 15 pieces each ) were cut out from the si 3 n 4 - based sintered bodies produced ; relative density and three - point bending strength were measured and are listed together with weibull coefficients estimated from measured values of three - point bending strength in table 1 . table 1__________________________________________________________________________ sintering sintering relative bending si . sub . 3 n . sub . 4 temperature time sintering density strength weibull t × tsample powder t (° c .) t ( sec . ) method (%) ( mpa ) coefficients (° c . × sec . ) __________________________________________________________________________ 1 - a * a 1100 60 ps sintering 95 580 12 6 . 6 × 10 . sup . 4 1 - b * b 1100 60 ps sintering 93 430 8 6 . 6 × 10 . sup . 4 2 - a * a 1300 60 ps sintering 96 715 15 7 . 8 × 10 . sup . 4 2 - b * b 1300 60 ps sintering 94 585 9 7 . 8 × 10 . sup . 4 3 - a a 1300 120 ps sintering 98 930 15 1 . 56 × 10 . sup . 5 3 - b * b 1300 120 ps sintering 96 740 8 1 . 56 × 10 . sup . 5 4 - a a 1600 120 ps sintering 100 1160 18 1 . 92 × 10 . sup . 5 4 - b * b 1600 120 ps sintering 98 910 12 1 . 92 × 10 . sup . 5 5 - a a 1900 120 ps sintering 100 1045 15 2 . 16 × 10 . sup . 5 5 - b * b 1900 120 ps sintering 99 895 10 2 . 16 × 10 . sup . 5 6 - a * a 2000 120 ps sintering 100 720 11 2 . 4 × 10 . sup . 5 6 - b * b 2000 120 ps sintering 100 710 9 2 . 4 × 10 . sup . 5 7 - a a 1600 360 ps sintering 100 1250 20 5 . 76 × 10 . sup . 5 7 - b * b 1600 360 ps sintering 100 985 15 5 . 76 × 10 . sup . 5 8 - a a 1600 600 ps sintering 100 1380 24 9 . 6 × 10 . sup . 5 8 - b * b 1600 600 ps sintering 100 1010 16 9 . 6 × 10 . sup . 5 9 - a * a 1600 1200 ps sintering 99 975 14 1 . 92 × 10 . sup . 6 9 - b * b 1600 1200 ps sintering 99 905 12 1 . 92 × 10 . sup . 610 - a a 1600 600 hp sintering 100 1180 20 9 . 6 × 10 . sup . 510 - b * b 1600 600 hp sintering 99 935 12 9 . 6 × 10 . sup . 511 - a a 1300 120 hp sintering 96 795 10 1 . 56 × 10 . sup . 511 - b * b 1300 120 hp sintering 95 595 8 1 . 56 × 10 . sup . 512 - a a 1800 120 hp sintering 98 895 12 2 . 16 × 10 . sup . 512 - b * b 1800 120 hp sintering 96 700 9 2 . 16 × 10 . sup . 5__________________________________________________________________________ * comparative examples the above results clearly show that the method manufactures high - density , high - strength silicon nitride , which was unobtainable using the conventional sintering methods , by sintering the powder mixture containing between 500 and 5000 ppm metal impurities at temperatures ranging from 1300 °- 1900 ° c ., and when the product of sintering temperature and sintering time ranges from 1 × 10 5 to 10 × 10 5 ° c .· seconds , despite the use of low - cost si 3 n 4 powder containing more metal impurities . powder mixture samples with si 3 n 4 powder a produced in the same manner as in example 1 were sintered in a 10 - 2 torr vacuum by employing the same ps sintering and hp sintering methods as in example 1 under the conditions of sintering temperature 1600 ° c ., sintering time 600 seconds ( the product of which is 9 . 6 × 10 5 ° c .· seconds ), and mechanical pressure shown in table 2 . the same evaluation as in example 1 was performed on the obtained sintered bodies , the results of which are also shown in table 2 . table 2______________________________________ three - point relative bending sintering pressure density strength weibullsample method ( mpa ) (%) ( mpa ) coefficients______________________________________13 - 1 * ps sintering 0 . 5 98 925 1413 - 2 * hp sintering 0 . 5 95 510 614 - 1 ps sintering 2 . 0 99 1090 1614 - 2 hp sintering 2 . 0 96 720 915 - 1 ps sintering 25 100 1450 2515 - 2 hp sintering 25 100 1210 1916 - 1 ps sintering 50 100 1380 2216 - 2 hp sintering 50 100 1090 1617 - 1 * ps sintering 100 99 1095 1617 - 2 * hp sintering 100 99 900 12______________________________________ * comparative examples the above results clearly show that the method allows the production of high - density , high - strength si 3 n 4 - based sintered bodies when mechanical pressure ranging from 1 to 50 mpa is applied , and that plasma sintering method , in particular , produces superior results . powder mixture employing si 3 n 4 powder a was produced in the same manner as in example 1 , and sintered according to the sintering methods and conditions shown in table 3 . the same evaluation as in example 1 was performed on the obtained si 3 n 4 - based sintered bodies , the results of which are also shown in table 3 . in the cases of gas pressurization sintering ( n 2 gas ), the gas pressurization levels are shown in the pressure condition column . table 3__________________________________________________________________________ three - point relative bending sintering temp . time pressure t × t density strength weibullsample method t (° c .) t ( mpa ) (° c . × sec .) (%) ( mpa ) coefficients__________________________________________________________________________18 ps sintering 1600 300 sec . 10 4 . 8 × 10 . sup . 5 100 1180 1919 microwave 1600 300 sec . 0 4 . 8 × 10 . sup . 5 100 1200 1720 electric 1600 300 sec . 1 4 . 8 × 10 . sup . 5 100 1150 1821 * gas pressure 1600 2 hrs . 10 11 . 5 × 10 . sup . 5 99 965 1322 * gas pressure 1800 2 hrs . 10 12 . 9 × 10 . sup . 5 100 850 1423 * gas pressure 1600 5 hrs . 10 28 . 8 × 10 . sup . 5 100 750 14__________________________________________________________________________ * comparative examples the above results show the invention &# 39 ; s method , especially by using plasma sintering , microwave sintering , and direct current sintering , produces si 3 n 4 - based sintered bodies with high - density , high - strength , and high weibull coefficients in shorter sintering time periods than in the conventional , representative gas pressurized sintering method . example 4 the same high - purity si 3 n 4 powder b as in example 1 was mixed for 36 - 180 hours by using grinding and mixing balls consisting of cemented carbide and nylon . obtained mixed powder samples were sintered by ps sintering or hp sintering in the same manner as in example 1 in a nitrogen gas atomosphere at a pressure of 10 mpa , and were evaluated . the results , together with sintering conditions and methods , are shown in table 4 . table 4 also includes the amount of metal impurities contained in the mixture samples when dried . table 4__________________________________________________________________________ properties of sintered bodiessintering conditions three - point metal sintering sintering bending impurities temp . time strength weibullsample ( ppm ) ( deg c .) ( sec .) method ( mpa ) coefficient__________________________________________________________________________24 - 1 * 420 1600 600 ps sintering 1035 1624 - 2 780 1600 600 ps sintering 1260 2024 - 3 2400 1600 600 ps sintering 1420 2224 - 4 4200 1600 600 ps sintering 1155 1724 - 5 * 6250 1600 600 ps sintering 895 825 - 1 * 420 1600 600 hp sintering 920 1225 - 2 780 1600 600 hp sintering 1100 1825 - 3 2400 1600 600 hp sintering 1295 2025 - 4 4200 1600 600 hp sintering 1010 1525 - 5 * 6250 1600 600 hp sintering 720 6__________________________________________________________________________ * comparative examples the results show that the invention &# 39 ; s method produces high - strength , high - reliability si 3 n 4 - based sintered bodies in relatively short sintering time even in the cases using high - purity si 3 n 4 , by adjusting the amount of metal impurities contained in the powder mixture of si 3 n 4 and sintering aids within the range between 500 and 5000 ppm . the same si 3 n 4 powder mixture a as in example 1 was sintered in the air and in nitrogen gas under the conditions specified in table 5 . oxygen concentration and three - point bending strength of the obtained sintered bodies are also shown in table 5 . the results show that the invention &# 39 ; s sintering conditions enable sintering in the air . table 5__________________________________________________________________________ sintering conditions properties of sintered bodies temp time relative bending oxygen t t pressure t × t density strength concentrationsample atmosphere (° c .) ( sec ) ( mpa ) (° c . × sec ) (%) ( mpa ) ( wt %) __________________________________________________________________________26 - 1 nitrogen 1800 60 10 1 . 1 × 10 . sup . 5 100 1180 426 - 2 air 1800 60 10 1 . 1 × 10 . sup . 5 100 1080 5 . 226 - 3 * air 1800 600 10 11 × 10 . sup . 5 100 600 15__________________________________________________________________________ * comparative example | 2 |
[ 0018 ] fig1 depicts a computer embodiment 100 having a processor 110 connected to a main memory 120 , a mass storage interface 130 , an i / o interface 140 , and a network interface 145 via a system bus 160 . the mass storage interface 130 connects one or more mass storage devices 155 , such as a hard disk drive , to the system bus 160 . the input / output (“ i / o ”) interface 140 connects one or more input / output devices 165 , such as a keyboard , to the system bus 160 . the network interface 150 connects the computer 100 to other computers 100 ( not shown ) over an appropriate communication device 170 , such as the internet . the main memory 120 in this embodiment stores an operating system 124 and one or more objects 135 . each object 135 is an identifiable , encapsulated piece of software instructions and data that provides services upon request . these requests , in turn , are made by other objects 135 . [ 0020 ] fig2 is a schematic view of a distributed computer system embodiment 20 . this embodiment comprises a first computer 21 , a second computer 22 , and a third computer 23 . the first computer 21 , the second computer 22 , and the third computer 23 in this embodiment each comprise a computer 100 ( fig1 ). a plurality of observer objects 26 a - 26 n (“ observers ”) reside in the main memory 120 of the first computer 21 ; a subject object 24 (“ subject ”), a plurality of aspect objects 30 a - 30 n (“ aspects ”), an update accumulator 34 (“ accumulator ”), and a preprocessing object 36 (“ preprocessor ”) reside in the main memory 120 of the second computer 22 ; and a plurality processes 28 a - 28 n reside in the main memory 120 of the third computer 23 . fig2 also shows a plurality of communication paths 32 that allow the subject 24 , the observers 26 a - 26 n , the aspects 30 , the accumulator 28 , the preprocessor 36 , and the processes 28 to send messages to each other . although only one set of communication paths 32 is shown in fig2 those skilled in the art will recognize that similar communication paths 32 allow each observer 26 to send messages to the subject 24 and to one or more aspects 30 . in operation , each observer 26 creates one or more aspects 30 and attaches the aspects 30 to the subject 24 using a predefined set of attach / detach methods . these aspects 30 include information about what specific type of information the observer wants , what form the information should be sent , and how frequently the information should be sent . when the subject 24 changes its state , it produces an update message and sends the message to the attached aspects 30 . if the update is the type that the observer 26 is interested , the aspect 30 sends a message to the subject 24 instructing it to send updated information to the observer 26 . in some cases , this message may also instruct the subject 24 to send the message to the accumulator 34 until the observer 26 is ready to receive the update and / or to send the update to the preprocessor 36 for additional processing . this update method allows the observer 26 to throttle and / or narrow its scope of attachment to the subject 24 . [ 0022 ] fig3 shows a block diagram of the embodiment depicted in fig2 . at block 50 , the subject 24 begins operation . at block 52 , the observer 26 begins operation and creates an aspect 30 ( frequently residing in the subject &# 39 ; s computer 22 ) containing certain configuration information . this configuration information may include , without limitation , what general type of updates of interest to the observer , the maximum frequency at which the observer can receive the updates , whether the subject &# 39 ; s computer 22 should perform any preprocessing , and what form the observer 26 wants the data to be sent . the observer 26 then instructs the aspect 30 to attach itself to the subject 24 . that is , the observer 26 sends a message to the aspect 30 instructing the aspect 30 to request that it be added to the subject &# 39 ; s update list . after this initial setup , the subject 24 begins normal operation . at block 54 , the subject &# 39 ; s state changes . at block 56 , the subject 24 determines whether it should produce an update message in response to this particular type of state change . if this is the type of change for which the subject 24 produces an update message , the subject 24 ( at block 58 ) sends the update to the attached aspects 30 . at block 60 , the notified aspects 30 interrogate the update message from the subject 24 and determine whether their corresponding observers 26 should be notified . the aspects 30 make this determination in this embodiment by comparing the information received from the interrogation of the message with the aspect &# 39 ; s initial configuration information . at block 62 , the aspect 30 determines whether or not the update message needs preprocessing or other modification . again , the aspect 30 makes this determination in this embodiment by comparing the information received from the interrogation of the update message with its initial configuration information . representative modifications include , without limitation , encapsulating the update with internet routing information , compressing the message , encrypting the message , calculating a related value , and filtering the information contained in the update . embodiments implementing the preprocessor 36 may be particularly desirable to reduce system bottlenecks . for example , in some embodiments , computer 22 may be a high - end “ server ” computer and whereas computer 21 may be a relatively inexpensive personal computer or a personal digital assistant . in these embodiments , preprocessing will allow the system 20 to shift part of the total computational load from computer 21 to computer 22 . embodiments using filtering and compression preprocessing may also be desirable for use in environments having limited transmission bandwidth , such as “ wireless ” and “ pervasive ” systems . at block 66 , the aspect 30 determines whether or not it should accumulate the update . in this embodiment , the aspect 30 compares how frequently updates have been sent to the observer 26 with the maximum communication rate specified in the initial configuration information . if the observer 26 is not ready for the update , the aspect 30 instructs the subject 24 to send the update to the accumulator 34 ( at block 68 ). this accumulator 34 may be a simple “ first - in - first - out ” queue , or may use a more advanced algorithm to prioritize the updates . at block 70 , the aspect 30 instructs the subject 24 to send the update to the observer 26 . the subject 24 then waits for the next state change ( block 54 ). the observer 26 can update the configuration information , such as with a real - time system load indication , at any time during the update method depicted in fig2 and 3 . in some embodiments , the observer 26 may update the configuration information by sending a message containing the updated information to the appropriate aspect 30 . in other embodiments , the observer 26 terminates the aspect 30 , creates a new aspect 30 ′ ( not shown ), and instructs the new aspect 30 ′ to attach itself to the subject 24 . other methods of updating the configuration information are also within the scope of the present invention . in one exemplary embodiment , the observers 26 are graphical user interfaces and the subject 24 is a single server &# 39 ; s activity . the aspects 30 in this embodiment would filter events based on need and processing capacity . more specifically , the graphical interface observer ( s ) that are only interested in overall status would define an aspect 30 to select only status events that affect overall status and effectively filter out detailed output . similarly , the graphical interface observer ( s ) designed to display all of the subject &# 39 ; s detailed output could specify two aspects : one to select overall status events , and one that accumulates detailed output until the observer 26 is able to process them as a single event . in the java programming language (“ java ”), the set of attach / detach methods in this example can be defined within an interface “ observable ” ( named here for convenience ). to support the aspect extension , the subject 24 maintains a two - dimensional list : a list of observers 26 and , for each observer 26 , a list of aspects 30 associated with that observer 26 . again , within java , this support can easily be encapsulated within an additional class “ observerlist ” ( named here for convenience ) that is a vector of vectors . continuing the example , the observer 26 implements an update method that enables the subject notification . once again , within java , this method can be defined within an interface “ notifiable ” ( named here for convenience ). given the aspect extension to the attach / detach methods , the observer 26 is enabled to define and dynamically control the aspect ( s ) 30 that the observer 26 is registered with against the subject 24 . the aspect 30 , in turn , is able to filter , throttle , change or exchange the data to be notified from the subject 24 . to minimize remote calls , the subject 24 in this example , upon undergoing a state change , produces a specific type of event , which contains the state change to be passed as a parameter on the observer update call . this event , and the data contained within it , can be architected any number of ways in terms of type and size . once the notification event is produced , the subject processes through the two - dimensional list of observers 26 and aspects to identify those aspects 30 that are configured to react to this event type . the subject 24 then presents the event to the aspect 30 for local examination . the observer 26 controlled aspect utilizes its settings , configuration or cached data to determine if , when and what event it &# 39 ; s paired observer 26 should be notified . this processing and interaction with aspects in this example is encapsulated within and delegated to the fore mentioned observerlist class by the subject . referring again to fig1 the processor 110 in the computer 100 may be constructed from one or more microprocessors and / or integrated circuits . processor 110 executes program instructions stored in main memory 120 . main memory 120 stores programs and data that processor 110 may access . when computer system 100 starts up , the processor 110 initially executes the program instructions that make up the operating system 124 . operating system 124 is a sophisticated program that manages the resources of computer system 100 . some of these resources are the processor 110 , the main memory 120 , the mass storage interface 130 , the input / output interface 140 , the network interface 150 , and the system bus 160 . although computer 100 is shown to contain only a single processor 110 and a single system bus 160 , those skilled in the art will appreciate that the computer 100 may have multiple processors 110 and / or multiple buses 160 . in addition , the interfaces may also each include a separate , fully programmed microprocessor . these embodiments may be desirable because the interface processors can off - load compute - intensive processing from processor 110 . however , those skilled in the art will appreciate that the present invention applies equally to computers 100 that simply use i / o adapters to perform similar functions . the i / o interface 140 directly connects the system bus 160 to one or more i / o devices 165 , such as a keyboard , mouse , or cathode ray tube . note , however , that while the i / o interface 140 is provided to support communication with one or more i / o devices 165 , some computer 100 embodiments do not require an i / o device 165 because all needed interaction with other computer 100 ( and their objects 135 ) occurs via network interface 150 . the network interface 150 is used in this embodiment to connect other computers and / or devices to computer 100 across a network 170 . the present invention applies equally no matter how computer 100 may be connected to other computers and / or devices , regardless of whether the network connection 170 is made using present - day analog and / or digital techniques or via some networking mechanism of the future . in addition , many different network protocols can be used to implement the communication between computers 100 . one suitable network protocol is the transmission control protocol / internet protocol (“ tcp / ip ”). the mass storage interface 130 in this embodiment directly connects the system bus 160 to one or more mass storage devices 155 . the mass storage devices 155 , in turn , may be any apparatus capable of storing information on and / or retrieving information from a mass storage medium 195 . suitable mass storage devices 155 and mediums 155 include , without limitation , hard disk drives , cd - rom disks and drives , dvd disks and drives , tapes and tape drives , and the like . additionally , although the mass storage device 155 is shown directly connected to the system bus 160 , embodiments in which the mass storage device 155 is located remote from the computer 100 are also within the scope of the present invention . one suitable computer 100 is an enhanced as / 400 ® running the os / 400 ® multitasking operating system , both of which are produced by international business machines corporation of armonk , n . y . however , those skilled in the art will appreciate that the mechanisms and apparatus of the present invention apply equally to any computer system and operating system , regardless of whether the computer system is a complicated multi - user computing apparatus or a single workstation . although the present invention has been described in detail with reference to certain examples thereof , it may be also embodied in other specific forms without departing from the essential spirit or attributes thereof for example , the present invention may be implemented on implemented , in whole or in part , on pervasive devices , such as cellular phones , personal digital assistants , and the like . those skilled in the art will appreciate that the bandwidth reduction and processor workload shifting features of the present invention may be particularly desirable in these embodiments . the present invention is also capable of being distributed as a program product in a variety of forms , and applies equally regardless of the particular type of signal bearing media used to actually carry out the distribution . examples of suitable signal bearing media include : recordable type media , such as floppy disks and cd - rw disks , cd - rom , dvd , and transmission type media , such as digital and analog communications links . additionally , the present invention can be used multiple times within a single distributed system 20 . thus , for example , the subject 24 may function as an observer 26 of the processes 28 . the present invention offers numerous advantages over conventional update methods . for example , the aspect design pattern extension offers multiple , flexible , extendible subject / observer relationships . these observer controlled relationships easily facilitate filtering and throttling of updates while maintaining the desired data consistency . the benefits of these extensions are magnified in systems where communication costs are high , such as distributed and pervasive systems . the aspect list allows some embodiments to handle a wider variety of types . this represents a dramatic shift from conventional subject / observer implementations where , given a specific state change , the subject controls what and how often to notify each observer regardless of the desired observer relationship . the accompanying figures and this description depicted and described embodiments of the present invention , and features and components thereof it is desired that the embodiments described herein be considered in all respects as illustrative , not restrictive , and that reference be made to the appended claims for determining the scope of the invention . | 6 |
referring to fig4 - 7 , a table saw 100 in accordance with the present invention is shown comprising a machine base 10 , a table 14 , two supporting devices 18 , four screws 22 , a suspension girder 24 , a lifter 26 , a pin 27 , a saw unit 28 , and an adjustment unit 30 . the machine base 10 has a side panel 10 a , an arched slot 11 formed in the side panel 10 a , an arched rack 12 extending along one side of the arched slot 11 , and angle - indication graduations 13 arranged in parallel to the arched rack 12 . the table 14 is provided at the top side of the machine base 10 , having a front side 141 , a rear side 142 , an opening 143 cut through the top and bottom walls thereof , and two mounting devices 15 and 16 . the mounting devices 15 and 16 are respectively formed in the bottom wall near the front side 141 and the rear side 142 . according to this embodiment , each mounting device 15 or 16 is comprised of two screw holes 151 or 161 . the two supporting devices 18 each are comprised of a locating plate 19 and a guide plate 20 . the locating plate 19 comprises a horizontal wall 191 and a vertical wall 192 . the horizontal wall 191 has mounting means formed of two through holes 191 a . the vertical wall 192 has a smoothly arched slot 192 a . the guide plate 20 is molded from plastics , having a smoothly arched guide slot 201 . the guide plate 20 is attached to the respective locating plate 19 , keeping the smoothly arched guide slot 201 in communication with the smoothly arched slot 192 a of the respective locating plate 19 . the four screws 22 are respectively inserted through the through holes 191 a of the horizontal wall 191 of the locating frame 19 of each of the two supporting devices 18 and threaded into the screw holes 151 and 161 of the table 14 to affix the two locating frames 19 to the bottom wall of the table 14 . the suspension girder 24 comprises a horizontally extending flat girder base 241 , two vertical side plates 242 and 243 respectively downwardly extending from the two distal ends of the horizontally extending flat girder base 241 , two sliding blocks 244 , two wings 245 , and an inner plate 246 . the sliding blocks 244 are respectively inserted through the smoothly arched slot 192 a of the vertical wall 192 of the locating plate 19 of each of the supporting devices 18 and the smoothly arched guide slot 201 of the guide plate 20 of each of the supporting devices 18 , having a stop face 244 a stopped at one side of the respective smoothly arched slot 192 a and two through holes 244 b formed in the stop face 244 a near two distal ends . screws 247 are respectively inserted through the through holes 244 b of the sliding blocks 244 and threaded into the two vertical side plates 242 and 243 of the suspension girder 24 to secure the suspension girder 24 to the supporting devices 18 . one vertical side plate 242 of the suspension girder 24 has a locating hole 242 a . the two wings 245 are fixedly fastened to and vertically downwardly extending from the bottom side of the horizontally extending flat girder base 241 , each having connecting means , for example , a circular hole 245 a . the inner plate 246 is arranged in parallel to the vertical side plate 242 , having a locating hole 246 a . referring to fig8 and fig4 again , the lifter 26 comprises a base frame 261 , which supports the saw unit 28 , and two side frames 262 arranged in parallel at two ends of the base frame 261 . the side frames 262 each have a through hole 262 a and an elongated slot 262 b . the pin 27 is inserted through the circular holes 245 a of the wings 245 and the through holes 262 a of the side frames 262 to pivotally secure the lifter 26 to the suspension girder 24 between the wings 245 . the saw unit 28 comprises a motor drive 281 , and a saw blade 282 . the motor drive 281 is mounted on the base frame 261 of the lifter 26 , and adapted to rotate the saw blade 282 . the adjustment unit 30 comprises a hand wheel 301 , a driven rod 302 , an adjustment rod 303 , a spring 304 , and a pointer 305 . the hand wheel 301 is provided outside the side panel 10 a of the machine base 10 , having a gear 301 a and a connecting portion 301 b . the driven rod 302 is inserted with the two distal ends thereof into the elongated slots 262 b of the side frames 262 of the lifter 26 , having a transversely extending screw hole 302 a . the adjustment rod 303 has a threaded shank 303 a and a connecting portion 303 b at one end of the threaded shank 303 a . the spring 304 is set between the hand wheel 301 and one vertical side plate 242 of the suspension girder 24 , and adapted to force the connecting portion 303 b of the adjustment rod 303 into engagement with the connecting portion 301 b of the hand wheel 301 when the hand wheel 301 receives no pressure ( see fig8 ). the threaded shank 303 a of the adjustment rod 303 is inserted through the spring 304 , the arched slot 11 of the side panel 10 a of the machine base 10 , the locating hole 242 a of the suspension girder 24 , and the transversely extending screw hole 302 a of the driven rod 302 into the locating hole 246 a of the inner plate 246 . when driving the hand wheel 301 to rotate the adjustment rod 303 , the driven rod 302 is driven by the adjustment rod 303 to change its position so as to lift and lower the saw blade 282 . fig8 shows the saw blade 282 received below the table 14 . fig9 and 10 show the saw blade 282 protruding over the table 14 . the pointer 305 is connected to the suspension girder 24 through a connector 306 . when pressed the hand wheel 301 to disengage the connecting portion 301 b from the connecting portion 303 b of the adjustment rod 303 , the gear 301 a is forced into engagement with the arched rack 12 . at this time , the user can rotate the hand wheel 301 to tile the saw blade 282 ( see fig1 ), and the tilting angle of the saw blade 282 is known by means of the indication of the pointer 305 at the angle - indication graduations 13 . referring to fig1 , the table 14 has a horizontal axis h and a vertical axis v . the horizontal axis h extends along the top surface of the table 14 . the vertical axis v passes through the opening 143 and intersected with the horizontal axis h . the intersected point between the horizontal axis h and the vertical axis v is referenced to be the center point c . when lifting the saw blade 282 , it passes through the center point c , and the two sliding blocks 244 are moved along a circular track of which the center coincides with the center point c . when the saw blade 282 is set perpendicular to the top surface of the table 14 , the cutting reference point of the saw blade 282 is at the center point c . when tilting the saw blade 282 , the saw blade 282 is turned about the center point c , i . e ., the cutting reference point of the saw blade 282 remains unchanged for accurate cutting operation when setting the saw blade 282 is any of a variety of angular positions . further , the horizontally extending flat girder base 241 of the suspension girder 24 is close to the bottom side of the table 14 ( see fig1 ). the distance between the horizontally extending flat girder base 241 of the suspension girder 24 and the bottom side of the table 14 is smaller than the diameter ( 9 . 5 mm ) of the prior art suspension rod 3 shown in fig3 . therefore , when lifting the saw blade 282 , a comparatively greater space is available for upward displacement of the motor drive 281 . when lifted the saw blade 282 to the upper limit position , the distance s 2 between the topmost edge of the saw blade 282 and the top surface of the table 1 is greater than the distance s 1 between the topmost edge of the prior art saw blade 2 c and the top surface of the prior art table 1 , i . e ., the saw blade 282 can cut into the workpiece comparatively deeper . although a particular embodiment of the invention has been described in detail for purposes of illustration , various modifications and enhancements may be made without departing from the spirit and scope of the invention . accordingly , the invention is not to be limited except as by the appended claims . | 8 |
as shown in fig1 of the drawings , which are provided for purposes of exemplary illustration , the invention is embodied in a biohazard centrifuge 10 having an housing 12 incorporating a hinged rotor chamber cover 14 which is formed of a high strength translucent material , such as lexan ® a trademark of general electric corporation for polycarbonate resins for example . also incorporated in the centrifuge housing is a seal 16 between the rotor chamber cover and the rest of the centrifuge housing . a control panel 18 is also incorporated in a front side of the centrifuge housing 12 . the interior of the rotor chamber 20 is accessible by lifting the rotor chamber cover 14 , which rotates around hinges 22 . an interlock mechanism ( not shown ) is provided as is known in the art to prevent the rotor chamber cover from being opened while the rotor 24 is in motion . referring now to fig2 and 3 , the centrifuge 10 is cooled by a fan 30 drawing air through the centrifuge housing 12 , the internal configuration providing for a cooling air flow onto and around the outside of a rotor chamber housing 32 enclosing the rotor chamber 20 . a rotor assembly shaft seal 33 is provided in the bottom of the rotor chamber housing 32 to seal the chamber 20 around the drive shaft 35 of the rotor assembly 24 . more particularly , fans 30 draw air through an inlet 34 into a lower portion 36of the housing 12 . this lower portion is separated from an upper portion 46by a baffle plate 38 which mates with the walls of the centrifuge housing except for at a front wall 40 . an opening 42 is left between the baffle plate and the front wall , forcing air drawn into the inlet 34 to pass through this relatively narrow opening extending the width of the housing 12 at the front of the centrifuge 10 , before traveling around the rotor chamber housing 32 and back to the fans 30 . as may be appreciated by one skilled in the art , the combination of the baffle plate and the narrow opening provides a turbulent air flow which is made to contact the rotor chamber housing from a front portion rearwardly to the back of the centrifuge housing 12 where the fans are located . this results in improvedheat transfer from the rotor chamber to the cooling air . additionally , a rotor assembly drive motor 44 can be positioned in the baffle plate 38 so that cooling air is drawn through the motor into the upper portion 46 as well as around it in the lower portion 36 of the centrifuge housing and through the opening 42 at the front of the centrifuge 10 . additionally , control circuits , power supplies , and the like , comprising electronic components 48 shown schematically in fig2 are cooled by the cooling air drawn through the centrifuge housing 12 by the cooling fans 30 . the cooling configuration of the invention providing for improved removal of heat from heat sources within the centrifuge 10 . more particularly , referring to fig4 and 5 , heat is removed from the rotor chamber 20 by the turbulent air 50 in the chamber 20 transferring heat 52 to the walls of the rotor chamber housing 32 , and from the rotor chamber housing walls heat 52 is transferred to the cooling air stream 54 . as can be seen particularly in fig5 the cooling air stream 54 is drawn in at inlets 34 below the baffle plate and exits the centrifuge 10 throughfans 30 above the baffle plate . in order to increase heat transfer across the rotor chamber housing wall 32 , fins 56 can be provided on the rotor chamber housing in contact with the cooling airstream 54 within the centrifuge housing 12 . as will be appreciated , centrifuge 10 of the invention is cooled to approximately ambient room temperature by means of the cooling air stream 54 which is separated from the interior of the rotor chamber 20 . this minimizes the possibility that a contaminant in aerosol form , as is likelyto be generated within the rotor chamber should a leak occur , will not be in contact with the cooling air stream . as a consequence , it is extremely unlikely that the lab environment will be contaminated by hazardous materials introduced into the cooling airstream 54 blowing through the biohazard centrifuge 10 , even in the event of a sample leak within the rotor chamber 20 . referring to fig6 and 7 , to further ensure that hazardous materials being separated in the centrifuge 10 of the invention are safely contained , a conveniently closable sample container 60 is provided to act as a carrier for specimens ( not shown ) to be separated . the sample container interfits with the rotor 24 as is known in the art to provide anability for the container to swing to a horizontal position in centrifugation of enclosed samples . to provide a convenient closure , a translucent cover lid 62 , formed of lexan ® for example , is provided with a l - shaped slot 64 . the sample container 60 is provided with a pin 66 which engages the l - shaped slot when closing the lid 62 over the sample container 60 . as will be apparent , this arrangement effects a closure of the sample container by a simple twist of the lid 62 , which locks into place by virtue of the pin 66 catching in the l - shaped slot . also , as will be apparent , in addition the arrangement shown in fig6 and 7 employing two pins and two l - shaped slots , multiple pins around the circumference of the sample container 60 could be provided to cooperate with the same number of l - shaped slots provided in the lid 62 , decreasing further the distance the lid must be turned before the pins align with slots 64 , the lid then dropping into place , and further twisting effects closure . a mouth portion 68 of the l - shaped slot 64 is made relatively wide to easily interfit with the pin 66 . a horizontal portion 70 of the slot is given an slightly helical configuration so as to tightly engage the lid 62and the sample container 60 as the lid is twisted in a clockwise direction when the pin 66 is engaged in the l - shaped slot 64 . disengagement of a lidis similarly simple , as the user needs only to twist the lid 62 in a counter clockwise direction a short distance and remove the lid , letting the pin 66 pass through the mouth portion 66 of the slot 64 . turning to fig8 and 9 , alternate embodiments of the centrifuge 10 according to the invention are illustrated . as will be appreciated by one skilled in the art , a cooling fan 30 could be provided on the shaft 35 of the drive motor 44 to provide a cooling air flow . in fig8 a cooling airflow is provided by placing the fan in an opening 78 in the baffle plate 38between the lower portion 36 and the upper portion 46 of the centrifuge housing . cooling air is drawn through intake vents 34 distributed about a lower outer periphery of the housing 12 , through the lower portion 36 of the centrifuge housing , and forced by the fan into the upper portion 46 ofthe housing and onto the exterior of rotor chamber housing 32 , traveling radially outward along a bottom portion of the rotor chamber housing between the rotor chamber housing and the baffle plate , and thereafter turning upward about the outer periphery of the rotor chamber housing and traveling up the sides thereof and exhausting through cooling air exhaust vents 80 disposed around an upper periphery of the centrifuge housing in the upper portion 46 thereof . alternatively , fig9 illustrates a centrifuge 10 of the invention operating upon the same principle , but wherein the fan 30 is disposed on the shaft 35 of the drive motor 44 below the drive motor adjacent an inletopening 34 in the centrifuge housing 12 at a bottom portion thereof . cooling air is drawn from below the centrifuge housing , which it will be appreciated must be separated from a surface ( not shown ) on which it restsby spacing feet 82 to provide a air flow clearance underneath the centrifuge 10 . air drawn into the centrifuge housing 12 by the fan thus disposed on the shaft of the drive motor is blown upwardly to contact the bottom of the rotor chamber housing 32 and thereafter continues in a radial direction outward and around the outer periphery of the rotor chamber housing , and up and through exhaust vents 80 provided around an upper periphery of the centrifuge housing 12 . as with the other embodiments described , a seal 16 is provided between a rotor chamber cover14 and the rest of the centrifuge housing 12 to prevent co - mingling of cooling air and air within the rotor chamber 20 . from the foregoing , it will be appreciated that the centrifuge 10 of the invention allows hazardous materials to be separated with improved safety to laboratory personnel by providing a cooling airstream which is physically separated from the rotor chamber 20 and thereby avoids contact with any hazardous materials that may escape from within the rotor assembly 24 in motion . also , an additional safety feature is provided in the more convenient provision of closed sample containers 60 , 62 in the rotor assembly 24 to contain any hazardous material that may leak from samples contained within the container 60 , and therefore is more likely tobe used by laboratory personnel . while several particular forms of the invention have been illustrated and described , it will also be apparent that various modifications can be madewithout departing from the spirit and scope of the invention . it is intended that the invention not be limited except by the appended claims . | 1 |
with reference to fig1 and 2 , the reference numeral 1 indicates a working floor on which an excavator 2 moves , this latter being composed of a rotatable turret 3 , a chassis 4 , rolling trains 5 and an articulated excavating arm 29 . a first rigid arm 7 of steel or other suitably strong material is hinged by means of a horizontal trunnion 33 to the front of the rotatable turret 3 , which can rotate in a plane parallel to the working floor 1 by means of a thrust bearing 6 . the arm 7 can rotate in a plane perpendicular to the working floor 1 , and coinciding with the vertical plane of symmetry of the excavator 2 when the turret 3 is not rotated . a first hydraulic rod actuator 8 hinged to the turret 3 and to the outer end of the arm 7 enables this latter to be moved in said plane so that it withdraws from or approaches the working floor 1 . the arm 7 terminates in a fork 9 which acts as a seat for a second rigid arm 10 of steel or other suitably strong material hinged to the arm 7 by means of an articulated joint 34 comprising a vertical pin 11 fixed to the arm 10 and substantially perpendicular to the floor 1 , so that said arm 10 can rotate in a plane substantially parallel to the plane 1 . a toothed wheel is connected to the upper end of the pin 11 , and engages with a worm of a hydraulic actuator 12 of known type mounted on the arm 7 . on said end of the arm 7 there is also disposed a vertical fixing pin 13 which can engage with bores 14 provided in the arm 10 or in lugs 15 rigid with the arm 10 . said arm 10 terminates in another end 16 to which a third rigid arm 19 of steel or other suitably strong material is coupled by means of a fork 17 and a vertical pin 18 fixed to the arm 10 and constituting an articulated joint 35 , this third arm being able to rotate by virtue of the pin 18 in a plane substantially parallel to the plane 1 and in practice coinciding with the plane of rotation of the arm 10 . a toothed wheel is connected to the lower end of the pin 18 and engages with a worm of a hydraulic actuator 20 similar to the actuator 12 and fixed on to the arm 19 . this latter , at its outer end 21 , also carries a horizontal hinge pin 36 which is connected to an intermediate zone of a fourth rigid arm 22 , the outer end of which is hinged in known manner to an arm 40 of a known assembly 41 of levers for operating an excavating shovel or bucket 24 . said arm 40 is operated by virtue of the fact that it has connected to it the end of a rod of an actuator 25 , the body of which is fixed to an inner end 42 of the arm 22 . this latter is able to rotate , by way of the pin 36 , in a plane perpendicular to the floor 1 and parallel to that in which the first arm 7 can move , and is controlled by a rod actuator 23 fixed between the end 42 of the arm 22 and the inner end 44 of the arm 19 . the arm 19 is also provided with a vertical fixing pin 27 which can engage in bores 28 provided in the end 16 of the arm 10 . in fig3 the excavator 2 is shown excavating a trench 30 lateral to the excavator , its walls 31 being perfectly parallel nd perpendicular to the working floor 1 and to a base 32 . thus , if the excavator 2 is able to straddle the excavation , the arm 10 will not be rotated , and thus the plane of its axis will coincide with that of the arm 7 and arm 19 , and with the turret 3 in a non - rotated position the entire articulated arm 29 will operate in the vertical plane of symmetry of the excavator . the bucket 24 is then made able to excavate by moving the arms 7 and 22 in this plane by means of the articulated joints 33 and 36 . however , in order to make a lateral excavation , the pins 13 and 27 are removed from the bores 14 and 28 in which they are located , and the arms 10 and 19 , thus released , are rotated by means of the hydraulic actuators 12 and 20 so that the arm 19 becomes disposed in a plane parallel to the vertical plane of symmetry of the excavator and thus perpendicular to the working floor but passing to the side of the excavator . further bores 14 and 28 serving as reference bores are provided to correspond with the new position assumed by the arm 10 , and enable the pins 13 and 27 to be reinserted in order to lock the arms 10 and 19 so as not to overload the hydraulic actuators 12 and 20 during the excavation . by means of this operation , the excavating shovel 24 and the corresponding arm 22 , which are rigid with the arm 19 , assume a position in the excavation plane to the side of the excavator , while at the same time remaining parallel to the arm 7 which on being lowered enables the excavation to be made in depth . as the arms 22 and 19 carrying the bucket 24 are parallel to the arm 7 , the movement of the bucket 24 takes place in a manner rigorously perpendicular to the working floor 1 , thus giving walls 31 which are perfectly flat , parallel , and perpendicular to the floor 1 . the advantages of the present invention are apparent from the aforegoing description . in a simple manner , it enables a result to be obtained which cannot be obtained by any of the known devices , in that it enables a lateral excavation to be made which is perfectly perpendicular to the working floor and at the same time of considerable depth , while maintaining a limited overall machine width . when moving the vehicle on the road , this width can be made equal to the machine gauge by rotating the arm 19 backwards into a suitable position defined by reference and fixing bores , thus also reducing its overall length . furthermore , all the excavation operations are carried out without rotating the turret 3 , which is moved only for unloading the removed material , for example into the back of a suitable truck . this characteristic enables the operator to always operate under the best possible conditions , with excellent visibility of the excavation , and thus overall enables more accurate work to be carried out , and dispenses with the need for any costly manual finishing operations on the excavation . from the description it is apparent that modifications can be made to the structure according to the present invention without leaving the scope of the inventive idea . in particular , the arms 10 and 19 can be moved in the plane parallel to the working floor by hydraulic rod actuators mounted to the side of the arms and of the same type as those ( 23 , 25 ) used for the other movements of the articulated arm 29 , or by hydraulic motors , or again manually without any actuator , or further by placing the bucket 24 on the working floor and rotating the turret 3 . the position assumed by the arms 10 and 19 is then fixed by the pins 13 and 27 . in addition , the number of component arms and articulated joints of the articulated arm 29 can be varied , provided this number allows the shovel 24 to be moved in a plane parallel to the plane containing the first arm 7 and perpendicular to the working floor 1 . finally , the articulated arm 29 according to the present invention can be fitted to excavator machines of a type other than that illustrated . in particular , it can be fitted to the rear region of tractors of the rough terrain vehicle type , for example comprising a slide slidable along guides perpendicular to the longitudinal axis of the vehicle . by sliding this slide , the distance of the excavation line from the side of the vehicle can be further increased . | 4 |
the composition of the fibers comprising the mist eliminator 13 employed in this process may vary widely , and practically any material that can be wire drawn can be utilized . suitable materials include metals such as stainless steel , monel , inconel , aluminum , hastelloy b , and the like , or they may include synthetic materials , such as teflon , polyester , fiberglass , polyvinyl chloride , polyurethane , polyethylene , polypropylene and the like . most preferably , the porous member is composed of expanded aluminum , polyethylene or polypropylene . it is also desirable to employ a porous member having a considerable amount of open area so the pressure differential across the mist eliminator is in the range of about 0 . 3 to 0 . 6 inches of water . mist eliminators having 85 to 98 percent by volume of open area have been found to be especially satisfactory . for satisfactory operation it is essential that the wetted urea particles strike the surface of the demister with sufficient energy to cause wet impaction of the particulate matter on its surface . accordingly , an air stream carrying entrained particles must travel at a certain minimum velocity in order for impaction of the particles to occur . for urea particles entrained in air , this minimum linear velocity of the air stream is in the range of three feet per second . the particle size range of the urea which can be effectively removed by this process is in the range where at least 50 percent of the particles have diameters of less than three microns . the effectiveness of the present invention for the removal of foreign particles from a particle - laden gas stream is illustrated by the following examples wherein urea dust was effectively removed from the cooling air exhaust exiting from the windows of a urea prilling tower . the process of the present invention was evaluated by the asme test procedure , power test code - 27 , which was approved by the ohio environmental protection agency . experiments representing the invention were conducted on a demister pad test module installed in one of the 10 exhaust exit windows of the urea prilling tower . window no . 2 of the prilling tower was fitted with a vertical filter consisting of polypropylene demister pads , ( a . c . s . industries ) having a thickness of 3 inches with a one - inch foam demister backing ( scott industries ), and an open are a volume of 95 %. this demister was representative of the mist eliminators of the present invention . the windows without the test module were tested for comparative purposes and are referred to as uncontrolled effluent . air sampling filters were desiccated and weighed before use . after sampling and desiccating overnight , the filters were reweighed and the dust loadings were calculated . the air volume sampled was measured with a dry test meter and the volume of the air exiting the prill tower was determined from heat balance calculations . a probe was used with the sampling rate being varied to obtain an isokinetic sample . the total emissions were calculated by multiplying the total air flow up the tower by the average weight gain of urea on the sample filters per unit volume of air . calculations based on the readings indicated the air velocity at the demister pad test module face was 5 . 0 ft / second . spray water circulation was 0 . 5 gpm / 1000 cfm of air , and the spray water contained 2 percent by weight of urea in solution and was directed against the entire surface of the demister pad . pressure drop measured across the demister test module was 0 . 5 inches of water . the emission rates determined for the exit windows with and without the mist eliminator under the above process conditions are compared in table i . the acceptable dust emission as established by the ohio environmental protection agency was obtained using ohio epa regulation ap - 3 - 12 . the process weight was determined by adding the air rate to the urea prill rate , and the allowable emission rate was then determined by applying the process weight to the tables in regulation ap - 3 - 12 . the allowable emission rates are also shown in table 1 for comparative purposes . table 1__________________________________________________________________________urea emissions in prill tower testsprocess conditions emission rates - lbs ./ day prill process uncontrolled controlled rate air rate rate ( no demister ( with demistertest ton / day scfm ton / hr . pad ) pad ) allowable__________________________________________________________________________1 853 249 , 400 599 2428 1270 17282 714 280 , 700 664 3098 1700 1754__________________________________________________________________________ | 1 |
turning now to the drawings , fig1 shows a carrier vehicle 20 having a chassis 21 upon which a body 22 and an operator &# 39 ; s cab 23 are supported . the chassis 21 is supported on the axles 24 , 25 of the front and rear ground wheels 26 , 27 by a suspension system that includes front and rear struts 30 , 31 . the struts 30 , 31 may be of the direct - acting type being pivotally connected to the axle 24 , 25 or wheel control link at one end , and similarly connected to the frame of the chassis 21 at the other end . the struts 30 , 31 may be single acting hydraulic cylinders , such as illustrated in fig2 having a chamber 34 containing a compressible gas 32 , such as nitrogen , and an incompressible hydraulic fluid 33 , such as oil . the struts 30 , 31 may also have an additional chamber 35 for incompressible fluid which may vary in volume as the strut 30 , 31 telescopes during operation . fluid flow between the chambers 34 , 35 in the strut 30 , 31 is achieved through valve controlled passages 36 to permit telescoping motion of the strut 30 , 31 . alternately , the struts 30 , 31 may be of the conventional hydropneumatic type with the gas 32 and fluid 33 contained in two or more chambers separated by a rubber diaphragm , a moveable piston , or the like ( not shown ). one skilled in the art will appreciate that the configuration shown in fig2 is given by way of illustration and not limitation . the struts 30 , 31 are charged or filled through fluid and gas charge valves 37 with sufficient volumes of fluid and gas in order to achieve a specified strut ride height . in the embodiment illustrated in fig1 and 2 , the struts 30 , 31 are &# 34 ; uncompensated &# 34 ; as the total volumes of fluid and gas contained within the chambers of the strut 31 , 32 do not vary as the vehicle 20 encounters an input force as the vehicle moves down the road or the body 22 is loaded . in accordance with the present invention , each strut is modified into a so - called &# 34 ; compensated &# 34 ; strut by the addition of an external variable - volume accumulator that allows the volume of gas in the strut to be varied . according to an important aspect of the invention , an orifice regulates the flow of gas between the accumulator and the gas chamber of the strut to control the movement of the axle relative to the vehicle . describing the system in more detail , the accumulator has two chambers separated by a floating piston portion , a diaphragm , or a rubber bladder within the accumulator cylinder . one chamber of the accumulator contains a gas and is connected to the strut , while the other chamber contains an incompressible liquid and is connected to a source of liquid under pressure . a valve mechanism controls the supply of liquid from the source to the accumulator chamber to permit adjustment of the volume of liquid in the accumulator . an orifice controls the flow of gas between the gas chamber of the accumulator and the chamber of the strut which contains gas . the orifice regulates the flow of gas such that the resulting dynamic response characteristics of the strut may be defined . as a result , an &# 34 ; uncompensated &# 34 ; suspension system may be &# 34 ; compensated &# 34 ; by the addition of an external device so that the system will achieve desired performance characteristics . to permit economic component geometry in a conventional uncompensated suspension system , the total suspension stroke must remain relatively short . in order to prevent a strut from bottoming out when the vehicle accelerates or encounters road inputs , the spring rate of an uncompensated strut increases rapidly as the load is added to the empty vehicle . the performance characteristics of a conventional uncompensated suspension strut without the adaption of the invention are illustrated in fig3 - 6 as curve a . fig3 - 6 show the static and dynamic characteristic curves for an empty and loaded vehicle for both the front and the rear struts . in fig3 - 6 , the left vertical axis represents the increasing sprung load on the strut . the horizontal axis reflects the decreasing stroke of the strut remaining until the volume of gas in the strut chamber is at zero . as the sprung load on the strut increases and the corresponding stroke of the strut remaining diminishes , the strut gas pressure increases , as shown on the right vertical axis . the determination of the natural frequency of the suspension at normal ride position is a method of evaluating the ride acceptability of the vehicle . a low natural frequency generally indicates an acceptable ride with corresponding low shocks , while a high natural frequency generally indicates a harsh ride . referring again to fig3 - 6 , the steeper the ascension of the performance curve , the higher the &# 34 ; instant &# 34 ; natural frequency and the more severe the acceleration of the sprung mass at any given point on the curve . moreover , in fig3 - 6 , the area below each performance curve represents the total energy absorbed during any given excursion distance . the shorter the distance to absorb the energy , the higher the shock transmitted to the chassis 21 for any given amount of energy absorbed . as the shock transmitted increases , ride unacceptability and resulting frame stresses likewise increase . thus , curve a representing the uncompensated suspension characteristics indicates a harsh vehicle ride for both the empty and loaded excursions of the front suspension ( fig3 and 5 ), and the loaded excursions of the rear suspension ( fig6 ). in order to improve ride acceptability by lowering the natural frequency of the suspension at normal ride position and decreasing the amount of shock transmitted for a given amount of energy absorbed , it is desirable to increase the stroke of the strut . to provide an increased constant stroke when the load is varied , the suspension is upgraded or &# 34 ; compensated .&# 34 ; to this end , more mass is added to the spring or strut 30 , 31 by means of an external variable volume reservoir or accumulator 40 , 41 , as shown in fig7 . it will be appreciated that the schematic of fig7 illustrates the upgraded suspension components and that their approximate location for only one side of the vehicle , as the suspension components for opposite side of the vehicle are duplicative of the components shown . in a preferred embodiment , the accumulator is a cylinder 42 which has two chambers 43 , 44 separated by a floating piston 45 . one cylinder chamber 43 contains oil or a similar incompressible fluid . the other cylinder chamber 44 contains a compressible gas , such as nitrogen , as is contained in the strut 30 , 31 . while the chambers 43 , 44 are separated by a floating piston 45 in the embodiment shown , one skilled in the art will appreciate that the chambers 43 , 44 may alternately be separated by a diaphragm , or a rubber bladder , or the like ( not shown ) as the configuration shown is given by way of illustration and not limitation . in order to provide a flow of nitrogen between the strut 30 , 31 and the gas chamber 44 of the accumulator 40 , 41 , a line 46 connects the chamber 34 of the strut 30 , 31 which contains the gas 32 with the gas chamber 44 of the accumulator 40 , 41 . if this line 46 allowed free flow of nitrogen between the two chambers 34 , 44 , as the strut encountered an input force , nitrogen would rapidly transfer from the chamber 34 of the strut 30 , 31 into the chamber 44 of the accumulator 40 , 41 . such unrestricted flow would result in the strut 30 , 31 bottoming out , and an unacceptably harsh input to both the chassis 21 and the driver . in order to maintain the additional stroke without permitting such bottoming out , the invention utilizes an orifice 47 to regulate the gas flow between the chambers 34 , 44 . in this way , and according to accepted principles of operation of orifices , when the gas pressure is greater than about 15 psig , the high pressure volume of gas discharged through the orifice 47 is substantially independent of pressure . as a result , the gas flow between the chambers 34 , 44 occurs at a substantially constant rate depending on the orifice 47 size and the orifice coefficient . it will be noted that the dimensions of the orifice 47 may be tailored so that the orifice coefficient will depend upon the direction of flow . further , the volumetric flow rate will depend upon the direction in which the gas flows between the two chambers 34 , 44 . in an alternate embodiment , the orifice 47 characteristics could be approximated by a device utilizing a check valve and preset directional valves ( not shown ). in this way , the addition of suspension stroke by means of an orifice 47 or other device which regulates gas flow to and from the external variable volume accumulator 40 , 41 results in more desirable performance characteristics while preventing the suspension from bottoming out with sudden inputs . moreover , the orifice 47 design parameters allow design flexibility in order to achieve specified dynamic performance characteristics . it is known that , for pressures greater than 15 psig , the volume of high pressure gas discharged through the orifice is independent of pressure , as represented by the following equation : ## equ1 ## in this equation , the letter &# 34 ; v &# 34 ; represents the volumetric flow of the higher pressure gas through the orifice in cubic inches per second . the letter &# 34 ; a &# 34 ; represents the cross sectional area of the orifice in square inches . the letter &# 34 ; c &# 34 ; represents the orifice coefficient in a particular direction . the letter &# 34 ; t &# 34 ; represents the absolute temperature of gas in the high pressure gas chamber . the &# 34 ; constant &# 34 ; for calculation purposes is 179 , 750 . by way of specific example , for an orifice diameter of 0 . 125 inches , with an orifice coefficient of 0 . 65 , and an absolute temperature of 560 degrees fahrenheit , the volume of higher pressure gas expelled through the orifice would be 60 . 558 cubic inches per second . for the same orifice dimensions and temperature , if the orifice has an orifice coefficient of 0 . 90 in the opposite flow direction , the resulting volumetric flow rate would be 83 . 849 cubic inches per second . in this way , regardless of the specific pressure achieved in excess of 15 psig within struts 30 and 31 , a predictable gas flow rate between the chambers 32 , 44 may be calculated to design specific suspension performance characteristics , such as those shown in fig3 - 6 . in accordance with the invention , fig8 illustrates an orifice 47 through an orifice fitting 48 secured in a wall of the chamber 34 of the strut 30 , 31 . it will be appreciated that the orifice 47 and orifice fitting 48 shown represent only one possible design and that the specific configuration and dimensions of the orifice 47 are parameters that may be varied in order to yield desired system performance results . in order to assemble the orifice fitting 48 in the strut 30 , 31 , the fitting 48 is provided with threads 49 that mate with corresponding threads in the strut wall . in this way , the orifice fitting 48 may be secured in the existing opening in the strut wall for the gas charge valve 37 ( fig2 ) or in an opening specifically designed to accept the fitting 48 . likewise , the fitting 48 is provided with threads 50 which mate with the fitting of line 46 to the gas chamber 44 of the accumulator 40 . in this way , the orifice 47 provides a means by which the flow of gas between the accumulator gas chamber 44 and the strut chamber 34 may be regulated to define the strut &# 39 ; s ( 30 , 31 ) specific dynamic performance results . it will be appreciated that the curves of fig3 - 6 illustrate only representative static and dynamic figures , as the actual results will vary based upon the dimensions of the orifice 47 and the orifice coefficient . curve b represents the static deflection performance of the upgraded strut . curves c , d , and e represent the dynamic performance of the upgraded strut as deflected at increasing speeds , curve e representing an infinitely fast deflection time . in viewing the curves , one skilled in the art will appreciate that the dynamic stiffness characteristic varies as a function of the speed of the excursion in the upgraded strut . in this way , the invention yields a suspension system with a very soft spring rate for slow deflections , while it prevents the suspension from bottoming as a result of rapid excursions , even with the relatively short maximum compression stroke mandated by vehicle space restrictions . as shown in fig3 and 7 , as the stroke for a given input load increases , the resulting performance curve ( curves c , d , e ) will remain flat for a longer stroke distance and then ascend less steeply than for the uncompensated strut ( curve a ). this is likewise true for the static performance curve b and the dynamic performance curve c for long frequency period excursions of the rear suspension in an empty vehicle , as shown in fig4 . in this way , the upgraded suspension system displays a lower instant natural frequency and reduces the amount of shock transmitted for a given amount of energy absorbed . more specifically , as shown by curve c , on a normally undulating road with a long frequency period , the response curve approaches a static displacement versus load curve as illustrated by curve b in fig3 - 6 . this result is most evident in fig6 in which the static deflection performance ( curve b ) and the dynamic performance for long frequency period excursions ( curve c ) of the loaded rear suspension are reflected by the same curve , designated curve b / c . in this way , the suspension system responds to low frequency inputs with a soft spring rate . as the speed of the dynamic input increases , as illustrated by curve d and further curve e in fig3 - 6 , the response curves ascend more rapidly to protect against &# 34 ; bumping .&# 34 ; as illustrated by curve e in fig3 , and 6 , when a rapidly moving truck encounters abrupt bumps , the response curve approaches an infinitely rapid curve , yet results in a longer stroke than the uncompensated suspension system for an equal area under the curve . thus , the increased energy absorption capacity during a given excursion of the upgraded strut results in less shock to the driver . while curves d and e for the upgraded rear suspension excursion in the empty vehicle ascend more rapidly than the existing strut ( curve a , fig4 ), the performance curves a through e shown in fig4 and 6 demonstrate the flexibility of the design parameters of the invention . due to the use of a fixed orifice , desirable characteristics for the rear strut excursion in the empty vehicle are attained by optimizing such design parameters as the normal ride stroke , the connected reservoir volume , and the orifice size and design . in this way , the design parameters of the rear suspension strut are tailored to provide more lateral roll stability in the empty vehicle than previously supplied by the uncompensated strut . returning now to fig7 in order to provide the upgraded system with additional flexibility , the pneumatic accumulator 40 , 41 is hydraulically operated . to this end , the oil chamber 43 of the accumulator 40 , 41 is provided with a source 52 of incompressible fluid . the volume of incompressible fluid in the oil chamber 43 of the accumulator 40 , 41 may thus be varied by way of a system of control devices to further define the size of the gas chamber 44 of the accumulator 40 , 41 . in order to detect the relationship of the body 22 and cab 23 to the axles 24 , 25 , position sensors 53 , 54 , are provided . the position sensors 53 , 54 each contain a double throw switch 55 , 56 or a similar sensing device . the front position sensors 53 are mounted to sense the vertical spacing of the front axle 24 from the vehicle body 22 and cab 23 . in the embodiment shown , the position sensors 53 are conveniently mounted to the steering cylinder 57 to detect this vertical movement . similarly , the rear position sensors 54 are mounted to sense the vertical spacing of the rear axle 25 to the vehicle body 22 . in this way , the actuation of the switches due to the change in vertical relationship of the vehicle body 22 and cab 23 to the ground will cause hydraulic fluid to be added or removed from the accumulator 40 , 41 in order to maintain a specified ride height , irrespective of the load . while the following explanation may refer to a single strut , accumulator , and control system , the reader will appreciate that the explanation refers to each individual wheel and corresponding strut , accumulator , and control system . as shown in fig7 during operation , the accumulator 40 , 41 is kept charged by a pump 61 from the fluid source 52 through a pressure control valve 62 and line 63 . when the pressure in the accumulator 40 , 41 reaches the level for which the valve 62 is set , that pressure , acting through a passage 64 , opens the output of the pump 61 to the source 52 through a line 65 . oil is added to the accumulator 40 , 41 through three - way solenoid operated valves 70 , 71 via lines 63 , 72 from the source 52 . the valve 70 , 71 can be operated either manually , so that the operator may add or remove oil from the accumulator 40 , 41 at will , or the same operation may be performed automatically . the operator in the cab 23 may determine the method of operation at the control panel 73 via the mode selection switch 74 . as shown in fig9 each of the valves 70 , 71 is controlled by an up relay 80 , 81 and a down relay 82 , 83 as well as a manual switch 84 for valves 70 and a manual switch 85 for valves 71 . the circuit is energized from a source 86 through a key switch 87 . when the mode selection switch 74 is in the automatic position as illustrated in fig9 the contacts of control relays 90 , 91 are closed . closing the contact for the relay 90 provides power to up and down relays 80 , 82 and the switches 55 for the front valves 70 . likewise , closing the contacts for the control relay 91 provides power from the line 92 , to switches 56 and up and down relays 81 , 83 for the rear valves 71 . operation of switches 55 or 56 in either the up or down direction energizes the associated up or down relay 80 , 82 , 81 , 83 associated with control valves 70 , 71 so as to operate the valves in appropriate direction . when the mode selection switch 74 is set for automatic operation of the front and rear valves 70 , 71 , some range of motion before the switches 55 , 56 are activated is desirable . to this end , time delay relays 100 , 101 are provided which prevent compensation of the system when normal travel vibrations , road bumps , and other transient conditions are encountered . because the relays 100 , 101 may be set to a desired time period , the relays 100 , 101 cause the system to be compensated when an input is sustained over a longer period of time . in this way , since the system does not respond to short , unsustained inputs , the time delay relays 100 , 101 conserve energy required to compensate the system by pumping oil into the oil chambers 43 of the accumulators 40 , 42 . the time delay relays 100 , 101 are provided with normally open contacts , 102 , 103 interposed in the line from the power source 86 which energizes one side of the up and down relays 80 , 82 , 81 , 83 for each of the valves 70 , 71 . a relay 100 , 101 is picked up when energized through one of the lines 104 , 105 , respectively , for a given time period . in a preferred embodiment of the invention , the time delay 100 , 101 would be set such that no subsequent position compensation would be made unless an excursion lasted for a period exceeding , for example , something on the order of four seconds . such an excursion could occur during a long sweeping , high - speed turn when the truck would tend to lean due to centrifugal force ; as a results after four seconds compensation would commence that would laterally level the truck . any change in payload would be compensated in a similar manner . the lines 104 direct current to the relay 100 through one of a set of diodes 106 whenever either switch 55 is moved to either the up or down actuated position . likewise , the lines 105 direct the current to the relay 101 through one of a set of diodes 107 whenever either switch 56 is moved to either the up or down actuated position . thus , the switches 55 , 56 must remain operated for a minimum of four seconds before the associated one of the relays 80 , 82 , 81 , 83 will be picked up to operate one of the valves 70 , 71 . when the mode selection switch 74 is moved from the illustrated position to the manual position , control relays 90 , 91 are picked up and current is supplied to the manual switches 84 , 85 . picking up of the relays 90 , 91 opens the circuit from the key switch 87 to the up and down relays 80 , 82 , 81 , 83 of the valve 70 , 71 so that the relays become ineffective . movement of the manual switch 84 to either its up or down position energizes the appropriate solenoid for both of the valves 70 . movement of the manual switch 85 to either its up or down position energizes the appropriate solenoid for both of the valves 71 . in this way , the operator may directly operate the valve 70 , 71 to manually adjust the suspension system . in summary , the invention provides a method by which a currently uncompensated strut 30 , 31 may be modified to yield an increased suspension stroke while preventing the suspension system from bottoming out . the chamber 34 of the strut 30 , 31 which contains gas 32 is adapted with an orifice 47 to allow a regulated flow of gas to the gas chamber 44 of an associated accumulator 40 , 41 . the dimensions of the accumulator gas chamber 44 are determined by the volume of the incompressible fluid or oil in the accumulator oil chamber 43 , which is separated from the gas chamber 44 by a floating piston 45 within the accumulator cylinder 40 , 41 . in order to level the vehicle 20 , oil from a source 52 may be added to or removed from the accumulator 40 , 41 through a solenoid operated valve 70 , 71 and control devices including a pump 61 , a pressure control valve 62 , and lines 63 , 72 . leveling may be achieved automatically or manually , as selected by the operator of the vehicle . | 1 |
the following detailed description of the invention is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . furthermore , there is no intention to be bound by any theory presented in the preceding background of the invention or the following detailed description of the invention . with that said , the present invention is a cosmetic agent comprising in a cosmetically acceptable carrier : ( i ) at least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid alkyl esters , and methacrylic acid alkyl esters ; and ( ii ) at least one amphoteric monomer a2 selected from ( meth ) acryloyl alkyl amine oxides of formula a2 - i , wherein in formulas a2 - i and a2 - ii : r 1 stands for h or ch 3 ; r 2 and r 3 each , independently of one another , stand for optionally branched c 1 - 10 alkyl ; and n stands for an integer from 1 to 20 ; ( b ) at least one film - forming and / or hair - setting amphoteric polymer b which is different from copolymer a ; and ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula c1 and at least one itaconic acid ester monomer of formula c2 , wherein r 4 stands for a hydrogen atom or a methyl group ; r 5 stands for a hydrogen atom or a ( c 1 to c 4 ) alkyl group ; r 6 and r 7 denote a hydrogen atom provided that at least one radical of r 6 and r 7 stands for a group - a 1 - r 8 , wherein a 1 stands for a group *—( ch 2 ch 2 o ) x —* in which x stands for an integer from 5 to 35 , a group *—( ch 2 chmeo ) y —*, wherein y stands for an integer from 5 to 35 or a group *—( ch 2 ch 2 o ) x —( ch 2 chmeo ) y —*, wherein the sum of x + y stands for an integer from 5 to 35 and x and y are greater than zero ; and r 8 stands for a ( c 6 to c 30 ) alkyl group . film - forming amphoteric and / or hair - setting amphoteric polymers b are known . the same also holds for copolymers a and their use as film - forming and / or hair - setting polymers . the cosmetic agents according to the invention contain at least one copolymer a as the first obligatory component . copolymers a formed from the aforementioned monomers are understood in the sense of the present invention to include only those copolymers which contain in addition to polymer units resulting from the incorporation of the aforementioned monomers a1 and a2 into the copolymer , max . 5 wt %, preferably max . 1 wt % polymer units attributed to the incorporation of other monomers . the copolymers a are exclusively composed of polymer units resulting from the incorporation of the aforementioned monomers a1 and a2 into the copolymer . preferred monomers a1 include acrylic acid , methacrylic acid , acrylic acid c 1 - 20 alkyl esters and methacrylic acid c 1 - 20 alkyl esters . monomer a1 is especially preferably selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester , methacrylic acid isopropyl ester , acrylic acid lauryl ester , methacrylic acid lauryl ester , acrylic acid cetyl ester , methacrylic acid cetyl ester , acrylic acid stearyl ester and methacrylic acid stearyl ester , most especially preferably from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid lauryl ester , methacrylic acid lauryl ester , acrylic acid stearyl ester and methacrylic acid stearyl ester . preferred monomers a2 include ( meth ) acryloyl alkyl amine oxides of formula a2 - i and / or ( meth ) acryloxyl alkyl betaines of formula a2 - ii , wherein r 2 and r 3 , independently of one another , each stand for methyl , ethyl , propyl , isopropyl , butyl , isobutyl , isobutyl or tert - butyl , especially preferably for methyl . preferred monomers a2 are also selected from at least one monomer from the group formed from ( meth ) acryloyl alkyl amine oxides of the formula a2 - i and / or ( meth ) acryloyl alkyl betaines of the formula a2 - ii , wherein n stands for an integer from 1 to 5 , preferably for an integer from 1 to 3 , and especially preferably for 2 . monomers a2 are preferably also selected from at least one monomer from the group formed from ( meth ) acryloyl alkyl amine oxides of the formula a2 - i and / or ( meth ) acryloyl alkyl betaines of the formula a2 - ii , wherein r 1 stands for ch 3 . the monomers a2 are especially preferably selected from at least one monomer from the group formed from ( meth ) acryloyl alkyl amine oxides of the formula a2 - i and / or ( meth ) acryloyl alkyl betaines of the formula a2 - ii , wherein r 2 and r 3 , independently of one another , each stand for methyl , ethyl , propyl , isopropyl , butyl , isobutyl or tert - butyl , especially preferably for methyl , n stands for an integer from 1 to 5 , preferably for an integer from 1 to 3 and especially preferably for 2 , and r 1 stands for ch 3 . monomer a2 is most especially preferably selected from at least one monomer from the group formed from ( meth ) acryloyl alkyl amine oxides of the formula a2 - i and / or ( meth ) acryloyl alkyl betaines of the formula a2 - ii , wherein r 1 , r 2 and r 3 each stand for ch 3 and n stands for 2 . in all the embodiments described above , it is again preferable for the copolymer ( a ) to be formed from ( in particular exclusively ) at least one monomer of the formula ( a1 ) and at least one of the monomers of formula a2 - i corresponding to the respective embodiment . in a preferred embodiment , the agent according to the invention contains at least one copolymer a derived from the copolymerization of ( i ) least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester ; and ( ii ) methacryloyl ethyl betaine as monomer a2 . corresponding copolymers are known and are available , for example , under the designations diaformer ® z - 400 , diaformer ® z - at , diaformer ® z - 301n , diaformer ® z - sm and diaformer ® z - w from the company clariant and under the designations yukaformer ® 202 , yukaformer ® 204 , yukaformer ® 206 and yukaformer ® 301 from mitsubishi . the use of diformer ® z - 301n is especially preferred . in a more preferred embodiment , the agent according to the invention contains at least one copolymer a formed from at least two monomers a1 , the first monomer being selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , and the second monomer being selected from acrylic acid stearyl ester and methacrylic acid stearyl ester ; and as monomer a2 methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula a2 - i : r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ). these copolymers are also known and are available under the brand name diaformer ® z - 632 from the company clariant , for example , but the use of diaformer ® z - 632 is especially preferred . in a preferred embodiment , the agent according to the invention contains at least one copolymer a formed from at least three monomers a1 , wherein the first monomer is selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , the second monomer being selected from acrylic acid lauryl ester and methacrylic acid lauryl ester and the third monomer is selected from acrylic acid stearyl ester and methacrylic acid stearyl ester ; and as monomer a2 methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula ( a24 ): r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ). corresponding copolymers are also known and are available , for example , under the brand names diaformer ® z - 611 , diaformer ® z - 612 , diaformer ® z - 613 , diaformer ® z - 631 , diaformer ® z - 633 , diaformer ® z - 651 , diaformer ® z - 711n , diaformer ® z - 712n and diaformer ® z - 731n from clariant , with diaformer ® z - 712n and diaformer ® z - 651 preferred . it is of course also possible for the agents according to the invention to contain a mixture of at least two of copolymers a which are used according to the three preferred embodiments just described . the agents according to the invention contain copolymer a , preferably in an amount of 0 . 01 to 20 wt %, especially preferably 0 . 05 to 10 wt %, and most especially preferably 0 . 1 to 5 wt %, based on the total agent . the agents according to the invention may of course also contain several copolymers a , but the total amount of copolymer a preferably does not exceed 20 wt %. the copolymers a can be produced from the aforementioned monomers by means of the known polymerization methods and are usually available commercially . the agents according to the invention for temporary shaping of keratinic fibers contain as the second obligatory component at least one film - forming and / or hair - setting amphoteric polymer b , which is different from copolymer a . the film - forming and / or hair - setting amphoteric polymer b is preferably selected from the group of copolymers of monomers with carboxyl groups and / or sulfonic groups , in particular acrylic acid , methacrylic acid , itaconic acid and monomers with amino groups in particular monoalkyl aminoalkyl acrylates , dialkyl aminoalkyl acrylates , monoalkyl aminoalkyl methacrylates , dialkylamino alkyl methacrylates , monoalkyl aminoalkyl acrylamides , dialkyl aminoalkyl acrylamides , monoalkyl aminoalkyl methacrylamides , dialkyl aminoalkyl methacrylamides and the copolymers of n - octylacrylamide , methyl methacrylate , hydroxypropyl methacrylate , n - tert - butylaminoethyl methacrylate and acrylic acid . the agent according to the invention especially preferably contains an n - octylacrylamide / acrylic acid / tert - butylamino ethyl methacrylate copolymer , in particular preferably the copolymer distributed under the brand name amphomer ® ( inci designation octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ) by the company national starch as the film - forming and / or hair - setting amphoteric polymer b . the film - forming and / or hair - setting amphoteric polymer b is preferably present in an amount of 0 . 01 to 20 wt %, preferably 0 . 1 to 15 wt %, especially preferably 1 . 0 to 10 wt %, based on the total agent . multiple film - forming and / or hair - setting amphoteric polymers b may of course also be present , but the total amount of film - forming and / or hair - setting amphoteric polymers b preferably does not exceed 20 wt %. to achieve the desired properties of the agent according to the invention , the agent must contain both copolymer a and a film - forming and / or hair - setting amphoteric polymer b which is different from copolymer a . in particular the combination of very strong hold and excellent humidity resistance which is desired for styling agents can be obtained in this way . it has been found that an optimal profile of properties is obtained when the agent contains copolymer a and the film - forming and / or hair - setting amphoteric polymer b in a weight ratio of 1 : 50 to 20 : 1 , preferably 1 : 30 to 10 : 1 , especially preferably 1 : 20 to 5 : 1 , most especially preferably 1 : 10 to 2 : 1 . an excess of copolymer a improves the thickening properties of the polymer mixture . furthermore , the agent according to the invention contains as the third obligatory component at least one amphiphilic anionic polymer c . this amphiphilic anionic polymer c is different from copolymer a and from the film - forming amphoteric and / or hair - setting amphoteric polymer b . the term “ amphiphilic ” herein refers to a molecule that comprises both hydrophilic and lipophilic properties . an “ amphiphilic polymer ” is understood to be a polymer that comprises both hydrophilic structural elements and lipophilic structural elements bonded to the polymer backbone . the a 1 r 8 radical of the itaconic acid ester monomer of formula ( c2 ) is of course bound to the radical molecule via the carbon atom from a 1 , and r 8 binds to the oxygen terminus of a 1 . preferred amphiphilic anionic polymers c are formed exclusively from at least one said monomer of formula c1 and at least one monomer of said formula c2 . preferred amphiphilic anionic polymers c include those wherein at least one radical from r 6 and r 7 stands for a group *- a 1 - r 8 and the other radical stands for a hydrogen atom , wherein a 1 and r 8 are defined above . especially preferred amphiphilic anionic polymers c for use in the present agent are characterized in being formed from at least one monomer of formula c1 and at least one itaconic acid ester monomer of formula of c2 : wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ); and r 8 denotes a ( c 6 to c 30 ) alkyl group . furthermore , amphiphilic anionic polymers c are preferably selected from acrylates / ceteth - 20 itaconate copolymer ( e . g ., which can be obtained as structure ® 3001 from the company akzo nobel ), acrylates / palmeth - 25 itaconate copolymer ( e . g ., which can be obtained as polygel w30 ® or polygel w40 ® from the company 3v sigma ), acrylates / stearet - 20 itaconate copolymer ( e . g ., which can be obtained as structure ® 2001 from the company akzo nobel ). preferred agents are characterized in that they have a viscosity of 1000 to 500 , 000 mpa · s , preferably from 5000 to 300 , 000 mpa · s , especially preferably from 10 , 000 to 150 , 000 mpa · s ( each measured with the brookfield rvdv ii + with heilpath , spindle t - e , 5 rpm , 20 ° c .). preferred agents contain the amphiphilic anionic polymer c in an amount of 0 . 1 to 10 wt %, based on the weight of the agent . an especially preferred embodiment of the present invention is therefore a cosmetic agent containing in a cosmetically acceptable carrier : ( i ) at least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid alkyl esters , and methacrylic acid alkyl esters ; and ( ii ) at least one amphoteric monomer a2 selected from ( meth ) acryloyl alkyl amine oxides of formula a2 - i , wherein r 1 stands for h or ch 3 ( preferably methyl ); r 2 and r 3 each , independently of one another , stand for optionally branched c 1 - 10 alkyl ; and n stands for an integer from 1 to 4 ( preferably 2 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , different from copolymer a , selected from octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ; and ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula c1 and at least one itaconic acid ester monomer of formula c2 , wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ), a group *—( ch 2 chmeo ) y —*, wherein y stands for an integer from 5 to 35 , or a group *—( ch 2 ch 2 o ) x —( ch 2 chmeo ) y —*, wherein the sum of x + y stands for an integer from 5 to 35 and x and y are greater than zero ; and r 8 denotes a ( c 6 to c 30 ) alkyl group . an especially preferred embodiment of the present invention is in turn a cosmetic agent containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from at least two monomers a1 , the first monomer being selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , and the second monomer being selected from acrylic acid stearyl ester and methacrylic acid stearyl ester ; and as monomer a2 , methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula a2 - i : r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b which is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl meth - acrylate copolymer ; and ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula c1 and at least one itaconic acid ester monomer of formula c2 , wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ), a group *—( ch 2 chmeo ) y —*, wherein y stands for an integer from 5 to 35 , or a group *—( ch 2 ch 2 o ) n —( ch 2 chmeo ) y —*, wherein the sum of x + y stands for an integer from 5 to 35 and x and y are greater than zero ; and r 8 denotes a ( c 6 to c 30 ) alkyl group . an especially preferred embodiment of the present invention is in turn a cosmetic agent containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from at least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid alkyl esters and methacrylic acid alkyl esters and at least one amphoteric monomer a2 selected from ( meth ) acryloyl alkyl amine oxides of formula a2 - i , wherein r 1 stands for h or ch 3 ( in particular ch 3 ); r 2 and r 3 each , independently of one another , stand for optionally branched c 1 - 10 alkyl ; and n stands for an integer from 1 to 4 ( in particular 2 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , different from copolymer a , selected from octylacrylamide / acrylates / butylaminoethyl meth - acrylate copolymer ; and ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ); and r 8 denotes a ( c 6 to c 30 ) alkyl group . an especially preferred embodiment of the present invention is in turn a cosmetic agent containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from least two monomers a1 , the first monomer being selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , and the second monomer being selected from acrylic acid stearyl ester and methacrylic acid stearyl ester and as monomer a2 methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula a2 - i : r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , different from copolymer a , selected from octylacrylamide / acrylates / butylaminoethyl meth - acrylate copolymer ; and ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ); and r 8 denotes a ( c 6 to c 30 ) alkyl group . an especially preferred embodiment of the present invention is therefore a cosmetic agent having a viscosity of 1000 to 500 , 000 mpa · s , preferably from 5000 to 300 , 000 mpa · s , especially preferably from 10 , 000 to 150 , 000 mpa · s ( each measured with the brookfield rvdv ii + with heilpath , spindle t - e , 5 rpm , 20 ° c . ), containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid alkyl esters and methacrylic acid alkyl esters and at least one amphoteric monomer a2 selected from ( meth ) acryloyl alkyl amine oxides of formula a2 - i , wherein r 1 stands for h or ch 3 ( in particular ch 3 ); r 2 and r 3 each , independently of one another , stand for optionally branched c 1 - 10 alkyl ; and n stands for an integer from 1 to 4 ( in particular 2 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , which is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl meth - acrylate copolymer ; and ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ), a group —( ch 2 chmeo ) y —*, wherein y stands for an integer from 5 to 35 , or a group —( ch 2 ch 2 o ) x —( ch 2 chmeo ) y —*, wherein the sum of x + y stands for an integer from 5 to 35 and x and y are greater than zero ; and r 8 denotes a ( c 6 to c 30 ) alkyl group . an especially preferred embodiment of the present invention is in turn a cosmetic agent having a viscosity of 1000 to 500 , 000 mpa · s , preferably from 5000 to 300 , 000 mpa · s , especially preferably from 10 , 000 to 150 , 000 mpa · s ( each measured using the brookfield rvdv ii + with the heilpath , spindle t - e , 5 rpm , 20 ° c . ), containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from least two monomers : a1 the first monomer being selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , and the second monomer being selected from acrylic acid stearyl ester and methacrylic acid stearyl ester ; and , monomer a2 methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula a2 - i : r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , different from copolymer a selected from octylacrylamide / acrylates / butylaminoethyl meth - acrylate copolymer ; and ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ), a group —( ch 2 chmeo ) y —*, wherein y stands for an integer from 5 to 35 , or a group —( ch 2 ch 2 o ) x —( ch 2 chmeo ) y —*, wherein the sum of x + y stands for an integer from 5 to 35 and x and y are greater than zero ; and r 8 denotes a ( c 6 to c 30 ) alkyl group . an especially preferred embodiment of the present invention is in turn a cosmetic agent having a viscosity of 1000 to 500 , 000 mpa · s , preferably from 5000 to 300 , 000 mpa · s , especially preferably from 10 , 000 to 150 , 000 mpa · s ( each measured using the brookfield rvdv ii + with the heilpath , spindle t - e , 5 rpm , 20 ° c . ), containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from at least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid alkyl esters and methacrylic acid alkyl esters ; and at least one amphoteric monomer a2 selected from ( meth ) acryloyl alkyl amine oxides of formula a2 - i , wherein r 1 stands for h or ch 3 ( in particular ch 3 ); r 2 and r 3 each , independently of one another , stand for optionally branched c 1 - 10 alkyl ; and n stands for an integer from 1 to 4 ( in particular 2 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , which that is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ; and ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ); and r 8 denotes a ( c 6 to c 30 ) alkyl group . an especially preferred embodiment of the present invention is in turn a cosmetic agent having a viscosity of 1000 to 500 , 000 mpa · s , preferably from 5000 to 300 , 000 mpa · s , especially preferably from 10 , 000 to 150 , 000 mpa · s ( each measured using the brookfield rvdv ii + with the heilpath , spindle t - e , 5 rpm , 20 ° c . ), containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from least two monomers a1 , the first monomer being selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , and the second monomer being selected from acrylic acid stearyl ester and methacrylic acid stearyl ester ; and as monomer a2 methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula a2 - i : r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b different from copolymer a selected from octylacrylamide / acrylates / butylaminoethyl meth - acrylate copolymer ; and ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ); and r 8 denotes a ( c 6 to c 30 ) alkyl group . each of the aforementioned preferred embodiments is in turn preferably transparent . in addition to copolymer a and amphiphilic anionic polymers c and film - forming and / or hair - setting amphoteric polymers b , the agents may additionally contain any other known film - forming and / or hair - setting polymer . these film - forming and / or hair - setting polymers may be either permanently or temporarily cationic , anionic or nonionic . the polymers are often multifunctional , but their functions are not always clearly and unambiguously differentiable from one another . this is true in particular of film - forming and hair - setting polymers . however , it is pointed out explicitly here that both film - forming and hair - setting polymers are essential within the scope of the present invention . since these two properties are not completely independent of one another , the term “ hair - setting polymers ” should also always be understood as “ film - forming polymers ” and vice versa . the preferred properties of the film - forming polymers include film formation . film - forming properties are understood to be polymers which leave a continuous film on skin , hair or nails on drying . such film - forming substances may be used in a wide variety of cosmetic products such as , for example , face masks , makeup , hair - setting products , hair sprays , hair gels , hair waxes , hair treatments , shampoos or nail polish . in particular those polymers which have a sufficient solubility in alcohol or water / alcohol mixtures to be present in completely dissolved form in the agent according to the invention are preferred . the film - forming polymers may be of a synthetic or natural origin . film - forming polymers are additionally understood according to the invention to include polymers capable of depositing a transparent polymer film on the hair when used in 0 . 01 to 20 wt % aqueous , alcoholic or aqueous - alcoholic solution . additional suitable synthetic film - forming hair - setting polymers include , for example , homopolymers or copolymers composed of at least one of the following monomers : vinyl pyrrolidone , vinyl caprolactam , vinyl esters , for example , vinyl acetate , vinyl alcohol , acrylamide , methacrylamide , alkyl and dialkyl acrylamide , alkyl and dialkyl methacrylamide , alkyl acrylate , alkyl methacrylate , propylene glycol or ethylene glycol , where the alkyl groups of these monomers are preferably c 1 to c 7 alkyl groups , especially preferably c 1 to c 3 alkyl groups . examples that can be mentioned include homopolymers of vinyl caprolactam , vinyl pyrrolidone or n - vinylformamide . other suitable synthetic film - forming hair - setting polymers include , for example , the copolymers of vinyl pyrrolidone and vinyl acetate , terpolymers of vinyl pyrrolidone , vinyl acetate and vinyl propionate , polyacrylamides , which are distributed , for example , under the brand names akypomine ® p 191 from the company chem - y , emmerich or sepigel ® 305 from the company seppic ; polyvinyl alcohols , which are distributed , for example , under the brand names elvanol ® by du pont or vinol ® 523 / 540 by the company air products as well as polyethylene glycol / polypropylene glycol copolymers distributed , for example , under the brand name ucon ® of union carbide . suitable natural film - forming polymers include , for example , cellulose derivatives , e . g ., hydroxypropyl cellulose with a molecular weight of 30 , 000 to 50 , 000 g / mol , which are distributed , for example , under the brand name nisso si ® by the company lehmann & amp ; voss , hamburg . hair - setting polymers contribute to the hold and / or creation of the hair volume and hair body of the overall hair style . the aforementioned hair - setting polymers are at the same time also film - forming polymers and therefore in general are typical substances for styling hair treatment agents such as hair - setting agents , hair mousse , hair wax , hair sprays . the film - forming may therefore be in spots or may bond only a few fibers together . substances which also impart hydrophobic properties to hair are preferred here because they reduce the tendency of hair to absorb humidity , i . e ., water . therefore limp hair strands are reduced and thus a long - lasting hair style creation and hold are ensured . the test method used for this frequently is the so - called curl retention test . these polymer substances may also be incorporated successfully into leave - on and rinse - off hair treatments or shampoos . since polymers are often multifunctional , i . e ., manifest multiple effects , which are desired for application technology , there are numerous polymers in several groups divided according to their mechanism of action , e . g ., in the ctfa handbook . if the agents according to the invention contain additional film - forming and / or hair - setting polymers , they are preferably used in an amount of 0 . 01 to 20 wt %, preferably 0 . 1 to 15 wt %, based on the total hair - setting agent . multiple film - forming and / or hair - setting polymers may of course also be present , in which case the total amount of other film - forming and hair - setting polymers is preferably max . 20 wt %, however . an especially preferred embodiment of the present invention is a cosmetic agent containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from : at least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid alkyl esters and methacrylic acid alkyl esters ; and at least one amphoteric monomer a2 selected from ( meth ) acryloyl alkyl amine oxides of formula a2 - i , wherein r 1 stands for h or ch 3 ( in particular ch 3 ); r 2 and r 3 each , independently of one another , stand for optionally branched c 1 - 10 alkyl ; and n stands for an integer from 1 to 4 ( in particular 2 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b that is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ; ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ), a group —( ch 2 chmeo ) y —*, wherein y stands for an integer from 5 to 35 , or a group —( ch 2 ch 2 o ) x —( ch 2 chmeo ) y —*, wherein the sum of x + y stands for an integer from 5 to 35 and x and y are greater than zero ; and r 8 denotes a ( c 6 to c 30 ) alkyl group ; and an especially preferred embodiment of the present invention is in turn a cosmetic agent containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from least two monomers a1 , the first monomer being selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , and the second monomer being selected from acrylic acid stearyl ester and methacrylic acid stearyl ester ; and as monomer a2 methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula a2 - i : r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , which is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ; ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ), a group —( ch 2 chmeo ) y —*, wherein y stands for an integer from 5 to 35 , or a group —( ch 2 ch 2 o ) x —( ch 2 chmeo ) y —*, wherein the sum of x + y stands for an integer from 5 to 35 and x and y are greater than zero ; and r 8 denotes a ( c 6 to c 30 ) alkyl group ; and an especially preferred embodiment of the present invention is in turn a cosmetic agent containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from at least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid alkyl esters and methacrylic acid alkyl esters ; and at least one amphoteric monomer a2 selected from ( meth ) acryloyl alkyl amine oxides of formula a2 - i , wherein r 1 stands for h or ch 3 ( in particular ch 3 ); r 2 and r 3 each , independently of one another , stand for optionally branched c 1 - 10 alkyl ; and n stands for an integer from 1 to 4 ( in particular 2 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , which that is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ; ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ); and r 8 denotes a ( c 6 to c 30 ) alkyl group ; and an especially preferred embodiment of the present invention is in turn a cosmetic agent containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from : at least two monomers a1 , the first monomer being selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , and the second monomer being selected from acrylic acid stearyl ester and methacrylic acid stearyl ester ; and as monomer a2 methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula a2 - i : r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , which is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl meth - acrylate copolymer ; ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ); and r 8 denotes a ( c 6 to c 30 ) alkyl group ; and an especially preferred embodiment of the present invention is therefore a cosmetic agent having a viscosity of 1000 to 500 , 000 mpa · s , preferably from 5000 to 300 , 000 mpa · s , especially preferably from 10 , 000 to 150 , 000 mpa · s ( each measured using the brookfield rvdv ii + with the heilpath , spindle t - e , 5 rpm , 20 ° c . ), containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from : at least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid alkyl esters and methacrylic acid alkyl esters ; and at least one amphoteric monomer a2 selected from ( meth ) acryloyl alkyl amine oxides of formula a2 - i , wherein r 1 stands for h or ch 3 ( in particular ch 3 ); r 2 and r 3 each , independently of one another , stand for optionally branched c 1 - 10 alkyl ; and n stands for an integer from 1 to 4 ( in particular 2 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , which is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ; ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ), a group —( ch 2 chmeo ) y —*, wherein y stands for an integer from 5 to 35 , or a group —( ch 2 ch 2 o ) x —( ch 2 chmeo ) y —*, wherein the sum of x + y stands for an integer from 5 to 35 and x and y are greater than zero ; and r 8 denotes a ( c 6 to c 30 ) alkyl group ; and an especially preferred embodiment of the present invention is in turn a cosmetic agent having a viscosity of 1000 to 500 , 000 mpa · s , preferably from 5000 to 300 , 000 mpa · s , especially preferably from 10 , 000 to 150 , 000 mpa · s ( each measured using the brookfield rvdv ii + with the heilpath , spindle t - e , 5 rpm , 20 ° c . ), containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from : least two monomers a1 , the first monomer being selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , and the second monomer being selected from acrylic acid stearyl ester and methacrylic acid stearyl ester ; and as monomer a2 methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula a2 - i : r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , which is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ; ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ), a group —( ch 2 chmeo ) y —*, wherein y stands for an integer from 5 to 35 , or a group —( ch 2 ch 2 o ) x —( ch 2 chmeo ) y —*, wherein the sum of x + y stands for an integer from 5 to 35 and x and y are greater than zero ; and r 8 denotes a ( c 6 to c 30 ) alkyl group ; and an especially preferred embodiment of the present invention is in turn a cosmetic agent having a viscosity of 1000 to 500 , 000 mpa · s , preferably from 5000 to 300 , 000 mpa · s , especially preferably from 10 , 000 to 150 , 000 mpa · s ( each measured using the brookfield rvdv ii + with the heilpath , spindle t - e , 5 rpm , 20 ° c . ), containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from : at least one monomer a1 selected from acrylic acid , methacrylic acid , acrylic acid alkyl esters and methacrylic acid alkyl esters ; and at least one amphoteric monomer a2 selected from ( meth ) acryloyl alkyl amine oxides of formula a2 - i , wherein r 1 stands for h or ch 3 ( in particular ch 3 ); r 2 and r 3 each , independently of one another , stand for optionally branched c 1 - 10 alkyl ; and n stands for an integer from 1 to 4 ( in particular 2 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , which is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ; ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ); and r 8 denotes a ( c 6 to c 30 ) alkyl group ; and an especially preferred embodiment of the present invention is in turn a cosmetic agent having a viscosity of 1000 to 500 , 000 mpa · s , preferably from 5000 to 300 , 000 mpa · s , especially preferably from 10 , 000 to 150 , 000 mpa · s ( each measured using the brookfield rvdv ii + with the heilpath , spindle t - e , 5 rpm , 20 ° c . ), containing in a cosmetically acceptable carrier : ( a ) at least one copolymer a formed from : at least two monomers a1 , the first monomer being selected from acrylic acid , methacrylic acid , acrylic acid methyl ester , methacrylic acid methyl ester , acrylic acid ethyl ester , methacrylic acid ethyl ester , acrylic acid propyl ester , methacrylic acid propyl ester , acrylic acid isopropyl ester and methacrylic acid isopropyl ester , and the second monomer being selected from acrylic acid stearyl ester and methacrylic acid stearyl ester ; and as monomer a2 methacryloylethylamine oxide , in particular methacryloylethyl - n , n - dimethylamine oxide ( in formula a2 - i : r 1 = ch 3 , n = 2 , r 2 and r 3 = ch 3 ); ( b ) at least one film - forming amphoteric and / or hair - setting amphoteric polymer b , which is different from copolymer a and is selected from octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ; ( c ) at least one amphiphilic anionic polymer c formed from at least one monomer of formula ( c1 ) and at least one itaconic acid ester monomer of formula ( c2 ), wherein r 4 denotes hydrogen or a methyl group ; r 5 denotes hydrogen or a ( c 1 to c 4 ) alkyl group ; at least one of r 6 and r 7 is the group - a 1 - r 8 while the other of r 6 and r 7 is hydrogen , wherein a 1 denotes the group *—( ch 2 ch 2 o ) x —*, with x an integer from 5 to 35 ( in particular for an integer from 10 to 30 ); and r 8 denotes a ( c 6 to c 30 ) alkyl group ; and the agents according to the invention contain the polymers in a cosmetically acceptable carrier . preferred cosmetically acceptable carriers include aqueous , alcoholic or aqueous - alcoholic media , preferably with at least 10 wt % water , based on a total agent . the alcohols present may include in particular low alcohols with 1 to 4 carbon atoms , for example , ethanol and isopropanol , which are generally used for cosmetic purposes in particular . additional co - solvents that may be used include organic solvents or a mixture of solvents with a boiling point below 400 ° c . in an amount of 0 . 1 to 15 wt %, preferably 1 to 10 wt %, based on the total agent . especially suitable as additional co - solvents are unbranched or branched hydrocarbons , such as pentane , hexane , isopentane and cyclic hydrocarbons such as cyclopentane and cyclohexane . additional especially preferred water - soluble solvents include glycerol , ethylene glycol and propylene glycol in an amount of up to 30 wt %, based on the total agent . these agents preferably have a ph of 4 . 5 to 6 . 9 . the ph range is especially preferably between 6 and 6 . 9 . the information about the ph value in the sense of this patent application relates to the ph value at 25 ° c ., unless otherwise noted . agents having these preferred ph values have an especially good humidity resistance of the set hair style . the agents according to the invention may also contain the excipients and additives which are usually added to the respective cosmetic agents . suitable excipients and additives include in particular care substances . these are used in both hair and skin treatment agents and may be incorporated into creams , shampoos , hair rinses , hair treatments , gels , pump and aerosol sprays and foam products for example , given a suitable choice of the care substance . the agents according to the invention may also contain the excipient and additives which are usually added to traditional styling agents . in particular additional care substances are to be mentioned as suitable excipients and additives . an example of a care substance that may be used is silicone oil and / or a silicone gum . silicone oils or silicone gums that are suitable according to the invention include in particular dialkyl and alkylaryl siloxanes , for example , dimethyl polysiloxane and methyl phenyl polysiloxane as well as their alkoxylated , quaternized or anionic derivatives . cyclic and linear polydialkyl siloxanes , their alkoxylated and / or aminated derivatives , dihydroxy polydimethyl siloxanes and polyphenyl alkyl siloxanes are preferred . silicone oils produce a wide variety of effects . for example , they influence both dry combability and wet combability at the same time , the feel of dry and wet hair as well as its luster . those skilled in the art understand the term silicone oils to include several structures of organic silicon compounds . this is understood first to include the dimethiconols . the following commercial products are mentioned as examples of such products : botanisil nu150m ( botanigenics ), dow corning 1 - 1254 fluid , dow corning 2 - 9023 fluid , dow corning 2 - 9026 fluid , ultrapure dimethiconol ( ultra chemical ), unisil sf - r ( universal preserve ), x - 21 - 5619 ( shinetsu chemical co . ), abil osw 5 ( degussa care specialties ), acc dl - 9430 emulsion ( taylor chemical company ), aec dimethiconol and sodium dodecylbenzene sulfonate ( a & amp ; e connock ( perfumery & amp ; cosmetic , ltd . ), b c dimethiconol emulsion 95 ( basildon chemical company , ltd . ), cosmetic fluid 1401 , cosmetic fluid 1403 , cosmetic fluid 1501 , cosmetic fluid 1401dc ( all the aforementioned are from chemsil silicones , inc . ), dow corning 1401 fluid , dow corning 1403 fluid , dow corning 1501 fluid , dow corning 1784 hvf emulsion , dow corning 9546 silicone elastomer blend ( all the aforementioned are from dow corning corporation ), dub gel si 1400 ( stearinerie dubois fils ), hvm 4852 emulsion ( crompton corporation ), jeesilc 6056 ( jeen international corporation ), lubrasil , lubrasil ds ( both from guardian laboratories ), nonychosine e , nonychosine v ( both from exsymol ), sansurf petrolatum - 25 , satin finish ( both from collaborative laboratories , inc . ), silatex - d30 ( cosmetic ingredient resources ), silsoft 148 , silsoft e - 50 , silsoft e - 623 ( all the aforementioned are from crompton corporation ), sm555 , sm2725 , sm2765 , sm2785 ( all the aforementioned are from ge silicones ), taylor t - sil cd - 1 , taylor tme - 4050e ( all from taylor chemical company ), th v 148 ( crompton corporation ), tixogel cyd - 1429 ( sud - chemie performance additives ), wacker - belsil cm 1000 , wacker - belsil cm 3092 , wacker - belsil cm 5040 , wacker - belsil dm 3096 , wacker - belsil dm 3112 vp , wacker - belsil dm 8005 vp , wacker - belsil dm 60081 vp ( all the aforementioned are from wackerchemie gmbh ). dimethicones form the second group of silicones which may be present according to the invention . they may be both linear and branched as well as cyclic or cyclic and branched . dimethicone polyols form another group of silicones which are suitable . corresponding dimethicone copolyols are commercially available and are distributed , for example , by the company dow corning under the brand name dow corning ® 5330 fluid . the teaching according to the invention of course also includes the fact that the dimethiconols , dimethicones and / or dimethicone copolymers may already be present in the form of an emulsion . after preparing the corresponding dimethiconols , dimethicones and / or dimethicone copolyols , the corresponding emulsion of dimethiconols , dimethicones and / or dimethicone copolyols can be produced from them and the usual methods of emulsification with which those skilled in the art are familiar . both cationic , anionic , nonionic or zwitterionic surfactants and emulsifiers may be used here as excipients for producing the corresponding emulsions . the emulsions of dimethiconols , dimethicones and / or dimethicone copolyols may of course also be prepared directly by emulsion polymerization methods . those skilled in the art are very familiar with such methods . if the dimethiconols , dimethicones and / or dimethicone copolyols are used as emulsions , then the droplet size of the emulsified particles according to the invention is 0 . 01 to 10 , 000 μm , preferably 0 . 01 to 100 μm , especially preferably 0 . 01 to 20 μm and most especially preferably 0 . 01 to 10 μm . the particle size is determined according to the light scatter method . if branched dimethiconols , dimethicones and / or dimethicone copolyols are used , this is understood to mean that the branching is greater than a random branching which occurs randomly due to impurities in the respective monomers . in the sense of the present invention , branched dimethiconols , dimethicones and / or dimethicone copolyols are therefore understood to mean that the degree of branching is greater than 0 . 01 %. a degree of branching greater than 0 . 1 % and most especially preferably greater than 0 . 5 % is preferred . the degree of branching is determined from the ratio of the unbranched monomers to the branching monomers , i . e ., the quantity of trifunctional and tetrafunctional siloxanes . according to the invention , both low - branched and high - branched dimethiconols , dimethicones and / or dimethicone copolyols may be most especially preferred . especially suitable silicones are amino - functional silicones in particular the silicones combined under the inci designation amodimethicones . it is therefore preferred according to the invention if the agents according to the invention additionally contain at least one amino - functional silicone . these are understood to include silicones having at least one optionally substituted amino group . these silicones are referred to according to the inci declaration as amodimethicones and are available , for example , in the form of an emulsion as commercial product dow corning ® 939 or as the commercial product dow corning ® 949 in mixture with a cationic surfactant and a nonionic surfactant . such amino - functional silicones , which have an amine number above 0 . 25 meq / g , preferably above 0 . 3 meq / g and in particular preferably above 0 . 4 meq / g are preferred . the amine number stands for milliequivalents of amine per gram of amino - functional silicone , which can be determined by titration and may also be reported in units of mg koh / g . these agents preferably contain the silicones in amounts of 0 . 01 wt % to 15 wt %, especially preferably from 0 . 05 to 2 wt %, based on the total agent . the agent may contain , for example , at least one protein hydrolysate and / or another derivative as a care substance of another class of compounds . protein hydrolysates are product mixtures obtained by acid - catalyzed , base - catalyzed or enzymatically catalyzed degradation of proteins . the term “ protein hydrolysates ” is also understood according to the invention to refer to total hydrolysates as well as individual amino acids and their derivatives as well as mixtures of different amino acids . the molecular weight of the protein hydrolysates that can be used according to the invention is between 75 dalton , which is the molecular weight of glycine , and 200 , 000 dalton , but the molecular is preferably 75 to 50 , 000 dalton and most especially preferably 75 to 20 , 000 dalton . according to the invention , protein hydrolysates of either plant or animal or marine or synthetic origin may be used . animal protein hydrolysates include , for example , elastin , collagen , keratin , silk and milk protein hydrolysates which may also be present in the form of salts . such products are distributed , for example , under the brand names dehylan ® ( cognis ), promois ® ( interorgana ), collapuron ® ( cognis ), nutrilan ( cognis ), gelita - sol ® ( deutsche gelatine fabriken stoess & amp ; co . ), lexein ® ( inolex ), sericin ( pentapharm ) and kerasol ® ( croda ). the protein hydrolysates are present in the agents according to the invention , for example , in concentrations of 0 . 01 wt % to 20 wt %, preferably 0 . 05 wt % to 15 wt % and most especially preferably 0 . 05 wt % to 5 wt %, each based on the total application preparation . the agents according to the invention may also contain at least one vitamin , a provitamin , a vitamin precursor and / or one of their derivatives as the care substance . according to the invention , vitamins , provitamins and vitamin precursors which are usually assigned to the groups a , b , c , e , f and h are preferred . the agents according to the invention preferably contain vitamins , provitamins and vitamin precursors from the groups a , b , c , e and h . panthenol , pantolactone , pyridoxine and its derivatives as well as nicotinamide and biotin are especially preferred . d - panthenol , optionally in combination with at least one of the aforementioned silicone derivatives , is most especially preferred as a care substance . the addition of panthenol , like the addition of glycerol and / or propylene glycol , increases the flexibility of the polymer film formed in use of the agents according to the invention . thus , if a particularly flexible hold is desired , the agents according to the invention may contain panthenol instead of or in addition to glycerol and / or propylene glycol . in a preferred embodiment the agents according to the invention contain panthenol , preferably in an amount of 0 . 05 to 10 wt %, especially preferably 0 . 1 to 5 wt %, each based on the total agent . the agents according to the invention may additionally contain at least one plant extract as the care substance . these extracts are usually prepared by extraction of the total plant . however , in individual cases it may also be preferred to produce the extracts exclusively from flowers and / or leaves of the plants . in particular the extracts from green tea , oak bark , stinging nettle , witch hazel , hops , henna , chamomile , burdock root , horsetail , hawthorne , lime - tree blossoms , almond , aloe vera , pine needle , horse chestnut , sandalwood , juniper berry , coconut , mango , apricot , lime , wheat , kiwi , melon , orange , grapefruit , sage , rosemary , birch , mallow , lady &# 39 ; s smock , wild thyme , yarrow , thyme , melissa , rest harrow , coltsfoot , marsh mallow , meristem , ginseng and ginger root are preferred according to the invention . in addition , it may be preferable to use mixtures of several different plant extracts , in particular two different plant extracts in the agents according to the invention . monosaccharides and / or oligosaccharides may also be used as the care substance in the agents according to the invention . both monosaccharides and oligosaccharides , for example , cane sugar , lactose and raffinose may be used . the use of monosaccharides is preferred according to the invention . the monosaccharides are in turn understood to include those compounds having 5 or 6 carbon atoms . suitable pentoses and hexoses include , for example , ribose , arabinose , xylose , lyxose , allose , altrose , glucose , mannose , gulose , idose , galactose , talose , fucose and fructose . arabinose , glucose , galactose and fructose are the preferred carbohydrates for use here . glucose is most especially preferred here and is suitable in both the d -(+)- and l -(−)- configurations or as a racemate . in addition , derivatives of these pentoses and hexoses such as the corresponding onic and uronic acids ( sugar acids ), sugar alcohols and glycosides may also be used according to the invention . preferred sugar acids include gluconic acid , glucuronic acid , sugar acid , mannose sugar acid and mucic acid . preferred sugar alcohols include sorbitol , mannitol and dulcitol . preferred glycosides are the methyl glycosides . since the monosaccharides and / or oligosaccharides used are usually obtained from natural raw materials such as starch , they usually have the configurations corresponding to these raw materials ( e . g ., d - glucose , d - fructose and d - galactose ). the monosaccharides and / or oligosaccharides are preferably used in the agents according to the invention in an amount of 0 . 1 to 8 wt %, especially preferably 1 to 5 wt %, based on the total application preparation . these agents may also contain at least one lipid as the care substance . suitable lipids according to the invention include phospholipids , for example , soy lecithin , egg lecithin and kephalins , as well as the substances known by the inci designations linoleamidopropyl pg dimonium chloride phosphate , cocamidopropyl pg dimonium chloride phosphate and stearamidopropyl pg dimonium chloride phosphate . these products are distributed , for example , by the company mona under the brand names phospholipid efa ®, phospholipid ptc and phospholipid sv ®. the agents according to the invention contain the lipids preferably in amount of 0 . 01 to 10 wt %, in particular 0 . 1 to 5 wt %, based on the total application preparation 1 . vegetable oils sunflower oil , olive oil , soy oil , canola oil , almond oil , jojoba oil , orange oil , wheat germ oil , peach pit oil and the liquid fractions of coconut oil . however , other triglyceride oils such as the liquid fractions of beef tallow and synthetic triglyceride oils are also suitable ; 2 . liquid paraffin oils , isoparaffin oils and synthetic hydrocarbons as well as di - n - alkyl ether with a total between 12 and 36 carbon atoms , in particular 12 to 24 carbon atoms , such as , for example , di - n - octyl ether , di - n - decyl ether , di - n - nonyl ether , di - n - undecyl ether , di - n - dodecyl ether , n - hexyl - n - octyl ether , n - octyl - n - decyl ether , n - decyl - n - undecyl ether , n - undecyl - n - undecyl ether , n - undecyl - n - dodecyl ether and n - hexyl - n - undecyl ether as well as di - tert - butyl ether , diisopentyl ether , di - 3 - ethyldecyl ether , tert - butyl - n - octyl ether , isopentyl - n - octyl ether and 2 - methylpentyl - n - octyl ether . the compounds 1 , 3 - di -( 2 - ethylhexyl )- cyclohexane ( cetiol ® s ) and di - n - octyl ether ( cetiol ® oe ), which can be obtained as commercial products may be preferred ; 3 . ester oils , understood to include the esters of c 6 - c 30 fatty acids with c 2 - c 30 fatty alcohols . the monoesters of fatty acids with alcohols with 2 to 24 carbon atoms are preferred . especially preferred according to the invention are isopropyl myristate ( rilanit ® ipm ), isononanoic acid c 16 - 18 alkyl ester ( cetiol ® sn ), 2 - ethylhexyl palmitate ( cegesoft ® 24 ), stearic acid 2 - ethylhexyl ester ( cetiol ® 868 ), cetyl oleate , glycerol tricaprylate , coconut fatty alcohol caprinate / caprylate ( cetiol ® lc ), n - butyl stearate , oleyl erucate ( cetiol ® j 600 ), isopropyl palmitate ( rilanit ® ipp ), oleyl oleate ( cetiol ®), lauric acid hexyl ester ( cetiol ® a ), di - n - butyl adipate ( cetiol ® b ), myristyl myristate ( cetiol ® mm ), cetearyl isononanoate ( cetiol ® sn ), oleic acid decyl ester ( cetiol ® v ); 4 . dicarboxylic acid esters such as di - n - butyl adipate , di ( 2 - ethylhexyl ) adipate , di ( 2 - ethylhexyl ) succinate and diisotridecyl acetate as well as diol esters such as ethylene glycol dioleate , ethylene glycol diisotridecanoate , propylene glycol di ( 2 - ethylhexanoate ), propylene glycol diisostearate , propylene glycol dipelargonate , butanediol diisostearate , neopentyl glycol dicaprylate ; 5 . symmetrical , asymmetrical , or cyclic esters of carbonic acid with fatty alcohols , for example , as described in unexamined german patent de - os 197 56 454 , glycerol carbonate or dicaprylyl carbonate ( cetiol ® cc ); 6 . trifatty acid esters of saturated and / or unsaturated , linear and / or branched fatty acids with glycerol ; 7 . fatty acid partial glycerides including monoglycerides , diglycerides and their technical - grade mixtures . when using technical - grade products , small amounts of triglycerides may still be present due to the production process . the partial glycerides preferably conform to the formula ( d4 - i ), wherein r 1 , r 2 and r 3 , independently of one another , stand for hydrogen or a linear or branched saturated and / or unsaturated acyl radical with 6 to 22 carbon atoms , preferably 12 to 18 carbon atoms , with the provision that at least one of these groups stands for an acyl radical and at least one of these groups stands for hydrogen . the sum ( m + n + q ) stands for 0 or for numbers from 1 to 100 , preferably for 0 or 5 to 25 . r 1 preferably stands for an acyl radical , and r 2 and r 3 stand for hydrogen , and the sum ( m + n + q ) is 0 . typical examples include the mono - and / or diglycerides based on caproic acid , caprylic acid , 2 - ethylhexanoic acid , capric acid , lauric acid , isotridecanoic acid , myristic acid , palmitic acid , palmoleic acid , stearic acid , isostearic acid , oleic acid , elaidic acid , petroselinic acid , linoleic acid , linolenic acid , eleostearic acid , arachidic acid , gadoleic acid , behenic acid and erucaic acid as well as their technical - grade mixtures . oleic acid monoglycerides are preferred for use here . the use quantity of the natural and synthetic cosmetic oil substances in the agents according to the invention is usually 0 . 1 - 30 wt %, based on the total ready - to - use preparation , preferably 0 . 1 - 20 wt % and in particular 0 . 1 - 15 wt %. although each of the aforementioned care substances yields a satisfactory result when used alone , all embodiments in which the agent contains multiple care substances even from different groups are also included within the scope of the present invention . by adding a uv filter , the agents themselves as well as the fibers to be treated can be protected from harmful influences of uv radiation . therefore at least one uv filter is preferably added to the agent . the suitable uv filters are not subject to any general restrictions with regard to their structure and their physical properties . instead , all the uv filters that can be used in the cosmetic field and whose absorption maximum is in the range of uva ( 315 - 400 nm ), in the uvb ( 280 - 315 nm ) or uvc (& lt ; 280 nm ) range may be used . uv filters with an absorption maximum in the uvb range in particular in the range from approx . 280 to approx . 300 nm are especially preferred . the uv filters preferred according to the invention may be selected from substituted benzophenones , p - aminobenzoic acid esters , diphenylacrylic acid esters , cinnamic acid esters , salicylic acid esters , benzimidazoles and o - aminobenzoic acid esters . the uv filters are usually present in amounts of 0 . 01 - 5 wt %, based on the total ready - to - use preparations . amounts of 0 . 1 - 2 . 5 wt % are preferred . in a special embodiment , the agent according to the invention also contains one or more direct dyes . this makes it possible for the treated keratinic fibers to be not only temporarily structured but also to be dyed at the same time when using this agent . this may be desirable in particular if only a temporary coloration is desired , for example , with striking fashion colors , which can be removed again from the keratinic fibers by simply washing . direct dyes are usually nitrophenylenediamine , nitroamino phenols , azo dyes , anthraquinones or indophenols . preferred direct dyes include the compounds known by the international designations i . e ., brand names hc yellow 2 , hc yellow 4 , hc yellow 5 , hc yellow 6 , hc yellow 12 , acid yellow 1 , acid yellow 10 , acid yellow 23 , acid yellow 36 , hc orange 1 , disperse orange 3 , acid orange 7 , hc red 1 , hc red 3 , hc red 10 , hc red 11 , hc red 13 , acid red 33 , acid red 52 , hc red bn , pigment red 57 : 1 , hc blue 2 , hc blue 11 , hc blue 12 , disperse blue 3 , acid blue 7 , acid green 50 , hc violet 1 , disperse violet 1 , disperse violet 4 , acid violet 43 , disperse black 9 , acid black 1 and acid black 52 as well as 1 , 4 - diamino - 2 - nitrobenzene , 2 - amino - 4 - nitrophenol , 1 , 4 - bis -( 6 - hydroxyethyeamino - 2 - nitrobenzene , 3 - nitro - 4 -( 6 - hydroxyethyl ) aminophenol , 2 -( 2 ′- hydroxyethyl ) amino - 4 , 6 - dinitrophenol , 1 -( 2 ′- hydroxyethyeamino - 4 - methyl - 2 - nitrobenzene , 1 - amino - 4 -( 2 ′- hydroxyethyl ) amino - 5 - chloro - 2 - nitrobenzene , 4 - amino - 3 - nitrophenol , 1 -( 2 ′- ureidoethyl ) amino - 4 - nitrobenzene , 4 - amino - 2 - nitrodiphenylamine - 2 ′- carboxylic acid , 6 - nitro - 1 , 2 , 3 , 4 - tetrahydroquinoxaline , 2 - hydroxy - 1 , 4 - naphthoquinone , picramic acid and its salts , 2 - amino - 6 - chloro - 4 - nitrophenol , 4 - ethylamino - 3 - nitrobenzoic acid and 2 - chloro - 6 - ethylamino - 1 - hydroxy - 4 - nitrobenzene . cationic direct dyes are preferred . especially preferred for the present invention include ( a ) cationic triphenylmethane dyes , for example , basic blue 7 , basic blue 26 , basic violet 2 and basic violet 14 ; ( b ) aromatic systems substituted with a quaternary nitrogen group , for example , basic yellow 57 , basic red 76 , basic blue 99 , basic brown 16 and basic brown 17 ; and , ( c ) direct dyes containing a heterocycle having at least one quaternary nitrogen atom , such as those mentioned in claims 6 through 11 of ep - a2 - 998 908 , incorporated herein by reference . the dyes which are also known by the names basic yellow 87 , basic orange 31 and basic red 51 are most especially preferably cationic direct dyes of group ( c ). the cationic direct dyes distributed under the brand name arianor ® are also most especially preferred cationic direct dyes according to the invention . the inventive agents according to this embodiment contain the direct dyes preferably in an amount of 0 . 001 to 20 wt %, based on the total agent . it is preferable according to the invention for the inventive agents to be free of oxidative dye precursors . oxidative dye precursors are divided into so - called developer components and coupler components . the developer components develop the actual dyestuff under the influence of oxidizing agents or atmospheric oxygen with one another or by coupling with one or more coupler components . depending on the type of agent according to the invention it may be necessary for them to contain at least one surfactant . this is true in particular of skin cleaning agents and shampoos . however , other agents such as hair rinses , hair cures and certain styling agents in particular styling foams may also contain surfactants . for example , cationic surfactants such as those already described above as suitable care substances may be used . with regard to the preferred cationic surfactants and the quantities used , the statements made above are applicable accordingly . in addition to or instead of the cationic surfactants , these agents may also contain additional surfactants or emulsifiers , but in principle both anionic and ampholytic as well as nonionic surfactants and all types of known emulsifiers are suitable . the group of ampholytic or amphoteric surfactants includes zwitterionic surfactants and ampholytes . the surfactants may already have an emulsifying effect . suitable anionic surfactants include in principle all the anionic surface - active substances that are suitable for use on the human body . these are characterized by a water - solubilizing anionic group , for example , a carboxylate , sulfate , sulfonate or phosphate group and a lipophilic alkyl group with approx . 8 to 30 carbon atoms . in addition , glycol or polyglycol ether groups , ester , ether and amide groups as well as hydroxyl groups may also be present in the molecule . examples of suitable anionic surfactants include , ( each in the form of the sodium , potassium and ammonium salts as well as the mono -, di - and trialkanol ammonium salts with 2 to 4 carbon atoms in the alkanol group ): ( a ) linear and branched fatty acids with 8 to 30 carbon atoms ( soaps ); ( b ) ether carboxylic acids of the formula r — o —( ch 2 ch 2 o ) x — ch 2 — cooh in which r is a linear alkyl group with 8 to 30 carbon atoms and x = 0 or 1 to 16 ; ( c ) acyl sarcosides with 8 to 24 carbon atoms in the acyl group ; ( d ) acyl taurides with 8 to 24 carbon atoms in the acyl group ; ( e ) acyl isethionates with 8 to 24 carbon atoms in the acyl group ; ( f ) sulfosuccinic acid mono - and dialkyl esters with 8 to 24 carbon atoms in the alkyl group and sulfosuccinic acid monoalkylpolyoxyethyl esters with 8 to 24 carbon atoms in the alkyl group and 1 to 6 oxyethyl groups ; ( g ) linear alkane sulfonates with 8 to 24 carbon atoms ; ( h ) linear α - olefin sulfonates with 8 to 24 carbon atoms ; ( i ) α - sulfo fatty acid ethyl esters of fatty acids with 8 to 30 carbon atoms ; ( j ) alkyl sulfates and alkyl polyglycol ether sulfates of the formula r — o ( ch 2 ch 2 o ) x — oso 3 h in which r denotes a preferably linear alkyl group with 8 to 30 carbon atoms and x is 0 or 1 to 12 ; ( k ) mixtures of surface - active hydroxysulfonates ; ( l ) sulfated hydroxyalkyl polyethylene and / or hydroxyalkylene propylene glycol ether ; ( m ) sulfonates of unsaturated fatty acids with 8 to 24 carbon atoms and 1 to 6 double bonds ; ( n ) esters of tartaric acid and citric acid with alcohols which are the addition products of approx . 2 - 15 molecules of ethylene oxide and / or propylene oxide onto fatty alcohols with 8 to 22 carbon atoms ; ( o ) alkyl and / or alkenyl ether phosphates of the formula e1 - i , wherein r 1 preferably stands for an aliphatic hydrocarbon radical with 8 to 30 carbon atoms , r 2 stands for hydrogen , a ( ch 2 ch 2 o ) n r 1 radical or x , n stands for numbers from 1 to 10 and x stands for hydrogen , an alkali or alkaline earth metal or nr 3 r 4 r 5 r 6 , where r 3 to r 6 independently of one another stand for hydrogen or a c 1 to c 4 hydrocarbon radical ; ( p ) sulfated fatty acid alkylene glycol esters of formula , r 7 co ( alko ) n so 3 m , wherein r 7 co stands for a linear or branched aliphatic saturated or unsaturated acyl radical with 6 to 22 carbon atoms , alk stands for ch 2 ch 2 , chch 3 ch 2 and / or ch 2 chch 3 , n stands for numbers from 0 . 5 to 5 , and m stands for a cation such as those described in de - os 197 36 906 ; ( q ) amide ether carboxylic acids ; and ( r ) condensation products of c 8 to c 30 fatty alcohols with protein hydrolysates and / or amino acids and their derivatives which are known to the skilled person as protein fatty acid condensates such as lamepon products , gluadin ® products , hostapon ® kcg or amisoft ® products . preferred anionic surfactants include alkyl sulfates , alkyl polyglycol ether sulfates and ether carboxylic acids with 10 to 18 carbon atoms in the alkyl group and up to 12 glycol ether groups in the molecule , sulfosuccinic acid mono - and dialkyl esters with 8 to 18 carbon atoms in the alkyl group and sulfosuccinic acid monoalkylpolyoxyethyl esters with 8 to 18 carbon atoms in the alkyl group and 1 to 6 oxyethyl groups , monoglycerol disulfate , alkyl and alkenyl ether phosphates as well as protein fatty acid condensates . zwitterionic surfactants include those surface - active compounds having at least one quaternary ammonium group and at least one coo − or so 3 − group in the molecule . especially suitable zwitterionic surfactants include the so - called betaines such as n - alkyl - n , n - dimethylammonium glycinates , for example , the coconut alkyl dimethylammonium glycinate , n - acylaminopropyl - n , n - dimethylammonium glycinate , for example , coconut acylaminopropyl dimethylammonium glycinate and 2 - alkyl - 3 - carboxymethyl - 3 - hydroxyethyl imidazolines , each with 8 to 18 carbon atoms in the alkyl or acyl group , and coconut acylamino ethylhydroxyethyl carboxymethyl glycinate . a preferred zwitterionic surfactant is the fatty acid amide derivative known by the inci designation cocamidopropyl betaine . ampholytes are understood to be those surface - active compounds which , besides having a c 8 to c 24 alkyl or acyl group in the molecule , also have at least one free amino group and at least one cooh or so 3 h group and are capable of forming internal salts . examples of suitable ampholytes include n - alkylglycines , n - alkylpropionic acids , n - alkylaminobutyric acids , n - alkyliminodipropionic acids , n - hydroxyethyl - n - alkylamidopropyl glycines , n - alkyltaurines , n - alkylsarcosines , 2 - alkylaminopropionic acids and alkyl aminoacetic acids , each with approx . 8 to 24 carbon atoms in the alkyl group . especially preferred ampholytes include n - coconut alkyl amino propionate , coconut acylaminoethyl amino propionate and c 12 - c 18 acylsarcosine . nonionic surfactants contain as the hydrophilic group , for example , a polyol group , a polyalkylene glycol ether group or a combination of polyol and polyglycol ether group . such compounds include , for example : ( a ) addition products of 2 to 100 mol ethylene oxide and / or 1 to 5 mol propylene oxide onto linear and branched fatty alcohols with 8 to 30 carbon atoms , onto fatty acids with 8 to 30 carbon atoms and onto alkyl phenols with 8 to 15 carbon atoms in the alkyl group ; ( b ) end - group - capped addition products of 2 to 50 mol ethylene oxide and / or 1 to 5 mol propylene oxide onto linear and branched fatty alcohols with 8 to 30 carbon atoms , onto fatty acids with 8 to 30 carbon atoms and onto alkyl phenols with 8 to 15 carbon atoms in the alkyl group , with end group capping with a methyl group or a c 2 to c 6 alkyl group , such as for example those products obtainable under the brand names dehydrol ® ls , dehydrol ® lt ( cognis ); ( c ) c 12 - c 30 fatty acid mono - and diesters of addition products of 1 to 30 mol ethylene oxide onto glycerol ; ( d ) addition products of 5 to 60 mol ethylene oxide onto castor oil and hydrogenated castor oil ; ( e ) polyol fatty acid esters , for example , the commercial product hydagen ® hsp ( cognis ) or sovermol products ( cognis ); ( g ) alkoxylated fatty acid alkyl esters of the formula , r 1 co —( och 2 chr 2 ) w or 3 , in which r 1 co stands for a linear or branched saturated and / or unsaturated acyl radical with 6 to 22 carbon atoms , r 2 stands for hydrogen or methyl , r 3 stands for linear or branched alkyl radicals with 1 to 4 carbon atoms , and w stands for numbers from 1 to 20 ; ( i ) hydroxyl mixed ethers such as those described in de - os 19738866 ; ( j ) sorbitan fatty acid esters and additional products of ethylene oxide onto sorbitan fatty acid esters such as polysorbates ; ( k ) sugar fatty acid esters and addition products of ethylene oxide onto sugar fatty acid esters ; ( l ) addition products of ethylene oxide onto fatty acid alkanolamide and fatty amines ; and ( m ) sugar surfactants of the type of alkyl and alkenyl oligoglycosides according to the formula , r 4 o -[ g ] p , where r 4 stands for alkyl or alkenyl radical with 4 to 22 carbon atoms , g stands for a sugar radical with 5 or 6 carbon atoms and p stands for numbers from 1 to 10 . these can be obtained by the relevant methods of preparative organic chemistry . the most especially preferred nonionic surfactants are the alkylene oxide addition products on the saturated linear fatty alcohols and fatty acids each with 2 to 100 mol ethylene oxide per mol fatty alcohol and / or fatty acid . preparations with excellent properties are also obtained when they contain as nonionic surfactants c 12 to c 30 fatty acid monoesters and diesters of addition products of 1 to 30 mol ethylene oxide onto glycerol and / or addition products of 5 to 60 mol ethylene oxide onto castor oil and hydrogenated castor oil . agents according to the invention most especially preferably contain as the surfactant at least one addition product of 15 to 100 mol ethylene oxide , in particular 15 to 50 mol ethylene oxide , onto a linear or branched ( in particular linear ) fatty alcohol with 8 to 22 carbon atoms . these include most especially preferably ceteareth - 15 , ceteareth - 25 or ceteareth - 50 , which are marketed as eumulgin ® cs 15 ( cognis ), cremophor a25 ( basf se ) and / or eumulgin ® cs 50 ( cognis ). the agents according to the invention they may be formulated in the products traditionally used for cosmetic agents , for example , in the form of solutions which may be applied to the skin or hair as facial preparations or hair water or pump or aerosol sprays , in the form of creams , emulsions , waxes , gels or foaming solutions containing surfactants or other preparations suitable for application to the skin or hair . the agents according to the invention are preferably present in gel form or cream form , with transparent gels being especially preferred . the agents according to the invention are preferably agents for temporary shaping of keratinic fibers , i . e ., styling agents . preferred styling agents include styling gels and styling creams . transparent styling gels are especially preferred . use of the agents according to the invention of the first subject matter of the invention for temporary shaping of keratinic fibers is a second subject matter of the present invention . the agents and products containing these agents according to the invention are characterized in particular in that they impart a very strong and humidity - resistant styling hold to the treated hair . the hold of the shaping , also known as styling hold , as well as the flexibility , elasticity and plasticity are determined according to the omega loop method in the sense of the present invention . the quality of the transparency of a preparation according to the invention can be evaluated by visual observation of a doctored film on a sheet of glass . the following examples should illustrate the subject matter of the present invention without restricting it in any way . the following quantitative data are understood to be in percent by weight , unless otherwise indicated . styling gels denoted e1 to e5 in accordance with the present invention are set out in table 1 below . even without the addition of the usual thickeners or structurants , styling agents on an aqueous and / or ethanolic basis having the desired transparent gel form and an excellent hold are obtained by the usual mixing of the raw materials listed in the table . in addition , these gels have an excellent transparency and their viscosity and transparency are stable in storage at temperatures from − 15 ° c . up to + 45 ° c . while at least one exemplary embodiment has been presented in the foregoing detailed description of the invention , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing an exemplary embodiment of the invention , it being understood that various changes may be made in the function and arrangement of elements described in an exemplary embodiment without departing from the scope of the invention as set forth in the appended claims and their legal equivalents . | 0 |
fig1 shows a brake unit which is actuatable by a brake pedal 1 . in essence , the brake unit includes a pressure - control valve 13 and a master cylinder 120 having master - cylinder pistons 10 and 10 &# 39 ;. the master - cylinder pistons 10 and 10 &# 39 ; urge brake fluid out of work chambers 12 and 12 &# 39 ; via brake lines 58 and 50 into wheel brake cylinders 52 and 5 of automotive vehicle brakes . the power source is a pressure accumulator 3 . the pressure - control valve 13 shall first be described in more detail . valve 13 controls the flow of pressure fluid from power source 3 into wheel brake cylinders 52 and 5 when the brake pedal 1 is depressed . pressure - control valve 13 includes a control casing 68 which is axially displaceable in the brake unit and in a sealed relation with the inner surface of the housing of master cylinder 120 . the control casing 68 has an annular chamber 69 permanently communicating with power source 3 via a bore 70 . axially displaceable in control casing 68 is a valve spool 16 permanently connected with brake pedal 1 . valve spool 16 has a longitudinal bore 71 and cross or transverse bores 72 and 73 . the longitudinal bore 71 provides a connection between a chamber 77 and a chamber 74 via a channel 76 , chamber 74 being disposed between a pedal - side front wall 75 of control casing 68 and the pedal - side end plate of the brake unit . chamber 77 is in constant communication with an unpressurized reservoir 29 through a conduit 66 . the cross bores 72 and 73 in valve spool 16 are so designed that the connection between the two chambers 74 and 77 will first be interrupted when valve spool 16 is displaced in the actuating direction . pressure fluid is then allowed to flow from annular chamber 69 into chamber 74 via a bore 126 , cross bore 72 and longitudinal bore 71 . from chamber 74 , a longitudinal channel 78 leads to a compensating reservoir 24 and to a further compensating reservoir 24 &# 39 ;. with regards to master cylinder 120 which shall now be explained in greater detail , it includes , as has already been mentioned , two master - cylinder pistons 10 and 10 &# 39 ; having different diameters . the master - cylinder piston 10 which has the larger diameter is closest to brake pedal 1 . as is conventional practice in stepped master cylinders , the two master - cylinder pistons 10 and 10 &# 39 ; are anchored to one another . the anchoring permits the two master - cylinder pistons 10 and 10 &# 39 ; to make limited movements towards or away from one another . the anchoring itself is known in the art . for example , one embodiment is described in u . s . pat . no . 3 , 488 , 959 . each of the two master - cylinder pistons 10 and 10 &# 39 ; has a respective annular chamber 20 and 20 &# 39 ; disposed between a respective sleeve seal 11 and 11 &# 39 ; and a respective seal 21 and 21 &# 39 ; closest to the brake pedal . from each of said annular chambers , respective compensating bores 23 and 23 &# 39 ; lead to the compensating reservoirs 24 and 24 &# 39 ;. finally , a travel simulator 79 shall be described which is interposed between pressure - control valve 13 and master cylinder 120 . travel simulator 79 includes a simulator spring 80 bearing with one end against control casing 68 and with the other end bearing against a supporting piston 121 . supporting piston 121 is disposed in a pressure chamber 122 communicating with longitudinal channel 78 via an opening 123 . in the direction of brake pedal 1 , the pressure chamber 122 has a stop 130 formed in the housing of the brake unit , against which stop the supporting piston 121 is held by virtue of the pressure in chamber 122 , because chamber 77 is always at reservoir pressure . the pressure chamber 122 is separated from the master cylinder 120 by a wall 124 . extending through wall 124 and through supporting piston 121 is an extension 125 of control casing 68 . extension 125 is in a sealed relation with supporting piston 121 and is axially slidable both in supporting piston 121 and in the wall 124 . extension 125 rests firmly against master - cylinder piston 10 , thereby causing the latter to be equally displaced when control casing 68 is displaced against the force of simulator spring 80 . the dual - circuit brake system operates as follows : the drawing shows the brake unit in its inoperative position . the chamber 74 communicates with chamber 77 and thus with unpressurized reservoir 29 via cross bore 73 , longitudinal bore 71 and channel 76 . compensating reservoirs 24 and 24 &# 39 ; are not pressurized since they communicate with chamber 74 via longitudinal channel 78 . when brake pedal 1 is depressed , valve spool 16 will move in control casing 68 , thereby first closing channel 76 so that the connection provided by longitudinal bore 71 between chamber 74 and unpressurized chamber 77 which communicates with unpressurized reservoir 29 is interrupted . upon further displacement of valve spool 16 in the operating direction , cross bore 72 will overlap control bore 126 so that pressure fluid will be allowed to flow from the annular chamber 69 into chamber 74 via control bore 126 , cross bore 72 and longitudinal bore 71 and , hence , into compensating reservoirs 24 and 24 &# 39 ; via longitudinal channels 78 and 78 &# 39 ;. from compensating reservoirs 24 and 24 &# 39 ;, pressure fluid will flow into the annular chambers 20 and 20 &# 39 ; via compensating bores 23 and 23 &# 39 ;. at the same time , the pressure in chamber 74 displaces the control casing 68 to the left , as viewed in the drawing , against the force of the simulator spring 80 . this causes extension 125 to displace master - cylinder piston 10 and thereby master - cylinder piston 10 &# 39 ; in the actuating direction . pressure will build up in each of the work chambers 12 and 12 &# 39 ; of master - cylinder pistons 10 and 10 &# 39 ;, the pressure resulting from the surface of control casing 68 , force of simulator spring 80 , and the end faces of master - cylinder pistons 10 and 10 &# 39 ;. only when the brake pedal has been depressed far enough to build up pressure in the compensating reservoirs 24 and 24 &# 39 ; and consequently in the annular chambers 20 and 20 &# 39 ;, the pressure being higher than the one in the work chambers 12 and 12 &# 39 ;, will pressure fluid be introduced from the annular chambers 20 and 20 &# 39 ;, through the longitudinal bores 22 and 22 &# 39 ; and past the outer periphery of sleeve seals 11 and 11 &# 39 ; into the respective work chambers 12 and 12 &# 39 ;. it results from the above features that control casing 68 is supported by simulator 79 and by the pressure prevailing in the two work chambers 12 and 12 &# 39 ;. for example , if the pressure building up in the work chambers 12 and 12 &# 39 ; is delayed due to air pockets , control casing 68 will be displaced in the brake - applying direction . the driver will become aware of such air pockets by having to depress the pedal farther than usual . it shall now be assumed that power source 3 has failed and that the driver has to operate the brake solely by his pedal effort . since pressure chamber 122 is unpressurized , supporting piston 121 may be readily displaced in the operating direction , together with extension 125 . thus , travel simulator 79 offers no resistance to the brake application upon the failure of power source 3 . via extension 125 , master - cylinder piston 10 will be mechanically shifted so that pressure will build up in both work chambers 12 and 12 &# 39 ; as in a normal stepped master cylinder . since the pedal effort is smaller than the force generated by power source 3 , the pressure available in the two work chambers 12 and 12 &# 39 ; will naturally be less than when use is made of the power source for brake application . the diameters of the master - cylinder pistons 10 and 10 &# 39 ; may , however , be designed such that sufficient brake pressure can also be generated without the assistance of the power source . if both the power source and a brake circuit have failed , the pedal force will bear against only one master - cylinder piston 10 or 10 &# 39 ; through the brake pedal 1 , control casing 68 and extension 125 . this permits a higher brake pressure to be achieved in the intact brake circuit using the same effort so that a sufficient braking effect can still be achieved even if only one brake circuit is operative . referring now to fig2 the second embodiment shall be explained . the brake unit of fig2 differs from that of fig1 in that a stepped piston 127 is interposed in the connection between annular chambers 20 and 20 &# 39 ;, respectively , and pressure - control valve 13 . in this embodiment , stepped piston 127 is provided between chamber 74 and compensating reservoir 24 . on the inlet side , stepped piston 127 has a large actuating surface 128 , and on the side adjacent compensating reservoir 24 , a small actuation surface 129 . this permits the use of a power source having a comparatively low pressure . namely , the pressure introduced into chamber 74 by pressure - control valve 13 is increased by stepped piston 127 in the ratio of the actuating surfaces 128 and 129 . in this manner , the steering pump of an automotive vehicle may , for instance , be used as power source 3 . while i have described above the principles of my invention in connection with specific apparatus it is to be clearly understood that this description is made only by way of example and not as a limitation to the scope of my invention as set forth in the objects thereof and in the accompanying claims . | 1 |
referring now in detail to the drawings and , in particular , to fig1 - 5 , the hair styling apparatus 100 in accordance with the principles of the present invention is illustrated . the hair styling apparatus 100 may be in the form of a hair straightener utilized to generally straighten the hair of the subject . however , it is envisioned that the hair styling apparatus may includes surfaces to shape , crimp or affect any styling effect to the subject &# 39 ; s hair . the hair styling apparatus 100 includes first and second handle members 102 , 104 connected to each other through a hinge 106 , of a conventional type . the hinge 106 typically incorporates a spring to normally bias the first and second members 102 , 104 to the open position depicted in fig1 and 2 . the first and second handle members 102 , 104 are adapted to pivot about the hinge 106 between the open position of fig1 and 2 and the closed position depicted in fig3 - 5 . the first handle member 102 includes a cartridge 108 and a cartridge release button 110 , which releases the cartridge 108 from the first handle member 102 . generally , the cartridge 108 contains a hair treatment agent , which is released in an at least partially vaporized state , between the first and second handle members 102 , 104 for application to the subject &# 39 ; s hair . the cartridge 108 will be discussed in greater detail hereinbelow . each of the first and second handle members 102 , 104 includes a heating element or plate 110 at the end remote from the hinge 106 . the heating plates 110 are heated by conventional electrical means ( not shown ) known in the art , so that hair can be positioned therebetween for styling . each heating plate 110 includes a centrally disposed channel 112 respectively extending lengthwise or longitudinally with respect to the longitudinal axes “ k 1 , k 2 ” of the respective handle members 102 , 104 . the channels 112 may be offset with respect to the respective axes “ k 1 , k 2 ”, may be non - linear , arcuate , sinusoidal or any other shape . the channels 112 convey the at least partially vaporized treatment agent , which is released from the cartridge 108 within the heating plates 110 for application to the hair of the subject . the second handle member 104 includes a pocket or recess 114 ( fig1 ), which is dimensioned to correspondingly accommodate at least a segment of the cartridge 108 when the first and second handle members 102 , 104 are in the closed position . the first and second handle members 102 , 104 may include an on / off power switch 116 , a power - on indicator or light 118 ( such as an led indicator or the like ) for indicating activation of the apparatus 100 and a power cord 120 for supplying power . contacts 122 on each of the first and second handle member 102 , 104 may be provided to power the heating plates only when the first and second handle members 102 , 104 are in the closed position . the first handle member 102 further includes an ultrasound power switch 124 and an ultrasound power indicator 126 such as an led or the like — the function of which will be discussed in greater detail herein below . referring now to fig6 , in conjunction with fig7 - 9 , the cartridge 108 will be discussed in detail . the cartridge 108 includes a cartridge housing 128 having a first internal chamber 130 defining a reservoir for accommodating the treatment agent 132 . the treatment agent may be argan oil . argan oil is extracted from the fruits of the argan tree , argania spinosa , that is endemic to morocco . the hair care composition may solely contain argan oil , or may include argan oil in combination with other ingredients . examples of other ingredients include pharmaceutically active agents , moisturizers , hydration agents , penetration agents , preservatives , emulsifiers , natural or synthetic oils , solvents , surfactants , detergents , gelling agents , emollients , antioxidants , fragrances , fillers , thickeners , waxes , odor absorbers , dyestuffs , coloring agents , powders , viscosity - controlling agents , buffers , protectants , ph regulators , chelating agents , humectants , conditioners , glitter , mica , minerals , silicones , polyphenols , sunblocks , phytomedicinals , and combinations thereof , as well as other additives typically used in hair care products as appreciated by those skilled in the art . in embodiments , the hair care composition may include argan oil and emollients and / or conditioning agents , alone or in combination with other ingredients as discussed above . in embodiments , the hair care composition includes argan oil and silicone . silicone includes , for example , silicone oils and oils having a hydrocarbon backbone , silicone oils combining cyclic polydimethylsiloxanes , α , ω - hydroxylated polydimethylsiloxanes , α , ω - trimethylsilyl polydimethylsiloxanes , polyorganosiloxanes such as polyalkylmethylsiloxanes , polymethylphenylsiloxanes , polydiphenylsiloxanes , aminosilicone derivatives , silicone waxes , copolyether silicones ( such as the oil mirasil dmco sold by rhone - poulenc , or dc 190 sold by dow corning ) or mixed silicone derivatives including various types of derivatization ( such as polyalkylmethyl - siloxane / copolyether silicone mixed copolymers ). an argan / silicon conditioning agent may strengthen , repair or condition hair , while potentially adding shine to the hair . other suitable emollients include , for example alkylmonoglycerides , alkyldiglycerides , and / or triglycerides such as oils extracted from plants and vegetables ( palm oil , coconut oil , cotton seed oil , soybean oil , sunflower oil , olive oil , grape seed oil , sesame oil , ground nut oil , castor oil , combinations thereof , and the like ), oils of marine origin ( fish oils , etc .) and derivatives of these oils , such as hydrogenated oils , lanolin derivatives , mineral oils or paraffinic oils , perhydrosqualane , squalene , diols such as 1 , 2 - propanediol and 1 , 3 - butanediol , cetyl alcohol , stearyl alcohol , oleyl alcohol , polyethylene glycols or polypropylene glycols , and fatty esters such as isopropyl palmitate , 2 - ethylhexyl cocoate , myristyl myristate , esters of lactic acid , stearic acid , behenic acid , isostearic acid . in embodiments , the hair care composition may include argan oil and conditioners , alone or in combination with other ingredients . conditioners include , for example , those of natural or synthetic origin , such as those known under the generic ctfa name “ polyquaternium ”, for instance the mirapol a15 ® or mirapol 550 ® polymers from rhone - poulenc , cationic polysaccharide derivatives ( cationic derivatives of cellulose , of guar or of carob ), such as cocodimonium hydroxyethyl cellulose , guar hydroxypropyl trimonium chloride , hydroxypropyl guar hydroxypropyl trimonium chloride ( jaguar c13s ®, jaguar c162 ® sold by rhone - poulenc ), volatile or non - volatile silicone derivatives , for instance amodimethicone , cyclomethicones , water - insoluble , non - volatile polyorganosiloxanes , for instance oils , resins or gums , such as diphenyldimethicone gums , combinations thereof , and the like . examples of other additives which may be useful in the hair care composition include additives for promoting moisturization of the hair and / or skin ( wetting agents ), for instance certain carbohydrates ( for example glycerol or sorbitol ), polyethylene glycols or polypropylene glycols , alkoxylated derivatives of sugars or of sugar derivatives ( for example methylglucose ), water - soluble or water - dispersible polymers such as collagen or certain non - allergenic derivatives of marine or plant proteins ( for example wheat protein hydrolysates ). thickeners , such as natural hydrocolloids ( guar gum , carob gum , tara gum , etc .) or hydrocolloids derived from fermentation processes , such as xanthan gum , polysaccharides extracted from seaweed , such as carrageenans , and polycarbohydrate derivatives such as modified celluloses ( for example hydroxyethylcellulose , carboxymethylcellulose ), or nonionic derivatives ( for example hydroxypropylguar ), anionic derivatives ( carboxymethylguar ) or nonionic / anionic mixed derivatives , such as carboxy - hydroxypropyl - guars or nonionic / cationic derivatives , can also be present . referring still to fig6 - 9 , the cartridge housing 128 may have a cartridge valve or cover 134 ( fig8 ), which permits access to the first internal chamber 130 . the cover 134 may be movable between the closed position and the open position depicted in phantom in fig8 to permit filling / refilling of the treatment agent 132 within the first internal chamber 130 of the cartridge housing 128 . the cartridge housing 128 further includes a second internal chamber 136 in fluid communication with the first internal chamber 130 . the second internal chamber 136 may have an absorbent member 138 such as a sponge , wicking material or the like , which collects and stores a volume of the treatment agent 132 . the cartridge 108 has an ultrasound emitter or transducer 140 such as a piezo electric transducer or the like . the piezo electric transducer 140 may be any conventional piezo electric transducer adapted to oscillate to generate energy in the form of heat . the transducer 140 may be disc shaped and mounted at each end within opposed channels 142 defined within the cartridge housing 128 adjacent or across a cartridge vapor outlet opening 146 of the cartridge housing 128 ( see also fig6 ). an elastomeric o - ring gasket or seal 148 comprising an elastomeric material or the like may extend within each channel 144 to form a fluid tight seal about the ends of transducer 140 . the transducer 140 further includes one or more micro - openings or channels 150 extending therethrough in communication with the second internal chamber 136 to permit release of the vaporized treatment agent . the cartridge 108 further includes one or more power contacts or pins 152 in electrical communication with the transducer 140 . the power pins 152 are received within corresponding power receptacles 154 disposed within the first handle member 102 adjacent the cartridge receiving recess 156 of the first handle member 102 ( fig6 ). the power receptacles 154 include electrical contacts , which are in communication with the ultrasound power switch 124 and the electrical cord 122 to selectively supply power to the transducer 140 . thus , upon mounting of the cartridge 108 fully within the cartridge receiving recess 156 of the first handle member 102 , the contact pins 152 of the cartridge 108 establish electrical contact with the contacts within the pin receiving receptacles 154 of the first handle member 102 . the cartridge receiving recess 156 is correspondingly dimensioned to accommodate the cartridge 108 in a manner to reduce the profile of the first handle member 102 . the cartridge housing 128 may have at least one locking detent 158 , which is selectively engaged by the cartridge release button 110 to releasably secure the cartridge 108 relative to the first handle member 102 . any type of releasable connection means are envisioned including , e . g ., tongue and groove arrangements , bayonet couplings , sliding release arrangements or the like . in one embodiment schematically depicted in fig1 , the cartridge release button 110 includes a depending resilient member 160 , which is receivable within the locking detent 158 of the cartridge housing 128 . depression of the release button 110 will cause the resilient member 160 to deflect in the direction “ m ” and become released from the locking detent 158 , thereby permitting removal of the cartridge 108 from the cartridge receiving recess 156 of the first handle member 102 . the use of the hair styling apparatus 100 for styling hair will now be discussed . the cartridge 108 filled with the hair treatment agent 132 is mounted within the outer cartridge receiving recess 156 of the first handle member 102 . electrical contact is established between the contact pins 152 of the cartridge housing 128 and the contacts within the pin receiving receptacles 154 of the first handle member 102 . the power switch 118 is activated to charge the heating elements 110 of the first and second handle members 102 , 104 . the subject &# 39 ; s hair is positioned between the open first and second handle members 102 , 104 ( fig1 and 2 ) and the first and second handle members 102 , 104 are moved to the closed position of fig3 - 5 . the hair is treated , e . g ., straightened , as it passes along the heating elements 110 . when it is desired to apply the hair treatment agent 132 , the transducer power switch 124 is activated causing the transducer 140 to oscillate . as the transducer 140 oscillates , heat is generated sufficient to at least partially vaporize the treatment agent 132 within the absorbent member 138 in the second internal chamber 136 . as depicted in fig9 and 11 , the vaporized treatment agent “ 132 v ” is released through the micro - openings 150 extending through the transducer 140 and out the cartridge vapor outlet opening 146 of the cartridge housing 128 . fig1 depicts the first handle member 102 removed for illustration purposes . the vaporized treatment agent “ 132 v ” communicates through the opening of the first handle member , and is conveyed through the channels 112 of the first and second handle members 102 , 104 for application to the subject &# 39 ; s hair . the treatment agent 132 v released in the vaporized state from the absorbent or wicking member 138 is continuously replenished with the treatment agent stored within the first internal chamber 130 . the ultrasound transducer 140 may be deactivated at any time during the procedure via the ultrasound power switch 124 . in the event more treatment agent 132 is needed , the cartridge 108 is released from the first handle member 102 by depression of the cartridge release button 110 . the closure seal or cover of the cartridge 134 may be opened , and additional treatment agent 132 is introduced within the first internal chamber 130 . the cover 134 is closed and the cartridge 108 is reinserted into the cartridge receiving recess 156 of the first handle member 102 . the wicking or absorbent member 138 maintains the treatment agent in the liquid state adjacent the transducer 140 while preventing the liquid treatment agent from interfering with the functioning of the transducer 140 . when subjected to heat generated by the transducer 140 , the treatment agent 132 at least partially vaporizes for release through the channels 150 of the transducer 140 . the vaporized treatment agent 132 v will not interfere with the functioning of the transducer . the vaporized treatment agent 132 v also protects the hair when subjected to the heat of the heating elements 110 . fig1 a - 12c illustrate alternate embodiments of the cartridge 108 . in fig1 a , the cartridge 200 is similar to the cartridge 108 of the first embodiment and incorporates a cover 202 which is selectively opened and closed to permit access to the internal chambers for refilling of the treatment agent . in fig1 b , the cartridge 300 includes a threaded opening 302 which receives a threaded bottle member 304 containing the treatment agent . the bottle 304 may replace the first internal chamber and supply the treatment agent to the absorbent member . upon emptying of the bottle 304 , the bottle may be released and replaced with a new bottle of agent or refilled and connected to the cartridge 300 . in fig1 c , a flexible pouch 308 , e . g ., a foil pouch , having a threaded segment 310 may be received within the threaded opening 302 of the cartridge 300 . multiple pouches 308 may be provided as replacement pouches during use of the apparatus 100 . the above description and the drawings are provided for the purpose of describing embodiments of the present disclosure and are not intended to limit the scope of the disclosure in any way . it will be apparent to those skilled in the art that various modifications and variations can be made without departing from the spirit or scope of the disclosure . thus , it is intended that the present disclosure cover the modifications and variations of this disclosure provided they come within the scope of the appended claims and their equivalents . | 0 |
unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . generally , the nomenclature used herein and the laboratory procedures in cell culture , chemistry , microbiology , molecular biology , cell science and cell culture described below are well known and commonly employed in the art . conventional methods are used for these procedures , such as those provided in the art and various general references ( sambrook et al ., molecular cloning : a laboratory manual , 2nd edition , cold spring harbor press , cold spring harbor , n . y . ( 1989 ); ausubel et al ., current protocols in molecular biology , john wiley and sons ( 1998 ); harlowe and lane , antibodies , a laboratory manual , cold spring harbor press ( 1988 )). where a term is provided in the singular , the inventors also contemplate the plural of that term . the nomenclature used herein and the laboratory procedures described below are those well known and commonly employed in the art . as employed throughout the disclosure , the following terms , unless otherwise indicated , shall be understood to have the following meanings : “ organism ” can be any prokaryote or eukaryote , and includes viruses , protozoans , and metazoans . metazoans include vertebrates and invertebrates . “ organism ” can also ref to more than one species that are found in association with one another , such as mycoplasm - infected cells , a plasmodium - infected animal , etc . a “ nucleic acid molecule ” is a polynucleotide . a nucleic acid molecule can be dna , rna , or a combination of both . a nucleic acid molecule can also include sugars other than ribose and deoxyribose incorporated into the backbone , and thus can be other than dna or rna . a nucleic acid can comprise nucleobases that are naturally occurring or that do not occur in nature , such as xanthine , derivatives of nucleobases such as 2 - aminoadenine and the like . a nucleic acid molecule of the present invention can have linkages other than phosphodiester linkages . a nucleic acid molecule can also be a peptide nucleic acid molecule . a nucleic acid molecule can be of any length , and can be single - stranded or double - stranded , or partially single - stranded and partially double - stranded . a “ probe ” or “ probe nucleic acid molecule ” is a nucleic acid molecule that is at least partially single - stranded , and that is at least partially complementary , or at least partially substantially complementary , to a sequence of interest . a probe can be rna , dna , or a combination of both rna and dna . it is also within the scope of the present invention to have probe nucleic acid molecules comprising nucleic acids in which the backbone sugar is other that ribose or deoxyribose . probe nucleic acids can also be peptide nucleic acids . a probe can comprise nucleolytic - activity resistant linkages or detectable labels , and can be operably linked to other moieties , for example a peptide . a single - stranded nucleic acid molecule is “ complementary ” to another single - stranded nucleic acid molecule when it can base - pair ( hybridize ) with all or a portion of the other nucleic acid molecule to form a double helix ( double - stranded nucleic acid molecule ), based on the ability of guanine ( g ) to base pair with cytosine ( c ) and adenine ( a ) to base pair with thymine ( t ) or uridine ( u ). for example , the nucleotide sequence 5 ′- tatac - 3 ′ is complementary to the nucleotide sequence 5 ′- gtata - 3 ′. “ substantially complementary ” refers to nucleic acids that will selectively hybridize to one another under stringent conditions . “ selectively hybridize ” refers to detectable specific binding . polynucleotides , oligonucleotides and fragments thereof selectively hybridize to target nucleic acid strands , under hybridization and wash conditions that minimize appreciable amounts of detectable binding to nonspecific nucleic acids . high stringency conditions can be used to achieve selective hybridization conditions as known in the art generally , the nucleic acid sequence complementarity between the polynucleotides , oligonucleotides , and fragments thereof and a nucleic acid sequence of interest will be at least 30 %, and more typically and preferably of at least 40 %, 50 %, 60 %, 70 %, 80 %, 90 %, and can be 100 %. conditions for hybridization such salt concentration , temperature , detergents , and denaturing agents such as formamide can be varied to increase the stringency of hybridization , that is , the requirement for exact matches of c to base pair with g , and a to base pair with t or u , along the strand of nucleic acid . “ corresponds to ” refers to a polynucleotide sequence that shares identity ( for example is identical ) to all or a portion of a reference polynucleotide sequence . in contradistinction , the term “ complementary to ” is used herein to mean that the complementary sequence will base pair with all or a portion of a reference polynucleotide sequence . for illustration , the nucleotide sequence 5 ′- tatac - 3 ′ corresponds to a reference sequence 5 ′- tatac - 3 ′ and is complementary to a reference sequence 5 ′- gtata - 3 ′. “ sequence identity ” or “ identical ” means that two polynucleotide sequences are identical ( for example , on a nucleotide - by - nucleotide basis ) over the window of comparison . “ partial sequence identity ” or “ partial identity ” means that a portion of the sequence of a nucleic acid molecule is identical to at least a portion of the sequence of another nucleic acid molecule . “ substantial identity ” or “ substantially identical ” as used herein denotes a characteristic of a polynucleotide sequence , wherein the polynucleotide comprises a sequence that has at least 30 percent sequence identity , preferably at least 50 to 60 percent sequence identity , more usually at least 60 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide positions , frequently over a window of at least 25 to 50 nucleotides , wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence that may include deletions or addition which total 20 percent or less of the reference sequence over the window of comparison . “ substantial partial sequence identity ” or “ substantially partially identical ” is used when a portion of a nucleic acid molecule is substantially identical to at least a portion of another nucleic acid molecule . as used herein “ identity ” or “ identical ” refers to the base composition of nucleic acids , and not to the composition of other components , such as the backbone that can be comprised of one or more sugars and one or more phosphates , or can have other substituted moieties . a “ detectable label ” is a compound or molecule that can be detected , or that can generate a readout , such as fluorescence , radioactivity , color , chemiluminescence or other readouts known in the art or later developed . the readouts can be based on fluorescence , such as by fluorescent labels , such as but not limited to , cy - 3 , cy - 5 , phycoerynin , phycocyanin , allophycocyanin , fitc , rhodamine , or lanthanides ; by flourescent proteins such as green fluorescent protein ( gfp ) and its variants , can be based on enzymatic activity , such as , but not limited to , the activity of beta - galactosidase , beta - lactamase , horseradish peroxidase , alkaline phosphatase , or luciferase ; or can be based on radioisotopes ( such as 33 p , 3 h , 14 c , 35 s , 125 i , 32 p or 131 i ). a label optionally can be a base with modified mass , such as , for example , pyrimidines modified at the c5 position or purines modified at the n7 position . mass modifying groups can be , for examples , halogen , ether or polyether , alkyl , ester or polyester , or of the general type xr , wherein x is a linking group and r is a mass - modifying group . one of skill in the art will recognize that there are numerous possibilities for mass - modifications useful in modifying nucleic acid molecules and oligonucleotides , including those described in oligonucleotides and analogues : a practical approach , eckstein , ed . ( 1991 ) and in pct / us94 / 00193 . “ label ” or “ labeled ” refers to incorporation of a detectable marker , for example by incorporation of a fluorescent or radiolabled compound or attachment of moieties such as biotin that can be detected by the binding of a second moiety , such as marked avidin . various methods of labeling nucleic acids are known in the art . a “ mutation ” is a change in the genome with respect to the standard wild - type sequence . mutations can be deletions , insertions , or rearrangements of nucleic acid sequences at a position in the genome , or they can be single base changes at a position in the genome , referred to as “ point mutations ”. mutations can be inherited , or they can occur in one or more cells during the lifespan of an individual . “ operably linked ” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner . for example , a control sequence operably linked to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with control sequences . a “ sequence of interest ” is a sequence whose presence or variation can be detected in one or more survey populations of nucleic acids by the methods of the present invention . a “ survey population of nucleic acid molecules ” is a population of at least two nucleic acid molecules that are to be tested for the presence of a sequence of interest . a survey population of nucleic acid molecules can be dna or rna . a survey population of nucleic acid molecules can be from any source , such as a human source , animal source , plant source , or microbial source . the survey population can be isolated from tissue ( including but not limited to hair , blood , serum , amniotic fluid , semen , urine , saliva , throat or genital swabs , biopsy samples , or autopsy samples ) or cells , including cells grown in culture , and can be isolated from living or nonliving samples or subjects . the survey population can be isolated from inanimate material , remnants or artifacts , including fossilized material . “ hybridization ” is the process of base - pairing of single - stranded nucleic acids , or single - stranded portions of nucleic acids , to create double - stranded nucleic acids or double - stranded portions of nucleic acid molecules . “ probe survey population mixture of nucleic acid molecules ” refers to a mixture that contains probe nucleic acid molecules and survey population nucleic acid molecules . preferably , the probe nucleic acid molecules and survey population molecules have been contacted under conditions that promote hybridization between nucleic acid molecules that are at least partially complementary or at least partially substantially complementary . a “ nucleolytic activity ” or “ nucleolytic agent ” is an activity that can cleave nucleosidic bonds to degrade nucleic acid molecules . nucleolytic activities or agents can be enzymes , such as , for example , dnase i , exonuclease iii , mung bean nuclease , s1 nuclease , rnase h , or rnase a , or can be chemical compounds , such as hydrogen peroxide , osmium tetroxide , hydroxylamine , or potassium permanganate , or can be chemical conditions , such as high or low ph . an “ overhang ” is a single - stranded region at a terminus of an otherwise double - stranded nucleic acid molecule . an “ attached nucleic acid molecule ” is a nucleic acid molecule that is bound to a solid support . an attached nucleic acid molecule can be of any length , can be single - stranded or double - stranded , or partially single - stranded and partially double - stranded , and can comprise non - naturally occurring linkages , such as nucleolytic activity - resistant backbone linkages , such as but not limited to phosporothioate , methyl phosphonate , or borano - phosphate linkages . an attached nucleic acid molecule can be dna , rna , or a combination of dna and rna . it is also within the scope of the present invention to have probe nucleic acid molecules comprising nucleic acids in which the backbone sugar is other than ribose or deoxyribose ; for example , certain hexoses may be substituted . probe nucleic acids can also be peptide nucleic acids . the attached nucleic acid molecule can be reversibly or irreversibly bound to the solid support . the binding to the solid support can be direct or indirect . if the attached nucleic acid is directly bound , it can be attached to the solid support at its 3 ′ or 5 ′ terminus . an “ attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complex ” or “ hybridized complex ” is a complex that includes at least one attached nucleic acid molecule and includes at least one nucleic acid molecule that has been treated with a nucleolytic activity . the nucleolytic activity - treated molecule of the hybridized complex can be a nucleic acid molecule that was portion of a nucleic acid molecule that was partially digested by a nucleolytic activity or can be a nucleic acid molecule that was wholly protected from nucleolytic activity . the attached nucleic acid molecule and the nucleolytic activity - protected nucleic acid molecule of the hybridized complex are preferably at least partially complementary . the hybridized complex can comprise other components as well , such as , but not limited to , additional nucleic acid molecules . one or more nucleic acid molecules of the hybridized complex can comprise a detectable label . a “ nucleolytic activity - protected nucleic acid molecule ” is at least one nucleic acid molecule that has been treated with one or more nucleolytic activities , and that has not been degraded by the nucleolytic activities . a nucleolytic activity protected nucleic acid molecule can be single - stranded or may be double - stranded , or may be partially single - stranded and partially double - stranded . a nucleolytic activity - protected nucleic acid molecule can be resistant to one or more nucleolytic activities . resistance to nucleolytic activities can be conferred , for example , by conformation of a nucleic acid molecule when it was treated with a nucleolytic activity ( including being in the double - stranded state ), by the nucleotide sequence of a nucleic acid molecule , or by one or more nucleoside linkages of a nucleic acid molecule . a nucleolytic activity - protected nucleic acid molecule can be a nucleolytic activity - protected survey population nucleic acid molecule or fragment thereof , or a nucleolytic activity - protected probe nucleic acid molecule or fragment thereof , or can comprise all or portions of both survey population nucleic acid molecules and probe nucleic acid molecules . in addition , in some embodiments , attached nucleic acid molecules or portions thereof can be nucleolytic activity - protected nucleic acid molecules . nucleolytic activity - protected nucleic acid molecules can include or be operably linked to other compounds as well , for example , peptides , chemical moieties , and / or labels . a “ nucleolytic activity - protected nucleic acid molecule complex ” or “ protected complex ” is a complex that includes one or more nucleic acid molecules that have been treated with one or more nucleolytic activities . one or more of the nucleic acid molecules of a protected complex , or one or more portions of a protected complex may be single - stranded . one or more of the nucleic acid molecules of a protected complex , or one or more portions of the nucleic acid molecules of a protected complex may be double - stranded . typically , nucleic acid molecules of a nucleolytic activity - protected nucleic acid complex are resistant to one or more nucleolytic activities , such that they have not been degraded by one or more nucleolytic activities . resistance to nucleolytic activities can be conferred , for example , by conformation of nucleic acid molecules ( including being in the double - stranded state ), by the nucleotide sequence of nucleic acid molecules , or by one or more nucleoside linkages of nucleic acid molecules . a nucleolytic activity - protected nucleic acid complex can include other compounds as well , for example , peptides , chemical moieties , and / or labels . a “ signal nucleic acid molecule ” is a nucleic acid molecule that is at least partially single - stranded , and that is at least partially complementary , or at least partially substantially complementary , or at least partially identical , or at least partially substantially identical to a sequence of interest . a probe can be rna , dna , or a combination of both rna and dna . it is also within the scope of the present invention to have probe nucleic acid molecules comprising nucleic acids in which the backbone sugar is other than ribose or deoxyribose ; for example , certain hexoses may be substituted . probe nucleic acids can also be peptide nucleic acids . a probe can comprise nuclease resistant linkages and can be operably linked to other moieties , for example a peptide or a chemical moiety such as biotin . a signal nucleic acid molecule preferably comprises a detectable label . a “ single nucleotide polymorphism ” or “ snp ” is a position in a nucleic acid sequence that differs in base composition in nucleic acids isolated from different individuals of the same species . a “ solid support ” is a solid material having a surface for attachment of molecules , compounds , cells , or other entities . the surface of a solid support can be flat or not flat . a solid support can be porous or non - porous . a solid support can be a chip or array that comprises a surface , and that may comprise glass , silicon , nylon , polymers , plastics , ceramics , or metals . a solid support can also be a membrane , such as a nylon , nitrocellulose , or polymeric membrane , or a plate or dish and can be comprised of glass , ceramics , metals , or plastics , such as , for example , a 96 - well plate made of , for example , polystyrene , polypropylene , polycarbonate , or polyallomer . a solid support can also be a bead or particle of any shape , and is preferably spherical or nearly spherical , and preferably a bead or particle has a diameter or maximum width of 1 millimeter or less , more preferably of between 0 . 5 to 100 microns . such particles or beads can be comprised of any suitable material , such as glass or ceramics , and / or one or more polymers , such as , for example , nylon , polytetrafluoroethylene , teflon ™, polystyrene , polyacrylamide , sepaharose , agarose , cellulose , cellulose derivatives , or dextran , and / or can comprise metals , particularly paramagnetic metals , such as iron . “ specific binding member ” is one of two different molecules having an area on the surface or in a cavity which specifically binds to and is thereby defined as complementary with a particular spatial and polar organization of the other molecule . a specific binding member can be a member of an immunological pair such as antigen - antibody , biotin - avidin , hormone - hormone receptor , nucleic acid duplexes , igg - protein a , dna - dna , dna - rna , and the like . “ substantially linear ” means that , when graphed , the increase in the product with respect to time conforms to a linear progression , or conforms more nearly to an arithmetic progression than to a geometric progression . the present invention recognizes that currently available technologies for the quantitative analysis of expressed genes are labor - intensive , time - consuming , and difficult to apply . there is a need to provide methods and compositions for obtaining gene expression profiles that can provide rapid , reliable , quantitative information on the expression of many genes in a single analysis . the present invention also recognizes that current methods for the analysis of gene mutations and snps use dna that is amplified by methods such as pcr . such amplification can introduce errors into the sequences being studied . moreover , such methods do not distinguish between genes that are expressed and genes that are not expressed in a cell or organism of interest . the present invention provides improved methods for gene expression analysis and gene mutation and snp detection . the invention provides other benefits as well . as a non - limiting introduction to the breadth of the present invention , the present invention includes several general and useful aspects , including : 1 ) a method for identifying nucleic acid molecules that are expressed in one or more cells , tissues , or subjects ; 2 ) a method for identifying one or more mutations or snps in a population of nucleic acids from one or more cells , tissues , samples , or subjects ; 3 ) a composition including at least one solid support having at least one attached nucleic acid molecule , and a set of nucleic acids that are either at least partially complementary , or at least partially substantially complementary , or at least partially identical , or at least partially substantially identical , to at least one of the attached nucleic acid molecules . these aspects of the invention , as well as others described herein , can be achieved using the methods , articles of manufacture , and compositions of the present invention . to gain a full appreciation of the scope of the present invention , it will be further recognized that various aspects of the present invention can be combined to make desirable embodiments of the invention . i . method of identifying expressed nucleic acid molecules using nucleolytic activities and hybridization the present invention includes a method of identifying at least one expressed nucleic acid molecule , such as a nucleic acid molecule that is expressed in one or more cells . the present invention also includes a method of detecting nucleic acid molecules in a sample , such as a biological sample or environmental sample . the method includes : contacting at least one probe nucleic acid molecule with a survey population of nucleic acid molecules under conditions that promote hybridization between complementary nucleic acid molecules to generate a probe - survey population mixture of nucleic acid molecules , treating the probe - survey population mixture of nucleic acid molecules with a nucleolytic acitivity , such that nucleolytic activity - sensitive nucleic acid molecules are digested , to generate a population of nucleolytic activity - protected nucleic acid molecules ; contacting said population of nucleolytic activity - protected nucleic acid molecules with a solid support comprising one or more attached nucleic acid molecules under conditions that promote hybridization between nucleic acid molecules to generate attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complexes ; and identifying one or more of said attached nucleic acid molecules or one or more of said nucleolytic activity - protected nucleic acid molecules in one or more attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complexes . the following description of preferred embodiments is provided for purposes of illustration , and not by way of limitation . it will be recognized that substitutions and combinations of methods , steps , and components described herein are within the scope of the present invention . the present invention can be directed to expression profiling , in which the genes expressed by a particular organism , cell type , or tissue type can be identified . expression profiling can be directed toward identifying genes expressed by one or more organisms at a particular time , at a particular stage of development , or under particular conditions . expression profiling using the methods of the present invention can be performed quantitatively , such that relative amounts of gene expression can be determined . it is recognized that the present invention can also be used to detect portions of genes , and thus the present invention can detect a region of a gene that is common to different gene transcripts and / or can detect more than one region of a single gene transcript . in these aspects probe nucleic acid molecules of the present invention can be designed such that they are at least partially complementary or at least partially substantially complementary to one or more than one region of a particular gene , and / or to one or more regions of a gene that may be shared among different gene transcripts , such as splice variants (“ isoforms ”) of gene transcripts , gene transcripts originating from different members of a gene family , or variant gene transcripts produced by viruses . the present invention can also be directed to detection of nucleic acids in a sample , such as , but not limited to , the detection of pathogen sequences in biological samples or contaminant sequences in environmental samples . the methods of the present invention can also be used to provide quantitative information of the copy number of a gene in one or more cells , such as a malignant cell . the following descriptions of embodiments depicted in the figures is by way of illustration and not by way of limitation . a preferred embodiment of the present invention is depicted in fig1 a . in this example of expression profiling , the survey population is rna , and a set of dna probes is employed in which the probes are complementary to rna transcripts known to be present or suspected of being present in the survey population . a set of attached nucleic acid molecules is also provided , in which the attached nucleic acid molecules are bound to a solid support in the form of an array , and in which the attached nucleic acid molecules are dna oligonucleotides that are at least partially complementary to the probe nucleic acid molecules . in this embodiment , the set of probe nucleic acid molecules is contacted with the survey nucleic acid molecules under conditions that promote hybridization between complementary nucleic acids , and then the probe - survey population of nucleic acid molecules is contacted with a single - strand specific nuclease , such as mung bean nuclease , such that single - stranded nucleic acid molecules are digested . following nuclease treatment , the nuclease is inactivated , for example by addition of edta . protected probe - survey population of nucleic acid molecules are then treated , for example , with rnase h , to remove the rna strands hybridizing to the dna probe , resulting in a solution of dna probes that quantitatively represent the rna transcripts to which they are complementary . in this embodiment , the single - stranded nucleic acids that are derived from the protected probe - survey population of nucleic acid molecules are probes that are complementary to expressed gene sequences . these protected nucleic acid molecules are hybridized to attached nucleic acid molecules on a dna array . attached and probe nucleic acid molecules are designed such that hybridization between complementary attached and probe nucleic acid molecules leaves single stranded overhangs on one or both ends of the hybridized complex . the number of single - stranded bases in a hybridized complex is standardized among all the possible complexes on the array . after washing to remove unhybridized nucleic acid molecules , the array is treated with a dna polymerase , such as the klenow fragment of e . coli dna polymerase , and labeled nucleotides . the dna polymerase extends an attached nucleic acid molecule using a protected nucleic acid molecule ( in this embodiment , the protected probe nucleic acid molecules ) as a template by incorporating labeled nucleotides . in this embodiment , the probe nucleic acid molecule cannot be extended by the dna polymerase . this can be accomplished , for example , by making the 3 ′ terminal nucleotide of the probe nucleic acid a dideoxynucleotide that does not permit extension . after washing the array , the array is scanned . incorporation of label at a position on the array is indicative of the presence of a transcript in the survey population . the intensity of the signal at a position on the array is proportional to the number of hybridization complexes at that position , which directly reflects the number of transcripts of the gene that the attached nucleic acid molecule at that position corresponds to that are present in the survey population . a variation on this embodiment is depicted in fig1 b , in which the survey population is rna , and a set of dna probes is employed in which the probes are complementary to rna transcripts known to be present or suspected of being present in the survey population . a set of attached nucleic acid molecules is also provided , in which the attached nucleic acid molecules are bound to a solid support in the form of an array , and in which the attached nucleic acid molecules are dna oligonucleotides that are at least partially identical to the probe nucleic acid molecules . in this embodiment , the set of probe nucleic acid molecules is contacted with the survey nucleic acid molecules under conditions that promote hybridization between complementary nucleic acids , and then the probe - survey population of nucleic acid molecules is treated , for example with mung bean nuclease , such that single - stranded nucleic acid molecules are digested . following nuclease treatment , the nuclease is inactivated , for example by addition of edta . protected probe - survey population of nucleic acid molecules are then treated with rnase - free dnase to remove the dna probe nucleic acids hybridizing to the rna survey population , resulting in a solution of protected rna survey population fragments . these single - stranded nucleic acids that are derived from the protected probe - survey population of nucleic acid molecules are hybridized to attached nucleic acid molecules on a dna array . as in the previous example , the number of unpaired bases in the hybridized complexes on the array can be controlled by appropriately standardizing the sizes of the probe and attached nucleic acid molecules . after washing to remove unhybridized nucleic acid molecules , the array is treated with a rna - dependent dna polymerase , such as mmlv reverse transcriptase , and labeled nucleotides . the reverse transcriptase extends the attached nucleic acid molecule using the protected nucleic acid molecule ( in this instance , the survey population rna fragments ) as templates by incorporating labeled nucleotides . after washing the array , the array is scanned . incorporation of label at a position on the array is indicative of the presence of a transcript in the survey population . the intensity of the signal at a position on the array is proportional to the number of hybridization complexes at that position , which directly reflects the number of transcripts of the gene to which the attached nucleic acid molecule at that position corresponds that are present in the survey population . in the embodiment depicted in fig2 , the survey population is rna , and a set of dna probes is employed in which the probes are complementary to rna transcripts known to be present or suspected of being present in the survey population . the dna probe nucleic acid molecules comprise at least one detectable label , such that members of the set of dna probes preferably are labeled to the same specific activity , or will give rise to signals of the same or comparable intensity . a set of attached nucleic acid molecules is also provided , in which the attached nucleic acid molecules are bound to a solid support in the form of an array , and in which the attached nucleic acid molecules are dna oligonucleotides that are at least partially complementary to the probe nucleic acid molecules . in this embodiment , the set of probe nucleic acid molecules is contacted with the survey nucleic acid molecules under conditions that promote hybridization between complementary nucleic acids , and then the probe - survey population of nucleic acid molecules is contacted with a single - strand specific nuclease , such that single - stranded nucleic acid molecules are digested . following nuclease treatment , the nuclease is inactivated . protected probe - survey population of nucleic acid molecules are then treated with an rnase to remove the rna strands hybridizing to the dna probe , resulting in a solution of single - stranded nucleic acids that are derived from the protected probe - survey population of nucleic acid molecules that are in fact a subset of the population of dna probes . members of this subset of dna probes quantitatively and qualitatively represent the rna transcripts to which they are complementary . the protected probe nucleic acid molecules are hybridized to attached nucleic acid molecules on a dna array . after washing to remove unhybridized nucleic acid molecules , the array is scanned . detection of label at a position on the array is indicative of the presence of a transcript in the survey population . the intensity of the signal at a position on the array is proportional to the number of hybridization complexes at that position , which directly reflects the number of transcripts of the gene to which the attached nucleic acid molecule at that position corresponds that are present in the survey population . a variation of this method is depicted in fig3 , in which rna transcript levels from two survey populations are detected on the same array . in this embodiment , the survey populations are rna , for example , a first survey population of rna extracted from normal cells and a second survey population of rna extracted from abnormal cells . these survey populations are hybridized in separate reactions to dna probe nucleic acid molecules . the set of probe nucleic acid molecules hybridized to the first survey population is identical in sequence composition to the set of probe nucleic acid molecules hybridized to the second survey population , but each set of probe nucleic acid molecules includes a different detectable label , such that the detectable label of the probe hybridizing to the first survey population is distinguishable from the detectable label of the probe hybridizing to the second survey population . after nuclease treatment of both probe - survey population nucleic acid mixtures , the protected complexes are rnase treated , and the protected probe nucleic acid molecules from both nuclease treatments are hybridized to the same array . after washing to remove unhybridized nucleic acid molecules , the array is scanned . detection of label corresponding to the set of probes hybridized to the first survey population at a position on the array is indicative of the presence of a transcript in the first survey population , and detection of label corresponding to the set of probes hybridized to the second survey population at a position on the array is indicative of the presence of a transcript in the second survey population . each position on the array can be identified as having no or negligible signal , or signal derived from one or both labels . the intensity of the different signals at a position on the array directly reflects the number of transcripts of the gene to which the attached nucleic acid molecule at that position corresponds that are present in each survey population , making it possible to determine the relative amount of expression of a gene of interest in two populations of rna , where the rna populations can be obtained from two different cell types , the same cell type under two different conditions , the same cell type in two different organisms , etc . in yet another variation of expression profiling , depicted in fig4 , the survey population is rna , and a set of dna probes is employed in which the probes are complementary to rna transcripts known to be present or suspected of being present in the survey population . a set of attached nucleic acid molecules is also provided , in which the attached nucleic acid molecules are bound to a solid support in the form of an array , and in which the attached nucleic acid molecules are dna oligonucleotides that are at least partially complementary to the probe nucleic acid molecules . the probe nucleic acid molecules are partially complementary to the attached nucleic acid molecules , such that a portion of the probe nucleic acid molecule is complementary to the attached nucleic acid molecule , and a portion of the probe nucleic acid molecule is not complementary to the attached nucleic acid molecule . in this embodiment , the set of probe nucleic acid molecules is contacted with the survey nucleic acid molecules under conditions that promote hybridization between complementary nucleic acids , and then the probe - survey population of nucleic acid molecules is contacted with a single - strand specific nuclease , such that single - stranded nucleic acid molecules are digested . following nuclease treatment , the nuclease is inactivated , for example by addition of edta . protected probe - survey population of nucleic acid molecules are then treated , for example with rnase h , to remove the rna strands hybridizing to the dna probe , resulting in a solution of single - stranded nucleic acids that are derived from the protected probe - survey population of nucleic acid molecules and are in fact a subset of the population of dna probes . members of this subset of dna probes quantitatively and qualitatively represent the rna transcripts to which they are complementary . the protected probe nucleic acid molecules are hybridized to attached nucleic acid molecules on a dna array . after washing to remove unhybridized nucleic acid molecules , another set of signal nucleic acid molecules is hybridized to the array . the signal nucleic acid molecules are complementary to portions of the probe nucleic acid molecules that are not complementary to the attached nucleic acid molecules . the signal nucleic acid molecules are labeled with a detectable label , such that each signal nucleic acid molecule gives rise to a signal of the same or comparable intensity . after washing , the array is scanned . detection of one or more labels at a position on the array is indicative of the presence of a transcript in the survey population . the intensity of the signal at a position on the array is proportional to the number of hybridization complexes at that position , which directly reflects the number of transcripts of the gene to which the attached nucleic acid molecule at that position corresponds that are present in the survey population . fig5 illustrates yet another embodiment of the present invention in which the survey population is rna , and a set of dna probes is employed in which the probes are complementary to rna transcripts known to be present or suspected of being present in the survey population . a set of attached nucleic acid molecules is also provided , in which the attached nucleic acid molecules are bound to a solid support in the form of an array , and in which the attached nucleic acid molecules are dna oligonucleotides that are at least partially complementary to the probe nucleic acid molecules . the attached nucleic acid molecules are detectably labeled , such that attached nucleic acids on the same array give rise to detectable signals of the same or comparable intensity . preferably , the attached nucleic acid molecules have one or more nuclease - resistant linkages , such as phosphothioate linkages , in the portion of the attached nucleic acid molecule that is proximal to the array , and have one or more nuclease - sensitive linkages , such as phosphodiester linkages , in the portion of the attached nucleic acid molecule that is not proximal to the array . the detectable label is incorporated into or linked to the portion of the nucleic acid molecule that comprises nuclease - sensitive linkages . the probe nucleic acid molecules are partially complementary to the attached nucleic acid molecules , such that when a probe nucleic acid molecule is hybridized to an attached nucleic acid molecule , the regions of a hybridized attached nucleic acid molecules that are nuclease - sensitive and comprise the detectable label are base - paired with a probe nucleic acid molecule . in this embodiment , the set of probe nucleic acid molecules is contacted with the survey nucleic acid molecules under conditions that promote hybridization between complementary nucleic acids , and then the probe - survey population of nucleic acid molecules is contacted with a nucleolytic activity such as mung bean nuclease , such that single - stranded nucleic acid molecules are digested . following nuclease treatment , the nuclease is inactivated , for example by addition of edta . protected probe - survey population of nucleic acid molecules are then treated , for example with rnase h , to remove the rna strands hybridizing to the dna probe , resulting in a solution of single - stranded nucleic acids that are derived from the protected probe - survey population of nucleic acid molecules and are in fact a subset of the population of dna probes . members of this subset of dna probes quantitatively and qualitatively represent the rna transcripts to which they are complementary . the protected probe nucleic acid molecules are hybridized to attached nucleic acid molecules on a dna array . after washing to remove unhybridized nucleic acid molecules , another nuclease treatment with mung bean nuclease is performed on the chip , such that single - stranded nuclease - sensitive nucleic acid linkages are cleaved . label that has been incorporated into the attached nucleic acid molecule is released from the array unless there is hybridization of the attached nucleic acid molecule to a probe nucleic acid molecule , rendering it resistant to nuclease digestion . after washing , the array is scanned . detection of label at a position on the array is indicative of the presence of a transcript in the survey population . the intensity of the signal at a position on the array is proportional to the number of hybridization complexes at that position , which directly reflects the number of transcripts of the gene to which the attached nucleic acid molecule at that position corresponds that are present in the survey population . the methods and compositions of the present invention can also be directed to the detection of mutations or snps . mutation or snp detection can be directed toward identifying mutations or snps in expressed genes by using rna as the survey population , although that is not a requirement of the present invention . in a preferred embodiment of the present invention , depicted in fig6 a , the survey population is rna , and a set of dna probes is employed in which the probes are complementary to rna transcripts known to be present or suspected of being present in the survey population . a set of attached nucleic acid molecules is also provided , in which the attached nucleic acid molecules are bound to a solid support in the form of an array , and in which the attached nucleic acid molecules are dna oligonucleotides that are partially complementary to the probe nucleic acid molecules . the 3 ′ ends of the attached nucleic acid molecules are unattached , and the 3 ′ termini of attached nucleic acid molecules are known or suspected snp sites . in this embodiment , the probe nucleic acid molecules include dna sequences that include a known or suspected snp , where the known or suspected mutation or snp is not at the terminus of the probe nucleic acid molecules . one region of the probe nucleic acid molecule is at least partially identical or at least partially substantially identical to the attached nucleic acid molecule , and another region of the probe nucleic acid molecule is not identical or substantially identical to the attached nucleic acid molecule . the probe nucleic acid molecules are contacted with the survey nucleic acid molecules under conditions that promote hybridization between complementary nucleic acids , and then the probe - survey population of nucleic acid molecules is contaced , for example with mung bean nuclease , a single - strand specific nuclease , such that single - stranded nucleic acid molecules are digested . following nuclease treatment , the nuclease is inactivated , for example by addition of edta . the protected probe - survey population of nucleic acid molecules are then treated , for example with rnase - free dnase to remove the dna probe sequences hybridizing to the rna , resulting in a solution of rna fragments that encompass known or suspected mutation or snp sites . these protected nucleic acid molecules are hybridized to attached nucleic acid molecules on a dna array . attached and probe nucleic acid molecules are designed such that hybridization between complementary attached and protected nucleic acid molecules leaves single stranded overhangs of protected rna molecules on the hybridized complex . the single - stranded region of the overhanging rna strand of the hybridized complex begins at the mutation or snp site , that may or may not be complementary between the protected rna fragment and the attached nucleic acid molecule , depending on the sequence of the rna at the mutation or snp site . the array is treated with a polymerase , such as the mmlv reverse transcriptase , and labeled nucleotides . the polymerase extends the attached nucleic acid molecule using the protected nucleic acid molecule ( in this instance , the protected rna survey population nucleic acid molecule ) as a template only if there is complementarity between the protected rna fragment and the attached nucleic acid molecule at the mutation or snp site . after washing the array , the array is scanned . incorporation of label at a position on the array is indicative of precise complementarity between the attached nucleic acid molecule and the protected rna molecule at the snp site , and thus identifies the sequence at an snp site in an expressed gene . in fig6 b , the method of snp or mutation detection is not restricted to expressed genes . the survey population is dna , and a set of dna probes is employed in which the probes are complementary to dna sequences known to be present or suspected of being present in the survey population in some aspects of this embodiment , the probe nucleic acid molecules can optionally be labeled with a specific binding member such as biotin , that can be used for capture of nucleolytic activity - protected probe - survey nucleic acid complexes . a set of attached nucleic acid molecules is also provided , in which the attached nucleic acid molecules are bound to a solid support in the form of an array , and in which the attached nucleic acid molecules are dna oligonucleotides that are partially identical to the probe nucleic acid molecules . the 3 ′ ends of the attached nucleic acid molecules are unattached , and the 3 ′ termini of the attached nucleic acid molecules are known or suspected snp sites . in this embodiment , the probe nucleic acid molecules include dna sequences that include known or suspected mutation or snp sites , where the known or suspected mutation or snp site is not at the termini of the probe nucleic acid molecules . one region of the probe nucleic acid molecule is identical or substantially identical to the attached nucleic acid molecule , and another region of the probe nucleic acid molecule is not identical or substantially identical to the attached nucleic acid molecule . the probe nucleic acid molecules are contacted with the survey nucleic acid molecules under conditions that promote hybridization between complementary nucleic acids , and then the probe - survey population of nucleic acid molecules is contacted with a nucleolytic activity such as mung bean nuclease , a single - stand specific nuclease , such that single - stranded nucleic acid molecules are digested . following nucleolytic activity treatment , the nucleolytic activity is inactivated , for example by addition of edta . the protected probe - survey population of nucleic acid molecules can optionally be treated to render the protected survey population nucleic acid molecules single - stranded . the protected survey population nucleic acid molecules can also be substantially purified from the protected probe nucleic acid molecules . this can prevent the protected probe nucleic acid molecules from competing with attached nucleic acid molecules for hybridization to the protected survey population molecules during the hybridization step . in aspects where the probe comprises a biotin moiety , the nucleolytic activity - protected complexes can be collected by capture , for example with streptavidin - coated beads that bind the biotinylated probe nucleic acid molecules of the protected complexes . protected survey nucleic acid molecule fragments can be stripped off the beads using conditions that denature double - stranded dna ( e . g ., basic ph ), leaving the probe nucleic acid molecules attached to the beads . the eluted protected survey nucleic acid molecules are collected and optionally concentrated , for example , by precipitation with ethanol for hybridization to attached nucleic acid molecules on a dna array . attached and probe nucleic acid molecules are designed such that hybridization between complementary attached and protected nucleic acid molecules leaves single stranded overhangs of protected survey population nucleic acid molecules on the hybridized complex . the single - stranded region of the overhanging protected nucleic acid molecule strand of the hybridized complex begins at the mutation or snp site , that may or may not be complementary between the protected nucleic acid molecule and the attached nucleic acid molecule , depending on the sequence of the survey population dna at the mutation or snp site . the array is treated with a dna polymerase , such as the klenow fragment , and labeled nucleotides . the polymerase extends the attached nucleic acid molecule using the protected nucleic acid molecule ( in this embodiment , the protected survey population nucleic acid molecule ) as a template only if there is complementarity between the protected survey population fragment and the attached nucleic acid molecule at the mutation or snp site . extension of the protected nucleic acid molecule using the attached nucleic acid molecule as a primer , which can lead to false positives , can be prevented by designing the entire attached nucleic acid molecule ( with the exception of the snp site ) to be complementary to a portion of the protected survey population nucleic acid molecule . after washing the array , the array is scanned . incorporation of label at a position on the array is indicative of precise complementarity between the attached nucleic acid molecule and the protected dna molecule of the survey population at the snp site , and thus identifies the sequence at a mutation or snp site in a gene . in the embodiment depicted in fig7 a and 7b , the survey population is rna from normal cells ( fig7 a ) or abnormal cells ( fig7 b ). the set of probe nucleic acid molecules terminate at a known or suspected mutation or snp site , and the nucleotide at the known or suspected mutation or snp site is labeled . from one to four different probes can be used for each mutation or snp to be detected , such that each different probe terminates in a different labeled nucleotide , and each different labeled nucleotide is labeled with a distinct detectable label . for example , g can be labeled with cy3 , a can be labeled with cy5 , etc . in this embodiment , the probes are at least partially complementary or at least partially substantially complementary to the attached nucleic acid molecules that are bound to the array , and are at least partially complementary or at least partially substantially complementary to at least one nucleic acid molecule of the survey population . the probe nucleic acid molecules are contacted with the survey nucleic acid molecules under conditions that promote hybridization between complementary nucleic acids , and then the probe - survey population of nucleic acid molecules is contacted with , for example , mung bean nuclease , a single - strand specific nuclease , such that single - stranded nucleic acid molecules are digested . because the probes terminate in known or suspected mutation or snp sites , their labeled termini may or may not be complementary to sequences in the survey population of nucleic acid molecules , and may or may not be digested by a single - stranded nuclease . if a probe sequence at a known or suspected mutation or snp site is not complementary to a sequence in the survey population , the labeled snp nucleotide will be cleaved off of the probe nucleic acid molecule . if a probe sequence at a known or suspected mutation or snp site is complementary to a sequence in the survey population , the labeled snp nucleotide will remain on a probe nucleic acid molecule . following nuclease treatment , the nuclease is inactivated , for example by addition of edta . the protected survey population nucleic acid molecules are removed , for example by digestion with rnase , and the probe nucleic acid molecules are hybridized to the array . a positive signal on the array is indicative of a particular nucleotide at the site of the known or suspected snp or mutation in a nucleic acid of the survey population . combining or modifying elements of the forgoing embodiments are within the scope of the invention . as one example , the snp detection method of fig7 can be modified to include dna as the survey population , where the probe comprises , in addition to an end label , a biotin label , and the biotin label can be used to capture protected complexes on avidin - coated beads . in this variation , survey population fragments are stripped off of the captured fragments to leave protected probe fragments attached to avidin - coated beads . the protected probe fragments are then stripped off of the beads for hybridization to the array . the embodiment depicted in fig8 includes a dna survey population of nucleic acid molecules and a set of dna probes that are complementary or substantially complementary to sequences in the survey population of nucleic acid molecules that comprise known or suspected mutation or snp sites . the probe nucleic acid molecules are partially identical or partially substantially identical to attached nucleic acid molecules that are attached to an array , and can include specific binding members such as biotin moieties . the attached nucleic acid molecules comprise dna and include a known or suspected mutation or snp site occurring at least one terminus that is not attached to the array . the probe nucleic acid molecules are contacted with the survey nucleic acid molecules under conditions that promote hybridization between complementary nucleic acids , and then the probe - survey population of nucleic acid molecules is contacted with a nucleolytic activity such as mung bean nuclease , a single - strand specific nuclease , such that single - stranded nucleic acid molecules are digested . following nuclease treatment , the nuclease is inactivated , for example by addition of edta . the protected probe - survey population of nucleic acid molecules can then be collected by capture with streptavidin - coated beads that can bind biotinylated probe nucleic acid molecules of the protected complexes . protected survey nucleic acid molecule fragments are stripped off the beads , using conditions that denature double - stranded dna ( e . g ., basic ph ), leaving the probe nucleic acid molecules attached to the beads . the protected survey nucleic acid molecules can be collected and are hybridized to attached nucleic acid molecules on a dna array . attached and probe nucleic acid molecules are designed such that hybridization between complementary attached and protected survey population nucleic acid molecules leaves single - stranded overhangs of protected survey population dna molecules on the hybridized complex . the single - stranded region of the overhanging protected nucleic acid molecule strand of the hybridized complex begins at or adjacent to the mutation or snp site , that may or may not be complementary between the protected nucleic acid molecule and the attached nucleic acid molecule , depending on the sequence of the dna at the mutation or snp site . alternatively , the probe does not comprise a specific binding member such as biotin , and after nuclease treatment and inactivation of the nuclease , protected survey nucleic acid molecules can be amplified . preferably , amplification reactions amplify only the survey nucleic acid molecule and not the probe nucleic acid . this can be accomplished , for example , by including in the amplification reactions one or more primers that are complementary or substantially complementary to at least a portion of the survey population nucleic acid molecules , and by not including in the amplification reactions primers that are complementary or substantially complementary to at least a portion of one or more probe nucleic acid molecules . after washing to remove unhybridized nucleic acid molecules , a set of signal nucleic acid molecules is hybridized to the array . the signal nucleic acid molecules are identical to portions of the probe nucleic acid molecules that are not identical to the attached nucleic acid molecules . in other words , signal nucleic acid molecules are designed to be at least partially complementary or at least partially substantially complementary to a portion of a survey nucleic acid molecule that can be protected by a probe nucleic acid molecule . protected survey population molecules are in one region complementary or substantially complementary to attached nucleic acid molecules , and in another region complementary or substantially complementary to signal nucleic acid molecule . the signal nucleic acid molecules are ligated to the attached nucleic acid molecules . a ligation is successful only if an attached nucleic acid molecule and a protected survey population nucleic acid molecule are complementary at a known or suspected snp or mutation site . signal nucleic acid molecules are labeled with a detectable label , such that each signal nucleic acid molecule gives rise to a signal of the same or comparable intensity . after washing under conditions that denature double - stranded dna , the array is scanned . detection of label at a position on the array is indicative of ligation of the signal molecule to the attached molecule at that position , which only occurs if there is exact complementarity between attached and protected survey population nucleic acid molecules . in other embodiments of the invention , the methods of the present invention may be directed toward detecting the presence of a particular organism in a sample . for example , a sample , such as a biological sample , such as a blood sample , or an environmental sample , such as a food or water sample , may be tested for the presence of a bacteria , virus , or other microorganism using the methods of the present invention . a probe nucleic acid molecule can be rna , dna , or partially comprised of rna and partially comprised of dna . it is also within the scope of the present invention to have probe nucleic acid molecules comprising nucleic acids in which the backbone sugar is other than ribose or deoxyribose ; for example , certain hexoses may be substituted . probe nucleic acids can also be peptide nucleic acids . probe nucleic acid molecules of the present invention can have nucleoside linkages other than the phosphodiester linkages found in naturally occurring nucleic acids . for example , two or more of their nucleoside subunits can be connected by phosphorus linkages including phosphodiester , phosphorothiate , 3 ′-( or - 5 ′) deoxy - 3 ′-( or 5 ′) thio phosphorothioate , phosphorodithioate , phophoroselenates , 3 ′-( or - 5 ) deoxy phophinates , borano phosphates , 3 ′-( or - 5 ′) deoxy - 3 ′-( or - 5 ′-) amino phosphoramidates , hydrogen phosphonates , methylphosphonates , borano phosphate esters , phosphoramidates , alkyl or aryl phosphonates and phosphotriester phosphorus linkages . alternatively or in addition , probe nucleic acids of the present invention can have two or more of their nucleoside subunits connected by carbonate , carbamate , silyl , sulfur , sulfonate , sulfonamide , formacetal , thiofromacetal , methylenedimethylhydrazo or methylimino linkages . a probe nucleic acid molecule can comprise natural or non - naturally occurring nucleobases , for example , adenine , guanine , cytosine , uridine and thymine , as well as inosine , xanthine , hypoxanthine , 2 - aminoadenine , 6 - methyl and other alkyl derivatives of adenine and gaunine , 2 - propyl and other alkyl derivatives of adenine and guanine , 5 - halo uracil and cytosine , 5 - propynyl uracil and cytosine , 6azo uracil , cytosine , and thymine , 5 - uracil ( pseudouracil , 4 - thiouracil , 8 - halo , amino , thiol , thioalkyl , hydroxyl , and other 8 - substituted adenines and guanines , 5 - trifluoromethyl and other 5 - substituted uracils and cytosines , 7 - methylguanine . further purines and purimidines include those disclosed in u . s . pat . no . 3 , 687 , 808 and disclosed in the concise encyclopedia of polymer science and engineering ( 1990 ) kroschwitz , j . i . ed ., john wiley and sons , pages 858 - 859 , and those disclosed by englisch et al . ( 1991 ) angewandte chemie , international edition , 30 : 613 . probe nucleic acid molecules of the present invention can be of any length , but preferably are between 5 and 500 nucleoside subunits in length , more preferably between 10 and 250 nucleoside subunits in length , and most preferably between 20 and 100 nucleoside subunits in length . at least one of the probe nucleic acid molecules of the present invention is preferably at least partially complementary , or at least partially substantially complementary , to one or more nucleic acid molecules that are known to be present or are suspected of being present in a survey population of nucleic acids . probe nucleic acid molecules of the present invention are preferably at least partially single - stranded . preferably , at least a portion of a probe nucleic acid molecule that is complementary to a nucleic acid molecule that is known to be or suspected of being present in the survey population is provided in the single - stranded state . double - stranded nucleic acid molecules may be converted to the single - stranded or partially single - stranded state for use as probes , for example by denaturation of double - stranded molecules , or by treatment of the double - stranded nucleic acid molecules with nucleases or polymerases . preferably , at least one of the nucleoside linkages in a probe nucleic acid molecule is sensitive to cleavage by a nucleolytic agent when the probe nucleic acid molecule or portion thereof is in the single stranded state , but is not sensitive to cleavage by a nucleolytic agent when the probe nucleic acid molecule is in the double stranded state , such as when hybridized to a nucleic acid molecule that is at least partially complementary or at least partially substantially complementary . probe nucleic acid molecules of the present invention can be at least partially complementary or at least partially substantially complementary to an attached nucleic acid molecule of the present invention . in some preferred embodiments of the present invention , such as those depicted in fig1 a , 2 , 3 , 4 , 5 , 7 a , and 7 b , one or more probe nucleic acid molecules can be at least partially complementary or partially substantially complementary to a nucleic acid molecule known to be present or suspected of being present in the survey population , and can also be at least partially complementary or partially substantially complementary to one or more attached nucleic acid molecules . in these embodiments , at least a portion of a probe nucleic acid molecule that is complementary or substantially complementary to a nucleic acid molecule known to be present or suspected of being present in the survey population is also complementary or substantially complementary to an attached nucleic acid molecule of the present invention . in other embodiments of the present invention , such as those depicted in fig1 b , 6 a , and 6 b , one or more probe nucleic acid molecules can be at least partially complementary or partially substantially complementary to a nucleic acid molecule known to be present or suspected of being present in the survey population , and can also be at least partially identical or partially substantially identical , to one or more attached nucleic acid molecules of the present invention . in these embodiments , preferably at least a portion of a nucleic acid molecule that is complementary or substantially complementary to a nucleic acid molecule known to be present or suspected of being present in the survey population is also at least partially identical or substantially identical to an attached nucleic acid molecule of the present invention . in some preferred embodiments of the present invention directed to mutation or snp detection , such as that depicted in fig6 a , one or more probe nucleic acid molecules can be partially identical or partially substantially identical to one or more attached nucleic acid molecules , and at least partially complementary or partially substantially complementary to a nucleic acid molecule known to be present or suspected of being present in the survey population . in this embodiment , at least a portion of the probe nucleic acid molecule that is complementary or substantially complementary to a nucleic acid molecule known to be present or suspected of being present in the survey population is also identical or substantially identical to an attached nucleic acid molecule of the present invention , and at least a portion of the probe nucleic acid molecule that is complementary or substantially complementary to a nucleic acid molecule know to be present or suspected of being present in the survey population is not identical or substantially identical to an attached nucleic acid molecule of the present invention . preferably , the portions of the probe nucleic acid molecule that are identical or substantially identical to an attached nucleic acid molecule and that are not identical or substantially identical to an attached nucleic acid molecule are adjacent . preferably , the border between the identical and non - identical portions is a known or suspected mutation or snp . in other embodiments of the present invention directed to mutation and snp detection , such as that depicted in fig6 b , a portion of a probe nucleic acid molecule of the present invention can be identical , or substantially identical , to one or more attached nucleic acid molecules of the present invention . one or more probe nucleic acid molecules can be at least partially complementary , or at least partially substantially complementary , to at least one nucleic acid molecule known to be or suspected of being in the survey population , and can be at least partially identical , or at least partially substantially identical , to one or more attached nucleic acid molecules of the present invention . in this embodiment , at least a portion of the probe nucleic acid molecule that is complementary or substantially complementary to a nucleic acid molecule known to be present or suspected of being present in the survey population is also identical or substantially identical with the attached nucleic acid molecule of the present invention . in this embodiment , the probe nucleic acid molecule optionally comprises a specific binding member , such as biotin , that can be used for capture of nucleolytic acitivity - protected probe - survey nucleic acid complexes . such capture can be on a column , for example a column comprising a matrix comprising avidin . alternatively , capture can be accomplished using magnetic beads , for example , magnetic beads coated with avidin or streptavidin . nucleolytic activity - protected survey population nucleic acid molecules can be stripped off of captured protected complexes , for example with low salt buffers , for hybridization to an array . probes comprising a binding member such as , but not limited to , biotin , or comprising a nucleic acid sequence that comprises nucleolytic activity - resistant linkages that can be used for sequence specific capture of the probe , can be useful in other embodiments of the invention as well ( for example , the embodiment depicted in fig8 ) where it is desirable to capture the probe and / or nucleolytic activity - protected complexes . probe nucleic acid molecules can be made by synthetic methods as they are known or developed in the art , such as solid phase synthesis ( see , for example , oligonucleotide synthesis , a practical approach ( 1984 ) ed . m . j . gait , irl press ; “ oligonucleotides and analogs , a practical approach ( 1991 ) ed ., f . eckstein , irl press ; martin ( 1995 ) helv . chim . acta , 78 : 486 - 504 ; beaucage and iyer ( 1992 ) tetrahedron 48 : 2223 - 2311 ; and beaucage and iyer ( 1993 ) tetrahedron 49 : 6123 - 6194 ). alternatively , probe nucleic acids can be made by reverse transcription of rna using reverse transcriptases such as , but not limited to , molony - murine leukemia virus mmlv reverse transcriptase or avian reverse transcriptase , or derivatives thereof , or by synthesis of rna from dna templates using polymerases such as t7 rna polymerase , t3 rna polymerase , sp6 rna polymerase , or other rna polymerases as they are known or developed in the art , or probe nucleic acids can be made by synthesis of dna from dna templates using dna polymerases , such as but not limited to , dna polymerase i , klenow fragment , taq dna polymerase , t7 dna polymerase , or t4 dna polymerase . the dna template used for synthesizing dna or rna probe nucleic acid molecules can be in the context of a construct , such as a plasmid construct , or can be naturally - occurring dna isolated from an organism . probe nucleic acid molecules can also be obtained by fragmentation of naturally occurring dna or rna , for example , by isolating dna from an organism and shearing it or digesting it with restriction enzymes or nucleases . dna or rna isolated from an organism or sample either for direct use as probe nucleic acid molecules or for use as a template to synthesize probe nucleic acid molecules can be highly purified or only partially purified . all or only a portion of the dna or rna isolated from the organism can be used as probe nucleic acid molecules , or used as a template for the synthesis of probe nucleic acid molecules . a probe nucleic acid molecule can optionally include a detectable label . preferred labels include fluorochromes , such as cy - 3 and cy - 5 , fluorescein , rhodamine , 7 - amino - 4 - methylcoumarin , dansyl chloride , hoescht 33258 , r - phycoerythrin , quantum red ( tm ), texas red , green fluorescent protein ( gfp ) or other fluorescent labels as they are known or developed in the art . alternatively , probe nucleic acid molecules of the present invention can be labeled with a radioisotope , such as 33 p , 35 s , 3 h , 32 p , 125 i , or 131 i . other detectable labels that can be incorporated into a probe of the present invention include specific binding members that can be detected by other molecules that can generate a detectable signal , such as biotin . enzymes that generate detectable signals in the presence of a suitable substrate , such as , but not limited to , alkaline phosphatase , luciferase , horeseradish peroxidase , and urease can also be used as labels . labels can optionally include mass - modified bases , that aid in distinguishing nucleic acid molecules by mass spectrometry . such labels can be attached to or incorporated into nucleotides that are incorporated into the probe nucleic acid molecules during synthesis . labels can also be attached to oligonucleotides after synthesis . methods of labeling oligonucleotides are well - known in the art . see , for example , sinha and strepeke , “ oligonucleotides with reporter groups attached to the 5 ′ terminus ” in oligonucleotides and analogues : a practical approach , eckstein , ed , irl oxford , 1991 ; sinha and cook , nucleic acids res . 1988 16 : 2659 ; haugland , molecular probes handbook of fluorescent probes and research chemicals , molecular probes , inc ., eugene , oreg . ( 1992 ) 20 ; thiesen , et al ., tertrahedron letters ( 1992 ) 33 : 3036 ; rosenthal and jones , nucleic acids res . ( 1990 ) 18 : 3095 ; smith et al ., nucleic acids res . ( 1985 ) 13 : 2399 . the survey population of nucleic acid molecules can be comprised of rna , of dna , or of a combination of dna and rna . the dna or rna can be isolated from at least one cell , at least one tissue , at least one biological sample , at least one organism , or at least one environmental sample . a cell can be a prokaryotic or eukaryotic cell , and can be a cell isolated from an organism or a cell grown in vitro . a tissue can be an organ or cell type , including skin , hair , and blood . a biological sample can be a blood sample , a semen sample , sputum sample , a urine sample , a fecal sample , a saliva sample , a biopsy sample , an autopsy sample , or a sample from a culture or collection of organisms . environmental samples include soil and water samples , as well as food and beverage samples , and samples and extracts from materials such as fabric , utensils , and fossilized materials . nucleic acids can be isolated from biological or environmental samples using methods known in the art and will depend upon the source of the material comprising the survey population of nucleic acid molecules . an attached nucleic acid molecule is a nucleic acid molecule that is bound to a solid support . preferably the attached nucleic acid molecule is irreversibly covalently bound to the solid support , although this is not a requirement of the present invention . an attached nucleic acid molecule can be rna , dna , or partially comprised of rna and partially comprised of dna . it is also within the scope of the present invention to have attached nucleic acid molecules comprising nucleic acids in which the backbone sugar is other than ribose or deoxyribose ; for example , certain hexoses may be substituted . attached nucleic acids can also be peptide nucleic acids . attached nucleic acid molecules of the present invention can have two or more of their nucleoside subunits connected by phosphorus linkages including phosphodiester , phosphorothioate , 3 ′-( or - 5 ′) deoxy - 3 ′-( or 5 ′) thio phosphorothioate , phosphorodithioate , phophoroselenates , 3 ′-( or - 5 ′) deoxy phophinates , borano phosphates , 3 ′-( or - 5 ′) deoxy - 3 ′-( or - 5 ′-) amino phosphoramidates , hydrogen phosphonates , borano phosphate esters , phosphoramidates , alkyl or aryl phosphonates and phosphotriester phosphorus linkages . alternatively or in addition , attached nucleic acids of the present invention can have two or more of their nucleoside subunits connected by carbonate , carbamate , silyl , sulfur , sulfonate , sulfonamide , formacetal , thiofromacetal , methylenedimethylhydrazo or methyleneoxymethylimino linkages . attached nucleic acid molecules of the present invention can comprise at least one nucleolytic activity - resistant linkage , such as , but not limited to , one or more phosphorothioate , methyl phosphonate , or borano - phosphate linkages . an attached nucleic acid molecule can comprise natural or non - naturally occurring nucleobases , for example , adenine , guanine , cytosine , uridine and thymine , as well as inosine , xanthine , hypoxanthine , 2 - aminoadenine , 6 - methyl and other alkyl derivatives of adenine and gaunine , 2 - propyl and other alkyl derivatives of adenine and guanine , 5 - halo uracil and cytosine , 5 ′- propynyl uracil and cytosine , 6 - azo uracil , cytosine , and thymine , 5 - uracil ( pseudouracil , 4 - thiouracil , 8 - halo , amino , thiol , thioalkyl , hydroxyl , and other 8 - substituted adenines and guanines , 5 - trifluoromethyl and other 5 - substituted uracils and cytosines , 7 - methylguanine . further purines and pyrimidines include those disclosed in u . s . pat . no . 3 , 687 , 808 and disclosed in the concise encyclopedia of polymer science and engineering ( 1990 ) kroschwitz , j . i . ed ., john wiley and sons , pages 858 - 859 , and those disclosed by englisch et al . ( 1991 ) angewandte chemie , international edition , 30 : 613 . attached nucleic acid molecules of the present invention can be of any length , but preferably are between 5 and 500 nucleoside subunits in length , more preferably between 10 and 250 nucleoside subunits in length , and most preferably between 20 and 100 nucleoside subunits in length . attached nucleic acid molecules of the present invention are preferably at least partially single - stranded . one or more attached nucleic acid molecules of the present invention is preferably at least partially complementary , or at least partially substantially complementary , or at least partially identical , or at least partially substantially identical to at least one probe nucleic acid molecule of the present invention . attached nucleic acid molecules can be made by synthetic methods as they are known or developed in the art , such as solid phase synthesis (“ oligonucleotide synthesis , a practical approach ” ( 1984 ) ed . m . j . gait , irl press ; “ oligonucleotides and analogs , a practical approach ( 1991 ) ed ., f . eckstein , irl press ; martin ( 1995 ) helv . chim . acta , 78 : 486 - 504 ; beaucage and iyer ( 1992 ) tetrahedron 48 : 2223 - 2311 ; and beaucage and iyer ( 1993 ) 49 : 6123 - 6194 ). alternatively , attached nucleic acid can be made by reverse transcription of rna using reverse transcriptases such as , but not limited to , molony - murine leukemia virus reverse transcriptase or avian reverse transcriptase , or derivatives thereof , or by synthesis of rna from dna templates using polymerases such as t7 rna polymerase , t3 rna polymerase , sp6 rna polymerase , or other rna polymerases as they are known or developed in the art , or probe nucleic acids can be made by synthesis of dna from dna templates using dna polymerases , such as but not limited to , dna polymerase i , klenow fragment , taq dna polymerase , t7 dna polymerase , or t4 dna polymerase . a dna template used for synthesizing dna or rna attached nucleic acid molecules can be in the context of a construct , such as a plasmid construct , or can be naturally - occurring dna isolated from an organism . attached nucleic acid molecules can also be obtained by fragmentation of naturally occurring dna or rna , for example , by isolating dna from an organism and shearing it or digesting it with restriction enzymes or nucleases . all or only a portion of the dna or rna isolated from the organism can be used as attached nucleic acid molecules , or used as a template for the synthesis of attached nucleic acid molecules . an attached nucleic acid molecule can optionally include a detectable label . preferred labels include fluorochromes , such as cy - 3 and cy - 5 , fluorescein , rhodamine , 7 - amino - 4 - methylcoumarin , dansyl chloride , hoescht 33258 , r - phycoerythrin , phycocyanin , allophycocyanin , quantum red ( tm ), texas red , green fluorescent protein ( gfp ) or other fluorescent labels as they are known or developed in the art . alternatively , attached nucleic acid molecules of the present invention can be labeled with a radioisotope , such as 33 p , 35 s , 3 h , 32 p , 125 i , or 131 i . other detectable labels that can be incorporated into an attached nucleic acid of the present invention include specific binding members that can be detected by other molecules that can generate a detectable signal , such as biotin . enzymes that generate detectable signals in the presence of a suitable substrate , such as , but not limited to , alkaline phosphatase , luciferase , horeseradish peroxidase , and urease can also be used as labels . labels can optionally include mass - modified bases , that aid in distinguishing nucleic acid molecules by mass spectrometry . such labels can be attached to or incorporated into nucleotides that are incorporated into attached nucleic acid molecules during synthesis . labels can also be attached to oligonucleotides after synthesis . methods of labeling oligonucleotides are well - known in the at see , for example , sinha and striepeke , “ oligonucleotides with reporter groups attached to the 5 ′ terminus ” in oligonucleotides and analogues : a practical approach , eckstein , ed , irl oxford , 1991 ; sinha and cook , nucleic acids res . 1988 16 : 2659 ; haugland , molecular probes handbook of fluorescent probes and research chemicals , molecular probes , inc ., eugene , oreg . ( 1992 ) 20 ; thiesen , et al ., tertrahedron letters ( 1992 ) 33 : 3036 ; rosenthal and jones , nucleic acids res . ( 1990 ) 18 : 3095 ; smith et al ., nucleic acids res . ( 1985 ) 13 : 2399 . nucleic acid molecules can be attached to solid supports simply by spotting the nucleic acids in solution onto a nylon , nitrocellulose , polycarbonate , polystyrene , or other plastic solid support . a solid support or one or more components thereof , including precursor materials of solid supports , may also be immersed in a solution of one or more nucleic acid molecules to allow the nucleic acid molecules to absorb into or onto the material . the solid support is then dried and optionally heated to fix the nucleic acids to the solid support . arrays having surfaces with covalently bound amine groups are commercially available ( nunc , naperville , ill . ), and nucleic acid molecules can be coupled to these arrays using carbodiimides such as 1 - ethyl - 3 -( 3 - dimethylaminopropyl )- carbodiimide as condensing reagents . preferably , attached nucleic acid molecules of the present invention are bound to the solid support such that their 3 ′ termini are unbound . in this aspect , nucleic acid molecules may be attached to a solid support via their 5 ′ termini , or may be attached to the solid support via a linker arm . covalent attachment of nucleic acid molecules of the present invention to solid supports may be accomplished by a reaction between a reactive site or a binding moiety on the solid support and a reactive site or another binding moiety attached to the nucleic acid molecules , or can be done via linkers or spacer molecules , where the two binding moieties can react to form a covalent bond . a variety of covalent attachment functional groups may be used to attach a nucleic acid molecules to a solid support , including disulfide , carbamate , hydrazone , ester , n - functionalized thiourea , functionalized maleimide , streptavidin or avidin / biotin , mercuric - sulfide , gold - sulfide , amide , thiolester , azo , ether , and amino . for example , binding of a nucleic acid molecule to a solid support can be carried out by reacting a free amino group of an amino - modified nucleic acid molecule with the reactive imidazote carbamate of the solid support . arrays can also be made by synthesizing nucleic acids on the solid supports , as described in u . s . pat . nos . 5 , 359 , 115 , 5 , 420 , 328 , 5 , 424 , 186 , and 5 , 143 , 854 . a solid support of the present invention is a solid material having a surface for attachment of molecules , compounds , cells , or other entities . a solid support can be a membrane , such as , for example , a nylon or nitrocellulose membrane , or can be a plate or dish and can be comprised of glass , ceramics , metals , or plastics , such as , for example , a 96 - well plate made of , for example , polystyrene , polypropylene , polycarbonate , or polyallomer . a solid support can also be a particle or bead that can comprise glass , can comprise one or more plastics or polymers , such as , for example , polystyrene , polyacrylamide , sepaharose , agarose , cellulose or dextran , and / or can comprise metals , particularly paramagnetic metals , such as iron . one preferred solid support of the present invention is a chip or array that comprises a flat surface , and that may comprise glass , silicon , nylon , polymers , plastics , ceramics , or metals . nucleic acid molecules are attached to the surface , such that the attached nucleic acid molecules are preferably at least partially identical to or are at least partially complementary to identified or unidentified genes ( such as expressed sequence tags ( ests )) and are arranged on the array at known locations so that positive hybridization events may be correlated to expression of a particular gene in the physiological source from which the target nucleic acid sample is derived . a number of different array configurations and methods for their production are known to those of skill in the art and disclosed in u . s . pat . nos . : 5 , 445 , 934 ; 5 , 532 , 128 ; 5 , 556 , 752 ; 5 , 242 , 974 ; 5 , 384 , 261 ; 5 , 405 , 783 ; 5 , 412 , 087 ; 5 , 424 , 186 ; 5 , 429 , 807 ; 5 , 436 , 327 ; 5 , 472 , 672 ; 5 , 527 , 681 ; 5 , 529 , 756 ; 5 , 545 , 531 ; 5 , 554 , 501 ; 5 , 561 , 071 ; 5 , 571 , 639 ; 5 , 593 , 839 ; 5 , 599 , 695 ; 5 , 624 , 711 ; 5 , 658 , 734 ; and 5 , 700 , 637 ; the disclosures of which are herein incorporated by reference . another preferred solid support of the present invention is a particle that comprises a spherical or nonflat surface , and that may comprise glass , polymers ( such as , but not limited to , polyacrylamide , agaroses , dextrans , cellulose , or plastics ), ceramics , or metals . nucleic acid molecules can be attached to the particles , which may or may not be porous . such particles can be used , for example , to capture nucleic acid molecules of the survey population or probe nucleic acid molecules by hybridization . the method of the present invention includes hybridization of one or more probe nucleic acid molecules of the present invention with a survey population of nucleic acid molecules . if the survey population of nucleic acid molecules comprises double - stranded dna , or if the nucleic acid molecules of the survey population comprise double - stranded regions , prior to the hybridization step the nucleic acid molecules of the survey population are preferably converted to the single - stranded state to promote hybridization with the nucleic acid probe . the hybridization reaction can be done with both probe nucleic acid molecules and survey nucleic acid molecules in solution , under conditions that promote hybridization between molecules that are complementary , partially complementary , substantially complementary , or partially substantially complementary . hybridization conditions such as the temperature of hybridization , salt concentrations , and the concentration of denaturing compounds such as formamide , can be adjusted to promote the hybridization of molecules of different degrees of complementarity . a discussion of hybridization conditions can be found in ausubel et al . ( 1998 ) short protocols in molecular biology , john wiley & amp ; sons , new york , 1992 . hybridization conditions are also described in sambrook et al ., dna cloning , a laboratory manual , cold spring harbor , 1989 . hybridization conditions are also described in hybridization with nucleic acid probes , part i and part ii , elsevier , new york and in “ molecular biology protocols ” web - site : listeria . nwfsc . noaa . gov / protocols . html . contacting one or more probe nucleic acid molecules of the present invention with a survey population of nucleic acid molecules under conditions that promote hybridization between nucleic acid molecules that are at least partially complementary or substantially complementary results in a probe - survey population mixture of nucleic acid molecules . the probe - survey population mixture of nucleic acid molecules can include single - stranded nucleic acid molecules , double - stranded nucleic acid molecules , and / or nucleic acid molecules that are partially single - stranded and partially double - stranded . the probe nucleic acid molecule - survey population nucleic acid molecule mixture of the present invention can be treated with one or more nucleolytic activities . nucleolytic activities of the present invention can be chemical cleavage agents , such as osmium tetroxide , hydrogen peroxide , hydroxylamine , and permanganate , or can be enzymes such as nucleases . preferred nucleases include single - strand specific nucleases , such as s1 nuclease , mung bean nuclease , rnase t1 , rnase a , or rnase h . for use in screening a survey population comprising rna , nuclease protection conditions are described in ausubel et al ., short protocols in molecular biology , john wiley & amp ; sons , new york , 1992 , units 4 . 6 - 4 . 7 , page 4 - 14 to page 4 - 20 . additional practical guidance on nuclease protection can be found , for example , in 2000 catalog , ambion , inc ., austin , tex . ; walmsely and patient , “ quantitative and qualitative analysis of exogenous gene expression by s1 nuclease protection assay ,” mol . biotechnol . 1 : 265 - 275 , 1994 ; lau et al ., “ critical assessment of the rnase protection assay as a means of determining exon sizes ,” anal . biochem . 209 : 360 - 366 , 1993 ; haines and gillispie , “ rna abundance measured by a lysate rnase protection assay ,” biotechniques 12 : 736 - 741 , 1992 ; and strauss and jacobowitz , “ quantitative measurement of calretinin and beta - actin mrna ,” brain res . mol . brain res . 20 : 229 - 239 , 1993 . treatment with a nucleolytic activity removes nucleolytic activity - sensitive nucleic acid molecules from the probe - survey population mixture of nucleic acid molecules , resulting in a population of nucleolytic - activity - protected nucleic acid molecules . in a preferred embodiment of the present invention , treatment with a nucleolytic activity removes single - stranded nucleic acid molecules and single - stranded regions of nucleic acid molecules from the probe - survey population mixture of nucleic acid molecules , and results in a population of double - stranded nucleolytic activity - protected nucleic acid molecules . however , the present invention also contemplates that molecules may be protected from or sensitive to nucleolytic activity for reasons other than that they are double - stranded or single - stranded . for example , particular nucleic acid molecules may comprise one or more nuclease - resistant linkages that render the nucleic acid molecules or portions thereof resistant to particular nucleases . in some embodiments of the present invention , it may be desirable to amplify nucleolytic - activity protected nucleic acid molecules . such embodiments include embodiments directed toward the detection of contaminants or pathogens . methods of dna amplification are well known in the art . amplification of rna is known in the art as well , and generally relies on a first cdna synthesis reaction using a reverse transcriptase . preferably , the amplification of nucleolytic - activity protected products is linear or substantially linear , and preferably , the amplification preferentially amplifies one strand , preferably the strand that is at least partially complementary , or at least partially substantially complementary to one or more attached nucleic acid molecules of the present invention . after treatment of the probe nucleic acid molecule - survey population nucleic acid molecule mixture with one or more nucleolytic activities , the resulting nucleolytic activity - protected nucleic acid molecules are preferably treated to inhibit or remove the nucleolytic activity . such treatments can involve heating the nucleolytic activity - protected nucleic acid molecules , or adding reagents such as , for example , detergents or chelating agents such as edta , the nucleolytic activity - protected nucleic acid molecules can then be used directly , but is preferably treated with any of a variety of agents that denature nucleic acids to single - stranded form , including but not limited to , high temperature , high ph , denaturing agents , or nucleases . for example , in certain preferred embodiments the nucleolytic activity - protected nucleic acid molecules are treated with a second nuclease in order to provide the protected probe nucleic acid molecules or fragments thereof or protected fragments of the survey population of nucleic acid molecules in single - stranded form for hybridization to the attached nucleic acid molecules on the solid support . nucleases can be selected based on their ability to degrade one of the strands of the nucleic acids of the nucleolytic - activity - protected nucleic acid molecules and to leave the strands that are to be hybridized to the attached nucleic acids of the solid support intact . for example , in embodiments where at least one probe is at least partially complementary , or at least partially substantially complementary , to one or more attached nucleic acid molecules , and the probe or probes comprise dna and the survey population comprises rna , the probe or probes can be rendered single stranded by treatment of the probe - survey population of nucleic acid molecule mixture with dnase - free rnase , such as rnase h . the nucleolytic activity - protected nucleic acid molecules or single - stranded portions thereof are contacted with the array under conditions sufficient for hybridization of nucleic acids to occur to form attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complexes . suitable hybridization conditions are well known to those of skill in the art and reviewed in maniatis et al , supra and wo 95 / 21944 , where the conditions can be modulated to achieve a desired specificity in hybridization , e . g . highly stringent or moderately stringent conditions . for example , low stringency hybridization conditions may be at 50 degress c . and 6 times ssc ( 0 . 9 m sodium chloride / 0 . 09 m sodium citrate ) while hybridization under stringent conditions may be at 50 degress c . or higher and 0 . 01 times ssc ( 15 mm sodium chloride / 1 . 5 mm sodium citrate ). in many instances , it is desirable to include in the sample of nucleolytic - activity - protected nucleic acid molecules that is contacted with the array an unlabeled or labeled set of standard dna molecules that are present in known amounts and can be used as calibrating agents in subsequent analysis . standard dna molecules may simply be added to the nucleic acids to be contacted with the array . alternatively , one or more standards can be provided in the survey population of nucleic acid molecules , and the standard or standards will be designed such that they are complementary or not complementary to one or more probe nucleic acid molecules . following hybridization , a washing step can be employed to remove unhybridized nucleolytic - activity - protected nucleic acid molecules from the solid support . a variety of wash solutions and protocols for their use are known to those of skill in the art and may be used . in certain preferred embodiments of the present invention ( such as those illustrated in fig1 a , 1 b , 6 a , and 6 b ), attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complexes are labeled by using one or more polymerases and one or more labeled nucleotides . preferably , hybridization of an attached nucleic acid molecule and a nucleolytic activity - protected molecule occurs such that only a portion of the nucleolytic activity - protected nucleic acid molecule hybridizes to an attached nucleic acid molecule , such that a nucleolytic activity - protected nucleic acid molecule in a hybridized complex is partially single - stranded and partially double - stranded . this allows the unhybridized portion of a nucleolytic activity - protected nucleic acid molecule in a hybridized complex to act as a template and the hybridized portion of an attached nucleic acid molecule in a hybridized complex to be used as a primer in polymerase reactions that extend the attached nucleic acid molecule of an attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complex . in the alternative , hybridization of a nucleolytic activity - protected nucleic acid molecule and an attached nucleic acid molecule occurs such that only a portion of the attached nucleic acid hybridizes to a nucleolytic activity - protected nucleic acid molecule , such that a hybridized attached nucleic acid molecule in a hybridized complex is partially single - stranded and partially double - stranded . this allows the unhybridized portion of an attached nucleic acid molecule in a hybridized complex to act as a template and the hybridized portion of a nucleolytic activity - protected nucleic acid molecule in a hybridized complex to act as a primer in polymerase reactions that extend the nucleolytic activity - protected nucleic acid molecule of an attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complex . it is also within the scope of the present invention to extend both an attached nucleic acid molecule and a nucleolytic activity - protected nucleic acid molecule of a hybridized complex using one or more polymerases , in one or more polymerase reactions performed simultaneously or in series . it may be preferred in particular embodiments ( especially , but not restricted to , embodiments directed toward mutation and snp detection ) to extend only one of the strands of a nucleic acid molecule of the hybridized complex . that is , it can be preferable to extend either the nuclcolytic activity - protected nucleic acid molecule strand of the hybridized complex or the attached nucleic acid molecule strand of the hybridized complex , but not both ). there are several ways of accomplishing this , some of which are discussed as follows . first , attached nucleic acid molecules and probe nucleic acid molecules can be designed such that hybridization between an attached nucleic acid molecule and a nucleolytic activity - protected nucleic acid molecule occurs such that only one of the two nucleic acid molecules ; has a single - stranded overhang region in the hybridized complex . second , the attached nucleic acid molecules and probe nucleic acid molecules can comprise different nucleic acids , such that one of the strands of a hybridized complex comprises dna and the other strand of a hybridized complex comprises rna . in this case , one or more polymerases is provided that is specific for synthesis of either dna or rna , but not both . a third option is to use either probe nucleic acid molecules or attached nucleic acid molecules that comprises moieties at their 3 ′ ends that do not permit extension of the nucleic acid molecules , such as , but not limited to dideoxy nucleotides . a fourth possibility is to design probe nucleic acid molecules and attached nucleic acid molecules such that one end of a hybridizing complex does not base pair at the terminal base of the non - overhanging nucleic acid . lack of precise base pairing precludes extension of the nucleic acid strand with polymerases . examples of dna polymerases useful in the present invention include , but are not limited to , dna polymerase i , klenow fragment , t4 dna polymerase , t7 dna polymerase , t . aquaticus (“ taq ”) dna polymerase , and reverse transcriptases . polymerase reactions are performed with nucleotides , at least one of which is detectably labeled . labels can be enzymes , specific binding members , radioisotopes , or fluorochromes . preferred labels are 33 p and fluorochromes such as cy3 and cy5 . additional reagents such as buffering agents , salts , etc . can be provided to optimize the polymerase reactions . polymerase reactions for incorporating labeled nucleotides may be performed at varying temperatures , depending on the polymerases used and their activity and specificity at particular temperatures . a preferred feature of the embodiments that include labeling of hybridized complexes on a solid support and that are directed toward expression profiling is that each hybridization event with a particular species of label results in a signal of the same intensity . preferably , all four nucleotides are detectably labeled , and the number of bases to be polymerized in the extension of the nucleolytic activity - protected molecule is uniform among all the attached nucleic acid molecule / nucleolytic activity - protected complexes of the array . that is , the attached nucleic acid molecules and probe nucleic acid molecules for all positions on the array are designed such that hybridization between nucleolytic activity - protected nucleic acid molecules and attached nucleic acid molecules leaves a uniform number of bases of the nucleic acid molecules of the hybridized complexes that are not base - paired and that can be “ filled in ” with labeled nucleotides in polymerase reactions . in embodiments that include labeling of hybridized complexes on a solid support and that are directed toward mutation or snp detection ( for example , those depicted in fig6 a and 6 b ), the attached nucleic acid molecules and probe nucleic acid molecules are designed such that attached nucleic acid molecules comprise mutations or snps that are positioned at their unattached 3 ′ termini and nucleolytic activity - protected nucleic acid molecules comprise mutations or snps that are not at their termini . hybridization of nucleolytic activity - protected nucleic acid molecules to attached nucleic acid molecules on the solid support results in hybridized complexes comprising nucleic acids that are partially double - stranded and partially single - stranded , in which the double - stranded region terminates at a known or suspected mutation or snp site . the mutation or snp site is therefore the site where a polymerase would initiate nucleic acid synthesis . if an attached nucleic acid molecule can base pair with a nucleolytic activity - protected nucleic acid molecule at the mutation or snp site , labeled nucleotides can be incorporated in polymerase reactions . if , however , the mutation or snp sequence of the attached nucleic acid molecule and the nucleolytic activity - protected molecule are not complementary , the polymerase cannot incorporate nucleotides . the detection of label at an array site therefore identifies the attached nucleic acid molecule at that array site as complementary to the mutation or snp sequence in a member of the survey population of nucleic acid molecules , and thereby identifies a mutation or snp in a survey population of nucleic acid molecules . in this embodiment , all four nucleotides can optionally be labeled to ensure that label is incorporated into attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecules complexes when the polymerase reaction is successful . in a related embodiment , the survey population of nucleic acid molecules can be rna or dna , and the probe nucleic acid molecule is at least partially identical , at least partially substantially identical , at least partially complementary , or at least partially substantially complementary to one or more attached nucleic acid molecules . attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complexes are labeled by using one or more polymereses and one or more labeled nucleotides . preferably , hybridization of an attached nucleic acid molecule and a nucleolytic activity - protected molecule occurs such that the nucleolytic - activity - protected nucleic acid molecule hybridizes to only a portion of an attached nucleic acid molecule , such that a hybridized attached nucleic acid molecule is partially single - stranded and partially double - stranded . this allows the hybridized portion of the nucleolytic activity - protected nucleic acid molecule to act as a primer and the unhybridized single - stranded portion of an attached nucleic acid molecule to be used as a template in polymerase reactions that extend the nucleolytic activity - protected nucleic acid molecule . examples of dna polymerases useful in the present invention include but are not limited to , dna polymerase i , klenow fragment , t4 dna polymerase , t7 dna polymerase , t . aquaticus dna polymerase , and reverse transcriptases . an important feature of this embodiment of the invention is that the nucleolytic activity - protected nucleic acid molecules and attached nucleic acid molecules are designed such that nucleolytic activity - protected nucleic acid molecules comprise mutations or snps that are not at their termini and attached nucleic acid molecules terminate just before mutation or snp sites at their unattached 3 ′ termini . hybridization of nucleolytic activity - protected nucleic acid molecules to attached nucleic acid molecules on the solid support results in nucleolytic activity - protected nucleic acid molecules that are partially double - stranded and partially single - stranded , in which the double - stranded region terminates adjacent to a known or suspected mutation or snp . the incorporation of a terminating nucleotide with a distinguishing label at the mutation or snp postion identifies the sequence of the mutation or snp . polymerase reactions are performed with terminating nucleotides , such as dideoxynucleotides , at least one of which is detectably labeled . terminating nucleotides do not permit the incorporation of additional nucleotides into a growing nucleic acid polymer . at least one terminating nucleotide is detectably labeled . preferably , all four nucleotides are detectably labeled with different distinguishable labels . labels can be enzymes , specific binding members , radioisotopes , or fluorochromes . preferred labels are fluorochromes such as cy3 and cy5 . additional reagents such as buffering agents , salts , etc . can be provided to optimize the polymerase reactions . in another embodiment of the invention , depicted in fig7 a and 7b , nucleic acid probes of the present invention can comprise a mutation or snp and are labeled at least one terminus , where the terminating nucleotide that is labeled occurs at a mutation or snp site . in this embodiment , a probe nucleic acid molecule is at least partially complementary , or at least partially substantially complementary to one or more attached nucleic acid molecules of the present invention . the survey population of nucleic acid molecules can be dna , but is preferably rna . following hybridization of the survey population of nucleic acid molecules and one or more probe nucleic acid molecules , nuclease treatment with single - strand specific nucleases removes single stranded nucleic acids , including the labeled terminal nucleotide of the probe , if it does not hybridize to a known or suspected mutation or snp . nucleolytic activity - protected probe nucleic acid molecules are hybridized to the attached nucleic acid molecules on a solid support . only probe nucleic acid molecules that are complementary to known or suspected mutations or snps at their terminal nucleotides will result in a signal on the array . in this embodiment , from one to four probes , each terminating in a different labeled nucleotide , can be hybridized to different arrays . hybridization of signal nucleic acid molecules to hybridized complexes on solid support in certain embodiments of the present invention , such as those illustrated in fig4 and 8 , one or more signal nucleic acid molecules can be hybridized to the attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complexe . in this embodiment , a “ sandwich ” hybridization is performed , in which nucleolytic activity - protected nucleic acid molecules are hybridized to attached nucleic acid molecules to form hybridized complexes , and signal nucleic acid molecules are hybridized to nucleolytic activity - protected nucleic acid molecules in hybridized complexes . one or more signal nucleic acid molecules can be at least partially complementary , at least partially substantially complementary , at least partially identical , or at least partially substantially identical to at least one probe nucleic acid molecule . thus , at least a portion of at least one nucleolytic activity - protected nucleic acid molecule is at least partially complementary , or at least partially substantially complementary to at least a portion of one or more signal nucleic acid molecules . preferably , the region of the nucleolytic activity - protected nucleic acid molecule that is complementary to at least a portion of a signal nucleic acid molecule is a region that is not complementary to an attached nucleic acid molecule of the present invention . a signal nucleic acid molecule can be rna , dna , or partially comprised of rna and partially comprised of dna . it is also within the scope of the present invention to have signal nucleic acid molecules comprising nucleic acids in which the backbone sugar is other than ribose or deoxyribose ; for example , certain hexoses may be substituted . signal nucleic acids can also be peptide nucleic acids . a signal nucleic acid molecules of the present invention can have nucleoside linkages other than the phosphodiester linkages found in naturally occurring nucleic acids . for example , two or more of their nucleoside subunits can be connected by phosphorus linkages including phosphodiester , phosphorothiate , 3 ′-( or - 5 ′) deoxy - 3 ′-( or 5 ′) thio phosphorothioate , phosphorodithioate , phophoroselenates , 3 ′-( or - 5 ′) deoxy phophinates , borano phosphates , 3 ′-( or - 5 ′) deoxy - 3 ′-( or - 5 ′-) amino phosphoramidates , hydrogen phosphonates , methylphosphonates , borano phosphate esters , phosphoramidates , alkyl or aryl phosphonates and phosphotriester phosphorus linkages . alternatively or in addition , the signal nucleic acids of the present invention can have two or more of their nucleoside subunits connected by carbonate , carbamate , silyl , sulfur , sulfonate , sulfonamide , formacetal , thiofromacetal , methylenedimethylhydrazo or methylimino linkages . a signal nucleic acid molecule can comprise natural or non - naturally occurring nucleobases , for example , adenine , guanine , cytosine , uridine , and thymine , as well as inosine , xanthine , hypoxanthine , 2 - aminoadenine , 6 - methyl and other alkyl derivatives of adenine and gaunine , 2 - propyl and other alkyl derivatives of adenine and guanine , 5 - halo uracil and cytosine , 5 - propynyl uracil and cytosine , 6 - azo uracil , cytosine , and thymine , 5 - uracil ( pseudouracil , 4 - thiouracil , 8 - halo , amino , thiol , thioalkyl , hydroxyl , and other 8 - substituted adenines and guanines , 5 - trifluoromethyl and other 5 - substituted uracils and cytosines , 7 - methylguanine . further purines and purimidines include those disclosed in u . s . pat . no . 3 , 687 , 808 and disclosed in the concise encyclopedia of polymer science and engineering ( 1990 ) kroschwitz , j . i . ed ., john wiley and sons , pages 858 - 859 , and those disclosed by englisch et al . ( 1991 ) angewandte chemie , international edition , 30 : 613 . signal nucleic acid molecules of the present invention can be of any length , but preferably are between 5 and 500 nucleoside subunits in length , more preferably between 10 and 250 nucleoside subunits in length , and most preferably between20 and 100 nucleoside subunits in length . signal nucleic acid molecules of the present invention are preferably at least partially single - stranded . preferably , at least a portion of a signal nucleic acid molecule that is complementary to a nucleolytic activity - protected nucleic acid molecule is provided in the single - stranded state . double - stranded nucleic acid molecules may be converted to the single - stranded , or partially single - stranded , state for use as signal nucleic acid molecules , for example by denaturation of double - stranded molecules , or by treatment of the double - stranded nucleic acid molecules with nucleases or polymerases . signal nucleic acid molecules can be made by synthetic methods as they are known or developed in the art , such as solid phase synthesis (“ oligonucleotide synthesis , a practical approach ” ( 1984 ) ed . m . j . gait , irl press ; “ oligonucleotides and analogs , a practical approach ( 1991 ) ed ., f . eckstein , irl press ; martin ( 1995 ) helv . chim . acta , 78 : 486 - 504 ; beaucage and iyer ( 1992 ) tetrahedron 48 : 2223 - 2311 ; and beaucage and iyer ( 1993 ) 49 : 6123 - 6194 ). alternatively , signal nucleic acid molecules can be made by reverse transcription of rna , or by synthesis of rna from dna templates using polymerases such as rna t7 polymerase , rna t3 polymerase , rna sp6 polymerase , or other rna polymerases as they are known or developed in the art , or signal nucleic acids can be made by synthesis of dna from dna templates using dna polymerases , such as but not limited to , dna polymerase i , klenow fragment , taq dna polymerase , t7 dna polymerase , or t4 dna polymerase . a signal nucleic acid molecule preferably includes a detectable label . preferably all of the signal nucleic acid molecules in a set of signal nucleic acid molecules to be hybridized to attached nucleic acid molecule / nucleolytic activity - protected complexes on a solid support of the present invention are labeled to the same specific activity , such that detection of the signal nucleic acid molecule gives quantitative information of the representation of a nucleic acid sequence in the survey population . preferred labels include fluorochromes , such as cy - 3 and cy - 5 , fluorescein , rhodamine , 7 - amino - 4 - methylcoumarin , dansyl chloride , hoescht 33258 , r - phycoerythrin , quantum red ( tm ), texas red , green fluorescent protein ( gfp ) or other fluorescent labels as they are known or developed in the art . alternatively , signal nucleic acid molecules of the present invention can be labeled with a radioisotope , such as 33 p , 35 s , 3 h , 32 p , 125 i , or 131 i . other detectable labels that can be incorporated into a signal of the present invention include specific binding members that can be detected by other molecules that can generate a detectable signal , such as biotin . enzymes that generate detectable signals in the presence of a suitable substrate , such as , but not limited to , alkalie phosphatase , luciferase , horeseradish peroxidase , and urease can also be used as labels . labels can optionally include mass - modified bases , that aid in distinguishing nucleic acid molecules by mass spectrometry . such labels can be attached to or incorporated into nucleotides that are incorporated into the signal nucleic acid molecules during synthesis . labels can also be attached to oligonucleotides after synthesis . methods of labeling oligonucleotides using are well - known in the art . see , for example , sinha and striepeke , “ oligonucleotides with reporter groups attached to the 5 ′ terminus ” in oligonucleotides and analogues : a practical approach , eckstein , ed , irl oxford , 1991 ; sinha and cook , nucleic acids res . 1988 16 : 2659 ; haugland , molecular probes handbook of fluorescent probes and research chemicals , molecular probes , inc ., eugene , oreg . ( 1992 ) 20 ; thiesen , et al ., tertrahedron letters ( 1992 ) 33 : 3036 ; rosenthal and jones , nucleic acids res . ( 1990 ) 18 : 3095 ; smith et al ., nucleic acids res . ( 1985 ) 13 : 2399 . signal nucleic acid molecules are contacted with the array under conditions sufficient for hybridization of nucleic acids to probe to occur . suitable hybridization conditions are well known to those of skill in the art and reviewed in maniatis et al , supra and wo 95 / 21944 , where the conditions can be modulated to achieve a desired specificity in hybridization , e . g . highly stringent or moderately stringent conditions . for example , low stringency hybridization conditions may be at 50 degress c . and 6 times ssc ( 0 . 9 m sodium chloride / 0 . 09 m sodium citrate ) while hybridization under stringent conditions may be at 50 degress c . or higher and 0 . 1 times ssc ( 15 mm sodium chloride / 1 . 5 mm sodium citrate ). following hybridization , a washing step is employed where unhybridized labeled signal nucleic acids are removed from the support surface . a variety of wash solutions and protocols for their use are known to those of skill in the art and may be used . in the embodiment depicted in fig8 , following hybridization of the signal oligonucleotide to the hybridized complexes on a solid support , a ligation reaction is performed to covalently attach a signal nucleic acid molecule to an attached nucleic acid molecule . in this embodiment , attached nucleic acid molecules terminate at known or suspected mutation or snp sites , and nucleolytic activity - protected nucleic acid molecules in hybridized complexes comprise known or suspected mutation or snp sites that do not occur at their termini . a signal nucleic acid molecule is designed such it borders a known or suspected snp site at one terminus , such that when hybridized to a nucleolytic activity - protected nucleic acid molecule , it abuts an attached nucleic acid molecule . the signal nucleic acid molecule can be ligated to the attached nucleic acid molecule only if there is precise complementarity between an attached nucleic acid molecule and a nucleolytic activity - protected nucleic acid molecule at the known or suspected mutation or snp site . ligases useful in the present invention include , but are not limited to , t4 dna ligase , e . coli ligase , thermostable dna ligases , and rna ligases . a stringent wash is performed following ligation , preferably including 0 . 1 n naoh , such that noncovalently attached nucleic acid molecules are stripped off of a solid support . in this embodiment , the signal nucleic acid molecule preferably comprises a detectable label . the detection of the detectable label of the signal nucleic acid molecule on a solid support is indicitative of an exact match is sequence between an attached nucleic acid molecule and a nucleolytic activity - protected nucleic acid molecules of the present invention . in another embodiment of the present invention ( exemplified in fig5 ), a further treatment with a nucleolytic activity is performed , in which after hybridization of nucleolytic activity - protected nucleic acid molecules are hybridized to attached nucleic acid molecules , the resulting attached nucleic acid molecule / nucleolytic activity - protected complexes are treated with a nucleolytic activity on the solid support . in this embodiment the attached nucleic acid preferably includes a detectable label , and can include one or more nucleolytic activity - resistant linkages . preferably , nucleolytic activity - resistant linkages of attached nucleic acid molecules occur in portions of the nucleic acid molecule that are proximal to the solid support , such that a short segment of the sequence of an attached nucleic acid molecules ( for example , 10 nucleotides or less in length ) will not be cleaved by a nucleolytic activity when in the single - stranded state . preferably , at least one of the nucleoside linkages in a probe nucleic acid molecule is sensitive to cleavage by a nucleolytic agent when the probe nucleic acid molecule or portion thereof is in the single stranded state , but is not sensitive to cleavage by a nucleolytic agent when the probe nucleic acid molecule is in the double stranded state , such as when hybridized to a complementary or substantially complementary nucleic acid molecule . as used herein , the single - stranded state can include one or more mismatched nucleotides that are not base - paired in a nucleic acid molecule that is base - paired in other regions . preferably the detectable label is incorporated into that portion of the attached nucleic acid molecule that comprises nucleolytic activity sensitive linkages , and is not proximal to the solid support . in the alternative , the attached nucleic acid molecule can be bound to the solid support indirectly , such as through a linker arm , and may or may not comprise nuclease - resistant linkages . preferably , at least one of the nucleoside linkages in a probe nucleic acid molecule is sensitive to cleavage by a nucleolytic agent when the probe nucleic acid molecule or portion thereof is in the single stranded state , but is not sensitive to cleavage by a nucleolytic agent when the probe nucleic acid molecule is in the double stranded state , such as when hybridized to a complementary or substantially complementary nucleic acid molecule . preferably a detectable label is incorporated into that portion of the attached nucleic acid molecule that comprises nucleolytic activity - sensitive linkages . thus , in this embodiment , following hybridization of the nucleolytic activity - protected nucleic acid molecules to the attached nucleic acid molecules on the solid support , the attached nucleic acid molecule / nucleolytic activity - protected complexes on the solid support are treated with a nucleolytic activity , such that portions of attached nucleic acid molecules that comprise one or more detectable labels and that are not hybridized to nucleolytic activity - protected nucleic acid molecules are cleaved , and the label is released from the solid support . attached nucleic acid molecules that comprise one or more detectable labels and that are hybridized to nucleolytic activity - protected nucleic acids remain on the solid support , and can be detected by any of the methods described below . detection of hybridized complexes can be accomplished through any of several methods , including , but not limited to , spectrophotometric fluorescence detection , spectrophotometric absorption measurement , scintillation counting , autoradiography , phosphorimaging , light emission measurement , mass spectrometry , and the like . where the label on the target nucleic acid is not directly detectable , one then contacts the solid support , now comprising bound target , with the other member ( s ) of the signal producing system that is being employed . for example , where the label on the target is biotin , one then contacts the array with streptavidin - fluorescer conjugate under conditions sufficient for binding between the specific binding member pairs to occur . following contact , any unbound members of the signal producing system will then be removed , e . g . by washing . the specific wash conditions employed will necessarily depend on the specific nature of the signal producing system that is employed , and will be known to those of skill in the art familiar with the particular signal producing system employed . in detecting or visualizing the hybridization pattern , the intensity or signal value of the label can preferably be not only detected but quantified , by which is meant that the signal from each spot of the hybridization can be measured and compared to a unit value corresponding the signal emitted by known number of end labeled target nucleic acids to obtain a count or absolute value of the copy number of each end - labeled target that is hybridized to a particular spot on the array in the hybridization pattern . following detection or visualization , the hybridization pattern can be used to determine quantitative information about the genetic profile of the labeled target nucleic acid sample that was contacted with the array to generate the hybridization pattern , as well as the physiological source from which the labeled target nucleic acid sample was derived . by genetic profile is meant information regarding the types of nucleic acids present in the sample , e . g . in terms of the types of genes to which they are complementary , as well as the copy number of each particular nucleic acid in the sample . from this data , one can also derive information about the physiological source from which the target nucleic acid sample was derived , such as the types of genes expressed in the tissue or cell which is the physiological source , as well as the levels of expression of each gene , particularly in quantitative terms . where target nucleic acids from two or more physiological sources are compared , the hybridization patterns may be compared to identify differences between the patterns . where arrays in which each of the attached nucleic acid molecules corresponds to a known gene are employed , any discrepancies can be related to a differential expression of a particular gene in the physiological sources being compared . thus , the present invention is useful in differential gene expression assays , where one may use the methods of the present invention in the differential expression analysis of : ( a ) diseased and normal tissue , e . g . neoplastic and normal tissue , ( b ) different tissue or subtissue types ; and the like . one embodiment of the present invention includes comparing expressed nucleic acid molecules from two survey populations of nucleic acid molecules . the survey populations are preferably related , but this need not be the case . for example , the first population may be of rna isolated from a particular cell type that is cancerous , and the second population can be of rna isolated from the same cell type that is not cancerous . the method includes : contacting a first set of at least one probe nucleic acid molecule with a first survey population of nucleic acid molecules under conditions that promote hybridization between complementary nucleic acid molecules to generate a first probe - survey population mixture of nucleic acid molecules , contacting a second set of at least one probe nucleic acid molecule with a second survey population of nucleic acid molecules under conditions that promote hybridization between complementary nucleic acid molecules to generate a second probe - survey population mixture of nucleic acid molecules , treating the probe - survey population mixtures of nucleic acid molecules with one or more nucleolytic activities , such that single - stranded nucleic acid molecules are digested , to generate two populations of nucleolytic activity - protected nucleic acid molecules ; contacting the two populations of nucleolytic activity - protected nucleic acid molecules with a solid support comprising one or more attached nucleic acid molecules under conditions that promote hybridization between nucleic acid molecules to generate attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complexes ; and identifying one or more of said attached nucleic acid molecules or one or more of said nucleolytic activity - protected nucleic acid molecules in one or more attached nucleic acid molecule / nucleolytic activity - protected nucleic acid molecule complexes . preferably the first and second sets of probe nucleic acids comprise probe nucleic acids that are identical in sequence composition , but this need not be the case . preferably , the first set of probe nucleic acids comprises a first detectable label and the second set of probe nucleic acids comprises a second detectable label , wherein the first and second detectable labels are distinguishable . in this case , the first and second sets of probe nucleic acid molecules are preferably at least partially complementary , or at least partially substantially complementary , to one or more attached nucleic acid molecules . for example , a survey population of rna isolated from primary glial cells can be hybridized with a first probe set that is labeled with cy3 , and a survey population of rna isolated from glioblastoma biopsy tissue can be hybridized with a second probe set that is labeled with cy5 . following nuclease treatment of both probe - survey population mixtures , the nucleolytic activity - protected nucleic acid molecules from both as hybridizations are hybridized to a dna array comprising attached nucleic acid molecules . spectrophotometric scanning of the array reveals the level of expression of genes corresponding to the attached nucleic acid molecules by both populations . for expression profiling , the survey population is preferably rna , where the rna can be total rna or polya + rna . the rna is preferably isolated from at least one cell or tissue . methods of rna isolation are well known in the art ( see , for example , ausubel et al . ( 1998 ) current protocols in molecular biology , john wiley and sons ). the survey population can also be amplified rna , or rna transcribed in vitro from one or more dna templates . methods of amplifying rna and methods of in vitro transcription are also known in the arts if the survey population for expression profiling is dna , it can be cdna obtained from reverse transcription of rna . such cdnas can be amplified . if amplified , preferably the amplification of dna of the survey population is linear or substantially linear . the present invention includes a composition including at least two probe nucleic acid molecules , and at least one solid support comprising at least two attached nucleic acid molecules . preferably , a majority of the attached nucleic acid molecules are at least partially complementary or at least partially substantially complementary , or at least partially identical , or at least partially substantially identical to at least one probe nucleic acid molecule . the composition can comprise other components as well , such as , but not limited to , one or more of polymerases , nucleases , buffers , reagents , nucleotides , and additional sets of nucleic acid molecules . components of the composition can optionally be provided in single or multiple containers . such compositions can be in the form of kits for carrying out the subject invention , where such kits at least include one or more probe nucleic acid molecules and at least one solid support comprising at least one attached nucleic acid molecule as described above and instructional material for carrying out the subject methodology , where the instructional material could be present on a package insert , on one or more containers in kit and / or packaging associated with the kit . two survey populations of rna are synthesized from the dna template pwpy001 , a plasmid carrying a gene encoding glutathione transferase protein ( gst ). a first rna population is synthesized from pwpy001 using the sp6 rna polymerase promoter , and a second rna population is synthesized from pwpy001 using the t7 rna polymerase promoter that is oriented in the opposite direction . thus , the two rna populations are complementary to one another , one rna population comprising at least a portion of the sense strand encoding the gst protein , and the other rna population comprising at least a portion of the antisense strand . prior to transcription , one aliquot of pwpy001 dna is linearized with restriction enzyme hindiii and another aliquot of pwpy001 dna is linearized with restriction enzyme xbai by incubating the dna with the enzymes at 37 degress c . for two hours using restriction enzyme buffers provided by the manufacturer . both enzymes are obtained from promega ( madison , wis .). following restriction enzyme digestion , the digestion products are separated on a 1 % agarose gel . after staining the gel with ethidium bromide , fluorescent dna bands corresponding to the size of the linearized plasmid are excised with a scalpel and extracted from the agarose using a qiaquick gel extraction kit ( qiagen , valencia , calif .). two in vitro transcription reactions are performed using one microgram of linearized pwpy001 dna in each and a transcription buffer provided by the manufacturer of the enzymes , 10 mm dtt , 0 . 5 mm rntps , 100 units of rnase inhibitor , and 40 units of t7 rna or 40 units of sp6 rna polymerase . the reactions are incubated for two hours at 3 8 degress c ., and then 5 microliters of rnase - free dnase is added to a concentration of one unit per microgram of template dna to each reaction , and the reactions are incubated for 15 minutes at 37 degress c . to digest the template dna . the resulting rna populations are purified by adding 350 microliters of high salt buffer ( qiagen , valencia , calif .) containing freshly added beta - mercaptoethanol ( ten microliters is added to one milliliter of buffer ) to each reaction . 250 microliters of ethanol is then added to the mixtures , and they are pipeted up and down several times before being applied to rneasy mini spin columns positioned in collection tubes ( qiagen , valencia , calif .). the column - plus - collection tubes are centrifuged for 15 seconds at 8 , 000 × g . the rneasy columns are then positioned in new collection tubes . 500 microliters of rpe buffer ( qiagen , valencia , calif .) is added and the column - plus - collection tubes are centrifuged an additional 15 seconds at 8 , 000 × g to wash the column . two addition washes are performed , again each using 500 microliters of rpe buffer , the first by centrifuging 15 seconds at 8 , 000 × g , and the second by centrifuging two minutes at 13 , 000 × g . the rneasy columns are then positioned in new collection tubes and centrifuged for one minute at 13 , 000 × g . the columns are transferred to new collection tubes and 30 microliters of rnase - free water are pipeted onto the rneasy membranes of the columns . the columns are centrifuged for one minute at 8 , 000 × g to elute the rnas which will be used as the survey populations of nucleic acid molecules . b . solution hybridization of survey population rnas to probe and treatment with nuclease two hybridizations are performed . in each hybridization , two microliters containing 0 . 1 microgram of one of the rnas of the survey populations synthesized in part i , above , is added to 1 × mung bean nuclease buffer ( pharmacia biotech ) containing 5 nanomolar ta 37 . ta 37 is a probe dna nucleic acid molecule having the following sequence : 5 ′- cat gtt ggg tgg ttg tcc aaa aga gcg tgc aga gat t - 3 ′ ( seq id no : 1 ), and is complementary to a portion of the nucleic acid molecules that make up the survey population of rna synthesized using sp6 rna polymerase in part i . ta 37 is identical to a portion of the nucleic acid molecules that make up the survey population of rna synthesized using t7 rna polymerase in part i . the rnas and t 37 probe , in a final volume of 40 microliters , are allowed to hybridize by heating the solutions for ten minutes at 90 degress c . and then incubating them at 50 degress c . for 60 minutes . following the 50 degress c . incubation , 12 units of mung bean nuclease are added to each of the mixtures , and the mixtures are incubated for 30 minutes at 37 degress c . edta is then added to a final concentration of 10 millimolar to stop the reactions . the resulting solutions contain mixtures of nuclease - protected nucleic acid molecules . c . synthesis of dna array and hybridization of nuclease - protected nucleic acid molecules to array a dna oligonucleotide with an amino terminus , “ nh 2 - ta 25 ”, with the sequence nh 2 - aat ctc tgc acg ctc ttt tgg aca a - 3 ′ ( seq id no : 2 ) is synthesized commercially . nh 2 - ta 25 is complementary to a portion of the ta 37 probe , such that all of nh 2 - ta 25 is complementary to ta 37 , and ta 37 is partially complementary to nh 2 - ta25 , having 12 bases at the 5 ′ end that are not complementary to nh 2 - ta 25 . a solution of 10 micromolar nh 2 - ta 25 is spotted onto sectors of two glass slides that have surface modified carboxyl groups , and the slides are placed in a dry light - impermeable box for three days . the slides are then washed , first in 0 . 2 % sds for 2 minutes , then twice in h 2 o for one minute , then once in nabh solution ( 0 . 2 grams of nabh 4 in 80 mls of 25 % ethanol ), and finally in h 2 o for one minute . twenty - two microliters of mixture 1 of nuclease - protected nucleic acid molecules ( in which t7 polymerase - synthesized rna was mixed with the probe ) is applied to the sectors of slide 1 , and twenty - two microliters of mixture 2 of nuclease - protected nucleic acid molecules ( in which sp6 polymerase - synthesized rna was mixed with the probe ) is applied to the sectors of slide 2 . then glass cover slips are placed over the sectors of the slides , and the slides are placed in a box . the box is closed tightly and incubated at 90 degress c . for 10 minutes , and then at 50 degress c . for 60 minutes . the slides are then washed in a solution of 1 × ssc / 0 . 1 % sds pre - warmed to 50 degress c . for 3 minutes , and then washed in a solution of 0 . 1 × ssc / 0 . 1 % sds pre - warmed to 50 degress c ., again for 3 minutes . the slides are then rinsed in water for 3 minutes at room temperature . for labeling hybridized complexes on the arrays , an extension solution is prepared that contains 1 × klenow buffer ( promega , madison , wis . ); 83 micromolar each of datp , dgtp , and dttp ; 66 micromolar of cy5 - dctp ; and 5 units of klenow fragment of dna polymerase i in a final volume of 90 microliters . twenty - two and a half microliters of the extension solution is added to each sector of the two slides , and the slides are incubated at room temperature for 30 minutes . the slides are then washed for 10 minute in a solution of 1 × ssc / 0 . 1 % sds , for 10 minutes in a solution of 0 . 1 × ssc / 0 . 1 % sds , for 5 minutes in water , for 10 minute in a solution of 1 × ssc / 0 . 1 % sds , for 10 minutes in a solution of 0 . 1 × ssc / 0 . 1 % sds , and finally for 10 minutes in water . the slides are then dried . the arrays are scanned using a gsi scanarray 3000 according to protocols suggested by the manufacturer . the results show that the slide that was hybridized with the rna derived from the sp6 polymerase transcription reaction has fluorescence , and therefore , the survey population derived from the sp6 polymerase transcription reaction is partially complementary to the probe nucleic acid molecule ta 37 ( and partially identical to the attached nucleic acid molecule nh 2 - ta 25 ). in contrast , no fluorescence is detected when the slide that was hybridized with the rna derived from the t7 polymerase reaction is scanned , indicating that the survey population derived from the t7 rna polymerase transcription reaction is not partially complementary or complementary to the probe nucleic acid molecule ta 37 , ( and is not partially identical or identical to the attached nucleic acid molecule nh 2 - ta 25 ). b . solution hybridization of survey population dna to probe and treatment with nuclease a hybridization is performed in which two microliters ( 0 . 1 microgram ) of l45 ( the dna survey population ) is added to 1 mung bean nuclease buffer ( pharmacia biotech ) containing 5 nanomolar m37 . m37 is a probe dna nucleic acid molecule having the following sequence : 5 ′- catgttgggtggttgtccaaaagagcgtgcagagatt - 3 ′ ( seq id no : 4 ), and is complementary to a portion of the oligonucleotide that makes up the survey population of dna . the dna survey population and m37 probe , in a final volume of 40 microliters , are allowed to hybridize by heating the solutions for ten minutes at 90 degress c . and then incubating them at 50 degress c . for 60 minutes . following the 50 degress c . incubation , 12 units of mung bean nuclease are added to the hybridization mixture , and the mixture is incubated for 30 minutes at 37 degress c . edta is then added to a final concentration of 10 millimolar to stop the reactions . the resulting solution contains a mixture of nuclease - protected nucleic acid molecules . c . synthesis of dna array and hybridization of nuclease - protected nucleic acid molecules to array “ nh 2 - s25 - a ” with sequence nh 2 - aatctctgcacgctcttttggacaa - 3 ′ ( seq id no : 5 ), “ nh 2 - s25 - c ” with sequence nh 2 - aatctctgcacgctcttttggacac - 3 ′ ( seq id no : 6 ), “ nh 2 - s25 - g ” with sequence nh 2 - aatctctgcacgctcttggacag - 3 ′ ( seq id no : 7 ), and “ nh 2 - s25 - t ” with the sequence nh 2 - aatctctgcacgctctittggacat - 3 ′ ( seq id no : 8 ), are purchased commercially . “ nh 2 - s25 - a ”, “ nh 2 - s25 - c ”, “ nh 2 - s25 - g ”, and “ nh 2 - s25 - t ” are identical to a portion of the l45 probe , and complementary to a portion of the survey dna molecule m37 , such that 24 of the 25 bases of each of “ nh 2 - s25 - a ”, “ nh 2 - s25 - c ”, “ nh 2 - s25 - g ”, and “ nh 2 - s25 - t ” are complementary to the survey dna molecule ( the 3 ′ terminal base varies among the four attached oligos ). four solutions of 10 micromolar of one of “ nh 2 - s25 - a ”, “ nh 2 - s25 - c ”, “ nh 2 - s25 - g ”, and “ nh 2 - s25 - t ” are spotted onto separate sectors of a glass slide that has surface modified carboxyl groups , and the slide is placed in a dry light - impermeable box for three days . the slide is then washed , first in 0 . 2 % sds for two minutes , then twice in h 2 o for one minute , then once in nabh 4 solution ( 0 . 2 grams of nabh 4 in 80 mls of 25 % ethanol ), and finally in h 2 o for one minute . twenty - two microliters of the mixture of nuclease - protected nucleic acid molecules is applied to each sector of the slide . then glass cover slips are placed over the sectors of the slide , and the slide is placed in a box . the box is closed tightly and incubated at 90 degress c . for 10 minutes , and then at 50 degress c . for 60 minutes . the slide is then washed in a solution of 1 × ssc / 0 . 1 % sds pre - warmed to 50 degress c . for 3 minutes , and then washed in a solution of 0 . 1 × ssc / 0 . 1 % sds pre - warmed to 50 degress c ., again for 3 minutes . the slide is then rinsed in water for 3 minutes at room temperature . for labeling hybridized complexes on the arrays , an extension solution is prepared that contains 1 × taq polymerase buffer , and 50 micromolar each of datp , dgtp , and dttp ; 50 micromolar of cy5 - dctp ; and 5 units of taq polymerase in a final volume of 90 microliters . twenty - two and a half microliters of the extension solution is added to each sector of the slide , and the slide is incubated at 68 degress c . for 5 minutes . the slide is then washed for 10 minutes in a solution of 1 × ssc / 0 . 1 % sds , for 10 minutes in a solution of 0 . 1 × ssc / 0 . 1 % sds , for 5 minutes in water , for 10 minute in a solution of 1 × ssc / 0 . 1 % sds , for 10 minutes in a solution of 0 . 1 × ssc / 0 . 1 % sds , and finally for 10 minutes in water . finally , the slide is dried . the array is scanned using a gsi scanarray 3000 according to protocols suggested by the manufacturer . the results show that the sector of the slide that has attached nucleic acid molecule “ nh 2 - s25 - a ” gives a fluorescent signal and there is no fluorescent signal from the sectors of the slide that have attached nucleic acid molecules “ nh 2 - s25 - c ”, “ nh 2 - s25 - g ”, and “ nh 2 - s25t ”. this indicates that only the attached nucleic acid molecule with a terminal adenine ( a ) could incorporate the fluorescent label , so that it can be deduced that the survey population nucleic acid molecule had complementary base thymine ( t ) at that position . in this way , the snp sequence in the survey population is identified . all publications , including patent documents and scientific articles , referred to in this application , including any bibliography , are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference . all headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading , unless so specified . ausubel et al . ( 1998 ) current protocols in molecular biology , john wiley and sons . eckstein , f ., ed . ( 1991 ) oligonucleotides and analogs , a practical approach irl press . gait , m . j ., ed . ( 1984 ) oligonucleotide synthesis , a practical approach , irl press . harlowe and lane ( 1988 ) antibodies , a laboratory manual , cold spring harbor press . kroschwitz , j . i . ed . ( 1990 ) concise encyclopedia of polymer science and engineering , john wiley and sons . sambrook et al . ( 1989 ) molecular cloning : a laboratory manual , 2nd edition , cold spring harbor press , cold spring harbor , n . y . sinha and striepeke ( 1991 ) in oligonucleotides and analogues : a practical approach , eckstein , ed , irl oxford . | 2 |
turning now to the drawings , fig1 illustrates a partial cross - sectional view of the semiconductor substrate 10 having a layer of polysilicon 12 deposited upon and between field oxide regions 14 . substrate 10 comprises a silicon - based substrate , generally grown as a single crystal silicon grown from , for example , the czochralski process . field oxide regions 14 are defined from the selective oxidation process , often referred to as local oxidation of silicon ( or &# 34 ; locos &# 34 ;) process . field oxide 14 can be grown from either dry oxygen or a steam ambient , depending upon process constraints . moreover , field oxide 14 can form from a non - recessed , semi - recessed or full recessed locos process . field oxide 14 is grown to a thickness necessary to prevent inversion and channel formation underneath the field oxide by virtue of voltages placed upon overlying interconnect . polysilicon 12 is preferably deposited from a chemical vapor deposition ( cvd ) chamber . the chamber can be an atmospheric or low pressure cvd chamber , either of which utilizes a silicon source such as silane . polysilicon 12 is preferably formed in a cvd chamber heated to a temperature less than 650 ° c . and , in many instances , less than 550 ° c . the reaction process is sustained for a period necessary to form a thickness in the range of 3 , 000 angstroms to 5 , 000 angstroms , and preferably near 4 , 000 angstroms . fig2 illustrates a processing step subsequent to that shown in fig1 . specifically , fig2 depicts a doping process , wherein ions 16 are diffused into polysilicon 12 . polysilicon 12 , comprising a layer extending across the entire wafer surface , is adapted to receive at its exposed surface a relatively heavy concentration of &# 34 ; phosphorous ions .&# 34 ; preferably phosphorous is diffused into polysilicon 12 via a diffusion furnace , wherein diffusion takes place from a pocl 3 source . &# 34 ; phosphorous doping &# 34 ; is preferably carried out at a heavy concentration generally in the range of 6 × 10 20 atoms / cm 3 . a heavy concentration of phosphorous atoms inserted into polysilicon 12 , coupled with subsequent drive - in , ensures a uniform concentration throughout the cross - sectional profile of polysilicon 12 . it is important that the entire cross - section receive the impurity concentration to maximize the electrically active cross - sectional surface . a maximum cross - sectional surface of electrically active species will desirably minimize the resistivity of polysilicon 12 . fig3 illustrates a processing step subsequent to that shown in fig2 . specifically , polysilicon 12 is illustrated as having been patterned to present a polysilicon gate structure ( or conductor ) 18 . structure 18 is patterned from the layer of polysilicon 12 using various photolithography techniques . structure 18 thereby resides over a relatively thin oxide 20 . oxide 20 is generally referred to as a gate oxide or tunnel oxide , depending upon its application . oxide 20 is grown after cessation of the locos process , and is generally of a thickness ranging between 50 angstroms and 200 angstroms , for example . during the patterning process , there may be instances in which the etchant used to form structure 18 reacts with the upper surface of structure 18 causing an unevenness at the upper surface of that structure . for example , the etchant material may cause pitting of the upper surface if not carefully controlled . fig4 illustrates a processing step subsequent to that of fig3 . a thermally grown oxide 22 is shown formed across field oxide 14 as well as gate structure 18 . oxide 22 has an advantage in that it consumes a portion of the polysilicon 18 upper surface . during the thermal growth ( or consumption ) process , various bond disruptions , often called &# 34 ; dangling bonds &# 34 ;, are populated with atomic oxygen derived from oxide 22 . oxide 22 thereby forms a highly conformal layer across polysilicon gate structure 18 as well as field oxide regions 14 . the conformal oxide easily lends itself to deposition of oxide 24 upon the exposed surface thereof . referring to fig5 a processing step subsequent to fig4 is shown . fig5 illustrates the step after which portions of oxides 22 and 24 are removed . after those portions are removed , a sidewall spacer 26 is presented at the side or lateral surfaces of polysilicon gate structure 18 . sidewall spacer 26 is used to reduce what is often called hot carrier effects and to prevent silicide shorting by eliminating silicidation thereon . accordingly , sidewall spacer 26 is used in the well known lightly doped drain ( or &# 34 ; ldd &# 34 ;) process . spacers 26 are present to allow formation of a lightly doped region near the channel area , and more heavily doped regions further from the channel area . not shown simply for the sake of brevity are those lightly doped regions which are formed in the source and drain regions prior to formation of spacer 26 . after spacer 26 is formed , more heavily doped regions are placed using spacer 26 as a masking material . it is important to note , however , that use of spacer 26 is merely an advantage in vlsi processes which are more susceptible to short channel effects . if desired , spacer 26 and the formation thereof can be avoided for lesser density processes without departing from the spirit and scope of the present invention . accordingly , it is not necessary that spacer 26 be used as a critical step in preparing the upper surface of the polysilicon gate structure . thus , it is not necessary that steps forming the spacer be employed as critical steps in carrying out the polysilicon preparation process . conformal oxide 22 may , however , enhance polysilicon 18 upper surface and thereby would not detrimentally effect the spirit and purpose of the present invention . referring now to fig6 a processing step subsequent to that of fig5 is shown . namely , species of ions 28 are implanted onto the exposed surfaces of the resulting wafer topography . the ions can be chosen from a group which consists of neutral ions , silicon ions or proper portions of electrically active ions . for example , &# 34 ; argon ions , silicon ions or phosphorous ions &# 34 ; can be used . the phosphorous ions would add to the contingent of ions normally residing within the source / drain regions of , for example , an nmos active device . field oxide 14 and polysilicon gate structure 18 prevent passage of ions through the respective structures to underlying silicon regions . thus , even if the chosen ions are electrically active ions , their presence would not reside in substrate areas where channels are not to be formed . more importantly , ions 28 impact with the upper surface grain structure of polysilicon 18 . an implant energy is chosen which allows the impacting ions to disrupt the grain structure from its pre - existing condition to a more amorphized pattern . preparation of polysilicon gate structure 18 upper surface using ion implantation provides smaller grains within the polycrystalline silicon material . the smaller grains ( and larger numbers of grain boundaries ) provide , according to the present purpose , a lower resistivity silicide subsequently formed on the upper surface of polysilicon gate structure 18 . ion implantation is one method in which to prepare that upper surface , regardless of whether or not a conformal oxide and an associated sidewall spacer are used . fig7 illustrates a detailed view along plane a of fig6 . the detailed view depicts , in relative terms , the dopant locations within polysilicon gate structure 18 . dopant ions 16 , implanted according to fig2 are presented in a somewhat uniform fashion across the cross - sectional area of polysilicon gate structure 18 . conversely , the atoms resulting from implanted ions 28 reside primarily at the upper surface of polysilicon gate structure 18 . atomic structure resulting from dopant ions 16 are illustrated with reference numeral 30 , and atomic structure resulting from implanted ions 28 are designated with reference numeral 32 . referring now to fig8 a processing step subsequent to that of fig7 is shown . fig8 depicts a layer of refractory metal 34 deposited across the upper wafer topography , including polysilicon gate structure 18 upper surface . refractory metal 34 includes any metal material classified as a refractory - type metal , including ti , ta , w or mo . after metal layer 34 is deposited , an anneal step is performed by heating the wafer as indicated by thermal convection arrows 36 . application of heat causes reaction between metal layer 34 and polysilicon 18 . metal layer 34 is preferably deposited using various well known techniques , such as sputter deposition or chemical vapor deposition . reaction between metal layer 34 and polysilicon 18 produces a silicon - rich phase as the polycide begins to grow . growth of polycide consumes a portion of the upper surface of polysilicon 18 , whereas growth of the silicide consumes a portion of the upper surface of silicon substrate 10 . fig9 illustrates resulting polycide region 40 and silicide region 42 formed from direct metallurgical action at the heated polysilicon / metal juncture . polycide 40 and silicide 42 remain after the unreacted portions of metal layer are removed . fig1 illustrates formation of a polysilicon gate structure according to an alternative embodiment . specifically , fig1 depicts a fabrication step subsequent to that of fig2 . polysilicon layer 12 is adapted to receive a relatively thin ( e . g ., less than 100 angstroms ) layer of silicon dioxide upon its upper surface . the silicon dioxide 44 is preferably grown , however , it can be deposited using conventional chemical vapor deposition techniques . deposited at the upper surface of oxide 44 is a second layer of polysilicon 46 . first layer polysilicon 12 , oxide 44 and second layer polysilicon 46 form a tri - layer structure across the entire wafer surface . fig1 illustrates a processing step subsequent to that of fig1 . the tri - layer structure is patterned , leaving a polysilicon gate structure ( or conductor ) 18a . gate structure 18a of fig1 is shown having sidewall spacers 26 , similar to the configuration shown in fig5 . sidewall spacers 26 are formed using various etch - back techniques , leaving an exposed upper surface of gate structure 18a . fig1 illustrates the relative locations of atomic structures provided within gate structure 18a . atomic structures 48 are present throughout the first layer of polysilicon 12 of gate structure 18a . oxide 44 suffices as a barrier against migration of those dopants 48 into overlying polysilicon layer 46 . fig1 represents a detailed view along plane b of fig1 , and presents an indication of where , relatively speaking , atomic dopants 48 , brought about by the step of fig2 reside within the first polysilicon layer 12 . it is appreciated from fig1 that the upper surface of gate structure 18a can be substantially void of dopant , and the problems of impurity accumulation within grain boundary areas at the upper surface of second polysilicon layer 46 . as shown by arrow 50 , oxide 44 serves as a barrier to prevent migration of impurities pre - existing within layer 12 to layer 46 . dopant 48 within layer 12 serves to enhance conductivity of the overall structure 18a but not at the expense of jeopardizing the integrity of layer 46 upper surface . thus , layer 46 upper surface has substantially lower concentrations of dopant 48 than layer 12 . fig1 illustrates , according to an alternative methodology , implantation of species 52 within second polysilicon layer 46 subsequent to the step of fig1 , implant is carried out using ion implantation techniques , whereby sufficient energy and dosage is imparted to the implanting species to cause disruption of the grain structure . the resulting grain structure therefore comprises more grains of smaller size than the grains present prior to ion implantation . fig1 and 13 illustrate alternative embodiments of gate conductor 18a having no ion implantation and ion implantation , respectively . in either instance , the tri - layer gate structure 18a is adequately prepared for subsequent growth of polycide at its upper surface . barrier oxide 44 in fig1 provides the same advantages as that shown in fig1 , in that dopants 48 within polysilicon 12 are prevented from migrating to second polysilicon layer 46 . fig1 illustrates a detailed view along area c of fig9 . polycide 40 is shown intermixed within the polysilicon of gate structure 18 at juncture 56 . fig1 is provided only for the sake of explanation , and is not indicative of the actual structural features at juncture 56 . fig1 is only provided to indicate a geometric disparity at the upper surface grain structure relative to the lower ( or bulk ) grain structure . specifically , the upper surface of gate structure 18 includes grains 58a of smaller dimension than grains 58b within the bulk . accordingly , there are more grain boundaries 60 at the upper surface than within the bulk . an enhanced number of grain boundaries cause a more uniform gradient of reaction sites at juncture 56 . a larger number of reaction sites spread more uniformly over structure 18 upper surface causes a corresponding uniformity in the growth of polycide 40 . polycide 40 therefore can be formed at a more even thickness with fewer numbers of large disparities in thickness . it will be appreciated to those skilled in the art having the benefit of this disclosure that this invention is capable of applications with numerous types of mos - processed circuits . furthermore , it is to be understood that the form of the invention shown and described is to be taken as presently preferred embodiments . various modifications and changes may be made to each and every processing step as would be obvious to a person skilled in the art . any modification necessary to prepare the upper surface of polysilicon for obtaining a more uniform growth rate of polycide thereon falls within the spirit and scope of the present invention . preparation techniques include not only the restriction of impurity atoms at the polysilicon upper surface , but also ion implantation of that surface . it is intended that the following claims be interpreted to embrace all such modifications and changes and , accordingly , specifications and drawings are to be regarded in an illustrative rather than a restrictive sense . | 7 |
three embodiments of a coating apparatus 120 are shown in fig2 and 4 as being similar to the apparatus 20 of fig1 and representative of a type suitable for depositing nickel - base intermetallic coatings . a particularly preferred coating material that can be deposited with the coating apparatus 120 is a beta - phase nickel aluminide , though it is also foreseeable that gamma - phase nickel intermetallics could be deposited . in fig2 the apparatus 120 is shown as comprising a crucible 112 through which a pair of ingots 110 and 111 are fed into a coating chamber 122 , and an electron beam ( eb ) gun 128 generates an electron beam 126 that , in combination with a controlled beam jumping technique , melts the upper surfaces of both ingots 110 and 111 to produce separate molten pools 114 and 115 of the ingot materials within the crucible 112 . with such a technique , the beam 126 is briefly projected ( in the millisecond range ) on each ingot 110 and 111 , with the amount of time on each ingot 110 and 111 being adjusted so that the energy output achieves the energy balance required to obtain compositional control . as an alternative to the use of a single eb gun 128 shown in fig2 two or more eb guns could be used to produce separate electron beams for maintaining both molten pools 114 and 115 . as with the apparatus 20 of fig1 a component 130 is suspended within the coating chamber 122 , so that an overlay coating 132 is deposited on the component 130 as a result of the melting and vaporizing of the ingots 110 and 111 , which produces streams 134 and 135 of vapors that condense on the component 130 . the component 130 is supported on planetary tooling 118 that transports the component 130 over both pools 114 and 115 , so that the overlay coating 132 is a mixture of the ingot materials . as they are gradually consumed by the deposition process , the ingots 110 and 111 are incrementally fed into the chamber 122 through separate passages 124 and 125 in the crucible 112 . as known in the art , water or another suitable cooling medium preferably flows through cooling passages 116 defined within the crucible 112 to maintain the crucible 112 at an acceptable temperature . according to a preferred aspect of the invention , the compositions of the ingots 110 and 111 are chosen so that the coating 132 is a beta - phase nial intermetallic material . notable examples of nial - based materials are those disclosed in nagaraj et al ., rigney et al ., darolia , and darolia et al ., discussed previously , which are formulated as environmental coatings and bond coats for gas turbine engine applications . these nial - based coatings preferably contain about 20 to 32 weight percent ( about 35 - 50 atomic percent ) aluminum to achieve the beta phase , and may contain one or more of chromium , hafnium , titanium , tantalum , silicon , gallium , zirconium , calcium , iron , cerium and / or yttrium . these alloying ingredients have different vapor pressures than beta - nial , which this invention has determined leads to limited deposition rates and difficulties in achieving controlled chemistries for the coating 132 . with the present invention , those alloying ingredients with significantly lower vapor pressures , most notably zirconium , hafnium , yttrium and cerium ( or another reactive element ), are provided in one of the ingots ( e . g ., 111 ), while those with higher vapor pressures , such as nial and chromium ( if desired in the coating 132 ), are present in the other ingot ( e . g ., 110 ). the electron beam 126 is then used to melt and vaporize the ingots 110 and 111 at controlled but different rates to produce a coating 132 with a predictable chemistry . in particular , the power of the beam 126 is jumped to an appropriate level to optimize the melting and vaporizing rates of the particular ingot material on which it is projected , so that the overall deposition rate can be increased and the uniformity of the coating chemistry improved . the power level inputs to the pools 114 and 115 are adjusted based in part on the coating chemistry , in addition to the relative sizes of the pools 114 and 115 . for ingots 110 and 111 of the same diameter , the required power level is lower for an ingot of zirconium and other reactive elements as compared to the nial ingot . because of the different melting and vaporizing rates , the ingots 110 and 111 are fed into the chamber 122 at different rates as they are gradually consumed by the deposition process . as an example of the above , deposition of an nicral overlay coating containing about 1 weight percent zirconium has been performed using separate ingots ( 110 and 111 ) of beta - phase nial + cr and zr , in which the molten pool size of the zirconium ingot is maintained to have a surface area of nearly fifty percent smaller than the pool size of the nial + cr ingot . a lower power level input is able to maintain the molten zirconium pool because of its smaller size as well as the lower vapor pressure of zirconium compared to nial and chromium . while only two ingots 110 and 111 are shown in fig2 it is foreseeable that multiple crucibles with multiple ingots of each type of material could be employed to increase the size of the coating zone within the chamber 122 . also foreseeable is the use of ingots containing multiple constituents of the coating 132 ( e . g ., nickel , aluminum and chromium ) that are present in separate regions of the ingot . another alternative is to use a separate ingot for each of the elements desired for the coating 132 . for example , for a coating 132 of nial alloyed with chromium and zirconium , four separate nickel , aluminum , chromium and zirconium ingots could be used , each compositionally homogeneous and each individually melted to produce single - element pools that are co - evaporated . again , the power levels of the electron beam used to evaporate the individual ingots would be controlled to optimize evaporation rates and promote the ability to obtain the desired chemistry for the coating 132 . in each of the different embodiments discussed above , the chemistry of the vapor cloud resulting from the vapor streams 134 and 135 will be quite different from one location to another within the cloud . therefore , and particularly if multiple components or surfaces are to be coated at a single time , the location of the surfaces being coated within the vapor cloud will effect the coating chemistry . therefore , the planetary tooling 118 shown in fig2 is preferably employed to achieve more uniform chemistry control by transporting the component 130 above both pools 114 and 115 , so that the component 130 passes through those regions of the vapor cloud with different chemistries . the embodiment of fig3 differs by modifying the crucible 112 to feed a wire 136 of the lower vapor pressure material into the chamber 122 , instead of the ingot 111 . the wire 136 is shown as being dispensed with a feed system 138 that includes a spool 140 from which the wire 136 is pulled by a wire feed device 142 , which feeds the wire 136 through a guide 144 to the molten pool 115 . alternatively , the wire 136 could be fed by the wire feed device 142 through a passage 146 defined within the upper surface of the crucible 112 , as shown in fig4 . other than appropriately modifying the control of the eb gun 128 to achieve a desired evaporation rate , the embodiments of fig3 and 4 are similar to that of fig2 . an advantage of feeding a smaller diameter wire is the capability of a more accurate measurement of the higher volume feed rate made possible with this invention , as compared to the accuracy possible with an ingot that is larger in diameter , and therefore requires lower and more accurate linear feed rates as compared to a wire to achieve the same volume feed rate . various modifications could be made to the physical vapor deposition processes described above , including the use of one or more laser beams instead of the electron beams 126 to melt the ingots 110 and 111 or wire 136 . other physical vapor deposition techniques could also be used , including magnetron sputtering , cathodic arc , ion plasma , pulsed laser deposition ( pld ), and combinations thereof . particular combinations of pvd techniques include ebpvd with cathodic arc , ebpvd with ion plasma , ebpvd with sputtering , ebpvd with pld , sputtering with pld , and cathodic arc with pld . in addition , a pvd technique could be combined with the use of a gaseous source of a minor alloying element , such as the reactive element ( zirconium , hafnium , yttrium and / or cerium ). in an investigation leading to this invention , beta - phase nial - based coatings were deposited onto six sets of buttons made from the single - crystal superalloy known as ren é ns . the targeted composition for the coatings was , in atomic percent , about 40 to 48 % aluminum , about 5 % chromium , and about 0 . 1 to 1 . 2 % zirconium . the ebpvd process used to deposit the coatings used an ingot of nialcr that was continuously melted and evaporated by one electron beam , while an ingot of zirconium was continuously melted and evaporated by a second electron beam . in this manner , ingot chemistry was used to obtain the relative desired levels of nickel , aluminum and chromium , while the electron beam parameters were adjusted to vary the zirconium content from one button set to another . during the coating process , the buttons were transported through the vapor cloud in a manner similar to that represented in fig2 . the coatings were deposited to a thickness of about 2 mils ( about 50 micrometers ), after which the coated buttons were subjected to a vacuum diffusion heat treatment at about 1975 ° f . ( about 1080 ° c .) for about two hours . on a second set of ren é n 5 buttons , nialcr + zr coatings with compositions of , in atomic percent , about 47 . 4 % aluminum , about 5 % chromium , and about 0 . 2 - 0 . 4 % zirconium were deposited to thicknesses of about 2 mils ( about 50 micrometers ) using a high velocity oxyfuel ( hvof ) thermal spray process . the buttons were diffusion heat treated at about 1975 ° f . ( about 1080 ° c .) for about two hours in a vacuum , after which their nialcr + zr coatings were subjected to surface grinding to improve their surface finishes to below 100 microinches ( about 2 . 5 micrometers ) ra , such that the hvof coatings had surface finishes and coating thickness uniformity comparable to the ebpvd coatings . all of the buttons were then coated by ebpvd with about 5 mils ( about 125 micrometers ) of a thermal barrier coating ( tbc ) of 7 % ysz ( zirconia stabilized by about 7 weight percent yttria ), such that the nialcr + zr coatings served as bond coats for the tbc . the spallation life potentials of the tbc coatings were then evaluated by furnace cycle testing ( fct ) at a maximum temperature of about 2125 ° f . ( about 1160 ° c .) using one - hour cycles . the results of the experiments are plotted in fig5 . in addition to evidencing that fct performance was strongly influenced by zirconium concentration , the plotted data show that the performance potentials for those coatings deposited by the pvd process of this invention were clearly superior those thermal sprayed coatings having the same bond coat chemistry . in addition to achieving greater fct performance as compared to coatings deposited by hvof , the coating process of this invention was found to proceed more rapidly than when a single ingot containing the same composition desired for the coatings was evaporated with a single electron beam , essentially as depicted in fig1 . although the above results were obtained with nial - based coatings deposited by ebpvd , it is believed that similar results can also be achieved by depositing nial - based coatings by magnetron sputtering , as will as one or more of the other pvd processes noted above . finally , it is believed that similar results would be obtained by intermittently ( instead of continuously ) melting the zirconium ingot with an electron beam , as discussed above . while the invention has been described in terms of a preferred embodiment , it is apparent that modifications could be adopted by one skilled in the art . accordingly , the scope of the invention is to be limited only by the following claims . | 2 |
polycarbonate is a transparent polymer comprising monomers containing hydrophobic phenyl and methyl groups and a hydrophilic carbonate group . scanning electron microscope images of untreated polycarbonate show a smooth surface that exhibits medium hydrophobicity to a static water droplet on its surface . see fig1 a . based on the chemical composition of the polycarbonate monomer , acetone , ( ch 3 ) 2 co , was chosen to treat polycarbonate to obtain a superhydrophobic surface by rearrangement of the polycarbonate macromolecules . the polycarbonate was immersed in acetone thr different time periods , and then taken out and dried at room temperature . the surface of the polycarbonate changed from transparent to white in color and exhibited superhydrophobicity . see fig1 b . as much research has shown , superhydrophobicity results from rough and porous surface structures , 16 - 18 that can efficiently trap air below a water droplet to separate liquid and solid 125 phases . after treatment with acetone , the polycarbonate surface exhibited layers and pores as shown in fig2 b - d , spherulites as shown in fig2 e - l and nano - fiber structures as shown in fig2 m - p at different scales in the sem images . as shown in fig2 a , partial spherulites formed on the polycarbonate surface after a one minute treatment with acetone followed by the formation of a hierarchical porous structure after five minutes as shown in fig2 b - d . multiple layers were observed with increasing treatment times as shown in fig2 f - h . the hierarchical structures were comprised of spherulites with rough surfaces as shown in fig2 e - l . the spherulites &# 39 ; diameter increased from approximately 3 - 4 μm in fig2 i to 6 - 10 μm in fig2 j - l . nano - fiber structures were also observed on the surface of these spherulites at the first layer in all of the treated polycarbonate as shown in fig2 m - p . the fiber structures and fiber diameters were substantially unchanged with acetone treatment time . these pores , rough structures and fibers on the treated polycarbonate surface may trap air to produce superhydrophobicity . the loss of transparency of the polycarbonate polymer suggests a crystallization of the polymer . 19 the formation of hierarchical structures and the observation of a white color on the polycarbonate surface after acetone treatment suggested that the polycarbonate structure is changed after the acetone treatment . the polycarbonate structures that were treated for different times were analyzed by x - ray diffraction ( xrd ) as shown in fig3 . untreated polycarbonate with a broad peak at approximately 18 degrees indicates an amorphous structure for the polycarbonate . with increasing acetone treatment time , the peak at 18 degrees became sharper and other peaks also formed suggesting the formation of crystal structures . the degree of crystallinity of samples was quantitatively estimated following the method of nara and komiya 20 . the equation of the degree of crystallinity is ; x c = a c /( a c + a a ) where x c refers to the degree of crystallinity , a c refers to the crystallized area on an x - ray diffractogram and a a refers to the amorphous area on the x - ray diffractogram . the degree of crystallinity increased with treatment time and reached the highest at approximately 30 minutes and then became stable as shown in fig3 . the contact angles of water on the polycarbonate surface treated by acetone for different times were determined as shown in the left scales of fig4 . the advancing and receding angles increased with increasing treatment time . after treatment for approximately 30 minutes , the contact angles became stable , up to 150 degrees for advancing angle and 140 degrees for the receding angle . the superhydrophobicity results from the formation of layers , rough spherulites , and the nano - fiber flower structures on the polycarbonate surface . the differences between advancing and receding angles were calculated as about 23 degrees for the polycarbonate treated by acetone for zero or one minute and ware decreased to about 4 - 9 degrees for treatments for a longer time . these results suggest that water contacts the polycarbonate surface in a wenzel state for a one - minute treatment and changes to a cassie - baxter state for longer treatment periods . with reference to fig2 a and 2e , the sem images of the polycarbonate surface treated for one minute show that the percentage of spherulites on the surface is low , thereby permitting water completely to contact the surface without the presence of spherulites ( wenzel state ). for polycarbonate treated for a longer time , however , all of the surfaces were covered by layers and spherulites which can trap air on the surface leading to the cassie - baxter state . the crystallization of the polycarbonate produced regular spherulite roughness that changes the polycarbonate surface from hydrophobic to superhydrophobic . the change is explained by a transition from the wenzel state to the cassie - baxter state . as shown in the right scales of fig4 , the adhesion of a water droplet to the polycarbonate surface was studied further by directly determining roil - off angles . a free six μl water droplet placed on the surface of untreated polycarbonate or polycarbonate treated with acetone for one minute remained attached to the surface and did not slide off when the substrate was tilted up to 90 degrees . with increasing treatment time , roll - off angles were decreased to about 30 degrees . the differences between advancing and receding angles were also decreased for longer treatment periods . the sem images show that the untreated and one - minute treated polycarbonate did not produce as many hierarchical structures ( pores and spherulites ) on the surface as compared to polycarbonate treated for longer times . we were also interested in the dynamic behavior of water on acetone - treated polycarbonate . on a macroscopic level , we compared the behavior of a water droplet freefalling onto an untreated polycarbonate surface and onto an acetone - treated polycarbonate surface . the photographs shown in fig5 were captured using a high - speed camera at a 10 , 000 hz frame rate . a water droplet falling onto the untreated polycarbonate surface did not rebound as shown in fig5 a suggesting that the surface shows a strong adhesion for water . similar behavior is seen in fig5 b , where a sample treated for 1 minute exhibits high adhesion . as shown in fig5 c , the polycarbonate surface treated with acetone for 15 minutes shows a significantly different behavior . the water droplet recoiled multiple times from the surface on the acetone - treated polycarbonate . these impact experiments , contact angles , and roll - off angles are all in good agreement . based on our polycarbonate / acetone research and also on theories of a solubility parameter 21 , 22 solvent induced crystallization 23 - 25 and solvent evaporation , 26 , 27 we disclose a one - step method for treating thermoplastics with solvents to produce hierarchical micro / nano polymer surfaces having selected hydrophobic characteristics . this aspect of the invention can be thought of as having two parts : ( 1 ) polymer / solvent selection , and ( 2 ) crystallization and hierarchical surface formation . polymers and solvents are selected to have similar solubility parameters that indicate a strong interaction to induce a homogeneous solid . a homogeneous solid results from immersing the polymer in the solvent followed by solvent evaporation that further induces crystallization and hierarchical surface formation . we used this method to create hierarchical surfaces in smooth polycarbonate ( fig6 a ) treated with dichloromethane to form nano - micro pores on the surface ( fig6 ). we also treated polyester ( fig6 c ) with acetone to create hierarchical structures ( fig6 d ). it is recognized that modifications and variations of the present invention will be apparent to those of ordinary skill in the art and it is intended that all such modifications and variations be included within the scope of the appended claims . ( 1 ) wang , r . ; hashimoto , k . ; fujishima , a . ; chikuni , m . ; kojima , e . ; kitamura , a . ; shimohigoshi , m . ; watanabe , t . nature 1997 , 388 , 431 - 432 . ( 3 ) parker , a , r . ; lawrence , c . r . nature 2001 , 414 , 33 - 34 . ( 4 ) bhushan , b . ; koch , k . ; jung , y . c . appl . phys . lett . 2008 , 93 , 093101 . ( 5 ) brozell , a . m . ; muha , m . a . ; abed - amoli , a . ; bricarello , d . ; parikh , a . n . nano lett . 2007 , 7 , 3822 - 3826 . ( 6 ) chen , w . ; fadeev , a . y . ; hsieh , m . c . ; oner , d . ; youngblood , j . ; mccarthy , t . j . langmuir 1999 , 15 , 3395 - 3399 . ( 7 ) oner , d . ; mccarthy , t . j . langmuir 2000 , 16 , 7777 - 7787 . ( 8 ) deng , t . ; varanasi , k . k . ; hsu , m . ; bhate , n . ; keimel , c . ; stein , j . ; blohm , m . appl . phys , lett . 2009 , 94 , 133109 . ( 9 ) love , c . j . ; gates , b . d . ; wolfe , d . b . ; paul , k . e . ; whitesides , g . m . nano lett . 2002 , 2 , 891 - 894 . ( 10 ) verplanck , n . ; galopin , e . ; camart , j .- c . ; thorny , v . nano lett . 2007 , 7 , 813 - 817 . ( 11 ) zhai , l . ; cebeci , f . c . ; cohen , r . e . ; rubner , m . f . nano lett . 2004 , 4 , 1349 - 1353 . ( 12 ) fan , j .- g . ; dyer , d . ; zhang , g . ; zhao , y .- p . nano lett . 2004 , 4 , 2133 - 2138 . ( 13 ) zheng , y .- m . ; jiang , l . ; wang , j .- x . ; han , d . appl . phys . lett . 2008 , 93 , 094197 . ( 14 ) liu , k . ; zhang , m .- l . ; zhai , j . ; wang , j . ; jiang , l . appl . phys . lett . 2008 , 92 , 183103 . ( 15 ) lau , k . k . s . ; bico , j . ; teo , k . b . k . ; chhowalla , m . ; amaratunga , g . a . j . ; milne , w . i . ; mckinley , g . h . ; gleason , k . k . nano lett . 2003 , 3 , 1701 - 1705 . ( 16 ) feng , x . j . jiang , l . adv . mater , 2006 , 18 , 3063 - 3078 . ( 19 ) brady , d . g . j . appl . poly . sci . 1976 , 20 , 2541 - 2551 . ( 22 ) dïnç , c . ö . ; kïbarer g . ; güner a . j . appl . poly . sci . 2010 , 117 , 1100 - 1119 . ( 23 ) turska , e . ; benecki , w . ; j . appl . poly . sci . 1979 , 23 , 3489 - 3500 . ( 25 ) durning , c . j . ; rebenfeld , l . ; russel , w . b . ; weigmann , h . d . ; j . poly . sci . part b : poly . phys . 1986 , 24 , 1341 - 1360 . ( 26 ) yang , y . y . ; chung t . s . ; ng n . p . biomaterials 2001 , 22 , 231 - 241 . ( 27 ) ge x . ; wang m . ; ji x . ; ge x . ; liu h . colloid poly . sci . 2009 , 287 , 819 - 827 . | 1 |
the 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide compounds of the invention may be represented by the following formula ( i ): ## str1 ## wherein r 2 , r 3 and r 5 individually are alkyl of 1 to 6 carbon atoms ; phenyl , naphthyl ; or phenyl or naphthyl substituted with 1 to 3 substituents selected from fluoro , chloro , bromo , iodo , alkoxy of 1 to 4 carbon atoms and alkyl of 1 to 4 carbon atoms or one substituent selected from trifluoromethyl , trichloromethyl , tribromomethyl , phenoxy , or phenoxy substituted with 1 to 2 fluoro , chloro , bromo or alkyl of 1 to 4 carbon atoms . preferably r 2 is alkyl of 1 to 6 carbon atoms , and more preferably alkyl of 1 to 3 carbon atoms . preferably r 3 is alkyl of 1 to 6 carbon atoms , phenyl or phenyl substituted with 1 to 2 fluoro , chloro , bromo , alkyl of 1 to 4 carbon atoms or alkoxy of 1 to 4 carbon atoms , and more preferably alkyl of 1 to 3 carbon atoms , phenyl or phenyl substuted with 1 to 2 fluoro , chloro or bromo . preferably r 5 is alkyl of 1 to 6 carbon atoms , phenyl or phenyl substituted with 1 to 2 fluoro , chloro , bromo , alkyl of 1 to 4 carbon atoms or alkoxy of 1 to 4 carbon atoms , and more preferably alkyl of 1 to 3 carbon atoms , phenyl or phenyl substituted with 1 to 2 fluoro , chloro or bromo . representative alkyl groups which r 2 , r 3 and r 5 may represent include methyl , ethyl , isopropyl , n - butyl and n - hexyl . representative aryl groups which r 3 and r 5 may represent include 1 - naphthyl , 2 - naphthyl , 2 - methyl - 1 - naphthyl , 4 - chloro - 1 - naphthyl , 2 , 4 - dichloro - 1 - naphthyl , 2 - fluorophenyl , 3 - chlorophenyl , 3 -( 4 - chlorophenoxy ) phenyl , 2 - phenoxyphenyl , 2 , 4 , 5 - trichlorophenyl , 4 - tolyl , 3 , 5 - dimethylphenyl , 4 - trichloromethylphenyl , 2 - tribromomethylphenyl , 2 - methoxyphenyl , 4 - ethoxyphenyl and 2 - methyl - 4 - chlorophenyl . in the compounds of formula ( i ), it is generally preferred that one of r 2 , r 3 or r 5 is aryl ( e . g ., phenyl , naphthyl , or substituted phenyl or naphthyl ), and two of r 2 , r 3 or r 5 are alkyl . a preferred class of compounds of formula ( i ) is that wherein r 2 is alkyl of 1 to 3 carbon atoms , r 3 is phenyl or phenyl substituted with 1 to 2 fluoro , chloro or bromo and r 5 is alkyl of 1 to 3 carbon atoms . another preferred class of compounds is that wherein r 2 is alkyl of 1 to 3 carbon atoms , r 3 is alkyl of 1 to 3 carbon atoms and r 5 is phenyl or phenyl substituted with 1 to 2 fluoro , chloro or bromo . 2 , 3 - dimethyl - 5 - tolyl - 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide 2 - methyl - 1 - naphthyl - 5 - ethyl - 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide 2 - phenyl - 3 , 5 - dimethyl - 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide 2 , 3 - diethyl - 5 -( 3 , 5 - dichlorophenyl )- 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide 2 - hexyl - 3 , 5 - diphenyl - 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide 2 -( 2 - naphthyl )- 3 , 5 - dimethyl - 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide 2 - methyl - 3 -( 2 - trichloromethylphenyl )- 5 - methyl - 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide 2 -( 4 - phenoxyphenyl - 3 , 5 - dimethyl - 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide 2 , 3 , 5 - trimethyl - 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide , and 2 , 3 , 5 - triphenyl - 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide the 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide compounds of the invention are prepared by reacting thionyl chloride and an n - aminourea ( semicarbazide ) ( ii ) as depicted by the following reaction ( 1 ): ## str2 ## wherein r 2 , r 3 and r 5 have the same significance as previously defined . preferably reaction ( 1 ) is conducted in the presence of a base . suitable bases include inorganic bases such as alkali metal carbonates and bicarbonates , e . g ., sodium carbonate and potassium bicarbonate , and organic bases , such as trialkyl amines , e . g ., tributyl amine , and pyridine compounds , e . g ., pyridine and dimethylpyridine . the preferred bases are pyridine compounds , particularly pyridine . the precise mechanism and the reaction intermediates involved in reaction ( 1 ) are not known with certainty . however , it appears that the stoichiometry of the reaction is one mol of thionyl chloride per mol of n - aminourea . therefore , substantially equimolar amounts of n - aminourea to thionyl chloride are employed , e . g ., molar ratios of n - aminourea to thionyl chloride vary from about 1 : 1 to 1 : 1 . 5 , although molar ratios of 1 : 1 to 1 : 1 . 1 are preferred . when a base is employed in the reaction , it is generally preferred to use enough base to scavenge the hydrogen chloride produced in the reaction . therefore , molar ratios of base to thionyl chloride generally vary from about 2 : 1 to 2 . 4 : 1 , although molar ratios varying from about 2 : 1 to 2 . 2 : 1 are preferred . generally the reaction is accomplished by reacting the n - aminourea , thionyl chloride and base in an inert liquid diluent . suitable inert diluents include alkanes and haloalkanes , such as hexane , isocctane or dichloromethane , and aromatic compounds , such as benzene , toluene or chlorobenzene . generally the amount of diluent employed ranges from 1 to 50 mols per mol of n - aminourea . the reaction is suitably conducted at a temperature of from about - 10 ° c . to 100 ° c ., although temperatures of from about 0 ° c . to 75 ° c . are preferred . the reaction is conducted at or above atmospheric pressure . the reaction time will , of course , vary depending on the reaction temperature and the particular n - aminourea reactant employed . generally , however , the reaction time varies from about 1 hour to 50 hours . the 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide product is isolated from the reaction mixture by conventional procedures , e . g ., extraction , chromatography , crystallization , etc . a 2 . 75 g ( 0 . 032 mol ) sample of thionyl chloride was added dropwise to a cooled ( 0 ° c .) solution of 4 . 18 g ( 0 . 023 mol ) 2 , 3 - dimethyl - 4 - phenylsemicarbazide and 3 . 62 g ( 0 . 046 mol ) pyridine in 250 ml chloroform . the resulting reaction mixture was stirred at about 25 ° c . for about 16 hours , washed twice with water , dried over magnesium sulfate and evaporated under reduced pressure to give a yellow solid . the solid was recrystallized from hexane / benzene to give the product , as a white solid , m . p . 77 - 79 ° c . the infrared spectrum of the product showed a strong carbonyl absorption band at 5 . 78 micron . the nuclear magnetic resonance ( nmr ) spectrum of the product showed two 3 - proton singlets ( methyl protons ) at 3 . 00 ppm and 3 . 26 ppm ppm and a 5 - proton singlet ( aromatic protons ) at 7 . 43 ppm ( relative to tetramethylsilane ). the product is tabulated in table i as compound no . 1 . a slurry of 10 g ( 0 . 075 mol ) 1 , 2 - dimethylhydrazine hydrochloride and 15 . 2 g ( 0 . 15 mol ) triethylamine in 300 ml dichloromethane was stirred until the hydrochloride salt dissolved . a solution of 4 - chlorophenylisocyanate in dichloromethane was then added dropwise and the resulting solution was stirred at about 25 ° c . for about 2 days . the reaction mixture was washed with water , dried over magnesium sulfate and evaporated under reduced pressure to give 2 , 3 - dimethyl - 4 -( 4 - chlorophenyl )- semicarbazide , as a white crystalline solid . a solution of 8 . 13 g ( 0 . 068 mol ) thionyl chloride in dichloromethane was slowly added to a cooled ( 0 ° c .) solution of 14 . 6 g ( 0 . 068 mol ) 2 , 3 - dimethyl - 4 -( 4 - chlorophenyl ) semicarbazide and 10 . 8 g ( 0 . 136 mol ) pyridine in 250 ml dichloromethane . the resulting reaction mixture was allowed to warm to about 25 ° c ., stirred for about 16 hours , washed with water , dried over magnesium sulfate and evaporated under reduced pressure to give a tan liquid which slowly crystallized . recrystallization of the crude product from hexane / benzene gave 14 . 7 g of the 2 , 3 - dimethyl - 5 -( 4 - chlorophenyl )- 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide product , as pink crystals , m . p . 83 °- 85 ° c . the nuclear magnetic resonance spectrum of the product showed 3 - proton singlets ( methyl protons ) at 3 . 00 ppm and 3 . 26 ppm and a 4 - proton singlet ( aromatic protons ) at 7 . 46 ppm ( relative to tetramethylsilane ). the product is tabulated in table i as compound no . 2 . a 5 . 7 - g ( 0 . 1 - mol ) sample of methyl isocyanate was added dropwise to a solution of 15 . 0 g ( 0 . 1 mol ) 1 - acetyl - 2 - phenyl - hydrazine and 2 drops triethylamine in 200 ml dichloromethane . the resulting reaction mixture was stirred for 2 hours at about 25 ° c ., refluxed for about 16 hours and evaporated under reduced pressure to give 21 g of crude 1 - acetyl - 2 - phenyl - 4 - methyl semicarbazide , as a yellow solid . a mixture of 17 g ( 0 . 082 mol ) of the semicarbazide prepared above , 14 . 2 g ( 0 . 1 mol ) methyl iodide , 14 . 0 g ( 0 . 1 mol ) potassium carbonate , and 200 ml ethanol was refluxed for 2 hours , cooled , filtered and evaporated under reduced pressure . the resulting residue was diluted with dichloromethane , filtered to remove suspended solids , washed with water , dried over magnesium sulfate , and evaporated under reduced pressure to give 10 g of crude 1 - acetyl - 1 , 4 - dimethyl - 2 - phenyl - semicarbazide . the 10 - g sample of semicarbazide prepared above and 110 ml 37 % hydrochloric acid were heated at 50 ° c . for 1 hour . the reaction mixture was then poured onto ice , neutralized to ph 7 with aqueous sodium hydroxide solution and evaporated under reduced pressure to give a yellow liquid . nmr spectroscopic analysis of the yellow liquid showed the presence of the starting semicarbazide . therefore , the yellow liquid was redissolved in water , acidified with 10 % hydrochloric acid and extracted with methylene chloride to remove the starting semicarbazide . the aqueous solution was then neutralized with sodium hydroxide and evaporated under reduced pressure to give 3 . 3 g of crude 1 , 4 - dimethyl - 2 - phenylsemicarbazide . a 2 . 2 - g ( 0 . 0184 - mol ) sample of thionyl chloride was added slowly to a cooled ( 0 ° c .) solution of the 3 . 3 - g ( 0 . 0184 - mol ) sample of semicarbazide prepared above and 2 . 9 g ( 0 . 036 mol ) pyridine in 200 ml dichloromethane and then stirred at about 25 ° c . for 16 hours . the reaction mixture was washed with water , dilute hydrochloric acid , dried over magnesium sulfate and evaporated under reduced pressure to give a red oil , which was purified by filtration through silica gel to give the 2 , 5 - dimethyl - 3 - phenyl - 1 , 2 , 3 , 5 - thiatriazine - 1 , 4 - dione product as an orange oil . the nmr spectrum of the product showed two 3 - proton singlets at 2 . 96 ppm and 3 . 20 ppm and the aromatic protons as a multiplet at 7 . 13 - 7 . 90 ppm ( relative to tetramethylsilane ). the product is tabulated in table i as compound no . 4 . other compounds of the invention were prepared by procedures similar to those of examples 1 - 3 . these compounds are reported in table i . the structures of the compounds reported in table i were verified by infrared spectroscopy and / or nmr analysis . all 1 , 2 , 3 , 5 - thiatriazolidin - 4 - one - 2 - oxide compounds of the invention showed a strong carbonyl absorption band at about 5 . 86 micron . the compounds of the present invention are herbicidal in both pre - and post - emergent applications . for pre - emergent control of undesirable vegetation , the herbicidal compounds will be applied in herbicidally effective amounts to the locus or growth medium of the vegetation , e . g ., soil infested with seeds and / or seedlings of such vegetation . such application will inhibit the growth of or kill the seeds , germinating seeds and seedlings . for post - emergent applications , the herbicidal compounds will be applied directly to the foliage and other plant parts . generally , the herbicidal compounds of the invention are effective against weed grasses as well as broadleaved weeds . some may be selective with respect to the type of application and / or type of weed . the compounds of the present invention can be used alone as herbicides . however , it is generally desirable to apply the compounds in herbicidal compositions comprising one or more of the herbicidal compounds intimately admixed with a biologically inert carrier . the carrier may be a liquid diluent or a solid , e . g ., in the form of dust powder or granules . in the herbicidal composition , the active herbicidal compounds can be from about 0 . 01 to 95 % by weight of the entire composition . suitable liquid diluent carriers include water and organic solvents , e . g ., hydrocarbons such as benzene , toluene , kerosene , diesel oil , fuel oil , and petroleum naphtha . suitable solid carriers are natural clays such as kaolinite , atalpulgite and montmorillonite . in addition , talcs , pyrophillite , diatomaceous silica , synthetic fine silicas , calcium aluminosilicate and tricalcium phosphate are suitable carriers . organic materials such as walnut - shell flour , cottonseed hulls , wheat flour , wood flour or redwood - bark flour may also be used as solid carriers . the herbicidal composition will also usually contain a minor amount of a surface - active agent . such surface agents are those commonly known as wetting agents , dispersing agents and emulsifying agents , and can be anionic , cationic or nonionic in character . the herbicidal compositions may also contain other pesticides , adjuvants , stabilizers , conditioners , fillers , and the like . the amount of herbicidal compound or composition administered will vary with the particular plant part or plant growth medium which is to be contacted , the general location of application -- i . e ., sheltered areas such as greenhouses , as compared to exposed areas such as fields -- as well as the desired type of control . generally , for both pre - and post - emergent control , the herbicidal compounds of the invention are applied at rates of 0 . 2 to 60 kg / ha , and the preferred rate is in the range 0 . 5 to 40 kg / ha . pre - emergent herbicidal tests on representative compounds of the invention were made using the following method : an acetone solution of the test compound was prepared by mixing 750 mg of the compound , 220 mg of a nonionic surfactant and 25 ml of acetone . this solution was added to approximately 125 ml of water containing 156 mg of surfactant . seeds of the test vegetation were planted in a pot of soil and the test solution was sprayed uniformly onto the soil surface at a dose of 33 micrograms / cm 2 ( 3 lbs / acre ). the pot was watered and placed in a greenhouse . the pot was watered intermittently and was observed for seedling emergence , healt of emerging seedlings , etc ., for a 3 - week period . at the end of this period , the herbicidal effectiveness of the compound was rated based on the physiological observations . a 0 - to - 100 scale was used , 0 representing no phytotoxicity , 100 representing complete kill . the results of these tests appear in table ii . the test compound was formulated in the same manner as described above for the pre - emergent test . the concentration of the test compound in this formulation was 5000 ppm . this formulation was uniformly sprayed on 2 similar pots of 24 - day - old plants ( approximately 15 to 25 plants per pot ) at a dose of 33 mcg / cm 2 ( 3 lbs / acre ). after the plants had dried , they were placed in a greenhouse and then watered intermittently at their bases , as needed . the plants were observed periodically for phytotoxic effects and physiological and morphological responses to the treatment . after 3 weeks , the herbicidal effectiveness of the compound was rated based on these observations . a 0 - to - 100 scale was used , 0 representing no phytotoxicity and 100 representing complete kill . the results of these tests appear in table ii . table i : ______________________________________compounds of formula ( i ) sulfur analysis , % no . r . sup . 2 r . sup . 3 r . sup . 5 m . p ., ° c calc . found______________________________________1 ch . sub . 3 ch . sub . 3 φ 76 - 79 14 . 2 14 . 22 ch . sub . 3 ch . sub . 3 4 - cl - φ 83 - 85 12 . 4 12 . 63 ch . sub . 3 ch . sub . 3 3 - cf . sub . 3 - φ 90 - 92 10 . 9 10 . 44 ch . sub . 3 φ ch . sub . 3 oil 14 . 2 14 . 55 ch . sub . 3 ch . sub . 3 2 - f - φ 72 - 74 13 . 2 13 . 56 ch . sub . 3 ch . sub . 3 3 - ch . sub . 3 - c - φ 59 - 62 12 . 6 12 . 67 ch . sub . 3 ch . sub . 3 3 , 4 - cl . sub . 2 - φ 104 - 106 10 . 9 11 . 08 ch . sub . 3 ch . sub . 3 4 - φ - o - φ 87 - 88 10 . 1 10 . 39 ch . sub . 3 φ i - c . sub . 3 h . sub . 7 oil 12 . 6 12 . 210 ch . sub . 3 2 - f - φ ch . sub . 3 oil 13 . 2 13 . 911 ch . sub . 3 ch . sub . 3 4 - f - φ 89 - 90 13 . 2 13 . 612 ch . sub . 3 ch . sub . 3 2 , 6 - cl . sub . 2 - φ 106 - 108 10 . 9 10 . 813 ch . sub . 3 4 - ch . sub . 3 o - φ ch . sub . 3 oil 12 . 6 14 . 614 ch . sub . 3 4 - ch . sub . 3 o - φ i - c . sub . 3 h . sub . 7 oil 11 . 3 10 . 915 ch . sub . 3 3 , 4 - cl . sub . 2 - φ ch . sub . 3 147 - 149 10 . 9 10 . 916 ch . sub . 3 i - c . sub . 3 h . sub . 7 3 , 4 - cl . sub . 2 - φ 62 - 65 9 . 9 9 . 217 ch . sub . 3 ch . sub . 3 3 , 4 -( ch . sub . 3 ). sub . 2 - φ oil 12 . 6 12 . 818 ch . sub . 3 ch . sub . 3 2 , 6 -( ch . sub . 3 )- φ 73 - 75 12 . 67 13 . 019 ch . sub . 3 ch . sub . 3 4 - i - c . sub . 3 h . sub . 7 - φ 135 - 136 11 . 8 11 . 720 ch . sub . 3 ch . sub . 3 2 , 4 , 5 - cl . sub . 3 - φ 152 - 154 9 . 7 9 . 721 ch . sub . 3 ch . sub . 3 4 - n - c . sub . 4 h . sub . 9 - φ oil 11 . 4 10 . 822 ch . sub . 3 ch . sub . 3 2 - naphthyl 93 - 94 11 . 6 11 . 723 i - c . sub . 3 h . sub . 7 φ ch . sub . 3 oil 12 . 6 13 . 524 ch . sub . 3 ch . sub . 3 4 - i - φ 111 - 112 9 . 1 10 . 325 ch . sub . 3 ch . sub . 3 4 - br - φ 101 - 103 10 . 5 10 . 8______________________________________ table ii______________________________________herbicidal effectiveness at 3 lbs / acre -- pre / postno . l m p c w o______________________________________1 0 / 93 0 / 95 0 / 70 0 / 25 0 / 25 0 / 202 0 / 100 0 / 100 0 / 84 0 / 50 0 / 80 0 / 553 0 / 75 0 / 90 0 / 20 0 / 0 0 / 0 0 / 404 100 / 100 100 / 100 100 / 90 97 / 0 90 / 55 100 / 405 30 / 100 30 / 100 15 / 100 0 / 30 0 / 75 0 / 806 0 / 90 0 / 100 0 / 95 0 / 0 0 / 15 0 / 07 98 / 100 58 / 100 98 / 100 0 / 93 0 / 75 0 / 838 0 / 65 15 / 0 / 65 0 / 45 0 / 20 0 / 359 65 / 25 60 / 25 20 / 25 50 / 0 0 / 0 0 / 010 95 / 100 95 / 100 100 / 98 74 / 25 84 / 10 69 / 011 0 / 100 0 / 0 / 100 0 / 85 0 / 85 0 / 8512 0 / 0 0 / 0 / 15 0 / 10 0 / 10 0 / 2513 65 / 95 65 / 95 / 80 55 / 65 45 / 50 20 / 8514 0 / 20 0 / 0 / 20 0 / 10 0 / 10 0 / 1015 100 / 100 95 / 100 100 / 100 97 / 80 83 / 97 25 / 8016 0 / 95 0 / 100 0 / 97 0 / 60 0 / 80 0 / 7517 0 / 40 0 / 100 0 / 25 0 / 25 0 / 25 0 / 2018 25 / 0 25 / 0 25 / 0 0 / 0 15 / 0 0 / 019 0 / 100 0 / 100 0 / 100 0 / 45 0 / 85 0 / 3520 0 / 100 0 / 100 0 / 65 0 / 50 0 / 90 0 / 2521 0 / 40 0 / 80 0 / 10 0 / 60 0 / 65 0 / 5022 0 / 85 0 / 100 0 / 70 0 / 50 0 / 50 0 / 4023 10 / 75 10 / 45 10 / 25 0 / 0 0 / 0 0 / 024 0 / 80 0 / 85 0 / 75 0 / 35 0 / 40 0 / 5025 0 / 97 0 / 97 0 / 95 0 / 40 0 / 65 0 / 80______________________________________ o = wild oats ( avena fatua ) w = watergrass ( echinochloa crusgalli ) c = crabgrass ( digitaria sanguinalis ) m = mustard ( brassica arvensis ) p = pigweed ( amaranthus retroflexus ) l = lambsquarter ( chenopodium album ) | 0 |
it is an object of the present disclosure to provide a mechanism for facilitating the quick assembly and disassembly of accessories onto a rail that is more cost effective to manufacture . it is another object of the present disclosure to provide a quick - disconnect mechanism that provides enhanced features against accidental release of the mechanism . it is yet another object of the present disclosure to provide an accessory mount mechanism that eliminates or minimizes the potential for catching foreign objects and becoming tangled . the present disclosure provides a quick - disconnect mounting system for mil 1913 picatinny and nato accessory rail stanag 4694 rail systems commonly used on modular weapons systems . the teachings of this disclosure , however , shall not be limited to firearms or to the specific aforementioned rail specification , as embodiments of the present disclosure may readily be adapted for use in conjunction with photographic and video equipment as well as for other applications . embodiments of the present disclosure provide an adjustable , rotatable , locking lever actuated clamp mechanism , also known as a throw - lever clamping system , for the quick assembly and disassembly of firearm accessories such as aiming devices , laser illumination devices , lighting devices and bipods onto a firearm mount rail . embodiments also provide locking or latching systems for positively maintaining throw - levers in a closed clamping position to prevent inadvertent opening due to firearm handling in rough field conditions such as sustained vibrations , shocks and friction with clothing , walls or terrain . notable improvements over the prior art include a dual safety mechanism to prevent unintentional release and a streamlined design to minimize the potential for catching or snagging on foreign objects . now referring to fig1 - 6 , which illustrate the assembly of the present disclosure according to a first embodiment . the present disclosure comprises two mechanisms : a locking lever mechanism and a safety latch mechanism . now referring to fig1 , a perspective view of the present disclosure , assembled onto a rail 8 is shown . rail 8 has four oppositely angulated clamping surfaces 80 , defining a generally elongated hexagon with three pairs of parallel sides ( 2 trapezoids sharing the long side ) mating surface for accessories . now referring to fig2 a and 2b , an exploded perspective view of the locking lever mechanism of the present disclosure is shown . notably , the locking lever mechanism only requires four components : a mounting base 1 , a locking lever 2 , a resilient member 3 and an adjustment member 4 . the resilient member 3 may be in the form of a circular wave spring or other suitable device . the adjustment member 4 may be in the form of a screw , shoulder screw , bolt , thumbscrew or the like . the mounting base 1 may further comprise a lever pivot cylinder opening 12 , which may advantageously be of a generally cylindrical shape . the locking lever 2 , in embodiments , further comprises a pivot cylinder 21 suitable for insertion into said lever pivot cylinder opening . the pivot cylinder 21 and the lever pivot cylinder opening 12 are designed for a close fit while still enabling rotation therebetween . relief cuts and grooves in the lever pivot cylinder opening 12 and / or pivot cylinder 21 may be added to allow for debris to escape without exceeding the scope of the disclosure . the retention member 4 may be threaded in the locking lever &# 39 ; s threaded hole 22 ( depicted in fig4 ). alternate methods of establishing adjustment of a retention member 4 are assumed to be known to those of ordinary skill in the art . the mounting base 1 , in embodiments and when used in conjunction with mil 1913 picatinny rail systems , may have 3 angulated clamping surfaces 10 dimensioned to mate with 3 of the rail &# 39 ; s surfaces 80 . when designed for the nato accessory rail stanag 4694 system , the mounting base would clamp against a different set of rail surfaces . the resilient member 3 , in embodiments , is mounted so as to bias the locking lever 2 towards mounting base 1 , as shown in fig2 b . variation in rails 8 may be compensated for by adjustment of retention member 4 . once the position of retention member 4 yielding the desired clamping force has been determined , it is important that the retention member 4 does not rotate in relation to the locking lever 2 when the locking lever 2 rotates around the mounting base 1 . to achieve this , the retention member 4 may be bonded with an adhesive ( not shown ) into the locking lever &# 39 ; s threaded hole 22 . to enable the later adjustment for use with other rails , a non - permanent adhesive should be used . a non - permanent adhesive , for the purposes of this specification should be considered an adhesive whose strength is enough to resist the friction force of the resilient member 3 against the retention member 4 , but whose strength is weak enough so as to enable the bond to be broken through the use of a tool such as a wrench to unscrew the retention member 4 . alternatively , or jointly , an interference fit may be implemented between the retention member 4 and the locking lever &# 39 ; s threaded hole 22 . alternatively , resilient member 3 may be designed so as to have enough travel amplitude to compensate for dimensional tolerances in rails 8 while providing adequate clamping force and a shoulder screw may be used as retention member 4 . now referring to fig4 , a perspective view of the locking lever 2 is shown . the locking lever 2 features a peripheral angulated cam surface 28 . this surface , in embodiments , comprises a long straight section 20 designed to contact the fourth oppositely angulated clamping surface 80 ( the one that is not in contact with the mounting base 1 ) and a short straight section 24 . the distance from the locking lever &# 39 ; s axis to the long straight section 20 is greater than the distance to the short straight section 24 to enable engagement and disengagement from rail 8 . the locking lever 2 may also , in embodiments , feature a safety latch cavity 25 . the safety latch cavity 25 also has a latch head well 26 that may be cylindrical as in this disclosure but may also be of any different shape without exceeding the scope of the present disclosure . these features are used for the safety latch mechanism . the locking lever 2 is said to be in clamping position when the long straight section 24 contacts a rail clamping surface 80 . the locking lever 2 is said to be in release position when the locking lever has rotated away from the clamping position . now referring to fig3 a and 3b , exploded perspective views of both the locking lever mechanism and the safety latch mechanism in accordance with embodiments of the present invention are shown . the safety latch mechanism comprises three further components : a safety latch 5 , a resilient member 6 and a safety latch head 7 , as well as an additional feature in the mounting base 1 : safety latch cavity 14 . the resilient member 6 may be in the form of a circular wave spring or other suitable biasing device . the safety latch head 7 may be in the form of a screw and may be screwed to safety latch 5 or otherwise attached to it by any other suitable means . the resilient member 6 is mounted so as to push the safety latch 5 away from the mounting base 1 , as shown in section views 5 and perspective section views 6 . the safety latch 5 is said to be in latched position when the safety latch head 7 prevents the locking lever 2 from rotating . the safety latch 5 is said to be in open position when the safety latch 5 is depressed , allowing the locking lever 2 to be rotated . now referring to fig5 a , 5b and 5c , section views of the safety latch mechanism of the present disclosure in accordance with embodiments of the present invention are shown . in fig5 a the safety latch 5 is in latched position and the locking lever 2 is in clamping position ( mount rail 8 is clamped ). this is the default spring - loaded position of the safety latch mechanism . in this position the locking lever 2 cannot rotate due to an interfering relationship between the head of the latch lever head 7 and the latch head well 26 . in fig5 b the safety latch 5 is shown in an open position ( the locking lever 2 may rotate ) and the locking lever 2 is in clamping position ( mount rail 8 is clamped ). in this position the locking lever 2 may rotate because the head of the latch lever head 7 has been pushed above the latch head well 26 . to be in this position , the safety latch must be pushed by the user . the user must keep applying pressure on the safety latch 5 to initiate the rotation of the locking lever 2 . in this sense , a double safety mechanism is thereby created . in fig5 c the locking lever 2 is in a release position ; the mount may be removed from rail 8 when configured in this manner . in this view it will be apparent to those of ordinary skill in the art why the peripheral angulated cam surface 28 must have a short straight section 24 . when the locking lever 2 is in a release position , the user may ease pressure on the safety latch 5 . to close the locking lever 2 , the user must push the safety latch 5 , complete the rotation , then release the safety latch 5 over the latch head well 26 . now referring to fig6 a , 6b and 6c , perspective section views of the safety latch mechanism in accordance with embodiments of the present disclosure are shown . now referring to fig7 , a second embodiment that shares the same locking lever assembly mechanism with the first and third embodiments but features a different safety latch 5 as well as a different latching mechanism is illustrated . in this embodiment the mounting base features a locking member 18 that the safety latch 5 engages to prevent accidental rotation of the locking lever 2 . fig7 a shows the safety latch 5 in latched position and locking lever 2 in a clamped position . fig7 b and 7d show the safety latch 5 in an open position , with the locking lever 2 still in a clamped position . fig7 c , 7f and 7e show the safety latch 5 in an open position and locking lever 2 in a release position . in this position the rail 8 may be disengaged . in the second embodiment described above , and unlike the first embodiments previously described and third embodiments yet to be described , the safety latch is not spring loaded . instead , it may be indexed with a ball plunger ( not shown ) in either the latched or open position . now referring to fig8 a - 8e , a third embodiment , which differs from the first embodiment primarily in that the safety latch 5 is integral to the locking lever 2 , and not to the mounting base 1 as is the case with the first embodiment , is illustrated . as shown in fig8 e the mounting base 1 may feature a locking member 19 . as shown in fig8 d the locking lever 2 may feature a safety latch hole 27 . as with the first embodiment , the user must apply pressure on the safety latch 5 to initiate rotation of locking lever 2 , preventing accidental loosening of the quick - disconnect mount . once the locking lever has rotated away from the safety latch adjustment member 7 , the user may ease pressure on the safety latch 5 . to close the locking lever 2 , the user must push the safety latch 5 , complete the rotation , then release the safety latch 5 . now referring to fig9 a - 9g various embodiments of the accessory facing side of the mounting base 1 are illustrated . as depicted in fig9 a , the accessory facing side , in embodiments , may be flat and feature any number of accessory mounting holes 16 . as depicted in fig9 b , the accessory facing side may provide a cut - off feature 15 in the form of a groove as well as any number of accessory mounting holes 16 . as depicted in fig9 c , the accessory facing side may provide any number of accessory mounting projections 17 , for instance to mount sighting devices . as depicted in fig9 d , the accessory facing side may provide a cylindrical accessory mounting projection 17 that would enable the accessory to rotate around the axis of said projection . as depicted in fig9 e , the accessory facing side may provide any number of accessory mounting projections 17 that would enable the accessory to pivot to the side of the firearm . as depicted in fig9 f , the accessory facing side may provide a concave cut - off feature 15 as well as any number of accessory mounting holes 16 . as depicted in fig9 g , the accessory facing side may provide a cylindrical accessory mounting cavity 13 that would enable the accessory to rotate around the axis of said cavity . the locking lever 2 may also be located on the accessory side of the mounting base 1 , instead of the rail side as is the case in the first , second and third embodiments previously described , without departing from the intended scope of the present invention . the foregoing description of the embodiments of the disclosure has been presented for the purposes of illustration and description . each and every page of this submission , and all contents thereon , however characterized , identified , or numbered , is considered a substantive part of this application for all purposes , irrespective of form or placement within the application . this specification is not intended to be exhaustive or to limit the disclosure to the precise form disclosed . many modifications and variations are possible in light of this disclosure . | 5 |
fig1 shows a two panel shelf type file folder 10 , having a covering panel 11 and a backing panel 12 . the panel 12 has an upper edge 14 . a file paper 16 is mounted on the backing panel as shown , in alignment with the backing panel 12 . the upper edge 17 of the file paper is only a small distance , about a quarter inch from the upper edge 14 of the panel 12 , and extends parallel to it . the dotted outline 18 shows the adhesive fastener outline which would ordinarily be occupied by the previous adhesive fastener designs , which are mounted on conventional metal prongs . the adhesive fastener packet of this invention , generally indicated at 20 , is firmly attached to the backing panel 12 at its central section along the upper edge 14 . significantly , it is half the length of the previous prong mounted adhesive fastener . the new adhesive fastener packet 20 , permits the file paper 16 to be mounted within the confines of the panel without extending below the bottom edge of the adjacent panel 11 . the adhesive fastener packet is sufficiently strong to hold the papers firmly in position without permitting any skewing or misalignment . the detailed construction and mounting arrangement of the adhesive fastener packet 20 is shown in fig2 and 3 . the adhesive fasteners are rectangular , paper thin plastic pieces , such as polypropylene , polyethylene or acetate film . they are of identical construction and are held together in superposed alignment at their top section . referring to fig2 and 3 , the uppermost adhesive fastener 22 is identical in construction with the adhesive fastener pieces below it . it has a bottom finger engageable free section . a clear one quarter inch wide adhesive tape 23 extends across the undersurface of the lower free edge . the tape stiffens the section and enables the fingertip of the user to readily separate and to lift and separate the lower most fastener . a strip of five - eighths inch wide non - adhereable tape 24 has a permanent contact adhesive on its lower surface adhered to the upper surface of the adhesive fastener 22 . the strip of tape 24 extends longitudinally across the central section of fastener 22 . the upper surface of the non - adhereable strip of tape 24 has a non - adhereable surface for example , a silicone coating to which contact adhesive will not adhere . the open horizontal area 25 between the release tape 24 and the one quarter inch wide reinforcing tape strip 23 is slightly less than a quarter of an inch wide . it provides a flexible longitudinally extending composite - bending section 23 , 25 . a two - sided strip of contact adhesive tape 26 slightly more than one - eighth inch wide , is disposed on the undersurface of fastener 22 and is aligned with the non - adhereable strip of tape 24 . it has a permanent high tack adhesive ( about 25 ounces ) on its upper surface which is adhered to the undersurface of the fastening piece 22 . it is disposed immediately under and in alignment with the non - adhereable strip of tape 24 on the fastener upper surface . the contact adhesive tape undersurface has a contact adhesive coating 26 a of medium tack adhesive . the medium tack contact adhesive is preferably in the range of approximately 8 to 16 ounces . the strip of contact adhesive provides a long and narrow line of contact adhesive about one eighth of an inch wide . this line of contact adhesive 26 a provides adequate adhesive capacity to prevent the file paper from either being pulled out of the file , or from peeling away from the adhesive fastener when the file papers are folded back over the top of the mounting panel 12 . however , when the adhesive fastener is pulled upwardly away from the surface , perpendicularly from the surface of the filed paper , to which the fastener is attached , the adhesive readily disengages , permitting the file paper to be removed . when the identical adhesive fastener pieces are assembled and aligned above one another as a packet 20 , the contact adhesive layer 26 a rests on , and is covered by the corresponding release surface of the adjacent adhesive fastener below it . the intermediate section 28 between the non - adhereable strip of tape 24 and the top section 30 is approximately one - half inch wide , and provides a bendable hinge section . the adhesive fasteners are held together in a stack by double coated high tack one quarter inch wide tape 32 . the fasteners are stacked and aligned in superposed position as shown in fig3 . they are held together by the double coated adhesive strip of tape 32 . the lowermost of the double coated strips of tape 32 of the fastener packet engages a label 34 . label 34 has a removable release liner ( not shown ) on its undersurface , which is removed prior to attachment of the packet to the panel 12 . fig3 is a side view of the packet 20 . the adhesive fastener immediate sections 28 are connected to the top section 30 and provide a hinge section for turning the file papers back over the top of the mounting panel 12 . the top section 30 of the fasteners are connected together by high tack double coated permanent adhesive tape 32 . the bottom tape 32 engages the label 34 , which fastens the entire packet 20 to the mounting panel 12 . it has a high tack permanent contact adhesive layer 35 for engaging the surface of the mounting panel 12 . additionally , it has an extended section 38 which bends around the top edge 14 of panel 12 at 36 and under it as is shown at 38 so that the adhesive 39 can engage the surface of the bottom panel 12 . the lower most adhesive fastener 42 has the free upwardly bendable section . the medium tack contact adhesive coating 46 a of tape 46 is in engagement with the upper central section of the file paper 16 . the non - adhereable strip of tape 44 on adhesive fastener 42 is aligned with the contact adhesive tape 56 of fastener 52 ( fig4 ). the adhesive coating 56 a rests on the non - adhereable surface of the non - adhereable strip of tape 44 . the medium tack contact adhesive coating 56 a , although directly resting on the non - adhering surface of the strip of non - adhering tape 44 , will not adhere to the non - adhereable surface . this is true for each of the adhesive fasteners in the assembly . there is no need for a covering strip on the medium tack adhesive strip of an adhesive fastener . when the fasteners are separated from each other to receive a file paper , the adhesive that is to engage the file paper is also immediately exposed and is ready to engage the surface of the file paper . see fig5 . this arrangement eliminates the prior need for a separate cover piece for the contact adhesive . in this event , the contact adhesive is immediately exposed . previously , when the adhesive fastener to be used was bent upwardly to permit insertion of the file paper , it was necessary to remove the release tape covering strip which covered the contact adhesive coating . this invention recognizes if there is a packet of aligned fasteners , the release cover piece initially required , for the adhesive strip , can be eliminated . by aligning a release coating surface on the underlying adhesive fastener with the contact adhesive on the adhesive fastener above it , a cover piece for the contact adhesive surface is unnecessary . this invention also recognizes that , for the user , the separation of the lowermost unattached fastener could be simplified . it was realized that the lower fastener , with the contact adhesive , is held down by the file paper to which it is attached . when the adhesive fastener above it is raised it provides space for insertion of the new paper to be filed . it also exposes its contact adhesive surface . it was subsequently recognized also that the free end section of the lower attached adhesive fastener could simply be bent up to bring about separation of these two fasteners , and exposure of contact attached adhesive in a simple push upward on the free end section of the lower adhesive fastener . fig4 illustrates the separation action . the adhesive fastener 42 is held down because of its attachment to the previously filed paper 16 . but all of the adhesive - fasteners above it are free to move upward . fig4 and 5 illustrate the manner of adding a file paper . they show the steps involved in fastening a new paper 80 to the lower most unattached adhesive fastener 52 . a previously fastened paper 16 is shown connected to lowermost adhesive fastener 42 . fig4 and 5 show the sequence of the lift and insert steps respectively in the installation of a file paper . adhesive file fastening piece 42 and adhesive fastener 52 immediately above it are both of identical construction as adhesive fastener 22 , previously described . the corresponding parts of these two adhesive fastener pieces 42 and 52 , correspond to the numbered elements of adhesive fastener 22 . for example , the non - adhereable tape 24 of adhesive fastener 22 corresponds to the non - adhereable tape 44 of adhesive fastener 42 . similarly non - adhereable tape 54 of the adhesive fastener 52 corresponds to tape 24 of adhesive fastener 22 . fig5 shows the situation after the adhesive fastener 52 is raised and separated from the adhesive fastener 42 . the contact adhesive surface 56 a is immediately exposed for contacting the incoming file paper . this construction avoids the need to reach under the raised adhesive fastener to remove the cover strip on the contact adhesive surface . the need to remove such a strip before the adhesive fastener could be affixed , was a major nuisance and drawback to general use of the previous type adhesive fastener . it was an additional nuisance to dispose of the removed cover strip itself . the elimination of the need for removal of the cover strip is a major simplification for the user . further , the ordinary adhesive fastener itself is a thin flexible plastic , such as polypropylene or acetate about the thickness of a sheet of paper , two ( 2 ) mils . the fastener has a longitudinal length of about one and three quarter inches . separation of one adhesive fastener from another was not previously quick and immediate . to expedite finger engagement and separation , the free end of the fasteners was thickened by the application of a strip of adhesive to the free , bottom end of the adhesive fasteners as shown at 23 , 43 and 53 . this provides a stiff section 43 that is bent up to push up the fasteners above it . the section preferably is no more than one - half inch so that it does not foul the contact adhesive of the adhesive fastener above it when it is bent up to separate the adhesive fasteners . the back of the finger is used to press in and up against all of the free ends of the adhesive fasteners , including the lowest and attached adhesive fastener 42 , as shown in fig4 . this simple single action presses up all of the adhesive fasteners , and lifts the adhesive fastener 52 and its adhesive strip 56 free from the non - adhereable tape 44 ( to which is does not adhere ), as illustrated in fig4 . continued upward movement allows the unattached adhesive fasteners above fastener 42 to move further upward . but , fastener 42 is held down because of its attachment to the file paper 16 by contact adhesive strip 46 . the free end of adhesive fastener 42 bends at the hinge section 43 , but it is held down by the file paper 16 , and the fingertip brushes up and by it . this brings the free end 43 of adhesive fastener 42 to drop down into engagement with the previously filed paper 16 , as shown in fig5 . it is then only necessary to insert , with the other hand , the end of the paper 80 under the fastener 52 and into engagement with its contact adhesive 56 a . fig6 shows a side view of adhesive fastener 22 previously discussed with respect to fig1 to 3 . of interest are the non - adhereable strip of tape 24 , and the two - sided contact adhesive strip 26 . the top surface of tape 24 has a non - stick non - adhereable surface 24 a . contact adhesive tape 26 has a contact adhesive layer 26 a , which preferably is an acrylic adhesive . the adhesive fastener piece 22 is preferably polypropylene , although polyethylene or similar flexible material such as acetate can be used . the surfaces of adhesive fastener 22 is preferably roughened by dyne treatment to enhance adhesion . as discussed previously , the strip of tape 23 of the free lower end of adhesive fastener 22 gives some additional thickness which makes is easier for the user to engage with the fingertip , since the adhesive fastener is only about 2 mils thick . the strip of binding tape 29 has two layers 29 a of high tack adhesive , one on each side , to hold the adhesive fasteners together along their top section , as previously discussed . the differential dimension 27 is necessary to ensure that misalignment during the course of assembly will not cause any of the adhesive 26 a to extend beyond the surface of the adjacent underlying non - adhereable non - stick coating of the adjacent adhesive fastener . this is similar in construction for all of the fasteners previously described with respect to fig1 to 5 . fig7 illustrates another modification of the adhesive fastener that is considered to be within the scope of the invention . adhesive fastener 22 does not have a non - adhereable tape , nor a contact adhesive tape . the adhesive fastener 92 has a non - adhereable coating 94 of silicone , or a similar non - adhereable type coating material on the upper surface . a non - adhereable coating would be applied to the length of polypropylene adhesive fastener material , thereby eliminating need for a non - adhereable tape . similarly , a contact adhesive coating layer 97 could also be applied to the underside of adhesive fastener material , instead of a contact adhesive tape . the strip of contact adhesive 97 could either be continuous or a series of discontinuous dots or blocks . it has been found that for a slightly less than a two inch length adhesive fastener , a one - eighth inch to one quarter one - quarter inch width of contact adhesive is sufficient for file use . the shorter length of a two inch strip of contact adhesive disengages from a file paper immediately on a small tug on the lower free end of the fastener . this modification , where a coating of non - adhereable material , and coating of contact adhesive to the fastener piece is less expensive than the tape strip . it also simplifies the manufacture process . fig8 is a perspective view of the adhesive fastener assembly generally indicated at 20 . previously described the label 34 extends across the whole width of the fastener and down to slightly below the contact adhesive tape on the lowermost adhesive fastener . it provides a wide and extensive adhesive holding area for the label , and a good support . the high tack permanent adhesive layer 35 on the undersurface of the label 34 is covered by a removable paper release liner 40 . note that the label section 38 extends above the top section 30 of the adhesive fasteners . the upper section 38 of the label 34 is bent over and around the mounting panel as shown in fig3 , 4 and 5 . this provides added holding power to prevent separation of the adhesive 35 from the mounting panel . however , if the label adhesive layer 35 is a strong permanent adhesive , the extended label section 38 will not be necessary . fig9 is a top view similar to fig2 showing the mounted adhesive fastener assembly 110 mounted along the upper edge 104 of the mounting panel 102 . file paper 106 has an upper edge 108 that is close to ( within one quarter inch ) and parallel to the mounting panel upper edge 104 . the adhesive fasteners of this adhesive fastener packet are all identical to the upper fastener 120 has is typical for all . the lower surface of the adhesive fastener 120 a longitudinal discontinuous adhesive strip . it has two spaced patches 125 and 126 , of a contact adhesive coating adjacent each side of the adhesive fastener 120 . it extends along the lower edge of the upwardly bendable section of the fastener 120 . the upper surface of the adhesive fastener 120 has either a non - adhereable coating layer , or a strip of non - adhereable tape . the staples 130 and 132 pass through all of the adhesive fasteners as well as the label ( not shown ) to hold the adhesive fastener assembly together . in this modification , the intermediate double - sided permanent tapes ( i . e ., tape 32 ) joining the top edge sections of the previously discussed , fasteners is omitted . this simple construction is also possible , and is within the scope of the invention . the versatility of the adhesive fastener packet of this invention is illustrated by the new type of flat ringless paper binder shown in perspective fig1 . the adhesive fastener packet is thin . it does not require the center width of the 3 - ring openable type assembly . this makes it possible to provide a flat binder which can be as small as one - half inch wide at the center of a binder . fig1 is a perspective view of an adhesive fastener assembly which is mounted on the side edge of the support panel . it is flat and thin binder . the two side panels 152 and 154 are flat rigid pressboard or chipboard panels . they are joined together at their center edges 153 and 155 by a narrow pressboard strip 156 . the two panels and the now center strip are jointed together by a tape 158 . the tape wraps around the outer surfaces along the edges of all three pieces to hold them together . the tape provides a hinge arrangement at the edges 153 and 155 . a similar tape arrangement is applied to the inner surface of the pressboard pieces . the inside of the binder is shown in the plan view of fig1 . adhesive fastener packets 160 and 170 are mounted on along the inner side edges of panels 152 and 154 . papers are progressively fastened to the adhesive fasteners of the packets , as needed . papers 164 and 174 are the most recent paper filed on the adhesive fastener packets 160 and 174 . fig1 is a sectional view through the opened adhesive fastener assembly of fig1 . the manner of joining the panels 154 and 152 to the center joining strip 156 is shown . the two tape strips 158 and 159 provides the support and the hinge for the binder . the adhesive fastener packet 160 and 170 are shown extending outwardly from the center of the binder assembly panels and joining file papers 164 and 174 . fastener 175 is shown bent over at 176 . because of the shorter length of the new adhesive fastener packets , the adhesive fastener 175 readily bends over at 176 so the paper 174 lies flat and the turned over page surface shows , in much the way of a page in a bound book . the arrow 177 shows the arcuate path of the turned page 174 . this permits the attached page 174 to be viewed on both its sides . page 178 which ordinarily underlies the page 174 is undisturbed and lies flat against the panel 179 . each of these pages are held in their normal position in the binder independently , unless like page 174 they are also turned over . this adhesive fastener assembly , is a thin , flat binder assembly which can be conveniently carried and stacked . this is in contrast to the angular , bulky configuration of the wider typical ring binder . this new flat ringless binder is about one - half inch wide and has a capacity of about 100 sheets , and takes up less shelf space . multi - page brochures , and stapled pages can be attached as one and are securely held . in this respect the adhesive fastener binder is very handy for a salesman or others in the field . the binder is small and compact , and no hole punching is required for fastening papers , either large or small . papers can be effortlessly slipped into the binder or removed . while this invention has been described as having a preferred design , it is understood that it is capable of further modifications , and uses and / or adaptations of the invention and following in general the principle of the invention and including such departures from the present disclosure as come within the known or customary practice in the art to which the invention pertains , and as may be applied to the central features hereinbefore set forth , and fall within the scope of the invention or limits of the claims appended hereto . | 8 |
the metal oxide doped cerium oxide of this invention has an excellent ultraviolet ray shielding effect . fig1 shows the results of measurement of the light transmittance as a function of wavelength of the metal oxide doped cerium oxide obtained by above mentioned method . the light transmittance is measured according to the following method . that is , each specimen is added to and dispersed in 6 ml of clear lacquer in such an amount that the content thereof is 3 . 0 % by weight by using a hoover muller ( rotating at 50 revolutions × 2 ) and mixed . the obtained solution is coated on a transparent quartz board to 30 μm thickness and the light transmittance is measured by a spectrophotometer ( uv - 2200 , product of shimadzu seisakusho co ., ltd .). specimen ( 2 ) is high purity pulverized cerium oxide particles ( average particle size is 10 μm ) on market , specimen ( 3 ) is europium oxide doped cerium oxide of this invention whose molar ratio of ce 4 + and eu 3 + is 7 : 3 , and specimen ( 4 ) is calcium oxide doped cerium oxide of this invention whose molar ratio ce 4 + and ca 2 + is 8 : 2 . as clearly understood from fig1 europium oxide doped cerium oxide particles ( 3 ) and calcium oxide doped cerium oxide particles ( 4 ) of this invention are superior to high purity cerium oxide particles ( 2 ) on market in the ultraviolet ray shielding effect over the wavelength range of 250 to 400 nm , further in the transparency in the visible wavelength of 400 to 800 nm . fig2 shows the estimation results of catalytic activity of metal oxide doped cerium oxide obtained by above mentioned method measured by ranshimat method which is a kind of cdm ( contactometric determination method ). as the cdm apparatus , model e679 ( product of metrom co .) is used , 0 . 5 g of specimen and 5 g of caster oil ( product of ito seiyu co .) are mixed together , poured into a sealed container placed in a thermostat set up to 130 ° c . for 10 hours . air is introduced with bubbling by 20 liter / hour flow rate to the caster oil . air of head space is introduced to the water contained in a separated flask , and the change of electroconductivity of trapped water caused by volatile decomposition of caster oil is detected by measuring cell . the degree of change of electric conductivity with lapse of time is regarded as the intensity of catalytic activity . the same specimen used at the measurement of light transmittance is used . as clearly understood from fig2 the europium oxide doped cerium oxide particles ( 3 ) and the calcium oxide doped cerium oxide particles ( 4 ) of this invention have smaller tendency to promote the oxidation and decomposition of caster oil compared with the high purity cerium oxide particles ( 2 ) on market , and it is obvious that the catalytic activity of ( 3 ) and ( 4 ) is remarkably reduced . a resin composition and a cosmetic composition of this invention are illustrated as follows . in general , a resin composition degrades by the absorption of ultraviolet rays of sun light . as the countermeasure method against the degradation by ultraviolet rays , the metal oxide doped cerium oxide is blended to the resin composition . thus , the resistance to light is improved and the decomposition by light can be prevented or reduced . further , the light decomposition of the contents which is covered by a transparent resin composition by ultraviolet ray can be prevented or reduced . when the catalytic activity of metal oxide doped cerium oxide of this invention is compared with that of cerium oxide , it is remarkably weaker , therefore , the oxidizing decomposition of resin composition caused by cerium oxide can be reduced . the resin composition of this invention indicates a molded product of synthetic resin such as polyvinylchloride , polypropylene , polyethylene , polyamide , polyester or polycarbonate , or natural resin , or a coating in which the resins are blended . a cosmetic composition of this invention is illustrated as follows . the cosmetic composition of this invention exhibits excellent transparency and high sunscreening effect by virtue of the inventive metal oxide doped cerium oxide particles contained therein . because the catalytic activity of the metal oxide doped cerium oxide of this invention is remarkably weaker than that of cerium oxide , the decomposition of blended component in cosmetic compound such as oil caused by cerium oxide can be reduced . as a concrete example of the formulation type of the inventive cosmetic composition , a skin care cosmetic composition such as milk lotion , skin lotion and the like , a make up cosmetic composition such as foundation or lipstick and a hair care cosmetic composition can be mentioned , desirably a sunscreening cosmetic composition can be mentioned . the amount of the metal oxide doped cerium oxide to be blended in a cosmetic composition is not limited , however , the desirable amount is 1 to 70 % by weight . optionally , the metal oxide doped cerium oxide or oxide coated metal oxide doped cerium oxide composite particles are subjected to a surface treatment before being introduced into a cosmetic composition . as the concrete example for the surface treatment method , a treatment by ordinary type oil and fat , a metal soap , silicone , dialkyl phosphoric acid , perfluoroalkyl group containing compound , amino acid , lecithin or collagen can be mentioned . the sunscreening effect exhibited by the inventive cosmetic composition can be further enhanced by including in the composition other well known ultraviolet ray absorbers and / or ultraviolet ray scattering agents in combination with the metal oxide doped cerium oxide particles . the ultraviolet ray absorbing agent suitable for the purpose includes oxybenzone , octyl methoxycinnamate , 4 - tert - butyl - 4 ′- methoxydibenzoylmethane and the like either singly or as a combination of two kinds or more according to need . the containing amount thereof , though not particularly limited , is usually in the range from 0 . 1 to 40 % by weight of the composition . the ultraviolet ray scattering agent used for the above mentioned purpose is preferably a fine powder of titanium dioxide or zinc oxide , more preferably , having an average particle diameter not exceeding 0 . 05 μm . the containing amount thereof is desirably in the range of from 0 . 1 to 50 % by weight . any conventional cosmetic ingredients can be used together with the cosmetic compositions . typical examples of such ingredients are cosmetic powder , surface active agents , oil , polymeric compounds , aesthetic ingredients , moisturizing agents , coloring agents , preservatives , perfumery and so on each in a limited amount not to decrease the advantages obtained by the invention . the effect of this invention is illustrated as follows . the catalytic activity of metal oxide doped cerium oxide of this invention is reduced by doping metal oxide in cerium oxide , the transparency in the visible range is good and the effect to shield the ultraviolet ray at a - range and the ultraviolet ray at b - range is increased . and , the resin composition or the cosmetic composition in which the metal oxide doped cerium oxide particles are blended have an excellent transparency and ultraviolet ray shielding effect . a resin or a cosmetic in which conventional cerium oxide is blended has a tendency that the contained oil or blended components are easily oxidized and decomposed by the catalytic activity of contained cerium oxide . on the contrary , since the catalytic activity of metal oxide doped cerium oxide of this invention is reduced , such defect can not be observed and has an excellent stability for aging . a complex of metal oxide doped cerium oxide whose surface is coated with oxide , can further reduce and weaken the catalytic activity and can improve the dispersability . the present invention will be understood more readily with reference to the examples and the comparative examples , however , these are only intended to illustrate the invention and not be construed to limit the scope of the invention . 342 g of cerium chloride ( cecl 3 ) is dissolved in water and 3 liter of cerium chloride aqueous solution is prepared . 155 g of europium chloride ( eucl 3 ) is dissolved in water and 3 liter of europium chloride aqueous solution is prepared . further 237 g of sodium hydroxide ( naoh ) is dissolved in water and 12 liter of sodium hydroxide aqueous solution is prepared . furthermore , 118 g of 30wt % hydrogen peroxide is dissolved in water and 3 liter of hydrogen peroxide aqueous solution is prepared . 12 liter of sodium hydroxide aqueous solution is heated to 30 - 40 ° c . and the cerium chloride aqueous solution and europium chloride aqueous solution are added simultaneously under constant stirring while maintaining ph of reacting solution higher than 11 and temperature of the solution lower than 40 ° c . after adding , stirring is continued for 30 minutes , while maintaining the temperature of reacting solution at 60 ° c ., then aqueous solution of hydrogen peroxide is added . after the adding , constant stirring is continued for 30 minutes , then the reacted product is rinsed by water , filtered and dried . europium oxide doped cerium oxide particles whose molar ratio of ce 4 + and eu 3 + is 7 : 3 is obtained . 390 g of cerium chloride ( cecl 3 ) is dissolved in water and 3 liter of cerium chloride aqueous solution is prepared . 45 g of calcium chloride ( cacl 2 ) is dissolved in water and 3 liter of aqueous solution of calcium chloride is prepared . further , 237 g of sodium hydroxide ( naoh ) is dissolved in water and 8 liter of sodium hydroxide aqueous solution is prepared . furthermore , 118 g of 30 wt % hydrogen peroxide is dissolved in water and 3 liter of hydrogen peroxide aqueous solution is prepared . to 8 liter of water heated to 30 - 40 ° c ., the cerium chloride aqueous solution , calcium chloride aqueous solution and sodium hydroxide aqueous solution are added simultaneously with constant stirring while maintaining ph of reacting solution at 9 to 11 and temperature of the solution lower than 40 ° c . after the reaction , hydrochloric acid is added to adjust ph of reacting solution to 5 to 7 and the temperature of solution to 60 ° c ., and the aqueous solution of hydrogen peroxide is added . the reacted product is rinsed with water , filtered and dried . calcium oxide doped cerium oxide particles whose molar ratio of ce 4 + and ca 2 + is 8 : 2 is obtained . the color index of obtained solid solution is l * value = 94 . 0 , a * value =− 1 . 6 and b * value = 6 . 2 . 20 g of obtained powder is press molded on a pan of 6 cm and l *, a * and b * values are measured by a color difference meter ( product of nihon denshoku kogyo ). 390 g of cerium chloride ( cecl 3 ) is dissolved in water and 3 liter of cerium chloride aqueous solution is prepared . 45 g of calcium chloride ( cacl 2 ) is dissolved in water and 3 liter of aqueous solution of calcium chloride is prepared . further 237 g of sodium hydroxide ( naoh ) is dissolved in water and 3 liter of sodium hydroxide aqueous solution is prepared . furthermore , 118 g of 30 wt % hydrogen peroxide is dissolved in water and 3 liter of hydrogen peroxide aqueous solution is prepared . to 8 liter of water heated to 30 - 40 ° c ., cerium chloride aqueous solution , calcium chloride aqueous solution and sodium hydroxide aqueous solution are added simultaneously by constant stirring , while maintaining ph of reacting solution 9 to 11 and temperature of the solution lower than 40 ° c . after the reaction , the reacted product is rinsed with water , filtered and dried , thus the calcium oxide doped cerium oxide whose molar ratio of ce 4 + and ca 2 + is 8 : 2 is obtained . the average particle diameter of metal oxide is 2 . 8 nm . the particle diameter is measured by a transmission electron microscope ( product of jeol co ., ltd .). namely , diameter of 100 particles are measured by naked eyes of inspector and averaged . 562 g of sodium silicate solution ( content of sio 2 is 28 . 5 wt %) is dissolved in water and 2 liter of sodium silicate solution is prepared . 75 . 8 g of 95 wt % sulfuric acid is diluted with water and 2 liter of diluted sulfuric acid is prepared . the aqueous solution containing calcium oxide doped cerium oxide obtained in example 2 is heated to a temperature higher than 80 ° c . with constant stirring , aqueous solution of sodium silicate and diluted sulfuric acid are added simultaneously as to maintain ph of reacting solution higher than 9 . after the adding of both solutions , the resulting solution is further stirred for another 30 minutes and ph of reacting solution is adjusted to 7 to 8 by adding dilute sulfuric acid . the reacted product is rinsed with water , filtered , dried and pulverized , thus 30 wt % sio 2 coated calcium oxide doped cerium oxide ( silicon oxide coated calcium oxide doped cerium oxide ) is obtained . 0 . 05 and 1 wt % of the white calcium oxide doped cerium oxide particles obtained in example 2 are blended to plasticized polyvinyl chloride resin . the polyvinyl chloride resin without doped particles and the two resin compositions blended with both amounts of particles are each shaped into a sheet having a thickness of 0 . 24 mm by using hot calendering rollers . each of thus prepared sheets are subjected to the measurement of the transmittance on a spectrophotometer ( uv - 2200 , product of shimadzu seisakusho co ., ltd .). results illustrated in fig3 are obtained . specimen b is a sheet containing 0 . 5 wt % of calcium oxide doped cerium oxide . specimen c is a sheet containing 1 . 0 wt % of calcium oxide doped cerium oxide . it is clearly understood from fig3 that the calcium oxide doped cerium oxide of this invention can improve the shielding effect in the range of ultraviolet rays by the higher blending ratio , however it maintains good transparency in the range of visible rays . four kinds of cream foundation of following recipe are prepared containing metal oxide doped cerium oxide or composite of silicon oxide coated calcium oxide doped cerium oxide obtained from example 1 to example 4 . ( b ) ingredient ( 15 ) is admixed with ( 8 ), heated at 80 ° c . to effect full swelling , then ingredients ( 9 ) to ( 11 ) are added and dissolved therein . to the mixture , the prepared mixture ( a ) is added and dissolved at 80 ° c . ( water phase ). ( c ) ingredients ( 1 ) to ( 7 ) are mixed together and dissolved at 80 ° c . ( oily phase ). ( d ) to the prepared ( water phase ), the prepared ( oily phase ) is added and emulsified . after that , the emulsion is cooled down to 35 ° c . under constant stirring . the cream foundations obtained as above , exhibit excellent transparency of coated layer along with good spreadability and an excellent sunscreening effect . 150 g of the ultrafine particles of calcium oxide doped cerium oxide obtained in example 3 and 200 g of purified water are taken into a flask and are mixed together with heating to 70 ° c . to prepare an aqueous slurry . further , an aqueous emulsion obtained from 6 g of diethanolamine salt of perfluoroalkyl phosphoric acid ester ( asahiguard ag 530 , a product of asahi glass co ., ltd .) and 150 g of purified water are admixed and emulsified . the obtained emulsion is added gradually into the slurry and followed by continuous stirring for 1 hour . after acidification , the aqueous dispersion is rinsed with water , filtered , dried to yield 154 g of fluorinated calcium oxide doped cerium oxide fine particles ( hereinafter shortened to fluorinated doped particle ). 150 g of the white calcium oxide doped cerium oxide obtained in example 2 and 200 g of isopropanol are taken into a flask and are mixed together with heating to 70 ° c . to prepare an aqueous slurry , then 3 g of methyl hydrogen polysiloxan ( product of shin - etsu chemical co ., ltd .) is added and mixed for 1 hour . isopropyl alcohol is removed from the mixture by heating and vacuuming to give 152 g of silicone treated white calcium oxide doped cerium oxide ( hereinafter , shortened to silicone treated doped particles ). a sunscreen milk lotion is prepared by using fluorinated doped particles obtained in example 7 according to the following recipe and preparing method . ( a ) ingredients ( 2 ) to ( 9 ) are melted together by heat , and ingredient ( 1 ) is added and heated to 70 ° c . ( b ) ingredients ( 10 ) to ( 12 ) are mixed together by heating up to 70 ° c ., and obtained mixture is added to ( a ) and emulsified . ( c ) after ( b ) is cooled down , ingredient ( 13 ) is added and mixed , thus the sunscreen milk lotion is obtained . a sunscreen milk lotion is prepared by same recipe and same method as example 9 except using high purity cerium oxide particles ( average particle size is 10 μm ) on the market instead of ingredient ( 1 ). when the sunscreen milk lotion of comparative example 1 is applied on human skin , it exhibits a pale - white color and white powderiness which does not give a natural feeling of cosmetic finish . on the contrary , the sunscreen milk lotion of example 9 which relates to this invention exhibits a transparent and good cosmetic finish along with an excellent sunscreen effect and preservability . a powder foundation is prepared by using silicone treated solid doped particles obtained in example 8 according to the following recipe and preparing method . ( a ) ingredients ( 1 ) to ( 8 ) are blended together by a henschel mixer . ( b ) ingredients ( 9 ) to ( 11 ) are heated and blended together and ingredients ( 12 ) and ( 13 ) are added . ( c ) the obtained mixture in ( b ) is pulverized into a powder , molded by pressing and a powder foundation is obtained . a powder foundation is prepared by same recipe and same method as example 10 except using high purity cerium oxide particles ( average particle size is 10 μm ) on the market instead of ingredient ( 7 ). when the powder foundation of comparative example 2 is applied on human skin , it exhibits a pale - white color and white powderiness which does not give a natural feeling of cosmetic finish . on the contrary , the powder foundation of example 10 which relates to this invention exhibits a transparent and good cosmetic finish along with an excellent sunscreen effect and preservability . a lipstick is prepared by using fine particles of calcium oxide doped cerium oxide obtained in example 3 according to the following recipe and preparing method . ( a ) ingredients ( 8 ) to ( 11 ) are blended together and added to a part of ingredient ( 6 ), then are mixed and dispersed by a mixing roller . ( b ) ingredients ( 1 ) to ( 5 ), remaining part of the ingredient ( 6 ) and ( 7 ) are heated and blended together , then prepared ( a ) is added and further mixed homogeneously . ( c ) a container for lipstick is filled with the molten mixture of ( b ) and cooled down rapidly , thus a lipstick is obtained . a lipstick is prepared by same recipe and same method as example 11 except using fine particles of titanium dioxide instead of ingredient ( 11 ). when the lipstick of comparative example 3 is applied on human lips , it exhibits a pale - white color and does not give a natural and healthy feeling on lip . on the contrary , the lipstick of example 11 which relates to this invention exhibits transparency with healthy coloration along with an excellent sunscreen effect and preservability . a pressed powder is prepared by using europium oxide doped cerium oxide obtained in example 1 according to the following recipe and preparing method . ( b ) ingredients ( 9 ) to ( 12 ) are blended together and added to ( a ) and mixed homogeneously . ( c ) the obtained mixture ( b ) is pulverized into a powder , molded by pressing and a pressed powder is obtained . a pressed powder is prepared by same recipe and same method as example 12 except using fine particles of titanium dioxide instead of ingredient ( 1 ). when the pressed powder of comparative example 4 is applied on human skin , it exhibits a pale - white color and white powderiness which does not give a natural feeling of cosmetic finish . on the contrary , the pressed powder of example 12 which relates to this invention exhibits transparency and good cosmetic finish along with an excellent sunscreen effect and preservability . | 1 |
fig9 shows an exemplary embodiment of a parametric header structure , whose fields depend on a header field hf 1 representing the used ip protocol , denominated “ ip_prot ”. by way of example , only the stbus and the amba ( axi / ahb ) protocol are shown for demonstration . specifically , a header field hf 1 having a binary value “ 00 ” indicates the use of the stbus protocol and a binary value “ 01 ” indicates the use of the amba protocol . fig8 highlights that several of the header fields might be used for both protocols with similar information content , such as : a header field hf 2 defining a security level , denominated “ security ”, a header field hf 5 carrying quality of service information , denominated “ qos ”, header fields hf 7 and hf 8 carrying a 32 bit address , denominated “ add ”, a header field hf 9 providing information on the addressing policy , denominated “ ptype ”, a header field hf 10 defining a load or store operation , denominated “ rnw ”, a header field hf 11 providing information on response optimization , denominated “ res_opt ”, a header field hf 16 providing information on cache ability , denominated “ cache ”, and a header field hf 17 providing information on protection , denominated “ prot ”. however , the header has to provide also information which is not common to the supported protocols . specifically , the header might support for the stbus protocol also : header fields hf 3 and hf 4 providing the source identified , denominated “ src ”, a header field hf 6 providing information on write posting , denominated “ wrp ”, a header field hf 12 carrying the stbus packet size , denominated “ opsize ”, a header field hf 14 providing the transaction identifier denominated “ tid ”, and a header field hf 15 providing information of the cpu operation type , denominated “ adv ”. instead , the same header fields might be used in the amba protocol for different objectives , such as : header fields hf 3 and hf 4 might provide also the source identified , wherein the field hf 3 might provide the 8 bit source identifier of the amba protocol , denominated “ awid / arid ”, and the field hf 4 might provide additional user defined source information , denominated “ user def . id ”, the header field hf 6 might provide information on ahb undefined operations , denominated “ undef . op .”, the header field hf 12 might carry the amba cell size , denominated “ cellsize ”, and the header field hf 14 might provide the packet length , denominated “ len ”. as can be seen , for example the field hf 15 remains unused for the amba protocol , which is denoted in fig9 as “ reserved ”. similarly , by way of example a header structure of 72 bits is assumed , however the exemplary header structure carries at most only 68 bit of information . consequently , the remaining bit might be assigned to an unused header field hf 13 again denoted “ reserved ”. those skilled in the art will appreciate that both the stbus and the amba ( axi / ahb ) protocols are of common knowledge , rendering a more detailed description of the header fields herein unnecessary . fig2 shows possible embodiments of network interfaces of both an initiator in and a target ta , which support the header described in the foregoing . specifically , the network interfaces might support for communication from the initiator in to the target ta the classical handshake signals “ val ” and “ ack ” and the above header structure might be communicated from the initiator in to the target ta via the signals “ flit ” having e . g . 72 bit . in an improved embodiment , the network interfaces support also signals , denoted “ aux ”, carrying information about boundaries between possible elements characterizing possible different hierarchy levels of the ip native protocol . in the improved embodiment , the network interface support also a flit identifier , denoted “ flit_id ”, carrying information about the start and the end of a noc transaction , which determines the arbitration granularity . similarly , the network interfaces might support for communication from the target ta to the initiator in handshake signals “ r_val ” and “ r_ack ”, a signal “ r_aux ” carrying information about boundaries between possible elements , and a signal “ r_flit_id ” carrying information about the start and the end of a noc transaction . instead of communication the complete header structure from the target to the initiator , in an improved embodiment , only a reduced header structure is communicated via the signals “ r_flit ” having e . g . only 64 bits . the fact that the response flit may be smaller than the request flit comes from the fact that , while in request , together with the data of n bytes ( or n * 8 bits ) it is necessary to provide also a “ mask ” ( byte_enables ) of n bits to specify , in the writing case , which byte of the total n byte should actually be written , in the read case this information is not relevant since , after receiving n bytes , the initiator will read only the ones in which it is really interested , so the response “ channel ” may have n bit less . in an improved embodiment , an optional signal , denoted “ r_flit_status ”, in the response path is supported , which carries information about the transaction status , such as possible errors and which flits are affected . fig3 shows a typical example of a transaction between the initiator in and the target ta , wherein each noc transaction t is composed of several packets p . in the embodiment shown in fig2 , the start and the end of the transaction could be indicated by the signal “ flid_id ” or “ r_flit_id ”, while the boundaries of each packet could be marked by the signals “ aux ” or “ r_aux ”. a noc packet p , in turn , consists of flow control units , called also flits , which are the elements transmitted on the data link layer e . g . within a clock cycle in case of synchronous transmission , or as asynchronous entities . the variable arbitration granularity consists actually in defining the relationship between the noc transaction , being the entity transferred after arbitration , and the noc packets , building the transaction itself and representing the basic ip traffic elements , usually called packets as well . fig4 a to 4 c show in the example of the stbus protocol different types of arbitration granularities . each noc packet p might be coincident with a stbus packet , wherein the values of the signals stbus msg and lck determine the stbus traffic pattern , such as message , chunk , or simple packet , and the chosen arbitration granularity determines the length of the noc transaction t . specifically , fig4 a shows a noc transaction t , which is coincident with a series of stbus messages . similarly , fig4 b shows a noc transaction t , which is coincident with a series of stbus chunks . finally , fig4 c shows a noc transaction t , which is coincident with a single stbus packet . fig5 a and 5 b show in much more detail two possible stnoc transactions with different granularities . specifically , fig5 a shows a transaction t of a stbus chunk being composed of three packets . each stnoc packet is composed of a header hd 1 , hd 2 and hd 3 , respectively , carrying e . g . the header fields indicated in the foregoing . typically , in case of a store request , indicates a transmission of data from the initiator to the target , or a load response , indicates a transmission of data from the target to the initiator . the packet might also contain several payload , denoted as pl 11 and pl 12 , pl 21 and pl 22 , pl 31 and pl 32 , respectively . similarly , fig5 b shows a transaction t with a granularity of a simple stbus packet , having e . g . only one header flit hd 1 and two payload flits pl 11 and pl 12 . in order to forward the packets of a transaction e . g . from several initiators to the same target in a noc , several arbitration strategies might be used . fig6 a to 6 c show examples of round - robin arbitrations between two stbus initiators generating respective transactions t 1 and t 2 . in the scenario shown in fig6 a , arbitration granularity is chosen equal to the stbus message size for both initiators , and consequently the two messages are transmitted back to back with no interleaving . in the scenario shown in fig6 b , arbitration granularity is chosen equal to the stbus packet size for both initiators , and consequently the packets are mixed and transmitted alternatively . fig6 c shows the result of a round - robin arbitration between two stbus initiators with different granularity . specifically , the granularity of the transaction t 1 of the first initiator is chosen equal to the stbus message size , while the granularity of the second transaction t 2 is chosen equal to the stbus packet size . this allows to mix traffic having different requirements . for example , the traffic t 1 from the first initiator might have a low latency , and the complete message should be transmitted as soon as possible . conversely , the traffic t 2 from the second initiator might be a high bandwidth traffic , which needs to transfer a big amount of information in a well defined time window but with no strong constraints on latency . fig7 shows a more detailed view of a prior art network interface 700 , interfacing e . g . a stbus ip with the noc such as the stnoc . specifically , such architecture is characterized by an abrupt distinction between transport and network layer , in such a way that the network interface 700 comprises internally two sub - modules which perform the conversion . a first sub - module 7001 , called also shell , is responsible for the transformation between the ip protocol , such as stbus , and the network transport layer protocol , such as stnoc . specifically , the module 7001 performs mainly mapping and translation operations . a second module 7002 , called also kernel , is responsible for the management of the network layer information , such as generation of the destination identifier in the request path , generation of the source identifier in the response path , and quality of service information . finally , a module 7003 is responsible for the transmission and manages traffic to and from the network via a handshake protocol . from a hardware point of view , the sub - modules 7001 and 7002 introduce one cycle of latency and require separate fifo ( first in first out ) memories , leading to a non optimized latency and area occupancy . from an architectural point of view , such an approach determines the transaction header to be composed of two flits at least . the first header flit is used to transmit the network layer information , and the second header flit is used to transmit the transport layer information . due to the two level structure of the conversion it is impossible to merge both header sets in one flit . instead the arrangement described in the foregoing provide a unique parametric header , which can be transported e . g . by a single flit . fig8 shows in that respect a modified network interface 800 , having only a single conversion block 8001 . specifically , the separation of the network interface 800 in shell and kernel is no longer required , allowing to share the same fifo memory between logics doing different tasks . this allows to reduce the transmission latency and optimizing the area occupancy . those skilled in the art will appreciate that the example of flits with 72 bit , such as used in stnoc , are used only for demonstration , even though 72 bit are the most widely used in current applications . without prejudice to the underlying principles of the invention , the details and the embodiments may vary , even appreciably , with reference to what has been described by way of example only , without departing from the scope of the invention as defined by the annexed claims . | 7 |
the following description of preferred embodiments of the invention is not intended to limit the invention to these embodiments , but rather to enable any person skilled in the art to make and use this invention . as shown in fig1 , the energy delivery system 10 of the preferred embodiments includes an energy source 12 , that functions to provide a source of ablation energy , and an electrical attachments 14 and 14 ′, coupled to the energy source 12 , that functions to energize the energy source 12 such that it emits an energy beam 20 . the energy delivery system 10 of the preferred embodiments also includes a sensor and / or the energy source 12 further functions to detect the gap ( distance of the tissue surface from the energy source 12 ), the thickness of the tissue targeted for ablation , the characteristics of the ablated tissue , and any other suitable parameter or characteristic of the tissue and / or the environment around the energy delivery system 10 . the energy delivery system 10 of the preferred embodiments also includes a processor ( not shown ), coupled to the sensor and through the electrical attachment 14 , that controls the electrical attachment 14 and / or the electrical signal delivered to the electrical attachment 14 based on the information from the sensor 40 . the energy delivery system 10 is preferably designed for delivering energy to tissue , more specifically , for delivering ablation energy to tissue , such as heart tissue , to create a conduction block — isolation and / or block of conduction pathways of abnormal electrical activity , which typically originate from the pulmonary veins in the left atrium — for treatment of atrial fibrillation in a patient . the system 10 , however , may be alternatively used with any suitable tissue in any suitable environment and for any suitable reason . as shown in fig1 , the energy source 12 of the preferred embodiments functions to provide a source of ablation energy and emit an energy beam 20 . the energy source 12 is preferably moved and positioned within a patient , preferably within the left atrium of the heart of the patient , such that the energy source 12 is positioned at an appropriate angle and distance ( defined herein as “ gap ”) with respect to the target tissue . the angle is preferably any suitable angle and gap such that the emitted energy beam 20 propagates into the target tissue , and preferably generates a transmural lesion ( i . e . a lesion through the thickness of the tissue ; the lesion preferably creates a conduction block , as described below ). angles between 40 and 140 degrees are preferable because in this range the majority of the energy beam will preferably propagate into the tissue and the lesion depth needed to achieve transmurality is preferably minimally increased from the ideal orthogonal angle . the gap between 0 mm and 30 mm is preferably because in this range the energy density of the beam is sufficient to achieve a transmural lesion . as shown in fig1 , the energy source 12 is preferably coupled to a housing 16 . the energy source 12 and the housing 16 are preferably positionable within the patient . for example , the housing 16 , and the energy source 12 within it , are preferably moved to within the left atrium of the heart ( or in any other suitable location ) and , once positioned there , are preferably moved to direct the energy source 12 and the emitted energy beam 20 towards the target tissue at an appropriate angle and gap . the housing 16 of assembly 10 , further functions to provide a barrier between the face of the energy source 12 and the blood residing in the patient , such as in the atrium of the heart . if fluid flow is not incorporated in the assembly , and the transducer face is directly in contact with blood , the blood will coagulate on the surface of the energy source 12 . additionally , there is a possibility of forming a blood clot at the interface of the energy source 12 and the surrounding blood . the flow of a cooling fluid 28 keeps the blood from contacting the energy source 12 , thus avoiding the formation of blood clots . the flow rate is preferably 1 ml per minute , but may alternatively be any other suitable flow rate to maintain the fluid column , keep the separation between the blood and the face of the energy source 12 , cool the energy source 12 , and / or cool the tissue being treated . furthermore , the housing 16 , and the energy source 12 within it , are preferably moved along an ablation path such that the energy source 12 provides a partial or complete zone of ablation along the ablation path . the zone of ablation along the ablation path preferably has any suitable geometry to provide therapy , such as providing a conduction block for treatment of atrial fibrillation in a patient . the zone of ablation along the ablation path may alternatively provide any other suitable therapy for a patient . alternatively , the ablation could be a single spot or a very small circle , ablating a focal source of electrical activity . a linear ablation path is preferably created by moving the housing 16 , and the energy source 12 within it , along an x , y , and / or z - axis . as shown in fig2 , the motion of the distal portion of the elongate member 18 in and out of the guide sheath portion gs of the elongate member 18 is represented by the z - axis . a generally circular or elliptical ablation path is preferably created by rotating the energy source 12 about an axis ( for example , as defined by the wires w in fig2 ). the elongate member 18 , along with the housing 16 and the energy source 12 , is preferably rotated , as shown in fig2 . alternatively , in other configurations , the energy source 12 is rotated within the housing 16 . for example , as shown in fig2 , the housing 16 points towards the wall tissue 2174 of an atrium . the energy source 12 in the housing 16 emits an energy beam to establish an ablation window 2172 . as the housing 16 ( and an elongate member 18 , described below ) are rotated ( as shown by arrow 2124 in fig2 ), the ablation window 2172 sweeps a generally circular ablation path 2176 creating a section of a conical shell . further , in this example , it may be desirable to move the elongate member forwards or backwards along the z - axis to adjust for possible variations in the anatomy . although the ablation path is preferably linear or circular , any suitable ablation path may be created by any suitable combination of movement in the x , y , and z axes and rotational movement . as shown in fig1 , the energy delivery system 10 of the preferred embodiments may also include an elongate member 18 , coupled to the energy source 12 . the elongate member 18 is preferably a catheter made of a flexible multi - lumen tube , but may alternatively be a cannula , tube or any other suitable elongate structure having one or more lumens . the elongate member 18 of the preferred embodiments functions to accommodate pull wires , fluids , gases , energy delivery structures , electrical wires , therapy catheters , navigation catheters , pacing catheters , connections and / or any other suitable device or element . as shown in fig1 , the elongate member 18 preferably includes a housing 16 positioned at a distal portion of the elongate member 18 . the elongate member 18 further functions to move and position the energy source 12 and / or the housing 16 within a patient , such that the emitted energy beam 20 propagates into the target tissue at an appropriate angle and gap and the energy source 12 and / or the housing 16 is moved along an ablation path such that the energy source 12 provides a partial or complete zone of ablation along the ablation path . the energy source 12 is preferably an ultrasound transducer that emits an ultrasound beam , but may alternatively be any suitable energy source that functions to provide a source of ablation energy . suitable sources of ablation energy include but are not limited to , radio frequency ( rf ) energy , microwaves , photonic energy , and thermal energy . the therapy could alternatively be achieved using cooled sources ( e . g ., cryogenic fluid ). the energy delivery system 10 preferably includes a single energy source 12 , but may alternatively include any suitable number of energy sources 12 . the ultrasound transducer is preferably made of a piezoelectric material such as pzt ( lead zirconate titanate ) or pvdf ( polyvinylidine difluoride ), or any other suitable ultrasound emitting material . for simplicity , the front face of the transducer is preferably flat , but may alternatively have a more complex geometry such as either concave or convex to achieve an effect of a lens or to assist in apodization selectively decreasing the vibration of a portion or portions of the surface of the transducer and management of the propagation of the energy beam 20 . the transducer preferably has a circular geometry , but may alternatively be elliptical , polygonal , or any other suitable shape . the transducer may further include coating layers which are preferably thin layer ( s ) of a suitable material . some suitable transducer coating materials may include graphite , metal - filled graphite , gold , stainless steel , nickel - cadmium , silver , a metal alloy , and amalgams or composites of suitable materials . for example , as shown in fig1 , the front face of the energy source 12 is preferably coupled to one or more acoustic matching layers 34 . the matching layer ( s ) preferably functions to increase the efficiency of coupling of the energy beam 20 into the surrounding fluid 28 . the matching layer 34 is preferably made from a plastic such as parylene , preferably placed on the transducer face by a vapor deposition technique , but may alternatively be any suitable material , such as graphite , metal - filled graphite , ceramic , or composites added to the transducer in any suitable manner . the energy source 12 is preferably one of several variations . in a first variation , as shown in fig3 , the energy source 12 is a disc with a flat front surface . in a second variation , as shown in fig4 a and 4b , the energy source 12 ′ includes an inactive portion 42 . in this variation , the inactive portion 42 does not emit an energy beam when the energy source 12 is energized , or may alternatively emit an energy beam with a very low ( substantially zero ) energy . the inactive portion 42 preferably functions to aid in the temperature regulation of the energy source , i . e . preventing the energy source from becoming too hot . in a full disk transducer , as shown in fig3 , the center portion of the transducer generally becomes the hottest portion of the transducer while energized . by removing the center portion or a portion of the center portion of the transducer , the energy emitted from the transducer is preferably distributed differently across the transducer , and the heat of the transducer is preferably more easily dissipated . the inactive portion 42 is preferably a hole or gap defined by the energy source 12 ′. in this variation , a coolant source may be coupled to , or in the case of a coolant fluid , it may flow through the hole or gap defined by the energy source 12 ′ to further cool and regulate the temperature of the energy source 12 ′. the inactive portion 42 may alternatively be made of a material with different material properties from that of the energy source 12 ′. for example , the material is preferably a metal , such as copper , which functions to draw or conduct heat away from the energy source 12 . alternatively , the inactive portion is made from the same material as the energy source 12 , but with the electrode plating removed or disconnected from the electrical attachments 14 and or the generator . the inactive portion 42 is preferably disposed along the full thickness of the energy source 12 ′, but may alternatively be a layer of material on or within the energy source 12 ′ that has a thickness less than the full thickness of the energy source 12 ′. as shown in fig4 a , the energy source 12 ′ is preferably a doughnut - shaped transducer . as shown , the transducer preferably defines a hole ( or inactive portion 42 ) in the center portion of the transducer . the energy source 12 ′ of this variation preferably has a circular geometry , but may alternatively be elliptical , polygonal ( fig4 b ), or any other suitable shape . the energy source 12 ′ preferably includes a singular , circular inactive portion 42 , but may alternatively include any suitable number of inactive portions 42 of any suitable geometry , as shown in fig4 b . the total energy emitted from the energy source 12 is related to the surface area of the energy source 12 that is active ( i . e . emits energy beam 20 ). therefore , the size and location of inactive portions 42 preferably reduce heat build - up in the energy source 12 , while allowing the energy source 12 to provide as much output energy as possible or as desired . in a third variation , as shown in fig5 , the energy source 12 ″ preferably includes a plurality of annular transducers 44 . the plurality of annular transducers is preferably a plurality concentric rings , but may alternatively have any suitable configuration with any suitable geometry , such as elliptical or polygonal . the energy source 12 ″ may further include an inactive portion 42 , such as the center portion of the energy source 12 ″ as shown in fig5 . the plurality of annular transducers 44 preferably includes at least a first annular transducer and a second annular transducer . the first annular transducer preferably has material properties that differ from those of the second annular transducer , such that the first annular transducer emits a first energy beam that is different from the second energy beam emitted from the second annular ring . furthermore , the first annular transducer may be energized with a different frequency , phase , voltage , duty cycle , power , and / or for a different length of time from the second annular transducer . alternatively the first annular ring may be operated in a different mode from the second annular ring . for example , the first annular ring may be run in a therapy mode , such as ablate mode which delivers a pulse of ultrasound sufficient for heating of the tissue , while the second annular ring may be run in a diagnostic mode , such as a - mode , which delivers a pulse of ultrasound of short duration , which is generally not sufficient for heating of the tissue but functions to detect characteristics of the target tissue and / or environment in and around the energy delivery system . the first annular transducer may further include a separate electrical attachment 14 from that of the second annular transducer . alternatively , the annular rings could be energized with the appropriate electrical signals such that they shape the beam 20 to optimize the energy density along the beam for desired ablation performance . in a fourth variation , as shown in fig6 , the energy source 12 ″′ preferably includes a grid of transducer portions 46 . the grid of transducer portions 46 preferably has any suitable geometry such as circular , rectangular ( as shown in fig6 ), elliptical , polygonal , or any other suitable geometry . the energy source 12 ′ in this variation may further include a transducer portion that is inactive , such as an inactive portion as described in the second variation of the energy source 12 ′. the grid of transducer portions 46 preferably includes at least a first transducer portion and a second transducer portion . in a first version , the first transducer portion and the second transducer portion are preferably portions of a single transducer with a single set of material properties . the first transducer portion is preferably energized with a different frequency , phase , voltage , duty cycle , power , and / or for a different length of time from the second transducer portion . furthermore the first transducer portion may be operated in a different mode from the second transducer portion . for example , the first transducer portion may operate in a therapy mode , such as ablate mode , while the second transducer portion may operate in a diagnostic mode , such as a - mode . in this version , the first transducer portion may further include a separate electrical attachment 14 from that of the second transducer portion . for example , the first transducer portion may be located towards the center of the energy source 12 ′ and the second transducer portion may be located towards the outer portion of the energy source 12 ′ and the second transducer portion may be energized while the first transducer portion remains inactive . in a second version , the first transducer portion preferably has material properties that differ from those of the second transducer portion , such that the first transducer portion emits a first energy beam that is different from the second energy beam emitted from the second transducer portion . in this version , the first transducer portion may also be energized with a different frequency , voltage , duty cycle , power , and / or for a different length of time from the second transducer portion . alternatively , the shape of the energy beam 20 can be modified using the appropriate transducer portions driven by the appropriate electrical signals . an example of this is commonly referred to as phase array beam forming . as shown in fig1 , the electrical attachment 14 of the preferred embodiments functions to energize the energy source 12 such that it emits an energy beam 20 . in use , as the energy source 12 is energized , it emits an energy beam 20 towards targeted tissue . as the energy is transferred from the energy beam 20 into the tissue , the targeted tissue portion is preferably heated sufficiently to achieve ablation . as shown in fig1 , the electrical attachment 14 is preferably coupled to the energy source 12 . the energy delivery system 10 preferably includes two electrical attachments 14 and 14 ′, but may alternatively include any suitable number of electrical attachments to energize the energy source 12 . the energy source 12 preferably has a first electrical attachment 14 coupled the front surface of the energy source 12 which is coupled to a suitably insulated wire 38 . the electrical attachment 14 is preferably accomplished by standard bonding techniques such as soldering , wire bonding , conductive epoxy , or swaging . the electrical attachment 14 is preferably placed closer to the edge of the energy source 12 so as not to disturb the energy beam 20 emitted by the energy source 12 upon being electrically energized . the energy source 12 preferably has a second electrical attachment 14 ′ coupled the back surface of the energy source 12 which is coupled to a suitably insulated wire 38 ′. wires 38 and 38 ′ together form a pair 38 ″, which are preferably a twisted shielded pair , a miniature coaxial cable , a metal tube braid , or are coupled in any other suitable method . the electrical attachment ( s ) 14 may alternatively be coupled to the energy source 12 in any other suitable fashion in any other suitable configuration . the energy delivery system 10 of the preferred embodiments also includes an electrical generator ( not shown ) that functions to provide power to the energy source 12 via the electrical attachment ( s ) 14 . the energy source 12 is preferably coupled to the electrical generator by means of the suitably insulated wires 38 and 38 ′ connected to the electrical attachments 14 and 14 ′ coupled to the two faces of the energy source 12 . when energized by the generator the energy source 12 emits energy . the generator provides an appropriate signal to the energy source 12 to create the desired energy beam 20 . the frequency is preferably in the range of 1 to 30 mhz and more preferably in the range of 5 to 25 mhz . the energy of the energy beam 20 is determined by the excitation voltage applied to the energy source 12 , the duty cycle , and the total time the voltage is applied . the voltage is preferably in the range of 5 to 200 volts peak - to - peak . in addition , a variable duty cycle is preferably used to control the average power delivered to the energy source 12 . the duty cycle preferably ranges from 0 % to 100 %, with a repetition frequency that is preferably faster than the time constant of thermal conduction in the tissue . one such appropriate repetition frequency is approximately 40 khz . energy beam and tissue interaction . when energized with an electrical signal or pulse train by the electrical attachment 14 and / or 14 ′, the energy source 12 emits an energy beam 20 ( such as a sound pressure wave ). the properties of the energy beam 20 are determined by the characteristics of the energy source 12 , the matching layer 34 , the backing 22 ( described below ), and the electrical signal from electrical attachment 14 . these elements determine the frequency , bandwidth , beam pattern , and amplitude of the energy beam 20 ( such as a sound wave ) propagated into the tissue . as shown in fig7 , the energy source 12 emits energy beam 20 such that it interacts with tissue 276 and forms a lesion ( zone of ablation 278 ). the energy beam 20 is preferably an ultrasound beam . the tissue 276 is preferably presented to the energy beam 20 within the collimated length l . the front surface 280 of the tissue 276 is at a distance d ( 282 ) away from the face of the housing 16 . as the energy beam 20 travels through the tissue 276 , its energy is absorbed and scattered by the tissue 276 and most of the ablation energy is converted to thermal energy . this thermal energy heats the tissue to temperatures higher than the surrounding tissue resulting in a heated zone 278 . in the zone 278 where the tissue is heated , the tissue cells arc preferably rendered dead due to heat . the temperatures of the tissue are preferably above the temperature where cell death occurs in the heated zone 278 and therefore , the tissue is said to be ablated . hence , the zone 278 is preferably referenced as the ablation zone or lesion . the shape of the lesion or ablation zone 278 formed by the energy beam 20 depends on the characteristics of suitable combination factors such as the energy beam 20 , the energy source 12 ( including the material , the geometry , the portions of the energy source 12 that are energized and / or not energized , etc . ), the matching layer 34 , the backing 22 ( described below ), the electrical signal from electrical attachment 14 ( including the frequency , the voltage , the duty cycle , the length and shape of the signal , etc . ), and the characteristics of target tissue into which the beam 20 propagates and the length of contact or dwell time . the characteristics of the target tissue include the thermal transfer properties and the ultrasound absorption , attenuation , and backscatter properties of the target tissue and surrounding tissue . the shape of the lesion or ablation zone 278 formed by the energy beam 20 is preferably one of several variations due to the energy source 12 ( including the material , the geometry , the portions of the energy source 12 that are energized and / or not energized , etc .). in a first variation of the ablation zone 278 , as shown in fig7 , the energy source 12 is a full disk transducer and the ablation zone 278 is a tear - shaped lesion . the diameter d 1 of the zone 278 is smaller than the diameter d of the beam 20 at the tissue surface 280 and further , the outer layer ( s ) 276 ′ of tissue 276 preferably remain substantially undamaged . this is due to the thermal cooling provided by the surrounding fluid ( cooling fluid and / or blood ), that flows past the tissue surface 280 . more or less of the outer layers 276 ′ of tissue 276 may be spared or may remain substantially undamaged due to the amount that the tissue surface 280 is cooled and / or the characteristics of the energy delivery system 10 ( including the energy source 12 and the energy beam 20 ). the energy deposited in the ablation zone 278 preferably interacts with the sub - surface layer ( s ) of tissue such that the endocardial surface remains pristine ( and / or not charred ). as the energy beam 20 travels deeper into the tissue , the thermal cooling is provided by the surrounding tissue , which is not as efficient as that on the surface . the result is that the ablation zone 278 has a larger diameter d 2 than d 1 as determined by the heat transfer characteristics of the surrounding tissue as well as the continued input of the energy from the beam 20 . as the beam 20 is presented to the tissue for an extended period of time , the ablation zone 278 extends into the tissue , but not indefinitely . there is a natural limit of the depth 288 of the ablation zone 278 as determined by the factors such as the attenuation and absorption of the ultrasound energy as the energy beam 20 propagates into the tissue , heat transfer provided by the healthy surrounding tissue , and the divergence of the beam beyond the collimated length l . during this ultrasound - tissue interaction , the ultrasound energy is being absorbed by the tissue , and therefore less and less of it is available to travel further into the tissue . thus a correspondingly smaller diameter heated zone is developed in the tissue , and the overall result is the formation of the heated ablation zone 278 , which is in the shape of an elongated tear limited to a depth 288 into the tissue . in a second variation , as shown in fig9 , the ablation zone 278 ′ has a shorter depth 288 ′. in this variation , the lesion preferably has a more blunt shape than ablation zone 278 ( fig7 ). one possible lesion geometry of this second variation may be tooth shaped geometry , as shown in fig9 , but may alternatively have any suitable shape such as a blunted tear shape , a circular shape , or an elliptical shape . as shown in fig9 , zone 278 ′ ( similarly to zone 278 in fig7 ) has a diameter d 1 of the zone 278 smaller than the diameter d of the beam 20 at the tissue surface 280 due to the thermal cooling provided by the surrounding fluid flowing past the tissue surface 280 . in this variation , the energy source 12 ′ preferably has an inactive portion 42 located at the center of the energy source 12 , such that energy source is a doughnut - shaped transducer which emits an energy beam 20 that is generally more diffused , with a broader , flatter profile , than the energy beam 20 of the first variation ( fig7 ). the energy beam 20 emitted from the doughnut - shaped transducer , as shown in fig9 , preferably has a reduced peak intensity along the midline of the energy beam ( as shown in cross section by the dotted lines in fig9 ). with this ultrasound tissue interaction , the reduced peak intensity along the midline of the energy beam is being absorbed by the tissue , and less and less of the energy is available to travel further into the tissue , forming a blunter lesion than in the first variation . the size and characteristics of the ablation zone 278 also depend on the frequency and voltage applied to the energy source 12 to create the desired energy beam 20 . for example , as the frequency increases , the depth of penetration of ultrasound energy into the tissue is reduced resulting in an ablation zone 278 ( fig7 ) of shallower depth 288 . the frequency is preferably in the range of 1 to 30 mhz and more preferably in the range of 5 to 25 mhz . the energy of the energy beam 20 is determined by the excitation voltage applied to the energy source 12 for a transducer fabricated from pzt material , for example . the voltage is preferably in the range of 5 to 200 volts peak - to - peak . in addition , a variable duty cycle is preferably used to control the average power delivered to the energy source 12 . the duty cycle preferably ranges from 0 % to 100 %, with a repetition frequency of approximately 40 khz , which is preferably faster than the time constant of thermal conduction in the tissue . when applied to an energy source 12 of approximately 2 . 5 mm diameter , this results in an ablation zone 278 , which is created within 1 to 5 seconds , and has a depth 288 of approximately 5 mm , and a maximum diameter of approximately 2 . 5 mm in correspondence to the diameter of the energy source 12 , for an average acoustic power level preferably of 0 . 3 to 10 watts , and more preferably 2 to 6 watts . the size and characteristics of the ablation zone 278 also depend on the time the targeted tissue is contacted by the energy beam 20 , as shown in fig8 a - 8d , which exemplify the formation of the lesion at times t 1 , t 2 , t 3 and t 4 , respectively . the ablation zone 278 in the tissue is formed by the conversion of the ultrasound energy to thermal energy in the tissue . as the energy density in the beam 20 is highest near the front surface 280 of the tissue 276 at time t 1 , heat is created which begins to form the lesion 278 ( fig8 a ). as time passes on to t 2 , and t 3 ( fig8 b and 8c ), additional energy is delivered into the tissue such that the ablation zone 278 continues to grow in diameter and depth . this time sequence from t 1 to t 3 preferably takes as little as 1 to 5 seconds , depending on the ultrasound energy density . as the incidence of the ultrasound beam is continued beyond time t 3 , the ablation lesion 278 grows slightly in diameter and length , and then stops growing due to the steady state achieved in the energy transfer from its ultrasound form to the thermal form balanced by the dissipation of the thermal energy into the surrounding tissue . the example shown in fig8 d shows the lesion after an exposure t 4 of approximately 30 seconds to the energy beam 20 . thus the lesion reaches a natural limit in size and does not grow indefinitely . the ultrasound energy density preferably determines the speed at which the ablation occurs . the acoustic power delivered by the energy source 12 divided by the cross sectional area of the beam 20 determines the energy density per unit time . effective acoustic power preferably ranges from 0 . 3 watt to & gt ; 10 watts , and the corresponding power densities preferably range from 6 watts / cm 2 to & gt ; 200 watts / cm 2 . these power densities are developed in the ablation zone . as the beam diverges beyond the ablation zone , the power density falls such that ablation will not occur , regardless of the time exposure . although the shape of the ablation zone 278 is preferably one of several variations , the shape of the ablation zone 278 may be any suitable shape and may be altered in any suitable fashion due to any suitable combination of the energy beam 20 , the energy source 12 ( including the material , the geometry , etc . ), the matching layer 34 , the backing 22 ( described below ), the electrical signal from electrical attachment 14 ( including the frequency , the voltage , the duty cycle , the length of the pulse , etc . ), and the target tissue the beam 20 propagates into and the length of contact or dwell time . the sensor . the energy delivery system 10 of the preferred embodiments also includes a sensor and / or the energy source 12 further functions to detect the gap ( the distance of the tissue surface from the energy source 12 ), the thickness of the tissue targeted for ablation , the characteristics of the ablated tissue , the incident beam angle , and any other suitable parameter or characteristic of the tissue and / or the environment around the energy delivery system 10 , such as the temperature . by detecting information , the sensor ( coupled to the processor , as described below ) preferably functions to guide the therapy provided by the ablation of the tissue . the sensor is preferably one of several variations . in a first variation , the sensor is preferably an ultrasound transducer that functions to detect information with respect to the gap , the thickness of the tissue targeted for ablation , the characteristics of the ablated tissue , and any other suitable parameter or characteristic . the sensor preferably has a substantially identical geometry as the energy source 12 to insure that the area diagnosed by the sensor is substantially identical to the area to be treated by the energy source 12 . more preferably , the sensor is the same transducer as the transducer of the energy source , wherein the energy source 12 further functions to detect information by operating in a different mode ( such as a - mode , defined below ). the sensor of the first variation preferably utilizes a burst of ultrasound of short duration , which is generally not sufficient for heating of the tissue . this is a simple ultrasound imaging technique , referred to in the art as a mode , or amplitude mode imaging . as shown in fig1 , sensor 40 preferably sends a burst 290 of ultrasound towards the tissue 276 . a portion of the beam is reflected and / or backscattered as 292 from the front surface 280 of the tissue 276 and the tissue at the front surface 280 . this returning sound wave 292 is detected by the sensor 40 a short time later and converted to an electrical signal , which is sent to the electrical receiver ( not shown ). the returning sound wave 292 is delayed by the amount of time it takes for the sound to travel from the sensor 40 to the front boundary 280 of the tissue 276 and the tissue 276 near the boundary 280 and back to the sensor 40 . this travel time represents a delay in receiving the electrical signal from the sensor 40 . based on the speed of sound in the intervening media ( fluid 286 and blood 284 ), information regarding the gap distance d ( 282 ) is detected . as the sound beam travels further into the tissue 276 , a portion 293 of it is scattered from the lesion 278 being formed and travels towards the sensor 40 . again , the sensor 40 converts this sound energy into electrical signals and a processor ( described below ) converts this information into characteristics of the lesion formation such as depth of the lesion , etc . as the sound beam travels still further into the tissue 276 , a portion 294 of it is reflected from the back surface 298 and travels towards the transducer . again , the sensor 40 converts this sound energy into electrical signals and the processor converts this information into the thickness t ( 300 ) of the tissue 276 at the point of the incidence of the ultrasound burst 290 . as the catheter housing 16 is traversed in a manner 301 across the tissue 276 , the sensor 40 detects the gap distance d ( 282 ), lesion characteristics , and the tissue thickness t ( 300 ). the sensor preferably detects these parameters continuously , but may alternatively detect them periodically or in any other suitable fashion . this information is used to manage ablation of the tissue 276 during therapy as discussed below . in a second variation , the sensor is a temperature sensor that functions to detect the temperature of the target tissue , the surrounding environment , the energy source 12 , the coolant fluid as described below , and / or the temperature of any other suitable element or area . the temperature senor is preferably a thermocouple , but may alternatively be any suitable temperature sensor , such as a thermistor or an infrared temperature sensor . this temperature information gathered by the sensor is preferably used to manage ablation of the tissue 276 during therapy and to manage the temperature of the target tissue and / or the energy delivery system 10 as discussed below . the energy delivery system 10 of the preferred embodiments also includes a processor , coupled to the sensor 40 and to the electrical attachment 14 , that controls the electrical attachment 14 and / or the electrical signal delivered to the electrical attachment 14 based on the information from the sensor 40 . the processor is preferably a conventional processor , but may alternatively be any suitable device to perform the desired functions . the processor preferably receives information from the sensor such as information related to the gap distance , the thickness of the tissue targeted for ablation , the characteristics of the ablated tissue , and any other suitable parameter or characteristic . based on this information , the processor preferably controls the energy beam 20 emitted from the energy source 12 by modifying the electrical signal sent to the energy source 12 via the electrical attachment 14 such as the frequency , the voltage , the duty cycle , the length of the pulse , and / or any other suitable parameter . the processor preferably also controls the energy beam 20 by controlling which portions of the energy source 12 are energized and / or at which frequency , voltage , duty cycle , etc . different portions of the energy source 12 may be energized as described above with respect to the plurality of annular transducers 44 and the grid of transducer portions 46 of the energy source 12 ″ and 12 ″′ respectively . additionally , the processor may further be coupled to a fluid flow controller . the processor preferably controls the fluid flow controller to increase or decrease fluid flow based on the sensor detecting characteristics of the ablated tissue , of the unablated or target tissue , the temperature of the tissue and / or energy source , and / or the characteristics of any other suitable condition . by controlling the energy beam 20 ( and / or the cooling of the targeted tissue or energy source 12 ), the shape of the ablation zone 278 is controlled . for example , the depth 288 of the ablation zone is preferably controlled such that a transmural lesion ( a lesion through the thickness of the tissue ) is achieved . additionally , the processor preferably functions to minimize the possibility of creating a lesion beyond the targeted tissue , for example , beyond the outer atrial wall . if the sensor detects the lesion and / or the ablation window 2172 ( as shown in fig2 ) extending beyond the outer wall of the atrium or that the depth of the lesion has reached or exceeded a preset depth , the processor preferably turns off the generator and / or ceases to send electrical signals to the electrical attachment ( s ) 14 , 14 ′. additionally , the processor preferably functions to maintain a preferred gap distance . the gap distance is preferably between 0 mm and 30 mm , more preferably between 1 mm and 20 mm . if the sensor detects that the ablation window 2172 ( as shown in fig2 ) does not reach the outer wall of the atrium , the processor preferably repositions the energy delivery system . for example , as the housing 16 ( and an elongate member 18 , described below ) are rotated ( as shown by arrow 2124 in fig2 ), the ablation window 2172 preferably sweeps a generally circular ablation path 2176 creating a section of a conical shell . however , if the sensor determines that the ablation window 2172 does not reach the wall of the atrium , the processor preferably moves the elongate member forwards or backwards along the z - axis , or indicates that it should be moved , to adjust for the possible variations in the anatomy . in this example , the operator can reposition the elongate member , or the processor is preferably coupled to a motor drive unit or other control unit that functions to position the elongate member 18 . additionally , if the sensor detects that the depth of the lesion has either not reached or has exceeded the desired depth , the processor preferably adjusts the signal delivered to the energy source 12 , and / or adjusts the speed at which the beam moves along the ablation path 2176 , thereby adjusting the dwell time of the beam in the tissue . when the processor adjusts the signal delivered to the energy source , it can adjust the power and / or the frequency to modify the lesion depth . additional elements . as shown in fig1 and 3 , the energy delivery system 10 of the preferred embodiments also includes a backing 22 , coupled to the energy source 12 . the energy source 12 is preferably bonded to the end of a backing 22 by means of an adhesive ring 24 . backing 22 is preferably made of a metal or a plastic , such that it provides a heat sink for the energy source 12 . the attachment of the energy source 12 to the backing 22 is such that there is a pocket 26 between the back surface of the energy source 12 and the backing 22 . this pocket preferably contains a material with acoustic impedance significantly different than the material of the energy source 12 , and preferably creates an acoustically reflective surface . most of the ultrasound that would otherwise exit from the back of the energy source 12 is preferably redirected back into the energy source 12 from the pocket , and out through the front surface of the energy source 12 . additionally , the material in the pocket is also preferably a good thermal conductor , so that heat can be removed from the energy source , and electrically conductive such that it may connect the electrical wires to the rear surface of the energy source . the pocket is preferably one of several variations . in a first version , the backing 22 couples to the energy source at multiple points . for example , the backing preferably includes three posts that preferably couple to the outer portion such that the majority of the energy source 12 is not touching a portion of the backing . in this variation , a fluid or gel preferably flows past the energy source 12 , bathing preferably both the front and back surfaces of the energy source 12 . in a second variation , the pocket is an air pocket 26 between the back surface of the energy source 12 and the backing 22 . the air pocket 26 functions such that when the energy source 12 is energized by the application of electrical energy , the emitted energy beam 20 is reflected by the air pocket 26 and directed outwards from the energy source 12 . the backing 22 preferably defines an air pocket of a cylindrical shape , and more preferably defines an air pocket 26 that has an annular shape . the backing defines an annular air pocket by further including a center post such that the backing is substantially tripod shaped when viewed in cross section , wherein the backing is coupled to the energy source 12 towards both the outer portion of the energy source and towards the center portion of the energy source . the air pocket 26 may alternatively be replaced by any other suitable material such that a substantial portion of the energy beam 20 is directed outwards from the energy source 12 . while the energy source 12 is emitting an energy beam 20 , the energy source may become heated . the energy source 12 is preferably maintained within a safe operating temperature range by cooling the energy source 12 . cooling of the energy source 12 is preferably accomplished by contacting the energy source 12 with a fluid , for example , saline or any other physiologically compatible fluid , preferably having a lower temperature relative to the temperature of the energy source 12 . in a first version , the temperature of the fluid is preferably cold enough that it both cools the transducer and the target tissue . in this version , the temperature of the fluid or gel is preferably between - 5 and 5 degrees celsius and more preferably substantially equal to zero degrees celsius . in a second version , the temperature of the fluid is within a temperature range such that the fluid cools the energy source 12 , but it does not cool the target tissue however , and may actually warm the target tissue . the fluid may alternatively be any suitable temperature to sufficiently cool the energy source 12 . by way of an example , as shown in fig3 , the backing 22 preferably has a series of grooves 36 disposed longitudinally along the outside wall that function to provide for the flow of a cooling fluid 28 substantially along the outer surface of backing 22 and past the face of the energy source 12 . the series of grooves may alternatively be disposed along the backing in any other suitable configuration , such as helical . the resulting fluid flow lines arc depicted as 30 in fig1 . the flow of the cooling fluid is achieved through a lumen 32 . the fluid used for cooling the transducer preferably exits the housing 16 through the end of the housing 16 or through one or more apertures . the apertures are preferably a grating , screen , holes , drip holes , weeping structure or any of a number of suitable apertures . the fluid preferably exits the housing 16 to contact the target tissue and to cool the tissue . the energy delivery system 10 of the preferred embodiments also includes a lens , coupled to the energy source 12 , that functions to provide additional flexibility in adjusting the beam pattern of the energy beam 20 . the lens is preferably a standard acoustic lens , but may alternatively be any suitable lens to adjust the energy beam 20 in any suitable fashion . for example , an acoustic lens could create a beam that is more uniformly collimated , such that the minimum beam width d ′ approaches the diameter of the disc d . this will provide a more uniform energy density in the ablation window 2172 , and therefore more uniform lesions as the tissue depth varies within the window . a lens could also be used to move the position of the minimum beam width d ′, for those applications that may need either shallower or deeper lesion . this lens could be fabricated from plastic or other material with the appropriate acoustic properties , and bonded to the face of energy source 12 . alternatively , the energy source 12 itself may have a geometry such that it functions as a lens , or the matching layer or coating of the energy source 12 may function as a lens . although omitted for conciseness , the preferred embodiments include every combination and permutation of the various energy sources 12 , electrical attachments 14 , energy beams 20 , sensors 40 , and processors . as a person skilled in the art will recognize from the previous detailed description and from the figures and claim , modifications and changes can be made to the preferred embodiments of the invention without departing from the scope of this invention defined in the following claim . while preferred embodiments of the present invention have been shown and described herein , it will be obvious to those skilled in the art that such embodiments are provided by way of example only . numerous variations , changes , and substitutions will now occur to those skilled in the art without departing from the invention . it should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention . it is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby . | 0 |
referring to fig1 - 6 , fig1 - 6 illustrate a method for fabricating a semiconductor device having metal gate , in which the method preferably conducts a gate - first approach accompanying a high - k first fabrication . as shown in fig1 , a substrate 100 , such as a silicon substrate or a silicon - in - insulator ( soi ) substrate is provided . a plurality of shallow trench isolations ( sti ) 102 used for electrical isolation is also formed in the substrate 100 . next , a gate insulating layer 104 composed of oxide or nitride is formed on the surface of the substrate 100 , in which the gate insulating layer 104 is preferably used as an interfacial layer . next , a stacked film composed of a high - k dielectric layer 106 , a polysilicon layer 108 , and a hard mask 110 is formed on the gate insulating layer 104 . the polysilicon layer 108 is preferably used as a sacrificial layer , which could be composed of undoped polysilicon , polysilicon having n + dopants , or amorphous polysilicon material . the high - k dielectric layer 106 could be a single - layer or a multi - layer structure containing metal oxide layer such as rare earth metal oxide , in which the dielectric constant of the high - k dielectric layer 106 is substantially greater than 20 . for example , the high - k dielectric layer 106 could be selected from a group consisting of hafnium oxide ( hfo 2 ), hafnium silicon oxide ( hfsio ), hafnium silicon oxynitride ( hfsion ), aluminum oxide ( alo ), lanthanum oxide ( la 2 o 3 ), lanthanum aluminum oxide ( laalo ), tantalum oxide , ta 2 o 3 , zirconium oxide ( zro 2 ), zirconium silicon oxide ( zrsio ), hafnium zirconium oxide ( hfzro ), strontium bismuth tantalite ( srbi 2 ta 2 o 9 , sbt ), lead zirconate titanate ( pbzr x ti 1 - x o 3 , pzt ), and barium strontium titanate ( ba x sr 1 - x tio 3 , bst ). the hard mask 110 could be composed of sio 2 , sin , sic , or sion . next , as shown in fig2 , a patterned photoresist ( not shown ) is formed on the hard mask 110 , and a pattern transfer is performed by using the patterned photoresist as mask to partially remove the hard mask 110 , the polysilicon layer 108 , the high - k dielectric layer 106 , and the gate insulating layer 104 through single or multiple etching processes . after stripping the patterned photoresist , a gate structure 112 is formed on the substrate 100 . next , a first seal layer 114 composed of silicon nitride is formed on the sidewall surface of the gate structure 112 and the surface of the substrate 100 , and a lightly doped ion implantation is carried out to implant n - type or p - type dopants into the substrate 100 adjacent to two sides of the gate structure 112 for forming a lightly doped drain 116 . as shown in fig3 , a second seal layer 118 composed of silicon oxide and a third seal layer 120 composed of silicon nitride are sequentially formed on the substrate 100 and covering the gate structure 112 and the first seal layer 114 . in this embodiment , the second seal layer 118 is preferably composed of silicon oxide and thus having a different etching rate with respect to the first seal layer 114 underneath . next , as shown in fig4 , a dry etching process is performed to partially remove the third seal layer 120 and stop on the surface of the second seal layer 118 , another dry etching is carried out to partially remove the second seal layer 118 and the first seal layer 114 , and a wet etching process is performed to remove remaining polymers from the above etching process for forming a first spacer 122 composed of l - shaped first seal layer , an l - shaped second seal layer 118 , and a second spacer 124 composed of the remaining third seal layer 120 on the sidewall of the gate structure 112 . in an alternative approach to the above steps , another embodiment of the present invention could also perform a dry etching process to partially remove the third seal layer 120 and stop on the surface of the second seal layer 118 , perform another dry etching process to partially remove the third seal layer 118 , and perform a wet etching process to partially remove the first seal layer 114 for forming the above l - shaped first spacer 122 , the l - shaped second seal layer 118 , and the second spacer 124 . next , an ion implantation process is performed to implant n - type or p - type dopants into the substrate 100 adjacent to two sides of the aforementioned spacer for forming a source / drain region 126 . in this embodiment , a selective strain scheme ( sss ) can be used for forming the source / drain region 126 . for example , a selective epitaxial growth ( seg ) can be used to form the source / drain region 126 , such that when the source / drain region 126 is a p - type source / drain , epitaxial silicon layers with silicon germanium ( sige ) can be used to form the p - type source / drain region 126 , whereas when the source / drain region 126 is an n - type source / drain region 126 , epitaxial silicon layers with silicon carbide ( sic ) can be used to form the n - type source / drain region 126 . additionally , silicides ( not shown ) are formed on the surface of the source / drain region 126 . thereafter , a contact etch stop layer ( cesl ) 128 and an inter - layer dielectric ( ild ) 130 layer are sequentially formed on the substrate 100 . since the steps of forming the above mentioned elements are well - known to those skilled in the art , the details of which are omitted herein for the sake of brevity . as shown in fig5 , a planarizing process , such as a chemical mechanical polishing ( cmp ) is conducted to partially remove the ild layer 130 , the cesl 128 , and the patterned hard mask 110 until exposing the polysilicon layer 108 . another adequate etching process could then be carried to remove the polysilicon layer 108 to form a trench 132 . during this step , the high - k dielectric layer 106 could be used as an etching stop layer to protect the gate insulating layer 104 underneath from the etching process conducted previously . as the aforementioned planarizing process and etching process are well known to those skilled in the art , the details of which are omitted herein for the sake of brevity . next , as shown in fig6 , a work function metal layer 134 , a barrier layer 136 , and a low resistance metal layer 138 are formed sequentially to fill the trench 132 , in which the work functional metal layer 134 could include a p - type work function metal or an n - type work functional metal . a planarizing process is conducted thereafter to partially remove the low resistance metal layer 138 , the barrier layer 136 , and work function metal layer 134 for completing the fabrication of a semiconductor device having metal gate 140 . referring to fig7 - 12 , fig7 - 12 illustrate a method for fabricating a semiconductor device having metal gate according to another embodiment of the present invention , in which this embodiment also employs a gate - first fabrication with a high - k first process . as shown in fig7 , a substrate 200 , such as a silicon substrate or a silicon - in - insulator ( soi ) substrate is provided . a plurality of shallow trench isolations ( sti ) 202 used for electrical isolation is also formed in the substrate 200 . next , a gate insulating layer 204 composed of oxide or nitride is formed on the surface of the substrate 200 , in which the gate insulating layer 204 is preferably used as an interfacial layer . next , a stacked film composed of a high - k dielectric layer 206 , a polysilicon layer 208 , and a hard mask 210 is formed on the gate insulating layer 204 . the polysilicon layer 208 is preferably used as a sacrificial layer , which could be composed of undoped polysilicon , polysilicon having n + dopants , or amorphous polysilicon material . next , as shown in fig8 , a patterned photoresist ( not shown ) is formed on the hard mask 210 , and a pattern transfer is performed by using the patterned photoresist as mask to partially remove the hard mask 210 , the polysilicon layer 208 , the high - k dielectric layer 206 , and the gate insulating layer 204 through single or multiple etching processes . after stripping the patterned photoresist , a gate structure 212 is formed on the substrate 200 . next , a first seal layer ( not shown ) composed of silicon nitride is formed on the sidewall surface of the gate structure 212 and the surface of the substrate 200 , and an etching back process performed to partially remove the first seal layer on the substrate 200 for forming a first spacer 214 on the sidewall of the gate structure 212 . next , a lightly doped ion implantation is carried out to implant n - type or p - type dopants into the substrate 200 adjacent to two sides of the gate structure 212 for forming a lightly doped drain 216 . a second seal layer 218 composed of silicon oxide is then covered on the gate structure 212 , the first spacer 214 , and the surface of the substrate 200 . as shown in fig9 , a third seal layer 220 composed of silicon nitride is formed on the substrate 200 and covering the gate structure 212 and the second seal layer 218 . in this embodiment , the second seal layer 218 is preferably composed of silicon oxide and thus having a different etching rate with respect to the third seal layer 220 above . as shown in fig1 , a dry etching process is performed to partially remove the third seal layer 220 and stop on the surface of the second seal layer 218 , and a wet etching process is performed to partially remove the second seal layer 218 for forming a first spacer 214 , an l - shaped second seal layer 218 , and a second spacer 222 on the sidewall of the gate structure 212 . next , an ion implantation process is performed to implant n - type or p - type dopants into the substrate 200 adjacent to two sides of the aforementioned spacer for forming a source / drain region 226 . in this embodiment , a selective strain scheme ( sss ) can be employed for forming the source / drain region 226 . for example , a selective epitaxial growth ( seg ) can be used to form the source / drain region 226 , such that when the source / drain region 226 is a p - type source / drain , epitaxial silicon layers with silicon germanium ( sige ) can be used to form the p - type source / drain region 226 , whereas when the source / drain region 226 is an n - type source / drain region 226 , epitaxial silicon layers with silicon carbide ( sic ) can be used to form the n - type source / drain region 226 . additionally , silicides ( not shown ) are formed on the surface of the source / drain region 226 . thereafter , a contact etch stop layer ( cesl ) 228 and an inter - layer dielectric ( ild ) 230 layer are sequentially formed on the substrate 200 . since the steps of forming the above mentioned elements are well - known to those skilled in the art , the details of which are omitted herein for the sake of brevity . as shown in fig1 , a planarizing process , such as a chemical mechanical polishing ( cmp ) is conducted to partially remove the ild layer 230 , the cesl 228 , and the hard mask 210 until exposing the polysilicon layer 208 . another adequate etching process could then be carried to remove the polysilicon layer 208 to form a trench 232 . in this step , the high - k dielectric layer 206 could be served as an etching stop layer to protect the gate insulating layer 204 underneath from the etching process conducted previously . as the aforementioned planarizing process and etching process are well known to those skilled in the art , the details of which are omitted herein for the sake of brevity . next , as shown in fig1 , a work function metal layer 234 , a barrier layer 236 , and a low resistance metal layer 238 are formed sequentially to fill the trench 232 , in which the work functional metal layer 234 could include a p - type work function metal or an n - type work functional metal . a planarizing process is conducted thereafter to partially remove the low resistance metal layer 238 , the barrier layer 236 , and work function metal layer 234 for completing the fabrication of a semiconductor device having metal gate 240 . overall , the present invention preferably forms an oxygen - free seal layer on the sidewall of the gate structure to protect the high - k dielectric layer in the gate structure before a lightly doped drain is formed . according to a preferred embodiment of the present invention , the oxygen - free seal layer is preferably composed of silicon nitride , and is adhered and contacting the hard mask , the polysilicon layer , the high - k dielectric layer , and gate insulating layer of the gate structure . as no material layer is formed on the sidewall of the gate structure for protecting the high - k dielectric layer before the formation of lightly doped drain in conventional art , the high - k dielectric layer is often damaged or removed during later processes including the wet cleaning conducted for lightly doped drain , oxide stripping , or spacer removal . by forming an oxygen - free seal layer on the sidewall of the gate structure before forming the lightly doped drain , the present invention could avoid the aforementioned problem found in conventional art and prevent the high - k dielectric layer from damage effectively . it should be noted that despite the aforementioned embodiment employs a gate - first and h - k first approach , the fabrication process of the present invention could also be applied to gate - first fabrication and high - k last fabrication , which are all within the scope of the present invention . for instance , the gate structure of the gate - first process preferably includes a gate insulating layer , a high - k dielectric layer disposed on the gate insulating layer and a polysilicon gate disposed on the high - k dielectric layer , in which the high - k dielectric layer preferably to be a linear high - k dielectric layer . the gate structure of a high - k last fabrication on the other hand , as shown in fig1 , includes a gate insulating layer 204 , a high - k dielectric layer 206 disposed on the gate insulating layer 204 , and a metal gate 240 disposed on the high - k dielectric layer 206 , in which the high - k dielectric layer 206 is a u - shaped high - k dielectric layer . those skilled in the art will readily observe that numerous modifications and alterations of the device and method may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims . | 7 |
a refrigerator 10 is shown in fig1 located in a space 11 having a floor 12 and a wall 13 that can be parts of a house trailer , a boat or the like . the refrigerator 10 , which is shown in diagrammatic form , is driven by an absorption refrigerating system of which only the insulated boiler housing 14 is shown . the remainder of the apparatus can be of any known type and requires no further description . the refrigerator is mounted on a support frame 15 having a rear part which accommodates a burner housing 16 for a gas burner . combustion air for the gas burner is drawn in from the ambient 17 through a valve 18 located in the wall 13 , and an air conduit 19 . the combustion gases from the burner pass through a flue 20 in the boiler housing 14 . the flue is connected to an exhaust gas conduit 21 opening into the valve 18 . it should be noted that the exhaust gases cannot enter the space 11 , but rather are discharged into the ambient 17 . in the front of the frame 15 and below the refrigerator 10 , are push buttons 22 connected by rods 23 to the control means 24 in the burner housing 16 . referring now to fig2 the burner housing 16 is shown on an enlarged scale , and also some parts connectecd to the housing . the burner housing 16 comprises a square or rectangular metal box with a sight glass 25 on the side directed towards the front of the refrigerator , and a door 26 on the opposite side , which faces the rear of the refrigerator , or the wall 13 . the door 26 is mainly for inspection and service of the burner , as well as the parts thereof , the door 26 also has a sight glass 27 and is hinged by a fork 28 to a bracket 29 secured to the housing 26 . at the side of the door 26 , which is opposite the fork 28 , the door plate is bent to form a groove 30 for a u - shaped spring device . the spring has a straight part 31 lying in the groove and on either side a coil 32 , and which by a hook 33 engages a holder 34 on the housing or on members connected to the housing . a wall of the groove 30 continues in a vertical metal plate edge with a central cut 35 ( fig4 ). a vertical part 37 of an angular metal plate engages the cut by a lug 36 , the other part 38 of the angular plate being horizontally disposed and fastened by a screw 39 to another horizontal metal plate 40 , which together with the part 38 encloses a part 41 of a frame 42 connected to the housing 16 . as seen in fig4 the plates 38 and 40 form a guide which permits movement of the plates by means of an upwardly bent part of the plate 40 forming a pressure plate 43 . the plate 38 has a lug 44 which projects through a hole in the pressure plate 43 . referring to fig2 a gas supply conduit 45 is shown mounted on the frame 42 . the latter can also contain a filter , disconnecting means , etc . the conduit can be connected to a safety shut - off valve 46 , with a sensor 47 positioned near the gas burner 48 in the housing 16 . when the burner operates , the sensor 47 is active and keeps the safety shut - off valve open so that gas from the conduit 45 passes through a conduit 49 and 50 to the gas burner 48 . however , the valve 46 can also be opened manually by a push button 51 in order to supply gas to the burner 48 , also when the latter is in an inactive condition . in the embodiment shown herein , the burner is lighted by a piezoelectric lighter 52 having a push button 53 by which a stroke can be applied to a piezoelectric crystal . the voltage thus generated is conducted from the crystal by a wire 54 to an electrode 55 whose tip is close to the burner 48 so that sparks are thrown off from the electrode 55 to the burner 48 . in fig2 the position of the flue is indicated by the dotted circle 56 over the burner housing and the connection for the supply of fresh air by another dotted circle 57 . in order to light the electrode 55 the following procedure is necessary : the push button 22 at the front of the support frame 15 and below the door 58 of the refrigerator 10 is depressed . the rod 23 transmits the movement to the pressure plate 43 which , as shown in fig3 and 4 , is moved a distance forwards towards the gas conduit so that the door 26 on one side of the burner housing 16 is opened by means of the plates 38 and 40 and the vertical part 37 . thus , a communication between the normally closed combustion system and the atmosphere is established . furthermore , there is a continued forward movement of the pressure plate 43 as well as the push button 51 of the valve in the safety device 46 which is acted upon . in addition , a push button behind the button 22 in fig1 is depressed which by a special transmission acts on the push button 53 of the lighter 52 . in this manner , the gas valve is kept open , and the burner can be observed through one of the sight glasses , preferably the front glass 25 , whose light is led by a light conductor in the support frame 15 to the front of the frame so that it can be seen whether or not the gas has been ignited . if the attempt has been successful the pressure plate 43 should be kept in its depressed position for a while so that the sensor 47 is heated by the burner , and which keeps the safety valve open . if the attempt has failed , another attempt is made with a spark from the lighter 52 , still with the door 26 open . as seen in fig2 the plate of the door 26 is surrounded by a groove 59 in which is a rubber strip 60 that seals against the edge of the housing 16 , when the door 26 is in a closed position . no particular ability is necessary to light the burner in the device described since one push button , that of the gas valve , is kept depressed , and the other , that of the burner 52 , is used repeatedly until the burner commences to operate . | 5 |
by “ near ir absorption ” meant absorption of light in the range of from about 700 nm to about 2500 nm . the absorption range of 2000 - 2500 nm is of particular interest , as that is the range where the unique fingerprints of the different polymers we have tested are typically expressed . the spectral data is evaluated using a combination of approaches . first , the spectral changes on the test sample , e . g ., hap disk after deposition are observed . strong vibrations in the regions specific for polymer provide evidence that polymer adhesion is occurring . tracking the area under the curve can be done as a . means to quantify retention after one washing and two washings with saline buffer solution . in addition , factor analysis can be used to identify the spectral differences observed across the entire spectrum . the use of principal component analysis ( pca ) generates scores for each test sample measured . these are semiquantitative values assigned to each spectrum that shows the difference among the spectra . pca scores that are very different from the control ( no polymer coating ) are considered to have the most polymer presence . advantages over alternative methods — data acquisition is very fast — less than a day atomic force microscopy ( afm ) and scanning electron microscopy ( sem ) need vacuum pressure and can take weeks to obtain results ; and the sample is tested in its native state ; there is no need for sample preparation ; one benefit of having a fast analytical technique is that microcontaminants can alter or destroy the polymer or change the properties of the polymer over time . the molecular overtone and combination bands seen in the near ir are typically very broad , leading to complex spectra ; it can be difficult to assign specific features to specific functional groups or components . the overall shape of the spectra can be viewed as a “ fingerprint ” of the particular substance , and the intensity of the spectra correlates with the degree of deposition . multivariate ( multiple variables ) calibration techniques ( e . g ., principal components analysis , partial least squares , or artificial neural networks ) may be employed to identify differences in the presence and absence of polymer and so to measure polymer deposition . the method is quick and efficient . one of the unique aspects of the near ir method is that the method requires no clean up of the instrument . the samples are measured in flat and optically clear borosilicate glass vials using a diffuser that reflects light back to the detector , making analysis time extremely rapid . total analysis time is less than one minute ( approximately 30 - 35 seconds ). as noted above , differences in specific brands or grades of the same type of polymer can affect the properties of the polymer in oral care formulations . for example , carboxymethyl cellulose ( cmc ) is a cellulose derivative with carboxymethyl groups (— ch 2 — cooh ) bound to some of the hydroxyl groups of the glucopyranose monomers that make up the cellulose backbone . it is often used as its sodium salt , sodium carboxymethyl cellulose . different types and grades of this polymer may have different chain lengths leading to different molecular weights , different levels of substitution resulting in different proportions of carboxymethyl groups compared to hydroxyl groups , different clustering of carboyxymethyl groups , and different degrees of ionization and salt formation . polyvinylpyrrolidone ( pvp ) is a water - soluble polymer made from the monomer n - vinylpyrrolidone . as in the case of cmc , different types and grades of this polymer may have different chain lengths leading to different molecular weights and viscosities . pyp may also be cross - linked and / or complexed with other ingredients , particularly hydrogen peroxide , in various proportions . both cmc and pvp are available in a variety of brands , types , and grades , each having somewhat different properties in oral care formulations . one embodiment of the application is a method of measuring polymer deposition on a saliva - coated dental substrate comprising : a . measuring the near ir absorption of a saliva - coated dental substrate in the absence of test polymer ; c . obtaining a test sample by contacting a saliva - coated dental substrate with the test polymer or a formulation comprising the test polymer ; f . comparing the near ir absorption of ( i ) the saliva - coated dental substrate in the absence of test polymer , ( ii ) the test polymer , and ( iii ) the test sample , to determine the degree of deposition and retention of the test polymer on the test sample . in another embodiment of the method , the saliva - coated dental substrate is a saliva - coated substrate selected from mammalian tooth , e . g ., human tooth or bovine tooth , dentin , and hydroxylapatite . in another embodiment of the method , the saliva - coated dental substrate is a saliva - coated hydroxylapatite disk . in another embodiment of the method , the test polymer is selected from carboxymethyl cellulose ( cmc ) and polyvinylpyrrolidone ( pvp ). in another embodiment of the method , the method is carried out entirely in vitro . in another embodiment of the method , steps d and e are repeated to assess retention of the test polymer following washing or rinsing . in another embodiment of the method , the washing or rinsing is carried out using saline buffer solution . in another embodiment of the method , the area between the absorption curve of the near ir absorption of the saliva - coated dental substrate in the absence of test polymer and the absorption curve of the near ir absorption of the test sample after washing or rinsing is correlated with the amount of test polymer deposited and retained on the test sample . in another embodiment of the method , the method is repeated using different concentrations of test polymer . in another embodiment of the method , the method is repeated in the presence and absence of dentifrice ingredients to determine the effect of the dentifrice ingredients on polymer binding . in another embodiment of the method , the dentifrice ingredients are selected from the group consisting of abrasives , amino acids , anti - bacterial agents , anti - plaque agents , breath freshening agents , colorants , desensitizing agents , fluoride ion source , stannous ion source , tartar control agents , whitening agents , zinc salts and combinations thereof . the method of any foregoing claim wherein the dentifrice ingredients are whitening agents selected from the group consisting of peroxides , hydrogen peroxide , urea peroxide , high cleaning silica , blue pigments , blue dyes , chlorophyll compounds and combinations thereof . the method of any foregoing claim wherein the method is repeated using different test polymers and further comprises the steps of : g . comparing the degree of deposition and retention of the test polymer against the degree of deposition and retention of the different test polymer ; and h . selecting the test polymer from step g . with the greater degree of deposition and retention for use in a method of making dentifrice composition . the method of any foregoing claim wherein the near ir absorption is measured in the range of 700 to 2500 nm . the method of any foregoing claim wherein the near ir absorption is measured in the range of 2000 to 2500 nm . embodiments of the present invention are further described in the following examples . the examples are merely illustrative and do not in any way limit the scope of the invention as described and claimed . near ir instrumentation setup : the foss xds near ir instrument with rapid content accessory ( rca ) is used for all measurements . the spectra are collected from 400 nm to 2500 nm with 0 . 5 nm spacing between wavelengths . reference standardization is employed , which involves using a certified 80 % reference standard every 2 weeks to correct for y axis changes . the nist traceable standard reference material ( srm ) 1920a is used every 2 weeks to correct for any x axis changes . each sample measured is an average of 32 scans collected over a 20 second measurement interval . in one embodiment of the invention , the spectra are collected over the range of from 2000 nm to 2500 nm . this range allows for better s / n ( signal to noise ) ratio and detection of lower concentrations of polymer . in one embodiment of the invention , the concentration of the sample being detected can range from 100 ppm ( 0 . 0001 % by weight = 1 ppm ) to 20 , 000 ppm . other concentration ranges suitable for testing include 100 ppm to 10 , 000 ppm , 100 ppm to 1 , 000 ppm , and 100 to 500 ppm ( concentrations higher than 10 , 000 to 20 , 000 can overwhelm the near ir data collection and is generally not suitable for use ). performance qualification of the instrument is performed daily and consists of running an instrument performance test which measures both instrument noise and peak to peak band resolution . reference scans using the internal reference standard are performed for each measurement . samples are measured by placing the hap disk directly on the sapphire lens and using the centering iris to center the disk in the center of measurement window . spectral measurements were taken and saved three times without moving the sample . the process was repeated on the other side of the hap disk . spectra of all raw materials are also measured and used to characterize the nir fingerprint . the polymer powder is placed into a glass vial up to about 1 cm depth . the spectrum is taken in the same way as described above . polymer solutions with and without sorbitol are also measured in order to evaluate interference of sorbitol in the measurement of cmc . owing to a direct interference due to sorbitol in measuring cmc , all further near ir experiments were conducted in nacl solutions alone . the spectra of several polymer solutions of different concentrations are also measured . the polymer solutions are put into the glass vial up to about 5 mm depth . a 316 stainless steel diffuser ( 2 mm effective pathlength ) was then immersed into the solution to facilitate reflectance of the nir light back to the detector . the space between the plate and the bottom of vial was checked to ensure no bubbles were trapped . the spectra are taken in the same way as described above . high molecular weight ( hmw ) cmc refers to cmc with a number average molecular weight ranging from 400 , 000 to 1 , 000 , 000 . medium molecular weight ( mmw ) cmc refers to cmc with a number average molecular weight ranging from 150 , 000 to less than 400 , 000 . low molecular weight ( lmw ) cmc refers to cmc with a number average molecular weight ranging from 1 , 000 to less than 150 , 000 . cmc binding assessment : a bar plot of showing the area of polymer vibrational band after deposition on saliva coated hap disks revealed the following areas under the curve ( auc ) from the near ir spectra . both high and low molecular weight cmc show preferential binding to saliva coated hap , compared to medium molecular weight cmc . the enhanced surface deposition is consistent with the enhancement in bioadhesion . cmc is one of the mucoadhesive polymers being investigated for use in products to treat dry mouth technology . initial consumer testing shows that the dry mouth prototype product exhibits superior mouth moisture retention comparing to a regular dentifrice . cmc data exemplifies the unique nature of the test technique in being able to distinguish not only between polymers , but also different types of polymers , e . g . surprising that hmw cmc and lmw cmc were better than mmw cmc for deposition . pvp binding assessment : a series of proprietary pvp structures including cross linked pvp are screened using the same near ir method after washing the substrate once with a polymer . the near ir spectrum provides a quantiative measure to track presence of polymer . factor analysis ( principal component analysis ( pca )) measures spectral differences among samples measured after one washing . the pca scores plot clusters samples that are similar in fingerprint . the samples farthest away from the control most likely have the most polymer deposited on the surface . the pca scores listed below represent 97 % of the spectral variability between the samples . a test of pvp treated samples revealed a p index of 0 . 07 indicating a close relationship between confidence intervals and significance tests . these near ir methods are thus capable of finding pyp polymers that have the most binding potential to saliva coated surfaces and that show the most tenacious binding affinity with post washing . pyp polymers can be functionalized with or entrap whitening materials such as peroxide or other chemicals that deliver surface whitening benefits . as those skilled in the art will appreciate , numerous changes and modifications may be made to the embodiments described herein without departing from the spirit of the invention . it is intended that all such variations fall within the scope of the appended claims . | 6 |
exemplary embodiments of an error display device and an error display method according to the present invention will be explained below in detail with reference to the accompanying drawings . the present invention is not limited to the embodiments . as an exemplary embodiment of the present invention , a method of displaying errors in six degrees of freedom associated with a motion along a rectilinear axis of a machine tool is explained . there are three translation errors and three attitude errors , that is , errors in a total of six degrees of freedom in a machine element 1 that performs a rectilinear motion as shown in fig1 . in fig1 , exx denotes a position error , eyx denotes a translation error , ezx denotes a translation error , eax denotes a roll , ebx denotes a pitch , and ecx denotes a yaw . it is known that these errors result from geometric accuracies in a guide face that guides the rectilinear motion and a drive mechanism , a sensor accuracy to be used for a feedback control , an interaction between a drive force and a reaction force thereto , and the like . an error display method according to the present embodiment is explained with reference to fig2 . fig2 is an explanatory diagram of a method of magnifying an error in a rectilinear axis and displaying the magnified error , and is a flowchart of procedures of an operation performed by an error display device according to the present embodiment . the error display device includes an operation program in which the procedures shown in fig2 are described and a central processing unit ( cpu ) that executes the operation program , and operates according to the procedures shown in fig2 . parts in which the procedures of the operation program are described and the cpu that performs the procedures constitute units that perform operations of the procedures , respectively . the error display device according to the present embodiment operates in procedures of an error - data reading step s 1 , a reference - motion - trajectory display step ( reference - motion - trajectory display unit ) s 2 , and an error magnification / display step ( error magnification / display unit ) s 3 . the error magnification / display step s 3 includes procedures of a translation - error - vector calculating step s 4 , a translation - error - trajectory display step s 5 , an attitude - error - matrix calculating step s 6 , and an attitude - error display step s 7 . at the error - data reading step s 1 , numerical data showing errors in six degrees of freedom in the rectilinear axis is read . images of error data are shown in fig3 . error data of the rectilinear axis is represented as numerical values of six error components at a plurality of target positions . the target positions are generally set at equal distances within a stroke of the rectilinear axis . when there is a plurality of rectilinear axes , there is similar error data corresponding to each of the rectilinear axes and a perpendicularity between respective two axes is also read as a numerical value . a method using a straightedge and a dial gauge , a method with a laser length - measuring machine , and a measurement method with a laser tracker are known as methods for measuring the error data as shown in fig3 . as can be understood from fig3 , whether the maximum error amount is within an acceptable value can be determined based on the error data ; however , how the rectilinear axis behaves cannot be read . first , at the reference - motion - trajectory display step s 2 , a design motion trajectory of the rectilinear axis is displayed . in the case of a rectilinear axis , the trajectory is a straight line parallel to a motion direction of the rectilinear axis and the length thereof is a movable range ( a stroke ) of the rectilinear axis . when plural rectilinear axes are arranged to intersect with each other , a plurality of intersected lines is displayed . next , at the error magnification / display step s 3 , the error data read at the error - data reading step s 1 is magnified and displayed on the reference motion trajectory displayed at the reference - motion - trajectory display step s 2 . an error is generally of an order of several micrometers or a thousandth of a degree and accordingly the error is magnified by a magnification factor of 100 to 1000 to be visually recognized . a process of the error magnify / display step s 3 is explained in detail . first , at the translation - error - vector calculating step s 4 , a translation error vector e trans is calculated according to the following expression 1 . while the expression 1 is an example in a case where the rectilinear axis is an x - axis , similar calculation can be performed also in a case where the rectilinear axis is a y - axis or a z - axis . in this expression , k is an error magnification factor and n is a target position number . at the translation - error - trajectory display step s 5 , a translation error position x e is obtained by adding the translation error vector to the target position according to an expression 2 , and adjacent translation errors are connected with a line segment to display a translation error trajectory . in this expression , x ( n ) is a target position vector , which is t [ x ( n ) 0 0 ] when the rectilinear axis is the x - axis . x e ( n )= x ( n )+ e trans ( n ) ( expression 2 ) at the attitude - error - matrix calculating step s 6 , an attitude error matrix a trans is calculated according to the following expression 3 based on the error data read at the error - data reading step s 1 . in the expression 3 , the sine and the cosine are approximated assuming that each attitude error is minute . while the expression 3 is an example in the case where the rectilinear axis is the x - axis , similar calculation can be performed also in a case where the rectilinear axis is the y - axis or z - axis . in this expression , k is an error magnification factor , which can be the same value as that in the expression 1 or can be different therefrom , and n is a target position number . at the attitude - error display step s 7 , coordinates of a predetermined line segment or a predetermined shape are transformed using the translation error vector of the expression 1 and the attitude error matrix of the expression 3 , and are displayed on the reference motion trajectory displayed at the reference - motion - trajectory display step s 2 . when coordinates of a point group representing a predetermined line segment or a predetermined shape located at the coordinate origin are t [ dx ( m ) dy ( m ) dz ( m )], coordinates t [ dxe ( n , m ) dye ( n , m ) dze ( n , m )] of a point group de representing the predetermined line segment or the predetermined shape in consideration of the magnified translation error and the magnified attitude error at the nth target position are calculated according to the following expression 4 . at the attitude - error display step s 7 , coordinates of the point group de at at least two target positions with respect to each rectilinear axis are calculated and adjacent points of the point group are connected by a line segment to display the predetermined line segment or the predetermined shape with the magnified translation error and the magnified attitude error on the reference motion trajectory displayed at the reference - motion - trajectory display step s 2 . an example of error data of rectilinear axes displayed according to the present embodiment is shown in fig4 . in fig4 , a design motion trajectory is represented by a thin line , and magnified translation errors and magnified attitude errors are represented by thick lines . in this example , a line segment is used as a predetermined shape representing an attitude error . that is , the attitude errors are displayed , at equal distances , with line segments intersecting with motion directions of the rectilinear axes . as shown in fig4 , the error display method according to the present embodiment enables to visually display both of the translation errors and the attitude errors on a three - dimensional perspective graph . as described above , the error display device and the error display method according to the present embodiment enable to display motion errors in six degrees of freedom of a machine element that performs a rectilinear motion as motion trajectories thereof , and attitudes of a line segment or a predetermined shape on a three - dimensional perspective graph . therefore , characteristics of the motion errors which a rectilinear axis of a machine has can be intuitively understood . accordingly , causes of a poor accuracy during machining can be examined . furthermore , the attitude error matrix and the translation error vector are calculated at at least two points with respect to one movable axis to draw a predetermined line segment or a predetermined shape , so that changes in the attitude error associated with the motion can be visually displayed . as a second embodiment of the present invention , a method for displaying assembly errors in rotation axes of a rotary - table - type 5 - axis machine tool having an a - axis and a c - axis on the side of a table is explained as an example . assembly errors present in the c - axis are explained first with reference to fig5 . in fig5 , xoc denotes a position of the c - axis in an x - direction , yoc denotes a position of the c - axis in a y - direction , aoc denotes a perpendicularity between the c - axis and the y - axis , and boc denotes a perpendicularity between the c - axis and the x - axis . assembly errors in a rotation axis ( a machine element 2 that performs a rotational motion ) are represented by a position and a tilt of the center line of the rotation axis . for example , in the case of the c - axis , there are translation errors in the x - axis direction and in the y - axis direction and attitude errors around the x - axis and around the y - axis . there are four assembly error components with respect to one rotation axis . when there are two rotation axes , the number of parameters representing assembly errors in the rotation axes is eight in total . a method for displaying assembly errors in rotation axes according to the present invention is explained with reference to fig6 . fig6 is an explanatory diagram of a method of magnifying and displaying assembly errors in rotation axes , and is a flowchart of procedures of an operation performed by an error display device according to the present embodiment . the error display device includes an operation program in which the procedures shown in fig6 are described and a cpu that executes the operation program , and operates according to the procedures shown in fig6 . parts in which the procedures of the operation program are described and the cpu that performs the procedures constitute units that perform operations of the procedures , respectively . the error display device according to the present embodiment operates in procedures of the error - data reading step s 1 , the reference - motion - trajectory display step ( reference - motion - trajectory display unit ) s 2 , and the error magnification / display step ( error magnification / display unit ) s 3 . the reference - motion - trajectory display step s 2 includes procedures of a reference - center - line display step ( reference - center - line display unit ) s 8 and a reference head - position - trajectory drawing step s 9 . the error magnification / display step s 3 includes procedures of the translation - error - vector calculating step s 4 , the attitude - error - matrix calculating step s 6 , an error - magnified center - line display step s 10 , and an error - magnified head - position - trajectory drawing step s 11 . at the error - data reading step s 1 , numerical data showing assembly errors in the rotation axes is read . images of error data are shown in fig7 . assembly errors in a rotation axis are represented as four numerical values of positions and angles with respect to one rotation axis . as can be understood from fig7 , even when assembly errors in the rotation axis are represented as numerical values , what the values mean cannot be intuitively understood . a method using a ball bar , a method using a ball and a displacement meter , a method using a straightedge or a cylinder speed square and a displacement meter , and the like are known as methods of measuring assembly errors in rotation axes . at the reference - center - line display step s 8 , a design center line of each of the rotation axes in a case where there is no assembly error is displayed . coordinates of both ends of line segments showing the center line of rotation around the a - axis and the center line of rotation around the c - axis in the case where there is no assembly error are represented by expressions 5 and 6 , respectively , when a length of the center line is 2 l and a vector showing coordinates of an intersection between the a - axis center line and the c - axis center line is m x c . in this expression , r a is a rotation matrix for rotating coordinates around the a - axis and is represented by an expression 7 . in this expression , q a is a rotation angle of the a - axis and , because the a - axis is arranged on the side of the table , the sign is negative . at the reference - center - line display step s 8 , the coordinates of the both ends of the line segment representing the a - axis center line are calculated according to the expression 5 to display a line segment connecting the both ends , and the coordinates of the both ends of the line segment representing the c - axis center line in a state where the a - axis rotation angle is zero in the expression 7 are calculated according to the expression 6 to display a line segment connecting the both ends . furthermore , a rotation angle of a rotation axis on the root side leads to a change in the direction of a rotation - axis center line of another rotation axis supported by the root - side rotation axis , in the case of the rotation axis of the rotary - table - type 5 - axis machine tool cited as an example in the present embodiment . in this case , a trajectory of a head of the center line of another one rotation axis , the trajectory being associated with the motion of the rotation axis on the root side , is drawn at the reference head - position - trajectory drawing step s 9 . the case of the present embodiment in which the rotation axis on the root side is the a - axis and the rotation axis on the table side is the c - axis is specifically explained . the a - axis rotation angle in the expression 7 is changed at a predetermined interval within a movable range of the a - axis , a head position of a line segment representing the c - axis center line at each of the a - axis angles is calculated according to the expression 6 , and adjacent head positions are connected by a line segment , so that a trajectory of the head position of the line segment representing the c - axis center line is drawn . in the case of the rotary - table type , a trajectory can be understood more intuitively when a trajectory of a head on the positive side is drawn than when a trajectory of a head on the negative side is drawn . at the error magnification / display step s 3 , the error data read at the error - data reading step s 1 is magnified and displayed on the reference center line displayed at the reference - center - line display step s 8 . an error is generally of an order of several micrometers or a thousandth of a degree . therefore , the error needs to be magnified by a factor of 100 to 1000 to be visually recognized . a process of the error magnification / display step s 3 is explained in detail . first , at the translation - error - vector calculating step s 4 , a translation error vector of each of the rotation axes is calculated based on the error data read at the error - data reading step s 1 . the translation error vector of a rotation axis is shown as a difference from a design center position of rotation . in the case of the a - axis and the c - axis , for example , the corresponding translation error vectors are represented by expressions 8 and 9 , respectively . in these expressions , k is an error magnification factor . e a = t [ 0 k · y 0 a k · z 0 a ] ( expression 8 ) next , at the attitude - error - matrix calculating step s 6 , an attitude error matrix of each of the rotation axes is calculated based on the error data read at the error - data reading step s 1 . for example , in the case of the a - axis and the c - axis , the attitude error matrices are represented by expressions 10 and 11 , respectively . in the expressions 10 and 11 , the sine and the cosine are approximated assuming that each attitude error is minute . k is an error magnification factor , which can be the same value as in the expressions 8 and 9 or can be different therefrom . at the error - magnified center - line display step s 10 , the rotation center line with a magnified assembly error is then displayed . coordinates of both ends of line segments representing the center line of the a - axis rotation and the center line of the c - axis rotation with magnified assembly errors are represented by expressions 12 and 13 , respectively . a length of the center line is 2 l . a vector representing coordinates of an intersection between the a - axis center line and the c - axis center line is m x c . in these expressions , r ae is a rotation matrix for rotating coordinates around the a - axis with an error and is represented by an expression 14 . in this case , θ a is a rotation angle of the a - axis and , because the a - axis is arranged on the table side , the sign is negative . at the error - magnified center - line display step s 10 , coordinates of both ends of a line segment representing the a - axis center line are calculated according to the expression 12 to display the line segment connecting the both ends , and coordinates of a line segment representing the c - axis center line in a state where the a - axis rotation angle in the expression 14 is zero are calculated according to the expression 13 to display the line segment connecting the both ends . furthermore , when an angle of a rotation axis on the root side leads to a change in the direction of the rotation - axis center line on a rotation axis located on the root - side rotation axis , as in the rotation axis of the rotary - table - type 5 - axis machine tool cited as an example in the present embodiment , a trajectory of the head of the center line of another rotation axis associated with the motion of the rotation axis on the root side is drawn at the error - magnified head - position - trajectory drawing step s 11 . to specifically explain a case where the rotation axis on the root side is the a - axis and the rotation axis on the table side is the c - axis , the a - axis rotation angle in the expression 14 is changed at a predetermined interval within a movable range of the a - axis , a head position of a line segment representing a c - axis center line at each of the a - axis angles is calculated according to the expression 13 , and adjacent head positions are connected by a line segment , thereby drawing a trajectory of the head position . in the case of the rotary - table type , a trajectory can be more intuitively understood when a trajectory of a head position on the positive side is drawn . an example in which assembly errors in the rotation axes of the rotary - table - type 5 - axis machine tool having the a - axis and the c - axis on the table side , which is cited as an example of the present embodiment are displayed on a three - dimensional perspective graph is shown in fig8 . in fig8 , center lines of the rotation axes with no error and a trajectory of a head position of the center line are represented by thin lines , and center lines of the rotation axes with errors and a trajectory of the head position of the center line are represented by thick lines . also in fig9 and 10 explained later , trajectories with no error are represented by thin lines and trajectories with errors are . as can be understood from fig8 , by displaying the trajectories with no error and the trajectories with errors side by side on the same three - dimensional perspective graph to indicate directions and magnitudes of the errors , errors such as the position and the tilt of each of the rotation - axis center lines can be displayed in an visually understandable manner . furthermore , by rotating the a - axis , an influence of the tilt of the a - axis center line appears large and it is found that deviation from the case where there is no error becomes large . in this way , by the error display method according to the present embodiment , the states of assembly errors such as the position and the tilt of the center line of the rotation axis can be visually displayed and therefore characteristics of the assembly errors included in rotation axes of a machine can be intuitively understood . accordingly , correction of the assembly errors or examination of causes of a poor accuracy during machining can be performed . furthermore , by the error display method according to the present embodiment , when a motion of a rotation axis on the root side leads to a change in the direction of the rotation center line of another rotation axis mounted to the root - side rotation axis , a behavior of the center line with an error when the center line is rotated can be visually displayed around the rotation axis with an error . by doing so , degrees of influences of assembly errors in the plural rotation axes can be recognized and errors that are to be strictly adjusted and errors that do not need to be strictly adjusted can be distinguished . while the present embodiment has been explained above with the example of the rotary - table - type 5 - axis machine tool having the a - axis and the c - axis on the table side , the applicable range of the present invention is not limited thereto . an example in which assembly errors in rotation axes of a mixed - type 5 - axis machine tool having the c - axis on the table side and the b - axis on the spindle side are displayed on a three - dimensional perspective graph by the error display method according to the present embodiment is shown in fig9 . in the mixed - type 5 - axis machine tool or a 4 - axis machine tool having one rotation axis on the table side , the direction of a center line of the rotation axis on the table side is fixed . when an assembly error in the rotation axis on the table side is to be displayed , the reference head - position - trajectory drawing step s 9 and the error - magnified head - position - trajectory drawing step sll are not performed . a rotational motion of the b - axis as the rotation axis arranged on the spindle side changes the direction of a center line of the spindle as another rotation axis . in such a case , the b - axis with no error and the spindle center line with no error , and a trajectory of a head position of the center line in a case where the spindle center line with no error is rotated around the b - axis center line with no error are drawn ( thin lines in fig9 ) at the reference - center - line display step s 8 and at the reference head - position - trajectory drawing step s 9 . furthermore , the b - axis with an error and the spindle center line with an error , and a trajectory of the head position of the center line in a case where the spindle center line with an error is rotated around the b - axis center line with an error are drawn ( thick lines in fig9 ) at the error - magnified center - line display step s 10 and at the error - magnified head - position - trajectory drawing step s 11 . a trajectory that can be more intuitively understood is obtained when the head position in this case is a head position of a tool or an end of the spindle . when a trajectory of a spindle center position ( a pivot point , which is an intersection between the b - axis center line and the spindle center line when there is no error ) at the height of the b - axis center line is also drawn as shown in fig9 , an influence of the translation error can be more easily understood . an example in which assembly errors in a 5 - axis machine tool having two rotation axes of the c - axis and the b - axis on the spindle side are displayed on a three - dimensional perspective graph by the error display method according to the present embodiment is shown in fig1 . in this case , the direction of the b - axis center line changes according to an angle of the c - axis , and the direction of the spindle center line changes according to angles of the two rotation axes of the c - axis and the b - axis . by the error display method according to the present embodiment , b - axis center lines at at least two c - axis angles , and trajectories of a head of the spindle center line in a case where the b - axis is rotated within a movable range at the at least two c - axis angles are displayed . in the example shown in fig1 , b - axis center lines and spindle center lines , and trajectories of the spindle head in the case where the b - axis is rotated when the c - axis is at zero degree and when the c - axis is at 90 degrees are displayed . a c - axis center line with no error , a b - axis center line with no error , and a spindle center line with no error are displayed , and a trajectory of the head of the spindle center line in a case where the spindle center line with no error is rotated around the b - axis center line with no error is drawn ( thin lines in fig1 ) at the reference - center - line display step s 8 and at the reference head - position - trajectory drawing step s 9 . furthermore , a b - axis center line in a state where the b - axis with no error is rotated at a predetermined angle around the c - axis with no error , and a trajectory of the head of the spindle center line in a case where the spindle center line with no error is rotated around the b - axis center line within the movable range of the b - axis are drawn ( thin lines in fig1 ). a c - axis center line with an error , a b - axis center line with an error , and a spindle center line with an error are displayed , and a trajectory of the head of the spindle center line in a case where the spindle center line with an error is rotated around the b - axis center line with an error is drawn ( thick lines in fig1 ) at the error - magnified center - line display step s 10 and at the error - magnified head - position - trajectory drawing step s 11 . furthermore , a b - axis center line in a state where the b - axis with an error is rotated at a predetermined angle around the c - axis with an error , and a trajectory of the head of the spindle center line in a case where the spindle center line with an error is rotated around the b - axis center line within the movable range of the b - axis are drawn ( thick lines in fig1 ). when a tool head position or a spindle end is defined as the head position also in these cases , the trajectory can be understood more intuitively . furthermore , when a trajectory of the spindle center position ( a pivot point , which is an intersection between the b - axis center line and the spindle center line when there is no error ) at the height of the b - axis center line is also drawn as shown in fig1 , influences of the translation error and the attitude error can be more easily understood . as described above , with the error display device and the error display method according to the present embodiment , the states of assembly errors such as the position and the tilt of the center line of a rotation axis can be visually displayed and therefore characteristics of the assembly errors included in the rotation axes of a machine can be intuitively understood . accordingly , correction of the assembly errors or examination of causes of a poor accuracy during machining can be performed . furthermore , when the direction of the rotation - axis center line on the table side or the spindle center line is changed due to a motion of the rotation axis on the root side as in the rotary - table type or the mixed type , behavior of the center line with an error when the center line is rotated around the rotation axis with an error can be visually displayed . accordingly , the degrees of influences of assembly errors in plural rotation axes are recognized and errors that are to be strictly adjusted and other errors can be distinguished . in addition , behaviors of the center line of the spindle with an error when the center line is rotated around two rotation axes can be visually displayed . this enables the degrees of influences of assembly errors in plural rotation axes to be recognized , so that errors that need to be strictly adjusted and other errors can be distinguished . the methods for magnifying and displaying errors in six degrees of freedom associated with a motion of a rectilinear axis or assembly errors in rotation axes in various rotation axis configurations by the error display methods according to the present embodiments have been explained above . it is quite possible for persons skilled in the art to display errors in an axis configuration that is not explained in the embodiments by a similar method . as described above , the error display device and the error display method according to the present invention are suitable for an error display device and an error display method that magnify an assembly error of a machine element , for example , in a machine tool or a robot , or an error associated with a motion thereof and to display the error . | 1 |
an electrical enclosure , in accordance with an exemplary embodiment , is indicated generally at 2 , in fig1 . electrical enclosure 2 is shown in the form of a switchgear 3 having a housing 4 . housing 4 includes a bus bar portion 6 that houses one or more electrical busses ( not shown ) and an electrical component portion 8 . housing 4 also includes a shutter system 10 that provides a selectively moveable barrier between bus bar portion 6 and electrical component portion 8 . shutter system 10 includes a first selectively shiftable shutter 12 and a second selectively shiftable shutter 14 . shutter system 10 includes a first operating mechanism 16 and a second operating mechanism 17 that selectively opens and closes first and second shutters 12 and 14 . as each operating mechanism 16 and 17 is similarly constructed , a detailed description will follow with reference to fig2 in describing first operating mechanism 16 with an understanding that second operating system 17 includes corresponding structure . first operating mechanism 16 includes a first operating lever 18 connected to first shutter 12 through a first linking bar 20 . similarly , a second operating lever 22 is operatively connected to second shutter 14 through a second linking bar 24 . as will be discussed more fully below , first operating lever 18 pivots downwardly opening first shutter 12 and second operating lever 22 shifts upwardly opening second shutter 14 . housing 4 is also shown to include a first component or circuit breaker support rail 30 and a second component or circuit breaker support rail 32 ( fig1 ). first and second component support rails 30 and 32 extend through electrical component portion 8 toward bus bar portion 6 . in the exemplary embodiment shown , an electrical component 40 ( fig3 ), shown in the form of a circuit breaker 44 , is positioned upon first and second component support rails 30 and 32 . electrical component 40 includes a support bracket 46 that slidingly engages with first and second component support rails 30 and 32 . in this manner , circuit breaker 44 may be shifted toward bus bar portion 6 allowing a first plurality of terminals 50 and a second plurality of terminals 52 to slide through corresponding openings 56 and 58 ( fig3 ) that are exposed as shutters 12 and 14 open . terminals 50 and 52 mate with bus bars ( not shown ) in bus bar portion 6 . more specifically , as circuit breaker 44 slides along component support rails 30 and 32 , support bracket 46 engages with first and second operating mechanisms 16 and 17 to open first and second shutters 12 and 14 . in accordance with an exemplary embodiment , electrical enclosure 2 includes a shutter interlock system 60 that restricts opening of first and second shutters 12 and 14 when electrical component 40 is absent from electrical component portion 8 . interlock system 60 includes a first shutter interlock 64 mounted to first component support rail 30 . a second shutter interlock ( not separately labeled ) may be mounted to second component support rail 32 . as will be discussed more fully below , shutter interlock 64 pivots between a deployed position preventing shutters 12 and 14 from opening to a non - deployed position allowing shutters 12 and 14 to open when acted upon by an interlock engagement member 70 provided on electrical component 40 . interlock engagement member 70 may take the form of a leading edge ( not separately labeled ) and an outwardly facing surface ( also not separately labeled ) as best shown in fig4 , shutter interlock 64 extends from a first end 80 to a second end 81 through an intermediate portion 83 . first end 80 is pivotally mounted to first component support rail 30 through an axel or pin 86 that nests within a bushing 88 . second end 81 includes a shutter locking plate 92 that extends between first and second operating levers 18 and 22 to prevent shutters 12 and 14 from opening . pin 86 defines an axis of rotation of the shutter interlock and extends from a first end ( not shown ) that nests within bushing 88 to a second end 97 that is connected to first component support rail 30 by an interlock support 100 . a return spring 104 extends around an upper portion of pin 86 between first end 80 of shutter interlock 64 and interlock support 100 . more specifically , return spring 104 extends from a first end section 107 connected to first end 80 of shutter interlock 64 to a second end section 108 that connects with interlock support 100 . in this manner , return spring 104 biases shutter interlock 64 in the deployed configuration , such as shown in fig5 . shutter interlock 64 also includes an activation member 120 that is acted upon by interlock engagement member 70 , as shown in fig6 . in accordance with an aspect of the exemplary embodiment , activation member 120 may include a roller 124 to reduce drag forces between shutter interlock 64 and interlock engagement member 70 . when electrical component 40 is inserted into electrical component portion 8 , support bracket 46 engages with activation member 120 through roller 124 initiating a pivoting of shutter interlock 64 ( fig6 ). continued insertion of electrical component 40 causes support bracket 46 to engage with activation member 120 pivoting shutter interlock 64 from a deployed position ( fig5 ) to a non - deployed position ( fig7 in which shutters 12 and 14 are free to open . once shutter interlock 64 is shifted to the non - deployed position , shutters 12 and 14 may open , and terminals 50 and 52 may engage with bus bars ( not shown ) in bus bar portion 6 . at this point it should be understood that the exemplary embodiments provide an interlock system that constrains opening of shutters that separate a bus bar portion from an electrical component portion of an electrical enclosure . the interlock system may be arranged on a single component support rail , or as shown , be arranged on each component support rail . however , it should be understood that the interlock system may be arranged in other portions of the enclosure that are exposed to an electrical component . further , while the activation member is shown to include a roller , other mechanisms may be used to engage with an electrical component support rail . while the invention has been described in detail in connection with only a limited number of embodiments , it should be readily understood that the invention is not limited to such disclosed embodiments . rather , the invention can be modified to incorporate any number of variations , alterations , substitutions or equivalent arrangements not heretofore described , but which are commensurate with the spirit and scope of the invention . additionally , while various embodiments of the invention have been described , it is to be understood that aspects of the invention may include only some of the described embodiments . accordingly , the invention is not to be seen as limited by the foregoing description , but is only limited by the scope of the appended claims . | 7 |
fig1 and 1a illustrate a conventional serpentine lcd backlight structure 10 such as might be used in an avionics display . it incorporates a serpentine tubular fluorescent lamp 12 mounted in a reflector housing 14 to enhance overall luminous efficiency . the structure 10 also incorporates a diffuser plate 16 to establish the needed backlight uniformity . the diffuser 16 scatters the light rays from the individual lamp legs 18 to create a uniform luminance plane behind the lcd . fig2 and 2a show a dual - mode lighting system 20 based on the structure described in the referenced patents ( u . s . pat . nos . 5 , 211 , 463 and 5 , 442 , 522 ). a lightpipe 22 is mounted in front of the serpentine lamp structure 24 which is edgelit by a separate ( night ) lamp 26 to provide lower luminance levels ( and / or nvis compatibility ) without affecting high ambient operation . as with the structure 10 of fig1 a diffuser 28 tends to make the transmitted light more uniform over the area of the lightpipe 22 . a night vision filter 30 may interposed between the night lamp 26 and the edge 32 of the lightpipe 22 . there are non nvis applications where a filter need not be employed . as shown , a reflector housing 34 is placed behind the serpentine lamp structure 24 to increase the brightness of the illumination transmitted through the lightpipe 22 . fig3 shows a prior art backlight structure 40 alternative to that described in fig1 but using a flat channel fluorescent lamp 42 instead of a serpentine tubular lamp element . the flat channel structure 42 typically permits more legs or channels 44 , spaced more closely together than would be possible with serpentine fluorescent tubes , improving uniformity and enabling the use of a more transmissive front substrate diffuser 46 for increased overall efficiency . the reflector housing function is typically incorporated into the flat channel lamp 40 , eliminating the need for a separate element and reducing overall installation depth . in the flat channel lamp 40 , the front substrate diffuser 46 is typically a flat piece of glass , which is coated with phosphor 48 on the inside and bonded ( frit sealed ) to the rear substrate 50 ( glass or ceramic ), which defines the lamp channel structure . the inner surface 52 of the rear substrate 50 is coated with a reflective layer 54 and over coated with phosphor 48 to increase lamp light output . the fluorescent gas mixture is contained in the lamp channel 44 and is excited by a pair of main electrodes 56 at the ends of the channel 44 . turning next to fig4 there is illustrated a simple embodiment of a day - night lamp 60 combining a flat channel lamp 42 with a night lamp 62 and nvis filter 64 adjacent the front substrate 66 which functions as a light pipe or light plate . the current invention combines the day - night architecture of the above referenced kalmanash patents with the flat channel fluorescent lamp structure , to enable synergistic gains . in its simplest embodiment , the invention calls for the functions of the night lightpipe to be incorporated into the front substrate 66 of the flat channel fluorescent lamp 60 this may be done by adding a pattern of diffuse &# 34 ; extractor dots &# 34 ; 68 to the inner surface 70 of the front lamp substrate 66 to direct the edgelit night mode light rays toward the viewer . the base substrate 72 is phosphor coated , as well , to enhance luminance in the day mode . in this configuration , the flat channel lamp front substrate 66 is edge - illuminated by the discrete cold cathode fluorescent lamp 62 or other luminance source . the edgelit optical path usually will include an nvis filter 64 as is described in u . s . pat . no . 5 , 211 , 463 . a principal advantage of this configuration is the elimination of the need for a discrete lightpipe in the backlight &# 34 ; stack &# 34 ;, thereby reducing cost and weight , and improving the packaging . other well - known means of constructing lightpipes might be incorporated into the flat channel lamp front substrate 66 instead of the &# 34 ; extractor dot &# 34 ; architecture . these include faceted structures as described by hamada , et al ( u . s . pat . no . 4 , 914 , 553 ); by hathaway , et al . ( u . s . pat . no . 5 , 050 , 946 ); and by arego , et al . ( u . s . pat . no . 5 , 202 , 950 ); as well as by wedge - shaped structures as described by hehr ( u . s . pat . no . 4 , 277 , 817 ) and my prior patents ( u . s . pat . nos . 5 , 211 , 463 and 5 , 442 , 522 ). according to the present invention , any of these structures might be phosphor - coated and serve as the front substrate of the flat channel lamp . the above structures are cited as examples of lightpipe architectures that might be included in the flat channel lamp . the list is not meant to be inclusive of all possibilities . in an alternative configuration , described in fig5 and 6 , the night lamp itself is incorporated into a flat channel lamp 80 , eliminating the need for a second , discrete lamp altogether and allowing for additional simplification of the overall backlight structure . the day lamp portion is excited by a pair of primary electrodes 82 . as shown , an independent channel 84 is formed in the rear substrate 86 of the flat channel lamp 80 in much the same manner as the serpentine &# 34 ; legs &# 34 ; are formed ( whether by etching or molding ). this night channel 84 is adjacent the serpentine day channel 88 and is independent in the sense that it is physically and electrically isolated from the multi - leg &# 34 ; day &# 34 ; channel 88 . its gas mixture is excited by a pair of secondary electrodes 90 . the same driver circuits can be used to alternatively excite either the day or night channels , providing extending dimming range and / or nvis compatibility . it is also possible that both day and night channels could be excited at the same time . separate front substrates 92 , 94 are used for the day and night channels 88 , 84 , with day channel front substrate 92 being much thicker night channel front substrate 94 . this additional thickness allows the day channel front substrate 94 to be edge illuminated by the night channel 84 , via a phosphor coating 96 on the night channel surface 98 abutting the day channel front substrate 92 . note , according to fig5 and 6 , that all internal surfaces of the night channel are coated with phosphor 96 plus reflective coatings 100 , except the surface forming the edge 102 of the day channel front substrate 92 . this surface is coated only with phosphor 96 . in this way , all the night channel 84 luminance is used to edge - illuminate the day channel front substrate 92 . an ir interference filter 104 on the phosphor - coated surface can provide nvis filtering , if desired . turning next to fig7 through 10 , there are shown alternative , integral embodiments of a flat channel lamp with an integral auxiliary or night light channel in addition to the primary or day light channel which has a serpentine tortuous path . in fig7 there is shown one approach to the edge lighting of the front light transmitting substrate 122 . as shown , a reflective surface 124 is placed in an auxiliary channel 112 to redirect illumination in the forward direction into an edge 126 of the front substrate 122 . all of the rear surfaces 128 have a combination of a reflective 130 and phosphor 132 coating to maximize the illumination in the forward direction . the inner surfaces of the front substrate 122 also have a phosphor coating . the angled reflective surface 124 in the auxiliary night channel 112 is provided with a reflective coating 130 . although the reflective surface 124 is shown as an angled , planar element , it can be appropriately curved to maximize the illumination directed into the edge 126 of the front substrate 122 , better seen in fig9 . in fig8 another embodiment of the integral flat channel lamp 110 &# 39 ; is shown . in this embodiment , the front substrate 122 &# 39 ; extends over the night channel 112 &# 39 ; and has an angled or beveled edge 124 &# 39 ; overlying the night channel 112 &# 39 ;, which is coated with a reflective material 130 or has a mirror attached to it . light generated in the night channel 112 &# 39 ; is directed upward and reflects off the angled surface 124 &# 39 ; and is redirected to the interior of the front substrate 122 &# 39 ;. another embodiment of a flat channel lamp 110 &# 34 ; is shown in fig9 . here , as in fig7 the front substrate 122 &# 34 ; has a thinner portion 136 which overlies the night channel 112 &# 34 ;. a reflective element 138 is placed within the night channel 112 &# 34 ; and , as shown , may have a curve to redirect impinging light onto the edge 126 &# 34 ; of the front substrate 122 &# 34 ;. in fig1 , there is yet another alternative embodiment of the present invention 110 &# 39 ;&# 34 ;. here , a hermetic sealing plate 140 covers the night channel 112 &# 39 ;&# 34 ; to keep it air tight . a reflective element 124 &# 39 ;&# 34 ; redirects light from the night channel 112 &# 39 ;&# 34 ; into the edge 126 &# 39 ;&# 34 ; of the front substrate 122 &# 39 ;&# 34 ;. fig1 shows a variation of a flat channel lamp 210 in which a two part cover plate is used . a first , hermetically sealing cover plate 240 covers the day channel 214 and a separate covering element 242 overlies the night channel 212 . the separate covering element 242 is made of a ir absorbing glass such as hoya cm500 . an angled edge 244 has a reflective coating 246 applied to the outer surface 246 so that light created within the interior of the night channel 212 is reflected and redirected into the main day channel cover plate 240 . the apparatus of fig1 is particularly useful in nvis applications . a variation of the structure of fig1 is shown in fig1 . here , an ir reflective layer 248 is applied to the edges of the cover elements 240 &# 39 ; and 242 &# 39 ; before they are sealed together . in this embodiment , both cover plate elements 240 , 242 can be made of the same material without compromising the nvis night performance of the dual mode lamp . thus there has been shown and described , integral day night backlighting structures with wide range dimming capabilities , suitable for use with nvis systems . a flat channel backlight is modified with the addition of a night lamp that directs illumination into the edge of the face plate that normally functions to transmit the light generated in the serpentine channels of the display . various structures can be incorporated in the face plate to redirect the edge light upwards . in a first embodiment , a separate night lamp is mounted to the edge of the flat channel device . in alternative embodiments , the night lamp can be an additional channel adjacent the main channel with means for redirecting the light generated therefrom into the edge of the face plate . the exterior edge of the cover or face plate can be beveled or curved to provide a reflective surface to the impinging illumination from the additional night channel . it is also possible to construct a reflecting surface within or exterior to the additional channel that can redirect the light into an edge of the face plate . accordingly , the breadth of the invention should only be limited by the scope of the claims appended hereto . | 6 |
the exemplary embodiments of packs ( blanks ) and apparatuses shown in the drawings refer to two exemplary designs of ( cigarette ) packs of the hinge - lid type . fig1 and 2 show a blank 11 which is made with rounded longitudinal edges 12 , specifically continuously in the region of a pack part 13 and a lid 14 . the blank according to fig1 and 12 shows a blank 90 , constructed similarly in principle , with bevelled longitudinal edges . the blank extended in both fig1 and fig1 and preformed only as regards the longitudinal edges 12 , 91 forms , when ready - folded , a pack part 13 and a lid 14 in a way which is conventional per se . because of the design of the blank 11 , a front wall 15 , the bottom wall 16 and a rear wall 17 are formed successively in the longitudinal direction in the middle region , as belonging to the pack part 13 . side tabs 18 and 19 respectively adjoin the front wall 15 and rear wall 17 laterally and , when the hinge - lid pack is ready - folded , overlap one another in pairs and form side walls . in the region of the bottom wall 16 , bottom corner tabs 20 are provided , although these are not joined to the bottom wall 16 , but are continuations of the side tabs 19 . to form the lid 14 , a lid rear wall 21 , a top wall 22 , a lid front wall 23 and a reinforcing tab 24 are formed successively in the longitudinal direction of the blank 11 . the lid rear wall 21 is joined to the rear wall 17 of the pack part 13 by means of a hinge 25 . lid side tabs 26 and 27 are assigned to the lid rear wall 21 and lid front wall 23 respectively in a similar way to the side tabs 18 and 19 . a lid corner tab 28 is provided in the region of the top wall 22 , as an extension of each of the lid side tabs 26 . the longitudinal edges 12 or 90 each extend between the front wall 15 , on the one hand , and the side tabs 18 adjoining it on both sides , on the other hand , between the rear wall 17 and the side tabs 19 , between the lid rear wall 21 and the lid side tabs 26 and between the lid front wall 23 and the adjoining lid side tabs 27 , on the other hand . to form rounded longitudinal edges 12 ( round edges ), strip - shaped regions of material , namely edge strips 29 and 30 , obtained from respective marginal regions of the walls or tabs adjoining one another , are permanently shaped in the form of an arc ( in the form of a quarter - circle arc ). as illustrated , the side tabs 18 , 19 and lid side tabs 26 , 27 are erected from the flat position of the blank 11 into an essentially vertical position ( fig2 ), to form the rounded longitudinal edges 12 . at the same time , as indicated by dot - and - dash lines in fig2 the above - mentioned lateral parts of the blanks 11 are moved beyond the vertical end position , i . e . are bent over . as a result of the restoring forces which are present , the side tabs 18 , 19 and lid side tabs 26 , 27 then move back into the vertical position . the ( polygonal ) longitudinal edges 91 of the pack according to fig1 and 12 are shaped in a similar way . the blank 11 prepared in this way is then processed further in a suitable conventional packaging machine , at the same time receiving the pack contents . the apparatus for making the rounded longitudinal edges 12 ( round edges ) is built into the conveyor track of the blanks 11 . in the region of a shaping station 31 , the above - described deformations of the lateral blank parts are carried out during a momentary stationary phase . for this purpose , shaping or embossing tools are provided in the shaping station 31 . these are movable folding members and fixed counter - folding members . in the exemplary embodiment illustrated , elongated folding rollers 32 and 33 of circular cross - section are arranged laterally relative to a blank track 34 . on the latter , the blank 11 is transported into the shaping station 31 and conveyed out of this . to transport the blanks 11 into the shaping station 31 and to transport them immediately after they leave the latter , rotationally driven pairs of drawing pulleys 35 , 36 and 37 , 38 are respectively arranged directly adjacent to the inlet side and the outlet side of the shaping station 31 . the blanks 11 each run through between the drawing pulleys 35 , 36 and 37 , 38 assigned to one another . during shaping or folding , immovable counter - folding members are assigned to the folding rollers 32 and 33 , specifically , in the present exemplary embodiment , a comtinuous , one - piece shaping plate 39 which has approximately the length of the entire blank 11 which is lowered from above onto the midle region of the latter . the shaping plate 39 serves , at the same time , for fixing the blank 11 temporarily in an exact position inside the shaping station 31 . the width of the shaping plate 39 is such that the shaping margins 40 and 41 , rounded ( in the form of a circular arc ) and extending in the longitudinal direction , can serve as a counter - shaping tool to the folding rollers 32 , 33 in such a way that the edge strips 29 and 30 can be shaped round the shaping margins 40 , 41 , thereby being deformed arcuately . at the same time , the respective parts of the blank 11 are pressed against the shaping margins 40 , 41 of the shaping plate 39 by the folding rollers 32 , 33 . for this purpose , these are moved out of the lower initial position according to fig8 or 9 ( unbroken lines ) into an upper position ( dot - and - dash lines ). the folding rollers 32 , 53 are thereby moved round the shaping margins 40 , 41 along a path in the form of a circular arc , taking with them the blank parts ( side tabs 18 , 19 or lid side tabs 26 , 27 ), at the same time pressing these against the shaping margins 40 , 41 . accordingly , in the initial position , the folding rollers 32 , 33 are located underneath the blank 11 . in the present exemplary embodiment , the folding rollers 32 are mounted so as to be rotatable about their own longitudinal axis . for this purpose , axially directed bearing bores 42 , into which a bearing journal 43 of a roller holder penetrates , are made at the ends . in front of each end of the folding roller 32 , 33 , a supporting arm 44 , 45 for each folding roller 32 , 33 is mounted adjustably . the supporting arms 44 , 45 are connected to an actuating gear 46 which produces the movement of the folding rollers 32 , 33 which has already been described . to execute the exclusively translational movement of the supporting arms 44 , 45 , the supporting arms 44 and 45 assigned to a respective folding roller 32 , 33 can be actuated by two crank mechanisms 47 and 48 attached to the end of a respective common drive shaft 49 , 50 . the crank mechanisms 47 , 48 each consist of a crank disc 51 with a crank pin 52 which is mounted rotatably in the supporting arm 44 or 45 . the drive shafts 49 , 50 are mounted in a supporting wall 53 belonging to the machine frame . the two drive shafts 49 , 50 are driven to rotate to and fro by means of a toothed quadrant 54 . their drive is transmitted via gear wheels 55 to corresponding gear wheels 56 of the adjacent drive shafts . by means of this gear , the folding rollers 32 , 33 always execute identical , synchronous movements . as is evident , the folding rollers 32 , 33 , while taking up the side tabs 18 , 19 or lid side tabs 26 , 27 , are moved so far that these blank parts are moved beyond the vertical position almost into a horizontal position ( bent over ). as a result of restoring forces , the said tabs then attain the vertical position according to fig2 . the blank track 34 has , at least in the region of the shaping station 31 , markedly less width than the blank 11 or than the front wall 15 , rear wall 17 , etc of the latter . the blank track 34 consists of an elongate supporting profile 57 of a trapezoidal cross - section tapering downwards . the lower drawing pulleys 35 , 37 of the pairs of drawing pulleys are mounted in the region of a lower web 58 , specifically being pressed elastically against the respective upper drawing pulleys 36 , 38 located opposite them . for this purpose , an inner part 59 of the drawing pulley 35 or 37 is mounted eccentrically via a supporting journal 60 in a corresponding bearing bore of the web 58 . a further supporting journal 61 , likewise attached to the inner part 59 eccentrically , is loaded by a spring member , namely a leaf spring 62 , so as to be constantly pressed elastically upwards . an outer rotary ring 63 runs rotatably on the inner part 59 . this rotary ring 63 passes through a slit orifice 64 in the supporting profile 57 and through a recess 65 in the region of the inlet side of the shaping station 31 . the shaping plate 39 is moved up and down each time only the amount of a short stroke of a few millimeters ( the positions represented by unbroken lines and dot - and - dash lines in fig4 ). to actuate it , there is a two - armed lifting lever 66 which is pivotably adjustable by means of an actuating rod 67 . inside the shaping station 31 , the blank is accommodated in a blank receptacle 68 , specifically positively aligned exactly . the blank receptacle 68 consists of two angular stop pieces 69 which , matching the contours of the blank 11 , surround the blank 11 laterally and so as to fit against its front side , in a region located at the front in the conveying direction . in particular , the stop pieces 69 , by means of a shoulder 70 , come respectively up against lid side tabs 27 projecting by means of the narrower reinforcing tab 24 and thus determine the relative position in the longitudinal direction . in the present exemplary embodiment , the stop pieces 69 are connected to the front supporting arms 44 and 45 and are consequently also lifted by means of these ( fig9 ). after the shaping plate 59 has been lowered onto the blank 11 and the latter has been fixed on the supporting profile 57 of the blank track 34 , the stop pieces 69 have performed their function . in the region of the shaping station 31 , the blank 11 is disengaged from the drawing pulleys 35 , 36 and 37 , 38 . to transport the blank 11 further after the shaping or folding operation , until it is grasped by the drawing pulley 37 , 38 , a special conveyor activated intermittently is provided . this consists of a gathering arm 71 which , during a conveying stroke , grasps the blank 11 on its rear side by means of an carrier lug 72 ( fig3 ) and transports the blank 11 over a short conveying distance . at the same time , the carrier lug 72 of the constantly moving gathering arm 71 moves along a low closed path of movement 73 ( fig4 ). to execute these movements , the gathering arm 71 is driven by a constantly rotating crank 74 and is held by a pivoting arm 75 articulated adjacent to the carrier lug 72 . as is particularly evident from fig3 a number of members described are moved by a common drive , in the present case by a toothed - belt drive 76 . a common toothed belt 77 runs over drive pulleys and deflecting pulleys , over a crank - mechanism pulley 78 for driving the gathering arm 71 and over toothed pulleys 79 assigned to the drawing pulleys 36 and 38 . the above - mentioned drive members are mounted on or in a common retaining wall 80 . the movement of the gathering arm 71 is coordinated with that of the folding rollers 32 , 33 . the deformability of the blank 11 , consisting of thin cardboard or the like , in the region of the edge strips 29 , 30 can be improved by moistening it or by coating on a layer of glue . for this purpose , in the exemplary embodiment illustrated , liquid containers 82 with an outflow channel and a transfer wick 83 arranged in the latter are located in front of the inlet side of the shaping station 31 . the transfer wick 83 is permanently saturated with liquid . the bottom end rests on the blank 11 in the region of the edge strips 29 , 50 during transport and thereby transfers the liquid . in the region of the transfer wick 83 , the blank track 34 is provided with a bore 84 , through which any drops of liquid can pass when there is no blank 11 being conveyed . furthermore , the deformability or the dimensional stability of the blank 11 can be improved by the application of heat . for this purpose , in the exemplary embodiment illustrated , the shaping plate 39 is provided with a flat heating element 85 , for example an electrical resistor . the mode of operation of the apparatus is such that the shaping plate 39 is lowered after a blank 11 has been conveyed into the shaping station 31 . the above - described upward or shaping movement of the folding roller 32 , 33 then takes place . after these have returned to the initial position , the shaping plate 39 is raised slightly . at the same time , the gathering arm 71 engages with the blank 11 by means of the carrier lug 72 and moves it further , in such a way that a front region of the blank 11 grasped by the drawing pulleys 37 , 38 . in the present exemplary embodiment , the folding rollers 32 , 33 are designed , in the region of the bottom corner tabs 20 and the lid corner tabs 28 , with a turned groove 86 that is to say with a smaller diameter , so that there is no deformation of the blank 11 here . outside the region of the shaping station 31 , the blanks 11 transported at suitable distances from one another in the conventional way . as evident from fig3 for example , a further pair of drawing pulleys 87 , 88 is arranged at a distance in front of the shaping station 31 for this purpose . as regards the pack or blank according to fig1 and 12 , the longitudinal edges 91 corresponding to the longitudinal edges 12 of he preceding exemplary embodiment are bevelled or polygonal , specifically by bending the blank 90 twice in this region . two polygonal edges 92 and 93 are consequently obtained in the region of the entire ( imaginary ) longitudinal edge 91 . consequently , a blank strip 94 extending obliquely &# 34 ; across the corner &# 34 ; is obtained between the polygonal edges 92 , 93 . the angles formed on the one hand by this blank strip 94 and on the othe hand by the adjoining blank regions are preferably equal ( 135 °). blank 90 designed thus is preferably preformed in the same way as already described and illustrated in fig1 and 12 . an apparatus suitable for this , similar to that of the exemplary embodiment of fig3 to 10 , is equipped with a shaping plate 95 which can be placed onto the blank 90 and of which the shaping margins 96 and 97 have angled shaping surfaces 98 , 99 corresponding to the form of the blank parts to be shaped into an angular position relative to one another . accordingly , in the present case , thereis a lower shaping surface 98 serving for shaping the blank strip 94 and a shaping surface 99 adjoining the former at an angle and intended for the adjacent blank ( side tab , lid side tab , etc ). the angular position of the shaping surfaces 98 , 99 is such that the blank regions are broken during shaping ( fig1 and 13 , and in particular the angles determining the positions of the shaping surfaces are each 120 °. here , the counter - folding members are the folding rollers 100 and 101 which have already been described in principle and are actuated in the same way and which have an elastic sheathing 102 , for example made of rubber or plastic , for matching the blank parts exactly to the shaping margins 96 , 97 of the shaping plate 95 . fig1 shows an alternative design of the apparatus in the region of the folding and counter - folding members . the solution illustrated is intended for a blank according to fig1 and 12 , that is to say with bevelled longitudinal edges 91 . however , if the folding members are adapted in an appropriate way , this apparatus can also be used for the exemplary embodiment of fig1 and 2 . as in the exemplary embodiments described , here again there is a shaping plate 95 with shaping margins 96 , 97 which extend in the longitudinal direction and which , in the present case , have shaping surfaces 98 , 99 directed at an angle to one another , as in the exemplary embodiment of fig1 . folding strips 103 , 104 extending in the longitudinal or conveying direction are provided as outer counter - folding members here . these folding strips 103 , 104 consist of a folding leg 105 which , on the side facing the shaping plate 95 , has the profile of the shaping margins 96 , 97 , that is to say is provided with corresponding counter - shaping surfaces 106 , 107 . the folding strips 103 , 104 or the folding leg 105 are pressed by means of the counter - shaping surfaces 106 , 107 against the shaping margins 96 , 97 of the shaping plate 95 as a result of an appropriate transverse movement , thereby shaping the blank 90 . at the same time , the polygonal edges 92 , 93 are formed . on the exemplary embodiment illustrated , the folding strips 103 , 104 are designed as two - armed levers , namely with an actuating leg 108 projecting sideways . the folding strips 103 , 104 thus acquire a general angular cross - section . the actuating legs 108 of the two folding strips 103 , 104 are connected to a common actuating linkage 109 movable up and down , which is connected in an articulated manner to each of the actuating legs 108 . of this actuating linkage 109 , only the centre lines of rods connected to one another are shown here . to execute joint pivoting movements of the folding strips 103 , 104 about a central pivot bearing 111 , the axis of which extends in the longitudinal direction , a central connecting rod 110 pointing downwards is moved up and down by means of a suitable drive member . in the initial position , the folding legs 105 are located directly below the plane of the ( spreadout ) blank 90 . in the present exemplary embodiment , the counter - shaping surface 107 assigned to the blank strip 94 is designed with longitudinal grooves 112 . by means of these , corresponding grooves are made in the blank 90 in the region of the blank strip 94 . otherwise , this apparatus is also designed in the same way as that already described . the above - described exemplary embodiments of an arrangement for prefolding the blanks are adjoined by a glueing station 120 . this serves for applying spots of glue 121 in the region of the bottom corner tabs 20 , spots of glue 122 in the region of the side tabs 19 and further spots of glue 123 in the region of the reinforcing tab 24 and the lid front wall 23 . further rectangular spots of glue 124 are provided in the region of the front wall 15 . all the spots of glue are applied to the inner face of the blank 11 pointing upwards . in the exemplary embodiment of the glueing station 122 illustrated , the above - mentioned spots of glue 121 to 124 are applied by a single common member , namely by a glue roller 125 . this is rotatably mounted laterally in the machine frame and is driven via a main gear wheel 126 . supporting discs 128 , 129 and 130 extending in the peripheral direction are arranged at an axial distance from one another on an cylindrical roller body 127 . attached to the outer peripheries of these supporting discs 128 to 130 are glue - coating members which are brought in contact with the respective surfaces of the blank 11 . the outer supporting discs 128 and 130 are provided with glue segments 131 which are offset inwards in a step - like manner and which extend along a part periphery and serve for applying the spots of glue 122 . glue segments 132 , offset in the peripheral direction , are formed on the same supporting disc 128 or 130 and serve for applying the glue spots 121 . the glue spots 123 are applied by a u - shaped glue segment 133 with two legs . a u - shaped glue segment 134 , offset in the peripheral direction , is likewise attached to the same supporting disc 129 and is divided in the peripheral direction by an indentation 135 , so that this glue segment altogether forms four glue transfer surfaces . the relative positions of the glue segments 131 to 134 and their shapes and dimensions in the peripheral direction are selected so that the glue patterns shown in fig1 are produced . whereas the glue segments 133 and 134 in the middle region of the glue roller 125 are designed with plane or cylindrical glue - coating surfaces , the glue - coating surfaces 136 and 137 of the outer glue segments 131 and 132 have a conical form , namely a form sloping obliquely outwards . these conical glue - coating surfaces 156 and 157 take effect in the region of side tabs 18 , 19 or in the region of the bottom corner tab 20 , while these blank parts are fixed in an obliquely raised v - shaped position . the design of the glue - coating surfaces 136 , 137 and their angular position are matched to the angular position of the side tabs 18 , 19 , accordingly being directed approximately at an angle of 45 °. the blanks 11 preformed or prefolded in the stations described above are conveyed in the glueing station 120 on a pack track 138 directed obliquely downwards . this consists of a bottom guide 139 , composed of two supporting bars arranged at a distance from one another ( fig1 ), and of a top guide 140 composed of a single guide bar offset relative to the bars of the bottom guide 139 . the middle region of the blanks 11 is conveyed between these . the blanks , after being shaped or prefolded , are first transported by the drawing pulleys 37 , 38 at the end of the folding arrangement or at the entrance of the glueing station 120 . further drawing rollers 141 and 142 are arranged at the outlet of the glueing station 120 and serve for the further transport of the blanks . the distance between these drawing rollers 141 , 142 and the drawing pulleys 37 , 38 is less than the length of a blank 11 . located opposite the glue roller 120 , namely underneath the blanks 11 , is a counter - roller 143 . this consists of individual counter - discs 145 and 146 arranged on a common counter - shaft 144 . the design , dimensions and arrangement of the counter - discs are co - ordinated with those of the supporting discs 128 to 130 or glue segments 131 to 134 of the glue roller 125 , specifically in such a way that there are always glue segments 131 to 134 or their glue - coating surfaces 136 , 137 arranged approximately centrally between two adjacent counter - discs 145 , 146 . the outer counter - discs 146 are arranged laterally next to the outer glue segments 131 and 132 and are provided with sloping or conical peripheral surfaces 147 for supporting the inclined side tabs 18 , 19 . the glue roller 125 is preceded by a guide member for the blanks 11 , namely a mouth piece 148 . this consists of a mouth piece body 149 with inclined guide slots 150 for receiving and guiding the obliquely directed parts of the blank 11 ( side tabs 18 , 19 , etc ). the guide slots 150 lie in a plane of 45 ° corresponding to the position of the blank parts when glue is applied . guide means in the form of curved guide plates 151 lead to the guide slots 150 . these guide plates 151 are designed and arranged in such a way that the lateral blank parts ( side tabs 18 , 19 ) erected during preforming are pressed into an angular position corresponding to the position of the guide slots 150 . the guide plates 151 lead to the inlet side of the guide slots 150 . located next to the glue roller 125 is a glueing unit 152 . this consists of a glue pot 153 of a design known in principle . mounted rotably in the glue pot 153 is a glue transfer roller 154 . this is partially immersed in the glue located in the glue pot 153 and takes up a layer of glue on its surface . during the rotation of the glue roller 125 , the glue segments 131 to 134 come in contact with the glue transfer roller 154 likewise driven to rotate , in such a way that glue can be transferred onto the glue - coating surfaces . the glue transfer roller 154 is designed in the manner of a yarn reel to match the shape of the glue roller 125 or glue segments 131 to 134 , namely with the cylindrical middle part 155 and lateral conical parts 156 . the latter are provided with glue transfer surfaces directed approximately at 45 °, corresponding to the glue - coating surfaces 136 , 137 of the outer glue segments 131 , 132 . installed inside the glue pot 153 is a scraper 157 . the contours of this match the shape of the glue transfer roller 154 , namely having triangular recesses 158 . for cleaning purposes , the glue transfer roller 154 can be extracted from the glue pot 153 . to achieve this , a drive shaft 159 of the glue transfer roller 154 is equipped with a coupling 160 . | 1 |
in the following description , the present invention will be elucidated in more detail by way of example . the contents and order of the description is as follows : example 2 . use of the mutant ( ii ) in 2 - keto - l - gulonic acod production by fermentation . example 3 . use of cell suspension and cell extract of the mutant ( ii ) in 2 - keto - l - gulonic acid production by contacting . example 4 . addition of a nitrate salt and a hydrogen donor to the fermentation broth . carrier : toyo roshi no . 50 or tlc aluminum sheet cellulose ( available from toyo roshi k . k . or merck a . g .) color development : spraying ahf solution ( prepared by dissolving 0 . 93 g of aniline and 1 . 66 g of phthalic acid in 100 ml of water - saturated n - butanol ) and heating at 105 ° c . for 2 minutes . was adjusted to ph 7 . 2 . each 50 ml portions was placed in a 500 ml conical flask and sterilized at 115 ° c . for 20 minutes . a medium of the following composition was adjusted to ph 7 . 2 and sterilized at 115 ° c . for 15 minutes . ______________________________________nh . sub . 4 cl 0 . 5 % nh . sub . 4 no . sub . 3 0 . 1 % na . sub . 2 so . sub . 4 0 . 2 % mgso . sub . 4 . 7h . sub . 2 o 0 . 1 % caco . sub . 3 0 . 0001 % kh . sub . 2 po . sub . 4 0 . 3 % k . sub . 2 hpo . sub . 4 0 . 1 % trace element solution * 0 . 1 % vitamin solution ** 0 . 1 % andagar 2 . 0 % na . sub . 2 b . sub . 4 o . sub . 7 . 10h . sub . 2 o 88 mg ( nh . sub . 4 ). sub . 6 mo . sub . 7 o . sub . 24 . 4h . sub . 2 o 37 mgfecl . sub . 3 . 6h . sub . 2 o 970 mgznso . sub . 4 . 7h . sub . 2 o 88 mgcuso . sub . 4 . 5h . sub . 2 o 270 mg andmncl . sub . 2 . 4h . sub . 2 o 27 mgthiamine 1 . 0 mgpantothenic acid 10 mgniacin 10 mg andbiotin 0 . 1 mg______________________________________ * trace element solution ( ingredients per liter ) ** vitamin solution ( ingredients per liter ) each of aqueous solutions ( 10 %) of sodium d - gluconate and of sodium 5 - keto - d - gluconate was adjusted to ph 6 . 8 - 7 . 2 and sterilized by filtration . one loopful each of corynebacterium sp . ferm - p 2770 and corynebacterium sp . ferm - p 2687 was inoculated in the liquid medium ( 1 ) and cultured at 28 ° c . for 8 hours . to each of the cultured media , previously sterilized 0 . 2 % aqueous solution of n - methyl - n &# 39 ;- nitro - n - nitroso - guanidine was added to give a final concentration of 0 . 02 % and the incubation was continued for another 30 minutes . the incubated medium was centrifuged ( 10 , 000 r . p . m ., 15 minutes ) and cells were collected therefrom . the collected cells were washed three times with sterilized physiological saline and suspended in each 10 ml of the saline . each 1 ml of the suspension was inoculated in the medium ( 1 ) and cultured at 28 ° c . for 15 hours . the culture was then diluted to 10 2 - 10 3 viable cells per milliliter with sterilized saline . then , each 0 . 5 - 1 ml of the diluted culture was spread over a plate medium prepared by mixing d - gluconic acid solution ( 3 ) with the minimum agar medium ( 2 ) in the proportion of 1 to 9 and allowed to grow at 28 ° c . for 3 - 5 days . colonies of the grown cells ( strain ( 1 ) of table 3 which grow in d - gluconic acid medium ) were transferred with a velveteen cloth to a plate medium prepared by mixing 5 - keto - d - gluconic acid solution ( 3 ) with the minimum agar medium ( 2 ) in the proportion of 1 to 9 . after being incubated for 3 - 5 days , colonies of the cells that grew on the d - gluconic acid medium but did not grow on the 5 - keto - d - gluconic acid medium were picked up and inoculated to be incubated in the d - gluconic acid medium . the thus selected mutant ( strain ( 2 ) in table 3 which cannot grow on the 5 - keto - d - gluconic acid medium ) was inoculated in the medium ( 1 ) containing 1 % of 5 - keto - d - gluconic acid and cultured at 28 ° c . for 24 hours . 5 - keto - d - gluconic acid remaining in the culture was determined by means of paper chromatography in order to confirm that this strain ( 2 ) was unable to utilize 5 - keto - d - gluconic acid . the medium ( 2 ) which will be described in example 2 was inoculated with one loopful of the mutant confirmed to be unable to utilize 5 - keto - d - gluconic acid ( strain ( 3 ) in table 3 ) and incubated for 20 hours . to this incubated medium , was added the calcium 2 , 5 - diketo - d - gluconate solution which will be described in preparation b to give a final concentration of 1 . 0 % and the incubation continued for further 24 hours . the amounts of 2 - keto - d - gluconic acid and 2 - keto - l - gulonic acid in the cultured medium were determined by means of paper chromatography . the results are shown in table 3 below . thus , 308 desired mutants defective in metabolizing 5 - keto - d - gluconic acid and substantially incapable of producing 2 - keto - d - gluconic acid were obtained from 84 , 520 colonies of mutagenized corynebacterium sp . ferm - p 2770 to grow out , and in a similar manner , 11 desired mutants were obtained from 29 , 100 colonies of mutagenized corynebacterium sp . ferm - p 2687 . table 3______________________________________2 - keto - l - gulonic acid corynebacterium corynebacteriumproducing microorganism sp . ferm - p 2770 sp . ferm - p 2687 ( parents ) ( number of the mutant strains ) ______________________________________strains ( 1 ) which can 84 , 520 29 , 100grow on d - gluconic acidmediumstrains ( 2 ) of those ( 1 ) 363 45which cannot grow on5 - keto - d - gluconic acidmediumstrains ( 3 ) of those ( 1 ) 319 13which cannot utilize5 - keto - d - gluconic acidstrains of those ( 3 ) 308 11which produce 2 - keto - l - gulonic acid but do notproduce 2 - keto - d - gluconic acid______________________________________ ______________________________________d - glucose 1 . 0 % corn steep liquor ( csl ) 5 . 0 % potassium primary phosphate ( kh . sub . 2 po . sub . 4 ) 0 . 1 % magnesium sulfate ( mgso . sub . 4 . 7h . sub . 2 o ) 0 . 02 % andcalcium carbonate ( caco . sub . 3 ) 0 . 5 % ______________________________________ was adjusted to ph 6 . 8 - 7 . 0 with 10 % naoh solution and divided into 50 ml portions to be placed in a 500 ml conical flask , respectively . the seed medium was sterilized at 120 ° c . for 20 minutes . the seed medium ( i ) in the flask was inoculated with one loopful of erwinia punctata ferm - p 5452 shown in table 1 and incubated under agitation ( 71 mm in amplitude , 270 r . p . m .) at 28 ° c . for 8 - 11 hours . the seed culture was terminated at a time point when its optical density reached about 8 ( end point ). ______________________________________d - glucose 20 % csl 3 % kh . sub . 2 po . sub . 4 0 . 1 % caco . sub . 3 6 . 3 % andantifoam , polypropylene glycol 0 . 01 %( p - 2000 ) ______________________________________ was adjusted to ph 6 . 8 - 7 . 0 , sterilized at 120 ° c . for 20 minutes , and each 455 ml portion was poured aseptically into a sterilized 1 liter fermenter and , each 45 ml of the above seed culture ( ii ) was added . a fermentation was carried out at 28 ° c . with air flow rate of 600 nml / minutes and agitation at 1740 r . p . m . for 20 - 30 hours ( final 2 , 5 - diketo - d - gluconic acid concentration being about 19 w / v %). the broth was centrifuged to remove the cells and the supernatant thereof was sterilized by filtration . this was used as the 2 , 5 - diketo - d - gluconic acid fermentation broth . the fermentation was terminated at a time when the pink spot of 2 - keto - d - gluconic acid disappeared from a thin - layer chromatogram of the broth . an aqueous solution containing 5 % powdery calcium 2 , 5 - diketo - gluconate in concentration of 5 . 0 % was sterilized by filtration . example 2 ( use of the mutant ( ii ) in 2 - keto - l - gulonic acid production by fermentation ) ______________________________________d - glucose 1 . 0 % bacto yeast extract ( difco ) 0 . 5bacto peptone ( difco ) 0 . 5potassium primary phosphate 0 . 1 % and ( kh . sub . 2 po . sub . 4 ) magnesium sulfate ( mgso . sub . 4 . 7h . sub . 2 o ) 0 . 02 % ______________________________________ was adjusted to ph 7 - 7 . 2 with 10 % naoh solution . each 50 ml portion was poured into 500 ml conical flask and sterilized at 115 ° c for 20 minutes . ______________________________________d - glucose 1 . 0 % corn steep liquor ( csl ) 3 . 0 % kh . sub . 2 po . sub . 4 0 . 1 % andmgso . sub . 4 . 7h . sub . 2 o 0 . 02 % ______________________________________ each 50 ml portion was placed in 500 ml conical flask and sterilized at 115 ° c . for 20 minutes . the seed medium ( 1 ) was inoculated with one loopful each of the 2 - keto - l - gulonic acid - producing microorganism ( parent ( i )) or mutants ( ii ) derived from ( i ), shown in table 4 and the inoculated medium was cultured at 28 ° c . for 24 hours . thereafter , each 5 ml of this seed culture was inoculated in the fermentation medium ( 2 ) and cultured . either one of solutions of 2 , 5 - diketo - d - gluconic acid ( preparations a and b ) was added to this fermentation medium to give a final concentration of 2 %, at the beginning or at any time within 16 hours after the beginning of the fermentation and the fermentation was continued for further 48 hours . the results of the gas - liquid chromatogrphy of the products are summarized in table 4 below . as indicated in table 4 , no 2 - keto - d - gluconic acid was detected from the broths of the mutant ( ii ) whereas a considerable amount of said acid was detected from those of the parent ( i ). table 4__________________________________________________________________________accumulations ( mg / ml ) of 2 - keto - l - gulonic acid and 2 - keto - d - gluconic acidinbroths , in which each of the parent strains ( i ) and each of the mutants ( ii ) was cultured , determined at the 48th hour after the beginning of thecultivations . time of feeding aqueous solution of broth of ferm - p 5452 , 2 - keto - l - gulonic acid 2 , 5 - diketo - d - gluconic calcium 2 , 5 - diketo - d - gluconate atcc 31626producing microorganism acid , hours after the ( sterilized by filtration ) ( sterilized by filtration ) strains beginning of cultivation . 2klg , mg / ml 2kdg , mg / ml 2klg , mg / ml 2kdg , __________________________________________________________________________ mg / mlcorynebacterium sp . 0 1 . 50 0 . 46 1 . 75 0 . 58ferm - p 2770 , 16 3 . 85 1 . 38 4 . 10 1 . 45atcc no . 310905 - keto - d - gluconic acid 0 5 . 20 0 5 . 33 0metabolism deficient 16 7 . 30 0 8 . 20 0mutant ( ferm - bp 108 ) corynebacterium sp . 0 0 . 28 0 . 42 0 . 38 0 . 24ferm - p 2687 , 16 0 . 70 0 . 70 0 . 73 0 . 68atcc no . 310815 - keto - d - gluconic acid 0 0 . 25 0 0 . 40 0metabolism deficient 16 0 . 83 0 0 . 86 0mutant ( ferm - bp 107 ) __________________________________________________________________________ 2klg : 2keto - l - gulonic acid , 2kdg : 2keto - d - gluconic acid example 3 ( uses of cell suspension and cell extract in 2 - keto - l - gulonic acid production by contacting ) the seed medium as described in example 2 , ( 1 ) was inoculated with each one loopful of corynebacterium sp . ferm - p 2770 ( i ) or the mutant defective in metabolizing 5 - keto - d - gluconic acid and substantially incapable of producing 2 - keto - d - gluconic acid ferm - bp 108 ( ii ), and cultured under agitation at 28 ° c . for 24 hours . the fermentation medium ( 455 ml ) as described in example 2 , ( 2 ), further containing 0 . 01 % of antifoam , polypropylene glycol 2000 ( p 2000 ) was aseptically placed in a 1 liter fermenter and inoculated with each 45 ml of the seed culture broth ( 1 ). fermentation was performed at 28 ° c . for 16 hours with agitation of 1740 r . p . m . and at an air flow rate of 600 nml / min . the cultured broth ( 2 ) was centrifuged ( 15 , 000 r . p . m .) to collect cells which were then washed twice with physiological saline . the washed cells were suspended in 0 . 05m tris buffer ( ph 7 . 5 ) to give a suspension of od 660 nm = 12 . the cells washed in the same manner as described in ( 3 ) above were suspended in 0 . 05m tris buffer ( ph 7 . 8 ) to give a suspension of od 660 nm = 100 , which was passed through a french pressure cell press at 1 , 000 kg / cm . the intact cells and cell debris were removed by centrifugation at 20 , 000 g for 30 min . the resultant supernatant thereof was dialyzed against 0 . 05m tris buffer ( ph 7 . 5 ) for 15 hours and defined as a cell extract . eight ( 8 ) ml of the cell suspension ( 3 ) was combined with 2 ml of ca 2 , 5 - diketo - d - gluconate solution ( preparation b ) and the mixture was allowed to react at 30 ° c . for 15 hours with shaking . thereafter , the reaction mixture was centrifuged ( 15 , 000 g , 15 min .) to remove the cells and analyzed for 2 - keto - l - gulonic acid and 2 - keto - d - gluconic acid by gas - liquid chromatography . the results of the quantitative determination are given in table 5 below . table 5______________________________________ concentration in the reaction mixture : microorganisms used for 2 - keto - l - 2 - keto - d - preparing the cell suspention : gulonic acid gluconic acid______________________________________corynebacterium sp . ferm - p 2770 1 . 93 mg / ml 0 . 64 mg / mlatcc 31090mutant defective in 2 . 65 mg / ml 0 mg / mlmetabolizing 5 - keto - d - gluconic acid ferm - bp 108______________________________________ the cell extract ( 4 )( 0 . 5 ml ) was added to 2 . 5 ml of 0 . 1m tris buffer ( ph 7 . 5 ) containing 75μ moles of ca 2 , 5 - diketo - d - gluconate and 15μ moles of nadph ( reduced nicotinamide adenine dinucleotide phosphate ) to be allowed to react at 30 ° c . for 16 hours . the results of quantitative determination of the reaction mixture are given in table 6 below . table 6______________________________________ concentration in the reaction mixture : microorganisms used for 2 - keto - l - 2 - keto - d - preparing the cell extract : gulonic acid gluconic acid______________________________________corynebacterium sp . ferm - p 2770 285 mcg / ml 32 mcg / mlatcc 31090mutant defective in 356 mcg / ml 0 mcg / mlmetabolizing 5 - keto - d - gluconicacid ferm - bp 108______________________________________ from the results shown in tables 5 and 6 above , it was confirmed that 2 - keto - l - gulonic acid was produced in either of the reactions wherein the cell suspension ( 3 ) or cell extract ( 4 ) was used . in both cases , the products , prepared from the parent 2 - keto - l - gulonic acid producing microorganism strain , ferm - p 2770 ( i ), however produce 2 - keto - d - gluconic acid together with 2 - keto - l - gulonic acid , while those prepared from the mutant ( ii ) produce 2 - keto - l - gulonic acid but do not produce 2 - keto - d - gluconic acid . example 4 ( addition of a nitrate and a hydrogen donor to the fermentation broth ) the fermentation broth prepared in accordance with preparation a was centrifuged ( 10 , 000 r . p . m ., 15 minutes ) to remove cells and its supernatant was sterilized by filtration ( 2 , 5 - diketo - d - gluconic acid concentration : 19 %). the sterilized fermentation broth was mixed with a sterilized aqueous d - glucose solution ( 50 %) to give a final concentration of 3 . 8 % of the hydrogen donor , d - glucose to the broth . ( 2 ) fermentation medium ( common to the subsequent examples for the preparation of 2 - keto - l - gulonic acid ) ______________________________________d - glucose 2 . 0 % csl 3 . 0 % kh . sub . 2 po 0 . 1 % mgso . sub . 4 . 7h . sub . 2 o 0 . 02 % andantifoam : polypropylene glycol 0 . 01 %( p - 2000 ) ______________________________________ was adjusted to ph 7 . 0 - 7 . 2 and each 450 ml portion was sterilized at 115 ° c . for 20 minutes and aseptically placed in a sterilized 1 liter fermenter . each of sodium nitrate , potassium nitrate , sodium nitrite and ammonium chloride was individually dissolved in water to make each 10 % aqueous solution to be sterilized by filtration , to give the additives for the media at the beginning of culture and of the start of 2 , 5 - diketo - d - gluconic acid feeding . the seed medium as described in example 2 , ( 1 ), was inoculated with one loopful of a mutant defective in metabolizing 5 - keto - d - gluconic acid and substantially incapable of producing 2 - keto - d - gluconic acid , ferm - bp 108 derived from corynebacterium sp . ferm - p 2770 , atcc no . 31090 and the inoculated medium was incubated with shaking at 28 ° c . for 20 - 24 hours . each 50 ml of this seed culture was inoculated in the fermentation medium ( 2 ) and , after being aseptically added with the various nitrogen compound additives prepared in accordance with the above ( 3 ) to give a final concentration of 0 . 25 %, it was cultivated at 28 ° c . at an air flow rate of 1 . 2 v . v . m . and 1740 r . p . m . for 10 - 16 hours . after confirmation of the disappearance of d - glucose by the quantitative determination described above , each of the nitrogen compound additives ( 3 ) was added again to give a final concentration of 0 . 1 %. furthermore , the 2 , 5 - diketo - d - gluconic acid fermentation broth containing 3 . 8 % of d - glucose was added to make the latter &# 39 ; s final concentration 0 . 2 %. subsequently , 2 , 5 - diketo - d - gluconic acid was fed by portions to the culture every 15 - 120 minutes to give a concentration about 0 . 2 % just after each feeding while monitoring elimination of said acid from the broth . the 2 , 5 - diketo - d - gluconic acid feeding was terminated at the 45th hour after the start of the feeding but the cultivation was continued for further 3 hours ( total cultivation time after the start : 48 hours ). after the cultivation is completed , the broth was analyzed for 2 - keto - l - gulonic acid , 2 - keto - d - gluconic acid and 2 , 5 - diketo - d - gluconic acid , individually by gas chromatography . as a result , it was confirmed that no 2 - keto - d - gluconic acid was detected from either of the media . accumulations of 2 - keto - l - gulonic acid in the broth with various nitrogen compound additives were summarized in table 7 below . table 7__________________________________________________________________________advantages of various nitrogen compound additives on the accumulationof 2 - keto - l - gulonic acid to the initial fermentation medium and to thesame medium at the start of the 2 , 5 - diketo - d - gluconic acid feeding . ( figures in table indicate the accumulation of 2 - keto - l - gulonic acid inthe medium , and figures in the parenthesis indicate the molar yield of2 - keto - l - gulonic acidfrom precursor , obtained by the following formula : ( 2 - keto - l - gulonicacid , produced ( mol ) ÷ ( 2 , 5 - diketo - d - gluconic acid consumed ( mol ) × 100 ) nitrogen compound added at the beginning of the 2 , 5 - diketo - d - gluconic acid additionnitrogen presence 2 - keto - l - gulonic acid accumulation , mg / ml , compound of ( molar yield of 2 - keto - l - gulonic acid , %) added to the hydrogen sodium potassium sodium ammoniuminitial fermen - donor none nitrate nitrate nitrite chloridetation medium ( d - glucose ) mg / ml % mg % mg / ml % mg / ml % mg / ml % __________________________________________________________________________none none 8 . 2 ( 41 ) 8 . 9 ( 43 ) 9 . 0 ( 43 ) 3 . 9 ( 38 ) 8 . 9 ( 46 ) added 15 . 7 ( 75 ) 22 . 0 ( 87 ) 22 . 1 ( 86 ) 6 . 0 ( 62 ) 16 . 0 ( 78 ) sodium nitrate none 8 . 6 ( 49 ) 12 . 1 ( 48 ) 4 . 4 ( 45 ) 9 . 2 ( 43 ) added 26 . 5 ( 91 ) 40 . 2 ( 93 ) 16 . 0 ( 88 ) 27 . 5 ( 90 ) potassium nitrate none 8 . 8 ( 52 ) 12 . 2 ( 46 ) added 25 . 8 ( 92 ) 40 . 3 ( 93 ) sodium nitrite none 3 . 2 ( 31 ) 3 . 6 ( 38 ) added 8 . 1 ( 54 ) 7 . 8 ( 53 ) ammonium chloride none 9 . 2 ( 42 ) 9 . 7 ( 45 ) added 17 . 0 ( 78 ) 18 . 3 ( 80 ) __________________________________________________________________________ as shown in table 7 above , in which a comparison is made between a case wherein a nitrate is added to the medium or broth at the beginning of the fermentation as well as at the start of the 2 , 5 - diketo - d - gluconic acid feeding , and d - glucose which serves as the hydrogen donor is added together with the feeding of 2 , 5 - diketo - d - gluconic acid , and another case wherein no such addition is made , it is obvious that the accumulation of 2 - keto - l - gulonic acid in the broth increases from 8 . 2 mg / ml to 40 mg / ml ( about five fold increase ) and the yield ( mol %) of 2 - keto - l - gulonic acid increases from 41 % to 93 %. on the other hand , the cell concentration in terms of optical density ( o . d .) at the time when d - glucose disappear from the broth is measured as summarized in table 8 below , which indicates that the nitrate is not as effective as the nitrogen nutrient source . as indicated in table 8 , although the increase in the cell concentration by the addition of the nitrate is limited only to 11 . 6 %, the increase by the addition of the ammonium salt reaches about 40 %. this fact shows that the effect of the nitrate as the nitrogen source is less than that of the ammonium salt . from the above fact , it is confirmed that the addition of nitrate to the medium has only a small effect on the increase in the cell concentration , but has a great advantage on the increase in the 2 - keto - l - gulonic acid production and on the improvement in molar yield of converting 2 , 5 - diketo - d - gluconic acid into 2 - keto - l - gulonic acid . table 8______________________________________effect of the additives added at thebeginning of the cultivation on the growthof the microorganisms ( fig . in table indicate the cell concentration at thetime when d - glucose disappears in terms of optical density ( o . d .) measured at 660 nm ) additives at the beginning opticalof the cultivation density ( o . d . ) ______________________________________none 13 . 7sodium nitrate 15 . 3potassium nitrate 15 . 0sodium nitrite 11 . 1ammonium chloride 19 . 3______________________________________ the broth prepared in accordance with preparation a was divided into several portions immediately after the culture was terminated . each of the listed surfactants was aseptically added to each portion of the broth to give a final concentration of 0 . 025 w / v %. the surfactants employed are shown in table 9 below . the surfactant treatment was conducted under occasional agitation at 28 ° c . for 6 hours . of these 2 , 5 - diketo - d - gluconic acid fermentation broths , one treated with sds was used in the 2 - keto - l - gulonic acid fermentation by mutant ( ii ) which will be described later . table 9______________________________________bacterial effects of various surfactantson the strain ( iii ) ferm - p 5452 decrease in number of viable cells / ml after treatmentsurfactant at 28 ° c . for ( 0 . 025 w / v %) initial 6 hours______________________________________none 2 . 3 × 10 . sup . 9 1 . 5 × 10 . sup . 8sodium dodecyl sulfate ( sds ) &# 34 ; 7 . 5 × 10 . sup . 3fatty acid sorbitate ( span &# 34 ; 2 . 2 × 10 . sup . 560 , available from kaooatlas k . k . ) sodium stearate &# 34 ; 1 . 7 × 10 . sup . 8sodium myristate &# 34 ; 1 . 6 × 10 . sup . 8nonion hs 210 &# 34 ; 3 . 8 × 10 . sup . 4 ( available from hs 215 &# 34 ; 4 . 5 × 10 . sup . 4nihon yushi k . k . hs 230 &# 34 ; 6 . 7 × 10 . sup . 4 l 4 &# 34 ; 2 . 1 × 10 . sup . 5 ns 240 &# 34 ; 5 . 0 × 10 . sup . 5______________________________________ an aqueous d - glucose solution ( 50 %) was added to each of the sds treated fermentation broth , the fermentation broth sterilized by filtration and the untreated broth to give its final concentration of 3 . 8 %, individually , just before the feeding of the broth to the cultured broth of the mutant ( ii ). these 2 , 5 - diketo - d - gluconic acid fermentation broths will be referred to as &# 34 ; substrate solution &# 34 ; hereinafter and used as the raw material for 2 - keto - l - gulonic acid production . ( 2 ) production of 2 - keto - l - gulonic acid from 2 , 5 - diketo - d - gluconic acid by the mutant ( ii ) the seed medium , as described in example 2 , ( 1 ), was inoculated with one loopful of the mutuant defective in metabolizing 5 - keto - d - gluconic acid and substantially incapable of producing 2 - keto - d - gluconic acid ( ii ) ferm - bp 108 , derived from corynebacterium sp . ferm - p 2770 , atcc no . 31090 and incubated at 28 ° c . for 20 - 24 hours with agitation ( 71 mm in amplitude , 270 r . p . m .). the fermentation medium , as described in example 4 , ( 2 ), further containing 0 . 2 % of sodium nitrate , was inoculated with each 50 ml of the seed culture solution and incubated at 28 ° c . for 10 - 16 hours at an airflow rate of 600n ml / min . and agitation ( 1740 r . p . m .). after d - glucose was consumed and eliminated from the culture of the mutant ( ii ), ferm - bp , 108 , each of substrate solutions prepared as described in ( 1 ) above was added separately to the culture so that the 2 , 5 - diketo - d - gluconic acid concentration was 0 . 2 %. subsequently , the substrate solution was fed to the culture by portions every 15 - 120 minutes , while monitoring the elimination in the amount of 2 , 5 - diketo - d - gluconic acid in the culture to give its concentration of about 0 . 2 % just after each feeding . the feeding of the substrate solution was terminated at the 45th hour but the cultivation was continued for further 3 hours to make the total cultivation time after the beginning of the feeding 48 hours . the fermentation broth was aseptically sampled at predetermined intervals to be analyzed for 2 , 5 - diketo - d - gluconic acid and 2 - keto - l - gulonic acid , and viable cells in the sample were counted ( measurement ( 3 )). the results of the analysis and the measurements are summarized in table 10 . table 10__________________________________________________________________________time after the bactericidal treatment ofbeginning of 25dkg * 25dkg fermentation brothfermentation broth treatment sterilizationfeeding ( hours ) untreated with sds by filtration__________________________________________________________________________ 8 2klg **, produced ( mg / ml ) 10 . 2 10 . 8 10 . 9 number of viable cells of 8 . 9 × 10 . sup . 3 not not the strain ( iii )( cells / ml ) detected detected24 2klg , produced ( mg / ml ) 14 . 8 18 . 6 18 . 7 number of viable cells of 2 . 3 × 10 . sup . 5 3 . 5 × 10 . sup . 3 not the strain ( iii )( cells / ml ) detected48 2klg , produced ( mg / ml ) 15 . 8 26 . 6 26 . 3 number of viable cells of 3 . 1 × 10 . sup . 7 3 . 3 × 10 . sup . 4 not the strain ( iii )( cells / ml ) detected__________________________________________________________________________ * 25dkg : 2 , 5diketo - d - gluconic acid * 2klg : 2keto - l - gulonic acid the sampled fermentation broth was diluted with sterilized physiological saline and spread over a glycerol - bouillon agar medium which was then incubated at 28 ° c . for 24 - 36 hours . the viable cells on the medium were counted as colonies . note : since the growth rate of the strain ( iii ) is much higher than that of the mutant ( ii ), cells of the strain ( iii ) intermingled with cells of the mutant ( ii ) can discriminately be counted without substantial difficulty . from the results of the above experiments , the following facts are confirmed . namely : ( 1 ) of various surfactants proposed and evaluated as a bactericidal agent for the strain ( iii ) in the 2 , 5 - diketo - d - gluconic acid fermentation broth , sds ( sodium dodecyl sulfate ) is the most excellent in the bactericidal effect ( see : table 9 ). ( 2 ) in the results ( see : table 10 ) of the 2 - keto - l - gulonic acid - producing experiments in which the three kind of substrate solutions prepared under conditions above are employed ; ( i ) in a fermentation experiment wherein the untreated substrate solution was used , the number of viable cells of the strain ( iii ) reached 10 5 - 10 7 cells / ml in 24 hours after the beginning of the addition of the substrate solution while the accumulation of 2 - keto - l - gulonic acid scarcely increased after 24 hours as compared with the other two experiments . ( ii ) in a fermentation experiment wherein the sds - treated substrate solution was added , the increase in the number of viable cells of the strain ( iii ) was effectively controlled to less than 10 4 cells / ml even after 48 hours from the beginning of the addition of the substrate solution , and the accumulation of 2 - keto - l - gulonic acid reached about 27 mg / ml , ( iii ) accumulation of 2 - keto - l - gulonic acid in that of ( ii ) is equivalent to that in a fermentation experiment in which the substrate solution sterilized by filtration was added ; and ( iv ) in the last - mentioned fermentation experiment wherein a substrate solution sterilized by filtration is added , no viable cells of the strain ( iii ) were of course detected and the production of 2 - keto - l - gulonic acid proceeded without any difficulty . | 8 |
the following discussion is directed to various embodiments of the invention . although one or more of these embodiments may be preferred , the embodiments disclosed should not be interpreted , or otherwise used , as limiting the scope of the disclosure , including the claims , unless otherwise specified . in addition , one skilled in the art will understand that the following description has broad application , and the discussion of any embodiment is meant only to be exemplary of that embodiment , and not intended to intimate that the scope of the disclosure , including the claims , is limited to that embodiment . fig1 shows a computing system 100 constructed in accordance with at least some embodiments of the invention . the computing system 100 preferably comprises the arm ® trustzone ® architecture , but the scope of disclosure is not limited to any specific architecture . the computing system 100 may comprise a multiprocessing unit ( mpu ) 10 coupled to various other system components by way of a bus 11 . the mpu 10 may comprise a processor core 12 that executes applications , possibly by having one or more processing pipelines . the mpu 10 may further comprise a security state machine ( ssm ) 56 which , as will be more fully discussed below , aids in allowing the computer system 100 to enter a secure mode for execution of secure software , such as m - commerce and e - commerce software . the computing system 100 may further comprise a digital signal processor ( dsp ) 16 that aids the mpu 10 by performing task - specific computations , such as graphics manipulation and speech processing . a graphics accelerator 18 may couple both to the mpu 10 and dsp 16 by way of the bus 11 . the graphics accelerator 18 may perform necessary computations and translations of information to allow display of information , such as on display device 20 . the computing system 100 may further comprise a memory management unit ( mmu ) 22 coupled to random access memory ( ram ) 24 by way of the bus 11 . the mmu 22 may control access to and from the ram 24 by any of the other system components such as the mpu 10 , the dsp 16 and the graphics accelerator 18 . the ram 24 may be any suitable random access memory , such as synchronous ram ( sram ) or rambus ™- type ram . the computing system 100 may further comprise a usb interface 26 coupled to the various system components by way of the bus 11 . the usb interface 26 may allow the computing system 100 to couple to and communicate with external devices . the ssm 56 , preferably a hardware - based state machine , monitors system parameters and allows the secure mode of operation to initiate such that secure programs may execute from and access a portion of the ram 24 . having this secure mode is valuable for any type of computer system , such as a laptop computer , a desktop computer , or a server in a bank of servers . however , in accordance with at least some embodiments of the invention , the computing system 100 may be a mobile ( e . g ., wireless ) computing system such as a cellular telephone , personal digital assistant ( pda ), text messaging system , and / or a computing device that combines the functionality of a messaging system , personal digital assistant and a cellular telephone . thus , some embodiments may comprise a modem chipset 28 coupled to an external antenna 30 and / or a global positioning system ( gps ) circuit 32 likewise coupled to an external antenna 34 . because the computing system 100 in accordance with at least some embodiments is a mobile communication device , computing system 100 may also comprise a battery 36 which provides power to the various processing elements . the battery 36 may be under the control of a power management unit 38 . a user may input data and / or messages into the computing system 100 by way of the keypad 40 . because many cellular telephones also comprise the capability of taking digital still and video pictures , in some embodiments the computing system 100 may comprise a camera interface 42 which may enable camera functionality , possibly by coupling the computing system 100 to a charge couple device ( ccd ) array ( not shown ) for capturing digital images . inasmuch as the systems and methods described herein were developed in the context of a mobile computing system 100 , the remaining discussion is based on a mobile computing environment . however , the discussion of the various systems and methods in relation to a mobile computing environment should not be construed as a limitation as to the applicability of the systems and methods described herein to just mobile computing environments . in accordance with at least some embodiments of the invention , many of the components illustrated in fig1 , while possibly available as individual integrated circuits , are preferably integrated or constructed onto a single semiconductor die . thus , the mpu 10 , digital signal processor 16 , memory controller 22 and ram 24 , along with some or all of the remaining components , are preferably integrated onto a single die , and thus may be integrated into a computing device 100 as a single packaged component . having multiple devices integrated onto a single die , especially devices comprising a multiprocessor unit 10 and ram 24 , may be referred to as a system - on - a - chip ( soc ) or a megacell 44 . while using a system - on - a - chip may be preferred , obtaining the benefits of the systems and methods as described herein does not require the use of a system - on - a - chip . fig2 shows a portion of the megacell 44 in greater detail . the megacell 44 comprises cpu 46 which couples to security state machine ( ssm ) 56 by way of a security monitoring ( secmon ) bus 73 , also described below . the cpu 46 couples to memories 400 comprising the ram 24 and rom 48 by way of an instruction bus 50 , a data read bus 52 and a data write bus 54 . the buses 50 , 52 and 54 are collectively referred to as “ bus 401 .” the instruction bus 50 may be used by the cpu 46 to fetch instructions for execution from one or both of the ram 24 and rom 48 . data read bus 52 may be the bus across which data reads from ram 24 propagate . likewise , data writes from the cpu 46 may propagate along data write bus 54 to the ram 24 . buses 50 , 52 and 54 couple to the ssm 56 by way of a group of connections collectively referred to as “ bus 403 .” the rom 48 and the ram 24 are partitioned into public and secure domains . specifically , the rom 48 comprises a public rom 68 , accessible in non - secure mode , and a secure rom 62 , accessible in secure mode . likewise , the ram 24 comprises a public ram 64 , accessible in non - secure mode , and a secure ram 60 , accessible in secure mode . in at least some embodiments , the public and secure domain partitions in the rom 48 and the ram 24 are virtual ( i . e ., non - physical ) partitions generated and enforced by a memory management unit ( not specifically shown ) in the cpu 46 . secure rom 62 and secure ram 60 preferably are accessible only in secure mode . in accordance with embodiments of the invention , the ssm 56 monitors the entry into , execution during and exiting from the secure mode . the ssm 56 preferably is a hardware - based state machine that monitors various signals within the computing system 100 ( e . g ., instructions on the instruction bus 50 , data writes on the data write bus 52 and data reads on the data read bus 54 ) and activity in the cpu 46 through secmon bus 73 . each of the secure and non - secure modes may be partitioned into “ user ” and “ privileged ” modes . programs that interact directly with an end - user , such as a web browser , are executed in the user mode . programs that do not interact directly with an end - user , such as the operating system ( os ), are executed in the privileged mode . by partitioning the secure and non - secure modes in this fashion , a total of four modes are made available . as shown in fig3 , in order of ascending security level , these four modes include the non - secure user mode 300 , the non - secure privileged mode 302 , the secure user mode 306 , and the secure privileged mode 304 . there is an intermediate monitor mode 308 , described further below , between the modes 302 and 304 . the computer system 100 may operate in any one of these five modes at a time . the computer system 100 may switch from one mode to another . fig3 illustrates a preferred mode - switching sequence 298 . the sequence 298 is preferred because it is more secure than other possible switching sequences . for example , to switch from the non - secure user mode 300 to the secure privileged mode 304 , the system 100 should first pass through non - secure privileged mode 302 and the monitor mode 308 . likewise , to pass from the secure user mode 306 to the non - secure user mode 300 , the system 100 should switch from the secure user mode 306 to the secure privileged mode 304 , from the secure privileged mode 304 to the monitor mode 308 , from the monitor mode 308 to the non - secure privileged mode 302 , and from the non - secure privileged mode 302 to the non - secure user mode 300 . each mode switch is enacted by the adjustment of bits in the cpsr 82 and the scr 84 . the cpsr 82 comprises a plurality of mode bits . the status of the mode bits determines which mode the computer system 100 is in . each mode corresponds to a particular combination of mode bits . the mode bits may be manipulated to switch modes . for example , the bits may be manipulated to switch from mode 300 to mode 302 . the scr 84 comprises a non - secure ( ns ) bit . the status of the ns bit determines whether the computer system 100 is in secure mode or non - secure mode . in at least some embodiments , an asserted ns bit indicates that the system 100 is in non - secure mode . in other embodiments , an asserted ns bit indicates that the system 100 is in secure mode . adjusting the ns bit switches the system 100 between secure and non - secure modes . because the status of the ns bit is relevant to the security of the system 100 , the ns bit preferably is adjusted only in the monitor mode 308 , since the monitor mode 308 is , in at least some embodiments , the most secure mode . more specifically , when the system 100 is in the monitor mode 308 , the core 12 executes monitor mode software ( not specifically shown ) on the secure rom 62 , which provides a secure transition from the non - secure mode to the secure - mode , and from the secure mode to the non - secure mode . in particular , the monitor mode software performs various security tasks to prepare the system 100 for a switch between the secure and non - secure modes . the monitor mode software may be programmed to perform security tasks as desired . if the core 12 determines that these security tasks have been properly performed , the monitor mode software adjusts the ns bit in the scr register 84 , thereby switching the system 100 from non - secure mode to secure mode , or from secure mode to non - secure mode . the mode of the system 100 is indicated by the signal on secmon 73 , show in fig2 . fig4 a shows a detailed view of the megacell 44 of fig2 . as shown in fig4 a , the memories 400 couple to cpu 46 via instruction bus 401 . the memories 400 also couple to ssm 56 via instruction buses 401 and 403 . the cpu 46 comprises core 12 and the register bank 80 having cpsr register 82 and scr register 84 . the core 12 comprises an execution pipeline 404 which couples to an embedded trace macro cell ( etm )/ secmon interface 406 via bus 413 . the interface 406 couples to the ssm 56 via etm bus 405 and secmon bus 73 , which the interface 406 receives from the register bank 80 . the ssm 56 comprises a physical address check logic ( pacl ) 408 and a virtual address check logic ( vacl ) 410 . both the pacl 408 and the vacl 410 couple to a storage 412 . the storage 412 may comprise any suitable storage , e . g ., registers , rom , etc . the contents of the storage 412 may be modified by the core 12 via peripheral port 398 and bus 399 while the system 100 is in monitor mode . both the pacl 408 and the vacl 410 are capable of generating security violation signals via buses 407 and 409 , respectively . fig4 b shows a detailed view of the storage 412 . specifically , the storage 412 comprises a plurality of storage units ( e g ., registers ). the pacl 408 and the vacl 410 use the contents of these registers to verify the integrity of the monitor mode , as described further below . the storage 412 includes a phys_mon_code_start register 450 and a phys_mon_code_end register 452 . these registers specify the physical start and end memory addresses , respectively , associated with the monitor code stored in the memories 400 . the storage 412 further includes a phys_mon_stack_start register 454 and a phys_mon_stack_end register 456 . these registers specify the physical start and end memory addresses , respectively , associated with a dedicated monitor mode stack stored in the memories 400 . the storage 412 further includes a virt_mon_code_start register 458 and a virt_mon_code_end register 460 . these registers specify the start and end virtual addresses , respectively , associated with the virtual memory space that is associated with the monitor mode code stored in the memories 400 . the storage 412 still further comprises a virt_mon_stack_start register 462 and a virt_mon_stack_end register 464 . these registers specify the start and end virtual addresses , respectively , associated with the virtual memory space that is associated with the dedicated monitor - mode stack stored in the memories 400 . the storage 412 also comprises a virt_peri_start register 466 and a virt_peri_end register 468 . these registers specify the start and end virtual addresses , respectively , associated with the virtual memory space associated with the peripheral port 398 . in accordance with embodiments of the invention , the pacl 408 uses the bus 403 to obtain data associated with each instruction ( or other type of data ) the core 12 fetches from the memories 400 . the pacl 408 ensures that any instruction fetch or data transfer occurring in monitor mode ( i . e ., as determined using the secmon bus 73 ) is associated with a memory address that falls within an expected range of memory addresses . the expected range of memory addresses is programmed into the storage 412 , e . g ., into registers 450 , 452 , 454 and 456 . as the core 12 fetches an instruction from the memories 400 via instruction bus 401 , the pacl 408 obtains an address associated with the instruction using bus 403 . the pacl 408 compares the address associated with the instruction to the expected range of physical memory addresses stored in the registers 450 and 452 . if a match occurs , the pacl 408 does not take any action . however , if the address associated with the instruction does not fall within the expected range of addresses , and if the pacl 408 determines ( i . e ., using the secmon bus 73 ) that the system 100 is in monitor mode , the pacl 408 generates a security violation signal on bus 407 that is transferred to the power reset control manager 66 . in response to the security violation signal , the power reset control manager 66 may reset the system 100 . the ssm 56 also may take any of a variety of alternative actions to protect the computer system 100 . examples of such protective actions are provided in the commonly owned patent application entitled , “ system and method of identifying and preventing security violations within a computing system ,” u . s . patent application ser . no . 10 / 961 , 748 , incorporated herein by reference . in some embodiments , the pacl 408 monitors the physical memory addresses associated with any suitable data obtained from any of the memories 400 for use by the core 12 . in addition to monitoring instructions fetched while the system 100 is in monitor mode , the pacl 408 also may monitor write accesses present on the bus 401 whereby the core 12 writes data to one of the memories 400 . specifically , the pacl 408 ensures that the core 12 does not write data to a monitor mode memory stack in the memories 400 if the core 12 is not in monitor mode . using bus 403 , the pacl 408 obtains the destination memory address associated with a write access on the bus 401 . if the pacl 408 is not in monitor mode and if the destination memory address falls within a range of addresses in the memories 400 reserved for use as a dedicated monitor mode stack ( i . e ., as specified by the registers 454 and 456 ), the pacl 408 may generate a security violation signal via bus 407 . the security violation signal may be handled as described above . if the pacl 408 determines that the system is in monitor mode , then no security violation signal is generated . as described , the pacl 408 ensures that while the system 100 is in monitor mode , instructions fetched from memories 400 are secure and safe to use in the monitor mode . however , it is possible that the instructions that are fetched from the memories 400 are not the instructions that are actually executed by the core 12 . accordingly , the vacl 410 ensures not only that instructions executed by the core 12 are safe to execute in monitor mode , but also that the instructions are properly executed . to this end , the megacell 44 may comprise one or more virtual memories ( not represented in fig4 a ) usable by the core 12 while executing software code . while executing an instruction , any virtual address associated with that instruction is transferred from the execution pipeline 404 to the interface 406 . in turn , the interface 406 transfers the virtual address to the vacl 410 via etm bus 405 for security clearance . the vacl 410 ensures that the instruction , if executed in monitor mode ( e . g ., as determined by the secmon bus 73 ), has a virtual address that falls within an expected range of virtual memory addresses . the expected range of virtual memory addresses is programmed into the storage 412 ( i . e ., registers 458 and 460 ). thus , the vacl 410 receives the virtual address from the interface 406 via etm bus 405 and compares the virtual address with the expected range of virtual memory addresses stored in the registers 458 and 460 . if a match is found , the vacl 410 does not take any action . however , if the received virtual address does not fall within the range of expected addresses , and if the vacl 410 determines ( using the secmon bus 73 ) that the system 100 is in monitor mode , the vacl 410 issues a security violation signal via bus 409 . the security violation signal is sent to the power reset control manager 66 . in response to the security violation signal , the power reset control manager 66 may reset the system 100 . the ssm 56 also may take any of a variety of alternative actions to protect the computer system 100 . examples of such protective actions are provided in the commonly owned patent application referenced above ( patent application ser . no . 10 / 961 , 748 ). as previously mentioned , the vacl 410 ensures not only that an instruction being executed by the core 12 is safe to execute in monitor mode , but also that the instruction is properly executed . accordingly , the etm bus 405 generated by the interface 406 indicates the execution status and any error flags associated with each instruction executed in the execution pipeline 404 while in monitor mode . the specific data used to verify execution status and execution errors may vary from implementation to implementation . such verification may include determining whether a monitor mode instruction was valid , whether data associated with the instruction was valid , etc . in addition to the functions described above , the vacl 410 also ensures that when the system 100 is in monitor mode , data transfers ( e . g ., read / write operations ) occur only to or from monitor mode code in the memories 400 , to or from the dedicated monitor mode stack area in the memories 400 , or to or from dedicated registers ( e . g ., the registers in storage 412 ) on the peripheral port 398 . as described above , the execution pipeline 404 transfers the virtual address associated with each data transfer , if any , to the interface 406 via bus 413 . the virtual address is transferred to the vacl 410 via the etm bus 405 . in turn , the vacl 410 determines whether the virtual address associated with the data transfer falls within one of the virtual address ranges specified by the registers 458 , 460 , 462 , 464 , 466 or 468 . if the virtual address falls within one of these virtual address ranges , the vacl 410 does not take action . however , if the virtual address does not fall within one of these virtual address ranges , and further if the vacl 410 determines ( using the secmon bus 73 ) that the system 100 is in monitor mode , the vacl 410 issues a security violation signal via bus 409 , as previously described . the vacl 410 also ensures that data transfers are properly executed while the system 100 is in monitor mode . specifically , in addition to the information described above , the etm bus 405 also transfers to the vacl 410 execution information associated with each data transfer performed by the core 12 . such execution information may include execution status , error flags , etc . the particular execution information provided to the vacl 410 regarding the execution of a data transfer may vary from implementation to implementation . fig5 shows a flow diagram of a method 500 in accordance with embodiments of the invention . the method 500 is applicable to operations of both the pacl 408 and the vacl 410 . the method 500 begins by obtaining an instruction address or data transfer address ( block 502 ). the instruction or data address may comprise a physical memory address or a virtual memory address . the method 500 also comprises comparing the obtained address to an expected address range ( block 504 ). the expected address range is stored in one of the registers of the storage 412 , as previously described . the method 500 further comprises comparing a current security level of the system with the security level associated with the address range ( block 506 ). for example , the method 500 may determine whether the system is in monitor mode , since at least some of the registers stored in the storage 412 comprise address ranges associated with the monitor mode . if the address falls within the range of addresses ( block 508 ), and if the current security level of the system matches the security level associated with the range ( block 512 ), the method 500 comprises generating an alert signal ( block 514 ). similarly , if the address does not match the range of addresses ( block 508 ), and if the current security level of the system matches the security level associated with the range of addresses ( block 510 ), the method 500 comprises generating the alert signal ( block 514 ). the above discussion is meant to be illustrative of the principles and various embodiments of the present invention . numerous variations and modifications will become apparent to those skilled in the art once the above disclosure is fully appreciated . it is intended that the following claims be interpreted to embrace all such variations and modifications . | 6 |
in accordance with the foregoing summary , the following provides a detailed description of the preferred embodiment , which is presently considered to be the best mode thereof . as used herein the distal end refers to the working end or patient end , while the proximal end refers to the operator end or actuator end from which the device of the present invention may be operated . the handle as shown in the described embodiment is on the side of the device referred to as the bottom side or the ventral aspect . the side opposite the bottom side is referred to as the top side or dorsal aspect . the right side is the side on the right hand when looking from the operator end , end - on . conversely , the left side is the side on the left hand when looking from the operator end , end - on . fig1 is a first side lateral perspective view of an elongated sheath body 1 for a device in accordance with one embodiment of the present invention , having longitudinal axis a extending from the proximal to distal end . in the preferred embodiment , the sheath 1 is about 15 cms long , and forms a hollow probe made of solid unyielding material such as metal or hard plastic , to gain access into the chest cavity through the access incision in between the ribs . it has a beveled distal end 2 with a spring biased door or cover 3 . it has a handle 4 to grasp . it also has a set screw 5 on the top surface of the operator end . this set screw when tightened will hold the outer vacuum tube in a set position ( see fig2 ). fig2 is a first side lateral perspective view of a device in accordance with one embodiment of the present invention , showing the inner tubular lead conduit or guide 6 and outer tubular lead conduit or guide 7 nested within one another so as to present an even co - terminus suction foot surface on the distal end thereof , with respective actuators 8 and 9 , in place in the elongated sheath body 1 . the outer tubular lead conduit or guide 7 or outer vacuum tube ( ovt ) has a length of approximately 30 cms as measured from the handle towards the patient end . the distal or patient end has a suction surface with multiple suction cups formed by the co - terminally aligned suction foot surfaces of the inner tubular lead conduit or guide 6 and outer tubular lead conduit or guide 7 , referred to respectively as the inner and outer suction foot portions . the main body of the outer tubular lead conduit or guide 7 preferably is made of a relatively rigid material , while the terminal portion , typically about 4 cms of the distal end thereof ( i . e ., next to the suction surface ) of outer tubular lead conduit or guide 7 , is sufficiently flexible to allow it to articulate with respect to the longitudinal axis . this can be achieved by building it with a flat spring with tension cords or hinges or other forms of equivalent articulating mechanical arrangement . the articulating and working lengths may vary . the proximal or operator end has a connector 11 with a stopcock 11 a to connect to an outside vacuum tubing to supply vacuum to the outer tubular lead conduit or guide 7 . the vacuum or suction or negative pressure is transmitted through the hollow shell of the outer tubular lead conduit or guide 7 to the articulating portion thereof 7 a , whereupon it is propagated to the suction cups ( comprised by the outer suction foot portion 13 ) through flexible ( plastic ) tubing ( not shown ). the proximal end also has a knob 9 to manipulate articulation of the distal end in one plane . articulation can be achieved by one , two or more tension cords or other mechanical arrangements to transmit torsional force to the outer tubular lead conduit or guide 7 to bring about articulation . the maximum articulating angle is about 60 - 70 degrees . plane of articulation is at right angles to the long axis of the elongated sheath body 1 , toward the dorsal - ventral aspect / plane . fig3 is a detailed distal end perspective view of a device in accordance with one embodiment of the present invention , and showing the inner and outer tubular lead conduits or guides 6 and 7 respectively , with respective inner and outer vacuum feet 12 and 13 respectively , and with the electrocautery blade 14 in a first , recessed position between the inner suction foot portion 12 and the outer suction foot portion 13 . fig3 a is a detailed distal end perspective view of a device in accordance with one embodiment of the present invention , and showing the inner and outer tubular lead conduits or guides 6 and 7 respectively , with respective inner and outer vacuum feet 12 and 13 respectively , and with the electrocautery blade 14 in a second position , extending from between the inner suction foot portion 12 and the outer suction foot portion 13 . an external electrical wire 16 connects at the proximal end of the outer tubular lead conduit or guide 7 to a “ spring biased contact .” the electrocautery device ( ec ) is a tube of electrically conducting material that extends from the proximal end of the outer tubular lead conduit or guide 7 to the distal end . fig1 and 15a are first side lateral perspective views of the control knob and the electrocautery blade portion 15 of a device in accordance with one embodiment of the present invention . fig1 is a partial first side lateral and longitudinally cross - sectioned perspective view of the control knob and the electrocautery blade portion . fig1 is a partial first side lateral perspective view of the control knob for the electrocautery blade portion . fig1 , 15a , 16 and 17 show the electrocautery device in greater detail , and in which like reference numerals refer to corresponding portions thereof . its inner surface 15 b and outer surface 15 a are insulated . the distal end has an un - insulated stylus 15 d that is 3 mm long and 1 . 5 to 2 mm wide . this stylus 15 d can be pushed out and rotated 360 degrees with cutting electric energy by action of control wheel 15 c . fig4 is a detailed distal end perspective view of the proximal end of the device in accordance with one embodiment of the present invention . this view shows the inner and outer tubular lead conduits or guides 6 and 7 assembled within the elongated sheath body 1 , with respective actuators in the form of articulation knobs 8 and 9 , respectively , as well as respective connection to inner and outer vacuum tubes 10 and 11 with associated stopcocks 10 a and 11 a . this view shows set screw 5 holding outer tubular lead conduit or guide 7 in place within elongated sheath body 1 , and with electrocautery device nested in between the inner and outer tubular lead conduits or guides 6 and 7 , and control wheel 15 c exposed . fig5 is a detailed proximal end perspective view of a device in accordance with one embodiment of the present invention , and showing the inner and outer tubular lead conduits or guides 6 and 7 assembled within the elongated sheath body 1 as shown in fig4 . this view also shows the position of lead drive 18 as it would be inserted along axis a of the device during the lead insertion and placement operation . fig6 and 7 show the proximal end of the device and show the two positions ( stylus protruded fig6 and withdrawn fig7 ) held by a detent on control wheel 15 c . the proximal end has an electrocautery contact ring on the distal surface of the proximal wheel . when the electrocautery contact is pushed into the “ stylus protruded position ” on the detent , the electrocautery contact ring comes in contact with the spring biased contact on outer tubular lead conduit or guide 7 and the electrocautery contact becomes energized . the proximal end also has a control wheel 15 c that allows the electrocautery contact with stylus to rotate 360 degrees to cut the pericardium . there is a zero mark on the wheel which coincides with a zero mark on the proximal end of the outer tubular lead conduit or guide 7 . fig8 is a first side lateral exploded perspective view of a device in accordance with one embodiment of the present invention in which like reference numerals refer to corresponding portions thereof , showing the inner tubular lead conduit or guide 6 , with extension - restricting spacer 17 in place , and withdrawn from the outer tubular lead conduit or guide 7 residing in the elongated body sheath 1 , and showing with respective actuators 8 and 9 for the inner and outer tubular guides 6 and 7 . the inner tubular guide 6 or inner vacuum tube ( ivt ) fit inside the electrocautery contact device and has a suction surface in the distal end , made of multiple suction cups in the form of inner suction foot portion 12 . the main body of the inner tubular guide 6 is made of hard material and 7 cms of distal end of the inner tubular guide 6 ( i . e ., that nearest to the suction surface ) are flexible , allowing it to articulate with respect to the longitudinal axis a . this can be achieved , for instance , by building it with a flat spring with tension cords or hinges or other forms of articulation through equivalent mechanical arrangements . the width and specification of the springs preferably will be adjusted so that there is no hindrance of one spring articulating inside the other . the articulating and working lengths can vary . the proximal or operator end of the inner tubular guide 6 has a connector 10 with a stopcock 10 a to connect to outside vacuum tubing . the vacuum or suction or negative pressure is transmitted through the hollow shell of the inner tubular guide 6 to the articulating portion 6 a , whereupon it is propagated to the suction cups of inner suction foot portion 12 through flexible ( plastic ) tubing . the proximal end of the inner tubular guide 6 also has a knob 8 to manipulate articulation of the distal end in one plane . articulation can be achieved by 1 , 2 or more tension cords or other methods . maximum articulating angle is about 30 degrees . the plane of articulation is at right angles to the long axis a of the elongated sheath body 1 , toward the right - left aspect / plane . at the proximal end , there is a spacer 17 of about 3 cm length , that prevents the inner tubular guide 6 from protruding beyond the outer tubular guide 7 , and maintains both suction surfaces of inner suction foot portion 12 and outer suction foot portion 13 in the same plane . once the cut piece of pericardium has been removed , the spacer is removed from the inner tubular guide 6 , the lead drive 18 with lead 20 is then loaded into the device . fig9 is a first side lateral exploded perspective view of portions of a device in accordance with one embodiment of the present invention , showing the cardiac lead drive 18 engaged over the cardiac lead 20 , and not yet inserted into the inner tubular lead conduit or guide 6 . the position lock 19 is in the engaged position . fig9 a is a first side lateral exploded perspective view of portions of a device in accordance with one embodiment of the present invention , showing the cardiac lead drive 18 further withdrawn from over the cardiac lead 20 , after placement through inner tubular lead conduit or guide 6 . the position lock 19 is in the disengaged position . fig9 b is a first side lateral exploded perspective view of portions of a device in accordance with one embodiment of the present invention , showing the inner tubular lead conduit or guide 6 further withdrawn from over the cardiac lead 20 , after placement thereof . fig9 c is a first side lateral exploded perspective view of portions of a device in accordance with one embodiment of the present invention , showing the elongated sheath body 1 with outer tubular lead conduit or guide further withdrawn from over the cardiac lead 20 , after placement thereof . fig1 is a detailed first side lateral perspective view of portions of a device in accordance with one embodiment of the present invention , showing the cardiac lead drive 18 extending into the inner tubular lead conduit or guide 6 , and showing the position lock 19 to hold the cardiac lead drive 18 in position with respect to the inner tubular guide 6 . fig1 a , 10b and 10c are progressive detailed views showing the operation of a device in accordance with one embodiment of the present invention , showing a detailed view of the lead placement series . the action of the position lock 19 may be appreciated by comparing fig1 a and 10b , showing the position lock 19 in the engaged and disengaged positions respectively . fig1 c shows the position lock 19 in the disengaged position , and further show the direction of axial force brought about by rotational movement of lead drive wheel 18 b for lead placement . fig1 is a first side lateral exploded perspective view of portions of a device in accordance with one embodiment of the present invention , showing the inner tubular lead conduit or guide 6 withdrawn from the outer tubular lead conduit or guide 7 residing in the elongated body sheath 1 , and showing the cardiac lead drive 18 locked in a position with respect to the inner tubular lead conduit or guide 6 . fig1 a is a detailed first side lateral perspective view of the cardiac lead 20 withdrawn from the inner tubular lead conduit or guide 6 . fig1 is a first side lateral cross - section perspective view of a cardiac lead drive 18 portion of a device , in accordance with one embodiment of the present invention . fig1 is a first side lateral perspective view of the distal end cardiac lead drive portion 18 of a device in accordance with one embodiment of the present invention . this view shows distal end 18 a of the lead drive configured correspondingly to engage with a reciprocating end 20 a of the cardiac lead . fig1 is a first side lateral perspective view of the cardiac lead drive portion 18 of a device , in accordance with one embodiment of the present invention . at the very proximal end of inner tubular guide 6 , there is a position lock 19 that in engaged position ( see fig1 ) holds the lead drive 18 with lead 20 such that the screw of the lead 20 is not protruding beyond the suction surface of the of inner suction foot portion 12 . once the inner suction foot portion 12 suction surface is in full contact with the heart muscle , the position lock 19 is disengaged to allow the lead drive 18 to implant the lead 20 to be implanted into heart muscle by screwing lead drive 18 to implant the lead 20 by use of lead drive wheel 18 b . the lead drive 18 preferably is in the form of a hollow tube that houses the lead 20 , and is made of solid , unyielding material except for about 7 cms of distal end which is compliant allowing it to be positioned by the inner tubular lead conduit or guide 6 , by allowing it to conform to its articulation . the length of the lead drive 18 is such that , in loaded position , with the position lock 19 in the inner tubular lead conduit or guide 6 engaged , the screw end of the lead 20 is at the same plane as the co - terminally aligned suction foot surfaces 12 and 13 of the inner tubular lead conduit or guide 6 and outer tubular lead conduit or guide 7 . the articulating and working lengths can vary . the distal end of the lead drive 18 preferably has a special socket 18 a into which the distal end 20 a of the lead 20 fits in order to prevent displacement . the proximal end has a wheel 18 b which allows the operator to screw in the lead into the heart muscle when the position lock 19 is disengaged . the length of the lead 20 preferably is in the range of about 52 - 58 cms ( or length of current leads in the commercial market ), and the proximal end of the lead 20 protrudes beyond the proximal end of the lead drive 18 . fig1 is a partial first side lateral perspective view of the inner tubular lead conduit or guide 6 with inner vacuum foot 12 and associated actuator knob 8 . fig1 is a partial first side longitudinally cross - sectional lateral perspective view of the inner tubular lead conduit or guide 6 with inner vacuum foot 12 and associated actuator knob 8 controlling the articulation of the inner tubular lead conduit or guide 7 . this view also shows the use of an internal vacuum chamber 6 a that extends through the rigid portion of the inner tubular lead conduit or guide 6 up to a point where it is made flexible to form flexible portion 6 c , and where there is provided a flexible tube or tubular portion 6 b that communicates the vacuum to the inner vacuum foot 12 while allowing flexion / articulation of the distal end of the inner tubular lead conduit or guide 6 , in accordance with a preferred embodiment of the present invention . these views show the aperture 12 a through which the lead drive 18 and lead 20 may be passed during the operation of the device . fig2 is a partial first side longitudinally cross - sectional lateral perspective view of the inner tubular lead conduit or guide 6 with inner vacuum foot 12 showing the distal end in greater detail , and showing internal vacuum chamber 6 a that extends through the rigid portion of the inner tubular lead conduit or guide 6 up to a point where it is made flexible to form flexible portion 6 c , and flexible tube or tubular portion 6 b that communicates the vacuum to the inner vacuum foot 12 while allowing flexion / articulation of the distal end of the inner tubular lead conduit or guide 6 . fig2 is a first perspective lateral view of the outer tubular lead conduit or guide 7 of a device in accordance with one embodiment of the present invention , and showing outer vacuum foot 13 . fig2 is a partial first side longitudinally cross - sectional lateral perspective view of the outer tubular lead conduit or guide 7 with outer vacuum foot 13 showing the proximal end in greater detail . fig2 is a partial first side longitudinally cross - sectional lateral perspective view of the outer tubular lead conduit or guide 7 with outer vacuum foot 13 showing the distal end in greater detail , and showing internal vacuum chamber 7 a that extends through the rigid portion of the outer tubular lead conduit or guide 7 up to a point where it is made flexible to form flexible portion 7 c , and flexible tube or tubular portion 7 b that communicates the vacuum to the outer vacuum foot 13 while allowing flexion / articulation of the distal end of the outer tubular lead conduit or guide 7 . these views show the aperture 13 a through which the inner tubular lead conduit or guide 6 may be passed during the operation of the device , to allow lead drive 18 and lead 20 to be inserted therethrough . fig2 is a first perspective lateral view of the outer tubular lead conduit or guide 7 of a device shown in an articulated position , in accordance with one embodiment of the present invention . fig2 is a first perspective lateral longitudinally cross - sectional view of the outer tubular lead conduit or guide 7 of a device shown in an articulated position , in accordance with one embodiment of the present invention . these views show outer tubular lead conduit or guide 7 articulated to deflect at a point where it is made flexible to form flexible portion 7 c , so as to change the planar positioning of the outer vacuum foot 13 . fig2 is an upper perspective view of the cooperating - outer tubular lead conduit or guide 7 of a device as seen from the proximal end , in accordance with one embodiment of the present invention . fig2 is a first lateral view of the cooperating outer tubular lead conduit or guide 7 of a device in accordance with one embodiment of the present invention shown in an articulated position . this view shows the articulation of flexible portion 7 c so as to change the planar positioning of the outer vacuum foot 13 . fig2 a is an additional perspective view of the cooperating inner tubular lead conduit or guide 6 shown in an articulated position with respect to and extending from outer tubular lead conduit or guide 7 , in accordance with one embodiment of the present invention . this view shows the articulation of flexible portions 6 c and 7 c , so as to change the planar positioning of both the inner vacuum foot 12 and outer vacuum foot 13 . this view shows the lead screw portion 20 b in an unextended position within aperture 12 a . fig2 b is an additional perspective view of the cooperating inner tubular lead conduit or guide 6 shown in an articulated position with respect to and extending from outer tubular lead conduit or guide 7 in accordance with one embodiment of the present invention . this view shows the articulation of flexible portions 6 c and 7 c , so as to change the planar positioning of both the inner vacuum foot 12 and outer vacuum foot 13 . this view shows the lead screw portion 20 b in a deployed position extending from aperture 12 a . fig2 is a proximal end perspective view of the outer tubular lead conduit or guide 7 of a device in accordance with one embodiment of the present invention . this view shows the external electrical wire 16 connecting to a “ spring biased contact ” at the proximal end of the outer tubular lead conduit or guide 7 , showing the stopcock 11 a for the suction tube 11 . fig2 a is a proximal lateral perspective longitudinally cross - sectioned view of the outer tubular lead conduit or guide 7 of a device in accordance with one embodiment of the present invention showing internal vacuum chamber 7 a that extends through the rigid portion of the outer tubular lead conduit or guide 7 . fig2 is a proximal end perspective view of the cardiac lead 20 extending from lead head portion 20 a of a device in accordance with one embodiment of the present invention . this view shows the lead 20 and the shaped lead head portion 20 a that is adapted to cooperate with special socket 18 a of the lead drive 18 , into which the shaped lead head portion 20 a of the lead 20 fits to secure its position and allow the lead drive 18 to screw the lead into place through action of corkscrew ( or other fixable shape ) lead end 20 b ; i . e ., the pacing or conducting end . fig3 is a distal end perspective view of the cardiac lead 20 extending from lead head portion 20 a , as shown in fig2 , and in which like reference numerals refer to corresponding portions thereof . as to the procedure for using the device of the present invention and otherwise to practice its method , the following steps may be used : an access incision is first made in the left chest wall , with a 3 to 4 cm diameter maximum . the left lung is then decompressed and collapsed , thereby exposing the pericardial sac , using the standard thoracoscopic , single lung ventilation technique . as may be appreciated with reference to fig1 , the elongated sheath body 1 is inserted by passing its distal end through the chest wall via the access . as may be appreciated with reference to fig2 , the distal ends of the coterminous inner and outer vacuum lead conduits or guides 6 and 7 ( i . e ., presenting inner and outer vacuum suction feet 12 and 13 ) and are urged through the elongated sheath body 1 , opening the spring biased cover 3 of the introducing distal end of the sheath . as may be appreciated with reference to fig3 and 4 , the faces of the inner and outer vacuum suction feet 12 and 13 are placed on the pericardium by articulating with knob 9 with or without rotating along its long axis . once in place , the set screw 5 is tightened against the outer vacuum lead conduit or guide 7 . at this point , the elongated sheath body 1 may be rotated by the operator about its longitudinal axis a for fine positioning . the vacuum for inner and outer vacuum lead conduits or guides 6 and 7 is controlled via respective stopcocks 10 a and 11 a to govern vacuum to inner and outer vacuum suction feet 12 and 13 respectively . using the handle 4 of the elongated sheath body 1 , the operator may place slight traction to pull the yielding pericardium away from the subjacent myocardium or heart muscle . as may be appreciated with reference to fig7 , electrocautery knob or wheel 15 c is then urged to position 2 . as may be appreciated with reference to fig4 and 3a , electrocautery knob or wheel 15 c is then rotated 360 degrees or more ( making reference to the degree indicator thereupon , thereby cutting the pericardium , which is then held captive between outer and inner suction ring by vacuum action from inner vacuum suction foot 12 , the cut piece of pericardium held by inner vacuum foot 12 secured for removal . as may be appreciated with reference to fig6 , the electrocautery knob or wheel 15 c may then be returned to position 1 . as may be appreciated with reference to fig8 , the inner vacuum lead conduit or guide 6 is then removed from outer vacuum lead conduit or guide 7 ( with the held piece of cut pericardial tissue ). the vacuum to inner vacuum lead conduit or guide 6 is turned off and the cut pericardial tissue is removed from inner vacuum suction foot 12 . spacer 17 is also taken out from around inner vacuum lead conduit or guide 6 . referring to fig9 and 10 , the lead 20 and lead drive 18 assembly is inserted into inner vacuum lead conduit or guide 6 until drive assembly contacts position lock 19 . as may be appreciated from fig1 , the inner vacuum lead conduit or guide 6 is reintroduced into the outer vacuum lead conduit or guide 7 / electrocautery assembly 15 , during which time , the outer vacuum suction foot 13 is still attached to the pericardium with suction , keeping it taut and splayed with a central hole , and through which the inner vacuum lead conduit or guide 6 with its inner vacuum suction foot 12 may be further advanced , the spacer 17 having been removed . as may be appreciated from fig1 , this figure shows the position inner vacuum suction foot 12 as it would be advanced against the left ventricular wall through the pericardial hole created in the procedure . as may be appreciated with reference to fig4 , the second plane of articulation is made possible by rotating articulation knob 8 . the operator may rotate inner vacuum lead conduit or guide 6 along its long axis for fine positioning . at this point , the vacuum for inner vacuum lead conduit or guide 6 may be engaged to attach itself to the myocardium or heart muscle ; and the loaded lead drive 18 ( with lead 20 ) is positioned inside the inner vacuum lead conduit or guide 6 in such a way that it is in touch with the myocardium with the distal end of the pacer lead screw at the end of the lead 20 . at this point , the lead 20 may be tested for sensing and pacing parameters by seeking various attachment points and testing the lead 20 , prior to final placement of the lead 20 in the heart tissue . referring to fig1 a and 10b , the position lock 19 may be disengaged from the lead drive 18 , to allow special socket 18 a , into which the distal end of the lead 20 ( i . e . cooperatively shaped lead head 20 a ) fits , to permit the lead 20 to be advanced and attached to the heart wall . this attachment is effected by rotating the lead 20 ( by use of lead drive wheel 18 b ) clockwise while applying slight axial force along axis a . this may be further appreciated from reference to fig1 c and 27b . at this point , the lead 20 again may be tested for sensing and pacing parameters . as shown in fig9 a , the lead drive 18 may be removed from within inner vacuum lead conduit or guide 6 , after which the vacuum serving inner vacuum suction foot 12 may be turned off in order to effect its release from the tissue site . a summary of the preferred procedure is presented in table form in appendix a hereto . from this point , the balance of the surgical operation and energizes of the pacing lead made be completed in accordance with methods and apparatus known and used in the art . it will be appreciated that the mechanical arrangements in the device and the logical order of the steps in the described methods are used for purposes of illustration only , and that the steps may be varied where not otherwise inconsistent with the purpose and result obtained in the practice of the invention . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting on the invention described herein . the scope of the invention is thus indicated by the appended claims rather than by the foregoing description , and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein . the present invention may be used in accordance with other methods and devices relating to lead and conduit placement , such as those described in the following references that are hereby incorporated herein by reference : 2 . decompress / collapse left lung thereby exposing pericardial sac ( standard thoracoscopic , single lung ventilation technique ) 3 . pass distal end of sheath through chest wall via access 4 . push distal end of outer and inner vacuum tubes through sheath , opening the spring biased cover of the introducing sheath 5 . position faces of outer and inner vacuum feet on pericardium by rotating articulation knob a a . tighten set screw for outer vacuum tube b . may rotate sheath around its long axis for fine positioning 6 . turn on vacuum for outer and inner vacuum tubes via stop cocks on outer and inner heads respectively 7 . using handle of sheath , place slight traction to pull the yielding pericardium away from the subjacent myocardium or heart muscle 9 . rotate electrocautery knob & gt ; 360 degrees thereby cutting pericardium held captive between outer and inner suction ring 11 . remove inner vacuum tube ( with the held piece of cut pericardial tissue ) and spacer a 15 . load lead and drive assembly into inner tube until drive assembly contacts position lock a . all this time , the outer vacuum foot is still attached to the pericardium with suction , keeping it taut and splayed with a central hole 17 . position inner vacuum foot against left ventricular wall through the pericardial hole created in step 9 1 . may rotate inner vacuum tube along its long axis for fine positioning a . loaded lead is positioned inside inner suction tube in such a way that it is in touch with myocardium with the distal end of the pacer lead screw 21 . attach lead to heart wall by rotating drive clockwise while applying slight axial force 25 . remove inner vacuum tube in a direction axial to lead ( to prevent dislodgement of lead ) by simultaneously relaxing articulation and withdrawing inner vacuum tube from outer vacuum tube 27 . remove outer tube in a direction axial to lead ( to prevent dislodgement of lead ) by simultaneously relaxing articulation and withdrawing outer vacuum tube and sheath together from chest cavity 28 . the proximal end of the lead can now be channeled and connected with the pacemaker / defibrillator device | 0 |
referring now to the figures , the preferred embodiment of the present invention is shown generally in fig1 – 3 at 10 . as will hereinafter be more fully described , the present invention is a dual video player for disc jockeys having a video playback unit 100 and a control unit 200 . the playback unit has a first video drive 110 and a second video drive 112 . the control unit 200 is connected to the playback unit 100 and controls the operation thereof . the control unit has two interfaces 210 , 212 to allow independent control of each of the video drives 110 , 112 . the interfaces 210 , 212 are arranged substantially in a format for ease of use by disc jockeys . in particular , the video drives 110 , 112 are positioned side - by - side in a single housing 202 with displays positioned proximal thereto with pitch controls included for easy mixing of the outputs of the video drives 110 , 112 . the playback unit 100 of the present invention has playback housing 102 with a front and a rear panel 104 , 106 . extending from the edges of the playback housing are rack mounts 108 . the rack mounts 108 and playback housing 102 are configured so that the playback unit 100 is mountable within a standard nineteen - inch rack , which disc jockeys commonly use . within the housing of the playback unit 100 are a first and second video drives 110 , 112 , which are preferably dvd optical drives , but could be other removable - media type video drives such as vcd and 5vcd compatible optical drives . the first and second video drives 110 , 112 could also be cd + g format compatible to facilitate karaoke performances . it should be understood that video is meant to include associated audio , if desired . the appropriate media ( e . g . dvd , vcd , 5vcd , or cd + g discs ) is loaded into one of the video drives 110 , 112 through the front panel 104 of the playback unit 100 by activating the appropriate first and second eject controls 114 , 116 , which are located on the front panel 104 and between the first and second video drives 110 , 112 . to turn the dual video player 10 on and off , a power switch 118 is located on the front panel 104 of the playback unit 100 and just below the eject controls 114 , 116 . another unique feature of the video player 10 is the ability for the system to be upgraded by using the video drives 110 , 112 . the disc jockey loads media pre - loaded with an upgrade package into the video drives 110 , 112 and then the video player 10 will automatically detect and install the upgrade . the disc jockey may obtain an upgrade either by downloading it through the internet and storing it on appropriate media , obtaining a copy from a distributor , or ordering it direct from the manufacturer . referring now to fig3 , the rear panel 106 of the playback unit 100 includes a number of connectors including a power input 120 , master video output 122 , a first and second s - video outputs 124 , 126 , a first and second composite video outputs 128 , 130 , a first and second rca audio outputs 132 , 134 , a first and second coaxial digital audio outputs 136 , 138 , and a first and second control connectors 140 , 142 . collectively , the outputs 122 , 124 , 126 , 128 , 130 , 132 , 134 , 136 , 138 mentioned above , are all internally connected to the respective video drive 110 , 112 . the power input 120 is connected to a power source ( not shown ) via a standard power cable ( not shown ) commonly used for consumer electronic devices . the first and second control connectors 140 , 142 are connected to the control unit 200 , described in more detail below , to enable the control unit 200 to operate the playback unit 100 . the digital audio outputs 136 , 138 are also capable of transmitting raw output in addition to digital output , such as dolby 5 . 1 audio , depending on the audio source . referring back now to fig1 – 3 , the control unit 200 of the present invention has a control unit housing 202 with a front and a rear panel 204 , 206 . extending from the edges of the control unit housing 202 are rack mounts 208 . the rack mounts 208 and control unit housing 202 are configured so that the control unit 200 is mountable within a standard nineteen - inch rack , which disc jockeys commonly use . the control unit has a first and a second interfaces 210 , 212 located on the front panel 204 . each interface 210 , 212 independently controls a corresponding video drive 110 , 112 of the playback unit 100 via a number of controls that are arranged in substantially the same format as the other interface 210 , 212 . each interface also has a display 214 , 216 , described in more detail below , to inform the disc jockey of operation statistics , modes and content of the dual video player 10 . on the rear panel 206 of the control unit housing 202 of the control unit 200 , are first and second control connectors 201 , 203 . the first and second control connectors 201 , 203 are connected to the respective first and second control connectors 140 , 142 on the rear panel 106 of the playback unit housing 102 of the playback unit 100 via a pair of control cables ( not shown ). referring now to fig4 , a close - up view of the first interface is 210 shown and will be discussed in detail . it is to be understood , however , that this discussion is equally applicable to the second interface 212 and is merely explained only once as a matter of convenience . the first interface 210 has a set of menu navigation controls 218 including a menu control 220 , arrow controls 222 and an enter control 224 . the menu navigation controls 218 enable the disc jockey to navigate through menus that may exist in video media content such as dvds . specifically , the menu control 220 activates the menu section of a dvd , for compatible dvds . the adjacent arrow controls 222 enable the disc jockey to navigate through the menu to find the content he or she wishes to view . typically , such content is organized according to track and chapter . activation of the enter control 224 allows selection of the content for viewing . the arrow controls 224 also have the additional functions of adjusting the viewable portion of the video content that has been magnified or “ zoomed ,” editing and creating play lists , and setting the dual video player &# 39 ; s 10 settings . these functions will be more fully described below . also , on the first interface 210 of the control unit 200 are a set of playback controls 226 . the playback controls 226 include play 228 , pause 230 , cue 232 , fast - forward 234 , rewind 236 , next track 238 , previous track 240 , slow motion 242 , and program 244 controls . each of the identified playback controls 226 operates the first video drive 110 of the playback unit 100 according to its namesake . accordingly , the play control 228 starts playback of video on the first video drive 110 and the pause control 230 pauses playback of video on the first video drive 110 . the play and pause controls 228 , 230 also have the function of setting an initial cue point ( not shown ) within the video playback of the first video drive 110 . during playback , the cue control 232 will return the video playback to the last cue point set by either the play or pause controls 228 , 230 . the fast - forward and the rewind controls 234 , 236 start playback of video at high speed either in forward or reverse play , respectively . activating either the fast - forward or the rewind controls 234 , 236 repeatedly will cycle through playback speeds of x 2 , x 4 , x 8 , x 16 , and x 32 . activating either control 234 , 236 while set at speed x 32 will restart the cycle at the beginning . the slow motion control 242 , which slows forward playback of the first video drive 110 , can be cycled through four speed settings . the next track and previous track controls 238 , 240 advance forward or backward by one track or chapter the playback of video from the first video drive 110 . the program control 244 activates a menu where the disc jockey can use the menu navigation controls 218 to reorder the order of play of the tracks and chapters on media within the first video drive 110 . the first interface 210 also has a pitch fader 246 for fine adjustment of the playback pitch / speed . this feature is incredibly important to the performance of the disc jockey because it enables him or her , when used in conjunction with the other pitch controls , to synchronize the tempo of the playback of the first and second video drives 110 , 112 with each other . synchronizing the tempo allows the disc jockey to seamlessly switch from the playback of first video drive 110 to playback from the second video drive 112 and vice versa . complimentary to the pitch fader 246 are the pitch bend control 248 a , 248 b , and pitch activation control 250 . the pitch activation control 250 disables and enables the pitch fader 246 and the pitch bend control 248 a , 248 b . this keeps the disc jockey from accidentally bumping the pitch fader 246 or the pitch bend control 248 a , 248 b during performance after he or she has already selected the desired settings . the pitch bend control 248 a , 248 b momentarily increases or decreases , as desired , the tempo of the playback of the first video drive 110 . this enables the disc jockey , once he or she has synchronized the tempo of the playback of both video drives 110 , 112 using the pitch fader 246 , to match the bass beats of both video drives 110 , 112 . just below the pitch activation 250 is the loop control 252 . when activated a first time during playback , the loop control 252 sets a loop - start point . activating the loop control 252 a second time simultaneously sets a loop - end point and immediately restarts playback at the loop - start point . the video playback will then continuously play between the loop - start and loop - end points until the loop control 252 is activated a third time . the first interface 210 also has a setup control 254 , which activates a menu ( not shown ) where the disc jockey can set equipment settings and parameters using the menu navigation controls 218 . the setup menu is split into several sub - menus including language setup , screen setup , audio setup , custom setup features and settings ( including a parental lock feature ). these features are standard on most consumer electronic devices and are not critical to the present invention . therefore , they will not be discussed in detail . the first interface 210 also has a set of function controls 256 . the function controls 256 include title 258 , subtitle 260 , volume adjust 262 a , 262 b , key adjust 264 a , 264 b , angle 266 , and zoom 268 controls . the title function control 258 activates the title menu content of a dvd if such content exists . similarly , the subtitle function control 260 activates any subtitle content on subtitle compatible dvds . the volume adjust control 262 a , 262 b adjusts the output volume up or down as desired . the key adjust control 264 a , 264 b adjusts the key of the audio up or down as desired for compatible dvds . the angle function control 266 cycles through multiple angles of compatible dvds . finally , the zoom function control 268 allows the picture to be enlarged by a factor of x 2 or x 4 . activating the zoom function control 268 multiple times cycles through these choices . referring now to fig5 , located on the first interface is a first display 214 , which displays information to the disc jockey about the current settings of the dual video player 10 and media being played in the playback unit 100 . the first display 214 and second display 216 are identical in all respects with the exception that the first display 214 displays relevant statistics and settings of the first video drive 110 , and the second display 216 does likewise for the second video drive 112 . therefore , only the first display 214 will be described solely as a matter of convenience and it is to be understood that this discussion is equally applicable to the second display 216 . the first display 214 has a number of indicators including a media type 270 , play mode 272 , title number 274 , chapter / track number 276 , total 278 , program 280 , dolby digital / dts 282 , angle 284 , elapsed time 286 , and parental lock 288 indicators . the media type indicator 270 displays the type of media ( e . g . dvd , cd , or vcd ) in the first video drive 110 . the play mode indicator 272 indicates if the first video drive 110 is playing or paused , and shows the repeat modes that are currently in use , if any . if the video drive 110 is stopped , the entire screen will display “ stop .” the title number indicator 274 shows the title number of the current media being played . the chapter / track number indicator 276 shows the current chapter or track number . the total indicator 278 indicates if the time is the total elapsed time on the media or track / chapter . the program indicator 280 indicates is the dual video player 10 is currently in a set program . the dolby digital / dts indicator 282 indicates if a compatible dvd has dolby digital or dts audio enabled . the angle indicator 284 indicates if a separate angle is in use ( as set by the angle function control 266 described above ) while the media in playing . the elapsed time indicator 286 indicates the elapsed time for the media . finally , the parental lock indicator 288 indicates if the parental locking feature is engaged as set through the custom setup features menu of the setup control 254 . referring back to fig4 now , located on the front panel 104 of the control unit 200 and between the interfaces 210 , 212 , is a master video switch 290 for controlling the output of the playback unit 100 . the master video switch 290 is a critical component to the disc jockey because it enables him or her to select the video that will be displayed during the performance . alternatively , the disc jockey can display a black screen instead of video . this feature is useful to the disc jockey because it allows the disc jockey to display nothing during the performance when the disc jockey needs to switch the media that is loaded in the video drives 110 , 112 , or when the disc jockey needs an intermission between sets . no other video player currently on the market incorporates such a video switch . the master video switch 290 has a first and second output switch 292 , 294 , a first and second on screen display (“ osd ”) controls 296 , 298 , a blackout control 300 , and three indicators ( vid 1 indicator 302 , vid 2 indicator 304 , and a black indicator 306 ). activating either the first or second output switch 292 , 294 selects the first or second video drives 110 , 112 , respectively , to output through the master video output 116 . activating the blackout control 300 blacks out output of the master video output 116 . the indicators vid 1 302 , vid 2 304 and black 306 , indicate which output control 292 , 294 , 300 has been selected for output through the master video output 116 . the osd controls 296 , 298 suppress any text generated from the video drive 110 , 112 themselves from displaying through the master video output 116 . this is useful to a disc jockey to prevent the video drive &# 39 ; s 110 , 112 functions ( e . g . play , pause , fast forward , rewind , etc .) from being displayed to the audience during the disc jockey &# 39 ; s performance . the first interface 210 also has an eject control 308 , which ejects media from the first video drive 110 of the playback unit 100 . this control is in addition to and functions the same as the eject control 114 located on the playback unit 100 . this extra eject control 308 has been added for the convenience of the disc jockey . the first interface 210 also has a random control 310 , which when activated selects from among the available titles on the current media within the first video drive 110 at random . once activated , titles will continually be selected at random . activating the random control 310 a second time disables this feature and resumes normal sequential play . the first interface 210 also has a repeat control 312 with four modes : disabled , chapter / track , title , and entire media . the repeat control enables continuous repeat play of either the entire media within the first video drive 110 , the current title , or the current chapter / track . the disabled mode resumes normal play . activating the repeat control 312 repeatedly cycles through the modes of play . the first interface 210 also has a display control 314 , which toggles the elapsed time indicator 286 to display the time elapsed in the track , the time remaining in the track , and the total time remaining . activating the display control 314 repeatedly cycles through these display modes . fig6 shows an alternative embodiment of a video player 400 of the present invention where the control unit 402 , first video player 404 , and second video player 406 are contained within a single main housing 408 . it should be understood that the functionality of the video player 400 is the same as the video player 10 of the preferred embodiment of the present invention as discussed in detail above . some users of the present invention may prefer a single housing 408 rather than the separate housings 102 , 202 of the preferred embodiment 10 . similarly , monitor units for the disc jockey could be incorporated in the housing 202 the control unit 200 of the preferred embodiment or the main housing 408 of the alternative embodiment 400 . while there is shown and described herein certain specific structure embodying the invention , it will be manifest to those skilled in the art that various modifications and rearrangements of the parts may be made without departing from the spirit and scope of the underlying inventive concept and that the same is not limited to the particular forms herein shown and described except insofar as indicated by the scope of the appended claims . | 7 |
korean patent application no . 10 - 2005 - 0069457 , filed on jul . 29 , 2005 , in the korean intellectual property office , and entitled : “ photosensitive composition for forming an electrode transfer film and an electrode , and a plasma display panel comprising the same ,” is incorporated by reference herein in its entirety . the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which exemplary embodiments of the invention are shown . the invention may , however , be embodied in different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . in the figures , the dimensions of layers and regions are exaggerated for clarity of illustration . it will also be understood that when a layer is referred to as being “ on ” another layer or substrate , it can be directly on the other layer or substrate , or intervening layers may also be present . further , it will be understood that when a layer is referred to as being “ under ” another layer , it can be directly under , and one or more intervening layers may also be present . in addition , it will also be understood that when a layer is referred to as being “ between ” two layers , it can be the only layer between the two layers , or one or more intervening layers may also be present . it will also be understood that the term “ phosphor ” is intended to generally refer to a material that can generate visible light upon excitation by ultraviolet light that impinges thereon , and is not intended be limited to materials the undergo light emission through any particular mechanism or over any particular time frame . like reference numerals refer to like elements throughout . the present invention may provide an electrode having electrical characteristics that are superior to a conventional silver electrode . in particular , a composition for forming an electrode may be used to fabricate a transfer film , which , in turn , may be used to fabricate the electrode . the composition may include a conductive composite formed by coating a first material , e . g ., nickel , carbon and / or copper , with a metal that has a higher electrical conductivity . thus , the electrode may use nickel , carbon and / or copper as an electrode material rather than silver , as conventionally used . the conductive composite may be formed by coating one or more of nickel , carbon and / or copper with a metal having a higher electrical conductivity . nickel , carbon and copper are relatively less expensive than the conventional silver material , and may be fired at a lower temperature than silver , which is conventionally fired at a temperature of 550 ° c . to fabricate an electrode . coating the nickel , carbon and / or copper with a metal having a higher electrical conductivity may offset the relatively low electrical conductivity of these materials , and also reduce or prevent their corrosion by air . the metal having a higher electrical conductivity may include , e . g ., aluminum ( al ), chromium ( cr ), copper ( cu ), rhodium ( rh ), palladium ( pd ), silver ( ag ), platinum ( pt ), and gold ( au ), a platinum - rhodium alloy ( pt — rh ), a silver - palladium alloy ( ag — pd ), etc . the nickel , carbon and / or copper may be coated with the metal through a number of suitable processes , e . g ., vacuum deposition , sputtering , plasma deposition , ion - plating , etc . the conductive composite formed by coating a material such as nickel , carbon and / or copper with the metal may provide advantages of low cost and low firing temperature , and may simultaneously provide the high electrical conductivity of the metal coated on the outside thereof . the conductive composite may be in a powder form , e . g ., granules , spheres , flakes , etc . the conductive composite may have an average diameter in a range of about 0 . 06 μm to about 20 μm . the nickel , carbon and / or copper in the conductive composite may have an average diameter in a range of about 0 . 01 μm to about 10 μm , e . g ., about 0 . 05 μm to about 5 μm . the metal coating may have a thickness in a range of about 0 . 05 μm to about 10 μm . the conductive composite described above may be used as an electrode material . for example , the conductive composite may be provided in a thermally sensitive or photosensitive composition , and the composition may be used for fabricating a transfer film , which may be used to form an electrode . the photosensitive composition may include , e . g ., a binder resin , a cross - linking agent , a dispersing agent and a solvent , as well as the conductive composite in a predetermined amount . in particular , the conductive composite may be included in an amount ranging from about 20 to about 80 parts by weight , based on the entire amount of the photosensitive composition . providing less than about 20 parts by weight of the conductive composite may yield an electrode with low conductivity . providing more than about 80 parts by weight of the conductive composite may yield an electrode that forms a short circuit and a non - uniform surface during the firing , due to poor dispersion in the solvent . the binder resin may include , e . g ., an acryl - based resin , a styrene resin , a novolac resin , a polyester resin , etc ., as are commonly used for preparing photoresists . the binder resin may have a number average molecular weight ( mn ) ranging from about 5 , 000 to about 50 , 000 , so that it can be easily removed during a developing process . the binder resin may be included in an amount ranging from about 10 to about 20 parts by weight , based on the entire amount of the photosensitive composition . providing less than about 10 parts by weight may make it difficult for a transfer film to maintain its shape . providing more than about 20 parts by weight may result in an electrode that contains undesired residues . the cross - linking agent may include any one of a variety of compounds that are suitable for a radical polymerization reaction , e . g ., multifunctional monomers such as ethylene glycol diacrylate , ethylene glycol dimethacrylate , trimethylolpropane triacrylate , trimethylol propane trimethacrylate , tetramethylol , propane tetraacrylate , tetramethylolpropane tetramethacrylate , combinations thereof , etc . the cross - linking agent may be provided in a predetermined proportion based on the amount of binder resin . the cross - linking agent may be present in an amount ranging from about 20 to about 30 parts by weight , based on 100 parts by weight of the binder resin , which corresponds to about 1 to about 3 parts by weight based on the entire amount of the photosensitive composition . providing less than about 1 parts by weight may yield an electrode having a pattern of pinholes . providing more than about 3 parts by weight may yield an electrode without a smooth and uniform pattern after the developing process , and which may contain residues after the firing . the photoinitiator may include one or more of a number of compounds that are suitable for generating radicals during the uv light exposure process and that initiate a cross - linking reaction by the cross - linking agent . examples of the photoinitiator may include , e . g ., methyl o - benzoylbenzoate , 4 , 4 - bis ( dimethylamine ) benzophenone , 2 , 2 - diethoxyacetophenone , 2 , 2 - dimethoxy - 2 - phenyl - 2 - phenylacetophenone , 2 - methyl -[ 4 -( methylthio ) phenyl ]- 2 - morpholinopropa - 1 - one , 2 - benzyl - 2 - dimethylamino - 1 -( 4 - morpholinophenyl )- 1 - butanone , bis ( 2 , 6 - dimethoxybenzoyl )- 2 , 4 , 4 - trimethylpentylphosphineoxide , combinations thereof , etc . the photoinitiator may be provided in a predetermined proportion based on the amount of the cross - linking agent . the photoinitiator may be provided in an amount of about 10 to about 50 parts by weight , based on 100 parts by weight of the cross - linking agent , which corresponds to about 0 . 1 to about 1 . 5 parts by weight , based on 100 parts by weight of the total photosensitive composition . the solvent may be , e . g ., an organic solvent , and may be any of a number of solvents capable of dispersing the above - described components . suitable organic solvents may include , e . g ., ketones such as diethylketone , methylbutylketone , dipropylketone , cyclohexanone , etc ., alcohols such as n - pentenol , 4 - methyl - 2 - pentenol , cyclohexanol , diacetonealcohol , etc ., ether - based alcohols such as ethylene glycol monomethylether , ethylene glycol monoethylether , ethylene glycol monobutylether , propylene glycol monomethylether , propylene glycol monoethylether , etc ., saturated aliphatic alkyl monocarboxylate esters such as n - butyl acetate , amyl acetate , etc ., lactate esters such as ethyl lactate , n - butyl lactate , etc ., ether - based esters such as methyl cellosolve acetate , ethyl cellosolve acetate , propylene glycol monomethyletheracetate , ethyl - 3 - ethoxypropionate , etc . the organic solvents may be used alone or in combination . the solvent may be used in an amount of about 4 to about 30 parts by weight , based the total weight of the composition , to obtain a composition suitable for forming a transfer film having a viscosity of about 7 , 000 to about 50 , 000 cps . in an implementation , the viscosity may be about 10 , 000 to about 30 , 000 cps . the photosensitive composition may further include , e . g ., a sensitizer for improving sensitivity , a polymerization inhibitor for improving storage stability of a coating composition , e . g ., phosphoric acid , phosphoric acid ester , a carboxylic acid - containing compound , etc ., an oxidation inhibitor , a uv light absorber for improving resolution , an antifoaming agent for reducing pores in the composition , e . g ., a silicone - based or acryl - based compound , a dispersing agent for improving dispersion properties , a leveling agent for improving flatness of a printed layer , e . g ., polyester modified dimethylpolysiloxane , polyhydroxycarboxylic acid amide , a silicone - based polyacrylate copolymer or a fluoro - based paraffin compound , and / or a plasticizer for introducing thixotropic characteristics . the photosensitive composition may be made by using , e . g ., a roll - kneader , a mixer , a homo mixer , a ball mill , a bead mill , etc . the composition described above may be implemented as a photosensitive composition and formed into a transfer film for forming an electrode . fig1 illustrates a cross - sectional view of an electrode transfer film according to an embodiment of the present invention . referring to fig1 , the transfer film may include a substrate film 20 , a transfer layer 24 including a conductive layer 23 and a black layer 22 , and a protection film 25 for protecting the transfer layer 24 . the black layer 22 may be particularly adapted to improve contrast and may be disposed between the conductive layer 23 and the substrate 20 . the conductive layer 23 may be formed of a photosensitive composition that includes a conductive composite formed by coating one or more of nickel , carbon and / or copper with a metal having a higher electrical conductivity , as described above . the black layer 22 may include , e . g ., a conductive metal and / or a black pigment . the conductive metal may be , e . g ., aluminum ( al ), nickel ( ni ), copper ( cu ), palladium ( pd ), silver ( ag ), platinum ( pt ), gold ( au ), alloys thereof , etc . the black pigment may include , e . g ., a metal oxide or a composite metal oxide formed from aluminum ( al ), chromium ( cr ), manganese ( mn ), iron ( fe ), cobalt ( co ) and / or copper ( cu ). the conductive layer 23 and the black layer 22 may each have a thickness ranging from about 0 . 05 μm to about 10 μm . a thickness of less than about 0 . 05 μm may cause the electrode including the conducting layer and the black layer to not work well . a thickness of more than about 10 μm may result in a transfer film that is too thick to perform a transfer process . the substrate film 20 and the protection film 25 may be made of the same or different materials , and may be formed from , e . g ., polyvinyl alcohol , polyvinyl formals , polyvinyl acetals , olefins such as ethylene and propylene , acrylic acid , unsaturated carboxylic acids such as methacrylic acids , crotonic acids , etc ., cellulose acetate butylene , polycarbonate , poly ( vinylchloride ), polystyrene , poly ( methylmethacrylate ), polyethylene , poly ( ethylene terephthalate ), etc . the transfer film may be fabricated according to the following method : a ) a first coating layer may be formed by coating and drying a photosensitive composition for the black layer on a substrate film ; b ) a second coating layer may be formed by coating and drying the photosensitive material for the conductive layer on the first coating layer ; and c ) a protection film may be laminated on the second coating layer . the photosensitive composition for a black layer may be prepared by , e . g ., mixing and dissolving a glass frit , a binder , a cross - linking agent and a photoinitiator with the conductive metal and / or the black pigment , and , in other aspects , may be similar to the above - described photosensitive composition including the conductive composite . the coating method used for the first and second coating layers may include , e . g ., a typical wet coating method . the wet coating may be performed with various coating tools , e . g ., a roll - coater , a blade , a slit - coater , a curtain - coater , a wire coater , etc . the drying process for the transfer film may be at a temperature of about 50 ° c . to about 150 ° c ., depending on the solvent used in the previous stage . a drying time may be , e . g ., about 0 . 5 minutes to about 30 minutes . the transfer film according to the present invention may be used to form an electrode through patterning with , e . g ., a sheet method , a photosensitive tape process , or a material transferring method . these transferring methods may be easy to perform and may be suitable for manufacturing large panels . fig2 illustrates stages in a method of fabricating an electrode using a sheet method according to an embodiment of the present invention . referring to ( a ) in fig2 , a transfer film may be formed by interposing a black layer 130 and a transfer layer 120 between a substrate film 110 and a protection film 140 . referring to ( b ) and ( c ) in fig2 , after the protection film 140 of the transfer film is removed , the black layer 130 under the protection film 140 may be turned down to face a substrate 220 , upon which an electrode is to be formed . referring to ( d ) and ( e ) in fig2 , the black layer 130 and the transfer layer 120 in the transfer film , which face the substrate , may be formed in a predetermined pattern through a photolithography process . for example , a photomask 150 may be separately placed on the substrate film 110 ( optional ), after which uv light exposure may be used to project uv light through the photomask 150 in order to cross - link binder resins in the photosensitive composition that forms the black layer 130 and the photosensitive composition including the conductive composite that forms the conductive layer 120 . after uv light exposure , the exposed layers may then be developed using a developing solution . in an implementation , unexposed parts of the black layer 130 and the transfer layer 120 , as well as the substrate film 110 , may be removed . referring to ( f ) in fig2 , the patterned black layer 130 and transfer layer 120 may be fired at about 300 ° c . to about 600 ° c ., yielding an electrode with two layers , i . e ., a black layer 132 and a transfer layer 122 . according to an embodiment of the present invention , the conductive layer 122 includes the conductive composite formed by coating nickel , carbon and / or copper with a metal having a higher electrical conductivity . thus , as compared to the conventional method of forming electrodes that uses silver , it can thereby lower the firing temperature from 500 to 700 ° c . to about 300 ° c . to about 600 ° c . in addition , since the present invention does not require a particular non - oxidizing atmosphere , it may be advantageous as a simpler process with lower costs . fig3 illustrates a cross - sectional view of an electrode transfer film fabricated in a photosensitive taping method according to an embodiment of the present invention . referring to fig3 , the transfer film formed in the photosensitive taping method may include a substrate film 210 , a conductive layer 212 , a black layer 230 and a protection film 240 , which is similar to that of fig1 . a transfer layer 200 including a conductive layer 212 and a black layer 230 may be first formed on a substrate film 210 . the conductive layer 212 may include the photosensitive composition including the conductive composite . the transfer film may be finished by stacking a protection film 240 on the transfer layer 200 . to use the transfer film , the protection film 240 may be removed and the transfer film may be oriented and placed on a substrate such that the black layer 230 contacts the substrate . the transfer film may be transferred to form an electrode , yielding an electrode with two layers , i . e ., the black layer 230 and the conductive layer 212 , similar to that shown in ( f ) of fig2 . where the black layer 230 and the conductive layer 212 have a pre - printed pattern , they do not need to be exposed and developed . where they have no pattern , they may be patterned using a photomask . fig4 illustrates a cross - sectional view of an electrode transfer film fabricated in a material transferring method according to an embodiment of the present invention . referring to fig4 , the transfer film formed in the material transferring method may include a toner tape 380 and a photosensitive film 390 . the toner tape 380 may include a transfer layer 300 including a conductive layer 320 and a black layer 330 disposed , in order , on a substrate film 310 and below a protection film 340 . the photosensitive film 390 may include a photosensitive adhesion layer 360 between another substrate film 350 and another protection film 370 . the protection film 340 of the toner tape 380 may be removed , and , thereafter , the black layer 330 may be disposed to face a substrate upon which an electrode is to be formed . the protection film 370 of the photosensitive film 390 may be removed , and then the photosensitive adhesion layer 360 may be disposed to face the substrate film 310 of the toner tape 380 and attached thereto . the substrate may be transferred and fired as described above in order to form an electrode having two layers , i . e ., the black layer 330 and the conductive layer 320 , similar to that illustrated in ( f ) of fig2 . where the photosensitive adhesion layer 360 has a pre - printed pattern , it does not need to be exposed and developed . where it has no pattern , it may be patterned using a photomask . the transfer film for forming an electrode can be used to form an address electrode and / or a bus electrode of a pdp . an electrode formed according to an embodiment of the present invention may have a line resistance value of about 30 to about 10 , 000 ω / cm . by comparison , a conventional silver electrode may be , e . g ., 30 ω / cm . therefore , an electrode formed according to an embodiment of the present invention may be used as a substitute for a conventional silver electrode . fig5 illustrates a partially exploded perspective view of a pdp according to an embodiment of the present invention . referring to fig5 , the pdp may include address electrodes 3 formed on a rear substrate 1 in one direction , e . g ., the y direction in fig5 . a dielectric layer 5 may be disposed on the surface of the rear substrate 1 and covering the address electrodes 3 . barriers ribs 7 may be disposed on the dielectric layer 5 between each address electrode 3 . the barrier ribs 7 may be open or closed as needed . red ( r ), green ( g ) and blue ( b ) phosphor layers 9 may be disposed between each barrier rib 7 . a front substrate 11 opposing the rear substrate 1 may include display electrodes 13 having a transparent electrode 13 a and a bus electrode 13 b . the display electrodes 13 may extend in a direction that crosses the address electrodes 3 , e . g ., the x direction in fig5 . another dielectric layer 15 and a protection layer 17 may be disposed on the surface of the second substrate 11 and covering the display electrodes 13 . discharge cells may be formed at the crossing points where the display electrodes 13 cross the address electrodes 3 . in operation , address discharges may be generated by applying address voltage signals ( v a ) across the address electrodes 3 and the display electrodes 13 . a sustain voltage signal ( v s ) may be applied across a pair of display electrodes 13 . vacuum ultraviolet light may be generated by the discharge in order to excite the phosphor layers 9 corresponding to the energized display electrodes 13 , thereby emitting visible light through the transparent front substrate 11 . in an implementation , the pdp described above may be fabricated by a ) preparing a rear substrate with address electrodes and a dielectric layer formed thereon , b ) forming barrier ribs on the entire surface of the dielectric layer on the rear substrate , c ) forming red , green and blue phosphor layers inside discharge cells defined by the barrier ribs , d ) preparing a front substrate with a display electrode including a transparent electrode and a bus electrode , a dielectric layer and a protection layer formed thereon , and e ) assembling , sealing , evacuating , injecting a discharge gas inside , and aging the rear and front panels . a pdp fabricated according to the present invention may be fabricated using a transfer film that includes the photosensitive composition having the conductive composite formed by coating nickel , carbon and / or copper with a metal having a higher electrical conductivity . the address electrodes 3 of the rear substrate 1 and / or the bus electrodes 13 b on the front substrate 11 may be formed using the transfer film . the address electrodes 3 and / or the bus electrodes 13 b may be patterned according to embodiments of the present invention using the sheet method , the photosensitive taping method or the material transferring method described above . the following examples and comparative examples are provided in order to set forth particular details of one or more embodiments of the present invention . however , it will be understood that the present invention is not limited to the particular details described . a photosensitive composition was prepared by mixing the components listed in table 1 , below , and a transfer film was fabricated using the photosensitive composition as follows . first , a binder , a cross - linking agent , a photoinitiator , an additive and a solvent were poured into a mixer and agitated , and then a conductive material and a frit glass were added thereto and mixed together . next , the resultant mixture was additionally agitated and dispersed with a three - roll mill , and then filtered and de - foamed to obtain photosensitive compositions for each of a black layer and a conducting layer . the photosensitive composition for a black layer was coated on a 0 . 5 μm thick substrate film of polyethyleneterephthalate and dried at 100 ° c . for 10 minutes to form a 5 μm - thick black layer thereon . then , the other photosensitive composition for the conductive layer , which includes the conductive composite , was coated on the black layer and dried at 100 ° c . for 10 minutes to form a 10 μm thick conductive layer thereon . the transfer film was finished by stacking the same protection film as the substrate film on the conductive layer . the transfer film prepared in a , above , was used to form an electrode pattern on a substrate as follows . first , a glass substrate was washed and dried , and then the glass substrate was combined with the transfer film , after removing the protection film from the transfer film . then , they were heat treated at 50 ° c . for crossing - linking and the transfer film was heated and pressed with a hot roller . the roller was set at a surface temperature of 100 ° c . and pressed at a speed of 1 . 0 m / min under a pressure of 50 psi . next , the resulting transfer film was exposed to uv light at 450 mj / cm 2 using a photomask with a predetermined pattern and developed by spraying thereon a 0 . 4 wt % sodium carbonate aqueous solution through a nozzle with a pressure of 1 . 2 kgf / cm 2 for 25 seconds , and then removing the unexposed parts to form the predetermined pattern . then , the transfer film with the black and conductive layers was fired at 550 ° c . for 30 minutes , obtaining a 4 μm thick electrode with the predetermined pattern . an electrode layer was formed using a general pdp electrode printing method as follows . first , a pre - cut mask was placed on a substrate and a silver electrode paste having 70 wt % of solid silver was printed with a printer once on the mask . the printed electrode was dried in a drier at 120 ° c . for 30 minutes and was then exposed to uv light and developed to form a pattern following the pre - cut mask . then , it was fired at 550 ° c . for one hour to form the silver electrode layer fig6 a illustrates a scanning electron microscope ( sem ) photograph of a cross section of an exemplary electrode fabricated according to an embodiment of the present invention and fig6 b illustrates a sem a photograph of a cross section of a comparative electrode . referring to fig6 a , the exemplary electrode formed according to an embodiment of the present invention includes nickel coated with silver and formed in a sheet method . the exemplary electrode is very straight , is not detached , and has no edge - curl or end - curl . in contrast , referring to 6 b , the comparative electrode formed using a general printing method has low straightness , due to the poor interface of the electrode , and has electrode detachment that occurred during the developing and firing . the exemplary electrode , formed according to an embodiment of the present invention and including the conductive composite , formed by coating nickel , carbon and / or copper with a metal having a higher electrical conductivity , had better electric characteristics than those of the conventional silver electrode . thus , the conductive composite of the exemplary electrode was shown to be capable of effectively replacing the conventional silver as an electrode material . the present invention may provide a fine electrode pattern using a transfer film and various transferring methods . the fine electrode pattern may be advantageously used in an address electrode and / or a bus electrode , which may be particularly advantageous as the resolution of pdps becomes finer and finer . exemplary embodiments of the present invention have been disclosed herein , and although specific terms are employed , they are used and are to be interpreted in a generic and descriptive sense only and not for purpose of limitation . accordingly , it will be understood by those of ordinary skill in the art that various changes in form and details may be made without departing from the spirit and scope of the present invention as set forth in the following claims . | 7 |
the method of the present invention is disclosed in the context of an event discrimination system designed to detect an impending rollover condition of a vehicle . however , it should be recognized that the method equally applies to other event discrimination systems , both automotive and non - automotive . referring to the drawings , and particularly to fig1 , the reference numeral 10 generally designates a diagram of a vehicle rollover detection system for implementing the methodology of the present invention . the methodology is carried out by an on - board microprocessor - based control unit such as a supplemental restraint controller that selectively activates various rollover restraint devices such as air bags , side curtains , seat belt pretensioners and pop - up roll bars . the inputs include the data developed by various sensors 12 , 14 , 16 , 18 , 20 , and the output is a deploy / no - deploy ( d / nd ) command on line 22 . the sensor data pertinent to rollover detection may include for example , vehicle speed , wheel speeds , roll rate , lateral acceleration , vertical acceleration , yaw rate , steering wheel position , tire pressure , and so on . the input data is subjected to conventional signal processing ( low - pass filtering , for example ) as indicated by the blocks 26 , 28 , 30 , 32 , 34 if not already processed , and made available for use by one or more event detection algorithms , as represented by the blocks 36 , 38 , 40 , 42 . each block produces an event discrimination output ( edo - 1 , edo - 2 , edo - 3 , edo - n ), and the block 46 combines the outputs to produce the single deploy / no - deploy ( d / nd ) output on line 22 . in a preferred implementation of the invention , the algorithms represented by the blocks 36 - 42 are the same rollover detection algorithm , but differently calibrated . for example , block 36 can represent a copy of the algorithm that is calibrated to reliably discriminate between rollover and non - rollover events associated with sudden braking and erratic movement of the vehicle steering wheel , block 38 can represent a copy of the algorithm that is calibrated to reliably discriminate between rollover and non - rollover events associated with side impacts , and so on . this approach works best with an algorithm having a high degree of calibration flexibility ; one example of such an algorithm in the field of rollover detection is the algorithm disclosed in the u . s . pat . no . 6 , 421 , 592 , incorporated herein by reference . alternatively , the algorithms represented by the blocks 36 - 42 can be different special - purpose algorithms , each designed to reliably distinguish between rollover events and non - rollover events associated with a specified kind of driver input or vehicle operating condition . for example , some algorithms are very good at discriminating rollover events associated with erratic driver steering inputs , while other algorithms are very good at discriminating rollover events associated with side impacts , and so on . fig2 and 3 illustrate two different ways the event discrimination outputs edo - 1 - edo - n can be combined by the block 46 . the simplest approach , illustrated in fig2 , is to logically combine the outputs using a boolean - or function as indicated by the block 50 . if any of the event discrimination outputs edo - 1 - edo - n indicates the presence of an impending rollover event , the or block 50 produces a deploy command on d / nd output line 22 ; otherwise the result is a no - deploy command . fig3 illustrates a somewhat different approach in which the outputs are arithmetically combined . the outputs are individually weighted by the blocks 52 , 54 , 56 , 58 and summed by the block 60 to form a combined output on line 62 . the combined output on line 62 is compared with a reference value ref by the comparator 64 to produce the d / nd output on line 22 . while the weights applied to each algorithm can be equal , they are preferably adjustable on - the - fly ( by the control line 66 , for example ) based on an assessment of driver inputs and / or vehicle operating conditions so that higher weight can be accorded to an algorithm designed to detect rollover events associated with the current conditions . in the diagram of fig1 , the block 68 has access to the input data from sensors 12 - 20 and carries out the function of assessing of driver inputs and / or vehicle operating conditions . when a specified input or condition ( such as a side impact ) is detected , the block 68 signals the weight - setting block 70 to re - distribute the weights applied by blocks 52 - 58 so that the output ( s ) of the algorithm ( s ) calibrated to discriminate rollover events associated with the detected condition is given more weight than algorithms calibrated to discriminate rollover events associated with different conditions . fig4 illustrates the performance of a rollover detection system configured according to the method of the present invention , as applied to six different data sets for rollover events a - f . in the illustration , three different copies of the same highly flexible rollover detection algorithm are individually calibrated and separately executed for each event a - f . the algorithm designated as cal 1 is calibrated to provide correct if not timely rollover discrimination for all of the events a - f . the algorithm designated as cal 2 is specifically calibrated to provide reliable detection of fast rollover events , due for example , to curb trips ; and the algorithm designated as cal 3 is specifically calibrated to provide reliable detection of slow rollover events , due for example , to straying into a roadside ditch . a desired deployment time is specified for each of the events a - f , and the table of fig4 indicates the lateness of the deploy command relative to the desired time ; a positive number indicates a deployment command that is late ( which is undesirable ), while a negative number indicates a deployment command that is early ( which is desirable ). while each of the algorithms correctly identifies the events a - f as rollover events , it is apparent that one or more of the algorithms are able to better discriminate any given event better than the other algorithms . for example , the algorithm designated as cal 1 adequately discriminates rollover events b , d , e and f , but fails to adequately discriminate events a and c . the algorithm designated as cal 2 adequately discriminates rollover events b - f , but fails to adequately discriminate event a . and the algorithm designated as cal 3 adequately discriminates rollover events a , b and e , but fails to adequately discriminate events c , d and f . while no single calibration of the algorithm can timely discriminate all of the rollover events , at least one version of the algorithm can timely discriminate any given event . when the outputs are logically or arithmetically combined according to this invention , the output of the algorithm designated as cal 3 triggers a deployment command for events a and b ; and the output of the algorithm designated as cal 2 triggers a deployment command for events c , d , e and f . if an additional set of rollover event data becomes available and the currently configured system fails to correctly discriminate the event , the only change required to achieve correct discrimination for all known events is to calibrate an additional version of the algorithm for the new event , and logically or arithmetically combine its output with the outputs of the existing versions of the algorithm . of course , this same advantage occurs in embodiments comprising a number of different algorithms instead of different versions of the same algorithm . since each of the algorithms is designed to detect a certain class of rollover events while discriminating against all non - rollover events in general , the logical or arithmetic combination of all algorithm outputs will also identify all rollover events while discriminating against all non - rollover events . the number of algorithm versions or different algorithms that can be executed according to this invention on any given system depends only on the memory and throughput capabilities of the system . in practice , the system microprocessor can call the algorithm ( s ) as a function with different calibrations passed to it as an argument . for example , assume a system with sensors running at a 10 oms sampling rate . between samples , a main program executed by the microprocessor would pass the sensor data along with each set of calibrations to the algorithm ( s ), which would return a signal to the main program indicating whether or not to deploy . if at any time a deploy is returned , the main program would initiate the issue a deploy command . otherwise , after 10 oms the next set of sensor data would be received and the process would start over again . the only limitation on the number of calibrations would be the speed of the processor , since all of the sets need to be run in the 10 oms interval between sensor data packets . also , if functions defining the relationship between the variables for several calibrations of an algorithm can be found , the algorithm can change its own calibration during operation . for example , one variable can be varied over tens or hundreds of values and the other values calculated . while the method of the present invention has been described with respect to the illustrated embodiment , it is recognized that numerous modifications and variations in addition to those mentioned herein will occur to those skilled in the art . accordingly , it is intended that the invention not be limited to the disclosed embodiment , but that it have the full scope permitted by the language of the following claims . | 6 |
the invention will now be described in conjunction with a copper interconnect process . it will , however , be apparent to those of ordinary skill in the art that the benefits of the invention may be applied to other devices and processes that involve an exposed conducting surface over which a thin isolating layer is desired . an isolated conducting surface 100 according to the invention is shown in fig2 . semiconductor body 102 includes a substrate with transistors and other devices formed therein as desired . interconnection between the transistors and other devices is accomplished via interconnect layer 104 , semiconductor body 102 may include a number of interconnect layers 104 to which the invention may be applied . interconnect layer 104 comprises a number of interconnect lines 106 . interconnect lines 106 comprise a metal , such as copper , with underlying barrier layers . the metal of interconnect line 106 is isolated at the surface by isolating layer 108 . isolating layer 108 comprises a thin aluminum - oxide ( al 2 o 3 ). the aluminum oxide is on the order of 10 - 100 nm . isolating layer 108 covers only the metal at the surface of interconnect line 106 . it is not formed on the surface of the intrametal dielectric ( imd ) 110 . the aluminum - oxide of isolating layer 108 provides a good , hard barrier . even a very thin layer ( e . g ., 10 - 100 nm ) provides sufficient electrical isolation . a good diffusion barrier is especially important for copper interconnects because copper easily diffuses into the surrounding dielectrics without a sufficient barrier . a process for forming the isolated conducting surface 100 according to the invention will now be discussed with reference to fig3 a - 3d . referring to fig3 a , semiconductor body 102 is processed through the formation of interconnect layer 104 . this includes the formation of isolation structures , transistors and other devices ( not shown ). it further includes the formation of interconnect line 106 and imd 110 . as an example , a damascene or dual damascene process ( as known in the art ) may be used to form interconnect line 106 and imd 110 . in the preferred embodiment , copper with appropriate underlying barrier layers are used for interconnect line 106 . interconnect layer 104 may represent the first or any subsequent metal interconnect layer . referring to fig3 b , a selective deposition process is used to form a layer of aluminum 130 on the surface of interconnect line 106 , but not on the surface of imd 110 . a selective cvd ( chemical vapor deposition ) process may be used . for selectivity between the metal and the dielectric , a precursor gas comprising aluminum and hydrogen may be used . for example , hal ( ch 3 ) 2 may be used . the bond structure for hal ( ch 3 ) 2 is shown in fig4 . the hydrogen - aluminum ( h — al ) bond 136 is easier to break over metal at lower temperatures . the h — al bond 136 will break over the dielectric , imd 110 , only at higher temperatures . thus , a chemical comprising aluminum and hydrogen is appropriate for selective deposition of aluminum over a metal as opposed to a dielectric . other suitable precursors include isopropyl aluminum and tert - butyle aluminum . to ensure selectivity , the selective deposition process is carried out at low temperatures . for example , a temperature in the range of 150 - 200 ° c . may be used . use of low temperatures makes the selective deposition process compatible with low - k materials . low - k materials include xerogels , fsg ( fluorine - doped silicate glass ), hsq , and organic low - k materials . low - k materials are becoming more and more important for high performance integrated circuits to further reduce capacitance of interconnect lines . accordingly , imd 110 may comprise a low - k dielectric . the selective deposition process can be performed in commercial reactors and is therefore easy to implement . thermal cvd reactors are readily available . referring to fig3 c , the aluminum layer 130 is then subjected to an oxygen ambient to form aluminum oxide isolating layer 108 . aluminum is known to oxidize easily . isolating layer 108 has a thickness on the order of 10 - 100 nm and is formed only over metal interconnect lines 106 . the oxygen ambient may be an anneal in o 2 or h 2 o . alternatively , the oxygen ambient may be a plasma oxidation . next , an ild 140 is deposited over the structure , as shown in fig3 d . ild 140 may comprise a low - k dielectric if desired . the total effective dielectric constant of the dielectrics 110 and 140 is not reduced by the presence of a higher dielectric constant material between them as in the prior art silicon nitride approach . the dielectric constant is thus increased because isolating layer 108 is formed only over the conducting surface and not between the dielectrics 110 and 140 . as discussed above , the aluminum oxide of isolating layer 108 provides good protection for interconnect line 106 . this is especially true if interconnect line 106 comprises copper . aluminum oxide prevents copper from diffusing into ild 140 even when very thin . another advantage of the invention is that the aluminum oxide of isolating layer 108 provides electrical isolation even when very thin . accordingly , ild 140 may be omitted and the subsequent interconnect layer 204 may be formed directly over interconnect layer 104 , as shown in fig5 . subsequent interconnect layer 104 comprises interconnect lines 206 , similar to interconnect lines 106 . the thin isolating layer 108 is sufficient for electrical isolation between interconnect lines 106 and interconnect lines 206 . after formation of isolating layer 108 , subsequent interconnect layers , such as layer 204 of fig5 may be formed as desired . as shown in fig5 the invention may be applied to multiple interconnect layers ( 104 , 204 ) in a device . the invention may be applied to one , several , or all of the interconnect layers of a device . the invention may also be applied to other instances of exposed conducting surfaces . for example , the invention may be applied to isolate conductive layers exposed on a sidewall of a via . as shown in fig6 a , a via 300 is formed through a stack 302 . stack 302 comprises both dielectric layers 308 , 312 and a conductive layer 310 . conductive layer 310 is shown as being recessed . it is desirable to isolate the conductive layer , without reducing the width of the via thereby increasing its aspect ratio . in one dram device , the dielectric 308 comprises a cap oxide layer , a nitride layer , and a tantalum - pentoxide layer . conductive layer 310 comprises a titanium - nitride layer , and dielectric layer 312 comprises a peteos oxide layer . in this dram device , via 300 extends through stack 302 to a polysilicon plug 304 at the substrate 306 surface . the selective aluminum deposition process of the invention is used to form an aluminum layer 320 on the exposed surface of the conductive layer 310 , as shown in fig6 b . as described above , a low temperature selective cvd process using a precursor comprising hydrogen and aluminum is used the precursor may , for example , comprise dimethylaluminum , isopropyl aluminum , or tert - butyle aluminum . aluminum layer 320 is then oxidized to form aluminum - oxide layer 322 as shown in fig6 c . because aluminum layer 320 and aluminum - oxide layer 322 are formed only on the surface of the exposed conductive surface , the width of the via is not reduced and the aspect ratio is not increased . while this invention has been described with reference to illustrative embodiments , this description is not intended to be construed in a limiting sense . various modifications and combinations of the illustrative embodiments , as well as other embodiments of the invention , will be apparent to persons skilled in the art upon reference to the description . it is therefore intended that the appended claims encompass any such modifications or embodiments . | 7 |
the exemplary embodiment of an indirect extrusion press 10 shown in fig1 comprises an indirect punch 12 having a tool head 14 that can be accommodated on the indirect punch 12 , a pressing punch 13 having a closure piece 16 , and a longitudinally movable block holder 18 having a material block accommodation 20 for accommodating a material block 22 . the indirect punch 12 furthermore comprises a peeling ring 42 . the material block 22 that can be pressed to produce a pressed product by means of the indirect extrusion press 10 is a material block 22 that can consist , at least in part or in its entirety , of a metallic material , such as , for example , aluminum , copper , brass or corresponding alloys . the block holder 18 can be moved in a straight line by the closure piece 16 , by way of the indirect punch 12 . the indirect punch 12 can be brought out of the material block accommodation 20 by moving the block holder 18 in the direction of the closure piece 16 . therefore the indirect punch 12 can be introduced into the material block accommodation 20 by moving the block holder 18 in the opposite direction ( see , in this regard , also fig4 ). because essentially relative movements are involved , in this connection , it is understood that in deviating embodiments , the indirect punch can also be movable , while other modules are merely configured to be stationary . in the operating state illustrated in fig2 , a section of the material block 22 introduced into the material block accommodation 20 was already pressed to produce a pressed product 17 in the form of a tube , by being pressed through a die plate 19 of the tool head 14 , by means of displacement of the block holder 18 and of the material block 22 by means of the closure piece 16 or by means of the pressing punch 13 ; this product was discharged by way of a cavity 15 provided in the indirect punch 12 . fig3 illustrates the operating state of the indirect extrusion press 10 in which the material block 22 was completely pressed to produce a pressed product 17 . the shearing blade 34 provided serves for shearing off a pressing remnant 35 formed during the pressing procedure , after being stripped out or pressed out of the material block accommodation 20 by the tool head 14 or the block holder 18 , and , in this connection , separating it from a shell 24 that is also formed during the pressing procedure , which is situated in a shell chamber 26 of the indirect extrusion press 10 , whereby the shell chamber 26 is disposed radially around the tool head 14 . to form the shell chamber 26 , the tool head 14 has a conical section 38 that narrows in the pressing direction of the indirect extrusion press 10 or in the opposite direction , whereby the shell chamber 26 is delimited by the narrowing section 38 and the inner wall 40 of the material block accommodation 20 , in other words the inner wall 40 that delimits the material block accommodation 20 . fig4 to 8 serve to illustrate an exemplary embodiment of the method for operating the indirect extrusion press 10 . after the material block 22 is pressed and the shell 24 is formed in the shell chamber 26 , steps a to d explained in greater detail below are provided in the exemplary embodiment of the method to be illustrated here . thus , fig4 illustrates the situation or the operating state after step a has been carried out and while step b of the method is being carried out . in other words , what is illustrated in fig4 is the situation or the operating state after the indirect punch 12 has been brought out of the material block accommodation 20 by moving the block holder 18 in the direction of the closure piece 16 and after a further tool head 28 has been placed between indirect punch 12 and material block accommodation 20 , but before accommodating the further tool head 28 on the indirect punch 12 . in the situation shown in fig4 , the closure piece 16 is situated in a maximal position with a maximal distance between the closure piece 16 and the indirect punch 12 , whereby the closure piece 16 or the pressing punch 13 can be moved in a straight line from the maximal position toward the indirect punch 12 . a material block 22 can be introduced into the material block accommodation 20 by means of moving the closure piece 16 or the pressing punch 13 toward the indirect punch 12 , whereby this functionality of the closure piece 16 or the pressing punch 13 is required for pressing the material block 22 , in each instance ( see also fig2 ). in order to implement problem - free or operationally reliable placement of the further tool head 28 between indirect punch 12 and material block accommodation 20 , and also problem - free or operationally reliable accommodation of the further tool head 28 on the indirect punch 12 , the maximal distance is preferably configured to be 7 % greater than the sum of the expanses of the tool head 14 and of the block holder 18 in the movement direction , in other words in the direction in which the block holder 18 can be moved in a straight line by the closure piece 16 , by way of the indirect punch 12 . fig4 also illustrates , although only schematically , that in step b , the further tool head 28 is placed between the indirect punch 12 and the material block accommodation 20 by a manipulator 36 of an industrial robot , which is shown very schematically , and accommodated on the further tool head 28 . fig5 illustrates the situation or the operating state after step c of the method has been carried out , whereby step c comprises introducing the indirect punch 12 , together with the accommodated further tool head 28 , into the material block accommodation 20 , and bringing the further tool head 28 into contact with the other tool head 14 by means of moving the block holder 18 in the opposite direction — here , in other words , by moving it away from the closure piece 16 . fig6 illustrates the situation or the operating state of the indirect extrusion press while step d of the method is being carried out or undertaken . step d comprises pushing the other tool head 14 out of the material block accommodation 20 by means of moving the block holder 18 further in the opposite direction , whereby the shell 24 is partially pressed out of the material block accommodation 20 during the further movement , by means of the further tool head 28 . in this connection , fig6 illustrates the situation in which step d has not yet been completely concluded , particularly the situation in which the shell 24 is still disposed in the material block accommodation 20 in its entirety . fig7 also illustrates an operating state or a situation in which step d has not been completely concluded , but shows a situation later in time as compared with the situation illustrated in fig6 . it can be seen in fig7 that a significant section of the other tool head 14 has already been pushed out of the material block accommodation 20 . this other tool head 14 is pushed into a predetermined position on a manipulator 36 of an industrial robot as it is pushed out , whereby the manipulator 36 is shown only very schematically in fig7 . fig8 illustrates the situation after the other tool head 14 has been pushed out of the material block accommodation 20 according to step d of the method . the situation that the other tool head 14 is grasped by the manipulator 36 after having been pushed out and moved away from the block holder 18 by means of the manipulator 36 is shown here . the shell 24 is pressed out of the material block accommodation 20 , in part , by means of the further movement of the block holder 18 in the opposite direction , according to step d of the method , by means of the further tool head 28 , in the present case . in fig8 , the situation that the excess length 30 formed by partially pressing out the shell 24 is separated from a remnant that is only very small ( not illustrated in any detail here ) of the material , specifically in that the excess length 30 is sheared off by means of the shear blade 34 , is also illustrated . such a small remnant can be ignored , as such , and fills the space formed by the next tool head 28 only to an insignificant amount , so that the subsequent method sequence is not impaired by it . fig9 illustrates the situation that is carried out after replacement of the tool head 28 , for example , or also in between , if a material block 22 was pressed in its entirety , in which situation , after the further tool head 28 or the new tool head 28 has been introduced into the material block accommodation 20 , a further or new material block 22 is placed in front of the further tool head 28 , by means of a block loader 44 , which pivots into a predetermined position for this purpose . although only a few embodiments of the present invention have been shown and described , it is to be understood that many changes and modifications may be made thereunto without departing from the spirit and scope of the invention . | 1 |
the present invention provides a user defined calling caricature or avatar ( i . e ., visual display ) that is associated with a provisioned voice announcement , which together , may be used to alert a called party of an incoming call being placed over an ip network . in one embodiment , the calling party accesses a web - based provisioning tool to select the attributes of the caricatures along with voice announcements ( e . g ., pre - recorded or user recorded ) to accompany the visual caricature during the alert . the visual caricatures may take the form of a digital image , such as a digital picture of the calling party , or an animated image representing some character , interest , location , or other visual indicia ( e . g ., company trademark , hobby , and the like ) the caller desires to be displayed to others . it is noted that other still and / or moving imagery may also be used . a party being called ( i . e ., a called party who is also a subscriber of the service ) is alerted of an incoming call by the digital caricature and voice announcement sent by the calling party during an alerting phase of the call . the called party may view the personalized caricature , as well as listen to the voice announcement , thereby enabling the called party to screen such incoming call . that is , the called party is provided additional call related information , beyond the basic caller name / user - name and number / url information , to assist in deciding whether to answer , terminate , or send the call to a voice - mail system . in another aspect of the invention , the caricature may be utilized or modified to another caricature during the voice sessions between the parties . fig1 depicts an exemplary ip telephony communications network environment 100 in which the present invention may be employed . the exemplary ip telephony communications network environment 100 comprises a plurality of subscriber devices 120 1 , through 120 n ( collectively , subscriber devices 120 ), an ip telephony communications service provider ( sp ) 110 , and at least one ip network 102 . the ip network 102 may include private ip networks , as well as public ip networks , such as the internet 104 . the ip telephony service provider 110 is any service provider having access to resources capable of providing the various voice over ip ( voip ) services described herein , such as a telephone company , a cable television company , a wireless communications provider , among others . the service provider 110 provides ip telephony services , which include animated / digitally depicted interactive voice session ( addivs ) services of the present invention . the exemplary service provider 110 comprises a softswitch 114 including a subscriber database 116 , a subscriber server 112 , an application server 140 including a profile database 142 , and a media server 114 . the subscriber server 112 is coupled to the application server 140 , while the softswitch 114 , application server 140 , and media server 114 are coupled to each other through the ip network 102 or an auxiliary communications network ( not shown ) such as an x . 25 network . the subscriber server 112 , application server 140 , and media server 144 comprise at least one processor , memory , support circuits , i / o circuitry , and the like that is conventionally known in the art . the softswitch 114 comprises , illustratively , an open application program interface ( api ) used to bridge a public switched telephone network ( pstn ) 106 and voice over internet protocol ( voip ) system by separating the call control functions of a phone call from the those of the media gateway ( i . e ., transport layer ). the softswitch 114 provides mediation between packet and circuit protocols and interfaces to pstn 106 and ss 7 ( signaling system 7 ) networks on a programmable platform . one exemplary softswitch is a lucent ® softswitch ( lss ), provided by lucent technologies , inc ., of murray hill , n . j ., which provides a central point of management for distributed gateways and ip endpoints . the softswitch 114 is capable of providing signaling and control protocols between circuit - switched pstns 106 and voip networks 104 , under the h 248 , h 323 , sip ( session initiation protocol ) signaling and / or other standards . in one embodiment , the softswitch 114 includes internal memory for facilitating the subscriber database 116 . however , one skilled in the art will appreciate that other types of softswitch devices 114 may utilize a separate storage device ( not shown ) for facilitating the subscriber database 116 . the subscriber database 116 comprises a list of the subscribers of the ip telephony services , and includes indicia of whether the user is registered as a subscriber for the animated / digitally depicted interactive voice session ( addivs ) service , as well as whether the user is available to take calls . specifically , the subscriber database 116 is used to indicate the status of the user , such as being idle , busy , not registered for specific services , and the like . the softswitch 114 facilitates routing calls between the subscriber device endpoints 120 based on the status ( e . g ., idle registered , busy , not registered ) and subscribers profile information ( subscriber to the interactive voice session service / non - subscriber ). it is noted that the application server 140 maintains a subscriber profile database 142 ( locally or remotely ) with the subscriber &# 39 ; s pre - provisioned profile . the softswitch 114 utilizes the subscriber database 116 to determine , via the status and profile information , whether to forward the registered subscriber calling / called party information to the application servers 140 for processing ( call treatment ), or hand the call off to establish a “ traditional ” voice session between calling party and called party , such as over the pstn 106 . the subscriber server 112 is coupled to the application server 140 . the subscriber server 112 facilitates a user profile administration system ( upas ) 118 . in one embodiment , the upas 118 is a web - based application program ( tool ) that allows a subscriber of the voip services to create a personal profile , as well as define parameters and criteria regarding when particular subject matter of the subscriber profile should be implemented during a call . for example , a subscriber may create a business profile that comprises a caricature and / or digital picture of the subscriber , as well as a particular voice message , as discussed below in further detail . the application server 140 manages a user profile created by the users subscribing to the addivs services . in one embodiment , the application server 140 comprises a profile database 142 , which stores the user - defined profiles that include the caricatures and / or other imagery or audio information . the media server 144 stores provisioned audible messages defined by the users . in one embodiment , the user records an announcement for each profile created . alternatively , the addivs service may provide a pre - recorded announcement that the user may simply select for use . the application server 140 associates and coordinates the visual display ( caricature ) with the selected announcement for delivery to the called party . it is noted that the decomposed architecture i . e ., the dual server approach comprising the application and media servers 140 and 144 , allows vendors and service providers greater flexibility to work in a multi - vendor environment , as well as the flexibility for vendors to define network architecture based on cost of goods sold ( cogs ) goals and / or service provider network expectations . however , one skilled in the art will appreciate that a single server device may also be implemented to provide the functionality of both the application server 140 and media server 144 . the subscriber devices 120 ( illustratively shown as subscriber devices 120 1 through 120 n ) may be any device capable of accessing the ip network 102 , such as a laptop computer , pda , wireless handheld device , and the like . that is , the subscriber devices 120 may be any devices having a digital signal processor therein to process the digital and audio information . for example , the first subscriber device 120 1 illustratively comprises a digital signal processor ( dsp ) 122 , support circuitry 124 , memory 126 , and a display 134 . the processor 122 cooperates with conventional support circuitry 124 , such as power supplies , clock circuits , cache memory and the like , as well as circuits that assist in executing the software routines stored in the memory 126 . as such , it is contemplated that some of the process steps discussed herein as software processes may be implemented within hardware , for example as circuitry that cooperates with the processor 122 to perform various steps . the subscriber device 120 also contains input / output ( i / o ) circuitry that forms an interface between the various functional elements communicating with the ip network 102 . for example , in the embodiment of fig1 , the subscriber device 120 communicates with the ip network 102 via an asynchronous digital subscribe line ( adsl ), cable connection 132 ( e . g ., modem ). however , one skilled in the art will appreciate that any other broadband connection such as wireless communications is also contemplated as providing connectivity between the ip network 102 and the wireless subscriber devices ( e . g ., cellular phones and pdas ). the subscriber devices 120 serve as endpoints in the network environment 100 , and preferably utilize session initiation protocol ( sip ) signaling for establishment , modification , and termination of conferencing and telephony sessions over the ip network 102 . sip signaling utilizes text - based messages and has addressing based on either a telephone number or a web host name . for example , the sip address for a web host name may illustratively be sip : jane_doe @ lucent . com . the url is translated into an ip address through a domain name server ( dns ) and the sip negotiates the features and capabilities of the session at the time the session is established . for example , codecs may be provided at each of the endpoints to negotiate a common set of voice and video compression algorithms prior to establishing the session . once the session is established , the designated capabilities can be modified during the course of the call . for example , whiteboarding may be added in instances where both endpoints have whiteboard capabilities and are able to negotiate a common compression algorithm . although the implementation of the addivs service is described as utilizing sip , a person skill in the art will appreciate that other ip based network communication standards , such as h . 323 , may be utilized as well . as discussed above , one inventive feature is the implementation of the caricatures or digital video that supplement the audio messages used to alert a called party of an incoming call . another inventive feature is the ability of the subscribers to the service ( i . e ., users ) to define their own caricatures / digital video and audible responses . fig2 - 4 illustrate various methods for implementing these inventive features . fig2 depicts a flow chart of a method 200 for creating a caricature enhanced alert message for an interactive voice session service . for purposes of better understanding the invention , the term “ caricature ” is defined as digital images such as still pictures , animated images , or any other video representation . the method 200 starts at step 202 and proceeds to step 204 , where the service provider 106 registers a subscriber for services . in particular , the subscriber registers for services ( e . g ., voip services ) with a service provider over the ip network 104 via their subscriber device 120 . the service provider 106 stores a basic subscriber profile in the local subscriber database 116 associated with the softswitch 114 , as well as profile information in the profile database 142 of the application server 140 to define service attributes ( caricature related information ). it is noted that the basic subscriber profile includes information such as name , phone number , billing information , and the like . in one embodiment , the subscribers may register directly with the softswitch 114 . registering a subscriber directly at the softswitch 114 provides various benefits , such as allowing the subscriber database 116 to generate call detail records ( cdrs ) for billing purposes , as well as managing the subscribed services of the individual callers . it is desirable that the softswitch maintain control of the subscriber services . in particular , the softswitch 114 is able to rout calls to the appropriate application servers 140 , proxy servers / location server ( not shown ), and the like for completing the calls , since the softswitch 116 is able to monitor the state of each call from the subscriber database . further , the softswitch 116 may utilizes various routing techniques to rout calls based on calling and / or called party information , least cost routing , day of week , time of day , and the like to minimize the processing impact on the softswitch 114 . it is noted that in an alternative embodiment , the subscriber may register with an application server 140 , where the information is subsequently forwarded to the softswitch 114 via the ip network 102 . at step 206 , the subscriber logs into the user profile administration system ( upas ) 118 and establishes a user id and password . in one embodiment , the upas is a web - based application program that allows the user to create their personalized profile information . at optional step 208 , the user records one or more alerting announcements . for example , the user may record a business type audible greeting such as “ hello , this is jane doe of lucent technologies calling ”. other alerting announcements may be personalized for family and friends , among other types of greetings . alternatively , the user may decide not to record a personalized message , but rather , select a prerecorded message that is provided by the service provider . the audio message is then stored on the media server 144 as discussed above . at step 210 , the user creates one or more user profiles with caller profile information . the user may upload one or more caricatures or other visual or audible information ( e . g ., personal digital images ) that a called party may view while listening to the alert message . the caricatures may be any image ( e . g ., jpeg , gif , vector graphics , a streaming video format ( flash format ), among others ) that the subscriber would like the called party to view during the alert and optionally during the session itself . further , the audible information may be any digital representation of actual or synthesized sound waves ( e . g ., wav , aiff , sdii , among others ). alternatively , the service provider 110 may provide a list of caricatures ( e . g ., animated attributes ) that the user may select as a visual alert . for example , a business profile may include an animated picture of an office , a person in a business suit , among others . the caricatures may include hobby related images ( e . g ., golfing , sailing , and the like ), home images ( e . g ., pictures of family members , home , pets , and the like ), images representing mobile usage ( e . g ., airplane and the like ), among other images . other user profile information includes user name , user location , and pre - recorded announcements , among others . the user may also provide caller profile information . caller profile information includes attributes regarding when to send the user defined profile caricatures . such caller profile options include always sending the profile , prompting the caller about sending a profile , prompting the caller about which profile to send , restricted use ( e . g ., parental control over time of day , content , and the like ), sending a profile based on the telephone number of the called party , and the like . in this latter instance , the caller may associate a particular caricature for a particular telephone line number of a called party . for example , a caller may send a digital business picture of him / herself to selected client numbers . alternatively , the caller may send a caricature of a hobby to members in a club ( e . g ., animated or still picture caricature depicting old coins to members of a coin club ). once the user has reviewed and selected the user profile attributes , at step 212 , the user profile administration system 118 saves the user profile and caller profile information , which is stored at the profile database 142 of the application server 140 . further , recall , that the recorded announcements may be pre - recorded announcements selected from a list provided by the service provider 110 , or announcements actually recorded by the user . at step 214 , the recorded announcements are stored at the media server 144 . the upas 118 also instructs the softswitch 114 that serves the user &# 39 ; s line to identify the subscriber &# 39 ; s line as a participant of the animated / digitally depicted interactive voice session ( addivs ). it is noted that a user may create or modify their profile at any time based on the user &# 39 ; s requirements . at step 216 , the method 200 ends . fig3 a and 3b together depict a flow chart of a method 300 for providing the caricature during an interactive voice session . the method 300 starts at step 302 , where a calling party has already created a caricature profile with the service provider 110 as described by method 200 of fig2 . recall , the term “ caricature ” is defined to include either digital images or animated images uploaded to the service provider 110 by the user , or video images provided by the service provider 110 and selected by the user to create their calling profile . at step 304 , the calling party ( e . g ., subscriber device 120 1 of fig1 ) initiates a call over the ip network 102 to another subscriber to the service provider 110 ( e . g ., subscriber device 120 2 ). the call is initiated from the subscribers sip based softclient loaded on their subscriber device 120 . the call is routed to a softswitch 114 serving such calling party , and at step 306 , the softswitch 114 checks the calling line to confirm that the caller subscribes to the addivs services . if at step 306 , the calling party is not a subscriber to the addivs services , then at step 308 , the call proceeds as a normal voip service without any personalized caricatures or announcements . if at step 306 the calling party is a subscriber to the addivs services , then the method 300 proceeds to step 310 . at step 310 , the softswitch 114 sends a sip / api message to the application server 140 . in particular , the call is sent to either a sip based application server , or an internal api message sent to a server with third party call control using a sip interface . at step 312 , the application server 140 checks the profile database 142 for pre - provisioned service settings . that is , the application server 140 identifies the level of service of the calling party . different service levels may be provided for various calling parties . for example , a service provider 110 may implement a default caricature that is sent to various types of called parties when the calling party initiates a call . for example , subscribers from a corporate environment may have a corporate logo ( e . g ., a telephone company logo ) and message pre - selected as a blanket default caricature and message provided by the service provider 110 . alternatively , where there is no default caricature / message implemented by a service provider 110 , a user - defined caricature such as the caricatures discussed above , may be implemented when the calling party initiates a call . such levels of service are indicated in the subscriber profile database 142 for each subscriber . at step 314 , a determination is made by the application server 140 to identify which service level applies to the calling and called party . if at step 314 , the calling party has a service level that provides attributes defined by the subscriber ( i . e ., caricatures and voice messages ), then the method 300 proceeds to step 316 . at step 316 , a determination is made whether to prompt the calling party for options . recall , that in step 210 of method 200 , the user may create more than one caricature and announcement for their profile . if the caller does not initially associate a particular caricature and announcement with a called number , then the calling party is prompted to provide provisioning options for the alert in real time ( i . e ., “ on - the - fly ”). at step 318 , the caller is provided an option to select a particular caricature and announcement with service attributes before proceeding with the alert and call session . specifically , at step 318 , the calling party is prompted ( e . g ., pop - up window ) to select service options regarding the alert and session , and at step 320 , the caller selects the desired caricature and announcement . the method 300 then proceeds to step 322 . however , if at step 316 the caller has previously associated a caricature and announcement with the called party &# 39 ; s number ( or sip url ), then steps 318 and 320 are omitted , and the method 300 proceeds to step 322 . moreover , if at step 314 , the query is answered negatively , where the service provider 110 chooses to select service attributes for these call scenarios , the default is provisioned by the application server 140 , thus eliminating the pop - up prompt to the calling party . as such , steps 316 through 320 are omitted and the method proceeds to step 322 . thus , the implementation of handing the call off to the application server 140 is to establish a sip session between the calling party and the application server 140 . the application server 140 retrieves the pre - provisioned profile information on the calling party and called party to determine service attributes in order to initiate an “ invitation ” to the called party for the interactive voice session . at step 322 , the application server associates the announcement with the caricature . in particular , the application server 140 retrieves the specific caricature assigned for the present call , as well as instructs the media server 144 to coordinate the playing of the announcement with the caricature . in particular , the application server 140 notifies the media server 144 to retrieve the audio file pre - selected by the subscriber or service provider 110 for alerting the called party . at step 324 , the call alert , which includes the personalized caricature and recorded announcement is sent to the called party , and at step 326 , the called party is alerted of the incoming call . in particular , the application server 140 establishes a separate session ( e . g ., sip session ) with the called party &# 39 ; s subscriber device 120 , where a data stream is sent from the application server 140 to the called party &# 39 ; s subscriber device 120 via the ip network 102 . once the caricature and recorded message is received by the called party &# 39 ; s subscriber device 120 , the subscriber device 120 processes the packetized video and audio information in a conventional manner as is known in the art to displays the caricature on the called party &# 39 ; s display , and play the recorded message over the sound system . for example , in one embodiment , the data stream may comprise the caricature and voice messaging data packets only , where an executable application program previously loaded on the subscriber device 120 is executed upon receiving such packet stream . when executed , the application program provides , illustratively , a “ pop - up ” window displaying the caricature while playing the audio to thereby alert the called party of an incoming call . in a second embodiment , an executable file containing the animated caricature information and voice messaging is sent to the subscriber device 120 for execution and generation of the exemplary pop - up window on their subscriber device 120 . at step 328 , the called party may either accept or reject the call . if at step 328 , the called party rejects the incoming call , then the called party may , at step 330 , terminate the call at step 330 and proceed to step 399 where the method 300 ends . alternatively , at step 332 , the called party may send the incoming call to voice mail for future review , and at step 399 , the method 300 ends . at step 328 , if the called party accepts the incoming call , and at step 334 , the called party desires a voice only session , then at step 338 , a voice only session is established between the caller and called party . it is noted that if the called party is also a subscriber to the addivs services , then the called party has the additional option , at step 336 , to establish the addivs between the caller and called party . in this case , the caller and called party a may view the caricature sent by the caller . once the call is sent to voice mail at step 332 , or the voice session is terminated by the parties at step 338 , or the caricature session is terminated by the parties at step 336 , the method 300 proceeds to step 399 , where the method 300 ends . it is noted that if the called party is not a subscriber of the service provider 110 , then the softswitch 114 utilizes its routing tables to process the call as a voice session only , and thereby bypasses the application server 140 altogether . however , one skilled in the art will appreciate that a service provider service level agreement ( sla ) may allow the service provider 110 to enable such addivs services of the present invention in some form to called parties who are not subscribers , as long as such non - subscribers have the necessary equipment ( subscriber device and software ) to participate in such service . for example , a service provider 110 may wish to provide such addivs services during a service promotion for some limited time to users in a particular geographic area . the addivs services also allow a calling party to place calls to users who are mobile . specifically , the subscriber server 112 also function as a location server to monitor the location of the subscribers . in particular , the location server 112 tracks the subscriber &# 39 ; s location by utilizing a specific prefix ( e . g ., ip address ) assigned each time a caller registers or logs on for services . that is , each time a calling party initiates a call the ip address is shared with the proxy servers / location servers in the network 100 . the incoming registration messages are routed to the softswitch 114 , where the subscriber database 116 is updated with the current ip address of the caller . once the called party is located via the ip address , the addivs automatically knows which profile to send based on the called number registered in the caller profile . as discussed above , the addivs service allows the caller to associate a particular profile with one or more numbers of called parties the caller desires to contact . fig4 depicts a flow diagram of a method 400 for providing the alerting services during an interactive voice session from a non - subscriber line . in particular , a calling subscriber may not have access to their normal subscriber line and may be using a third party line . thus , method 400 provides a technique for accessing the addivs from such a third party line . specifically , method 400 starts at step 401 and proceeds to step 402 , where the caller calls a remote activation telephone number . the remote access telephone number may be one of a plurality of remote access telephone numbers provided to the subscribers . at step 404 , a switch that serves the remote telephone line receives the call on an interactive voice response system ( ivrs ), and at step 406 , the ivrs prompts the caller to enter their caller profile service id and passwords . it is noted that ivrs receives the ip address of the called party from the register sip message . at step 408 , the ivrs forwards the sip registration message to the softswitch 114 , where the caller is verified as being a subscriber . at step 410 , the subscriber database 116 is updated with the new ip address of the calling party . the ivrs then generates a confirmation announcement to the caller . at step 412 , the caller terminates the remote call to the ivrs . the method 400 then proceeds to step 304 of method 300 , where the calling party initiates a call from the remote line to the called party . specifically , the remote call is first routed via proxy / location servers to the softswitch 114 , and subsequently routed to either a non - subscriber via the pstn 106 , or to the application server 140 , as discussed above with regard to method 300 of fig3 . thus , the animated / digital depicted interactive voice session services allows the users to flexibly control the information that they want to be presented , as well as providing an amenable call alert system . although various embodiments that incorporate the teachings of the present invention have been shown and described in detail herein , those skilled in the art can readily devise many other varied embodiments that still incorporate these teachings . | 7 |
with reference to drawings illustrating an embodiment according to the present invention , it will be seen that on a supporting stand 1 , a rotary disc supporting plate 2 is fixedly mounted in a position inclined to the horizontal and a hopper head 3 is connected to the supporting plate 2 by means of bolts 4 to form a hopper 5 for holding a supply of coins . within the hopper 5 , a rotary disc 6 is rotatably supported on the inclined supporting plate 2 and is provided at the peripheral portion 6a thereof with a plurality of coin engaging projections such as pins 8 extruded from the top surface of the rotary disc with a height corresponding to thickness of a coin to be dispensed and spaced in the peripheral direction with a distance corresponding to diameter of the coin . concentrically overlaying the top surface of the rotary disc 2 is also provided with a central disc 9 . thus central disc 9 and the pins 8 on the rotary disc 2 define a plurality of coin receiving spaces on the rotary disc 2 . these coin receiving spaces on the rotary disc 2 pickup coins from the lower portion of the hopper and deliver them to the upper delivery zone 7 one at each of the receiving spaces when the rotary disc is rotated within the hopper . at the upper delivery zone 7 , a delivery knife 10 is secured to the supporting plate and is extended across the peripheral portion 6a of the rotary disc 2 so that the top surface of the knife point 10a is tangential to the upper periphery 9a of the central disc 9 and thereby the coin carried by the pin 8 is transferred from the upper periphery 9a of the central disc 9 onto the delivery knife 10 at the upper delivery zone 7 to pass the coin into the discharge chute 11 . the delivery knife 10 is made of a flat metal plate as shown in fig2 having a thin knife point portion 10a of a thickness corresponding to the thickness of the coin to be dispensed and a thick portion 51 formed with a channel 50 for passing of pin 8 . the thin portion is provided with a frustoconical deflector 52 secured by means of a set screw 53 and the thick portion 51 has a coin discharging rail 10b which is inclined downwards within the discharge chute 11 . opposite upwardly to the delivery knife 10 is provided with a counter roller 13 which is rotatably supported on the free end of a spring loaded rocker arm 12 of a coin mounting switch so that the switch is actuated by the coin passing between the delivery knife 10 and the counter roller 13 . at the upper delivery zone , there is at least one antidoubling means or wiper 14 for controlling the coin passing to the discharge chute 11 as shown in fig2 . the antidoubling wiper 14 is made of sheet shaped elastomer material and is secured to a mount piece 16 on the supporting plate 2 at the upper base portion 14a thereof together with a deflecting metal sheet 17 by means of screws 18 so that the wiper 14 is suspended from the mount piece 16 over an upper circumferential wall 19 which circles the rotary disc to overlay the free end portion 14b of the wiper 14 on the top surface of the peripheral portion 6a . the free end 14b is provided with a conical projection . the intermediate portion 14c of the wiper 14 is spaced from the top surface of the peripheral portion 6a to provide a clearance 20 for passing of the pin 8 . referring to fig3 the rotary disc 6 has a concentric circular race 21 formed at the peripheral portion on the bottom surface thereof and a plurality of balls 22 are rotatably confined in retainers 23 , respectively , which are spaced in the peripheral direction and interposed between the top surface of the supporting plate 2 and the bottom surface of the rotary disc 6 for antifriction engaging the surface of the circular race 21 so that the rotary disc 6 is rotatably supported at the outer peripheral portion thereof on the supporting plate 2 by means of balls 22 . the rotary disc 6 is resiliently urged at the center portion thereof towards the supporting plate 2 as will be mentioned below and as a result all of the outer peripheral portion of the rotary disc is pressed onto the balls 22 on the supporting plate so that the rotary disc is prevented from joggling in the normal direction to the plane of the rotary disc during rotation owing to the unbalanced load subjected to the lower portion of the rotary disc by the coin within the hopper . the rotary disc 6 also has an eccentrically driven pin 27 extruded from the bottom surface thereof for engagement by a radially projecting drive pin 28 secured to the drive shaft 25 . when the drive shaft 25 is driven and rotated through a reduction gear in the gear box 24 by means of motor , the rotary disc 6 is connected operatively to the drive shaft 25 by the drive pin 28 in its engagement with the driven pin 27 to rotate the rotary disc 6 . the drive shaft is extended through the supporting plate 2 , the rotary disc 6 and the central disc 9 on the rotary disc from the reduction gear box 24 . in the embodiment illustrated in the drawings , on the central disc 9 , three agitating coil springs 15 are arranged so as to extend radially of the drive shaft 25 . each of these coil springs 15 has at the opposite ends hook portions 15a and 15b , respectively and has a reinforcing coil spring 29 of a short length and a smaller diameter or the like inserted within the inner end portion 15c of the coil spring 15 which is resiliently held as will be mentioned below . the coil spring 15 has preferable 10 mm diameter and is made of a wire of 1 . 5 mm diameter to provide a desired strenth and flexibility . these coil springs 15 are resiliently held at the inner end portions 15c on the central disc 9 by an elastomer retainer 30 made of elastomer material and a connecting piece 31 which are mounted on the extended end portion 25a of the drive shaft 25 . the elastomer retainer 30 has a central bore 32 for inserting the extended end portion 25a , recesses 33 formed radially for holding the inner end portions 15c of the coil springs 15 , retaining recesses 34 partially extended from the recesses 33 for retaining the inner end hooks 15b , a recess 35 for mounting the connecting piece 31 and holes 36 for engaging with connecting legs 40 of the connecting piece 31 as illustrated in fig5 and 6 , and the connecting piece 31 has a center bore 37 for inserting the extended end portion 25a of the drive shaft 25 , retainer pressing upper portion 38 , a spring seat 39 for a compression spring 46 and connecting legs 40 for engaging with the inner end hook 15b of the coil spring 15 . the connecting legs 40 are extended through the holes 36 of the elastomer retainer 30 , the inner holes 41 of the hooks 15b of the coil springs 15 , holes 42 formed in the central disc 9 and holes 43 formed in the rotary disc 6 so as to connect the elastomer retainer 30 , the coil springs 15 , the central disc 9 and the rotary disc 6 integrally . the elastomer retainer also has a conical portion 45 . the coil springs 15 , the elastomer retainer 30 and the connecting piece 31 are assembled on the central disc 9 and the connecting piece 31 is retained through a spring 46 interposed between the spring seat 39 and a washer 47 by a screw 48 secured to the end of the drive shaft 25 . thus the connecting piece 31 , the elastomer retainer 30 , the inner end portions 15c of the coil springs , central disc 9 and the rotary disc 6 are connected and also the rotary disc 6 is urged towards the supporting plate 2 so as to keep the outer peripheral portion of the rotary disc 6 in pressedly contact with the balls 22 on the supporting plate 2 . referring to fig7 - 9 . the delivery chute 11 is consisted of a coin guide side plate 55 as ilustrated in fig7 and a covering side plate 56 as illustrated in fig8 these two side plates 55 and 56 are spaced to each other to define a coin passage 57 between the opposite inner surfaces 55a and 56a as shown in fig9 . the coin guide side plate 55 is secured to the supporting plate 2 together with the covering side plate 56 by means of screws 58 so that the inner surface 55a of the coin guide side plate 55 is on a level with the surface 6b of the peripheral portion 6a of the rotary disc 6 or on a lower level as shown by an imaginary line 55a &# 39 ;. the side plate surface 55a has a guide ridge 59 extruded from the surface higher than the pin 8 on the rotary disc 6 . the guide ridge 59 extends in a coin discharge direction , i . e . in parallel with the top edge 10b of the delivery knife thick portion 51 inclined downwards so as to contact with the side face of a coin a as shown in fig9 . | 6 |
with reference to fig1 , numeral 10 indicates a machine for applying threaded caps to containers c , such as bottles or the like . the machine 10 comprises a central column 12 rotatable about a vertical axis a . the central column 12 carries a turret 14 equipped with a plurality of means for gripping the containers c . the means for gripping the containers c are known per se and can be of various types depending on the type of containers c . in general , the gripping means of the bottles must ensure a radial and axial retention of the bottle and must also have an anti - rotation element which prevents rotation of the bottle about its vertical axis . in the illustrated example , the turret 14 is equipped with an external guide 20 and fork elements 22 configured to receive respective necks of the containers c , and equipped with respective anti - rotation elements . it is intended that the system represented in the figures is only an example of a possible gripping means and that the invention is applicable to any other system for gripping the containers c . as illustrated in greater detail in fig2 and 3 , the containers c are provided with an external thread 16 configured for receiving a threaded cap . at the base of the thread 16 of the containers c a radially projecting rim 18 is formed . with reference to fig1 , the machine 10 comprises a plurality of screwing heads 24 . each screwing head 24 is located above a respective gripping means of the containers c . each screwing head 24 comprises a spindle 26 carrying a cap - gripping member 28 at its lower end . each screwing head 24 has a respective electric motor 30 which imparts a rotational movement to the spindle 26 about a respective longitudinal axis b . the cap - gripping member 28 is equipped with a rotational movement about the axis b and a translational movement in the direction of the axis b . the rotational movement and the translational movement are synchronized with each other , so that during operation the caps held by the gripping members 28 are equipped with a screwing movement . the linear movement in the direction of the axis b of the cap - gripping member 28 can be obtained by means of a mechanical or electronic cam . the structure and operation of the screwing heads 24 are known per se and do not require a more detailed description as they are beyond the scope of the present invention . the maximum torque applied to the cap - gripping member 28 is limited by the current supplied to the motor 30 . with reference to fig2 and 3 , the cap - gripping member 28 of each screwing head 24 has a frusto - conical seat 32 configured for receiving and retaining a respective cap 34 . the cap 34 has a respective internal thread 36 which is designed to couple with the external thread 16 of the respective container c . the machine 10 according to the present invention comprises a vision system 38 which is used for detecting the angular position of the threads 16 of the containers c and the angular position of the threads 36 of the caps 34 . more precisely , the vision system 38 is used to detect the angular position of the start points of the threads 16 and 36 . the vision system 38 can comprise a first viewing device 40 ( fig2 ) for detecting the angular position of the start point of the external thread 16 of a container c , and a second vision device 42 ( fig3 ) for detecting the angular position of the start point of the internal thread 36 of a cap 34 held by the gripping member 28 . each vision device 40 , 42 can be associated with a respective illuminator 44 , 46 arranged to illuminate the respective area of vision . as illustrated in fig2 and 3 , the vision devices 40 , 42 and the respective illuminators 44 and 46 may be arranged outside of the turret 14 . alternatively , the vision devices 40 , 42 can be axially aligned with the caps 34 and containers c . the vision system 38 is in a fixed position and detects images of the threads 16 , 36 of the containers c and the caps 34 which , from time to time , pass in front of the vision system 38 . the images recorded by the vision system 28 are sent to an electronic control unit schematically indicated with numeral 48 in fig1 . the electronic control unit 48 has an algorithm that analyses the images detected by the vision devices 40 , 42 and determines the angular position with respect to a reference system of the start point of the external thread 16 of the container c and the start point of the internal thread 36 of the corresponding cap 34 . the electronic control unit 48 is configured to control the electric motors 30 of the screwing heads 24 in order to make an adjustment of the angular position of the caps 34 according to the information on the detected angular position of the threads 16 , 36 . the adjustment of the angular position of the caps 34 consists in a rotation about the axis b of the gripping members 28 . this adjustment can be carried out before applying the caps 34 to the respective containers c . alternatively , the adjustment of the angular position of the caps can be carried out after the caps 34 have been placed on the threads 16 of the respective containers c . in this case , an angular stroke equal to the sum of the screwing angle of the caps and the displacement angle between the thread of the cap and the thread of the container is applied to each cap 34 . the purpose of the adjustment movement is to arrange the caps 34 with respect to the containers c so that the threads 36 of the caps 34 are in a preset angular position with respect to the threads 16 of the respective containers c . starting from the position in which the caps 34 are juxtaposed to the containers c with the threads 36 , 16 in a predetermined angular position , the motors 30 apply an angular rotation about the axis b , with a predetermined amplitude , to the respective gripping members 28 . in this way , the screwing stroke of the caps 34 is determined on the basis of a geometric criterion rather than as a function of the screwing torque . this allows a greater precision of screwing to be obtained and the avoidance of defects in the closing of the containers due to an excessive or insufficient closing torque . in parallel to the control of the motors 30 on the basis of a predetermined screwing stroke , the electronic control unit 48 can also carry out a detection of the screwing torque applied to the caps 34 by any known method for torque detection . the electronic control unit 48 may be programmed to vary the screwing stroke with respect to the established preset value in case the measured closing torque is insufficient or excessive . the vision system 38 is able to recognize the threads 36 of caps with different sizes , different colours and different numbers of thread elements ( from 1 to n elements ). the vision system 38 is also able to recognize interruptions of the threads and the thread sectors with zero slope . the vision system 38 is also able to detect the thread of transparent glass or plastic containers . of course , without prejudice to the principle of the invention , the details of construction and the embodiments may vary widely with respect to those described and illustrated without departing from the scope of the invention as defined by the claims that follow . | 1 |
the assembly shown in fig1 is a standard container 50 mounted on top of a driving device 70 . the container 50 has a generally cubic upper chamber 51 with a converging base 52 leading to a funnel outlet 53 closed by a lower plug 54 . a base ring 55 is secured to the converging base 52 by legs 56 so that the container can be parked with the base ring 55 resting on the ground and the funnel outlet 53 clear of the ground . around the periphery of the funnel outlet 53 are four depending pins 57 whose purpose will be described later . a sleeve 61 is mounted by means not shown in the drawing to depend below the plug 54 , the sleeve forming a bearing for a reciprocable vertical shaft 62 on the top of which is mounted a plate 63 . at the bottom of the shaft 62 is a shackle 64 across the arms of which is mounted a pin 65 . cam follower member 66 is mounted on the pin between the arms of the shackle , the member having a lower cam follower surface which is concave and cylindrical . as can be seen in fig1 the funnel 53 and plug 54 of the container are lined with a flexible liner 68 which extends down the sides of the funnel , across the upwardly inclined top surface of the rim of the plug 54 and over the upper surface of the plate 63 . the top edges of the liner 68 are secured by a diode plate 69 against the walls of the funnel and this diode plate may be of the form described in ep - a - 0 123 452 . the drive unit 70 has a generally rectangular framework 71 which rests on the floor , provided with parallel hollow passages 72 adapted to receive the forks of a lift truck . there are four upwardly directed columns 73 which receive the four pins 57 of the container , and the top of one column is provided with a sensor switch 74 which senses the presence of a pin 57 to control the energization of the drive unit . mounted on the framework 71 is a motor 75 driving an output shaft 76 extending transversely , parallel to the pin 65 of the container . mounted on the shaft aligned with the cam follower 66 and the axis of the vertical shaft 62 is an eccentric 77 whose radius matches that of the concave cam follower surface of the cam follower 66 . the eccentric is a cylinder whose axis is displaced from but parallel to the axis of the motor drive shaft 76 . a further cylinder 78 is mounted coaxially with the eccentric on each side thereof having rotatably mounted about its circumference a claw member 79 as can best be seen in fig3 . the claw member can be rotated about the further cylinder 78 from the position shown in fig3 to a position in which the mouth 81 of the claw envelops the pin . the claw mouth has a spring - loaded plunger 82 which secures the claw member 79 on the pin 65 in a releasable manner . the motor 75 drives the eccentric in an anti - clockwise direction as seen in fig3 so that the claw member is urged into engagement with the pin ; there is no tendency for the claw member to become detached from the pin during operation of the motor . the claw members 79 engage the pin 65 so that vertical reciprocation of the axis of the eccentric 77 when the motor is energised is transferred to the pin 65 and thence to the plate in the interior of the container . the vibrations of the plate are transmitted through the liner 68 to the contents of the container to mix them , with the assistance of the diode plate 69 if provided . the liner serves to isolate the container contents from the reciprocating plate 63 to avoid it and its bearings becoming contaminated by the contents of the container . when the container 50 is used for storage , it can be parked on the ground with its base ring 55 in contact with the ground . when it is desired to mix the contents of the container , the container 50 is lifted on to the drive unit 70 so that the pins 57 depending from the periphery of the plug enter the respective columns 73 on the drive unit . the switch 74 then energises the drive motor . this ensures that the drive unit 70 cannot be energized until a container 50 is mounted thereon . as the container 50 is lowered on to the drive unit 70 , the cam follower surface 66 will engage the periphery of the eccentric 77 . the claw members 79 will have been placed in the position shown in fig3 prior to the lowering of the container on to the drive unit and once the container is in position , the claw members can be moved manually into position so that the pin ends are engaged by the two claw members or the drive motor can be energized so that the friction between the further cylinders and the claw member will rotate the member into engagement with the pin . once the claw members 79 are engaged with the pin they will be releasably held there by the plungers 82 and the vertical reciprocation of the cam is transmitted through the shaft to the plate . when the mixing operation has been completed , the claw members 79 are disengaged and container 50 is lifted off the drive unit and can be parked elsewhere with its base ring 55 resting on the ground . if the mixed contents of the container are to be used immediately , the container may be parked over a delivery chute and the plug 54 removed from the base of the container to allow the contents to be delivered to the chute . it will be necessary to remove the flexible diaphragm and possibly the diode plate if provided as well to allow the contents to escape easily . a new container 50 can then be lifted into position on top of the drive unit 70 in its present position or the drive unit can be moved to a new location . | 1 |
it is to be understood that the following disclosure provides many different embodiments , or examples , for implementing different features of various embodiments . specific examples of components and arrangements are described below to simplify the present disclosure . these are , of course , merely examples and are not intended to be limiting . in addition , the present disclosure may repeat reference numerals and / or letters in the various examples . this repetition is for the purpose of simplicity and clarity and does not in itself dictate a relationship between the various embodiments and / or configurations discussed . fig1 depicts a liquid delivery system consistent with embodiments of the present disclosure . fig1 depicts fluid containers 101 positioned on flatbed 10 of truck 15 . truck 15 may be used to , for example , deliver fluid containers 101 to a wellsite , return fluid containers 101 from the wellsite , or transfer fluid containers 101 between wellsites . each of fluid containers 101 is at least partially filled with a liquid to be transferred . fluid containers 101 include at least one drain 103 positioned to allow liquid to be drawn from the fluid container 101 to be used at the wellsite . in some embodiments , fluid containers 101 may be filled at a supply depot . at the supply depot , fluid containers 101 may be at least partially filled with the desired liquid . as depicted in fig2 , 3 , fluid container 101 may include differential pressure sensor 105 positioned to measure the differential pressure between the inside of fluid container 101 and the external environment . differential pressure sensor 105 may be positioned in an existing aperture at the top of fluid container 101 , such as a bung hole . differential pressure sensor 105 may output the differential pressure as an electrical signal via sensor wire 107 . as depicted in fig1 , sensor wire 107 may , when fluid container 101 is positioned on flatbed 10 , electrically connect to sensor bus 109 . sensor bus 109 may serve to connect each fluid container 101 with control unit 111 . sensor bus 109 may be positioned to run along the side of flatbed 10 to , for example , prevent a potential tripping hazard for one walking on flatbed 10 . control unit 111 may be positioned to measure the differential pressure as output by each fluid container 101 , allowing control unit 111 to calculate the volume of liquid remaining in each fluid container 101 . in some embodiments , flatbed 10 may include a suspension system positioned to ensure any fluid containers 101 are level at the time of reading . in some embodiments , the suspension system may be an active suspension including , for example and without limitation , an air suspension system . in some embodiments , control unit 111 may include a display to display relevant data to a user including , for example and without limitation , starting liquid volume , current liquid volume , change in liquid volume , time of delivery , time of current and previous measurement , etc . in some embodiments , control unit 111 may include a printer to print , for example , a ticket , invoice , or receipt for the liquid used . in some embodiments , control unit 111 may output or print readings or measurements on demand and / or according to a schedule . in some embodiments , control unit 111 may include a data port capable of being connected to a wellsite network . in some embodiments , the data port may be , as understood in the art , an rs 232 compatible connection . in some embodiments , control unit 111 may be powered by a battery . in some embodiments , the battery may be recharged by a solar array . in some embodiments , the battery may be recharged by a wind turbine . in some embodiments , control unit 111 may also be capable of providing a closed pressure system . in some such embodiments , control unit 111 may be positioned to control a pump or to control a valve on a compressed gas container each positioned to provide pressurized gas to fluid container 101 to , for example , fill space in fluid container 101 left by dispensed fluid or to force fluid from fluid container 101 . in some embodiments , the combined gas law may be utilized to determine the amount of liquid that has been dispensed since the last time fluid container 101 was connected to control unit 111 by measuring , as depicted in fig2 , 3 , the change in pressure of gas 113 positioned within fluid container 101 as liquid 115 is dispensed . as understood in the art , the combined gas law may be approximated as follows : where p 1 is the pressure of gas 113 , v 1 is the volume of the gas , t 1 is the temperature of the gas , and k is a constant . the constant k remains the same value while conditions , such as pressure , volume , and temperature vary . thus , extending the combined gas law to apply to a second set of parameters , the following equations may be derived : where p 2 , v 2 , and t 2 are the pressure , volume , and temperature of gas 113 at the second point in time . assuming that fluid container 101 is sealed at the time it is filled by the supply depot and no additional gas may enter thereinto , by measuring the change in pressure of gas 113 between the filled state and the at least partially emptied state ( as well as the temperature change ), the corresponding volume of liquid 115 dispensed may be calculated . the equation to do so may be derived as follows : where v container is the volume of the container , δv gas and δv fluid are the change in volume of the gas and liquid respectively , v liquid , filled is the volume of liquid in fluid container 101 when fluid container 101 is delivered to the wellsite , and p filled , t filled , p emptied , and v emptied are the pressures and volumes of the gas when fluid container 101 is delivered ( filled ) and picked up ( emptied ). thus , by measuring the change in pressure of gas 113 with a known volume of liquid 115 in a fluid container 101 of known volume , the amount of liquid 115 dispensed may be calculated . in some embodiments , the temperature term may be ignored , assuming that gas 113 is air , and the temperature of the gas is the same as the temperature of the surrounding environment both when fluid container 101 is filled and when the measurement is taken . in some embodiments , the hydrostatic pressure of liquid within the container may instead be utilized . as depicted in fig4 , fluid container 201 may include hydrostatic pressure sensor 205 which is submerged within liquid 215 . in some embodiments , hydrostatic pressure sensor 205 may be coupled to extension arm 217 , extending from the top of fluid container 201 . in some embodiments , extension arm 217 may be , for example , a wire or cable from which hydrostatic pressure sensor 205 is suspended . in some embodiments , hydrostatic pressure sensor 205 may include or be coupled to a weight to , for example , ensure hydrostatic pressure sensor 205 is able to sink to the bottom of any liquid 215 which may be in fluid container 201 . in some embodiments , the weight distribution of hydrostatic pressure sensor 205 may be such that hydrostatic pressure sensor 205 lays horizontally on the bottom of fluid container 201 . in other embodiments , as depicted in fig5 , fluid container 201 may include hydrostatic pressure sensor 205 which is mounted to the bottom of fluid container 201 . in embodiments measuring the hydrostatic pressure of liquid 215 , the height of the column of liquid 215 may be calculated from the differential pressure measured by hydrostatic pressure sensor 205 . assuming that liquid 215 is incompressible , and thus the density of liquid 215 is constant , the height of liquid 215 above hydrostatic pressure sensor 205 may be calculated according to : where h is the height of liquid 215 above hydrostatic pressure sensor 205 , p is the differential pressure measured by hydrostatic pressure sensor 205 , g is the gravitational acceleration , and ρ is the density of the fluid . one having ordinary skill in the art with the benefit of this disclosure will understand that the density of liquid 215 may be calculated from its specific gravity , and that the density of liquid 215 may vary based on , for example , the temperature of liquid 215 . by knowing the height of liquid 215 and the geometry of fluid container 201 , the volume of liquid 215 in fluid container 201 may be calculated according to : where v is the volume of liquid 215 above hydrostatic pressure sensor 205 , z is a distance in the direction of h ( up ) from hydrostatic pressure sensor 205 , and a ( z ) is the cross - sectional area of fluid container 201 at a distance z . by comparing the volume of liquid 215 measured at drop off and the volume of liquid 215 measured at pick - up , the volume of liquid 215 dispensed can be readily calculated . with regards to fig1 , in some embodiments , control unit 111 may include a computer or microcontroller to make the relevant previously described calculations . in some embodiments , control unit 111 may further include equipment for transmitting the calculated volume change to portal 117 as depicted in fig1 . in some embodiments , control unit 111 may communicate by wireless communication equipment 119 to wireless communication equipment 121 at portal 117 . in some embodiments , control unit 111 may communicate with portal 117 via satellite uplink 123 utilizing satellite 125 . in some embodiments , satellite uplink 123 may be one of globalstar or iridium leo networks . in some embodiments , control unit 111 may connect to a land - based communications network , such as cellular , gsm , lte , hspa , cdma , etc . to communicate with portal 117 . in some embodiments , control unit 111 may connect wirelessly to the internet to communicate its measurements to portal 117 . once measurements are received at portal 117 , portal 117 may initiate a billing request from the client . in some embodiments , each fluid container 101 may be assigned a unique identifier such as a serial number to allow portal 117 to associate the fluid container 101 with a specific client , worksite , liquid type , distributor , etc . portal 117 may , in some embodiments , aggregate this data to identify the client , worksite , container , liquid type , distributor , and automatically generate a bill for the client based on the amount of liquid dispensed as calculated by control unit 111 . in some embodiments , a user input on control unit 111 may cause control unit 111 to measure pressure differential and transmit the information to portal 117 . in other embodiments , rather than utilizing pressure sensor 105 to determine the amount of liquid dispensed from fluid container 101 , a load cell may be used to determine the weight of fluid container 101 , and thus derive the amount of liquid dispensed by comparing the weight of fluid container 101 at delivery and when picked up . knowing the density or specific gravity of the liquid , the volume dispensed may be calculated . such a load cell may be positioned on flatbed 10 or as a part of fluid container 101 . the foregoing outlines features of several embodiments so that a person of ordinary skill in the art may better understand the aspects of the present disclosure . such features may be replaced by any one of numerous equivalent alternatives , only some of which are disclosed herein . one of ordinary skill in the art should appreciate that they may readily use the present disclosure as a basis for designing or modifying other processes and structures for carrying out the same purposes and / or achieving the same advantages of the embodiments introduced herein . one of ordinary skill in the art should also realize that such equivalent constructions do not depart from the spirit and scope of the present disclosure and that they may make various changes , substitutions , and alterations herein without departing from the spirit and scope of the present disclosure . | 7 |
objects , technical solutions , and advantages of the invention will be easily understood by reference to the following description of embodiments when read in conjunction with the accompanying drawings . hereby , the exemplary embodiments of the invention together with the description serve to explain , but not limit , the principles of the invention . fig1 is a schematic diagram of an interface of a security device according to one embodiment of the present invention . a security device 100 includes a camera module 110 ( which is not shown ) such as a camera and a display module 120 such as a display screen ; and the security device 100 can be any device , which includes but not limited to a cell phone , a tablet computer , a desktop computer , a laptop computer , etc . a plurality of icons are displayed on the display module 120 , shown as 130 , 140 , 150 and 160 etc . those icons represent objects which include but not limited to image , video , program , interface , etc . for example , the object represented by icon 130 is program . when a user clicks icon 130 by a mouse , a keyboard , a touch screen , and so on , the flowing process of the method according to the embodiment of the invention is as the following : step s 10 , displaying a image , which is capturing by the camera module 110 , on the display module 120 ; the camera module can be in photo mode or video mode ; step s 20 , when the camera module 110 captures a preset image , the display module 120 displaying an interface for entering a password . hereby , the preset image includes any one of color , brightness , pattern or any combination thereof which satisfy a predetermined condition . the embodiments of using color , brightness and pattern respectively are as the following . the user presets a color value as base color and the user sets positive and negative tolerance simultaneously ; a color represented by a color value which is in the range of positive and negative tolerance is trigger color . when the camera module 110 capturing an image , the camera module 110 divides the image into units of n × n pixels ( number of pixels can be equal to the resolution of the camera module 110 or less than the pixels thereof ; in case that the number of pixels is less than the resolution , the color value of each unit is equal to average value of color values of all actual pixels in the unit ), if the proportion for the number of pixel units of which color values are in the range of tolerance in total number of all pixel units exceeds a preset value ( for example , including but not limited to , 80 %, which can be set according to actual situation ), it is regarded as satisfying trigger color , i . e . the preset image is captured . the user presets a brightness value as base brightness and the user sets positive and negative tolerance simultaneously ; an brightness represented by a brightness value which in the range of positive and negative tolerance is preset color . when the camera module 110 capturing an image , the camera module 110 divides the image into units of n × n pixels ( number of pixels can be equal to resolution of the camera module 110 or less than the pixels thereof ; in case that the number of pixels is less than the resolution , the brightness value of each unit is equal to average value of brightness values of all actual pixels in the unit ), if the proportion for the number of pixel units of which brightness values are in the range of tolerance in total number of all pixel units exceeds a preset value ( for example , including but not limited to , 80 %, which can be set according to actual situation ), it is regarded as satisfying trigger brightness , i . e . the preset image is captured . the user draws an outline as trigger pattern , the outline can be unclosed . when the camera module 110 capturing an image , the camera module 110 will detect the object in the image ( if required , including that , but not limited to , detection is made in situations of different focuses ; the detection can determine the edge line of the object according to color contrast value ) so as to compare the detected edge line of the object with the trigger pattern , if they are matched , the trigger pattern is satisfied , i . e . the preset image is captured . of course , the above three embodiments serve to exemplary illustration ; any method for identifying color , brightness , pattern of an image is adaptable . in addition , a set password can be text or pattern ; the password entering interface is shown by fig2 and fig3 ; fig2 is a text entering interface ; fig3 is a pattern entering interface ; the pattern can be made up by connecting dots ; of course , it can be a combination of text and pattern . it should be understood that the method for above password setting and entering is just for example only . any applicable method for password setting and entering can be used . step s 30 , if the password is matched , an object expected by the user , i . e . program , being displayed on the display module 120 ; if the password is not matched , the user can keep on trying for a predetermined failure times ( such as 10 times ), if reach the predetermined failure times , go to step s 40 ; step s 40 , the display module 120 prompting the user that the user can not do the entering operation and recording current information simultaneously ; the current information includes but not limited to time , location ( for example , obtained by a gps device ), background ( for example , obtained by camera module 110 ) etc , for example , monday , apr . 16 , 2012 , 39 ° 54 ′ n116 ° 23 ′ e ; at same time , the current information is sent to a predetermined address in a predetermined way ; the predetermined way includes , but not limited to any one of phone call , voice mail , short message , e - message , mail , instant messaging tool , social network or any combination thereof . the predetermined address can be preset by the user , or the predetermined address is selected from a place such as phone book , etc . of course , an alert can be given by other ways in the prior art . as shown in fig5 , the invention further provides a security device 100 , which includes a camera module 110 , a display module 120 , a confirming module 210 , a determining module 220 , a recording module 230 and a sending module 240 . the camera module 110 is capable of capturing an image , which includes but not limited to a camera , and is for capturing image by photo mode or video mode . the display module 120 is capable of displaying icon , image , program , interface , and so on , which includes but not limited to a display screen , a touch screen , etc . the confirming module 210 is configured to make the display module 120 present an interface for entering a password when confirming that a preset image is captured by the camera module 110 . hereby , the preset image comprises any one of color , brightness , pattern or any combination thereof which satisfy a predetermined condition . the embodiments of using color , brightness and pattern respectively are as the following . the user presets a color value as base color and the user sets positive and negative tolerance simultaneously ; a color represented by a color value which is in the range of positive and negative tolerance is trigger color . when the camera module 110 capturing an image , the camera module 110 divides the image into units of n × n pixels ( number of pixels can be equal to the resolution of the camera module 110 or less than the pixels thereof ; in case that the number of pixels is less than the resolution , the color value of each unit is equal to average value of color values of all actual pixels in the unit ), if the proportion for the number of pixel units of which color values are in the range of tolerance in total number of all pixel units exceeds a preset value ( for example , including but not limited to , 80 %, which can be set according to actual situation ), it is regarded as satisfying trigger color , i . e . the preset image is captured . the user presets a brightness value as base brightness and the user sets positive and negative tolerance simultaneously ; an brightness represented by a brightness value which in the range of positive and negative tolerance is preset color . when the camera module 110 capturing an image , the camera module 110 divides the image into units of n × n pixels ( number of pixels can be equal to resolution of the camera module 110 or less than the pixels thereof ; in case that the number of pixels is less than the resolution , the brightness value of each unit is equal to average value of brightness values of all actual pixels in the unit ), if the proportion for the number of pixel units of which brightness values are in the range of tolerance in total number of all pixel units exceeds a preset value ( for example , including but not limited to , 80 %, which can be set according to actual situation ), it is regarded as satisfying trigger brightness , i . e . the preset image is captured . the user draws an outline as trigger pattern , the outline can be unclosed . when the camera module 110 capturing an image , the camera module 110 will detect the object in the image ( if required , including that , but not limited to , detection is made in situations of different focuses ; the detection can determine the edge line of the object according to color contrast value ) so as to compare the detected edge line of the object with the trigger pattern , if they are matched , the trigger pattern is satisfied , i . e . the preset image is captured . of course , the above three embodiments serve to exemplary illustration ; any method for identifying color , brightness and pattern is adaptable . in addition , a set password can be text or pattern ; the password entering interface is shown by fig2 and fig3 ; fig2 is a text entering interface ; fig3 is a pattern entering interface ; the pattern can be made up by connecting dots ; of course , it can be a combination of text and pattern . it should be understood that the method for password setting and entering is just for example only . any applicable method for setting and entering a password can be used . the determining module 220 is configured to determine whether the password entered by the user is matched , if the password is matched , an object expected by the user is displayed on the display module 120 ; if the password is unmatched , the user can keep on trying for a predetermined failure times ( such as 10 times ), if the times reaches the predetermined failure times , the display module 120 displays information and prompts the user that the user can not do the entering operation and the recording module 230 records current information simultaneously ; the current information includes but not limited to time , location ( for example , obtained by a gps device ), background ( for example , obtained by camera module 110 ) etc ; for example , monday , apr . 16 , 2012 , 39 ° 54 ′ n116 ° 23 ′ e ; simultaneously , the sending module 240 sends current information to a predetermined address in a predetermined way ; the predetermined way includes but not limited to any one of phone call , voice mail , short message , e - message , mail , instant messaging tool , social network or any combination thereof . the predetermined address can be preset by the user , or the predetermined address is selected from phone book , etc . of course , an alert can be given in other ways of the prior art . the above detailed description of the detailed embodiments has been presented for the purpose , technical solutions and advantages of the invention better in details . it should be understood that , all of the above description serves for the preset embodiments of the invention only and has no limitation of the scope of the invention . the present invention covers any and all modifications , equivalent alternatives and improvements , and so on , that fall in the spirit and principle of the invention . | 7 |
the invention can especially be implemented in an image analyzer having a conventional general design , such as that shown in fig1 but having a morphological rewrite processor . the analyzer in fig1 comprises an image acquisition component 10 ( camera or recording ), whose output signals are digitized in a circuit 12 , with each pixel being represented by a number comprised of several binary elements or &# 34 ; bits &# 34 ; ( digital image ). the signals are applied to a write bus 14 connected to a display memory 16 having a content corresponding to the number of pixels of an image to be provided on a display component 18 such as a cathode ray tube . the analyzer comprises two identical read buses , which can be connected to other components , such as tape recorders , etc . the data circulating on these input busses is applied to an arithmetic and logical unit 24 which can effect operations of addition , subtraction , search for minimum and maximum among pixels . the outlet of the unit 24 is connected to a morphological neighborhood processor 26 which allows parallel transformations of the neighborhoods to be effected . the read busses 20 and 22 are also connected to a morphological processor 28 . the output of processors 26 and 28 is applied , using a common bus , to a circuit 32 whose role is to provide stop criteria for the rewrite processor . this circuit conducts an integral measurement . but a more advantageous stop test can be implemented in the processor itself , for all transformations which do not lead to the result in a fixed number of transformations . indeed , it may consist of a comparator which compares the initial value to the transformed value of each pixel in turn . as long as a transformation couple in the direct direction , then in the inverse direction modifies a single pixel , a new transformation couple must be carried out . the comparator has as inputs the values of pixels a ij and a ij * ( former value and transformed value ). the output of the comparator constitutes the input of a or gate . the output of the or gate is connected to the input of a flip - flop which can store one bit . the flip - flop is reset at the beginning of a transformation couple and set to 1 as soon as the two pixels a ij and a ij * have different values . the output of the flip - flop is reinjected into the or gate so that the flip - flop remains locked at 1 until the end . finally , the busses are connected to a random access memory 30 having sufficient capacity to store two or three complete images , which can be considered as occurring in three parts a , b , c . so that the analyzer in fig1 can implement the process according to the invention , the morphological processor 28 is comprised of two modules 40 and 42 . the module 40 constitutes the rewrite device and has the function of presenting the module 42 which constitutes the processor with all of the arguments it needs to effect the transformation ( 1 ). in order to minimize the number of & lt ; memory & gt ; accesses for the image & lt ;& gt ; 30 , the rewrite device 40 advantageously comprises a local memory 41 in which all of the pixels are stored which have already served in the transformation of the pixels encountered before pixel a ij during the scan and which will still serve in the transformation of the pixels which follow pixel a ij . in other applications , the local memory 41 is also designed to receive pixels at once before and after a ij . as soon as it is calculated by the processor 42 , the new value a * ij is recorded in the image memory 30 as well as in the local memory 41 of the device 40 so as to serve as an argument for the transformation of the subsequent pixels . the composition of the rewrite processor 28 and its memory will depend on the type of frame and neighborhood graph adopted . fig2 shows an assembly of the processor 28 which can be used when the scan is the video type in the direct and inverse directions , corresponding to a rectangular frame . but , as was indicated above , a hexagonal frame can be used . in the case of direct video scanning , the values presented to the processor 42 must be : in the case of grain reconstruction , the value b i , j read from the memory b , is also presented to the processor 42 . the local memory 41 shown in fig2 must simultaneously make available , for the processor 42 , the pixel on which the transformation is being executed and four already transformed pixels . to do so , it comprises a random access memory 34 , having a capacity corresponding to n - 1 pixels . this memory can be a ram addressed by the address bus 35 . the output of data from the memory 34 drives two cascade mounted store elements 36 and 38 , each having a capacity for a single pixel ( generally flip - flops ). the processor output 42 is connected to the memory 34 input and to the input of a memory component 44 having a capacity for a single pixel , as well as the memory 30 write bus . moreover , in the case shown , the memory 30 is also connected to store elements 46 and 48 whose capacity is for a single pixel . it is seen that the outputs of memory 34 store elements 36 , 38 , 44 , 46 and 48 allow the simultaneous presentation of the value of six pixels to the processor 42 . these six values are applied to inputs e1 , e2 , . . . e6 . the transformation to be made determines the constitution of the processor 42 , the distribution of the pixels stored in the store elements and that applied to the processor 42 . the assembly as shown allows the erosion function in square frame and grain reconstruction to be achieved , as will be seen below in greater detail . the following can especially be present in a simultaneous manner , at the output of the various elements : for the store element 46 for pixel a ij , simultaneously with the reading of pixel a i , j + 1 in part a of the memory and transfer to 46 , for the store element 48 for pixel b ij , simultaneously with the reading of pixel b i , j + 1 in part b of the memory , as for the other elements , they provide the following when a * i , j is applied to 34 and 44 : for the store element 44 , aready transformed pixel a * i , j - 1 ; for the store element 36 , already transformed value a * i - 1 , j ; for the store element 38 already transformed value a * i - 1 , j - 1 . the operations are synchronized by a clock signal h issuing from the system &# 39 ; s time base . during the scan in the opposite direction , the structuring element associated with a ij undergoes a symmetry with respect to point aij . thus , the store element of the device 41 which contained pixel a 1 , s during the direct scan now contains pixel a 2i - 1 , 2j - s . some of the most important of the various devices which each allow a specific transformation to be effected will now be described . the erode function is already known . j . serra , &# 34 ; image analysis and mathematical morphology &# 34 ;, academic press , 1982 , pp . 43 - 45 can be consulted for the definition of erosion , and the aforementioned rosenfeld article , for a definition of the erode function under the name &# 34 ; distance transformation &# 34 ;. here , it is sufficient to remember that the erode function for a binary image x , conditionally for a binary image y , is a digital function , which is designated by erode y ( x ) and which is defined perfectly by its successive thresholds . with sn being the level n threshold for the function erode y ( x ), it is defined by the recurrence relation : where θ h represents the smallest degree of erosion by a surface isotropic element . when y is not an empty set , erode y ( x ) represents the length of the shortest path going from x to x c and bypassing y , i . e ., in fig3 the path from x to z . a special case is that in which the set y is empty . in this case the geodetic distance is to the euclidian distance xz o of x ( fig3 ). fig4 and 5 show , as an exmple , in square frame and for the same complex x , the euclidian erode function ( fig4 ) and the geodetic erode function , conditionally for a y set comprising four pixels in a square arrangement ( fig5 ). before describing the implementation of the process using a device having the composition shown in fig1 and 2 , a detailed explanation of the processing procedure will be given for the specific case of a square pattern , in eight connexity and with real distances between pixels , with adaptation for another frame or to another connexity being immediate . in the most general case , the process must allow the geodetic erode of a binary complex x to be determined conditionally for a binary complex y . in a preferred ( though nonlimitative ) implementation of the process , allowing calculations to be simplified , an initialization is done consisting of encoding the initial image to create a transformed initial digital image f such that : ______________________________________f ( x ) = max if xε yf ( x ) = max - 1 if xε x ∩ y . sup . cf ( x ) = 0 if xε x . sub . c ∩ y . sup . c______________________________________ with max designating the maximum available value 2 s and y c being the complement of y . the current part of the process consists of repeating a group of two successive passes , with the first pass being in the direct video direction and the second in the inverse video direction . in the euclidian case , two successive passes are sufficient to obtain the result . in the geodetic case , on the contray , the succession must be repeated until stability , i . e ., until two additional passes no longer modify any points , which involves a test . during each pass , the configuration of the neighborhood , with a square pattern , is assumed to be as follows : the rules for the transformation of each point in this case , for direct video scanning are as follows : in the case of a hexagonal pattern , the value a * i . j ( when a i , j is not equal to max ) is different , the following can be adopted : where b , c , d , e , f , g , are arranged as follows during the direct scan : ## equ5 ## with the arrangement being inverted for the inverse video scan . it must be noted that , as compared with the rosenfeld article mentioned above , the introduction to two different distances between two adjacent points on horizontal and vertical lines on the one hand and on diagonal lines on the other hand , constitutes an important innovation , because it allows a much more faithful representation of the distances to be obtained . as such , the process can be implemented using the device shown in fig1 and 2 , with device 40 presenting to the processor 42 the following neighborhood during the direct video scan ( with e1 to e5 designaating the inputs of 42 ): ## equ6 ## and , during the inverse video scan : ## equ7 ## the composition of the processor 42 can as such be that shown in fig6 with the input e6 shown in fig2 not being assigned . the device 42 in fig6 comprises two input branches . the first branch comprises an operator 52 , comprised of a comparator controlling a multiplexer with two input lines , providing on its output the minimum of the two values applied to its input . these two inputs are those identified by e 2 and e4 in fig2 . the output f1 and the operator 52 is sent to a correspondence table 54 which transforms f1 into f &# 39 ; 1 defined by : the second branch has the same composition and executes the same operations on inputs e3 and e5 to provide a value f &# 39 ; 2 if it is only that the correspondence table of this branch transforms f2 into f &# 39 ; 2 defined by : values f &# 39 ; 1 and f &# 39 ; 2 are applied to the two inputs of an operator 56 which provides at its output the minimum g of f &# 39 ; 1 and f &# 39 ; 2 and applies it to one of the inputs of a comparator 58 and a multiplexer 64 . the second input of the comparator 58 constitutes input e1 of the rewrite device 42 . this comparator is such that it provides , on its output , a signal j equal to : the signal j is applied to one of the inputs of a or gate 60 . the other input of gate 60 is connected to the output of a comparator 62 providing a signal if the inputs are equal . the output signal h of the comparator 62 is equal to 1 if e1 = max . in the contrary case , h = 0 . consequently , it is seen that the output i of gate 60 is equal to j if h has a value of 0 , thus if e1 is not equal to max . the output signal of gate 60 is applied to the multiplexer control input 64 , whose second data input receives the signal e1 . gate 60 thus determines that of the inputs of the multiplexer 64 which is connected to its output , which constitutes output s of processor 42 connected to the write bus for writing into part b of memory 30 , in the random access memory 34 and in the register 44 . the erode function by rewrite processing according to lines having any orientation it can be advantageous to design an architecture for image analysis using commercial integrated circuits having , in the same box , a processing component and a memory component . in this case , it is interesting to break down the processing of the image into independent tasks to be effected on a parallel basis , with a processor being dedicated for each independent task . the erode function lends itself well to such a breakdown into sequential linear transformations which are sequential , i . e ., which utilize and modify only information contained in a line of predetermined orientation of the image . in this case , the processing will involve several passes , with each modifying the result of the previous pass and working in a different direction . for a given direction , the processing of each line of the image is independent of the processing of all the other lines . as such , each line can be processed by to a different processor , with all of these processors working in a parallel . another advantage of this method of operation is to allow much more isotropic structuring elements to be generated , introducing unusual directions ( such as π / 2 in a hexagonal grid ). the taking into account of these directions in conventional video scanning would be very expensive because it would require the use of very large structuring elements . it will now be demonstrated how an erode processing can be effected with line by line rewrite ; for purposes of simplification to the euclidian case in a square pattern will be considered . the initial image will be coded as follows ( with the notations being those already utilized ): thus , each of the following directions is processed one after the other : where k j represents the distance between two consecutive pixels for the exploration direction j , i . e ., for example k = 5 for directions 0 , π / 2 , π , 3π / 2 ; k = 7 for directions λ / 4 , 3π / 4 , 5π / 4 , 7π / 4 in square frame . to effect this transformation , one processor of the type represented in fig1 can be utilized for each line . this processor comprises a scanning microprocessor 114 and an accessible exploration random access image memory 116 and a pixel by pixel accessible random access image memory 116 , connected to the microprocessor by an address bus 118 . since the exploration of lines having any orientation requires a more elaborate address generator than those normally utilized , a good solution consists of utilizing a microprogrammed microprocessor 114 in slices . the processor also comprises blocks 120 and 122 of and gates , each driving a register 124 or 126 . the register 126 is connected to a read table 128 having a role which is similar to that of the tables shown in fig1 and 11 . finally , a processor 130 receives the outputs of 128 and 124 and provides the minimum of the values received . an initialization input ( not shown ) allows the max value to be introduced into registers 124 and 128 . in steady operation , the memory 116 is read along a line in the direction chosen for the processing and the values of pixels a 1 , a 2 , . . . a i , . . . a n are presented to the processor . when the memory 116 presents the value a i + 1 to the register 124 , the latter presents the value a i to the processor 130 . the output of the processor 130 i s written in image memory 116 as well as in the register 126 by the bus 132 . the output a * i 1 of the register 126 undergoes an addition as follows in table 128 : the value b 1 - 1 constitutes the second input of the processor 130 . it is seen that , as such , the aforementioned algorithm is implemented . grain reconstruction constitutes a transformation which is known in and of itself , a description of which can especially be found in the serra book cited above , pp 401 - 403 . the result sought by the invention is to effect a digital reconstruction of the grains of a digital image a based on a digital image b . to do so , the implementation of the algorithm below is repeated until stability is reached : where a &# 39 ; is substituted for a for the subsequent operation and h is the elementary hexagon ( or square ) in the pattern . the rewrite algorithm below allows the same result to be obtained with a much smaller number of passes than with the conventional algorithm . the implementation device may also be that shown in fig1 and 2 , but with a processor 42 of a different composition than that shown in fig6 . in the specific case of a square pattern in eight connexity , the processor 42 can have the constitution shown in fig7 . since the neighborhood is that already defined in ( 2 ) above , the following transformation must be made : in inverse video scanning , the neighborhood is inverted and the transformation to be made on each pixel of the digital image a is done according to the algorithm : to do so , the processor 42 must receive the following inputs in direct video scanning : ( where b designates a pixel in part b of the memory containing image b ) the presentation in inverse video scanning is deduced from the preceding by symmetry of the structuring element around a ij . the processor 42 comprises two input operators 66 , each of which is comprised of a compartor followed by a multiplexer . the first operator 66 , for example , receives inputs e2 and e3 and provides in its output a digital signal representative of the largest of the two values e2 and e3 . the second operator 66 has the same composition but receives inputs e4 and e5 . the outputs of the two operators are connected to two inputs of a second operator having the same constitution as the first , thus providing on its output a digital signal which is representative of the maximum of e2 , . . . , e5 . another operator 70 , which is identical to the preceding , comprises an input connected to the output of the operator 68 and a second input which receives e1 . consequently , the output f of the operator 70 represents the maximum of all values e1 to e5 . a last operator 72 receives the output of the operator 70 and the signal e6 , representative of b ij , regardless of the scanning direction . the output s of the latter comparator , constituted by min f ( f , e6 ) is recorded in the image memory by the write bus and is reinjected into the memories 44 and 34 to serve in the processing of the subsequent pixels . the skeletonization of a group of pixels represented by binary numbers of digital functions constitutes one of the most widely used transformations in image analysis . it allows the median axis to be determined of a group of binary coded pixels or the &# 34 ; peak lines &# 34 ; of a group of pixels which can be considered as representing a digital function . a description of skeletonization and the devices conventionally used today may be found in the work by serra cited above , on pages 373 to 401 and 450 to 456 . prior methods of skeletonization are all based on the same principle : using successive passes , contour points are removed from each particle in the image for which the skeleton is being sought , which corresponds to successive thinning operations on the particle . neighborhood criteria allow the disappearance of the particle to be avoided , with said particle being comprised of a group of pixels , or a hole , or to avoid dividing the particle or hole . the same is done for a set which can be represented by a digital function , while being certain that the same criterion is verified for all thresholds . all known methods require a number of passes which increases with the size of the largest particles to be skeletonized in the image . the process and device according to the invention , which will now be described , allow the operation to be simplified considerably : they allow the skeleton of a particle to be determined in a sequence which comprises : a skeletonization in three passes ( effected , for example , with the first being direct video scanning , the second inverse video scanning and the third direct video scanning ). now , the description will be given , first of all , of the general skeletonization sequence , then , in a detailed manner , the case of the construction of the euclidian skeleton of a group of binary pixels . the procedure can be regarded as comprising at least three stages ( a ) a relief without plateau is generated ( b ) the relief of the neighborhood of each pixel in the group to be skeletonized is possibly coded in acceptance with a predetermined coding algorithm , ( c ) the peak points are marked on the ( possibly coded ) relief and ( d ) on this same relief , the points upstream of the peak points are generated using a rewrite process such as defined above . by way of example , the general process will be described while first assuming that the pixels are distributed in a pattern which is no longer square as in the previous cases , but hexagonal . the square pattern process is done in a very similar manner . the passage from a distribution in a square mesh to a hexagonal mesh can be done by parallel transformation which produces the following neighborhoods : on an odd line : ## equ9 ## and , for a presentation which does not depend on parity , the neighborhood will be designated by ## equ10 ## this transformation can be done by using the device shown in fig8 which comprises channels operating in an alternating manner . the device shown in fig8 receives from the central memory 30 , on input e , the value of each pixel and stores it until it is no longer utilized by any structuring element . it detects these values within the local memory at each clock interval so as to prresent the processor 42 ( fig1 ) with the correct neighborhood ( a , b , c , d , e , f , g ) of the central point and regardless of the parity of the line processed . indeed , it is noted on the two neighborhoods of a ij illustrated above that , when the line i is even , neighbors a and f ( respectively b and g ) have rank j ( respectively j + 1 ) while , for an odd line , they have rank j - 1 ( respectively j ). to operate such a shift every other line , the device comprises three identical assemblies 74 - 76 , 82 - 84 , 96 - 98 . for example , the construction of the assembly 74 - 76 will be given in detail . it receives from memory 30 , the value a i + 1 , j + 2 , when a i , j is the central point of the structuring element . this input is applied simultaneously to the input of a register 74 and to one of the inputs of a multiplexer 76 . the output of the register 74 constitutes the other input of the multiplexer . the multiplexer itself is controlled by a parity signal on its input 104 . in an even line , the multiplexer presents on its output the input applied to e , or a 1 + 1 , j + 1 , while , in an odd line , it takes the content of the register 74 , or a i + 1 , j + 1 . the output of the multiplexer 76 feeds two cascade mounted registers 78 and 80 , each delaying the value of the pixel which it receives as input by one clock period . thus , on an even line , the registers 78 and 80 will present in their output the values of the pixels a i + 1 , j + 1 and a i + 1 , j and , on an odd line , the values of pixels a i + 1 , j and a i + 1 , j 1 . it is noted that the correct values of points f and g , neighbors of central point d , are clearly present , in these outputs . the assembly is to present , to the input of a random access memory 86 , the value of pixel a i + 1 , j - 1 , regardless of the parity of the line . to do so , the assembly 82 - 84 operates in opposition with the assembly 74 - 76 : when the multiplexer 76 selects the input of register 74 , the multiplexer 84 selects the output of register 82 . thus , their effects cancel each other out . the random access memory operates like a delay register , introducing a delay of n - 3 pixels . the output of the random access memory 86 , or a i , j - 2 &# 39 ;, is injected into a cascade of three registers 88 , 90 and 92 allowing each a clocked time delay of the value of the pixel which it received as input . the outputs of these three registers constitute the points neighboring e = a i , j + 1 , d = a ij , c = a i , j - 1 . the output of register 92 , or a i , j - 1 , is also connected to the input of a memory 94 which is identical to the memory 86 . the output of the random access memory 94 , i . e ., a 1 - 1 , j + 2 &# 39 ;, constitutes the input of the last of the three register - multiplexer assemblies 96 - 98 . the entire device 96 - 98 - 100 - 102 is identical to the device 74 - 76 - 78 - 80 and operates in a synchronous manner with the latter . the outputs of registers 100 and 102 thus constitute the last points in the neighborhood , b and a , which have the respective values a i - 1 , j , and a i - 1 , j - 1 , when the line being processed is odd . this device is slightly more complicated than that which is normally utilized for the local storage of parallel hexagonal transformations . however , as presented , it has the advantage of the ability to transform easily into a rewrite device , by a simple modification of connections , as shown in fig8 a . in the device in fig8 pixels g , f , d , read respectively at the output of registers 78 , 80 and 90 , are reinjected into the subsequent registers 78 , 80 and 92 . on the contrary , in the rewrite device in fig8 a , the transformed values g *, f * and d * are injected into the input of registers 80 , 82 and 92 , with said values having been calculated by the processor 42 . henceforth , it can be noted that one can pass from the device shown in fig8 to the rewrite device using a simple modification of the connections . to correctly resolve edge of field problems , the useful image will be a sub - matrix m n - 2 , n - 2 , begining at point a 22 so as to leave a complete frame around the image which the operator can figure as desired as a function of the transformation and the edge effects he wishes to produce . after having thus described the passage from the square frame to the hexagonal frame , the general sequence of the process for obtaining the skeleton will be described , before beginning a detailed amount of the specific case of various binary euclidian skeletons . the first step consists of executing a preparation of the image by generating a relief . case of a binary image : first of all , using the process described above under the heading &# 34 ; erosion function &# 34 ;, the erode function for the binary set x to be skeletonized is created conditionally for the potential binary set y ( if one is working geodetically ). this erode function allows the relief to be coded in the neighborhood of the pixel a of the set x to be transformed . this pertains solely to a local coding : the pixel a as well as all of its neighbor , having an altitude equal to that of a in the erode function , will be coded 1 . those whose altitude is above that of a are coded 2 . those whose altitude is below are coded 0 . case of a digital image : on the erode function of the digital image , each pixel belonging to the set x ∩ y c has neighboring pixels lower than itself . but this property is not true for a random function , which can present plateaus . to be able to construct the skeleton , first of all , a relief which is compatible with the relief ot the function representing the digital pixel set must be generated on these plateaus . the simplest way to achieve this result consists of constructing the flow graph of the relief . the peaks of this graph are comprised of pixels , and the arcs ( in the sense of a graph ) from a pixel a indicate the neighbors of a towards which a drop of water placed in a would flow . these arcs are assigned in the following manner : for each pixel , an arrow is created , going from this pixel towards each of its neighbors smaller than itself , the flow graph is supplemented to take into account that the pixels which have not been assigned an arrow during the first stage are those inside plateaus ; this is done by repeating , until stability is reached , the operation of creating arrow from a towards any neighboring pixel b for which b is already the origin of an arrow , while a is not . when the arrow generation operation is completed , the relief for the neighborhood of each pixel has been coded , as in the binary case . the central pixel and all of its neighbors which are not connected by an arc to the central pixel are coded 1 . those of the neighboring components towards which an arrow exists stemming from the central pixel are coded 0 . those of the neighboring components from which an arrow departs towards the central pixel are coded 2 . once the coding of the relief is executed for the neighborhood of each pixel , the skeletonization properly speaking will be executed in two stages on the relief generated in the image , first the marking of the peak points , then the marking of the points upstream of the peak points in the erode function or the flow graph ( the upstream point also belongs to the skeleton ). according to a modified embodiment , the relief is generated without plateaus during step ( a ) by the construction of an equivalent digital function on the flow graph in at least one couple of two passes : ( a1 ) the following transformation is done by direct video scanning on each pixel d of the initial relief b : in which the arrangement of points a , b , c , d is that given during the presentation of the general procedure , as described previously , b is an auxiliary image initialized at the maximum objectal value available for the pixels , for x = a , b or c , with pixel x being considered as having an altitude higher than pixel y if : for this operation , a binary memory is used , initially containing 1 &# 39 ; s , zeroing all of the pixels belonging to a peak line of the image are zeroed in a single pass through the image . ( b1 ) pixel x and its neighbors having an altitude above x are coded 2 , pixels neighboring pixel x having an altitude below x are coded 0 , pixels neighboring pixel x having an altitude equal to x take all possible combinations of value 0 and 2 so as to obtain a family ( vi ) or neighborhoods , during step c , a pixel x is considered as a peak point if there exits a neighborhood vj belonging to the family ( vi ) of x for which one of the following conditions is fulfilled : ( i ) all of the components neighboring the central pixel have the value of 0 and the zoning of the central pixel would eliminate a particle comprised of 2 , ( ii ) the zeroing of the central pixel creates a bridge between two particles consisting of 0 , which had no mutual connection in the x neighborhood ; ( iii ) the zeroing of the central pixel eliminates the only connection existing between two particles consisting of 2 which have no other connection in the x neighborhood . this signifies that a pixel a will be considered as a peak point if it enters into one of the following categories in the case of a hexagonal frame : ( i ) a has at least four neighbors equal to 0 in the coding of the relief of its neighborhood , ( ii ) a has three neighbors equal to 0 , but its neighborhood cannot be superimposed , directly to by rotation , over the configuration : ## equ12 ## with a period (.) designating either a &# 34 ; one &# 34 ; or a &# 34 ; two &# 34 ;. ( iii ) a has two neighbors equal to 0 , but its neighborhood cannot be superimposed , directly or by rotation , over the configuration : ## equ13 ## ( iv ) a has one neighbor equal to 0 , but its neighborhood cannot be superimposed , directly or by rotation , over the configuration : ## equ14 ## in the binary euclidian case , the configurations of the peak points are equivalent to the following ## equ15 ## which are shorter and , in certain cases , more advantageous . in the case of eight ( pattern ) and eight ( background ) connexity , all pixels which do not verify any of the configurations will be considered as peak points : ## equ16 ## ( in which the pixels marked . have a value of 1 or 2 ), or any of the configurations which are deduced therefrom by rotation or symmetry . to the peak points above can be added the ends of the barbules . in the case , for example , of a square matrix , the configurations of peak points detected can be implemented with the ends of the barbules , i . e ., the pixels which verify , in any angular position , at least one of the configurations : ## equ17 ## the means to determine sections of the skeleton in square frame are directly derived from the above . when the matrix is square and the neighborhood is in 4 connexity 4 for the pattern and in 4 connexity for the background , the neighborhood of each pixel is coded during step ( b ) in the following manner : the central pixel and its neighbors having the same altitude are coded 1 ; the pixels having lower altitude are coded 0 . during step ( c ) all pixels which do not verify any of the following configurations are detected as peak points : ## equ18 ## ( where the . signs indicate that the value of the pixel is 1 or 2 ) or any of the configurations which are deduced therefrom by rotation or symmetry . in the case of eight connexity for the pattern and four for the background , all pixels which do not verify any of the following configurations are detected as peak points : ## equ19 ## ( where the . sign indicates that the value of the pixel is indifferent ) or any of the configurations which ensue therefrom by rotation . in all cases , for each of the peak pixels , the corresponding position in memory is zeroed . thus , a sketch of the skeleton is obtained , which will generally occur in several fragments . the entire upstream part of these fragments in the erode function or in the flow graph also belongs to the skeleton . this &# 34 ; upstream part &# 34 ; is defined in practice according to the same principles in all cases ( euclidian binary , geodetic binary or digital ). in a hexagonal frame , the twelve pixels closest to the pixel considered on which the determination of the relief is to be based are considered ( with this pixel being a peak point of departure or a point which is &# 34 ; upstream &# 34 ; during a subsequent back generation ). for each of the vectors av i the slope is computed by dividing the difference in relief between v i and a by the distance a v i . as was seen earlier during the examination of the hexagonal matrix , the distance v i has the following value : 1 for the immediate neighbors v 1 , v 3 , v 5 , v 7 , v 9 , v 11 ; √ 3 for the other neighbors v 2 , v 4 , v 6 , v 8 , v 10 , v 12 ; in order to have whole values in the 1 /√ 3 ratio , distances 4 and 7 will generally be adopted respectively . deduced from the flow graph for the digital functions ( grey level pixels ). any pixel v i having an altitude above that of the pixel x and such that the slope of the vector x vi is greater than the slopes of x vi + 1 and x vi - 1 belongs to the &# 34 ; upstream &# 34 ; part of x . the application of this rule in the binary euclidian case ensures that the skeleton obtained is connected . the same does not necessarily apply in the case of a more general relief , and it is necessary to complete the skeleton during a last pass : if v i is the upper part of the pixel x without belonging to the hexagon h x having the size 1 centered on x , then x and v i have two common neighbors y and z belonging to h x which has the following configuration : ## equ21 ## if neither y nor z belong to the skeleton , then that of the two points y and z having the highest altitude ( both if they are equal in altitude ) also belong to the skeleton . thus , based on peak points giving a sketch of the skeleton , the upper part can be constructed in three passes using a rewrite process which can implement the device shown in fig8 taking into account a neighborhood of twelve points . specific case of the generating of the skeleton of a set of binary pixels , in the euclidian case ( y set empty ). fig9 a shows , as an example , a binary set which can be considered as typical , with the circles indicating the pixels having one of the levels ( that corresponding to the pattern ), with the points indicating the pixels having the other level ( that corresponding to the background ). the local structure of the relief can then be represented by a four - state relief function , obtained from the erode function ( shown in fig9 b ): in the above formula [ n , modulo 3 ] signifies the congruence of n modulo 3 , where n is the whole number equal to erode ( a ). it is important to note that , to be put generally , the skeleton can also be detected on the erode function ; on the flow graph ; or on the relief function . of the three representations , the relief function has the poorest information , and this information is , however , sufficient to construct the skeleton in binary euclidian conditions . for the other cases in the figure , geodesic or digital , recourse must be made to the flow graph or the erode function . the circuit for the detection of peak points of the skeleton can be as shown in fig1 . this circuit comprises two correspondence or transcoding tables 110 and 111 , each having eight inputs and six outputs . each of these tables can be constituted by a 256 byte rom . tables 110 and 111 are intended to recode the local relief around a central point a in the following manner : the central point and those of the neighboring points v which have a value equal to the central point are coded 1 ; the points having an altitude greater than the central pixel are coded 2 , the points having an altitude lower than the central pixel are coded 0 . it is thus necessary to code each pixel on two bits , with the lsb being identified by index 2 and the msb by index 1 . a third bit , marked with index 3 , will indicate if the pixel considered belongs to the skeleton ( if yes , bit 3 will have the value 0 ) or does not belong ( and then bit 3 will have a value 1 ). the correspondence between the new values v and the old values v ( bits v i and v 2 ) is thus given by the following table ( with a being the central point , v a neighbor of a ): ______________________________________initial values final ( msb ) ( lsb ) valuev a v . sub . 1 v . sub . 2 a . sub . 1 a . sub . 2 v . sub . 1 v . sub . 2 v______________________________________0 1 0 0 0 1 0 0 03 1 1 1 0 1 0 0 01 1 0 1 0 1 0 1 12 1 1 0 0 1 1 0 21 2 0 1 1 0 0 0 02 2 1 0 1 0 0 1 13 2 1 1 1 0 1 0 22 3 1 0 1 1 0 0 03 3 1 1 1 1 0 1 11 3 0 1 1 1 1 0 2______________________________________ the circuit in fig1 comprises a logical processing component 112 which receives the outputs of the two tables 110 and 111 , representing the new value , coded on two bits , of each of the pixels neighboring the central point of the relief . the component 112 can be constituted of a programmable logic array ( pal 18l 4 port network , for example ), each column of which provides a complemented input . in this programmable logic array , twenty and gates having forty inputs are available . these forty inputs are the inputs ( or the complemented inputs ) of the programmable logic array . each of these and gates is capable of generating a structuring element . for example , the following neighborhood can be implemented on a neighborhood line : ## equ22 ## t1 = a . sub . 1 ∩ a . sub . 2 ∩ b . sub . 1 ∩ b . sub . 2 ∩ e . sub . 1 ∩ e . sub . 2 ∩ g . sub . 1 ∩ g . sub . 2 ∩ f . sub . 1 ∩ f . sub . 2 ∩ c . sub . 1 ∩ c . sub . 2 in this formula , a , b , c , e , f and g designate the six points neighboring the central point , from left to right and top to bottom , with a 1 and a 2 being the msb and lsb bits , respectively . five other and gates can be utilized to implement the structuring elements derived from the preceding by successive 60 degree rotations . in the last step of the programmable logic network , one obtains the value s1 =( t1 u . . . t6 ) present on output no . 17 . the six structuring elements r having the following form can also be made : ## equ23 ## ensuing from one another by 60 degree rotation . the value s 2 = r 1 ur 2 ur 3 ur 4 will be present in output no . 18 and s 3 = r 5 ur 6 will be present on output no . 19 ; the same applies for the structuring elements p having the shape : ## equ24 ## the value s =( p 1 up 2 u . . . p 6 ) will then be present on output no . 20 . finally , the structing elements may be assembled by a nand gate 114 operating receiving outputs nos . 17 , 18 , 19 , 20 . the resulting signal s can be recorded in central memory and constitutes the third bit of the central point , equal to 0 if the pixel a is a peak point , 1 in the contrary case . return in the upstream direction . upon completion of the preceding operation , there are only three sections of the skeleton present . to connect these sections and form the complete skeleton , it is necessary to return in the upward direction . this operation is done in three passes : the first in the direct video direction for directions - π / 6 , - π / 3 , - π / 2 , - 2π3 , - 5π / 6 the second in the inverse video direction for directions π / 6 , π / 3 , π / 2 , - 2π / 3 , - 5π / 6 , π only the first operation executed in direct video scanning will be described here , since the two others are deduced directly therefrom . it suffices , for a neighborhood of size 1 and for each pixel a , to simultaneously have two relief bits a 1 and a 2 as well as bit a 3 indicating if a is a peak pixel or belongs to the upper part of a peak pixel . to do so , bits 1 and 2 can be delayed in a parallel processing device such as that illustrated in fig8 . in the neighborhood ## equ25 ## the return in the upstream direction : in direction - π / 6 , can occur from c to g , and all information on the local relief is found inside the size 1 neighborhood . the return in the upward direction in directions - π 6 , - π / 2 , - 5π / 6 is done with the same rules . for example , the ascent in the direction - 5π / 6 is done from e to f when : e is an element of the skeleton , thus e3 has a value of 0 , ## equ26 ## then , bit f3 is given a value of 0 , otherwise , its value is retained . this can be expressed by : possibly after a rotation , the ascent in directions - π / 3 , - 2π / 3 is done with the same rules . for example , the ascent from a to d occurs when : a is an element of the skeleton , thus bit a3 has a value of 0 , ## equ27 ## then , bit d3 is assigned a value of 0 , otherwise its value is retained . this is expressed by the function the overall group of logical functions expressing the return in the upstream direction in different directions can be implemented for example , by using a unit of the type already illustrated in fig1 , but associated with the devices shown in fig8 and 8a . such an arrangement is shown diagrammatically in fig1 . it is possible ( and advantageous in certain cases ) to return in the upstream direction only one direction at a time , and to repeat the return in the upstream direction for each of the four , six , eight or twelve directions of the matrix . finally , the skeleton can be completed in all points where a point of the skeleton and its upper point are not connected by a path of contiguous points of the skeleton by adding the contiguous points which constitute such a path having a minimum length . | 6 |
broadly stated , the present invention comprises a method and software module that efficiently and simultaneously receives disparate information and transforms the disparate information into usable graphical displays . the graphical displays convey information that is used to position the ea relative to a threat emitter system . a typical threat emitter system is composed of an antenna , a transmitter , a receiver , a mechanism to position the antenna , electronics to process information received and a user interface . key to the success of any radar jamming technique is exceeding the signal to noise ratio threshold that is an inherent characteristic of the threat emitter system . when the noise signal generated by the ea exceeds the signal return of the pe you have defeated the threat emitter system . likewise , if the ea generates a stronger yet similar signal to the actual return signal of the pe while shifting a pe parameter , such as range or speed , the threat emitter system will be deceived , masking the true position of the pe . generating a jamming signal to mask the true position , speed or course of the pe degrades acquisition and tracking performance in the threat emitter system . generally , threat radar coverage is viewed as the instantaneous threat radar volume swept vertically and horizontally over time through azimuth and elevation limits defined by the threat radar antenna mount . multiple three - dimensional concentric ellipsoids extend from the transmitting antenna and compose the threat radar volume . the threat radar volume is composed of a main - lobe ellipsoid , numerous side - lobe ellipsoids and numerous back - lobe ellipsoids . the main - lobe ellipsoid extends much farther than any side - lobe ellipsoid or back - lobe ellipsoid . the main - lobe ellipsoid is the primary beam that is swept across a target to generate a return signal strong enough to be detected by a threat receiver . one critical factor in successful radar jamming is placing the jamming signal emitted by the ea in a position to enter the threat receiver via the threat antenna while the threat antenna is slewed in the direction of the pe . in addition to the geometric relationship ( bearing relationship ) of the ea and the pe to the threat emitter system other factors also determine the effectiveness of the threat emitter system . the other factors are the jamming technique and the jamming tactic employed by the ea . two representative jamming techniques are preemptive assignment ( pa ) and reactive assignment ( ra ). the pa technique is invoked when the threat emitter characteristics and threat emitter location are known before the mission is undertaken . the ra technique is employed when an unexpected threat emitter or threat emitter wave form are encountered during a mission requiring the ea to adapt to the threat . generally , the pa technique results in jam acceptability region ( jar ) contours that are smaller in area and shorter in range relative to the jar contours associated with the ra technique . a jar is defined as the family of positions an ea may occupy and still provide effective jamming to protect the pe . the difference in area and range , pa relative to ra , is attributed to the relationship of bandwidth to power . when an ea jams the entire known pa bandwidth for a planned threat emitter lower ea jam power is applied to any specific threat emitter frequency . when the ea detects a threat emitter the ra jamming power may be narrowed into a band focused on the frequency of interest resulting in a jar that has a larger area and a longer range , relative to the pa jar . three representative jamming tactics are associated with three jar contours , irrespective of activating either a pa or an ra technique . referring to fig1 , two dimensional depictions of the three dimensional jar contours are out of alignment ( o ) 110 , in side - lobe alignment ( s ) 115 and in main - lobe alignment ( i ) 120 . the out of alignment tactic 110 means the jamming asset can be geographically located anywhere within a hemispherical region centered at the threat emitter and will remain effective in protecting the pe . this is by - far the simplest tactic . the center of jar 110 represents the location of threat emitter system 160 . a disadvantage of the out of alignment tactic is that the ea must be close in range 125 to the threat antenna in order to impart adequate energy to exceed the threat receiver signal to noise ratio , regardless of the direction of arrival of the ea jamming signal . to overcome this range vulnerability the s or i tactic is used . using either the s or i tactic necessitates maintaining a stringent geometric relationship between the ea and the pe to the threat emitter system . the s tactic results in a conically shaped jar directly related to the side lobe radiation pattern of the threat emitter antenna . the ea is effective anywhere within jar 115 provided the ea does not exceed the as range 135 . successful jamming of the threat emitter system using the s tactic requires the ea to be within the side - lobe volume of the threat emitter while the main lobe of the threat emitter volume encompasses the pe . while the s tactic increases the standoff range for the ea , relative to the o tactic , the ea is effective only while maintaining the geometric relationship to the pe and to the threat emitter . the i tactic results in a conically shaped jar directly related to the main lobe radiation pattern of the threat emitter antenna . a two dimensional depiction of the conically shaped jar contour is depicted in fig1 item 120 . the ea is effective anywhere within jar 120 provided the ea does not exceed i range 145 . the i tactic provides an improved ea stand off range from the threat antenna but requires that a stringent geometric relationship be maintained between the ea and pe to the threat antenna . the i tactic requires that the ea and pe are in alignment while the threat antenna main - lobe volume encompasses the pe , hence the narrowness of jar 120 . each of the techniques and tactics are combined in all permutations to produce a set of jamming approaches to degrade the performance of the threat emitter system . the jamming approaches are : preemptive assignment — out of alignment ( pao ), preemptive assignment — in side - lobe alignment ( pas ), preemptive assignment — in main - lobe alignment ( pai ), reactive assignment — out of alignment ( rao ), reactive assignment — in side - lobe alignment ( ras ), and reactive assignment — in main - lobe alignment ( rai ). a given ea jamming approach has a determinable impact upon the threat emitter radar coverage . the jar represents a volume of space in which the ea may position itself to provide effective jamming to mask the pe or deceive the threat emitter system regarding the true course and speed of the pe . generating the jar , assessing jamming effectiveness , determining optimum positioning of the ea and conveying this information to the ea aircrew are objectives of this invention . referring to fig2 , jar volumes for pao - jar 250 , pas - jar 230 and pai - jar 215 are represented as two dimensional jar areas . a jar defines an area in which an ea may position itself for a given jamming approach and provide protective jamming to the pe . as pe 205 progresses along its flight path 210 , pai - jar 215 and pas - jar 230 will remain centered on pe 205 . the ea 240 must maintain its position within pai - jar 215 and move along with pai - jar 215 while jamming threat emitter system 160 using the pai jamming approach . positioning ea 240 in the corner of pai - jar 215 places ea 240 farthest from threat emitter system 160 , optimum for ea safety while providing protective jamming . as another example , ea 260 is the sole ea and is positioned outside of jar contours 250 , 230 and 215 . ea 260 would be ineffective in jamming threat emitter 160 regardless of the jamming approach employed resulting in threat emitter system 160 detecting and tracking pe 205 . pe 205 is now vulnerable to attack . optionally , placing the ea 240 within pas - jar 230 would enable the pas jamming approach that would provide adequate protection for pe 205 . it should be noted that the pas jamming approach would place the ea 240 closer to the threat emitter 160 . optionally , placing the ea 240 within pao - jar 250 would enable the pao jamming approach that would provide adequate protection for pe 205 . it should be noted that the pao jamming approach would place the ea 240 even closer to the threat emitter 160 . fig4 is a flowchart describing the software processing steps necessary to generate jam assessment displays . after program initialization is complete program execution begins , item 405 . own aircraft navigational parameters for the pe and the ea are read into memory buffers where the information is used to initialize navigational parameters . the navigational parameters are provided by a designated suite of aircraft equipment specialized to provide latitude , longitude , aircraft attitude , speed and course . an electronic order of battle ( eob ) is a an electronic library of information functioning as a database of information related to the characteristics and locations for threat emitter systems likely to be encountered on a given mission , the expected flight path of the pe and the jamming capabilities of the ea . the eob is generated during the planning phase of a mission and is derived from sources of intelligence specific to the theater of operation . the eob is downloaded into computer memory residing in the existing suite of aircraft equipment and is made available to the jam assessment software program via designated aircraft interfaces and computers . both the navigational information and the eob information are used in processing step 410 to determine the pe and ea bearing to the threat emitter and to determine whether the pe lies within the range of the threat emitter system . processing step 410 is performed with the assumption that the threat emitter is functioning according to the eob data and the ea is not radiating a jamming signal . relying on the bearing relationships between the ea and pe to the threat emitter and the maximum range of the threat emitter , the software performs a check 415 to determine if the pe is within the maximum range of the threat emitter . if the pe is not within the range of the threat emitter a no jam required flag is set 420 , the displays are cleared of stale information in step 465 , then step 475 determines program end 480 or directs program control to step 410 for a subsequent iteration . if the pe is within range of the threat emitter , step 425 determines the alignment of the ea , pe and threat emitter . if the result of alignment check 425 is that the ea , pe and threat emitter are in alignment then a flag is set 430 to “ i ”. if alignment check 425 returns an out of alignment result then a side lobe check is made at step 435 . if the side lobe check 435 result is positive for the pe being within the side lobe then the alignment flag is set to “ s ” 445 . if the side lobe check 435 is negative the assumption is the ea , pe and threat emitter are out of alignment and the alignment flag is set to “ o ” 440 . the software must now determine whether to invoke ra processing or pa processing . the software then checks for activation of ra 450 , a check to determine whether the ea has detected a threat emitter waveform . if the result of ra 450 check is positive , the threat emitter is not in the eob , then ra processing 455 is called . refer to fig5 for a high level flowchart describing ra processing or the detailed description below . if the result of ra 450 check is negative , the threat emitter is in the eob , then pa processing 460 is called . refer to fig6 for a high level flowchart of describing pa processing or the detailed description below . both ra and pa processing routines return to the same software control point in fig4 , a call to draw the displays 470 . the displays convey information related to overall ea jamming effectiveness and relative location of the pe and ea to the threat emitter . step 475 then determines program end 480 or directs program control to step 410 for a subsequent iteration . referring to fig4 several flags ( steps 440 , 445 and 430 ) correspond to the alignment of the pe and the threat emitter . these flags are common to ra 455 and to pa 460 processing routines and must be set prior to calling either ra or pa processing routines . referring to fig5 , when ra processing is invoked in step 455 ( fig4 ) program flow is routed to step 505 ( fig5 ) and ra processing 505 begins . ra processing determines rai range 510 by running the jammer and tactics optimization ( jato ) power equation 1 - 1 with the variables and constants set for the rai jamming approach . ras range 515 is determined by running jato power equation 1 - 1 with the variables and constants set for the ras jamming approach . rao range 520 is then determined by running jato power equation 1 - 1 with the variables and constants set for the rao jamming approach . the variable definitions and constants used in equation 1 - 1 are based on the critical threat attribute parameters residing in the eob , real time own aircraft navigational information from the pe and ea aircraft and the characteristics of the specific ra jamming approach . the limits of threat emitter coverage , in the presence of jamming , obtained from the jato power equation yield a jar contour . the constants and variable definitions for the jato power equation 1 - 1 are provided below . r max = { p r · g rt 2 · σ · λ 2 · g m · g i ( 4 π ) 3 · ( s / n ) min · l rx · l tx · l rp · b r · [ k · t · n f + ( λ 4 π ) 2 ∑ i = 1 n ( p j · g jr · g rj r j 2 · b j · δ m l p · l j · l rx ) ] } 1 4 jato equation 1 - 1 the accuracy of r max is dependent upon the accuracy of the critical threat attribute parameters drawn from the eob , the positional information of the threat emitter system , the positional information of the ea and the ea jamming approach parameters . equation 1 - 1 is a variation of the well known radar range equation . equation 1 - 1 is invoked for each jamming approach , for each threat emitter , and for changing pe and ea positions . fig5 further describes the steps necessary to assemble a jas representing the ra - jar information . the in alignment flag ( i ) is checked at step 525 ( fig5 ). if the i flag is set then a check 530 is made to determine whether the pe is within the rai range of the threat emitter . if the pe is within range of the threat emitter the jam flag is set to rai alarm 545 , the jas color is set to red 550 and the ra routine is exited 598 . if the pe is not within the range of the threat emitter then the jam flag is set to rai 540 and the jas color is set to green 555 and the ra routine is exited 598 . if the i flag was not set then the side lobe ( s ) alignment flag is checked 535 . if the s flag is set then a check 565 is made to determine whether the pe is within the ras range of the threat emitter . if the pe is within range of the threat emitter the jam flag is set to ras alarm 585 , the jas color is set to red 590 and the ra routine is exited 598 . if the pe is not within the range of the threat emitter then the jam flag is set to ras 580 and the jas color is set to green 595 and the ra routine is exited 598 . if the s flag was not set then the alignment must be out of alignment ( o ). a check 560 is made to determine whether the pe is within the rao range of the threat emitter . if the pe is within range of the threat emitter the jam flag is set to rao alarm 575 , the jas color is set to red 576 and the ra routine is exited 598 . if the pe is not within the range of the threat emitter then the jam flag is set to rao 570 and the jas color is set to green 571 and the ra routine is exited 598 . fig6 describes the steps necessary to assemble a jas representing the pa - jar information . after calculating the pai range 610 , the pas range 615 and the pao range 620 the in alignment flag ( i ) is checked at step 625 . if the i flag is set then a check 630 is made to determine whether the pe is within the pai range of the threat emitter . if the pe is within range of the threat emitter the jam flag is set to pai alarm 645 , the jas color is set to red 650 and the pa routine is exited 698 . if the pe is not within the range of the threat emitter then the jam flag is set to pai 640 , the jas color is set to green 655 and the ra routine is exited 698 . if the i flag was not set then the side lobe ( s ) alignment flag is checked 635 . if the s flag is set then a check 665 is made to determine whether the pe is within the pas range of the threat emitter . if the pe is within range of the threat emitter the jam flag is set to pas alarm 685 , the jas color is set to red 690 and the pa routine is exited 698 . if the pe is not within the range of the threat emitter then the jam flag is set to pas 680 and the jas color is set to green 695 and the pa routine is exited 698 . if the s flag was not set then the alignment must be out of alignment ( o ). a check 660 is made to determine whether the pe is within the pao range of the threat emitter . if the pe is within range of the threat emitter the jam flag is set to pao alarm 675 , the jas color is set to red 676 and the pa routine is exited 698 . if the pe is not within the range of the threat emitter then the jam flag is set to pao 670 and the jas color is set to green 671 and the pa routine is exited 698 . referring to fig4 , ra 455 and pa 460 processing routines return control to the draw display routine 470 providing the information necessary to draw the jar and the jas . the information to draw the jar and jas is in a format suitable for further processing by the designated aircraft display processor . once the boundaries of the jar contours and jamming effectiveness are determined any number of user defined displays may be used to present the information to the ea aircrew . typical displays are jars with pe and ea positions plotted with respect to their last known or extrapolated position and a color coded jam assessment strobe ( jas ) indicating jamming effectiveness . the length of the jas represents the maximum effective range for a threat emitter experiencing ea jamming . each jamming approach ( rao , rai , ras , pao , pas , pai ) affects the maximum detection range of the emitter adversely . color coding the jar contours and jas is a user preference and is limited by the display processor and the properties of the display hardware residing in the ea aircraft . in the event multiple threat emitters have overlapping coverage the overlap volume can be determined . refer to fig3 for a two dimensional representation of the jar overlap volume for two threat emitters . threat emitter 160 is associated with jar 315 while threat emitter 340 is associated with jar 320 . each point within every jar has a three dimensional coordinate corresponding to latitude , longitude and altitude . using eob data for azimuth and elevation scan limits , the maximum effective range of emitter coverage , positional information describing the latitude , longitude and altitude for a given threat emitter , allows points in common between multiple jars to be compared . the comparison of jar points results in common points between the jars to be identified and used to define an overlap in threat emitter coverage areas . plotting ea flight path 210 through the threat emitter coverage allows assessment of the ea position with respect to jamming effectiveness . this method of determining the jar overlap area can be expanded to include any number of threat emitters having overlapping coverage and is only limited by the processing throughput of the interfaces and computers in the ea aircraft . referring to fig7 , segment 710 represents the current effective ( jammed ) range , and segment 720 represents the un - jammed range of the threat emitter . the jas orientation represents the geometric relationship between the pe and the threat emitter . referring to fig8 , jas 810 has a length that passes through pe 205 indicating that pe 205 is within the detection range of the threat emitter . jas 810 would be color coded to indicate that pe 205 is not vulnerable to attack because jamming is effective . fig8 represents the scenario in which the ea is effective despite the pe position within the pai range of the threat emitter . in the event that pe 205 drifts into line segment 820 which results in jamming not being effective , the ea aircrew is prompted to either : maneuver to address the threat , use other tactical options such as change jam techniques , deploy a kinetic weapon , or advise the pe to maneuver further away from the threat . referring to fig9 , jas segment 910 has a length that is short of pe 205 indicating that pe 205 is not within the detection range of the threat emitter . jas 910 would be color coded to indicate that pe 205 is not vulnerable to attack . another embodiment of this invention generates a display format as depicted in fig1 . jas 1010 and jas 1020 represents jamming employed by ea 1030 which is positioned in the jar overlap area of the two threat emitters . in this configuration jas 1010 and jas 1020 would be color coded green indicating that pe 205 is not vulnerable to detection by either threat emitter . fig1 depicts another display embodiment combining the jar and jas information with the relative positions of ea 1130 and pe 1140 . the explanation for fig1 is applicable to either the pa or ra jamming technique . assume ea 1030 is positioned within the in alignment jar 1120 employing the pai jamming approach . jas 1125 calculated for the pai jamming approach falls short of pe 1140 and would be colored green indicating that pe 1140 is not vulnerable to attack . at a glance the aircrew can determine that pe 1140 is safe from detection by threat emitter 1150 and that ea 1130 could maneuver anywhere within jar 1120 while employing pai jamming and remain effective in protecting pe 1140 . equally important , is the situational awareness that shifting to the pas jamming approach and maneuvering ea 1130 into jar 1115 would provide adequate protection for pe 1140 . equally important is the situational awareness that shifting to pao jamming and maneuvering into jar 1110 would also provide protection for pe 1140 . fig1 provides critical information to the ea aircrew in a format that is easy to understand , is used to ascertain jamming effectiveness and improves the ability to adapt to changing conditions . the capability to assess jam effectiveness as described in the preferred embodiment fills a need unmet by the current aircraft displays . providing information to the ea aircrew related to detected threat emitters not currently assigned a jamming approach is critical to overall situational awareness . fig1 represents the scenario in which threat emitter 1250 has been defined by the ea 1230 and an assessment of pe 1220 vulnerability has been made along flight path 1240 . at this point threat emitter 1250 has not been assigned a jamming approach , as indicated by the dashed segment 1260 . at a glance , ea 1230 is able to determine that threat emitter 1250 is a threat that requires ea 1230 jamming or that flight path 1240 needs to be altered to avoid detection . the aircrew controls the display format posted by the aircraft display processor via designated aircraft interfaces . depending on the need , the aircrew display options include the jar contours , the jas or a combined jar jas display format . the software algorithm and method described above is suitable for implementation upon any number of electronic warfare systems and architectures . it is not necessary to limit the implementation of the preferred embodiment to currently existing aircraft computers , aircraft interfaces or electronic warfare capabilities . | 6 |
turning now to the drawings and specifically to fig1 shown is an exploded view of an example of a disc drive 100 in which the present invention is particularly useful . the disc drive 100 includes a deck 110 to which all other components are directly or indirectly mounted and a top cover 120 which , together with the deck 110 , forms a disc drive housing which encloses delicate internal components and isolates these components from external contaminants . the disc drive 100 includes a plurality of discs 200 which are mounted for rotation on a spindle motor ( not shown ). the discs 200 include on their surfaces a plurality of circular , concentric data tracks 210 on which data are recorded via an array of vertically aligned head assemblies ( one of which is shown at 310 ). the head assemblies 310 are supported by flexures 320 , which are attached to arm portions of actuator 300 . the actuator 300 is mounted to a bearing assembly 400 which includes a stationary pivot shaft 410 about which the actuator 300 rotates . power to drive the actuator 300 about the pivot shaft 410 is provided by a voice coil motor ( vcm ). the vcm consists of a coil 330 which is supported by the actuator 300 within the magnetic field of a permanent magnet assembly having spaced upper and lower magnets 340 . the magnets 340 are mounted to spaced pole pieces 350 which are fixed to the deck 110 and are further spaced from one another by spacers 360 . electronic circuitry is provided on a printed circuit board ( pcb , not shown ) mounted to the underside of the deck 110 . control signals to drive the vcm are carried between the pcb and the moving actuator 300 via a flexible printed circuit cable ( pcc ) 380 , which also transmits data signals to and from the heads 310 . [ 0026 ] fig2 shows a partially exploded , perspective view of an actuator 300 incorporating the bearing assembly of the present invention . the actuator 300 has a bore 370 formed therethrough which receivingly engages a bearing assembly . the bearing assembly is shown to include a bearing cartridge 400 and a tolerance ring 450 compressingly interposed between the bearing cartridge 400 and the bore 370 to retain the bearing cartridge 400 within the bore 370 . the cartridge 400 and the tolerance ring 450 are installed by first placing the tolerance ring 450 around the cartridge 400 , and then axially inserting the cartridge - ring assembly into the actuator bore 300 . [ 0027 ] fig3 shows a cross - sectional view of the actuator 300 with the bearing cartridge 400 and the tolerance ring 450 installed in actuator bore 370 . the cartridge 400 has a stationary pivot shaft 410 which has a threaded projection 415 at its lower end for secure mounting to the floor of deck 110 . the cartridge 400 also includes an outer sleeve 420 separated at upper and lower ends thereof by a pair of ball bearings 430 . the stationary shaft 410 may also include an upper threaded opening 440 to receive a fastener ( not shown ) for attachment of the stationary shaft 410 to the top cover 120 . it will be readily understood that the shaft 410 could be attached to the deck 110 and cover 120 by other means than those disclosed here without departing from the spirit of the present invention . in this manner it will be understood that the stationary shaft 410 is rigidly supported and the sleeve 420 is free to rotate about the stationary shaft 410 . the sleeve 420 of the bearing cartridge 400 forms an upper shoulder , a lower shoulder , and a groove of a reduced diameter between the shoulders . the tolerance ring 450 is seated in the groove before the bearing cartridge 400 is placed into the bore 370 . it should be understood that the width of ring 450 is actually shorter then the width of the groove for ease of assembly . as can be seen in fig2 the tolerance ring 450 is typically a split ring member which forms a cylindrical inner surface 460 and a cylindrical outer surface 470 , with a plurality of projecting corrugations 480 forming a corrugated surface on the outer surface 470 . such tolerance rings are well - known , for a variety of purposes , and examples of such rings are those manufactured by usa tolerance ring . it will be understood from fig4 that the tolerance ring 450 is sandwiched between the groove of the sleeve 420 and the surface of the bore 370 of the actuator 300 . the sleeve 420 and tolerance ring 450 combine to provide an effective outer diameter that is greater than the diameter of bore 370 . as such , the sleeve 420 and tolerance ring 450 combination can be press fit into the bore 370 . the press - fit compresses the corrugations 480 as shown in fig4 where the broken lines denote the shape of the corrugations 480 before insertion into the bore 370 . the compression imparted to the corrugations 480 of the tolerance ring 450 creates sufficient frictional resistance to retain the tolerance ring 450 within the bore 370 , preventing displacement of the tolerance ring 450 relative to the actuator in both the axial and radial directions . the frictional resistance between the tolerance ring 450 and the actuator bore 370 is greater than that between the ring 450 and cartridge sleeve 420 . this is primarily because the corrugations 480 of the ring 450 , which are made of steel , actually “ bite ” into the softer aluminum from which the actuator bore 370 is formed . the bearing cartridge sleeve 420 , however , is made of steel , and much less frictional resistance is created between the machined surface of the sleeve 420 and the inner surface 460 of the tolerance ring 450 . it follows that even when the tolerance ring 450 is securely axially located within the bore 370 , slippage may occur nonetheless between the cartridge 400 and the tolerance ring 450 if measures are not taken to prevent it . it is for this reason that frictional elements are provided on the outer surface of the cartridge sleeve 420 . one embodiment of the present invention is illustrated in fig2 and 5 , in which circumferential horizontal grooves 422 are provided in the outer surface of the cartridge sleeve 420 . machining these grooves 422 creates edges and recesses which effectively “ bite ” into the inner surface 460 of the tolerance ring 450 , reducing the likelihood of slippage therebetween without unnecessarily increasing the frictional resistance between the ring 450 and the actuator bore 370 . because the outer surface of the cartridge sleeve 420 is typically turned to precise specifications anyway , the grooves 422 can machined at the same time . this is advantageous in that manufacturing costs are not significantly increased by providing grooves 422 in the sleeve 420 . grooves 422 are also easily inspected to ensure they are in conformance with tolerances and specifications . the horizontal orientation of the grooves 422 is particularly effective in preventing axial slippage between the cartridge 400 and sleeve 450 . [ 0032 ] fig6 shows another embodiment of the invention in which the outer surface of the sleeve 420 is knurled 424 . again , knurling 424 provides a large number of edges and recesses which allow the sleeve 420 to “ bite ” into the inner surface 460 of the tolerance ring 450 . knurling 424 has the added advantage of effectively preventing rotational slippage in addition to axial slippage . while rotational slippage is far less likely than axial slippage , given that cartridge sleeve 420 is free to rotate about pivot shaft 410 , it is conceivable that in some applications a severe rotational shock event might cause rotational slippage in the absence of frictional elements 424 . [ 0033 ] fig7 shows another embodiment of the invention in which the outer surface of the sleeve 420 is provided with adhesive 426 . adhesive 426 provides a sticky surface on the cartridge sleeve 420 to which the tolerance ring 450 may bond , so as to prevent both axial and rotational slippage between the ring 450 and sleeve 420 . [ 0034 ] fig8 shows yet another embodiment of the invention in which the outer surface of the sleeve 420 is provided with a layer of resilient material 428 . the resilient material 428 may be rubber , plastic , or any other similar material that provides a soft surface into which the inner surface 460 of the tolerance ring 450 may “ bite ”, so as to prevent both axial and rotational slippage between the ring 450 and sleeve 420 . of course , it should be understood that a bearing cartridge mounting arrangement may differ from the example described above without departing from the spirit of the claimed invention . for example , while frictional elements are discussed above with respect to a corrugated tolerance ring , they could of course be used with other mounting systems in which enhanced friction with respect to the bearing cartridge is desirable . moreover , other friction - enhancing methods could be provided in lieu of or in combination with those discussed above . for example , bead blasting , sanding , or other methods could be use to provide a rough surface in order to increase friction . alternatively stated , a first contemplated embodiment of the invention is an mounting assembly for an actuator 300 including a bearing cartridge 400 having a shaft 410 and a sleeve 420 rotatable about the shaft 410 . the cartridge 400 is configured to be positioned in a bore 370 within the actuator 300 . the assembly further includes a retention element 450 configured to be positioned between the sleeve 420 and a surface of the bore 370 . the assembly further includes at least one feature positioned between the shaft 410 and the retention element 450 configured to prevent relative movement between the sleeve 420 and the retention element 450 . optionally , the retention element 450 may be a corrugated sheet 450 . as another option , the movement preventing feature may be a groove 422 in the sleeve 420 . as yet a further option , the movement preventing feature may be a plurality of grooves 422 extending about a periphery of the sleeve 420 . as another option , the movement preventing feature may be adhesive material 426 located on the sleeve 420 . alternately characterized , a second comtemplated embodiment of the invention is a disc drive 100 having a housing 110 , an actuator 300 having a bore 370 therein , and a bearing cartridge 400 fixed to the housing 110 and positioned within the actuator bore 370 . the cartridge has an axis of rotation . a resilient element 450 is positioned between the cartridge 400 and a surface of the bore 370 . the disc drive further includes at least one frictional element associated with the cartridge 400 and contacting the resilient element 450 so as to prevent all axial movement of the actuator 300 relative to the cartridge 400 . optionally , the resilient element 450 may be a tolerance ring . as another option , the frictional element may be a knurled projection 424 located on the sleeve . as yet another option , the frictional element may be a resilient member 428 affixed to the sleeve . from the foregoing , it is apparent that the present invention is particularly suited to provide the benefits described above . while particular embodiments of the invention have been described herein , modifications to the embodiments which fall within the envisioned scope of the invention may suggest themselves to one of skill in the art who reads this disclosure . | 5 |
while the invention has been shown and described with reference to a number of embodiments thereof , it will be recognized by those skilled in the art that various changes in form and detail may be made herein without departing from the spirit and scope of the invention as defined by the appended claims . fig1 first shows schematically a maldi time - of - flight mass spectrometer for recording daughter ion spectra according to the prior art . on a sample support plate ( 1 ) there are dried sample portions , which can be transferred , one after another , by the positioning unit ( 2 ) into the focus of the uv laser ( 3 ). the samples consist of fine crystals of matrix material , into which analyte molecules have been embedded by the drying process from solution droplets . the ratio of analyte molecules to matrix molecules should be 1 : 10000 at most . a pulsed uv laser ( 3 ) sends a pulse of laser light with a duration of approximately 0 . 1 to 10 nanoseconds through a focusing lens ( 4 ) and a deflecting mirror ( 5 ) onto a sample ( 6 ). some of the sample material abruptly evaporates , creating a plasma cloud . accelerating potentials at the acceleration diaphragms ( 7 ) and ( 8 ) shape the ions generated in the plasma cloud into an ion beam ( 9 ). the ions that will be used for recording the daughter ion spectra are accelerated by relatively low voltages , for instance , 6 kev . switching on the acceleration after a delay following the flash of laser light creates time - focusing of the ions , the focal length being adjustable . the time - focusing occurs at approximately the same point for ions of all masses , but the time of flight up to this point depends on the mass of the ions . the focusing length is adjusted in such a way that the ions in the plasma cloud experience their time focusing at the site of the parent ion selector ( 10 ). this parent ion selector is a bipolar switchable grid that only allows ions to pass straight through during an adjustable switching time window , so making them available for further analytical investigation . the parent ion selector thus chooses the parent ions whose daughter ions are to be measured . if metastable parent ions have already decomposed between the acceleration diaphragm ( 8 ) and the parent ion selector ( 10 ), the daughter ions created here can also pass through the parent ion selector because they have the same velocity as the undecomposed parent ions , and therefore arrive at the parent ion selector at the same time as the latter arrive . the undecomposed parent ions and the daughter ions created by the decomposition of parent ions now fly in ion beam 11 on to a post - acceleration unit ( 12 ), where they are given an additional acceleration by about 20 kilovolts . prior to the post - acceleration , the daughter ions only possess that fraction of the 6 kev of energy that corresponds to the ratio of their fractional mass to the mass of the parent ion . the post - acceleration now gives the daughter ions an energy of between 20 and 26 kev . the light ions are the fastest , although they have somewhat less kinetic energy . the mass analysis can , therefore , again be carried out as a time - of - flight analysis at the detector ( 17 ). to prevent those daughter ions that are created by the decomposition of the post - accelerated parent ions from reaching the reflector ( 14 ), a further ion selector ( 13 ) is installed in the ion path between the post - acceleration unit ( 12 ) and the reflector ( 14 ) in order to suppress the parent ions and their equally fast daughter ions . this parent ion suppressor is not only necessary to suppress the daughter ions created after the post - acceleration , but also to suppress a continuous background noise that would be generated by the ions that decompose in the reflector . this mass spectrometer according to the prior art , however , accepts all the ions that arrive at the parent ion selector within the correct time window for measurement in the daughter ion spectrum . this is a very large number of ions , including many unwanted ions , such as all the decomposed and undecomposed complex ions of the same mass as the parent ions , many ions that decompose in the acceleration region and slip through the parent ion selector , and many ions that are generated in the acceleration region having their lower mass compensated by a lower kinetic energy . these unwanted ions impose a strong background of undefined ions on the daughter ion spectrum , and so reduce the sensitivity of measurement . the fundamental idea of the invention , therefore , is to mask out these ions that do not belong with the daughter ions as fully as possible , so that they cannot reach the parent ion selector , but also to provide good time - focusing of ions of the same mass . this can be done , according to the invention , by filtering the ions in at least one reflector according to their energy , whilst at the same time providing energy - focusing for ions of the same mass . only ions with the selected correct mass and the associated correct energy are then able to reach the parent ion selector . the reflector is favorably implemented as a double reflector , but arrangements with only a single reflector or with more than two reflectors are also possible . there are several favorable arrangements for the double reflector . a first arrangement with a double reflector is illustrated in fig2 and 4 ; the explanation here will concentrate particularly on the magnified fig4 of the region around the double reflector . two angled ion reflectors ( 38 ) and ( 39 ) are able to generate a homogeneous electrical reflection field in their interior by means of potentials applied to widely opened annular diaphragms . in this reflection field , the entering ions are first braked until a full stop and then accelerated back out again . the entrance to each of the two reflectors is closed by a very permeable grid , in order that as few ions as possible are filtered out through impacts on the grid wires , but the field inside the reflector is nevertheless homogenized . the ion beam ( 37 ) created by acceleration at the diaphragms ( 35 ) and ( 36 ) is reflected back and forth in the two reflectors ( 38 ) and ( 39 ). parent ions leave the double reflection as an ion beam ( 40 ) in the same direction as they entered the reflectors . the ion beam ( 40 ) is , however , laterally displaced with respect to the ion beam ( 37 ), so that these double reflectors require a specially constructed time - of - flight mass spectrometer that allows for this displacement . any ions that do not possess the full energy of the acceleration pass through the two reflectors on other paths , of which one path ( 46 ) is drawn dotted in fig4 . these ions impinge on a diaphragm that belongs to the parent ion selector ( 41 ). these rejected ions include practically all the complex ions , as these decompose with a very short half - life . they also include all those ions that decompose in the acceleration region between the sample support plate ( 30 ) and the acceleration diaphragm ( 36 ), and which therefore do not achieve the full acceleration energy . they also include all the daughter ions that have formed on the path ( 37 ) or in the reflectors . this loss of daughter ions is , however , compensated for by a significantly cleaner daughter ion spectrum , whose improved ratio of daughter ion signals to background noise offers greater measurement sensitivity . the interpretation of the daughter ion spectrum is made a great deal simpler through the absence of ghost signals . only those daughter ions now appear in the mass spectrum that form on the ion paths ( 40 , 9 ) and ( 42 , 11 ) leading up to the post - acceleration unit ( 12 ). the ions of lower energy that are to be rejected can also be masked out by other diaphragms included in the ion path . the entrance grids , for instance , can be replaced by solid plates , each having just one inlet opening and one outlet opening for the ions of the correct energy . the displacement of the ion beam is somewhat disadvantageous if such double reflection is to be integrated into an existing maldi time - of - flight mass spectrometer without making relatively large changes to the design . for this reason , fig5 illustrates a second embodiment that does not exhibit this beam displacement . here , two deflection capacitors ( 43 ) and ( 44 ), implemented in a curved form , before and after the two reflectors ( 38 ) and ( 39 ) correct the ion path in such a way that the beam is no longer displaced . this arrangement has the further advantage that the additional deflection capacitors ( 43 ) and ( 44 ) achieve an even sharper energy filtering . each of the deflection capacitors ( 43 ) and ( 44 ) itself acts as an energy filter . many modifications of this embodiment are possible . curved deflection capacitors ( 43 ) and ( 44 ) as shown here may be used , or the deflection capacitors may be straight . the deflection capacitors ( 43 ) and ( 44 ) may also have a tighter curve , as a result of which the reflectors ( 38 ) and ( 39 ) are positioned at a greater angle . the deflection capacitors do not have to be located symmetrically ; instead , one deflection capacitor can deflect the ion beam more than the other . in the limiting case it is also possible to use only one deflection capacitor before or after the two reflectors , and to position the two reflectors in such a way that the ion beam is not displaced . positioning the deflection capacitors symmetrically has the advantage that the beam divergence generated in the first deflection capacitor for ions of the same mass but different initial energies can be cancelled again in the second deflection capacitor . this second embodiment , which does not displace the beam , is particularly suitable for installing in maldi time - of - flight mass spectrometers of existing design . it is only operated with dc voltages that do not have to be switched . the ion beam feeds all the undecomposed molecular ions of the mass concerned successively to the parent ion selector . only the parent ion selector ( 41 ) undergoes time - switching , apart from the post - acceleration unit ( 12 ) and the unit for parent ion suppression ( 13 ), which may also have to be switched , depending on the mode of operation . a third embodiment uses two anti - parallel reflectors in series , as is shown in fig3 and 6 . the two reflectors ( 38 ) and ( 39 ) are here closed at both ends with highly transparent grids , so that the ions can pass through them almost undisturbed when no electric fields are switched on inside them . if these reflectors are used as energy filters , they must be switched in accordance with a programmed rhythm . the slight displacement of the ion beam indicated in fig6 is only shown for better understanding of the flight path of the ions as they move back and forth . in practical embodiments , the ions are reflected back precisely along their former flight path . one favorable mode of operation is first of all to leave the reflector ( 38 ) switched on after the pulse of laser light , so that all the ions are reflected in the direction of the ion source and cannot reach the parent ion selector at all . if the selected parent ions then , after the first reflection , reach the central region ( 45 ) between the two reflectors , the electric field in the reflector ( 39 ) is switched on so that the parent ions are now also reflected in the reflector ( 39 ). when the parent ions now , following the second reflection , again reach the central region ( 45 ) between the two reflectors , the electric field in reflector ( 38 ) is switched off so that now the parent ions can reach the parent ion selector ( 41 ). operation in this way filters out all those ions with lower energy . only the undecomposed parent ions and those daughter ions that are created from the central region ( 45 ) through to the parent ion selector ( 41 ) are now allowed through . all other ions are filtered out . this unit consisting of two anti - parallel reflectors in series is also easy to install in existing maldi time - of - flight mass spectrometers . there are several other designs and modes of operation for this embodiment with two reflectors in series . it is , for instance , possible only to switch on the two reflectors when the parent ions pass through the central region ( 45 ) for the first time , and to switch both of them off again when they pass through the central region ( 45 ) the third time . the two outer grids on the reflectors can also be replaced by plates with central holes . if small pieces of pipe are attached to the central openings , the distorting effect of the homogenous field in the interior is even less . in the limiting case the two reflectors can be moved right up against one another , with now only a single grid between the two reflection fields . it is even possible to omit this grid too , but in this case the two homogeneous electrical reflection fields are replaced by an approximately parabolic saddle - shaped potential well . a fourth embodiment has only one reflector ( 39 ) and two deflection capacitors ( 43 ) and ( 44 ), as shown in fig7 . it can also be dimensioned in such a way that good time - focusing of all ions of the same mass , independently of their initial energy , is achieved at the parent ion selector ( 41 ). however , the fact that the ion beam ( 37 , 40 ) passes through the two deflection capacitors ( 43 ) and ( 44 ) in the same deflection direction means that ions of different initial energies form a divergent ion beam after they have passed through . the angle of emergence depends on the initial energy spread . this divergent beam can , however , be focused back to a fine beam by a cylindrical lens ( 45 ) positioned either before or after the parent ion selector . all devices of this type , which do not generate a displacement of the ion beam , can also be moved out of the ion path in order to record normal molecular mass spectra . no loss of ions is then caused by passing through the grids . the units ( 12 ) for post - acceleration of the ions and ( 13 ) for suppression of the residual parent ions can also be moved out of the ion path . all of these units are only required for recording daughter ion spectra , and are only moved into the ion path for this purpose . with some of the embodiments , e . g . that shown in fig4 , it is possible to improve signal to noise for the original mass spectra of the ion mixture because only the ions with correct masses and correspondent correct energies are recorded . for recording daughter ion spectra , in principle , a single ion species can serve as the parent ions . all organic materials , however , contain a mixture of the isotopes of their elements ; the mass spectrum therefore contains what are known as isotope groups , occupying several successive mass signals of the mass spectrum . if the parent ion selector only filters out those ions that only consist of the main isotopes of their elements , that is 1 h , 12 c , 14 n , 16 o or 32 s , then only one signal for each type of daughter ion will appear in the daughter ion spectrum . it has , however , become common to select the entire isotope group in the parent ion selector so that the various isotope groups are also seen in the daughter ion spectra . the visibility of the isotope groups in the daughter ion spectra increases confidence that they have been correctly identified . the selection of the entire isotope group by the parent ion selector does increase the proportion of unwanted ions that are also admitted . it is particularly in this case that a device according to this invention brings a sharp improvement to the analytic process , both from the point of view of easier interpretation of the daughter ion spectra through the removal of the ghost signals , and also in respect of improved mass determination for the daughter ions through the improved mass resolution , and also for improved detection through a higher signal - to - noise ratio . | 7 |
according to an embodiment of the present invention , an advertising management system is used to create , analyze and control online advertisements . fig1 represents a network 10 including an advertising management system of the present invention . as is known , the internet 20 and / or other wide area or global network , connects together various servers providing services to users . a search engine host 30 , such as yahoo ® and google ® provides a searching service for users . ( search engine host 30 is representative of multiple hosts which can be accessed and utilized by the system and method of the present invention .) the search engine host 30 has a connection to the internet 20 . users are able to access the search engine host 30 through that connection . when the search engine host 30 receives a request for a search , it returns information relating to a set of relevant websites . as is known , a search engine host 30 also provides a set of advertisements related to the search . the advertisements are selected based upon keywords entered by the advertiser . when a user selects or “ clicks ” an advertisement , the user is directed , through the internet 20 , to the advertiser &# 39 ; s website , hosted on the advertiser web server 130 . the advertiser web server 130 is part of a computer system 100 of the advertiser . the advertiser system 100 may include a single computer or multiple computers . if the advertiser system 100 encompasses multiple computers , one or more separate networks ( not shown ) link the various computers . the components of the advertiser system may be located at a plurality of locations and may communicate through the internet 20 as well as through other networks . the components may also be owned or operated by third parties , such as another entity which hosts the advertiser &# 39 ; s website , as long as they are used in operation of the business of advertiser . fig1 illustrates some of the functionality of the advertiser system 100 as it pertains to the present invention . the various components are connected together through datalines 101 or a network ( not shown ) to form the system . the advertiser web server 130 hosts the advertiser &# 39 ; s web site to provide a service to businesses or the public . the service may include providing information about the advertiser or advertiser &# 39 ; s products . it may also include an ecommerce service allowing ordering of the advertiser &# 39 ; s products . advertiser system server 160 provides computer services to the advertiser . it may include application programs and accompanying data used by advertiser . it may include one or more computers and storage devices . accounting system 120 stores or processes information stored in the advertiser &# 39 ; s financial and other accounting records . accounting system 120 runs , for example , intuit quickbooks accounting software , produced by intuit inc ., 2632 marine way , mountain view , calif . 94043 . the accounting system 120 may operate on the advertiser system server 160 or may include separate hardware . the advertiser system 100 includes one or more user interfaces 150 for accessing the functionality of the components of the advertiser system 100 . one or more databases 140 may be included in the advertiser system 100 . in the present invention , the advertiser system 100 includes an advertising management system 110 to create , control and manage online advertisements . the advertising management system 110 is connected to the other components of the advertising system in order to provide its functionality . the advertising management system 110 includes a connection to the internet 20 in order to communicate with other systems outside the advertiser system 100 in providing its functionality . while fig1 illustrates advertiser system 100 as having separate components , any or all of them may be integrated into a single computer , computer system , or program . for example , the user interface 150 may be integrated into the interface for the accounting system 120 . thus , the advertising management system 110 could be accessed directly through the accounting system 120 . alternatively , the user interface 150 may be integrated with the advertising management system 110 . accounting information may be retrievable by the interface 150 through the connection between the advertising management system 110 and the accounting system 120 . alternatively , the user interface 150 may be a separate gui interface associated with a computer within the advertiser system 100 . fig2 illustrates a process 200 for operation of the advertising management system 110 to create keywords for use in conjunction with advertisements on a search engine host 30 according to an embodiment of the present invention . the advertising management system 110 determines keywords through a number of data sources . at step 210 , the advertising management system 110 searches data created or stored by accounting system 120 to determine words frequently used in connection with sales records , inventory lists , or other business transactions . at step 220 , the advertising management system 110 searches the advertiser &# 39 ; s website on advertiser server 130 or scanned promotional materials , business email databases , product information or other relevant sources stored in a database 140 . at step 230 , the advertising management system 110 searches third party websites 40 accessed through the internet 20 . such third party sites could include industry associations and competitors &# 39 ; websites . the specific sources to be searched by the advertising management system 110 would be identified by the advertiser through the user interface 150 or automatically determined from information accessed from accounting system 120 , advertiser web server 130 , advertiser system server 160 , or database 140 . at step 240 , a list of keywords is generated from all of the words culled from different sources . at step 250 , the advertising management system 110 collects information relating to use of the various keywords . such information may be stored in the advertising management system 110 from previous lists , may be obtained from the search engine host 30 , or may be culled from various sources connected to the internet 20 . the information may include data on estimated traffic , associated costs , and similar ads using various combinations of the keywords . the information may include an estimation of the average display position that different bids would result in for the keyword combinations . pricing information for the ads is also obtained . at step 260 , the list of keywords and other collected information is displayed on the user interface 150 . the advertiser can then revise and edit the list of keywords at step 260 . once editing is complete , the advertising management system 110 retains the selected keywords for submission with advertisements , as discussed below . according to an embodiment of the present invention , as illustrated in the process of fig3 , the advertising management system 110 provides assistance in creating the advertisements through the collection and presentation of information . advertising management system 110 accesses the database 140 , advertiser web server 130 and / or advertiser system server 160 to collect information for advertisements at step 310 . at step 320 , advertising management system 110 retrieves information from search engine host 30 relating to competitive ads ( e . g ., that correspond to the same keywords ). using the collected information , the advertising management system 110 generates and displays suggested ads based upon templates at step 330 . these ads are selected to demonstrate recommended wording and structuring . since ads displayed by search engine host 30 are , at least to some degree , ranked by click - through success , ads listed first by search engine host 30 are likely to have been effective at generating traffic . therefore , ads listed first are selected more often at step 320 . the collected information about third party ads is also displayed . at step 340 , using the interface 150 , advertiser can edit , delete or add advertisements based upon the suggested ads , examples of third party ads , and general or customized ad templates . the advertising management system 110 automatically sets an initial bid price in conjunction with the selected keywords and ads . the bid price can also be modified by the advertiser . once the advertisements are complete and prices are set , the advertising management system 110 submits the ad campaign to search engine host 30 through an automatic process which avoids the complex manual entry system . depending on the particular search engine host 30 , limited manual entry may be required . for example , an account may need to be created before step 350 may proceed . according to an embodiment of the invention , the advertising management system 110 monitors performance of ads after submission . through monitoring , the advertising management system 110 uses an automated adaptive learning process to revise the suggested ads and keywords . the advertising management system 110 tracks the performance of ads it has previously created and the performance of ads of third parties . the advertising management system 110 may retrieve data from advertiser web server 130 , advertiser system sever 160 , a database 140 containing , for example , server logs , or a third - party system ( not shown ). the advertiser may , through user interface 150 , specify which metrics are to be optimized . for example , the advertiser may choose revenue , profitability , or other metrics . according to an embodiment of the invention , as illustrated in fig4 , the advertising management system 110 assists with control of an advertising campaign during operation . at step 410 , the advertising management system 110 collects ad campaign measurement statistics . various reports are generated and displayed , at step 420 , on the user interface 150 based upon the collected information . the reports may include the current , past , and predicted future states of the campaign . the advertising management system 110 also maintains real - time cost of advertising and revenues generated . as discussed previously , the advertising management system 110 is connected to the accounting system 120 . the costs and revenues associated with ads can be directly retrieved from and written to the accounting system 120 or retrieved from another system . advertiser can display the ad campaign data in a standardized or custom format that allows the advertiser to capture , manipulate , and store the data as he likes . at step 430 , the advertiser can revise the ads and / or keywords in the advertising campaign using the user interface 150 based upon the reports generated by the advertising management system 110 . the revised ads and keywords are automatically provided to the search engine host 30 . according to another embodiment of the invention , the advertising management system 110 conducts automated experiments to derive empirically optimum bid , keyword , advertisement copy , day or date of placement , and time of placement combinations . through such experimentation , the advertising management system 110 can derive price elasticity curves for both the advertisement itself , and for the product or service that is being advertised . through inferred user information indicated by the search engine host 30 , advertising management system 110 can optimize price discrimination strategies . the advertising management system 110 can be optimized according to inventory turnover , inventory levels , days receivable , customer lifetime value ( which traces all purchases a customer makes and connects that to the initial lead for detailed return - on - investment (“ roi ”) analysis ), customer up - selling to a more expensive or higher - profit product , order size , shipping costs , geography , profit levels , gross sales , net sales , ebit , cost - per - click , click - through rates , number , cost , or timing of telephone inquiries , attitudinal changes in target market ( e . g ., awareness , knowledge , interest ) or estimated or known impact on competitors &# 39 ; websites or businesses . for example , consider an optimization strategy that focuses on equivalent sales per click . there could be two keywords : one costs $ 0 . 10 per click while another costs $ 1 . 00 per click . if the $ 1 . 00 per click keyword generates more than 10 times as many equivalent sales per click as does the $ 0 . 10 per click keyword , it offers a better roi . the advertising management system 110 is adapted to perform the automated analysis and optimization through integration of information tracked by search engine host 30 and accounting system 120 . the advertiser may save money by , for example , finding cost - effective advertisements . the advertising management system 110 is also capable of managing , in all the same ways that keywords are otherwise discussed , negative keywords , meaning keywords that will prevent an advertisement from displaying . for example , advertising management system 110 can optimize negative keywords to minimize click - through loss or to minimize buy - through loss . in an embodiment of the invention , advertising management system 110 collects information by explicitly linking the unique tracking identifier and its associated information ( e . g ., implied user location ) that is created , observed or maintained by the search engine host 30 with the tracking identifier and its associated information that is created or maintained by accounting system 120 . for example , the accounting system 120 may have unique customer identifying numbers , customer accounts , email or home addresses , telephone numbers , product warranty numbers , discount coupon numbers , browser cookies , ip addresses , credit card numbers , or any combination thereof . by linking the tracking identifiers , multiple search engine searches can be associated with a single final sale , or , alternatively , a single click - through with multiple sales that occur separately over a period of time after the search engine user first saw an advertisement and clicked on it . by linking all the sales to customers , whether conducted by email , telephone , fax , or internet , with the initial customer acquisition through internet advertising and online identification , a more complete understanding of the revenue per new customer , profit per new customer , and other metrics can be obtained and compared to the cost of acquiring that new customer through online advertising . the advertising management system 110 is adapted to optimize online advertising by measuring online and offline sales . the advertising management system 110 can use the search engine tracking identifier and the accounting system 120 identifier and their related information to calculate optimum pricing levels . in another embodiment , the advertising management system 110 links a unique tracking identifier and its associated information ( usually stored by a cookie on the search engine user &# 39 ; s computer ) that is created , observed or maintained by the search engine host 30 with the tracking identifier and its associated information that is created or maintained by accounting system 120 in order to allocate automatically certain advertising costs to separate cost - pools in accounting system 120 . for example , suppose there is an advertiser that is a lawn mower retailer , and he has a google ad campaign for lawn mowers assigned a keyword “ lawnmower .” the advertiser wishes to assign the ad campaigns costs two cost - pools , one for its riding mower division and another for its push mower division . system 240 can assign click - throughs that result in a riding mower purchases to the riding mower cost - pool , and click - throughs that result in push mower purchases to the push mower cost - pool , and all other click - throughs to these two cost - pools in a similar ratio . in another embodiment , advertising management system 110 provides advertising cost aggregations to accounting system 120 in order to generate automatic advertising reimbursement invoices . for example , one business forms a partnership that allows it to have some of its advertising costs reimbursed . advertising management system 110 identifies a specified portion of advertising costs related to certain keywords and automatically generates invoices to the partnership . in another embodiment , the advertiser system 100 uses the database 140 to store or process business information created , generated , or used by the advertiser . the business information may include information stored in a customer relationship management ( crm ) application , a billing system , a mailing database , any customer records , electronic mail programs or systems , checks generated or received in the course of business , transaction records , electronic trade journals , electronic commerce software , or internet web sites . advertising management system 110 communicates with the database 140 to retrieve the business information . advertising management system 110 performs an automated review of information from the database 140 to generate keywords for use in online advertising . in another embodiment , the advertising management system 110 is a windows - based application that is adapted to facilitate signing up for and maintaining a paid - search and pay - per - click (“ ppc ”) advertising campaign . the advertising management system may be designed using the c ++ or c # programming languages on the microsoft visual studio . net platform , produced by microsoft corp ., 1 microsoft way , redmond , wash . it communicates with a quickbooks accounting system using the quickbooks sdk ( qbsdk ) and the quickbooks foundation class ( qbfc ) library , an object - oriented layer developed by intuit . the present invention is not limited to advertisements on search engine host 30 . in another embodiment of the invention , the advertising management system 110 operates to provide advertisements to any advertisement publisher 60 . the advertisement publisher 60 may provide advertisements for banner or other online advertisements , text messages , emails , etc . the advertising management system 110 creates , monitors , controls and optimizes the content and possible keywords of advertisements in accordance with the processes described above . to provide the information regarding the advertisements to the advertisement publisher , the advertising management system 110 communicates through publisher &# 39 ; s application program interface 65 . in another embodiment , the advertising management system 110 operates remotely from the advertiser system 100 . an application installed in the advertiser system 100 facilitates data analysis and transfer of accounting and sales data from the accounting system 120 to the remote advertising management system 110 . the application may also facilitate communications between the advertising management system 110 and other components of the advertiser system 100 . having disclosed at least one embodiment of the present invention , various adaptations , modifications , additions , and improvements will be readily apparent to those of ordinary skill in the art . such adaptations , modifications , additions and improvements are considered part of the invention which is only limited by the several claims attached hereto . | 6 |
referring in detail now to the drawings , wherein similar parts of the invention are identified by like reference numerals , there is seen the apparatus of this invention , generally illustrated as 10 , which is for splicing , connecting , or otherwise attaching together the ends of belts 12 such as those for conveying , bailing hay , etc . ( see fig2 - 28 ). the apparatus 10 comprises a base , generally illustrated as 14 , consisting of a pair of angle irons 16 -- 16 disposed generally parallel with respect to each other and having connected thereacross a base support member 18 which functions to provide support for a clipper vise lacer means , generally illustrated as 20 , containing a plurality of clipper hooks 22 which are to be embedded into the ends of a belt 12 for securing together the same , as illustrated in fig2 . base 14 also includes a container , generally illustrated as 24 , having a front wall 26 and a rear wall 28 , both of which secure to the angle irons 16 -- 16 such that a structural portion of the angle irons 16 -- 16 define the sides to the container 24 . the container 24 also includes a floor 30 secured to the angle irons 16 -- 16 and to the front and rear walls 26 and 28 . a lid 32 pivotally connects to the rear wall 28 . the apparatus 10 also comprises a frame means , generally illustrated as 34 , secured to and supported by the angle irons 16 -- 16 ; a lever 36 slidably disposed within the frame means 34 ; a pair of spring means 38 -- 38 secured to the frame means 34 for biasing the lever 36 upwardly and / or away from the base 14 ; and a means , generally illustrated as 40 , for sending or drawing the lever 36 downwardly towards the base 14 , more specifically towards the base support member 18 , to contact and close the clipper vise lacer means 20 in order to drive and embed the clipper hooks 22 into an end of the belt 12 that had been previously disposed in the clipper vise lacer means 20 . the frame means 34 preferably includes a first frame structure 42 having a top 44 , and a second frame structure 46 having a top 48 . the tops 44 and 48 of the respective frame structures 42 and 46 come together or join or are in close proximity to each other at 50 ( see fig1 and 4 ). after combining ( or other coming together ) at 50 , the respective frame structures 42 and 46 extend away from each other to provide a slot or opening 52 wherethrough the lever 36 can travel up and down . the base support member 18 is secured to the angle irons 16 -- 16 such as to be within the opening 52 and between the first and second frame structures 42 and 46 , and such as further to be aligned with and over the lever 36 . a pair of press stops 54 -- 54 is bound to and on opposed ends of the base support member 18 in close proximity to the locations where the base support member connects to the angle irons 16 -- 16 . the press stops 54 -- 54 extend upwardly and through the opening 52 and function to stop or prevent the continuing downward travel of the lever 36 as it is being driven downwardly by the means 40 for driving the lever 36 downwardly towards the base 14 . a press stop 54 is of the type whose height can be adjusted by screwing the press stop either clockwise or counterclockwise . for example , clockwise rotation can shorten the height of press stop 54 while counterclockwise rotation can lengthen the height of the press stop 54 . the frame means 34 additionally comprises a pair of lever support members 56 -- 56 connected to the first and second frame structures 42 and 46 across the opening 52 to straddle the same . a pair of spring connector members 58 -- 58 is also connected to the first and second frame structures 42 and 46 across the opening 52 to straddle the same . connector members 58 -- 58 ( as best illustrated in fig3 ) are above the lever support members 56 -- 56 ; and the pair of spring means 38 -- 38 connects to the connector members 58 -- 58 and is coupled further to opposed ends of the lever 36 for biasing the latter upwardly against the pair of lever support members 56 -- 56 . when the means 40 for drawing the lever 36 is activated , the lever 36 leaves its biased position against the support members 56 -- 56 and is driven downwardly while the pair of spring means 38 -- 38 is being stretched , until the bottom of the lever 36 comes in contact with the pair of press stops 54 -- 54 . on the way down , the lever 36 contacts the clipper vise lever means 20 such that the same can release its contained clipper hook 22 into the end of the belt 12 . the means 40 for driving the lever 36 downwardly is preferably a manually operated hydraulic jack means 68 having a handle 60 pivotally coupled to a plunger 62 and a linkage 64 . when handle 60 is manually driven downwardly a piston 66 ( see fig1 ) commences to be driven away from the main body of the hydraulic jack 68 and contacts a buttress member 70 that has been previously secured to the first and second frame structures 42 and 46 underneath the respective tops 44 and 48 thereof . the buttress member 70 provides an immovable barrier whereagainst the top of piston 66 urgedly contacts such that as the length of piston 66 extends , the lever 36 travels downwardly proportionately ( see fig4 ). a support plate 80 is secured to the top of the lever 36 to function as a base support for the means 40 of the hydraulic jack 68 . as best illustrated in fig1 , the support plate 80 has a pair of opposed apertures 82 wherethrough a pair of hooks 83 -- 83 extend after being implanted into the lever 36 ( see fig1 ). the hooks 83 -- 83 provide a lug means for coupling the pair of spring means 38 -- 38 to the lever 36 . stated alternatively , the spring means 38 -- 38 , in addition to connecting to connector members 58 -- 58 , secure to the hooks 83 -- 83 for biasing the lever 36 within the opening 52 away from the base 14 ; more specifically , away from the base support member 18 that is aligned directly underneath the lever 36 . a pair of generally parallel rib members 84 -- 84 connect transversely to and across the support plate 80 , as best shown in fig1 . the hydraulic jack means 68 is secured to the support plate 80 between the rib members 84 -- 84 . the clipper vise lacer means 20 is a conventional clipper vise lacer and no invention is claimed therein . as best illustrated in fig6 - 14 , the clipper vise lacer means 20 comprises a pair of vise side plates 100 -- 100 with each comprising a pair of rear apertures 102 -- 102 and a pair of front apertures 104 -- 104 and a slot 106 . bound to each side plate 100 via a bolt 108 is a clipper retainer 110 comprising a plurality of slots 112 ( see fig1 ) defining a plurality of partitions 113 with each having an aperture 115 . the apex - ends of the clipper hooks 22 lodge within slots 112 and are retained therein by rod 114 passing through the apertures 115 of each partition 113 . typically , the plurality of hooks 22 come with a removable paper shield 200 to protect the user from the sharp hooks 22 . this paper shield 200 is obviously removed before a belt 12 is inserted between the sharp ends of the hooks 22 . the clipper vise lacer means 20 additionally comprises an upper jaw 120 and a lower jaw 122 . the upper jaw 120 has a front upper lug 124 and a rear upper lug 126 which respectively lodge pivotally in the upper of the apertures 104 and 102 in the side plate 100 . similarly , the lower jaw 122 has a front lower lug 128 and a rear lower lug 130 which respectively lodge pivotally in the lower of the apertures 104 and 102 in the side plate 100 . when the upper and lower jaws 120 and 122 are pivotally driven towards each other by being compressed from the downwardly moving lever 36 and the stationary base support member 18 as best illustrated in fig3 the jaws 120 and 122 bend and drive the hooks into an end of the belt 12 . when both ends of the belt 12 have embedded hooks 22 , a retainer rod 300 passes through the eyelets of the bent hooks 22 ( see fig2 and 26 ) for securing together the ends of the belt 12 . while the present invention has been described herein with reference to particular embodiments thereof , a latitude of modification , various changes and substitutions are intended in the foregoing disclosure , and it will be appreciated that in some instances some features of the invention will be employed without a corresponding use of other features without departing from the scope of the invention as set forth . | 5 |
as discussed , an area of computer security weakness is off - chip memory . an adversary may alter or play back information contained in off - chip memory to subvert a computer system . one way to curtail adversaries is to sign and encrypt off - chip memory . calculating a signature on memory may entail generating a message authentication code ( mac ). a mac algorithm is run with a key and a block of memory or data as inputs . the mac algorithm may output a signature or mac . the mac may be a value . the mac may be sixteen or thirty - two bits . the mac , however , may be larger or smaller . a first mac is computed with data that is written to off - chip memory . the first mac is stored with the data . when the data is read from off - chip memory , a second mac is generated from the data that is read . if the first mac does not match the second mac , the system may reset and / or discard the data . turning to fig1 , which is a sample block diagram of a system 100 where the apparatus and method for mac pre - computation may reside . the main components of the system 100 are either on - chip or off - chip . the off - chip component of the system is memory in the form of dynamic random access memory ( dram ) 115 . the dram may store data that is used by the software or programs resident on the on - chip portion of the system . although dram is depicted in this embodiment , dram , random access memory , or any other memory or method of storing data may be used to store off - chip data in the system 100 . the components that reside on - chip may include a dram controller 120 , an encryption authentication unit 125 , bus interface logic 130 , a bus 135 , a central processing unit 140 and cache 145 , and a direct memory access ( dma ) engine 150 . the cpu 140 and dma engine 150 may communicate with the bus interface logic 130 via the bus 135 . the bus interface logic 130 may be communicatively coupled to the eau 125 . the eau 125 may be further communicatively coupled to the dram controller 120 . the dram controller may be communicatively coupled to the dram 115 . the cpu 140 and dma 150 may read and write data to dram 115 . when the cpu 140 or dma 150 reads or writes to dram 115 , the data that is read or written flows through the bus interface logic 130 , the eau 125 and the dram controller 120 . in reading and writing data , the bus interface logic 130 handles transactions of all sizes . the eau 125 , however , reads and writes fixed sized blocks of data to off - chip dram 115 . the fixed sized blocks may be called encryption blocks or data blocks . in an embodiment , a data block comprises two hundred fifty - six bits . an encryption block may be a minimal unit of data to be read or written memory 115 . because the bus interface logic 130 handles transactions of all sizes , the eau 125 has to manage a request to read or write data that is larger or smaller than an encryption block . in an embodiment , the method and system for message authentication code pre - computation may reside on the eau 125 . the eau 125 may perform encryption / decryption and authentication of data that is written or read from dram 115 . write transactions may be encrypted on the way out to dram 115 . read transactions may be authenticated and decrypted as information is read from dram 115 . thus any data blocks the eau 125 writes or reads from memory may contain encrypted data . when authenticating data or memory , the eau 125 may generate a first mac for a data block that the eau 125 writes to memory . the first mac is then associated with the data block . when the data block is read from memory , the eau 125 may generate a second mac based on the data that is read . the second mac may be compared with the first mac . if the first mac and second mac do not match , the memory may have been corrupted or compromised . if memory is corrupted , the eau 125 may perform memory corruption procedures . this may entail resetting the system , or sending a message to the cpu to inform the cpu of the memory anomaly . the cpu may then reset the system or take some other preventive actions . typically , the eau 125 receives the address of a memory transaction before data associated with the memory transaction arrives . thus a majority of the computation involving encrypting the data and generating a mac may be performed before the data arrives . turning to fig2 , which is one example of a method 200 that may be used in writing and reading data employing mac pre - computation with applications to secure memory . the method 200 may reside on the encryption authentication unit 125 . the method first handles a request 210 . the request may be a request to read or write data . the request may come through the bus interface logic 130 . when the bus interface logic 130 sends a request to read or write data , the bus interface logic 130 may pass an address to the method 200 . if the request is a write request , the address may be an address where data is to be written . if the request is a read request , the address may be an address where data is to be read from . the method 200 then determines if the request is a write request 215 . if the request is a write request , the method 200 invokes the write handler 220 . because this is a write request , the bus interface logic 130 may pass a write address to the method 200 . when the method 200 invokes the write handler , the method 200 may pass the address or write address to the write handler . after the write handler is done processing the request , the method 200 continues handling requests 210 . if the incoming request is not a write request , the method 200 determines if the request is a read request 225 . if the request is not a read request , the method 200 returns to handling requests 210 . if the request is a read request , the method 200 may invoke the read handler 230 . when the method 200 invokes the read handler , the method 200 may pass the address or read address to the read handler . turning to fig3 , a method in one example , which may write data to dram 115 using mac pre - computation . the write handler method or write handler 300 may reside on - chip as part of the eau 125 . as the eau 125 receives data , the eau 125 may generate a mac and may also encrypt the data . this process begins when the write handler receives an address 310 . the address may be the location in dram 115 where the eau 125 is supposed to write the data . the address may be a thirty - two bit address , a sixteen bit address or any other sized address that may be used to address the dram 115 . for the sake of illustration , we will assume the address is thirty - two bits long . at this point , the data may not have arrived . because the address is now available , the mac calculation may commence . the method 300 does not have to wait for data to arrive to begin mac calculations . the eau 125 may create a two hundred fifty - six bit data block by concatenating two hundred eight bits of zeros ( pad ), the thirty - two bit address and a sixteen bit nonce ( zeros , address , and nonce ). the two hundred fifty - six bit data block may be a data input . part of calculating the mac may involve evaluating a prf or prp or randomness using the data input . one of ordinary skill in the art will readily appreciate that a prf / prp is an idealized block cipher , where the cipher results in a bit pattern that cannot be distinguished from randomness . part of calculating the mac may also involve evaluating an epsilon differentially uniform ( ε - du ) function . it will be readily apparent to one of ordinary skill in the art that a ε - du function may be a block cipher that results in a random bit pattern . the randomness of a bit pattern created by an ε - du function , however , is not as good as that of a bit pattern generated by a prp . thus , a bit pattern generated by an ε - du may not be as secure as a bit pattern generated by a prp . one of ordinary skill in the art will also readily recognize that a nonce , or number used once , is a number that is rarely if ever repeated . in this embodiment , the nonce may be a counter that is incremented each time a write is executed . a prp or prf function f may be used to create the level of randomness needed in ciphering the nonce , address , and zeros . the method 300 may run rijndael ( or it &# 39 ; s most popular instantiation , advanced encryption standard or aes ) f 320 . the method 300 may run fourteen rounds of rijndael on the data input ( zeros , address and nonce ) to achieve two hundred and fifty - six bits of randomness . the two hundred and fifty - six bits of randomness may be a rijndael write block or rijndael block . the random values or randomness may be , for example , a series of ones and zeros . note , in some embodiments , prp f may be achieved by running ten rounds of aes version of rijndael on two sets of one hundred and twenty - eight bits . the two sets of one hundred twenty - eight bits are concatenated to form a two hundred and fifty - six bit block . when running rijndael , the method 300 chooses a random key , k1 . the rijndael algorithm may use the key k1 as an input to the rijndael algorithm . a random or secret key is a key that is chosen randomly . for example , a random number generator may be used to choose a random key . other forms of random generation may be used to choose a random key . the method 300 receives write data 330 . when the method 300 receives write data , the method 300 may encrypt the data . the method 300 may encrypt the data by using aes , or any other method of encrypting the data . the encrypted data may be xored with the rijndael write block 335 . the result may be an xored rijndael write block . the xored rijndael write block may comprise two hundred and fifty - six bits . the method 300 may compute a function g of an ε - du family of functions . the method 300 may choose a second random key , k2 which may be used as input to ε - du family of functions . the ε - du function g may be run on the xored rijndael write block 340 . function g may be an evaluation of two or four rounds of rijndael on the xored rijndael write block which results in a two hundred and fifty - six bit g write block . the g write block may be xored with a two hundred fifty - six bit key 345 , k3 , which results in a two hundred fifty - six bit m block . the m block may be collapsed from two hundred fifty - six bits to a thirty - two bit mac or first mac by using an xor tree 350 . the encrypted data block may be stored in dram 360 . the thirty - two bit first mac and the nonce , may also be stored in dram 360 and associated with the encrypted data block . thus when the encrypted data needs to be authenticated , the information needed to perform the authentication may be retrieved . the keys , k1 , k2 , and k3 , may be stored on the eau . although in this example , the method and apparatus for pre - computing a mac was used in writing data to memory , the method and apparatus may be used in any application that involves writing or sending data . in other embodiments , rather than using a memory address to pre - compute a mac , other values may be used to compute a mac . for example , if the method and apparatus is used in a message application , a message context identifier may be used in place of an address . furthermore , the size of the address , nonce and other variables may vary depending on a user &# 39 ; s need and the application for which the method is used . turning to fig4 , which is a method 400 in one example that may read data from dram 115 . in the process of reading data from dram 115 , the method 400 may authenticate the data . authenticating the data may entail generating a second mac based on the stored data and comparing the second mac with the first mac that was originally stored with the data . the method 400 may receive an address or read address 410 from the bus interface logic 130 . the method 400 may retrieve information 420 needed to authenticate the data . this information may include information that may reside on - chip such as the keys , k1 , k2 and k3 . further , this information may include information that may reside off - chip such as the first mac , a nonce and read data resident at the read address . the read data may be encrypted data . the method 400 may compute prp f 430 on the address , nonce and zeros ( zero pad ) as described in relation to fig3 . the key k1 is needed to compute prp f . note , the key k1 that is used to compute prp f when authenticating or reading the data , may be the same key k1 that was used to compute the prp f when writing the data . as previously described , prp f may be achieved by running fourteen rounds of rijndael on the nonce , the address and two hundred eight bits of zeros 430 . the result of the fourteen rounds of rijndael may be two hundred fifty - six bits of randomness that may be a rijndael block . f may also be achieved by running in parallel two instances of ten - round one hundred twenty eight bit aes version of rijndael . when reading data , the rijndael block may be referred to as a rijndael read block . in computing g 440 , the rijndael read block may be xored with the read data . the result may be an xored rijndael block or xored rijndael read block . g may be achieved running two or four rounds of rijndael on the xored rijndael read block . the result of computing g 440 may be a two hundred and fifty - six bit g block or g read block . note , the same key k2 used to compute the g write block may be used to compute the g read block . the g read block may be xored with the key , k3 , to arrive at a two hundred fifty six bit m read block . the m read block may be reduced to a thirty - two bit second mac via an xor tree 450 . the second mac may be compared with the first mac 470 . recall that the first mac was generated when the data was originally written to dram 115 . if the first mac and the second mac are not equal , the data may have been corrupted or compromised . the method 400 handles the mismatch 490 by performing memory corruption response procedures . if the first mac and the second mac are equal , the method 400 may return the read data to the bus interface logic 130 . the data may also be passed to the cpu prior to mac verification , since mac failure may cause a system reset . the described methods 300 , 400 may be known as shallow mac or shmac . turning to fig5 , which depicts an embodiment of a system 550 that may comprise an apparatus for performing mac pre - computation . the system 500 may be comprised of a bus interface logic unit 130 , a dram controller 120 and an eau 125 . the eau 125 may be further comprised of a data handler 530 , a mac computer 535 and a data encryptor 540 . the mac computer 535 may be further comprised of a mac prp f calculator 545 and an ε - du calculator 550 . as previously described , the eau 125 may be communicatively coupled to the dram controller 120 and the bus interface logic 130 . the dram controller 120 and bus interface logic 130 may be communicatively coupled to the data handler 530 . the data handler 530 may be a node or component that is capable of reading and writing data external to the eau 125 . a node or component may be software , firmware , hardware or any other type of apparatus capable of performing computation . the data handler 530 may also be communicatively coupled to the mac computer 535 and the data encryptor 540 . the mac computer 535 may be a node or component that is capable of pre - computing a mac . the data encryptor 540 may be a node or component that is capable of encrypting data . the mac computer 535 may be further comprised of the prp f calculator 545 and an ε - du 550 calculator . the prp f calculator 545 is a component or node that may be capable of computing a prp f function . the ε - du 550 calculator is a component that may be capable of computing an ε - du function . the bus interface logic 130 may send a request to read or write data from dram 115 . the data handler 530 may receive the request . the request to write data may come in two parts . first , the bus interface logic 130 may send an address to the data handler 530 . in typical systems , two or more clock cycles later , the data handler 530 may receive write data associated with the address . when reading data , the bus interface logic 130 may send the read address . the data handler may respond by sending the read data to the bus interface logic 130 . if the data handler 530 receives a write request , the data handler 530 may forward the write address to the mac computer 535 and the data encryptor 540 . in some embodiments , the write address may be thirty - two bits . the data encyptor 540 may use the write address as part of the process of encrypting data . the mac computer 535 may forward the write address and a nonce to the prp f calculator 545 . in some embodiments , the nonce may be sixteen bits . the prp f calculator 545 may generate a random key , k1 , to use in executing a rijndael function . the prp f calculator may use k1 to run fourteen rounds of rijndael ( or two parallel instances of two - round one hundred twenty eight - bit aes version of rijndael ) on a two hundred fifty - six bit data input . the data input may be comprised of two hundred eight bits of zeros , thirty - two bits of address and sixteen bits of nonce . the output of running fourteen rounds of rijndael on the data input may be two hundred fifty - six bits of random data that may be called a rijndael block or rijndael write block . the prp f calculator 545 may pass the rijndael write block to the ε - du calculator 550 . in some embodiments , the write data has yet to arrive at this point . nevertheless , the prp f calculator 545 has run rijndael and created rijndael write block . when the write data arrives the data handler 530 may forward the write data to the data encryptor 540 . the data encryptor 540 may encrypt the data and pass the encrypted data to the ε - du calculator 550 . the ε - du calculator 550 may xor the encrypted data with the rijndael write block . the result may be a two hundred fifty - six bit xored rijndael block or xored rijndael write block . the ε - du calculator 550 may generate or choose a random key , k2 , at initialization . the ε - du calculator 550 may use k2 in running two or four rounds of rijndael on the xored rijndael write block . the result of running four rounds of rijndael on the xored rijndael write block may be a two hundred fifty - six bit g write block . the g write block may be xored with a two hundred fifty - six bit key , k3 , to arrive at a two hundred fifty - six bit m block . the two hundred fifty - six bit m block may be collapsed to a thirty - two bit mac or first mac via an xor tree . the encrypted data may be written to dram 115 . the nonce and first mac may also be stored off - chip and associated with the encrypted data that is written to dram 115 . when data handler 530 receives a read request , the data handler 530 may receive a read address with the read request . the data handler 530 may pass the read address to the mac computer 535 . the mac computer 535 may retrieve from off - chip memory , a first mac , a nonce , and read data . the mac computer 535 may also retrieve the keys , k1 , k2 and k3 that was stored on - chip when the read data was written to dram 115 . the mac computer 535 may pass the keys , the first mac , the nonce and the read data to the prp f calculator 545 . the prp f calculator 545 may use k1 to run fourteen rounds of rijndael on a two hundred fifty - six bit data block comprised of two hundred eight bits of zeros ( zero pad ), the thirty - two bit address and the sixteen bit nonce . alternatively , in correlation with the write handler , the prp f calculator 545 may run in parallel two instances of two - round one hundred twenty eight - bit aes version of rijndael ). the output of running rijndael may be two hundred fifty - six bits of random data that may be called a rijndael block or rijndael read block . the prp f calculator 545 may pass the rijndael read block to the ε - du calculator 550 . the ε - du calculator 550 may xor the encrypted read data with the rijndael read block . the result may be a two hundred fifty - six bit xored rijndael block or xored rijndael read block . the ε - du calculator 550 may use k2 in running four rounds of rijndael on the xored rijndael read block . the result of running two or four rounds of rijndael may be a two hundred fifty - six bit g block or g read block . the g read block may be xored with a two hundred fifty - six bit key , k3 , to arrive at a two hundred fifty - six bit m block or m read block . the two hundred fifty - six bit m read block may be collapsed to a thirty - two bit second mac via an xor tree . the second mac may be compared to the first mac . if the second mac is not equal to the first mac , the read data may have been compromised or corrupted . if memory is compromised or corrupted , the mac computer 535 may perform memory corruption response procedures . the system and methods for message authentication code pre - computation may be stateless . authentication and encryption algorithms that are stateless may open memory up to replay attacks . for example , an adversary may replace a location of memory with a value that was previously stored in the same location of memory . similarly , an adversary may simply not update dram during a write transaction . these attacks may result in memory that is mistaken as valid after decryption and authentication . for purposes of efficiency , encryption and authentication keys may be created for the whole memory or large portions of memory . in an effort to thwart the previously described replay attacks , encryption and authentication keys associated with memory may be periodically refreshed . an embodiment of memory key refreshing may comprise dividing memory into two regions . memory is an ordered array that may be divided into a first region and a second region . the first region and the second region may be separated by a boundary address . the first region may be encrypted and authenticated with a first set of keys . the second region may be encrypted and authenticated with a second set of keys . the refresh method comprises growing one region of memory at the expense of the other region . thus the second region may grow until the boundary of the second region reaches the end of memory . the end of memory may be a highest addressable address or a lowest addressable address . as data is written to the second region of memory , the second set of keys may be used to decrypt and authenticate data . when the boundary reaches the end of memory , for example the boundary reaches the lowest addressable address , the keys for the first region of memory may be retired and a new third set of keys may be generated for the first region of memory . as data is written to memory , the data is encrypted and authenticated using the third set of keys and the data is placed in the first region of memory . the first region of memory may be grown at the expense of the second region of memory . this continues until the boundary again reaches the end of memory , for example the highest addressable address of memory . the method continues by generating a fourth set of keys . as new data is written to memory , the data is encrypted and authenticated using the fourth set of keys and the data is placed in the second region of memory . this method of regenerating keys and writing to separate regions of memory continues . the system 500 in one example comprises a plurality of components such as one or more of computer software components . a number of such components can be combined or divided in the system 500 . an example component of the system 500 employs and / or comprises a set and / or series of computer instructions written in or implemented with any or a number of programming languages , as will be appreciated by those skilled in the art . the system 500 in one example comprises a vertical orientation , with the description and figures herein illustrating one example orientation of the system 500 , for explanatory purposes . the system 500 in one example employs one or more computer - readable signal - bearing media . the computer - readable signal - bearing media store software , firmware and / or assembly language for performing one or more portions of one or more implementations of the invention . the computer - readable signal - bearing medium for the system 500 in one example comprise one or more of a magnetic , electrical , optical , biological , and atomic data storage medium . for example , the computer - readable signal - bearing medium comprise floppy disks , magnetic tapes , cd - roms , dvd - roms , hard disk drives , and electronic memory . the steps or operations described herein are just for example . there may be many variations to these steps or operations without departing from the spirit of the system 500 and method 200 , 300 , 400 . for instance , the steps may be performed in a differing order , or steps may be added , deleted , or modified . although example implementations of the system 500 and method 200 , 300 , 400 have been depicted and described in detail herein , it will be apparent to those skilled in the relevant art that various modifications , additions , substitutions , and the like can be made without departing from the spirit of the method 200 , 300 , 400 and these are therefore considered to be within the scope of the system 500 and method 200 , 300 , 400 as defined in the following claims . | 7 |
the preferred embodiment of the invention will be described in the context of a vibratory rotation sensor for which the control and readout is accomplished with multiplexed signals . the vibratory rotation sensor which will serve in illustrating the use of the invention consists of a resonator , a housing to which the resonator is attached , and multiplex electronics . the resonator can be any rotationally - symmetric thin - walled object having standing - wave vibration modes . the prior art typically suggests that the resonator be hemispherical in shape . a simplified method for determining the parameters of the standing waves and controlling the dynamics of the resonator is illustrated in fig2 . the standing waves are describable with respect to x and y axes fixed with respect to the resonator . the orientation of the inphase standing wave with respect to the resonator can be specified by the orientation angle θ of an inphase antinodal axis measured clockwise from the x axis . the deviation of the resonator rim from a circle along the inphase antinodal axis is assumed to vary as cos ( ωt + φ ) where ω is the vibration frequency , t is time , and φ is an arbitrary phase angle . the orientation of the quadrature standing wave with respect to the resonator is specified by the orientation angled θ + π / 4 of a quadrature antinodal axis measured clockwise from the x axis . the deviation of the resonator rim from a circle along the quadrature antinodal axis is assumed to vary as sin ( ωt + φ ). the circumferentially - continuous resonator electrode 42 , deposited on the interior surface of the resonator , is biased to a dc voltage v b and is connected through a dc - blocking capacitor 43 to the amplifier - demultiplexer 44 . eight electrodes 46 attached to the vrs housing are equally spaced about the circumference in close proximity to the resonator electrode 42 , the uppermost xp electrode being centered on the x - axis . the eight electrodes 46 are supplied with the driving voltages v xpk ( t ), v xnk ( t ), v ypk ( t ), and v ynk ( t ) from the multiplexer 48 where v . sub . xpk ( t )= a . sub . k ( 2θ . sub . r ) v . sub . mxr ( t ) cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- a . sub . k ( 2θ . sub . r ) v . sub . myr ( t ) sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) u . sub . xp ( t ) v . sub . xnk ( t )=- a . sub . k ( 2θ . sub . r ) v . sub . mxr ( t ) cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ a . sub . k ( 2θ . sub . r ) v . sub . myr ( t ) sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) u . sub . xn ( t ) v . sub . ypk ( t )= a . sub . k ( 2θ . sub . r ) v . sub . mxr ( t ) sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ a . sub . k ( 2θ . sub . r ) v . sub . myr ( t ) cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) u . sub . yp ( t ) v . sub . ynk ( t )=- a . sub . k ( 2θ . sub . r ) v . sub . mxr ( t ) sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- a . sub . k ( 2θ . sub . r ) v . sub . myr ( t ) cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) u . sub . yn ( t )( 1 ) v . sub . xp1 ( t )= v . sub . mxr ( t ) cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) tan 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) u . sub . xp ( t ) v . sub . xn1 ( t )=- v . sub . mxr ( t ) cos ( ω . sub . xr t + ψ . sub . xr )+ v . sub . myr ( t ) tan 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) u . sub . xn ( t ) v . sub . yp1 ( t )= v . sub . mxr ( t ) tan 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ v . sub . myr ( t ) cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) u . sub . yp ( t ) v . sub . yn1 ( t )=- v . sub . mxr ( t ) tan 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) u . sub . yn ( t ) ( 3 ) v . sub . xp2 ( t )= v . sub . mxr ( t ) cot 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) u . sub . xp ( t ) v . sub . xn2 ( t )=- v . sub . mxr ( t ) cot 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ v . sub . myr ( t ) cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) u . sub . xn ( t ) v . sub . yp2 ( t )= v . sub . mxr ( t ) cos ( ω . sub . xr t + ψ . sub . xr )+ v . sub . myr ( t ) cot 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) u . sub . yp ( t ) v . sub . yn2 ( t )=- v . sub . mxr ( t ) cos ( ω . sub . xr t + ψ . sub . xr )- v . sub . myr ( t ) cot 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) u . sub . yn ( t ) ( 4 ) at any particular time , the driving voltages correspond to some particular value of k . the value of k is chosen so that the magnitudes of the driving voltages remain at practical levels . for example , the k = 1 driving voltages might be used for values of 2θ r between 7 π / 4 and π / 4 and between 3 π / 4 and 5 π / 4 where tan2θ r is less than or equal to one . the k = 2 driving voltages might be used for values of 2θ r between π / 4 and 3 π / 4 and between 5 π / 4 and 7 π / 4 where cot2θ r is less than or equal to one . it should be noted that the driving voltages require the computation of only one function of the quantity 2θ r at any particular time . the excitation voltages v mxr ( t ) cos ( ω xr t + ψ xr ) and v myr ( t ) cos ( ω yr t + ψ yr ) are components is the x r - y r tracking - angle coordinate system of fig2 ( denoted by the r in the subscripts ). the preferred embodiments of the excitation voltages include the sinusoids cos ( ω xr t + ψ xr ) and cos ( ω yr t + ψ yr ). there are a variety of periodic functions f ( ω xr t + ψ xr ) which may be utilized instead of the sinusoids including ordinary square waves . the x r - axis is rotated clockwise from the x - axis by the tracking angle θ r . the excitation voltages are designed not to affect the parameters of a standing wave on the resonator . the angular frequencies ω xr and ω yr and phases ψ xr and ψ yr depend on the type of multiplexing being used . the forcing voltages v cx ( t ) u xp ( t ), v cx ( t ) u xn ( t ), v cy ( t ) u yp ( t ), and v cy ( t ) u yn ( t ) ( expressed as components in the x - y coordinate system ) cause forces to be applied to the resonator for the purpose of controlling the parameters of the one or more standing waves on the resonator . the functions u xp ( t ), u xn ( t ), u yp ( t ), and u yn ( t ) are generated by control unit 50 and supplied to multiplexer 48 . the voltages v cx ( t ) and v cy ( t ) are predetermined functions used to isolate the forcing voltages from the excitation voltages . the current i ( t ) flowing from the resonator electrode 42 into the amplifier - demultiplexer 44 is given by i . sub . xpk ( t )= k . sub . i a . sub . k v . sub . mxr ( t ) ω . sub . xr cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- a . sub . k v . sub . myr ( t ) ω . sub . yr sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) ω . sub . uxp u . sub . xp ( t )! c . sub . xp i . sub . xnk ( t )= k . sub . i - a . sub . k v . sub . mxr ( t ) ω . sub . xr cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ a . sub . k v . sub . myr ( t ) ω . sub . yr sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cx ( t ) ω . sub . uxn u . sub . xn ( t )! c . sub . xn i . sub . ypk ( t )= k . sub . i a . sub . k v . sub . mxr ( t ) ω . sub . xr sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ a . sub . k v . sub . myr ( t ) ω . sub . yr cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) ω . sub . uyp u . sub . yp ( t )! c . sub . yp i . sub . ynk ( t )= k . sub . i - a . sub . k v . sub . mxr ( t ) ω . sub . xr sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- a . sub . k v . sub . myr ( t ) ω . sub . yr cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cy ( t ) ω . sub . uyn u . sub . yn ( t )! c . sub . yn ( 6 ) the capacitances c xp , c xn , c yp , and c yn are the capacitances of the xp , xn , xp , and yn electrodes 46 with respect to the resonator electrode 42 . the angular frequencies ω uxp , ω uxn , ω uyp , and ω uyn are those associated with the corresponding u &# 39 ; s and are typically equal to or less than 2ω where ω is the resonator vibration frequency . the symbol k i denotes a constant . the phase differences between the driving voltages and the resulting currents are of no relevance and have been ignored in the equations above . the capacitances are given by where terms involving higher orders of d i and d q have been omitted . the effects of the higher - order terms are taken into account in subsequent processing operations . the quantity c o is the capacitance of the electrode pairs when the resonator is not excited , d i and d q are the maximum flexing amplitudes respectively of the inphase and quadrature modes divided by the gap between the resonator electrode 42 and the electrodes 46 when the resonator is not excited , θ is the angle between the antinode of take inphase standing wave and the x - axis , ω is the angular frequency of vibration of the resonator , and φ is an arbitrary phase angle . substituting the expressions for the capacitances in the current equations and summing to obtain i , we obtain ## equ2 ## the current i ( t ) is transformed into the voltage v ( t ) by the amplifier - demultiplexer 44 : v . sub . k ( t )= k . sub . v v . sub . xk ( t ) r . sub . x ( t )+ v . sub . yk ( t ) r . sub . y ( t )!+ k . sub . f f . sub . x ( t )+ f . sub . y ( t )! ( 9 ) f . sub . y ( t )= v . sub . cy ( t ) ω . sub . uyp u . sub . yp ( t ) c . sub . yp + ω . sub . uyn u . sub . yn ( t ) c . sub . yn ! ( 11 ) the signals r xk ( t ) and r yk ( t ) are the desired outputs from a demultiplexing process applied to v ( t ) since they contain the standing wave parameters d i , d q , θ - θ r , ω , and φ . signals s x ( t ) and s y ( t ) containing the signals r xk ( t ) and r yk ( t ) are extracted by amplifier - demultiplexer 44 . the operating principle of the demultiplexer portion of the amplifier - demultiplexer 44 depends on the form of the voltages v mxr ( t ), v myr ( t ), v cx ( t ), and v cy ( t ) and the values of ω xr , ω yr , ψ xr , and ψ yr . for frequency - division multiplexing , v mxr ( t ), v myr ( t ), v cx ( t ), and v cy ( t ) are all equal to a constant , ω xr , ψ yr , are | ω xr - ω yr | are greater than about 6ω , and ψ xr , and ψ yr are arbitrary constants . the signals r x ( t ) and r y ( t ) which contain the standing - wave parameters are obtained by performing two product demodulations of v ( t ), one with respect to cos ( ω xr t + ψ xr ) and the other with respect to cos ( ω yr t + ψ yr ). if a periodic function other than a sinusoid is being used , then the demodulations proceed using replicas of the periodic functions . a product demodulation consists of multiplying the input voltage by the reference sinusoid ( or replica ) and lowpass filtering the product , the cutoff frequency of the lowpass filter being about 3ω . the results of the above process are the signals s fdmx ( t ) and s fdmy ( t ): where k fdm is a constant . because the upper limit to the frequency spectrums of f x ( t ) and f y ( t ) are about 3ω , these quantities are eliminated by the demultiplexing process . for phase - division multiplexing , ω xr and ω yr have the same value ω o , ω o being greater than about 6ω , and ψ xr - ψ yr is equal to π / 2 radians . the signals s pdmx ( t ) and s pdmy ( t ) are obtained by performing product demodulations of v ( t ) with respect to cos ( ω o t + ψ x ) and with respect to cos ( ω o t + ψ y ) ( or with respect to replicas of the periodic functions being used ). for one form of time - division multiplexing , ω xr and ω yr have the same value ω o with ω o being greater than about 6ω and ψ xr , and ψ yr are equal to an arbitrary number ψ o . the voltages v mxr ( t ) and v myr ( t ) are proportional to square waves which take on values of 0 and 1 , only one of which being equal to 1 at any given time and the duration of a &# 34 ; 1 &# 34 ; value being equal to an integer times 2 π / ω . the voltages v cx ( t ), and v cy ( t ) are both equal to a constant . the signals s tdmx ( t ) and s tdmy ( t ) are obtained by performing a product demodulation of v ( t ) with respect to cos ( ω o t + ψ o ) ( or replica ) followed by parallel multiplications with v mxr ( t ) and v myr ( t ): where k tdm is a constant . it should be noted that r x ( t ) and r y ( t ) are available only when v mxr ( t ) and v myr ( t ) are non - zero . the same results are obtained ( except possibly for the value of the constant k tdm ) if v mxr ( t ), v myr ( t ), v cx ( t ) and v cy ( t ) are proportional to square waves which take on values of 0 and 1 , only one of the square waves being equal to 1 at any given time , and the duration of a &# 34 ; 1 &# 34 ; value being equal to an integer times 2 π / ω . this mode of operation may be desirable in that it completely isolates the forcing voltages v cx ( t ) u xp ( t ), v cx ( t ) u xn ( t ), v cy ( t ) u yp ( t ), and v cy ( t ) u yn ( t ) from each other and from the excitation voltages v mxr ( t ) cos ( ω o t + ψ o ) and v myr ( t ) cos ( ω o t + ψ o ). for another form of time - division multiplexing , ω o equals 0 and v mxr ( t ), v myr ( t ), v cx ( t ), and v cy ( t ) are proportional to square waves which take on values of 0 and 1 , only one of the square waves being equal to 1 at any given time , and the duration of a &# 34 ; 1 &# 34 ; value being equal to an integer times 2 π / ω . multiplying v ( t ) in parallel operations by v mxr ( t ) and by v myr ( t ) gives the same results as in the first form of time - division multiplexing . for code - division multiplexing , ω xr , ω yr , ψ xr , ψ yr are all equal to 0 , v cx ( t ), and v cy ( t ) are constants , and v mxr ( t ) and v myr ( t ) are proportional to square waves which take on pseudo - random sequences of values of - 1 / t and 1 / t and satisfy the following conditions : ## equ3 ## where the subscripts i and j stand for any of the subscripts mxr , myr , cx , and cy . the integration time interval t should be less than 2 π / 3ω . the signals s cdmx ( t ) and s cdmy ( t ) are obtained by separately multiplying v ( t ) by v mxr ( t ) and v myr ( t ) and then integrating over t : where k tdm is a constant and n is an integer . it should be noted that the signals s cdmx ( t ) and s cdmy ( t ) provide information concerning the standing - wave parameters at intervals of t . the voltages u x ( t ) and u y ( t ) typically may include three components : where the subscripts a , q , and r identify the amplitude , quadrature and rate control voltages . it is not necessary to isolate these components from one another in all applications . however , if isolation is desired , the following substitutions can be made in the foregoing equations . v . sub . cay ( t ) u . sub . ayn ( t )+ v . sub . cqy ( t ) u . sub . qyn ( t )+ v . sub . cry ( t ) u . sub . ryn ( t ) for v . sub . cy ( t ) u . sub . yn ( t ) ( 18 ) with these substitutions , any constraints imposed on v cx ( t ) and v cy ( t ) also apply to v cax ( t ), v cqx ( t ), v crx ( t ), v cay ( t ), v cqy ( t ), and v cry ( t ). for example , equations ( 1 ) become v . sub . xp ( t )= a . sub . k ( 2θ . sub . r ) v . sub . mxr ( t ) cos 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- a . sub . k ( 2θ . sub . r ) v . sub . myr ( t ) sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cax ( t ) u . sub . axp ( t )+ v . sub . cqx ( t ) u . sub . qxp ( t )+ v . sub . crx ( t ) u . sub . rxp ( t ) v . sub . xn ( t )=- a . sub . k ( 2θ . sub . r ) v . sub . mxr ( t ) cos 2θ . sub . r cos ( ω . sub . x rt + ψ . sub . xr )+ a . sub . k ( 2θ . sub . r ) v . sub . myr ( t ) sin 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cax ( t ) u . sub . axn ( t )+ v . sub . cqx ( t ) u . sub . qxn ( t )+ v . sub . crx ( t ) u . sub . rxn ( t ) v . sub . yp ( t )= a . sub . k ( 2θ . sub . r ) v . sub . mxr ( t ) sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )+ a . sub . k ( 2θ . sub . r ) v . sub . myr ( t ) cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr )+ v . sub . cay ( t ) u . sub . ayp ( t )+ v . sub . cqy ( t ) u . sub . qyp ( t )+ v . sub . cry ( t ) u . sub . ryp ( t ) v . sub . yn ( t )=- a . sub . k ( 2θ . sub . r ) v . sub . mxr ( t ) sin 2θ . sub . r cos ( ω . sub . xr t + ψ . sub . xr )- a . sub . k ( 2θ . sub . r ) v . sub . myr ( t ) cos 2θ . sub . r cos ( ω . sub . yr t + ψ . sub . yr + v . sub . cay ( t ) u . sub . ayn ( t )+ v . sub . cqy ( t ) u . sub . qyp ( t )+ v . sub . cry ( t ) u . sub . ryn ( t ) ( 19 ) one possible time - division - multiplex configuration is a sixteen - slot frame of duration 32 π / ω synchronized to the flexure rate of the resonator . the multiplex control voltages are as shown in fig3 . when θ r equals θ , the x r axes coincide with the antinodal axes and the y r axes coincide with the nodal axes . eight slots are assigned to reading out the y r signal component , 4 slots to reading out the x r signal component , and 1 slot each to applying amplitude , quadrature , and rate forces to the resonator . for a vibration frequency of 4 khz , readouts of the x r and y r signal components would be available at a rate of 2 khz and 1 khz respectively . the control voltages would be applied at a rate of 0 . 25 khz . in general , the signals s x ( t ) and s y ( t ) exiting from the amplifier - demultiplexer 44 have the form where k vx and k vy each equals k v except in the case of time - division multiplexing when k vx equals k v v mx ( t ) and k vy equals k v v my ( t ). in order to extract the standing - wave parameters from the signals s x ( t ) and s y ( t ), a stable and precise replica of the resonator vibration signal cos ( ωt + φ ) is required . the replica is obtained from a voltage - controlled oscillator in replica generator 52 wherein the voltage - controlled oscillator is phase - locked to the in - phase standing - wave antinodal signal . the first step of the process is to multiply s x ( t ) and s y ( t ) first by the replica signal cos ( ω r t + φ r ) and lowpass filter the results and then by the phase - shifted replica sin ( ω r t + φ r ) and lowpass filter the results . the results of this process are : ## equ4 ## where k is a constant . the next step is to form the following combinations of products of the s ix ( t ), s iy ( t ), s qx ( t ), and s qy ( t ): l . sub . i = 2 ( s . sub . ix s . sub . qx + s . sub . iy s . sub . qy )=( ka . sub . k ). sup . 2 ( d . sub . i . sup . 2 - d . sub . q . sup . 2 ) sin 2 ( ω . sub . r - ω ) t + 2 ( φ . sub . r - φ ! ( 22 ) with l i ( t ) as the error signal , the phase - locked loop will lock up with the replica phase or equal to φ r equal to φ and ω r equal to ω . the difference between the standing - wave orientation angle and the tracking angle θ - θ r , can be determined from the equation ## equ5 ## and the signs of s ix ( t ) and s iy ( t ). the quantity s ( t ) can be used as the error signal in a control loop which generates θ r and causes on average θ to equal θ r and d / dt ( θ - θ r ) to equal 0 . the digitally - synthesized tracking angle θ r is used in generating tan2θ r or cot2θ r , depending on the value of 2θ r , which is supplied to the multiplexer 48 . the actual value of θ at any given time is given by ## equ6 ## the difference between e ( t ) and a specified number is used as the error signal in the amplitude control loop which causes the total energy in the combined inphase and quadrature standing waves , which is proportional to d i 2 + d q 2 , to equal the specified number . the quantity q ( t ) is used as the error signal in the quadrature control loop which results in the quadrature standing - wave amplitude d q to be zero . when this loop is closed , the amplitude control loop maintains the inphase amplitude d i at a specified value . the use of the above control variables can be shown to be optimum . it will be apparent to those skilled in the art that there are many choices of control variables that are suboptimum but still practical . the outputs of the control unit 50 are the functions u xp ( t ), u xn ( t ), u yp ( t ), and u yn ( t ) together with the tangent or the cotangent of 2θ r , which are all supplied to multiplexer 48 . additional details concerning vibratory rotation sensors are contained in u . s . pat . no . 4 , 951 , 508 by loper , jr . et al . dated aug . 28 , 1990 which is incorporated by reference . | 6 |
through transmission welding by various sources of radiation is known . the use of lasers as the radiation source represents a subset of this welding technology . the arrangement of the laser oriented to pass through an upper substrate to the joint is described in detail in u . s . pat . no . 5 , 893 , 959 , the contents of which are incorporated herein by reference thereto . above and beyond the teachings of u . s . pat . no . 5 , 893 , 959 , the present invention includes the features of : lasers matched to absorption peaks above 350 nm , for example , nd : yag tripled ( 354 ), nd : yag doubled ( 532 nm ), argon ( 488 and 514 nm ), cu vapor ( 511 and 578 nm ), ruby ( 694 . 3 nm ), hene ( 632 . 8 nm ), krypton ( 647 nm ), vis diode ( about 600 to 780 nm ) and dye lasers ( 577 to 593 nm ); laser absorbing dyes disposed in the upper substrate at the joint region ; laser absorbing dyes disposed in a separate film or lamina clamped between the substrates ; laser absorbing dyes disposed in the lower substrate at the joint region or thoughout all or part of the substrate ; substrates selected from a variety of polymers , for example , polycarbonate , polymethylmethacrylate ( pmma ), polyamides , and polyesters and films made of these polymers ; polyolefin films ; transparent substrates including clear , water - white and cosmetically tinted but still transparent substrates ; a variety of aesthetically demanding applications ; and novel absorption ratios to determine dye efficiency and photopic values to determine dye performance . the dye may be introduced into the joint region in several ways . first , the dye can be incorporated into a thin film . the film is preferably made of the same material as at least one of the substrates . if the film is made from a different material than a substrate , the film should be compatible with , i . e . soluble in , the polymer . the film may contain on the order of one ten - thousandths part dye on a weight basis . the film thickness may be on the order of tens of microns thick . second , the dye may be incorporated into a surface of either substrate facing the joint via insert molding , dip coating , dye infusion , painting , printing , spraying . the dye may furthermore be incorporated into the entire lower substrate since only the surface facing the joint will be reactive . previously it was thought that laser welding wavelengths had to be at least above 800 nm , outside the visible region , in order to be useful in demanding aesthetic applications . the theory was that any absorption bands between 380 nm and 780 nm would strongly interfere with the transmission of visible light resulting in darkly or intensely colored portions by virtue of their dye content . furthermore , it was thought that incident laser radiation below 380 nm would adversely sever polymeric bonds . surprisingly it was discovered that only radiation below 350 nm would adversely affect the polymeric bonds . even more astonishing was the discovery that laser welding wavelengths in the visible spectrum could be used if the concentration of the dye was balanced against the dye &# 39 ; s absorption bandwidth . applicant has developed a novel two part rating system to measure and balance dye efficiency and dye performance especially for through - transmission laser welding . part 1dye efficiency . dye concentration is a key issue that drives the need for screening and selecting general - purpose dyes usable in a range of concentrations for different applications . currently in order to assess the effect of different concentrations , a part needs to be reproduced at nominal thicknesses and doped at different levels so that all the reproductions can be tested . this process may have to be repeated for parts of different thicknesses . the expense and required resources for such testing cycles may be commercially unreasonable . in addition , it can be very difficult to test thin films or larnina because reflections off the front and back surfaces can create interference patterns that obfuscate the dye transmission data or differences between measured films . furthermore , thicker pieces have another problem in that their own transmission characteristics may mask or overshadow what would otherwise be extremely high transmission bands of the dye . for cosmetically tinted pieces , the transmission characteristics of the cosmetic tint may further mask or overshadow the transmission bands of the dye . applicants have developed a measure that they call “ absorbance ratio ” that measures the relative optical density ( od ) as a function of wavelength . the beer lambert law , defines the od at a given wavelength ( wv ) as c is the molar concentration of the absorber in the host material ( mol / l ); k is the molar extinction coefficient of the absorber in the host material at the wavelength in question ( l /( mol · cm )) four separate optical density measurements are used to generate one absorbance ratio point at a given wavelength . this absorbance ratio uses the dye &# 39 ; s absorption band matched to a laser welding wavelength as a reference point , having an optical density of unity , for example . this reference value is then compared to the absorbance troughs in the visible spectrum . both values subtract out the absorbance due to the substrate thereby making the ratio independent of substrate contribution or interference . applicants absorbance ratio may be calculated by preparing just two substrate samples of nominal thickness . sample 1 will be devoid of the dye under investigation ( substrate ) and sample 2 will have the dye incorporated therein at concentration x ( substrate + dye ). next , identify a laser wavelength which is within the dye &# 39 ; s absorption band . this will serve as the laser welding wavelength ( lww ) in the denominator of all absorbance ratio equations for a given example . then , plot optical density ( od ) as a function of wavelength ( wv ) as follows in equation 1 : absorbance ratio ( od ) = od ( substrate + dye @ wv ) - od ( substrate @ wv ) od ( substrate + dye @ lww ) - od ( substrate @ lww ) . equation 1 the substrate was doped with a notch absorber at a concentration of between 0 . 05 and 0 . 10 grams per pound of substrate . in this example , the notch includes the 532 nm wavelength of the doubled nd : yag laser . accordingly the laser welding wavelength equals 532 nm ( lww = 532 nm ). this value used in the denominator of equation 1 will be constant for all calculations with this absorber . next we calculate the reference point for our absorbance ratio . the reference point by definition has an optical density ( od ) of unity . the reference point is where the wv equals lww ( 532wl - 532lww ) as is calculated in equation 1 - a as follows : absorbance ratio ( od ) = od ( substrate + dye @ 532 nm ) - od ( substrate @ 532 nm ) od ( substrate + dye @ 532 nm ) - od ( substrate @ 532 nm ) = 1 equation 1 - a note that the absorbance ratio will remain at 1 independent of concentration , substrate type , substrate transmission characteristics or substrate thickness . next we calculate the absorbance ratio at a first visible wavelength . as an example we have selected 592 nm , which is input into equation 1 - b as follows : absorbance ratio ( od ) = od ( substrate + dye @ 592 nm ) - od ( substrate @ 592 nm ) od ( substrate + dye @ 532 nm ) - od ( substrate @ 532 nm ) = . 01 equation 1 - b note that at this visible wavelength the absorbance ratio is yields an optical density one - hundredth less dense than at the reference point . this is shown graphically as point b on fig1 . optionally , we then calculate the absorbance ratio at a second visible wavelength . as an example we have selected 751 rn , which is input into equation 1 - c as follows : absorbance ratio ( od ) = od ( substrate + dye @ 751 nm ) - od ( substrate @ 751 nm ) od ( substrate + dye @ 532 nm ) - od ( substrate @ 532 nm ) = . 001 equation 1 - c note that at this visible wavelength the absorbance ratio yields as optical density one - thousandth less dense than at the reference point . this is shown graphically as point c on fig1 . to summarize , the lww a point serves as a reference point having an optical density of 1 . applicants dye efficiency criteria is based on the relative value of point b . in the example , the b point is two orders of magnitude below the reference point . this suggests that the dye transmits fairly well near the middle of the visible spectrum , represented by the b point , yet very efficiently absorbs at the lww . as indicated by the c point , the dye also transmits extremely well at the high end of the visible spectrum . while the example utilizes a laser welding wavelength in the visible spectrum , it should be understood that other lasers outside the visible wavelength may be selected . applicants selection criteria is equally valid for near ultra - violet welding between about 350 nm and about 380 nm , for example , with the nd : yag tripled at 354 nm . however , it is critical that equations 1 - b , and optionally equation 1 - c , be calculated at wavelengths within the visible spectrum . next we calculate the absorbance ratio for a prior art compound , for example carbon black . we use the same reference point of 532 nm for the lww and we use the same wavelengths as above , 532 nm , 592 nm and 751 nm , for the wv value in the numerator . these points as shown as x , y and z on fig2 . the absorbance ratio at the reference point ( x ) is 1 . 0 . the absorbance ratios at point y is 1 . 0 and at point z is 1 . 1 . the following table presents a side - by - side comparison : absorbance ratios ( ref . graph point ) wavelength 532 nm absorber carbon black 532 nm 1 . 0 ( a ) 1 . 0 ( x ) 592 nm 0 . 01 ( b ) 1 . 0 ( y ) 751 nm 0 . 001 ( c ) 1 . 1 ( z ) [ 0052 ] fig3 shows the full absorbance ratio curves for the 532 absorber and carbon black together . this graph readily shows that the 532 absorber effectively absorbs at the desired laser welding wavelength and absorbs 100 times and 1000 times less strongly at other points within the visible spectrum . carbon black absorbs at about the same strength across the entire visible spectrum . in general we will select dyes that demonstrate this 100 - fold difference . the greater the difference , the better the dyes efficiency rating . however , it is to be noted that a selected dye according to the present invention may have an absorption ratio at a wavelength within the dye &# 39 ; s absorption trough that is less than one - tenth ({ fraction ( 1 / 10 )}) of the dye &# 39 ; s absorbance ratio at a wavelength in the absorption band . this is part one of our selection criteria , part two is the photopic value . part 2dye performance . the photopic value is the eye - integrated value of the filter over the visible spectrum as defined by equation 2 as follows : photopic transmission % = ∫ 380 nm 780 nm t ( x ) · p ( x ) · ic ( x ) x ∫ 380 nm 780 nm p ( x ) · ic ( x ) x × 100 % equation 2 t ( x ) represents the transmission values of the dye in question as a function of wavelength . p ( x ) represents the photopic sensitivity curve as a function of wavelength . ic ( x ) represents the reference light source ( typically illuminant c ) to which the eye &# 39 ; s photopic sensitivity is calibrated as a function of wavelength . [ 0058 ] fig4 shows the p ( x )· ic ( x ) curve . the area under the curve represents the integral of p ( x )· ic ( x ), i . e . the denominator of equation 2 . [ 0059 ] fig5 shows the transmission curve for the 532 nm dye overlying the p ( x ) ic ( x ) curve from fig4 . the cross - hatched area under the combined curves , represents the numerator of formula 2 above . in our present example , the area in fig5 is about twenty percent less than the area of fig4 . accordingly , equation 2 calculates an 80 % photopic value for the dye . [ 0060 ] fig6 shows the transmission curve for carbon black overlying the p ( x )· ic ( x ) curve from fig4 . the cross - hatched area under the combined curves , represents the numerator of formula 2 above . the area in fig5 is about forty percent less than the area of fig4 . accordingly , equation 2 calculates a 60 % photopic value for carbon black . for the sake of comparison , clear plastic , or more particularly water - white polycarbonate possesses a photopic value of about 88 - 90 % depending on thickness and other factors . applicants have discovered that for a general purpose dye , a photopic value within 10 % of water white is ideal and will likely be unseen by the naked eye . furthermore , a at slightly higher dye concentrations or dye concentration gradients , a photopic value within 15 % of water white is highly desirable and may provide only the slightest hint of color under perfect viewing conditions . finally , at greater dye concentrations or higher dye concentration gradients , a photopic value within 20 % of water white is practical and useful where a light pastel coloration to the lower substrate or joint region is acceptable . accordingly , we use high photopic values , within given ranges to water - white as the second performance criteria to evaluate general purpose through - transmission laser welding dyes . below is an exemplary listing of three classes of dyes that achieved a high rating under the criteria of the invention . other classes of dyes with favorable ratings may also exist and are included under this invention . a . the first class of dyes that has both high efficiency and high performance under applicants rating system is metalloporphyrins . this class is characterized by cyclic planar compounds consisting of four pyrrole rings bridged to each other by methyne carbon atoms and chelated with a metal ion bearing a + 2 charge , such as pt + 2 , cu + 2 , or zn + 2 . the candidate dye from example 1 above is a palladium porphyrin . b . the second class of dyes that has both high efficiency and high performance under applicants rating system is metalloazaporphyrins . this class is characterized by cyclic planar compounds consisting of four pyrrole rings bridged to each other by nitrogen atoms and chelated with a metal ion bearing a + 2 charge , such as pt + 2 , cu + 2 , zn + 2 , or pd + 2 . c . the third class of dyes that has both high efficiency and high performance under applicant &# 39 ; s rating system is fischer base dyes . this class is characterized by indolene molecules comprising a benzene ring fused to a pyrrole ring with the n in a position adjacent to the juncture . a dienyl group is attached at the pyrrole carbon adjacent the n and is terminated with numerous molecular moieties which are conjugated with double bonded structures and with various alkyl substituents on the indolene ring . in general , candidate dyes would possess high extinction coefficients . applicant &# 39 ; s rating system then provides a quantitative way to measure whether those candidate dyes also possess a sufficiently low absorbance ratio within the visible spectrum as well as sufficiently high photopic values for the welding application in question . as recited in the claims , a fraction means less than one - half . the word transparent means that images transmitted through a substrate are clearly discemable without linear or spatial distortion . transparent includes clear or water - white plastic panels . transparent also includes plastic panels which are lightly pastel tinted but do not distort the shape or relationship of images , like lightly tinted portions of automobile windows . | 1 |
in the following description , for the purposes of explanation and not limitation , specific details are set forth , such as particular systems , networks , software , components , techniques , etc ., in order to provide a thorough understanding of the present invention . however , it will be apparent to one skilled in the art that the present invention may be practiced in other embodiments that depart from these specific details . in other instances , detailed descriptions of known methods , devices and circuits are abbreviated or omitted so as not to obscure the present invention . methods and systems for increasing performance in raman - amplified optical communication systems can be employed in systems such as those depicted in fig1 i . e ., submarine optical communication systems , or in terrestrial systems . for the purpose of illustration , rather than limitation , an exemplary raman - amplified system is described below for context . those skilled in the art will appreciate that many different system configurations could also implement the present invention . an exemplary architecture for terminal 12 and 18 is provided in the block diagram of fig3 . therein , the long reach transmitters / receivers ( lrtrs ) 30 convert terrestrial signals into an optical format for long haul transmission , convert the undersea optical signal back into its original terrestrial format and provide forward error correction . the wdm and optical conditioning unit 32 multiplexes and amplifies the optical signals in preparation for their transmission over cable 34 and , in the opposite direction , demultiplexes optical signals received from cable 34 . the link monitor equipment 36 monitors the undersea optical signals and undersea equipment for proper operation . the line current equipment 38 provides power to the undersea line units 36 . the network management system ( nms ) 40 controls the operation of the other components in the wdm terminal , as well as sending commands to the line units 36 via the link monitor equipment 36 , and is connected to the other components in the wdm terminal via backplane 42 . functional blocks associated with an exemplary line unit 16 are depicted in fig4 . therein , each fiber has a splitter 50 connected thereto to sample part of the traveling wdm data signal . the splitters 50 can , for example , be implemented as 2 % tap couplers . a photodetector 52 receives the sampled optical signal from its respective splitter 50 and transforms the optical signal into a corresponding electrical signal . the photodetector 52 outputs the electrical signal to a corresponding sub - carrier receiver unit 54 , which detects and decodes the commands present in the sub - carrier modulated monitoring signal that has been modulated on the envelope of the wdm data signal . after decoding the command , the particular sub - carrier receiver 54 determines whether the decoded command is intended for it . if so , the action in the command is executed , e . g ., measuring the power of the wdm signal , measuring the pump power output from one or more lasers in the pump assembly , or changing the supply current to the lasers of the pump assembly . to this end , the sub - carrier receivers 54 are connected to respective current control and power monitoring units ( i settings ) 56 , which each include pump power monitors and pump current controls for each laser in the associated pump laser assembly 58 . the pump modules 58 provide pump light into the optical fibers to amplify the data signals traveling therein using a raman amplification scheme , as generally described above . the gain profile for a single pump wavelength has a typical bandwidth of about 20 - 30 nm . for high capacity wdm communication applications , such a bandwidth is too narrow and , accordingly , multiple pump wavelengths can be employed to broaden the gain profile . fig5 depicts an exemplary pump architecture for providing multiple pump wavelengths in a raman amplification scheme . therein , a number n of pump radiation sources 110 are optically coupled to a respective one of n pump radiation combiners 112 . each of the pump radiation sources 110 generate various pump wavelengths at various pump powers using individual radiation emitters 114 . the individual radiation emitters 114 can , for example , be lasers , light emitting diodes , fiber lasers , fiber coupled microchip lasers , or semiconductor lasers . the combiners 112 combine the various outputs of their respective pump radiation sources , e . g ., by wave division multiplexing , and outputs the combined optical pumping signal to coupler 118 . coupler 118 can be an nxm coupler which takes contributions from all n inputs to provide a representative output at each of m output ports . energy from the coupler 118 is pumped into the optical fiber ( s ) via pump signal combiners 122 . in general , raman pump architectures couple the light generated by pump lasers at various wavelengths and various powers to the optical fibers to pump the optical data signals . those skilled in the art will appreciate that many other types of pumping architectures can be employed to provide raman amplification to optical data signals in accordance with the present invention . in designing an appropriate ( e . g ., flat ) composite gain profile for the pumping signal , a system designer should consider the raman pump — pump and signal — signal interactions . pump - pump interactions refer to the fact that the shorter wavelength pump signals will transfer energy to the longer wavelength pump signals , as well as the optical data signals , due to stimulated raman scattering . likewise , signal — signal interactions refer to the fact that the shorter wavelengths in the signal band will amplify the longer wavelengths in the signal band . these effects become more pronounced as the range of wavelengths selected for the signal band increases . because of the pump — pump and signal — signal interactions , the shorter wavelengths ( within both the pump band and the signal band ) should be generated at a higher power than the longer wavelengths in wideband raman - amplified system . for example , fig6 depicts exemplary pump powers and signal band launch powers for achieving a relatively flat composite gain profile using eight different pump wavelengths and an approximate signal band of 100 nm . those skilled in the art will appreciate that more or fewer than eight pump wavelengths may be used in any given implementation . as seen therein , the pump power decreases for increasing wavelength . likewise , the launch power of the shorter wavelength channels is generally larger than the launch power for the higher wavelength channels , unlike edfa - amplified systems that typically employ a relatively constant launch power across all channels . the slope associated with the launch power as a function of wavelength is sometimes referred to as the launch power tilt , which parameter will be discussed in more detail below . these types of power spectrums for raman pump wavelengths and the optical data channel wavelengths tend to desirably minimize the excursion in the signal - to - noise ratio ( snr ) of the received optical data signal . unfortunately , these techniques for minimizing the excursion in the snr have a less desirable impact when considering the nonlinearities of the optical fiber medium . these nonlinearities , for example self - phase modulation , cross - phase modulation and four - wave mixing , create interactions between the propagating light and the medium and , generally , reduce system performance . the nonlinear effects of the optical fiber medium tend to increase with signal power . thus , power spectrums employed to minimize snr excursion result in the shorter wavelengths ( higher launch power ) experiencing greater nonlinear effects than the longer wavelengths ( lower launch power ). the greater the launch power tilt , the greater the variance in the nonlinear effects across the signal bandwidth . this variance in nonlinear effects across a wideband in raman amplified optical communication systems adversely impacts overall system performance . when considering optical communication system performance generally , it is important to consider ( in addition to snr ) a parameter known as the q factor , which is generally considered to be a good measure of overall system performance because it takes into account both noise and isi ( e . g ., the aforementioned nonlinear effects ). specifically , the q factor is related to bit error ratio ( ber ) as it is the argument to the normal error function used to calculate the ber . a detailed discussion of the q factor , and its general use in optical system performance measurement , is beyond the scope of this discussion however the interested reader is referred to optical fiber telecommunications , edited by kaminow and koch , volume iiia , chapter 10 , pp . 314 - 329 ( 1997 ), the disclosure of which is incorporated here by reference . what is significant , however , is that the q factor is an important design factor in optical communication systems that typically is used to provide a performance target for the system as a whole . fig7 presents a graph plotting the q factor as a function of snr for an exemplary raman amplified system , using a pumping scheme that is similar to that described above and with a launch power tilt of about 4 db , i . e ., the launch power of the shortest wavelength channel in the signal band is about 4 db greater than the launch power of the longest wavelength channel . specifically , q vs snr is plotted for both a shorter wavelength channel and a longer wavelength channel in a wdm raman amplified system having a channel spacing of 50 ghz . note that the particular values depicted in this graph and the particular pumping scheme used to generate these values are not significant per se , instead what should be noted from this particular figure is that the q factor performance of the shorter wavelength channel is worse than that of the longer wavelength channel . moreover , the difference in q factor performance tends to increase with snr and the q performance of the shorter wavelength peaks before that of the longer wavelength ( in this example the shorter wavelength peaks at an snr of about 14 db ). note also the relatively large difference between the q factor of the shorter wavelength channel and the q factor of the longer wavelength channel , e . g ., about 1 - 1 . 5 db at an snr of about 14 db . fig8 is a graph of the q factor as a function of channel number , where increasing channel number corresponds to increasing wavelengths . again , the phenomenon described above with respect to fig7 is also seen here , as the system performance in the lower numbered channels is distinctly poorer than that of the higher numbered channels . for the reasons described above , given the tension in raman amplified systems between minimizing snr excursion and equalizing nonlinear effects , applicants believe that this phenomenon will be common to all wideband applications of raman amplified optical communication systems . the issue then becomes one of system design given this phenomenon . a straightforward way of approaching this problem is to accept that the system will be performance limited by the shorter wavelength channels . thus , taking the exemplary system characteristics depicted in fig7 a system designer might conclude that it would be undesirable to increase the launch power to a point beyond which the shorter wavelength channel &# 39 ; s q performance begins to significantly drop off , e . g ., an snr of 14 db and a q of slightly more than 13 db . this has the unfortunate ramification of limiting the better performing longer wavelength channels &# 39 ; q performance , which could otherwise accept higher power without q degradation , i . e ., the system becomes limited by the greater nonlinear effects experienced in the shorter wavelength portion of the data carrying bandwidth . exemplary embodiments of the present invention provide techniques and systems for addressing this dilemma . specifically , exemplary embodiments of the present invention provide techniques and systems which permit higher system launch power by substantially equalizing the system q performance across the entire bandwidth of a raman amplified optical communication system . the following test simulation studies were based on an exemplary raman - amplified optical communication system having the following parameters : the increase in nonlinear effects , which are the result of the variable launch powers used to equalize the snr excursion are , according to these exemplary embodiments , offset by increased spacing between selected channels . more specifically , by increasing the channel spacing of selected channels as a function of launch power tilt , the q factor for the entire system can be equalized and system snr raised . note that , unlike the above incorporated article by davidson et al . describing the use of increased channel spacing to offset unexpected noise in an edfa - amplified system , exemplary embodiments of the present invention provides techniques for selecting channel spacings as a function of launch power tilt to offset the variance in nonlinear effects caused by the launch power tilt in a raman - amplified system . a first example is provided in fig9 where the impact of increased channel spacing in the most nonlinear ( highest launch power ) region of a raman system is evaluated . therein , the effect of increasing the channel spacing between channels 1 and 2 is shown to increase the q performance of channel 1 , ultimately close to single channel performance at a spacing of 80 ghz and beyond . the impact of increased channel spacing on the ability to increase launch power ( which results in increased snr ) in the shorter wavelengths is shown in the graph of fig1 . therein , it can be seen that the point at which the q performance of channel 1 drops off with increased snr shifts to the right as channel spacing increases . applicants have likewise studied the impact of wider channel spacings at higher numbered channel ( longer wavelengths ), examples of which are provided as fig1 and 12 for channel numbers 25 and 125 , respectively . these graphs indicate that the benefits of wider channel spacings , from a q performance perspective , tend to diminish with increased wavelength . these results have enabled applicants to design raman - amplified optical communication systems that have substantially the same q factor across the entire channel range . specifically , by widening the channel spacing in the region of the signal bandwidth where the launch power and nonlinear effects are significantly higher , applicants have designed raman - amplified optical communication systems wherein the q performance of the channels in the nonlinear region can be made substantially similar to that of the other channels . consider , for example , the graph of fig1 . therein , the first 40 channels have a spacing of 100 ghz , while the remaining 210 channels have a spacing of 40 ghz . plotted here are the q performances for channels # 1 , 25 , 125 and 250 across a range of relative snrs ( the actual snr at 0 is about 14 db ). note that the q performance on each of these channels is substantially similar over a broad range of snrs ( e . g ., a q range of less than about 0 . 5 db at snrs greater than 12 db ) that could be selected for system operation . in particular , this graph illustrates that the system is no longer limited by the q factor performance of the lower numbered channels and that it can operate at higher snrs , meaning that launch power across the data carrying bandwidth can be increased . another example is provided in fig1 . therein , the first 30 channels have a spacing of 90 ghz , while the remaining 220 channels have a spacing of 45 ghz . once again , the channels are closely grouped in their q performance so that no particular channel or group of channels mandates a low overall system snr . in the foregoing examples , the channel spacing was increased for about the first 12 % of the data carrying bandwidth . of course , system implementations will vary , however applicants contemplate that increased channel spacing for the first 10 - 15 % of the channel bandwidth will provide the desired q factor equalization described above for most wideband , raman - amplified optical communication systems . those skilled in the art will recognize that there is a tradeoff between increased channel spacing and system capacity , e . g ., doubling the channel spacing for the first 12 % of the bandwidth reduces overall capacity by 6 %. one approach is to accept the reduced capacity in favor of the improved system performance . another approach is to reduce the channel spacing of the channels outside of the highly nonlinear region of the bandwidth to compensate , partially or completely , for the increased channel spacing of the channels that are in the nonlinear portion . for example , if the channel spacing of the first 12 % of the bandwidth is doubled , then the channel spacing of the remaining 88 % can be reduced by 6 %, e . g ., from 50 ghz to 47 ghz . this reduction in channel spacing will slightly increase the nonlinear effects for the remaining 88 % of the bandwidth , but will restore the overall capacity of the system to that of uniform channel spacing across the entire bandwidth . those skilled in the art will appreciate , therefore , that the present invention contemplates a widening of the channel spacing in the nonlinear portion of the bandwidth , e . g ., the first 10 - 15 %, and , optionally , a reduction in the channel spacing of the remaining bandwidth , e . g ., 90 - 85 %. as mentioned earlier , the present invention recognizes the impact of launch power tilt on q performance of raman - amplified optical communication systems . although the foregoing exemplary embodiments have focused on increasing the channel spacing by a fixed amount in the most non - linear region of the signal bandwidth and then either maintaining or reducing the channel spacing in the remainder , those skilled in the art will appreciate that the present invention can also be implemented to provide more than two different channel spacings within the signal band . in fact , at its most general , the present invention contemplates that channel spacing for wideband raman systems will be selected as a function of the launch power tilt . consider fig1 which depicts various such functions . as described above , a step function 1000 can be employed wherein two different channel spacings are used in the signal bandwidth with the smaller channel spacing being provided over the lower launch power and the greater channel spacing being provided over the higher launch power . alternatively , it would also be possible to increase the spacing between each of n channels as shown by function 1010 . of course it is further possible to use functions between the two which are illustrated in fig1 , i . e ., having more than two steps and less than n − 1 steps , the selection of which will be guided by the recognition that more variations in channel spacing also tend to increase system complexity . to equalize q performance across the signal bandwidth , the selected function should also follow the general relationship that a 1 db launch power tilt can be offset by approximately a 25 % channel spacing increase . the preferred embodiments have been set forth herein for the purpose of illustration . however , this description should not be deemed to be a limitation on the scope of the invention . accordingly , various modifications , adaptations , and alternatives may occur to one skilled in the art without departing from the scope of the claimed inventive concept . | 7 |
with reference to fig1 , a cvd cold - wall reactor 11 is provided with a deposition zone 21 that is constructed so as to enclose an environment supporting thin film deposition onto a substrate . in particular , one or more process gas inlets 17 are provided for supplying gaseous cvd precursors via a showerhead assembly 19 toward a substrate 29 within the reactor 11 , while one or more exhaust outlets is provided for removing any excess process gas and reaction products from the chamber 21 . a movable carrier 25 receives and transports a substrate to be processed into the deposition zone 21 , where it can be subject to any known cvd process . in fig1 , the carrier 25 moves out of the plane of the drawing on opposed rollers 36 , 38 . the deposition zone 21 may be considered as a central reactor within the larger cold - wall reactor 11 that provides the low pressure or vacuum environment for the deposition zone 21 , substrate access ports , heating and cooling sources , radio frequency energy and substrate rotation if needed . such cold - wall reactors are commercially known . a typical film to be deposited is a gallium arsenide film . precursor gases are typically trimethyl gallium and arsine . as seen in the enlarged view of the deposition zone 21 in fig2 , the carrier track 25 holds an oversized wafer susceptor 27 supporting a wafer substrate 29 thereon . the carrier 25 may be transparent material , such as fused silica or quartz , and the susceptor 27 may be preferably constructed from graphite material to form a thermal susceptor that is radiantly heatable by a set of lamps 28 located beneath the transparent carrier 25 . the wafer substrate 29 may be heated by thermal conduction from the heated susceptor 27 on which it sits . the wafer carrier 27 and wafer substrate 29 are received by the carrier 25 into the deposition zone 21 , e . g . through a port in the reactor 11 , and likewise exits the deposition zone 21 through the same or a different port . the reactor 11 may include multiple processing and / or inspection chambers connected to each other through such ports , with the carrier 25 facilitating transport of a substrate on a wafer carrier between such chambers . within a portion of the chamber 21 , a cvd hot zone is created as a first environment where cvd precursor gases 24 supplied to the chamber 21 by the showerhead assembly 19 through a plurality of apertures , not shown , react to form cvd reaction products that are formed on a substrate 29 present in the hot zone . in accord with the present invention , a box - like liner assembly comprising a plurality of stacked liners 33 , 35 , and 37 are provided so as to enclose the hot zone and thereby maintain a uniform temperature above the substrate 29 . liner 35 has legs 36 that support the liner from carrier 25 . that is , the liner assembly forms at least one box around the substrate 29 , creating the hot zone with small openings for radially outward gas flow . a first set of liners 33 and 35 may be arranged to form an outer box enclosure of that portion of the chamber 21 receiving the cvd precursor gases , with chamber lid liner 35 forming first outer side walls of that outer box enclosure , while the deposition liner 37 may form an inner enclosure , with second inner side walls of the deposition liner 37 immediately surrounding portions of the periphery of the substrate 29 . the liner material may be any of quartz , a ceramic , and graphite , which retain heat . the liners 33 , 35 and 37 receive their heat generally by convection from the flowing cvd gases and reaction products , but mostly from energy supplied by radiation from the hot carrier 27 and substrate 29 . the substrate 29 may itself be heated by conduction from the susceptor 27 , which in turn may be heated by lamps , electrical induction , fluid passages , or any other convenient means in the cold - wall reactor , i . e ., the second environment . the cvd precursor gases are preferably delivered to the hot zone already preheated to an elevated temperature ( e . g ., about 350 ° c .) just below a reaction temperature , and is then heated to its final reaction temperature ( e . g ., about 400 to 450 ° c .) for deposition by heat transfer onto the substrate 29 where cvd reactions occur . the surrounding inner liner material 37 maintains the heat in hot zone immediately above the substrate 29 , like the walls of an oven , for creating conditions conducive to uniform deposition by reactions on the substrate 29 . by maintaining the deposition zone at 400 ° c . or hotter , excess arsenic remains in a gaseous phase so that it can be pumped out through an exhaust port . excess gallium tends to plate out onto the liners . at lateral edges of the showerhead , gas exhaust ports 34 and 38 may be provided to form part of a gas flow curtain around the showerhead . such a gas flow curtain partly isolates the reaction chamber helping to form a reactor within a reactor , as explained further below . additionally , the liners 33 , 35 and 37 of the liner assembly are positioned to line selected portions of the deposition zone 21 so as to control byproducts of the cvd reaction during deposition and protect those selected portions of the chamber 21 from unwanted film deposition . management of deposition byproducts and temperature control are the principal functions of the liner assembly . thus , a showerhead liner 33 protects a first zone of the deposition zone 21 surrounding the cvd process gas outlets 31 of the showerhead assembly 19 . the showerhead liner 33 minimizes loss of heat from the showerhead assembly 19 to prevent condensation of preheated cvd precursor gases in the showerhead channels and especially at its gas outlets 31 . a chamber lid liner 35 protects a third zone of the deposition zone 21 outside of the deposition zone . it physically separates a concentration of the cvd process gas and reaction products in a hot deposition zone above the wafer substrate 29 from cooler isolation regions outside of the deposition zone . additionally , pressure differences between the deposition zone and isolation regions may produce radially outward gas flows that direct any unreacted process gas and undeposited reaction products to an exhaust port of the chamber 21 , such as an exhaust port 34 or 38 . finally , a deposition liner 37 , in addition to forming an inner hot zone of the deposition zone 21 , protects portions of the oversized wafer carrier 27 around the wafer substrate 29 . at least some portions of the liner assembly may be in thermal communication with one or more heat sources ( radiant , convective , or conductive ) so as to be maintained at an elevated temperature different from than the substrate so as to discourage deposition anywhere other than onto the wafer substrate 29 . even so , some deposition and / or condensation may occur onto the liners 33 , 35 and 37 . accordingly , the preferred liner materials ( e . g ., quartz , a ceramic , or graphite ), in addition to retaining heat , are preferably selected so as to be resistant to various cleaning processes . the liners are preferably removable from the reaction chamber for maintenance or replacement . the deposition liner 37 nearest to the wafer substrate 29 is especially designed to be removable along with the substrate 29 and its susceptor 27 after each substrate processed . the reaction chamber with its gas curtain isolation provides a reduction in contaminants that is at least an order of magnitude less than in the surrounding reactor environment . with reference to fig3 and 4 , cutaway perspective views with the showerhead assembly 19 removed reveal the showerhead liner 33 surrounded by one or more plates of a chamber lid liner 35 overlying a susceptor 27 and carrier 25 carrying a wafer substrate 29 . the showerhead liner 33 , which generally corresponds in its location , shape and size with that of the showerhead assembly &# 39 ; s process gat inlet , overlays the processing location of a wafer substrate 29 inserted into the reactor . the chamber lid liner 35 surrounds the showerhead liner 33 . in the depicted embodiment , the chamber lid liner 35 is seen to have legs 36 extending downward along the sides of the susceptor 27 onto the carrier 25 . alternatively , the legs 36 could be replaced by side panels . in either case , the legs 36 or side panels form a tunnel or cap with the chamber lid liner 35 around the deposition zone that both confines process reaction gas and minimizes heat loss in the lateral direction , yet allows excess or spent gas to flow out . a deposition liner 37 seated on the susceptor 27 and the movable carrier surrounds a perimeter of the wafer substrate 29 so as to form a kind of partial inner “ box ” or “ dome ”, with the fixed showerhead liner 33 forming the box or dome &# 39 ; s cover and the deposition liner 37 defining its side walls on all sides of the wafer substrate 29 . the deposition liner therefore ensures temperature and process gas uniformity over the wafer substrate surface . with reference to fig5 and 6 , another cvd reactor embodiment 61 illustrates the possibility of scaling to accommodate the processing of multiple wafer substrates 79 a 1 - 79 d 4 at one time , while still maintaining the use of liners for promoting deposition uniformity . the illustrated embodiment provides for 16 wafer substrates , shown here as grouped into four sets of four , 79 a 1 - 79 a 4 , 79 b 1 - 79 b 4 , 79 c 1 - 79 c 4 and 79 d 1 - 79 d 4 . different numbers of wafers and different groupings are possible in a variety of reactor embodiments . each set of wafers has an associated showerhead , of which showerheads 69 a and 69 b are seen in fig5 . the showerheads are connected to one or more supplies of process gases , represented by conduits 67 . each of the showerheads has a showerhead liner , e . g ., 83 a and 83 b , and the showerhead liners are in turn surrounded by one or more plates forming a chamber lid liner 87 with side panels or legs 86 at lateral sides of each deposition zone associated with a group of wafers , such that the combination of showerhead liners and chamber lid liners forms a tunnel or cap around the respective deposition zones that both confine process gas and minimizes heat loss in the later direction . additionally , each group of wafer substrates 79 a 1 - 79 a 4 , 79 b 1 - 79 b 4 , 79 c 1 - 79 c 4 , and 79 d 1 - 79 d 4 , has a corresponding deposition liner 85 a - 85 d positioned on the movable wafer carriers 77 a - 77 d surrounding the parameter of each group . in combination with the showerhead liners , the deposition liners form a kind of partial inner box or dome around the wafer substrates that ensure temperature and process gas uniformity over each wafer substrate surface and isolate one environment from another . the movable carriers allow liner assemblies to be moved away from fixed showerheads for cleaning . the reactor structure provided by the present invention allows better uniformity of deposition by creating an environment where the substrate has uniform temperature over its entire surface and where the cvd process gases over the substrate are likewise at a uniform temperature in a hot zone . the regions or zones enclosed by the various sets of liners facilitate heat retention for such temperature uniformity , while the liners themselves also serve to protect selected portions of the chamber from unwanted deposition and to facilitate short downtimes for cleaning and maintenance . | 2 |
hereinafter an embodiment of the present invention will be described with reference to the drawings . fig1 shows a schematic perspective view showing an appearance of a flange ( member ) of the present invention prior to cutting process . fig2 is an enlarged cross - sectional view of the flange of fig1 after cutting process , which is provided with a groove at the bottom of the drum bumping part thereof . fig3 is a schematic perspective view showing an appearance of another flange of the present invention prior to cutting process . fig4 is a schematic perspective view showing an example of the shape ( prior to cutting process ) of a gear - free flange of the present invention , which is provided with a protruding part . fig5 is a perspective view showing a system configuration of a flange processing device ( system ) according to the present invention . a flange 10 a shown in fig1 is a two - staged substantially cylindrical member formed by injection molding of synthetic resin . the flange 10 a is cut on a lathe or the like to give a shape shown in fig2 . one end surface 5 a of a large diameter - main cylinder 5 includes a protruding part 5 b that after cutting serves as a drum engagement part 1 to be fitted into the inner circumference of a photoconductor drum end ( not shown ). at the center of the other end surface 5 c of the main cylinder 5 , having a circular end , has a protruding helical gear 3 and protruding shaft cylinder 6 to be a shaft portion , both of which are smaller in diameter than the main cylinder 5 . the center hole 6 a in the shaft cylinder 6 communicates with the shaft hole 4 . as shown in fig2 , the drum engagement part 1 is cut to have a predetermined outer diameter in such a way that it is coaxial with the helical gear 3 . as shown in the cross - sectional view of fig2 , a narrow groove 7 is formed in the vicinity of the drum bumping part ( flange part ) 2 of the flange 10 a so that the diameter of the drum engagement part 1 ( engagement diameter ) is 0 . 1 - 0 . 5 mm smaller at the groove 7 than at other areas of the drum engagement part 1 . the center hole part 6 a of the cylindrical shaft portion 6 provided at the center of the flange is processed to form a shaft hole 4 that is coaxial with the drum engagement part 1 and helical gear 3 . a flange 10 b shown in fig3 is also a substantially cylindrical member formed by injection molding of synthetic resin . the flange 10 b is cut on a lathe or the like to form a protruding part 5 b at one end surface 5 a of the main cylinder 5 , which the protruding part 5 b becomes a drum engagement part 1 to be fitted into the inner circumference of a photoconductor drum end . in the flange 10 b shown in fig3 , the other end surface of the main cylinder 5 is processed to be a helical gear 3 . in a subsequent process , the drum engagement part 1 is cut so as to be coaxial with the helical gear 3 . a narrow groove ( step ) 7 is formed in the vicinity of the drum bumping part ( flange part including the helical gear 3 ) 2 of the flange 10 b so that the diameter of the drum engagement part 1 ( engagement diameter ) is 0 . 1 - 0 . 5 mm smaller at the groove 7 than at other areas of the drum engagement part 1 . the center hole part at the center of the flange is processed to form a shaft hole 4 that is coaxial with the drum engagement part 1 and helical gear 3 . a flange 10 c of the present invention shown in fig4 ( prior to cutting process ) is a flange that does not have a gear , and is a member formed by injection molding of synthetic resin as are the foregoing flanges 10 a and 10 b . the flange 10 c is cut on a lathe or the like to form a protruding part 5 b at one end surface 6 a of the main cylinder 5 , which the protruding part 5 b becomes a drum engagement part 1 to be fitted into the inner circumference of a photoconductor drum end . at the center of the other end surface 5 c of the main cylinder 5 , there is provided a protruding protruding part 8 ( for chucking ) that is smaller in diameter than the main cylinder 5 , forming a two - staged substantially cylindrical member . at the inner side of the protruding part 8 , a protruding shaft cylinder 6 is formed that becomes a shaft portion . the center hole part of the cylindrical shaft portion 6 provided at the center of the flange is processed to form a shaft hole 4 that is coaxial with the drum engagement part 1 and helical gear 3 . the drum engagement part 1 is cut to have a predetermined outer diameter and , as in the case of fig2 , in the vicinity of the drum bumping part ( flange part ) 2 thereof , there is provided a narrow groove 7 so that the diameter of the drum engagement part 1 ( engagement diameter ) is 0 . 1 - 0 . 5 mm smaller at the groove 7 than at other areas of the drum engagement part 1 . because of their specific structures these flanges 10 a , 10 b and 10 c can achieve the concentricity of 0 . 005 mm or less and roundness of 0 . 005 mm or less much easier than conventional flanges . this is achieved by setting the inner and outer diameters of the drum engagement part and center hole to predetermined values through a cutting process in which the flange is clamped to the lathe chuck only once ( i . e ., without re - clamping the flange to the chuck ). in particular , the use of a processing device to be described later and a cutting process in accordance with a processing method to be described later can , without fail , ensure that both the concentricity and roundness are 0 . 005 mm or less without re - clamping of the flange to be processed . a flange processing device ( system ) shown in fig5 , which is suitable for cutting of the flanges , will be described below . the flange processing device 100 shown in fig5 is composed primarily of a lathe 50 , a cutting machine to be described later in detail . a stacker 70 can be attached to the flange processing device 100 for increasing overall operational efficiency in conjunction with an injection molding machine 60 . to be more specific , a stacker 70 for transferring flanges is attached to the flange processing device 100 so that flanges formed by injection molding can be readily supplied to the cutting machine . the stacker 70 is provided with trays 71 for storing flanges prepared using the injection molding machine 60 , and is connected to the side of the lathe 50 ( hereinafter may be referred to as a “ cutting machine ”). in this way flanges can be automatically supplied from the tray 71 to the chuck 51 of the cutting machine 50 by means of a ( flange member ) supplier 72 . an air blower 80 is incorporated into the flange processing system 100 so that the stacker 70 can function effectively . injection molded flanges exhibit shrinkage right after their preparation and thus generally need to be left stand for a long period of time before their shapes are stabilized . however , it is necessary that full shrinkage be accomplished in the shortest time for synchronized operation with the cutting machine . to stabilize the shapes of flanges stored in the stacker 70 as early as possible , the air blower 80 ( see fig7 ) is incorporated into the flange processing system 100 as a cooling device for blowing cooled air to the flanges in the stacker 70 . as described above , it succeeded in stabilizing the flange shapes by facilitating their shrinkage by using such an air blower . for increased heat efficiency , a stainless steel shield is wrapped around the stacker 70 . this cooling method can facilitate cooling of flanges at low costs , however , for a shorter flange shape stabilization time , another method may be adopted wherein a refrigerator is used that can accommodate the entire stacker . the lathe 50 uses a 6 - jaw diaphragm chuck as the chuck 51 that can be attached to the rotational spindle . this is because there is a concern of causing deformation of the flange due to the strain of clamping force when it is clamped to the chuck by means of normal air or oil pressure upon cutting of portions near the chuck . the use of the diaphragm chuck 51 enables flange clamping at a pressure low enough to avoid deformation of the flange . by controlling the pressure applied to the diaphragm chuck 51 , it is possible to achieve delicate cutting condition changes in a case where the shape of a non - processed injection molded article has changed from the previous one . note that a similar effect can be obtained even when an air balloon chuck is used as the chuck for the lathe 50 . the lathe 50 has a function of removing a thread - like chipping ( cutting ) by air suction at the spindle 52 . to be more specific , for the purpose of removing chippings during the cutting process , the lathe 50 has a hollow at the spindle through which a suction device ( not shown ) is connected to the lathe 50 for suctioning chippings by air from inside the spindle 52 . to realize this configuration it is necessary to ensure that cutting depth falls within a proper range ( 0 . 05 - 0 . 3 mm ) during the actual cutting process so that chippings can be readily removed in the form of a thread - like chipping rather than separate chipping pieces . note that the chipping suction configuration is not particularly limited to the above - noted configuration . an example of a cutting operation will be described specifically below . a gear - equipped flange which is formed by injection molding of resin and has a shape shown in fig1 is attached to the lathe by clamping it to the 6 - jaw chuck at the outer surface of the gear part provided at the end of the flange . cutting is performed first for the drum engagement part of the flange . although a proper cutting depth to form a thread - like chipping differs depending on the material , a cutting depth is preferably about 0 . 15 mm in the case of general polycarbonate . a groove is provided at the drum bumping part of the flange ( see fig2 ). the groove is about 0 . 1 - 05 mm in depth and the depth can be appropriately set according to the finish of the drum end . it was confirmed that a groove of 0 . 2 mm depth can avoid influences of burrs and warpage at the drum end . with the configuration shown in fig6 , a thread - like chipping is removed by air suction at the spindle of the lathe upon cutting of a shaft hole . for forming a thread - like chipping , the cutting depth is set to about 0 . 15 mm in the case where the flange is made of polycarbonate . an optimal cutting depth is selected depending on the material . during the cutting of a shaft hole , a thread - like chipping is removed together with other chipping pieces by air suction without any tangle of the thread - like chipping . to avoid generation of burrs at the end of the resultant shaft hole of the flange , which are created as a result of entry of the bite ( cutting tool ) into the flange shaft core , it is preferable to change the angle at which the bite enters the flange . fig8 shows a pattern in which the bite moves upon cutting of the shaft hole . with this cutting method , it is possible to avoid generation of burrs during entry of the bite . furthermore , in order to avoid generation of burrs that are generated by withdrawal of the bite , it is preferable to change the angle in which the bite withdraws out of the flange . fig9 shows a pattern in which the bite withdraws out of the flange during cutting the shaft hole . with this cutting method , it is possible to avoid generation of burrs during withdrawal of the bite . for example , a cutting process adopting a bite entry angle of 30 ° and a bite withdrawal angle of 35 ° gave good results . by cutting the drum engagement part and shaft hole part while clamping the outer surface of the gear part of the flange to the chuck , it succeeded in obtaining low concentricity between the resultant shaft hole and drum engagement part and excellent roundness . fig1 shows obtained concentricity and roundness values measured by a roundness analyzer made by tokyo seimitsu . a 6 - jaw diaphragm chuck was adopted , and it succeeded in achieving precisions shown in fig1 in mass production of flanges with this chuck . however , the number of jaws may be 6 or more . pre - evaluations were made with respect to a 3 - jaw diaphragm chuck and an 8 - jaw diaphragm chuck , and evaluation results are shown in fig1 . in the case of the 3 - jaw diaphragm chuck , there was a tendency that the cross - sectional shape of the processed flange . in order to ensure excellent cutting results , it is preferable that the number of jaws is 6 or more . fig1 shows cutting process data with different pressures ( 0 - 0 . 6 mpa ) applied to the diaphragm chuck . pressure control can realize delicate cutting condition changes in a case where the shape of a non - processed injection molded article has changed from the previous one . an air balloon chuck may be used as a chuck for clamping a flange to the lathe chuck , in order to clamp the flange with a low pressure as in the case of a diaphragm chuck . the air balloon chuck can provide the same effect as the diaphragm chuck . flange temperature changes during the actual cutting process causes flange expansion or shrinkage , and hence the cutting amount changes . fig1 shows variations in outer diameter of flange when room temperature varied from 22 ° c . to 27 ° c . as shown in fig1 , since the outer diameter of flange changes with the temperature , the processing device according to the embodiment is so configured that the variations in dimension among identical flanges can be minimized by controlling the degree of entry of the bite in the flange by feedback control according to the temperature change . for reference temperature data for this feedback control , either work surface temperature or room temperature is selected depending on the circumstances . note , however , that if the room temperature change can be within about ± 2 ° c . during the course of the cutting process , the effect of this feedback control is little and , since the cutting depth is preferably constant , in actual , room temperature - based control may be selected . although the descriptions given above are directed to the cutting process for the flange shown in fig1 , the flange shown in fig3 can be processed with high precision in much the same way by clamping the outer surface of the gear part of the protruding part of the flange . the flange shown in fig4 formed by injection molding of resin is attached to the lathe 50 by clamping the protruding part 8 , which is provided to its end , to the 6 - jaw chuck 51 . high - precision cutting of the drum engagement part 1 and center hole ( shaft hole ) 4 is made possible by performing cutting with the protruding part 8 being clamped to the lathe chuck only for once . the present invention can be widely applied to substantially cylindrical mechanical components such as rollers that include plastic flanges attached at either end thereof , whereby roundness and concentricity are improved to increase rotation performance of the components . | 1 |
the general path planner program is the heart of the system . it performs the algorithmic processing of the data input through the graphical interface . a block diagram of the general path planner is presented in fig1 which illustrates the interaction of the several code groups required to implement the system . the executive code group 10 , the communications code group 20 , the messages code group 30 , the path solver code group 40 , the world - view code group 50 , and the gui / output code group 60 . each of these groups performs one or more related tasks within the system . the overall architecture of the system is a single threaded , message - driven server architecture . each message received is processed in turn , without threading . output is sent back through the use of an observer design pattern , much like java = s generator - listener mechanisms for guis . the system uses a command design pattern , where messages contain their handling code as methods . the system may be implemented on a platform such as the java skd 1 . 4 and the basic path planning algorithms are variants of the rapidly - explored random trees algorithm described by s . m . lavalle in a paper titled , “ rapidly - exploring random trees : a new tool for path planning ,” published as tr 98 - 11 by the computer science dept ., iowa state university , in october 1998 . the paper is incorporated herein by reference . the executive code group 10 is the container classes for all of the statically - held objects in the system . the objects in this group act as traffic cops to the other code groups , and initialize objects that require initialization at startup time . the communications code group 20 handles all i / o for the system . it contains an incoming message queue which is polled to see if new messages have arrived . once messages arrive , they are executed in the order they arrive , one at a time . the communications group also holds all of the output message generators that the system creates . these message generators send the output messages created by the system to registered listeners as soon as the output message arrives . input messages contain their handling code in an overridden execute abstract method . in this way , new input message types , i . e . commands , can be added easily by creating a new message class and defining the code to handle that message . messages also contain a halt method , which will be called if a special halt method is called on the path planning component . the halt method can be used to safely stop current message execution . the path solvers code group 40 represents path - planning package interfaces that the system can use . in the preferred embodiment the path - planning solvers are based on rrt algorithms . the solver is able to set its state using a world - view object plan given a set of way points and halt its planning if has to . also included in this group is a reflective method to set a planner = s parameters when given a list of parameter names and values . the set parameters method looks for methods in the planner class which have “ set ” prepended to the parameter name and take the object corresponding to the parameter name as the sole argument . it then executes that method on the passed - in argument object . the world - view code group 50 is in charge of holding a database of world objects , such as mines , bathymetry data , shorelines , etc . the world - view interface is fairly empty , and only has a clear method on it . in the preferred embodiment the only world - view implementation is the mines only world - view , which is simply a list of mine locations and probabilities on the plane . this preferred embodiment is presented as exemplary , additional embodiments are anticipated to expand the versatility of the system . the output code group 60 is in charge of supplying output to interested parties . it uses the observer design pattern , and is modeled after java awt = s event system . there are message event generators for each type of output method produced , and listener interfaces that listening classes must implement to receive the output . there are two generators : a generator for path solutions , and a generator for algorithm progress messages . the preceding code groups are operational in any one of three different modes or use cases which are defined by the input message type . the use cases are : administrative use - case , state use - case , and path query . to perform a use - case , a corresponding message is sent to the system through the communications group . the administrative use - case is intended to be used to send high - level commands to the system . it operates reflectively so that an administrative message is created with a string representing one of the methods defined on the administrative message class . when sent to the system , the method named by the string will be invoked inside the system . current administrative messages include : printing the administrative message ( a debugging tool ), printing the world - view , clearing the world - view , and exiting the program . new commands can be added by simply adding a method to the administrative class . the state use - case message is used to update the current state held in the system = s world - view . simple - state , a subclass of state use , is used with the mines - only world - view , and contains a list of added or a list of deleted mines ( but not both ). to execute this use - case , the simple - state message either adds or deletes its contents to the world - view , as appropriate . the path query message defines the use - case of requesting a path solution by the system . it is parameterized by the name of the algorithm desired , algorithm parameters , and a list of waypoints to be followed for the path . the first waypoint is the start point and the last waypoint is the goal point . if less than two waypoints are present , behavior is undefined . the path query execution involves the following steps : 1 ) a path planner solver is fetched or created for the desired algorithm . 2 ) the planner is loaded with the current world - view state . 3 ) any parameters present are loaded into the algorithm . 4 ) the planning algorithm is executed with the passed waypoints . 5 ) if a solution is returned , it is sent to the solution event generator in the communications code group 20 . the gui incorporates a means for linking designated portions of a display with an electronic address . it provides an interface with the multi - algorithm capabilities of the general path planner architecture while providing an interactive view of plan progress and an intuitive means to design world - view configurations . the gui performs its tasks sequentially . the gui uses a component based design and performs in collaboration with the general path planner and the separate gui components through message passing . several dialogs are used to perform more complex configurations while the most common actions are laid out in toolbar fashion along the left side of the gui as illustrated in fig2 . the gui user is first presented with an area 71 defined by coordinates and representing an open expanse of ocean on which the user may create minefields . the user may place and remove mines 72 on the minefield with mine editing tools 62 and 63 on a tool bar 61 . in addition to the manual method of mine layout , the user may generate a uniform random distribution of mines throughout the area 71 . minefields can be saved and loaded from the file menu as well . the toolbar , 61 of fig2 , is like that of a typical drawing program , with buttons depicting various tasks that interact with the canvas . the add mine , remove mine , and mine line buttons , 62 through 64 respectively , provide direct manipulation of mines 72 in the field 71 . the mine line tool 64 allows the user to click and drag , creating an elongated randomized field of mines . the thickness and density of this line is configured from the mine line preferences dialog accessed from the edit menu . once the line is dragged on the area map view 71 , mines 72 are randomly placed in the box defined by the line = s endpoints and thickness setting . in addition to these direct methods of mine layout , the new minefield dialog in the file menu allows the user to generate a uniform random distribution of mines throughout the area . minefields can then be saved and loaded from the file menu as well . the mine probability slider , 65 , at the end of the toolbar modifies the probability of subsequent mines added to the canvas . the minefield is rendered differently for each algorithm available by a reflectively loaded minefield renderer class . in this way the characteristics of the risk function for each algorithm can be displayed . once a minefield is loaded , waypoints 73 can be placed in sequential order from route start 74 to route end 75 using the waypoint tool . the algorithm menu allows the user to select an algorithm for use with the minefield . here , the options associated with each algorithm are reflectively selected from the algorithm = s implementation of the path planner solver abstract class . the world - view and waypoints generated from the gui are able to be sent to any of the planners such that multiple plans may be generated for the same minefield . once the algorithm is properly configured , the start button sends a path query message to the selected planner and a plan is generated . if the show progress check box is activated in the algorithm menu , algorithm - specific progress information will be presented in the navigation box . the progress animation can be saved to disk as a series of images if the option is selected in the algorithm menu . in addition , messages about plan progress will be printed in the lower text window . after the algorithm has completed , the result will be displayed as a route 76 over the area 71 . for example , in fig2 , the rrt algorithm has produced a plan , 76 , which is colored according to the speed of each path segment . statistics about the current solution are displayed in the lower right panel . these statistics include the computed risk of the final path found by the algorithm , the time the path would take to follow , and other statistics about the solution . when the rrt algorithm is implemented as a solver for the general path planner two main code groups are employed , the tree algorithm code group and the models and actions code group . the tree algorithm code group runs the rrt algorithm proper and the models and actions code group determines the state space and robot / ship properties that will be used when running the algorithm . the tree algorithm code group implements the rrt tree algorithm proper . this algorithm is a space - filling randomized algorithm . the algorithm produces a tree in the state - space of the problem . after each iteration , the algorithm attempts add a node which minimizes the distance from any point in the state space to a point on the tree . finding the optimal point to add at each iteration exactly is prohibitively expensive , so the rrt algorithm approximates this by choosing a point with some randomness . the pseudocode for the algorithm is as follows : 1 . choose a random point r in state space with some random point generator . 2 . choose the closest existing tree node to r , call it t . 3 . for each possible legal extension of the tree from r , find the closest point to t , call it t — 0 . 4 . add t — 0 to the tree . 5 . repeat these steps until the space is filled enough . for path planning , the tree starts at the starting point of the plan . the algorithm stops when the tree is less than some critical distance to the goal point . since the tree is rooted at the start point , the path can then be reconstructed by following the ancestors of the node closest to the goal back to the root . the models and actions code group allows for wide flexibility in the type of path planning done by the rrt algorithm . the model interface is the entity which all models will implement . this interface has three important purposes : 1 ) defining appropriate geometries for the model , 2 ) defining a random state space point generator , and 3 ) selecting the “ best ” action for a given point in the state space . the rrt code group uses a concrete models methods to build the rrt tree in an appropriate manner . actions are model - specific actuations that can be perform and which extend from an abstract class named action . models are loaded with a set of actions on instantiation . each concrete action must define what will happen to the state space if the action is applied for a certain amount of time . this is known as the “ integration ” method . three different models for generating obstacle space geometries are available . they are : the ship model , the bull = s eye model and the cone model . the basic ship model uses java awt shape classes to define the obstacles in the minefield as keep - out regions . mines are added as circular shapes whose radii depend on the probability of the existence of a mine . the greater the probability of the existence of a mine , the greater the radius of the circle defining the obstacle space . it selects the best action by integrating each action over a small unit time and selecting the point closest to the goal point which does not collide with any obstacle . in this model , distance is taken to be the four - dimensional euclidian distance in planar space and planar velocity . the bull = s eye model is similar to the ship model except it contains a second , larger set of obstacles superimposed over the smaller obstacles . it has a radius which is a function of the probability of a mine plus an added factor to increase the radius . if no action can be found using the more conservative obstacles , an action is searched for using the more liberal obstacles . mines are added as a bull &# 39 ; s eye of two concentric circles . the cone model uses a half - space of three - dimensional obstacles in the dimensions of x , y and speed . the actions are again checked for collisions with the obstacles , this time in three dimensions . mines are added as cones with a circle of baseline keep - out region at no speed and a linearly increasing radius as the objects speed increases , see fig3 . the baseline keep - out region size depends on the probability of the mine but the cone = s slope is fixed for each instantiation of the model . this model is the default model used in the general path planner . in an alternate rrt variant using the cone model , when the path gets within a certain distance of the goal , the rrt random point selection is chosen close to the goal . this is the “ goal directed ” rrt variant . changing a model &# 39 ; s actions dramatically changes the algorithm operation . two types of actions are available : point - robot actions and ship - like actions . the point - robot actions integrate by applying a simple x - y force . for example , one could create a point - robot action which applies a east - facing force of 10 meters per second squared to the planned object . ship - like actions take an approximation of rudder position and forward throttle , and integrate an approximate new position using these parameters . with ship - like actions , the turning radius of the generated path , 66 of fig2 , may be limited to that of the planned - for object . the system performs the following steps when generating a route through a minefield : 2 ) populate the area with obstacle spaces defined as coordinate bound areas through which the route may not pass ; 3 ) establish the coordinates of a route start point within the area and outside the coordinate bound areas defining obstacle spaces ; 4 ) establish the coordinates of a route end point within the area and outside the coordinate bound areas defining obstacle spaces ; 5 ) generate a series of connected vectors between the start and end points which do not pass through the coordinate bound areas of the obstacle spaces ; 6 ) establish at least one set of parameters defining the coordinates for a waypoint along the route and on one of the vectors ; 7 ) define a path created by the connected vectors as the route through the minefield . while preferred embodiments of this invention have been illustrated and described , variations and modifications may be apparent to those skilled in the art . therefore , we do not wish to be limited thereto and ask that the scope and breadth of this invention be determined from the claims which follow rather than the above description . | 6 |
a shock absorber 10 of first design is illustrated in fig1 a , 1b , 1c and 2 . this design uses a pressurized nitrogen differential area at each end of the device 10 to balance two volumes of oil disposed inboard therefrom and separated by a fast acting metering system . the shock absorber device 10 consists of an upper tubing section 12 defining an internal bore 13 as secured co - axially by means of sleeves 14 and metering sleeve 16 to a mid - portion sleeve 18 . the mid - portion sleeve 18 is then further connected coaxially by means of a metering sleeve 20 to lower tube casing 22 , and a bottom cap 24 is then sealingly connected to provide a slidable , sealed closure around a co - axial inner tubing or mandrel 26 . the mandrel 26 having internal bore 27 consists of an upper tube 28 threadedly connected in - line with a middle tube 30 and a lower tube 32 which extends through the bottom cap 24 . lower tube 26 includes external threads 34 for engaging downhole tubing structure , and the upper tubing section 12 includes internal threads 36 for receiving a complementary threaded tubing member . the central flow way 38 allows fluid passage through the device 10 . the co - axial connecting sleeve 14 includes a first counterbore 40 having threads 42 for secure affixure with external threads 44 of upper sleeve 12 . a seated o - ring 46 about the upper collar 48 in counterbore 40 provides a seal relative to upper tube section 12 . a metering sleeve section 16 is received within a lower counterbore 50 of sleeve 14 . the metering sleeve section 16 includes upper and lower milled surfaces 52 and 54 having respective external threads 56 and 58 . threads 60 formed within counterbore 50 are received over threads 56 as a seated o - ring seal 62 provides sealing affixure . internal threads 64 formed in the upper end of middle tubing section 18 are then received over threads 58 as a seated o - ring seal 66 provides seal integrity . as shown also in fig2 the metering sleeve 16 includes a longitudinal , rectangular groove 68 which co - acts with a spline 70 on upper tubing 28 to maintain longitudinal alignment of the coacting components . an oil - fill port 72 with screw plug 74 is also provided through metering sleeve 16 . a clearance 76 allows for passage of nitrogen gas as charged for pressurizing the chamber 78 . the upper sleeve 14 includes an axial bore 80 having an annular recess 82 for receiving the upper tube 28 slidingly therethrough . a seal 84 consisting of bronze - elastomerbronze combination of successive rings is seated within the annular recess 82 . the bronze could be replaced by glass - filled teflon ™ rings thus , a sealed void consisting of clearances 76 and annular chamber 78 is terminated by ( see fig1 b ) an annular shoulder or piston formation 86 about the upper end of middle tube 30 . the annular shoulder 86 includes an annular groove 88 that provides seating for a standard type of seal 90 , e . g ., a bronze - elastomer - bronze ring seal which maintains seal integrity of chamber 78 . in most cases the bronze rings may be replaced by teflon ™ rings . the middle tube 30 and lower tube 32 are joined by means of a similar configuration wherein tube 32 is formed with a piston - like upper annular shoulder 86 which , in turn , is formed with an outer surface annular groove 88 which receives a multi - ring seal 90 therein in contact with the inner wall of lower sleeve 22 . seal 90 may again be the teflon - elastomer - teflon type of seal combination , or bronze end rings may be used . another metering sleeve 20 functions to join the middle sleeve 18 to lower sleeve 22 while defining a pair of annular chambers 92 and 94 . the metering sleeve 20 is formed with opposite milled ends 96 and 98 having external threads 100 and 102 for receiving the respective internal threads 104 and 106 of middle sleeve 18 and lower sleeve 22 . the metering sleeve 20 also includes a central bore 108 through which the middle tube 26 is received with a predetermined clearance 110 . a threaded counterbore 112 receives an upper metering ring 114 and , in like manner , a lower threaded counterbore 116 receives a threaded metering ring 118 . a screw plug 120 and bore 122 communicating with chamber 94 and the metering system , provide means for input of silicone oil to fill the opposite chambers 92 and 94 and the close clearance spaces 108 between metering sleeves or rings 114 and 118 . referring also to fig1 c , the lower tube 32 is secured co - axially with middle tube 30 as the threaded central bore 124 is received over the external threads 126 of middle tube 30 . the upset shoulder formation 86 forms yet another chamber 128 as closed off by the threaded collar 130 of lower cap 24 . collar 130 receives external threads for engagement with the internal threads 134 of lower tube 22 . a seated o - ring 136 maintains fluid - tight integrity . an annular channel 138 carrying the standard 3 - ring seal 140 provides fluid - tight integrity between lower tube 26 and lower cap 24 . a counterbore clearance 142 is formed concentrically around lower cap 24 to provide fluid communication between annular chamber 128 and a port 144 as sealed by a screw plug 146 . the opposite end annular chambers 78 and 128 , accessible through respective screw plugs 74 and 146 receive a charge of nitrogen under pressure . the internal annular chambers 92 and 94 , both accessible through screw plug 120 , receive a charge of silicone oil . the nitrogen pressure installed at each end of the tool will depend upon the weight of the tool string below the point of insulation . for instance , if the tool string below the shock absorber device 10 weighed 15 , 000 pounds and the differential area in the nitrogen chambers 78 , 128 was 5 square inches , one would install 3 , 000 psi nitrogen to balance the weight of the tool string therebelow . the nitrogen pressure acting on each end locates the mandrel 26 in proper position within the outer case 11 so that any forces exerted either upwards or downwards will allow enough relative travel between outer case 11 and mandrel 26 to dissipate the shock . that is , to dissipate the shock without bottoming out either the oil system ( chambers 92 , 94 ) or the nitrogen system within chambers 78 and 128 . shock loads dissipated upward will force the silicone oil to be metered from chamber 94 to chamber 92 with displacement proportional to the upward force . as the silicone oil is metered , the nitrogen pressure on the trip piston 86 increases the pressure of the nitrogen within chamber 78 . this rapidly slows the inertia effect of the moving mandrel 26 to absorb the shock load by metering silicone oil and further pressurizing the nitrogen charge . shock loads acting downward have a somewhat similar function except that the weight of the tool string below the shock absorber device 10 is a plus force that must be added to the shock load and must be taken into consideration when calculation the nitrogen charge to install in the tool , as discussed above . fig3 a , 3b , 3c and 4 show an alternative form of shock absorber device 150 which is similar to the device 10 except that the silicone oil chambers are isolated from each other and metering of fluid is between the oil and nitrogen chambers . thus , the shock absorber device 150 consists of an inner mandrel 152 with internal bore 153 received slidably within an outer casing 154 . the outer casing 154 consists of an upper tube section 156 having internal threads 158 for connection into the tubing string . tube section 156 having internal bore 157 terminates at the lower end with an external thread 160 which is received within a threaded axial bore 162 of a tube section 164 . tube section 164 includes an axial bore 166 having an annular groove 168 retaining a standard 3 - ring seal 170 , i . e ., a teflon ™, elastomer combination . the surface 166 and seal 170 provide sealing engagement against mandrel 152 . a seated o - ring 172 provides sealing integrity between tube section 156 and an upper collar 173 of tube section 164 . the lower section of tube section 164 is also formed with an axial counterbore having threads 174 which engage external threads 176 of a metering section 178 . the metering section 178 includes seated o - rings 180 and 182 to maintain fluid - tight integrity , and a longitudinal slot 184 slidingly meshes with a spline 186 formed on the outer surface of mandrel 152 ( see fig4 ). a fluid - tight screw cap 188 and a port 190 provide nitrogen access via metering clearance 192 to the annular void or chamber 194 . the metering sleeve 178 includes external threads 196 around the bottom end for sealed affixure to internal threads 198 of a casing sleeve 200 . actually the casing sleeve 200 is formed with a counterbore inner surface 202 extending downward to a shoulder 204 , and this serves to define the annular chamber 194 relative to the mandrel 152 . a free - sliding annular piston ring 206 is disposed within the annular chamber 194 . this tends to divide the annular chamber into sections 194a and 194b having annular grooves 208 and 210 on the inner and outer surfaces with respective sealing ring combinations 212 and 214 seated therein . the lower end of casing section 200 is milled to form an external thread 216 while a threaded , axial counterbore 218 receives a metering ring 220 therein . a concentric clearance 222 and metering ring 220 provide communication between chambers 194b and an annular chamber 224 . a screw plug 226 and port 228 provide fill access to chamber 224 . a middle casing sleeve 230 having internal threads 232 is secured on external threads 216 of casing section 200 and a seated o - ring 234 provides fluid - tight integrity . the inner mandrel 152 is extended by inclusion of a bottom tube 236 having internal bore 237 and a flange - like piston formation 238 that rides on inner wall 240 of sleeve section 230 as an annular groove 242 carries a 3 - ring seal combination 244 in contact with inner wall 240 . a threaded axial counterbore formed within piston formation 238 provides means for connecting to external threads 248 of mandrel tube section 152 . actually the piston formation 238 divides the annular chamber into chamber 224 and a lower chamber 250 as the remaining lower structure is essentially a mirror image of the upper structure described heretofore . thus , the lower tube section 236 of mandrel 152 extends downward through the lower end cap 154 and includes external threads 252 at the bottom for securing in the tube string . the outer casing 154 is extended by a casing section 254 which is similar to upper casing section 200 . that is , an externally threaded milled end 256 is tightly joined to internal threads 258 of casing section 230 as a grooved o - ring 260 maintains seal . a threaded counterbore 262 threadedly receives a metering ring 264 as an annular clearance 266 is provided adjacent the mandrel 152 . clearance 266 then communicates with annular chamber 268 . a screw cap 270 and port 272 allow fill access to the silicone oil chamber 250 . the chamber 268 includes a free sliding ring piston 274 which divides chamber 268 into chambers 268a and 268b , size depending upon the positioning of piston 274 . the piston 274 is sealingly engaged with the inner and outer walls of the annular chamber 268 by inner and outer annular grooves 276 and 278 which carry respective dual o - ring 280 and 282 , an o - ring combination of bronze or teflon ™ with a more pliable elastomer ring . finally , the lower end of the device 150 ( fig3 c ) terminates with a lower end cap 284 of outer casing 154 sealingly secured in position over the mandrel bottom tube 236 . end cap 284 is formed with and upper threaded collar 286 tightly received within internally threaded lower end 288 of lower casing section 254 . a groove and o - ring 290 provide sealed interconnection . an annular groove 292 within the lower end of bore 294 carries an o - ring seal combination 296 ( back - up rings with central o - ring ) against mandrel bottom tube 236 . a screw plug 298 and port 300 in communication with axial clearance 302 provides access to nitrogen chamber 268 . the alternative design , shock absorber device 150 of fig3 is similar to the design of shock absorber device 10 ( fig1 ) except that the silicone oil chambers are isolated from each other and the metering of the fluid is between the oil and nitrogen chambers . that is , the interior chambers 224 and 250 are charged with silicone oil as filled through respective screw plugs 226 and 270 , and nitrogen to predetermined pressure is placed in outer chambers 194 and 268 through respective screw plugs 188 and 298 . the floating pistons 206 and 274 located in the respective chambers 194 and 268 provide an interface between nitrogen and silicone oil and on each side the nitrogen charge balances the upward and downward forces . the inertial effect of a sudden shock load will force the mandrel 152 either upward or downward depending upon the particular force direction . in either event , it causes the metering of silicone oil against a floating piston 206 , 274 that further pressurizes the respective nitrogen chamber 194 , 268 . the fast metering of silicone oil working against the respective nitrogen charge quickly dissipates any shock load , i . e ., on the order of milliseconds . referring to fig5 a , 5b and 6 , yet another alternative shock absorber device 310 may be constructed that takes advantage of the external hydrostatic pressure within the surrounding borehole annulus . the device 310 utilizes an external casing 312 that defines an inside bore 314 as it is sealingly affixed in concentric relationship over a mandrel 316 defining an inside bore 318 . the mandrel 316 consists of an upper tube section 320 having an upper terminus 322 and being formed into piston 324 at approximately the midpoint . piston 324 is disposed to ride against inner bore 314 of outer casing 312 and includes an annular groove 326 containing an o - ring seal 328 , e . g ., the teflon / elastomer o - ring combination . mandrel 316 then extends into a lower tube portion 330 having external threads 332 around the lower end . outer casing 312 includes an upper connecting collar 332 having internal threads 334 and defining an internal bore 336 that is tightly received over terminals 322 , i . e ., the upper end of mandrel tube 320 . an annular groove 338 in inner bore 336 provides seating for a dual o - ring seal 340 , e . g ., teflon ™ and elastomer , against the outer surface of upper mandrel tube 320 . the interior bore of collar section 332 also includes a lower axial counterbore 342 which provides minimal clearance leading down to an annular chamber 344 which communicates with the annulus through a port 346 in casing sleeve 34b . the bore 342 of collar 332 includes a longitudinal slot 350 for receiving an aligning spline 352 ( see also fig6 ) formed on upper mandrel tube 320 . the lower end of upper collar 332 is formed with an inset collar 354 having external threads 356 for engaging internal threads 358 of the casing sleeve 348 . the annular chamber 344 is formed within mandrel 316 and casing sleeve 348 as bounded on the ends by inset collar 354 and the piston 324 . a free - floating piston ring 356 divides the chamber into chambers 344a and 344b . the piston ring 356 includes inner and outer annular grooves 358 and 360 which provide seating for respective triple o - ring seals 362 and 364 . here again , the triple o - ring seal combination may be the standard type of outer bronze or teflon ™ square rings boundering an elastomer - type inner ring . thus piston ring 356 is positioned in accordance with hydrostatic pressure from the annulus as communicated through port 346 and this will determine the piston ring positioning and the relative sizes of annular chambers 344a and 344b . a fill plug 365 allows access to chamber 344b . a lower end cap 366 secures outer casing 312 in sealed manner over lower mandrel tube 368 to define an annular chamber 370 beneath piston 324 . the end cap 366 includes an inset collar portion 372 having external threads 374 for connection within lower internal threads 376 of casing section 312 . lower cap 366 has an axial bore 378 which includes an annular groove 380 seating a double o - ring combination seal 382 for sealing contact around lower mandrel tube 330 . an outer , seated o - ring seal 380 provides sealed connection between collar 372 and outer casing 312 . silicone oil input to annular chamber 370 may be effected by means of screw plug 384 , port 386 and counterbore clearance 388 . the shock absorber design 310 utilizes approximately equal volumes of silicone oil disposed on opposite ides of piston 324 within lower annular chamber 370 and upper annular chamber 344b . chamber 344a above the floating piston 356 communicates with the annulus through port 346 such that hydrostatic pressures ranging anywhere from 3 , 000 psi to 15 , 000 psi maintain a tight volume of silicone oil balanced around piston 324 . in this case , the compressibility of the silicone oil will take the shock load and dissipate the energy quickly between the mandrel 316 and outer casing 312 . the silicone oil within bottom chamber 370 would be pressurized by the weight of the tools below the absorber device 310 , and the oil volume in chamber 344b above the piston 324 would be pressurized by annulus pressure transmitting force through the mandrel to the bottom oil chamber 370 . thus , a downward force would act on the lower oil chamber volume and an upward force would act against the floating piston 356 which partially balances the upward force by loading the bottom oil chamber 370 . in summary , shock absorbers , to be effective must absorb and dissipate large forces within a matter of milliseconds . quick oil metering devices that buck a pressurized gas charge are able to provide a fast acting , positive means with which to absorb these tremendous shock loads and protect the delicate instrumentation located above the tool . the foregoing discloses a novel type of downhole shock absorber device that is capable of very rapid absorption of shock traveling either upward or downward relative to the shock absorber device . the loading to the shock absorbing device is almost instantaneous , within 45 / 100 of a second . in order to counteract forces traveling at these speeds , the shock absorber must be extremely fast acting as is enabled by a gas pressurized system , a hydraulic system or a combination of both . silicone oil is selected because it exhibit its a good compressibility characteristic across a wide range of temperature variations as does nitrogen as selected from various gases . changes may be made in combination and arrangement of elements as heretofore set forth in the specification and shown in the drawings ; it being understood that changes may be made in the embodiments disclosed without departing from the spirit and scope of the invention as defined in the following claims . | 4 |
the following detailed description is merely exemplary in nature and is not intended to limit the described embodiments or the application and uses of the described embodiments . as used herein , the word “ exemplary ” or “ illustrative ” means “ serving as an example , instance , or illustration .” any implementation described herein as “ exemplary ” or “ illustrative ” is not necessarily to be construed as preferred or advantageous over other implementations . all of the implementations described below are exemplary implementations provided to enable persons skilled in the art to make or use the invention and are not intended to limit the scope of the invention which is defined by the claims . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary or the following detailed description . referring to the drawings , an illustrative embodiment of the saw blade sharpening assembly , hereinafter assembly , is generally indicated by reference numeral 1 . the assembly 1 may be used in conjunction with a table or circular saw 2 which may be conventional . the table / circular saw 2 may include a cutting surface 3 . a pair of generally elongated , parallel , spaced - apart miter gauge slots 4 may extend through the cutting surface 3 . a blade slot 5 extends through the cutting surface 3 between the miter gauge slots 4 . a sharpening disk 6 is attached to a saw motor ( not illustrated ) of the table saw 2 and extends through the blade slot 5 for purposes which will be hereinafter described . as shown in fig2 and 3 , the assembly 1 may include a generally elongated , flat , rectangular blade support panel 10 . a pair of generally elongated , parallel , spaced - apart guide rails 11 may be provided on a lower surface of the blade support panel 10 . as shown in fig2 , the guide rails 11 may be adapted for insertion into the respective miter gauge slots 4 in the cutting surface 3 of the table saw 2 . at least one stop 34 may be inserted and secured in at least one of the miter gauge slots 4 to limit the distance between the front edge of the blade support panel 10 and the edge of the sharpening disk 6 . in some embodiments , the blade support panel 10 may be laterally adjustable on the guide rails 11 . accordingly , as shown in fig3 , multiple , generally elongated , parallel , spaced - apart panel adjustment slots 13 may extend through the blade support panel 10 . a pair of knob openings 15 may be provided in each guide rail 11 in registering relationship with respect to a corresponding pair of panel adjustment slots 13 . a panel adjustment knob extends through each panel adjustment slot 13 and is threaded into the corresponding knob opening 15 . a washer 14 may be interposed between each panel adjustment knob 12 and the blade support panel 10 . accordingly , each panel adjustment knob 12 may be partially unthreaded from the corresponding knob opening 15 to disengage an upper surface of the blade support panel 10 and facilitate selective lateral adjustment of the blade support panel 10 with respect to the guide rails 11 . the panel adjustment knobs 12 may be threaded into the respective knob openings 15 and tightened against the blade support panel 10 to secure the blade support panel 10 with respect to the guide rails 11 . a blade support base 16 is provided on the blade support panel 10 . as shown in fig3 , the blade support base 16 may include a pair of generally parallel , spaced - apart , triangular base side panels 17 . a generally sloped base front panel 18 , which may have a generally elongated , rectangular configuration , is attached to and extends between the base side panels 17 . the base front panel 18 may be attached to the base side panels 17 using multiple panel fasteners 19 and / or other suitable fastening technique . multiple blade attachment openings 20 may extend through the base front panel 18 in a selected pattern for purposes which will be hereinafter described . in typical application , the assembly 1 may be used to sharpen carbide - tipped blade teeth 31 on a circular saw blade 30 . accordingly , the guide rails 11 are placed in the respective miter gauge slots 4 in the cutting surface 3 of the table saw 2 , as shown in fig2 . the sharpening disk 6 is attached to the saw motor ( not shown ) of the table saw 2 . the lateral position of the blade support base 16 with respect to the sharpening disk 6 may be selectively adjusted using the panel adjustment knobs 12 , as was heretofore described . at least one stop 34 may be inserted and secured in one or both of the miter gauge slots 4 to limit the distance between the front edge of the blade support panel 10 and the edge of the sharpening disk 6 . as further shown in fig2 , the blade 30 having the blade teeth 31 which are to be sharpened is attached to the blade support base 16 . attachment of the blade 30 to the blade support base 16 may be accomplished by , for example , placing a blade support disk 24 against the sloped surface of the base front panel 18 ; aligning a central blade fastener opening 25 in the blade support disk 24 with a selected one of the blade attachment openings 20 ; and extending a threaded blade fastener 26 through a central blade opening 32 in the blade 30 and through the blade fastener opening 25 in the blade support disk 24 , and threading the blade fastener 26 through the selected one of the blade attachment openings 20 . as shown in fig1 , the lateral position of the blade support panel 10 with respect to the sharpening disk 6 may be adjusted using the panel adjustment knobs 12 , and the proximity of the blade teeth 31 of the blade 30 with respect to the sharpening disk 6 may be adjusted by sliding the guide rails 11 in the respective miter gauge slots 4 , to facilitate contact of the blade teeth 31 with the sharpening disk 6 . accordingly , by operation of the saw motor ( not shown ) of the table saw 2 , the sharpening disk 6 may be individually and sequentially rotated against each blade tooth 31 to sharpen each blade tooth 31 . sequential advancement of the individual blade teeth 31 against the rotating sharpening disk 6 may be facilitated by manual rotation of the blade 30 with respect to the blade fastener 26 . after the blade teeth 31 on the blade 30 are sharpened , the blade 30 may be removed from the blade support base 16 by unthreading of the blade fastener 26 from the blade attachment opening 20 ( fig2 ) and removal of the blade fastener 26 from the blade fastening opening 25 of the blade support disk 24 and the blade opening 32 of the blade 30 . while the preferred embodiments of the disclosure have been described above , it will be recognized and understood that various modifications can be made in the disclosure and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the disclosure . | 1 |
descriptions will be given of an embodiment of the invention in detail with reference to the drawings . fig1 shows a top view of a laser diode array 1 according to an embodiment of the invention . fig2 shows a cross sectional configuration taken along arrows a - a of the laser diode array 1 of fig1 . fig1 and fig2 schematically show the laser diode array 1 , and the dimensions and the shapes in the figures are different from those actually used . the laser diode array 1 includes a plurality of vertical cavity surface emitting laser ( vcsel ) devices 20 ( vertical resonator structure ) on a support substrate 10 . the laser diode array 1 has a function to concurrently output a plurality of laser lights having the same wavelength . further , in the laser diode array 1 , the plurality of laser diode devices 20 is arranged on the surface on a metal layer 14 ( described later ) side of the support substrate 10 , so that the distance p between each optical axis ax of each laser light emitted from each laser diode device 20 is as short as possible . for example , as shown in fig1 , the respective laser diode devices 20 are arranged in a lattice pattern at almost even intervals . however , the laser diode devices 20 are not necessarily arranged in a vertical and reticular pattern at almost even intervals , but they may be , for example , arranged in a line at almost even intervals . the support substrate 10 has , for example , a support base 11 , an insulating layer 12 , an adhesive layer 13 , the metal layer 14 , a via 15 ( connection part ), and an electrode layer 16 . the insulating layer 12 , the adhesive layer 13 , and the metal layer 14 are layered in this order from the support base 11 side on one face side of the support base 11 . the electrode layer 16 is formed on the other face side of the one face of the support base 11 . the via 15 is formed to penetrate through the support base 11 , the insulating layer 12 , and the adhesive layer 13 . one end thereof is in contact with the lower face of the metal layer 14 , and the other end thereof is in contact with the top face of the electrode layer 16 . the support base 11 is made of a material different from that of the laser diode device 20 . the support base 11 is made of , for example , a silicon substrate . the insulating layer 12 is made of an insulative material such as silicon oxide ( sio 2 ) and silicon nitride ( sin ). the adhesive layer 13 is made of , for example , multicrystalline silicon , amorphous silicon or the like . the multicrystalline silicon and the amorphous silicon have a high affinity with the insulative material , such as silicon oxide ( sio 2 ) and silicon nitride ( sin ). thus , when the insulative material such as silicon oxide ( sio 2 ) and silicon nitride ( sin ) is used as the insulating layer 12 and the multicrystalline silicon or the amorphous silicon is used as the adhesive layer 13 , the contact characteristics between the insulating layer 12 and the adhesive layer 13 become strong . the laser diode device 20 is joined to the metal layer 14 of the support substrate 10 . the laser diode device 20 has a columnar vertical resonator structure in which , for example , a lower contact layer 21 , a lower dbr layer 22 , a lower spacer layer 23 , an active layer 24 , an upper spacer layer 25 , a current confinement layer 26 , an upper dbr layer 27 , and an upper contact layer 28 are layered in this order from the metal layer 14 side . that is , the laser diode device 20 is obtained by removing a separately prepared semiconductor substrate 40 ( described later ) from a structure in which the foregoing vertical resonator structure is formed by crystal growth on the semiconductor substrate 40 . the lower contact layer 21 is made of , for example , n - type al x1 ga 1 - x1 as ( 0 ≦ x1 & lt ; 1 ). the lower dbr layer 22 is formed by alternately layering a low refractive index layer ( not shown ) and a high refractive index layer ( not shown ). the low refractive index layer is made of , for example , n - type al x2 ga 1 - x2 as ( 0 & lt ; x2 & lt ; 1 ) having an optical thickness of □ 1 / 4 (□ 1 is an oscillation wavelength ). the high refractive index layer is made of , for example , n - type al x3 ga 1 - x3 as ( 0 ≦ x3 & lt ; x2 ) having an optical thickness of □ 1 / 4 . the lower spacer layer 23 is made of , for example , n - type al x4 ga 1 - x4 as ( 0 ≦ x4 & lt ; 2 ). the lower contact layer 21 , the lower dbr layer 22 , and the lower spacer layer 23 contain a n - type impurity , such as silicon ( si ). the active layer 24 has a multi - quantum well structure in which it well layer ( not shown ) made of undoped in x5 ga 1 - x5 as ( 0 & lt ; x5 & lt ; 1 ) and a barrier layer ( not shown ) made of undoped in x6 ga 1 - x6 n ( 0 & lt ; x6 & lt ; x5 ) are alternately layered . of the active layer 24 , the region opposed to a current injection region 26 a ( described later ) is a light emitting region 24 a . the upper spacer layer 25 is made of , for example , p - type al x7 ga 1 - x7 as ( 0 ≦ x7 & lt ; 1 ). the upper dbr layer 27 is formed by alternately layering a low refractive index layer ( not shown ) and a high refractive index layer ( not shown ). the low refractive index layer is made of , for example , p - type al x8 ga 1 - x8 as ( 0 & lt ; x8 & lt ; 1 ) having an optical thickness of □ 1 / 4 . the high refractive index layer is made of , for example , p - type al 9 ga 1 - x9 n ( 0 ≦ x9 & lt ; x8 ) having an optical thickness of □ 1 / 4 . the upper contact layer 28 is made of , for example , p - type al x10 ga 1 - x10 n ( 0 ≦ x10 & lt ; 1 ). the upper spacer layer 25 , the upper dbr layer 27 , and the upper contact layer 28 include a p - type impurity , such as magnesium ( mg ). the current confinement layer 26 has a current confinement region 26 b in the peripheral region of a current injection region 26 a . the current injection region 26 a is made of , for example , p - type al x11 ga 1 - x11 as ( 0 & lt ; x11 ≦ 1 ). the current injection region 26 a is preferably made of a material having an oxidation rate equal to or slower than that of a peel layer 41 d described later . for example , when the peel layer 4 d is made of alas , the current injection region 26 a is made of al x11 ga 1 - x11 as ( 0 . 98 ≦ x11 ≦ 1 ). in the case where the current injection region 26 a is made of alas ( x11 = 1 ), the thickness of the current injection region 26 a needs to be smaller than the thickness of the peel layer 41 d . meanwhile , when the current injection region 26 a is made of al x11 ga 1 - x11 as ( 0 . 98 ≦ x11 & lt ; 1 ), the thickness of the current injection region 26 a may be equal to or smaller than the thickness of the peel layer 41 d . however , as will be described later , when the oxidation step of the peel layer 41 d is performed separately from the oxidation step of the current confinement layer 26 d , the material of the current injection region 26 a is not particularly limited in relation to the peel layer 41 d . meanwhile , the current confinement region 26 b contains , for example , al 2 o 3 ( aluminum oxide ). as will be described later , the current confinement region 26 b is obtained by oxidizing concentrated al contained in a current confinement layer 26 d from the side face . therefore , the current confinement layer 26 has a function of confining a current . in the laser diode device 20 of this embodiment , a circular electrode layer 30 is formed on the top face of the upper contact layer 28 . the electrode layer 30 is formed by layering , for example , a ti layer , a pt layer , and an au layer in this order . the electrode layer 30 is electrically connected to the upper contact layer 28 . further , an insulating film 31 is formed over the entire surface including each laser diode device 20 and the electrode layer 30 . the insulating film 31 is made of an insulative material , such as silicon oxide ( sio 2 ) and silicon nitride ( sin ). an aperture is formed in part of the region opposed to the electrode layer 30 of the insulating film 31 . an electrode pad 33 electrically connected to a wiring layer 32 through the aperture is formed on the surface of the insulating film 31 ( refer to fig1 ). the laser diode array 1 having the foregoing configuration may be manufactured as follows , for example . first , the laser diode device 20 is manufactured . for example , in the case where the vertical resonator structure is formed from gaas - based group iii - v compound semiconductor , for example , the vertical resonator structure is formed by the metal organic chemical vapor deposition ( mocvd ) method with the use of tma ( trimethyl aluminum ), tmg ( trimethyl gallium ), tmin ( trimethyl indium ), or ash 3 ( arsine ) its a raw material gas . the gaas - based group iii - v compound semiconductor represents a semiconductor that contains at least ga out of the group 3 b elements in the short period periodic table and at least as ( arsenic ) out of the group 5 b elements in the short period periodic table . specifically , the peel layer 41 d , the lower contact layer 21 , the lower dbr layer 22 , the lower spacer layer 23 , the active layer 24 , the upper spacer layer 25 , the current confinement layer 26 d ( layer to be oxidized ), the upper dbr layer 27 , and the upper contact layer 28 are layered in this order over the semiconductor substrate 40 ( gaas substrate ) ( fig3 a ). the foregoing current confinement layer 26 d is made of the same material as that of the current injection region 26 a , and will become the current confinement layer 26 by the after - mentioned oxidation treatment . the peel layer 41 d is preferably structured to have a faster oxidation rate in the lamination in - plane direction than that of the current confinement layer 26 d . for example , in the case where the current confinement layer 26 d is made of the same material as that of the peel layer 41 d ( for example , al x11 ga 1 - x11 as ( 0 . 98 & lt ; x11 ≦ 1 ), the thickness of the peel layer 41 d is preferably larger than that of the current confinement layer 26 d . in the case where the current confinement layer 26 d is made of al x11 ga 1 - x11 as ( 0 . 98 & lt ; x11 & lt ; 1 ), the peel layer 41 d is preferably made of alas . in the case where the current confinement layer 26 d is made of al x11 ga 1 - x11 as ( 0 . 98 & lt ; x11 & lt ; 1 ) and the peel layer 41 d is made of alas , that is , when the peel layer 41 d is made of a material having a faster oxidation rate than that of the current confinement layer 26 d , the thickness of the peel layer 41 d may be equal to or larger than the thickness of the current confinement layer 26 d . next , a region from the upper contact layer 28 to part of the semiconductor substrate 40 is selectively etched by , for example , the dry etching method to form a mesa shape ( fig3 b ). thereby , the peel layer 41 d is exposed on the side face of a mesa m . next , heat treatment is performed at high temperature in a water vapor atmosphere , and the current confinement layer 26 d and the peel layer 41 d are concurrently oxidized from the side face of the mesa m . the oxidation treatment is performed until almost all of the peel layer 41 d is oxidized and the diameter of the non - oxidized region of the current confinement layer 26 d becomes a desired value . thereby , almost all of the peel layer 41 d becomes an insulating layer ( alumninum oxide ), and an oxidized peel layer 41 is formed ( fig4 a ). further , since the outer edge region of the current confinement layer 26 d becomes an insulating layer ( aluminum oxide ), the current confinement region 26 b is formed in the outer edge region , and the current injection region 26 a is formed in the central region thereof . accordingly , the laser diode device 20 is formed over the semiconductor substrate 40 ( fig4 a ). next , for example , the laser diode device 20 is peeled from the semiconductor substrate 40 by , for example , vacuum contact or by using a light curable adhesive sheet or the like ( fig4 b . out of the interfaces between each layer composing the laser diode device 20 , at the interface between the oxidized peel layer 41 and the lower contact layer 21 , the oxidized peel layer 41 and the lower contact layer 21 are not contacted with each other in a graded manner . that is , at the interface between the oxidized peel layer 41 and the lower contact layer 21 , an interlayer in which the both materials are mixed with each other does not exist . otherwise , even if such an interlayer exists , the interlayer slightly exists to the degree that the interlayer is ignorable compared to the thickness of interlayer at the other interfaces . thus , since a stress caused by oxidation has been applied to the interface between the oxidized peel layer 41 and the lower contact layer 21 , the laser diode device 20 is able to be relatively easily peeled at the interface between the oxidized peel layer 41 and the lower contact layer 21 or in the vicinity thereof by the peeling step . heating ( alloying ) may be performed at about from 300 deg c . to 400 deg c . before the peeling step . in this case , the stress at the interface between the oxidized peel layer 41 and the lower contact layer 21 is further increased , and thus the laser diode device 20 is able to be easily peeled . if the oxidized peel layer 41 remains on the laser diode device 20 side , the portion of the oxidized peel layer 41 remaining on the laser diode device 20 side is removed by wet etching . next , the plurality of laser diode devices 20 is arranged with the lower contact layer 21 side downward on the metal layer 14 of the support substrate 10 and jointed to the metal layer 14 ( fig5 and fig6 ). fig6 is a cross sectional configuration view takes along arrows a - a of fig5 . next , the circular electrode layer 30 is formed on the top face of the laser diode device 20 ( fig2 ). subsequently , the insulating film 31 is formed over the entire surface including the laser diode device 20 and the electrode layer 30 . after that , the electrode pad 33 is formed in a place with a given distance from the laser diode 20 in the surface of the insulating film 31 . after that , the aperture ( not shown ) is formed in part of the region opposed to the electrode layer 30 in the insulating film 31 . after that , the wiring layer 32 extending from the surface of the electrode layer 30 exposed in the aperture to the electrode pad 33 is formed . accordingly , the laser diode array 1 of this embodiment is manufactured . in the laser diode array 1 of this embodiment , when a given voltage is applied between the connection pad 33 electrically connected to the electrode layer 30 on each laser diode device 20 and the electrode layer 16 , a current is injected into the active layer 24 , light emission is generated by electron - hole recombination , and stimulated emission is repeated in the device . as a result , laser oscillation is generated in a given wavelength □ 1 , and laser light in wavelength □ 1 is outputted outside from the light emitting region 24 a of each laser diode device 20 through the aperture of the electrode layer 30 . in a laser diode array 100 of the related art shown in fig1 , that is , in the laser array in which a columnar vcsel 120 obtained by layering , for example , a lower dbr layer 121 , a lower spacer layer 122 , an active layer 123 , an upper spacer layer 124 , a current confinement layer 125 ( current injection region 125 a and a current confinement region 125 b ), an upper dbr layer 126 , and an upper contact layer 127 in this order over a common substrate 110 is directly formed by crystal growth , as shown in the equivalent circuit shown in fig1 , a resistance component r 3 exists between each laser diode 120 and a ground gnd independently of a current path of other laser diode 120 , and a resistance component r 4 exists on the current path common to each laser diode 120 . the resistance component r 4 is a resistance component of the common substrate 110 . in the case where the resistance component r 4 exists , for example , when one laser diode device 120 is cw - driven as shown in fig8 a and another laser diode device 120 adjacent to the foregoing one laser diode device 120 is pulse - driven as shown in fig8 b , in the equivalent circuit of fig1 , an input voltage v l1 of the cw - driven laser diode device 120 has a wavy waveform including noise as shown in fig1 a , and an input voltage v l2 of the pulse - driven laser diode device 120 has a distorted rectangular waveform including noise as shown in fig1 b . that is , electric cross talk is generated between the laser diode devices 120 adjacent to each other . meanwhile , in this embodiment , each laser diode device 20 is jointed to the surface of the metal layer 14 of the support substrate 10 . thus , as shown in fig7 , in the equivalent circuit of the laser diode array 1 , the resistance component r 3 exists between each laser diode device 20 and the ground gnd independently of a current path of the other laser diode device 20 , but no resistance component exists on the current path common to each laser diode device 20 . this is because , in the manufacturing course of this embodiment , the semiconductor substrate 40 is removed ( peeled ) from the structure in which the vertical resonator structure is formed by crystal growth over the semiconductor substrate 40 , and thereby the resistance component of the semiconductor substrate 40 that is connected in series to each vertical resonator structure is separated from each vertical resonator structure . thereby , for example , in the case where one laser diode device 20 is cw - driven as shown in fig8 a and another laser diode device 20 adjacent to the foregoing one laser diode device 20 is pulse - driven as shown in fig8 b , in the equivalent circuit of fig7 , the input voltage v l1 of the cw - driven laser diode device 20 has a flat waveform not including noise as an input voltage waveform , and the input voltage v l2 of the pulse - driven laser diode device 20 has a rectangular waveform not including noise as the input voltage waveform . that is , electric cross talk is not generated between the laser diode devices 20 adjacent to each other . as described above , in this embodiment , since each laser diode device 20 is jointed to the surface of the metal layer 14 of the support substrate 10 , the resistance component of the semiconductor substrate 40 that is connected in series to each laser diode device 20 is separated from each laser diode device 20 . thereby , electric cross talk between the laser diode devices 20 adjacent to each other is inhibited from being generated . in the foregoing embodiment , the oxidation steps of the peel layer 41 d and the current confinement layer 26 d are concurrently performed . however , each oxidation step may be performed separately . for example , it is possible that after the side face of the current confinement layer 26 d is coated with a protective film so that the side face of the peel layer 41 d is not coated therewith , the oxidized peel layer 41 is formed by oxidizing the peel layer 41 d from the side face , the protective film is removed , and then the current confinement layer 26 d is oxidized from the side face to form the current confinement layer 26 . further , the formation step of the laser diode device 20 may be performed , for example , as follows . first , the peel layer 41 d , the lower contact layer 21 , the lower dbr layer 22 , the lower spacer layer 23 , the active layer 24 , the upper spacer layer 25 , the current confinement layer 26 d ( layer to be oxidized ), the upper dbr layer 27 , and the upper contact layer 28 are layered in this order over the semiconductor substrate 40 ( gaas substrate ) ( fig3 a ). then , a region from the upper contact layer 28 to part of the lower dbr layer 22 is selectively etched by , for example , a dry etching method to form a mesa shape . next , heat treatment is performed at a high temperature in the water vapor atmosphere , the current confinement layer 26 d is oxidized from the side face of the mesa m to form the current confinement layer 26 ( fig9 b ). since the peel layer 41 d is not exposed on the side face of the mesa m , the peel layer 41 d is not oxidized . next , a protective film 19 is formed on the entire surface including the mesa m ( fig1 a ). after that , a groove 29 a penetrating thorough the protective film 19 is formed to surround the mesa m ( fig1 b ). thereby , the lower dbr layer 22 is exposed on the bottom face of the groove 29 a . next , for example , the lower dbr layer 22 and the lower contact layer 21 that are directly under the groove 29 a are selectively removed by using , for example , a phosphoric acid etchant ( fig1 a ). after that , the peel layer 41 d is selectively removed by using a fluorinated acid etchant ( fig1 b ). thereby , the contact force by the peel layer 41 d between the semiconductor substrate 40 and the lower dbr layer 22 is lowered . next , a support substrate 42 is bonded to the top face of the protective film 19 ( fig1 a ). after that , by using the support substrate 42 , the laser diode device 20 is peeled from the semiconductor substrate 40 ( fig1 b ). accordingly , the laser diode device 20 is able to be formed as well . in the foregoing embodiment , the vcsel 20 is jointed to the surface of the metal layer 14 of the support substrate 10 having the via 15 . however , for example , as shown in fig1 and fig1 , it is possible that a support substrate 50 in which the insulating layer 12 , the adhesive layer 13 , and the metal layer 14 are sequentially layered from the support base 11 side is prepared on one surface of the support base 11 , and the vcsel 20 is jointed to the surface of the metal layer 14 of the support substrate 50 . however , in this case , for example , it is necessary that an aperture 31 a is formed in part of the insulating layer 31 formed on the surface of the metal layer 14 , part of the metal layer 14 is exposed from the aperture , and the exposed section is used as an electrode pad 14 a to decrease the potential of the metal layer 14 to the ground potential . further , in the foregoing embodiment , the wiring layer 32 and the electrode pad 33 are formed over the support substrate 10 with the insulating layer 31 in between . however , for example , it is possible to provide a buried layer made of an insulative material , such as polyimide , around the laser diode device 20 , the wiring layer 32 and the electrode pad 33 that are formed on the top face of the buried layer , and thereby the capacity component generated between the wiring layer 32 electrode pad 33 and the metal layer 14 is decreased as much as possible . the laser diode array 1 according to the foregoing embodiment or the modification thereof is suitably applicable to , for example , a printer , such as a laser printer , and an optical communication device , such as a multichannel optical integrated device . for example , as shown in fig1 , as a light source 61 in a laser printer 60 including the light source 61 , a polygon mirror 62 for reflecting light from the light source 61 and scanning the reflected light , a f □ lens 63 for guiding the light from the polygon mirror 62 to a photoconductive drum 64 , the photoconductive drum 64 receiving the light from the f □ lens 63 to form an electrostatic latent image , and a toner supplier ( not shown ) adhering the toner according to the electrostatic latent image to the photoconductive drum 64 , the laser diode array 1 may be used . further , for example , as shown in fig1 , as a light source 72 in art optical communication device 70 including the light source 72 , a light guide 73 in which a light input end is arranged correspondingly to a light output end of the light source 72 , and an optical fiber 74 in which a light input end is provided correspondingly to a light output end of the light guide 73 on a support substrate 71 , the laser diode array 1 may be used . while the descriptions hereinbefore have been given of the invention with reference to the embodiment and the like , the invention is not limited to the foregoing embodiment and the like , and various modifications may be made . it should be understood by those skilled in the art that various modifications , combinations , subcombinations and alternations may occur depending on design requirements and other factors insofar as they are within the scope of the appended claims or the equivalents thereof . | 7 |
as various embodiments of the fluid dispensing device are described , reference will be made to fig1 - 3 . certain parts of the dispensing device are denoted by reference numerals . where there is more than one of the same feature , generally only one will be denoted by a reference numeral . where assembly steps are described , these steps are exemplary and are not to be limiting as to the sequence of operations used to arrive at the final package . also , directions such as up , down , top , bottom , front , back , etc . are used for convenience in describing the device and are not meant to be limiting . fig1 shows a side view of a dispensing device 200 , in an assembled state . the parts include cylinder 210 , actuator button 220 , stopper 230 ( hidden within the cylinder ), collar 240 , outlet valve 250 , cap 260 , and actuator track 270 ( hidden within track housing 276 in fig1 ). cylinder 210 may by a generally right circular shape , such as a round tube . the cylinder may be made of a material such as a plastic and may be formed by injection molding . the cylinder may have an open end ( toward the left in fig1 ) and distal end ( toward the right in fig1 ). along at least part of the length of cylinder 210 may be provided gradations 214 such as printed indicia , molded indicia , or transparent , translucent , or opaque areas . cylinder 210 may be transparent , translucent , or opaque . if the cylinder is not transparent , at least a portion 216 may be provided which is transparent or translucent in order for a user to see the contents of the cylinder . at the distal end of the cylinder there may be provided an outlet such as nozzle 218 . a one way valve or drip - prevention feature such as a slit valve or duckbill valve 250 , or split or rolling septum , may be provided within or on the outlet nozzle 218 to seal the product in the cylinder when the delivery device is at rest . alternately , a spring - loaded valve may be used . an outlet valve , for example a spring - loaded valve , may prevent a child from sucking the contents from the cylinder , and may provide an additional microbial barrier for the contents . a removable cap 260 may be provided to attach onto or fit over the distal end of cylinder 210 and / or nozzle 218 . cap 260 may be used as an auxiliary dispensing device , for example with the dose dispensed into the cap so that it may be poured from the cap into a patient &# 39 ; s mouth . the cap may have graduations provided thereon , for example by molding or printing . the cap may be attached to cylinder 210 or nozzle 218 by a child - resistant feature , for example using any of the known child - resistant attachments by which a cap may be attached to a medicine bottle . as shown in fig2 a , stopper 230 may be sized to fit in cylinder 210 . stopper 230 may be made from rubber , plastic , or elastomeric material and may be sized and shaped to provide a close , fluid - tight fit against the inside of cylinder 210 . stopper 230 and / or pusher plate 274 may be long enough to move smoothly through cylinder 210 without tending to turn out of axial alignment with the cylinder . an actuator track 270 may be provided to push the stopper 230 forward in the cylinder 210 . the actuator track 270 may include a series of links 272 connected together with a forward end of the series of links connected to a pusher plate 274 immediately behind stopper 230 ( e . g . toward the open or left end of cylinder 210 ). the length of the series of links may be approximately equal to the useful length of the cylinder 210 through which stopper 230 will move . the links 272 may be formed of a plastic or polymer material or other somewhat flexible material and may be connected one to another through living hinges , that is , thinned portions capable of flexing . the links 272 may be housed in a track housing 276 which may be provided on the outside of cylinder 210 . as shown in fig2 b , the links may have a generally flat aspect as with links 272 b . as shown in fig2 c , the links may have a somewhat curved aspect as with links 272 c , in which case actuator track 270 may form a shallow trough - shaped structure which may more readily transfer a pushing force from tooth 224 to pusher plate 274 . some or all of links 272 may have an opening , depression , or protrusion to receive tooth 224 ( described below ), or the tooth may engage a gap between links such as a gap at a living hinge between links . the living hinges between the 272 links allows actuator track 270 to bend over 180 degrees on itself when pulled around the junction where track housing 276 joins cylinder 210 , which allows for a compact construction . however , the living hinges still help provide a relatively rigid actuator track 270 when the links 272 are being pushed between tooth 224 and drive plate 274 . at the open end of the cylinder 210 may be provided an actuator button 220 that may be received in a collar 240 . on the inside of collar 240 may be a bore 242 through which actuator button 220 may pass . a spring 244 may be provided to bias the actuator button outward from the collar . a tooth 224 may be provided on a portion of the actuator button extending into the cylinder 210 . the tooth 224 may be biased radially outward by a flexing arm 222 . collar 240 and / or actuator button 220 may be provided with indicia such as symbols or words to indicate how to align the actuator button 220 with collar 240 in order to bring driving tooth 224 into alignment with links 272 so that the dispensing device may be utilized . thus , a rotary motion of the actuator button 220 may bring the tooth 224 into or out of alignment with links 272 . to help rotate button 220 , it may be provided with knurling or other texture or raised or depressed areas for better gripping of the button by the user . this ability of the actuator button 220 to be rotated to engage or disengage the driving tooth 224 may be utilized as a child resistant or travel lock option . an audible or tactile indication may be produced when the actuator button has been turned so that the driving tooth 224 is aligned into its engaged position . fig3 a - 3c illustrate use of the dispensing device . as shown in fig3 a , initially the plunger actuator button may protrude outward ( to the left in fig3 a ) under the force of spring 244 . the tooth 224 may engage between two links 272 of the actuator track 270 . as shown in fig3 b , inward pressure p 1 on actuator button 220 will cause the button to move inward against the force of spring 244 , so that tooth 224 forces one of the links 272 further inward into cylinder 210 . this in turn forces pusher plate 274 inward , and stopper 230 as well , causing a dose of the fluid contents to be expelled from the nozzle 218 . tooth 224 may engage an opening or a protrusion in a link 272 , or may engage a gap between links such as a gap at a living hinge between links . actuator button 220 may be constructed to provide an audible or tactile indication when the button is depressed to its full stroke . in one manner of operation , the user may push on the actuator button with his thumb while one or more fingers support or grip the collar or the cylinder . as shown in fig3 c , actuator button 220 upon being released will be forced back outward by spring 244 . tooth 224 will disengage from the links of the actuator track , and move back outward until it engages with the next link 272 . the dispensing device is then ready for another cycle . the steps shown in fig3 a - 3c may be repeated to eventually deliver several doses , for example , about ten doses for the dispensing device shown in fig3 a - 3c . the dispensing device prevents a user from dispensing more than one dose in one actuation of the button , which may help prevent an overdose of medication . the actuator button stroke length and the pitch of the holes the track links may be designed to give the precise dose , and no more , with each actuation of the device . although various aspects of the disclosed dispensing device have been shown and described , modifications may occur to those skilled in the art upon reading the specification . | 0 |
specific embodiments of the present invention are now described with reference to the figures , wherein like reference numbers indicate identical or functionally similar elements . the following detailed description is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . although the description of the invention is in the context of a package for a medical device , the invention may also be used in packaging for other products . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary or the following detailed description . fig1 - 10 shows an embodiment of a container or carton or package 100 according to an embodiment hereof . package 100 may be made of any material suitable for packaging products such as medical devices . for example , and not by way of limitation , package 100 may be made from solid bleach sulfate carton , cardboard , and other similar materials . package 100 as shown in fig1 is generally shaped as a box with an interior volume and includes a first corner pocket 120 and a second corner pocket 140 . first and second corner pockets 120 , 140 are finger pockets by which a user may easily remove package 100 from a shelf or other storage unit . further , although two ( 2 ) corner pockets are shown and described herein , it is recognized that a package with only a single corner pocket , or more than two ( 2 ) corner pockets , may be utilized . package 100 includes a first or left panel 102 , a second or right panel 104 , a front edge panel 106 , a rear edge panel 108 , a top edge panel 110 , and a bottom edge panel 112 . although directional descriptions such as “ left ”, “ right ”, “ front ”, “ rear ”, “ top ”, and “ bottom ” have been used to describe the panels of package 100 , these descriptions are merely used for reference to describe package 100 as it may be placed on a shelf with front edge panel 106 facing outwardly and a user facing front edge panel 106 . however , these directional descriptions do not limit package 100 as it may be oriented in other directions in space . first corner pocket 120 is formed as a chamfered corner between front edge panel 106 and top edge panel 110 . first corner pocket 120 is not merely a chamfered corner , as it includes a depth to form a pocket . as can be seen in fig1 - 3 , first corner pocket 120 includes a lip 122 , a first side surface 124 , a second side surface 126 , and an angled surface 128 . lip 122 is formed by angled surface 128 contacting front edge panel 106 at a location remote from a top edge 123 of front edge panel 106 . similarly , second corner pocket 140 is formed as a chamfered corner between front edge panel 106 and bottom edge panel 112 . as with first corner pocket 120 , second corner pocket 140 has a depth to form a pocket . as can be seen in fig1 and 4 - 5 , second corner pocket 140 includes a lip 142 , a first side surface 144 , a second side surface 146 , and an angled surface 148 . lip 142 is formed by angled surface 148 contacting front edge panel 106 at a location remote from a bottom edge 143 of front edge panel 106 . fig6 shows a blank sheet of laminar material 180 , such as solid bleach sulfate carton , cardboard , and other similar materials , used to make the package of fig1 - 5 . fig6 shows the panels and surfaces described above with respect to fig1 - 5 and fold lines where blank sheet of material 180 is folded as described below to form package 100 . as described below , left panel 102 and right panel 104 as shown in fig6 are considered the outer or exterior surfaces thereof . thus , the directions of the folds in the description below are such that the surfaces shown in fig6 are outer or exterior surfaces of package 100 . the folds can equally be in the opposite direction such that the surfaces shown in fig6 are inner or interior surfaces of package 100 . in particular , sheet 180 is folded approximately 90 degrees along fold line 113 between left panel 102 and bottom edge panel 112 such that left panel 102 and bottom edge panel 112 are approximately perpendicular to each other . sheet 180 is also folded approximately 90 degrees along fold line 115 between bottom edge panel 112 and right panel 104 such that bottom edge panel 112 and right panel 104 are approximately perpendicular to each other . folding sheet 180 along fold lines 113 and 115 as described above causes an inner surface of left panel 102 to face an inner surface of right panel 104 , separated from each other by approximately the width of bottom edge surface 112 . the term “ approximately 90 degrees ” as used herein means approximately 90 degrees such that the panels described herein form the general shape of a box and allows for minor variations from 90 degrees provided that the package formed from folding sheet 180 forms such a box . sheet 180 is also folded approximately 90 degrees along a fold line 107 between left panel 102 and rear edge panel 108 such the rear edge panel 108 extends from left panel 102 towards right panel 104 . sheet 180 is also folded along a fold line 105 between rear edge panel 108 and a tab 118 . as right panel 102 and left panel 104 are folded towards each other , tab 118 is tucked inside a rear edge 172 of right panel 104 such that tab 118 extends along the inner surface of right panel 104 between a corner tab 174 and a corner tab 176 . similarly , sheet 180 is also folded approximately 90 degrees along a fold line 109 between left panel 102 and top edge panel 110 such the top edge panel 110 extends from left panel 102 towards right panel 104 . sheet 180 is also folded along a fold line 111 between top edge panel 110 and a tab 116 . as left panel 102 and right panel 104 are folded towards each other , tab 116 is tucked inside a top edge 117 of right panel 104 such that tab 116 extends along the inner surface of right panel 104 between a corner 176 and first pocket 120 associated with a fold line 136 . tab 116 is attached to the interior surface of right panel 104 . tab 116 may be adhesively attached to the interior surface of right panel 104 or attached in other ways . the adhesive used to adhesively attach tab 116 to the interior surface of right panel 104 may be any adhesive . for example and not by way of limitation , adhesive product number 2171 or 2174 available from the adhesive products inc . may be utilized . sheet 180 is also folded approximately 90 degrees along a fold line 103 between left panel 102 and front edge panel 106 such front edge panel 106 extends from left panel 102 towards right panel 104 . sheet 180 is also folded along a fold line 101 between front edge panel 106 and a tab 114 . as left panel 102 and right panel 104 are folded towards each other , tab 114 is tucked inside a front edge 178 of right panel 104 such that tab 114 extends along the inner surface of right panel 104 between first pocket 120 associated with a fold line 136 and second pocket 140 associated with a fold line 156 . further , pockets 120 and 140 are formed as sheet 180 is folded as described above , and as described in more detail below . in particular , fig7 - 9 shows pocket 140 being formed . although pocket 140 is being shown , pocket 120 is formed in a similar manner . as shown in fig7 , as ( or after ) left panel 102 and right panel 104 are folded towards each other , a tab 152 is pulled out of plane with bottom edge panel 112 and bent along a fold line 156 to form angled surface 148 extending at an angle α relative to bottom edge panel 112 . angle α may be in the range of 30 to 60 degrees as defined in fig8 . sheet 180 also folds along a fold line 147 between second side surface 146 and front panel 102 and along a fold line 149 between first side surface 144 and rear panel 104 . as shown in fig8 - 9 , tab 152 is pushed towards an interior volume of package 100 such that second pocket 140 folds along a fold line 154 between second side surface 146 and angled surface 148 such that second side surface 146 is pushed against the inner surface of left panel 102 . similarly , second pocket 140 folds along a fold line 150 between first side surface 144 and angled surface 148 such that first side surface 144 is pushed against the inner surface of right panel 104 . tab 152 may be folded along fold line 158 to extend towards first pocket 120 along the inside surface of front edge panel 106 . alternatively , tab 152 may be folded in the opposite direction along fold line 158 to create a double - thickness with front edge panel 106 for at least a portion of the front edge of second pocket 140 at lip 142 . first pocket 120 is formed in a similar way as described above with respect to second pocket 140 . accordingly , sheet 180 as shown in fig6 includes a fold line 136 between top edge panel 110 and angled surface 128 , a fold line 127 between first side surface 124 of first pocket 120 and tab 116 , a fold line 129 between second side surface 126 and front panel 102 , a fold line 130 between angled surface 128 and first side surface 124 , a fold line 134 between angled surface 128 and second side surface 126 , and a fold line 138 between angled surface 148 and tab 132 . then , front edge panel 106 is folded along fold line 103 such that front edge panel 106 extends towards right panel 104 and tab 114 is tucked inside front edge 178 of right panel 104 . a portion of tab 114 adjacent first pocket 120 is tucked between a portion of first side surface 124 of pocket 120 and the inner surface of right panel 104 . similarly , a portion of tab 114 adjacent second pocket 140 is tucked between a portion of first side surface 144 of second pocket 140 and the inner surface of right panel 104 . fig1 shows two packages 100 adjacent conventional packages . fig1 shows a package 100 with a single pocket 120 instead of two pockets , and located on a shelf adjacent to conventional packages . as can be seen in fig1 , it can be difficult to remove a conventional package from a packed or full shelf because it is difficult to access a surface to grab or upon which to pull . the large panels of the conventional packages ( i . e ., left and right panels ) are blocked by adjacent packages . the top and bottom panels are blocked by the shelf . a package according to the present application , on the other hand , allows a user to insert a finger into pocket 120 and slide or tilt package 100 out of the shelving unit , as shown in fig1 - 13 . similarly , if the packages are stacked horizontally , as shown in fig1 - 15 , a user can access pocket 120 to easily remove package 100 from the shelf . while various embodiments according to the present invention have been described above , it should be understood that they have been presented by way of illustration and example only , and not limitation . it will be apparent to persons skilled in the relevant art that various changes in form and detail can be made therein without departing from the spirit and scope of the invention . thus , the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the appended claims and their equivalents . it will also be understood that each feature of each embodiment discussed herein , and of each reference cited herein , can be used in combination with the features of any other embodiment . | 1 |
the connection arrangement or apparatus and procedure of this invention , while capable of broader mechanical application , is specifically designed to be used with flat conductor cable systems . fig1 a and 1b illustrate one example of such a cable . thin strips of conducting material 1 , such as copper , are embedded in , or adheringly surrounded by a thin sleeve 2 of an insulating plastic material , for example , a polyester . the metal strips 1 are separated and insulated from each other by spacings 3 at the edges of the cable and between the metal strips . the top and bottom plastic portions of the sleeve are simply bonded to each other at these points . fig1 b is an illustration of the cross section of such a cable with the dimensions of the components somewhat exaggerated for easier illustration . an example of 3 - strip flat conductor cable is a type fcc 12 awg , 300 volt , 20 amp copper cable sold by burndy corporation . as a dimensional example , the thickness of this specific cable is approximately 15 mils across a conductor strip , the copper strip itself being approximately 7 mils , and the insulating plastic being approximately 4 mils at the top and at the bottom . of course , at the spacings 3 the overall width decreases to about 8 mils of plastic . in any event , the connection arrangement and procedure of this invention is not limited in its scope to any specific gauge or thickness of conductor cable . as before stated , this invention makes use of a flanged electrically - conductive malleable or compressible rivet connector , a preferred structure of which is illustrated in fig2 a and 2b . the rivet connector 4 consists of a thin disc - shaped flange or base 5 and a vertical post 6 . the post 6 and indeed the connector 4 is hollow , wherein the opening in the flange and the hollow or inner diameter of the post are equal . a preferred feature of the connector of this invention is that the post 6 is tapered at or near the top as shown to form a wedge . the tapered portion 7 slopes from the top of the post outward toward the flange portion of the rivet connector . the wedge feature is designed to assist a suitable puncturing and expansion of the flat conductor cable during the connection procedure . this will be described in more detail below . the dimensions of the connector are not critical per se , however , having selected specific types of conducting elements to connect , the practioner of this invention will find that a preferred range of dimensions works best . thus for example , using the specific type of conductor cable mentioned above , it has been found that excellent connections are produced with a rivet connector having the following dimensions : inner diameter ( hollow diameter ) of about 166 mils ; post wall thickness of about 25 mils ; total height of about 248 mils ; and a flange diameter of approximately 430 - 440 mils . the material of construction of the rivet connector must be compressible or malleable under force in order to be cold - formable into the eyelet shape desired at the end of the procedure . additionally , of course , the material is preferably electrically conductive to approximately the same extent as the conductivity of the metal strips 1 . obviously the easiest way to match conductivities is to use the same materials ; therefore , for copper flat conductor cable it is preferred that the connector element be comprised of copper or a copper alloy . to enhance the connecting procedure , and to reduce or eliminate any tendency for the connector material to adhere to the anvil means , and also for ease of removal of the completed connector from the anvil means , it is preferred that the surface of the connector be coated with lubricating or smooth inorganic or organic material . suitable materials would include paraffin or smooth metal such as tin or combinations of these . the exact degree of taper of the wedge at the top of the rivet post is not critical in and of itself , and may in fact vary depending upon the type of flat conductor cable undergoing the connection procedure . generally however , angles of 40 degrees to 50 degrees have been found to achieve the desired results . fig3 a and 3b illustrate the anvil means of this invention , the shape and construction of which is considered very important for proper functioning of this invention . the anvil 8 is comprised of a hard pressure - resistant material , such as a polished steel and the relative motion which occurs between the rivet connector 4 and the anvil 8 causes the connector to be formed into the final desired eyelet shape . in a preferred compressing device , which is described and claimed in detail in copending u . s . patent application ser . no . 06 / 314 , 966 , filed of even date , assigned to burndy corporation , and entitled apparatus and method for installing electrical connectors on flat conductor cable , the anvil means 8 is held stationary with respect to the movement of the compressing means and connector . however , it it not critical to this invention which of the connector and anvil means moves with respect to the other . it is the thrusting movement of the one toward the other that is important . the anvil 8 consists of a relatively thick , disc - like base 9 , to which is attached a generally vertical post 10 . the upper portion 11 , shown extending from the top of post 10 down to the dashed line , is perpendicular with respect to the base and the post thereafter is gently tapered outward until it reaches the base . at that point , the post opens up into a curved , circular well 12 formed in the base . specifically referring to fig3 b , line 13 -- 13 represents the top surface of the anvil base 9 , and is shown passing over well 12 and through post 10 for purposes of reference . it is seen that the well 12 is generally of u - shape , and it is clear from fig3 a and 3b that the well surrounds the post 10 where it is connected to the base 9 . the slight outward tapering of anvil post 10 which occurs below upper portion 11 serves several purposes . the taper forces the malleable rivet post placed thereover to expand in an outward direction , such that when the tip of the rivet post reaches well 12 , it will begin to expand further outward and around the puncture made in the cable to form the eyelet . additionally , as the rivet post forces the cut cables ahead of it , the anvil post taper controls the descent of the cables such that the expanding rivet post and the cut cables arrive in the well in proper placement and timing . further , since there is friction between the cut cable or cables and the tapered portion of the anvil post , it has been found that this friction exerts a cleaning or polishing effect on the conductive strips of the cables to enhance the quality of the electrical connection which is about to be made . as with the dimensions of the rivet connector 4 , the dimensions of the anvil means are not critical in and of themselves . they will depend in large measure upon the parameters selected for the conducting cables or other articles to be joined , the dimensions and materials of construction of the rivet connector to be utilized , and the compressing forces to be used to effect puncture and connection . as an example , using the specific flat conductor cable referred to above , and the specific dimensions given for the copper rivet connector , it has been found that the following anvil dimensions produce excellent connections when utilized with compression forces of about 2500 to 3500 pounds : diameter of the anvil base of about 624 mils ; height of the base from the bottom to line 13 -- 13 of about 375 mils ; height of the anvil post from line 13 -- 13 to the top of about 174 mils ; diameter of the upper , non - tapered portion of the anvil post of about 163 mils ; length of post portion 11 of about 44 mils ; the angle of outward taper of the anvil post is approximately 2 . 5 ° from the normal ; the distance from line 13 -- 13 to the bottom of well 12 , or in other words the depth of the well is about 19 mils ; and the distance across the top of the well from the side of the post to the other side of the well along line 13 -- 13 is from about 38 - 44 mils . the sequence of cable puncturing and electro - mechanical fixation will now be described with reference to fig4 - 7 . first with respect to fig4 a ram portion 14 of a suitable compression means , such as the means described in the above referred to pending application , holds and registers the rivet connector 4 above anvil means 8 such that the post 6 of the rivet is perfectly concentric with the post 10 of anvil 8 . resting on top of the anvil for purposes of this illustration , are portions of two flat conductor cables which are to be electrically connected , as would occur in a tapping or splicing operation , by the rivet connector 4 . both portions of the two cables contain of course , a conductive metal strip since the object is to electro - mechanically connect the two cables . therefore , the portion of flat conductor cable 15 resting immediately on anvil 8 comprises a bottom plastic insulating layer 16 , a layer of copper conductor 17 , and a top layer of insulating plastic 18 . directly above cable 15 is another flat conductor cable 19 , the portion immediately over the anvil comprising a bottom plastic layer 20 adjacent to plastic layer 18 , a middle copper strip 21 , and an upper plastic insulating layer 22 . referring now to fig5 ram 14 of the compressing means has moved the rivet connector 4 down forcibly against cables 15 and 19 . in so doing , the cables have been ruptured and post 6 of rivet connector 4 has slid over the top portion of post 10 of anvil 8 . it should be recalled that the inner diameter of the rivet post is just slightly larger than the diameter of the upper portion 11 of the anvil post . this swift downward action results in a rupturing of cables 15 and 19 due to the combined forces of the wedge feature 7 of rivet post 6 and the close resistance fit between the rivet post and the anvil post . cable portions 15a and 19a are the circular cut out portions caused by this puncturing action . the puncturing is actually completed well before the leading edge of the rivet post has reached the tapered portion of anvil post 10 , and it can be seen that the puncturing action of the rivet post also drives the cut portions of cables 15 and 19 before it , down along the anvil post and towards well 12 . referring now to fig6 as the downward stroke of the compression means continues , the leading edge of post 6 , still driving the cut portions of the cables ahead of it , enters the tapered area of anvil post 8 and is spread outward as a result thereof . as the leading edge continues and encounters well 12 , cold forming of post 6 , as defined by the shape of the well , commences . referring now to fig7 the compression stroke continues to the end , and forces the post 6 of the rivet connector 4 to expand into a rounded eyelet 23 , which curls under around and up to clamp the cable sandwich on the underside of 15 in the direction of the flange 5 . the downward movement of the cut portions of the cables 15 and 19 is limited by their physical length , and as the post 6 continues to expand around the well , the rivet post material overcomes the advance of the cut portions of the cables which snap up into the enclosure formed by the eyelet and flange portions of the rivet connector . therefore , together the eyelet portion 23 and the flange 5 form a pinch clamp to mechanically secure the connection and it can be clearly seen that the conductor strip portions 17 and 21 of cables 15 and 19 are in intimate contact with the inside of the eyelet , thus yielding an excellent electrical connection . as before mentioned , any suitable compression means for forcing the hollow post of the connector over the top of the anvil post , will suffice . compression forces of between about 2500 and 3500 pounds produce excellent results . again reference is made to the above mentioned copending u . s . patent application , of burndy corporation , the entire contents of which are hereby expressly incorporated herein by reference . referring to fig8 a , a finished tap connection of two flat conductor cables accomplished by the connection apparatus of this invention is illustrated , looking at the flange side of the connector . fig8 b illustrates this connection from the other side , that is , the eyelet side of the connector . the connector is of course hollow . although the connection apparatus and procedure of this invention has been described and illustrated with respect to the joining of two flat conductor cables , such as would occur in a tapping or splicing operation , this invention also embraces within its scope terminal or transition connections , in which the rivet connector is driven through and clamps the top and bottom portion of a single flat conductor cable , or in which the end of the cable is folded upon itself once and the connector driven through the folded over portion . the reason for the latter possibility is to insure good electrical connection by giving the connector two opportunities to pass through the cable . a terminal or service module connection is illustrated in fig9 in which proper sized screws 24 have been inserted through the hollow connector openings 25 and into a suitable insulating holding bar 26 . then , for example , lugs 27 from an electrical outlet are placed between the screw and flange portion of the connector to achieve the terminal connection . alternately , instead of lugs making the connection conventional round wires may be stripped and bent into curved shapes which would be inserted between the screw and flange as with the lugs illustrated . a transition connection would be accomplished in a similar fashion , since , at the transition junction , the cable to be connected is mounted generally on an insulating holding bar , and screws are then inserted into the connector openings similar to that depicted in fig9 . this invention can be utilized to produce electrical connections in other flat conductive articles as well . for example , the steel grounding shields which , as indicated above , are used with flat conductor wiring systems , may be electro - mechanically connected using the connector and apparatus of this invention . typically , the grounding shield strips are of about 10 mils thickness , and the procedure to utilize the rivet connector of this invention to secure two such shield pieces together would be essentially the same as that detailed for cable connecting . it has been found however that the best electro - mechanical connections between two such conductive sheets of material are produced when a separation layer is placed between the two sheets to be connected . conveniently enough for under carpet wiring systems , a strip of fabric adhesive would be one example of a separating layer which works quite suitably . generally , the separating layer which may also be a suitable plastic film should be between 5 and 15 mils in thickness . the separation layer is believed to be responsible for the best eyelet formation when two metal strips are connected using the procedure and apparatus of this invention . this invention is capable of use quite beyond the specific examples detailed herein , as will be apparent to practioners in the relevant art . although not described herein , these further applications for making electro - mechanical connections are deemed to be within the scope of this invention . | 7 |
the present patent is intended to protect a chemical process for producing glass with an anti - reflective finish , comprising immersion in an acid solution , for simultaneous and continuous production of one or several glass pieces and / or sheets with varying dimensions , thicknesses , colors , standard uses and applications ; such anti - reflective glass may be treated on both sides in the production process . the produced glass of the present process and its characteristics , in addition to the equipment , accessories , and materials specially designed for this process is described in detail below . the chemical process for obtaining glass with anti - reflective finish in an acid solution for continuous and simultaneous production of one or several glass pieces and / or sheets with dimensions , widths , colors , standard uses and applications has the following stages : a ) reception of glass pieces and / or sheets , b ) loading of the glass pieces and / or sheets into the glass containers , c ) processing of the glass pieces and / or sheets by immersion in acid solution , d ) drying of the glass pieces and / or sheets , and e ) unloading of the glass pieces and / or sheets from its containers . a stock of glass pieces and / or sheets is received in specially designed trucks . an adapted crane is used to unload the truck ; this “ bridge ” type crane has 3 tons in capacity , 15 meters in width , 20 meters in length and 5 meters in height ; it has a microelevation speed of 0 . 5 meters per minute , elevation speed is variable from 0 . 5 meters per minute to 5 . 2 meters per minute ; also a motor reducer speed is variable from 5 . 1 meters per minute to 15 . 4 meters per minute . the same “ bridge ” type crane is used for loading the packages of anti - reflective glass on trucks , for delivering , distributing and transporting them . the crane used for loading and unloading allows fast processing of the glass . it is noteworthy that the absence of the above mentioned crane would increase operations time and associated costs . also , physical risk for the personnel and the materials is minimized . glass pieces and / or sheets are unloading from to the truck to be stored in special containers for further processing . to convey glass pieces and / or sheets during the production process , a specially designed container is used to allow us fast processing of the glass on both sides ( tinned side and atmospheric side ) simultaneously . this way allows a higher production rate in contrast to the already - known traditional process ; it also minimizes personnel risk since there is no direct manipulation . glass pieces and / or sheets are vertically placed in the special container as shown in fig2 and by means of a chain - hoist ; the glass is ready for the immersion process . the specially - designed containers are made of rectangular tubular steel profile ( ptr ) of 2 . 54 centimeters of thickness and its unique design can hold static and dynamic stresses that are present during the production process . the glass pieces and / or sheets container has 180 centimeters in height , 180 centimeters in length and 39 centimeters in width ; into the glass sheets can be collocated until 16 glass sheets of 1800 × 1600 × 2 millimeters ( commercial dimension ), but the container capacity can receive the sheets with any kind of thicknesses , dimensions and colors . the lateral framework container has movable simple pivots ( 7 ) are made of polypropylene or high density polyethylene plate and bar , because they are resistant to the acid attack , each one of said pivots can turn on its axis , to put on vertical position for receiving the glass sheets , and soon happen pass to a horizontal position to maintain them ( 9 ). the superior position of container has 3 hooks to balance the container load and to hold said container onto traveling crane “ bridge ” type for transporting and immersing the glass sheets in to the solution containers ; its gravity center was calculated for stabilizing totally the container . the inferior position of container has 3 supports ( 8 ) made of polypropylene or high density polyethylene plate resistant to acid attack ; each support has 34 centimeter in length and 1 . 27 centimeters in height and they are grooved with 2 . 5 centimeters between separation of grooves in which the glass sheets are collocated in vertical form . the glass pieces and / or sheets container resist the chemical treatment by having a covering with an accelerated thyxotropic polyester resin in conjunction with the catalyst methyl - ethyl - ketone peroxide in dimethyl phthalate at 50 %, the loading of glass pieces and / or sheets is by storage into the trestle , either manually or pneumatically . the pneumatic way consists of 6 pneumatic cupping glasses connected to a vacuum pump of ¼ of h . p . with capacity until 500 kilograms ( 11 ), the cupping are located on framework specially designed to permit it entrance to the container ( 12 ), said cupping system has flexible movements due to turn 360 ° since they are placed to an endless bullet mold by means of a cable to the chain - hoist ( 14 ); said chain - hoist is in the riel of “ flag ” type crane ( 13 ), this cupping system is versatile because take the glass sheets in vertical form ( fig2 ), horizontal form ( fig6 ), or any ankle ( fig5 ), and runs in both directions from one side to another to take or to deposit the glass sheets by means the riel ( 13 ) to collocate said sheets into container ( fig7 ). the crane enlistment the container once the container ( 6 ) is loaded with the glass sheets , and is ready for the process ( fig8 ) approximately , we process 230 kg per container in 15 minutes , it means 184 meters 2 of glass sheets of 2 mm of thickness per hour , this capacity may be increased according to production necessities . this container may be process pieces or sheets with different dimensions , colors , thicknesses , by both sides ( atmospheric side and tinned side ) including mirror sheets simultaneously ; the fig9 shows how we can protect the paint side in a mirror sheet ( 15 ), applying auto - adherible plastic resistant to acid attack film type ( 16 ) with u . v . protection , when the anti - reflective finish is made on one side of mirror sheets or float glass sheet we can join two mirror or float sheets or one side of mirror or float sheets can protected with an adhesive acrylic type on the paint side and re - forced the edges with special tape ( 17 ) used in air conditioning ducts . c ) processing of the pieces and / or glass sheet by immersion in an acid solution the chemical process for obtaining anti - reflective glass by immersion in an acid solution for simultaneous and continuous production , of one or several pieces and / or sheet of glass of dimensions , thicknesses , colors , uses and standard , special and variable applications ( fig1 ); it has had in sequence a series seven containers of chemical solutions ( 19 ) of 239 centimeters in length , 54 centimeters in width , 207 centimeters in depth these dimensions are adequate for collocating into the container the glass sheets , but the measures are changed depending on the production necessities . all these containers of chemical solutions are isolated by means of an encapsulated system by means of a wall done of square tubular steel profile covered with polyethylene ( 18 ), with the purpose of avoiding the acid gas emanation increasing the security degree , preventing the equipment corrosion and splits of the solutions . said encapsulated system has the gas exit by means of eight extractors transporting the acid steam ( 23 ) towards the gas washers ( fig1 ), having an absorption and neutralization of these acid steam in a volume of 64000 cubic meters per hour in all system , both gases washing have four extractors towards gas washers ( fig1 ); this encapsulated system have perfect sealing by means of slide awing in the curtain that can automatic or manual form through a chain - hoist ( 20 ) with variable speed from 3 to 20 meters per minute and its optimal velocity is from 5 . 1 to 19 . 3 meters per minute , passing the glass container ( fig8 ) towards chemical solutions ( 19 ). when the glass container supported with the chain - hoist entrance and exit to encapsulated system , the awing curtain up or down slide by means of motor reducers of ⅛ h . p . said encapsulated system ( 18 ) has four extractors ( 24 ) of 800 cubic meters per hour each one , the gas are extracted and transported by ducts ( 23 ) toward gas washers ( fig1 ) neutralizing them with a solution of sodium hydroxide at 4 % with a nominal volume of 220 liters ( 28 ); this extraction allows us to unload to the outer atmosphere a neutral and inert gas by the exit chimneys ( 25 ); said chimney has a gas sampling port ( 32 ) to evaluate the process analyzing it every 6 months according to the environmental mexican norms ( nom 02 ). the capacity total of the washers is of 1000 liters . in order to renew and to maintain the level of the washing solution the system has an access floodgate ( 26 ). each chemical solution container ( 19 ) has a volume of 2700 liters for assuring the total glass covered when the immersion is made . said solutions containers ( 19 ) have a system of agitation and movement with compressed air provided by a 135 compressor of psi of 30 amperes and 2 . 5h . p . for homogenizing the solution and removing the accumulated remainders . these chemical solutions containers are over the level of the floor ( with 3 m in elevation ) if is necessary a movable stair could be occupied ; these seven containers are constructed of concrete armed with a double wall of partition or brick ( fig1 ); they were constructed calculating the support mechanical , static and dynamic efforts and pressures exerted on the walls and floor by the fluids contained within , its volume is 3000 liters with a security factor of 60 %. the chemical solutions containers are covered with plate of polypropylene or high density polyethylene 0 . 635 cm . of thickness ( 29 ) that makes resistant to the acid attack because these materials are inert to used acids , allowing the storage of the solutions per prolonged time , included several decades . for the transport and immersion of the glass of pieces and / or sheet container , using a chain - hoist of 0 . 5h . p . of variable speed for elevation and translation ( 3 meters per minute until 20 meters per minute ), said chain - hoist has a capacity of 500 kg and 6 meters of elevation ( 20 ), which run around the riel ( 21 ) for transporting the glass container toward the solutions container in the sequential manner by stages . the stages of the process are described following : step 1 in the immersion process .— the first chemical solutions container has an acid solution prepared with 17 % of hydrofluoric acid at 70 %, 53 % of hydrochloric acid at 30 %, 23 % of dextrose monohydrated sugar and 7 % of ammonium bifluoride anhydrous . these components are mixed in this order ; it is the optimal formulation , for the treatment for obtaining the anti - reflective finish ; the reagent time is at least by one hour . the concentration can have the following range : from 12 % to 22 %, 48 % to 58 %, 17 % to 28 % and 5 % to 13 % respectively , without affecting the process . it is necessary to monitor its concentration , its acidity is between 14 a 19 miliequivalents per liter , its electrical conductivity is from 900 , 000 to 2 , 100 , 000 microhms , the reagent time is form 20 to 185 seconds , the immersion velocity can be from 5 . 1 to 19 . 3 meters per minute , the parameters vary depending on glass type , and thickness ; in this container the finish anti - reflective is made . step 2 in the immersion process .— the second container has current water for rising the glass pieces and / or sheets eliminating the acid residues . this container must be has the following parameter : electrical conductivity until 400 , 000 microhms . step 3 in the immersion process .— the third chemical solution container has a neutralizing solution prepared with sodium hydroxide at 4 %; said container must be has the following parameters : ph 7 . 5 , the electrical conductivity is until 400 , 000 microhms and the reagent time of immersion is from 30 to 180 seconds depending on the ph , because the reaction must be stopped . step 4 in the immersion process .— the forth chemical solution container has current water for rising the glass pieces and sheets for eliminating the acid residues and the residues of neutralizing solution . this container has the following parameters : electrical conductivity until 100 , 000 microhms for assurance the treatment . this container has a hydro - washing system by sprinkling deionized water less than 10 microhms , with automatic or manual way at 3000 pressure pounds of 5h . p . ( fig1 ). when the glass container is leaving the solutions container the deionized water is sprinkled by hydro - washing system . step 5 in the immersion process .— the fifth chemical solution container has a washer solution prepared with deionized water ( less than 10 microhms ) that for its electrical conductivity eliminate the acid residues and residues of neutralizing solution , guarantee the safety use of the anti - reflective glass . the sixth and seventh chemical solution containers must be ready for any eventuality during the process . we have a tank covered with high density polyethylene with automatic shaking or manual for preparing the solutions used during the process ; its capacity is of 1100 liters however must be increasing it according to production necessities . the raw material is deposited into the tank and when the solution is ready it pass to its containers by means of special pumps covered with polypropylene , pvc , or high density polyethylene ; as is shown in the fig1 . for raising deionized water used during the process we have a special equipment that deionized water by ionic interchange ( cationic - anionic ) with a flux to 22 . 7 liters per minute , however it could be increasing it . after chemical processing , the anti - reflective glass pieces and / or sheet are passed from its container to a continuous dryer “ tunnel ” type ; said continuous dryer is specially designed in function of our necessities ( 34 ) which consists of a motor reducer of 2h . p . for traction and transport the glass pieces container from its entrance to its exit ; it can be a heating system by means of l . p . gas , natural gas and / or electrical resistance with internal ventilation ; the temperature process and velocity are variable ; its temperature at work is from 35 to 60 ° c ., and the time dried is from 2 to 3 . 5 hours depending of the production . the capacity of continuous dryer is for 9 glass sheets containers , it means 2100 kg of glass . this dryer permit to increase the process productivity and efficiency due to the humidity marks are diminished . the ceiling dryer has a humidity extractor ( 31 ), also has a window ( 32 ) to watch the dried process , its entrance and its exit are sealed through slide doors . the dryer has a transport riel ( 36 ) wherein the containers are hanged . the drying of the anti - reflective glass pieces and / or sheets also can become at room temperature by means of a vertical or horizontal washing - dryer machine , including conditions at room temperature . e ) unloading of the glass pieces and / or sheet from its containers once dried the anti - reflective glass pieces are transported toward the trestle for delivering and distributing them . the unloading of the anti - reflective glass from its containers can be by means of cupping pneumatic system whose 6 cupping are connected to a vacuum pump of ¼h . p . which is comprised in the system of crane “ flag ” type ( fig3 ), with capacity of up to 500 kilograms according to the production necessities . for monitoring , sampling , analyzing and controlling the parameters established , each chemical solution container has a laboratory equipped support fully process , with the following equipment : conduct - meters of different scales depending on the solutions , electronic and manual potentiometers and lab material using this chemical process by immersion for treatment total or partial glass with anti - reflective finish by immersion in acid solution for simultaneous and continuous production of one or several pieces and / or sheet of glass of dimensions , thicknesses , colors , uses and standard , special and variable applications , the process is optimized reutilizing the waste materials ; it allows to have a high volume of production because anti - reflective one or several pieces and / or sheets is produced on one or both side of the float glass ; indistinct manner . the process diminished the risks to acid manipulation because the personnel have been trained about dangerous of the acid solutions , how combat the fire and residues , besides each stage is carefully made , mainly by using an encapsulated system to protect the solutions containers avoiding the acid gas emanation . for example , the water process is discharged with previously neutralization , avoiding all kind of risk . the process established in this request is highly better than the already - known process , for example the traditional process only anti - reflective the atmospheric side and the finishes is not homogeneous because the experience of operator to applicant the past or solutions is critical ; in contrast our process the finished is higher homogeneous and it can be on one or both sides included tinned side . all and each stages of process are made at room temperature , at atmospheric pressure and relative humidity except the furnace “ tunnel ” type . | 8 |
this invention relates to a curable organopolysiloxane composition comprising a composition of ( i ) 100 weight parts organopolysiloxane having at least 2 -- or 1 groups bonded to silicon in each molecule where r 1 is hydrogen atom or monovalent hydrocarbon group , ( ii ) 0 to 50 weight parts silane with the formula . where r 2 is alkyl , alkenyl or alkoxyalkyl group , r 3 is monovalent organic group , a is from 2 to 4 inclusive , or its partial hydrolysis condensate , and ( iii ) 0 . 01 to 20 weight parts silyl ester of phosphoric acid in which the -- oh groups of phosphoric acid are replaced by -- osir 4 3 groups or silyl ester of polyphosphoric acid in which the -- oh groups of polyphosphoric acid are replaced by -- osir 4 3 groups where r 4 is monovalent organic group . by way of explanation , component ( i ) is the principal component of the composition of the present invention : it undergoes a curing reaction under the catalytic activity of component ( iii ), possibly in the presence of component ( ii ) as the crosslinker , to give the cured material . this component is to be an organopolysiloxane having at least two groups -- or 1 bonded to silicon in each molecule . r 1 is to be a hydrogen atom or monovalent hydrocarbon group . said monovalent hydrocarbon group is exemplified by methyl , ethyl , propyl , isopropyl , butyl , phenyl , phenethyl , phenylisopropyl , allyl , isopropenyl and isobutenyl . the r 1 groups in the individual molecule may or may not be identical . r 1 is preferably the hydrogen atom or a lower alkyl group due to the corresponding higher curing reaction rate and the low cost of production . or 1 may be present at any position in the molecule , but preferably at least two are present at the molecular terminals . this component may be linear , branch - containing straight chain , network or three dimensional , but a straight chain or a slightly branched straight chain is preferred . a polydiorganosiloxane is preferred when an elastomeric product is desired . while no restriction is placed on the molecular weight of this component , it preferably has a molecular weight corresponding to a viscosity equal to or less than 100 pa . s at 25 ° c . from a consideration of the mixability with the other components . actual examples of this component are as follows : dimethylhydroxysiloxy - terminated polydimethylsiloxanes , methyldimethoxysiloxy - terminated polydimethylsiloxanes , methyldiethoxysiloxy - terminated polydimethylsiloxanes , trimethoxysiloxy - terminated polydimethylsiloxanes , dimethylhydroxysiloxy - terminated dimethylsiloxane - diphenylsiloxane copolymers , methyldimethoxysiloxy - terminated dimethylsiloxane - diphenylsiloxane copolymers , methyldiethoxysiloxy - terminated dimethylsiloxane - diphenylsiloxane copolymers , trimethoxysiloxy - terminated dimethylsiloxane - diphenylsiloxane copolymers , dimethylhydroxysiloxy - terminated dimethylsiloxane - methylphenylsiloxane copolymers , methyldimethoxysiloxy - terminated dimethylsiloxane - methylphenylsiloxane copolymers , methyldiethoxysiloxy - terminated dimethylsiloxane - methylphenylsiloxane copolymers , trimethoxysiloxy - terminated dimethylsiloxane - methylphenylsiloxane copolymers , dimethylhydroxysiloxy - terminated polymethyltrifluoropropylsiloxanes , dimethylhydroxysiloxy - terminated dimethylsiloxane - methyltrifluoropropylsiloxane copolymers , and the hydrolyzates of at least one species of silane selected from among methyltrimethoxysilane , dimethyldimethoxysiloxane , trimethylmethoxysilane and tetramethoxysilane . preferred polysiloxane copolymers are those which contain at least 50 mol percent dimethylsiloxane units . component ( ii ) is a crosslinker for the composition of the present invention . this component is required when oh is the or 1 in component ( i ), but it is not necessarily required in other cases . this component is a silane with the formula ( r 2 o ) a sir 3 4 - a or the partial hydrolyzate thereof . the groups r 2 may or may not be identical to each other , and are alkyl , alkenyl or alkoxyalkyl groups . the groups r 3 may or may not be identical to each other , and are monovalent organic groups . a is from 2 to 4 inclusive . when this component takes the form of the partial hydrolyzate of silane with the above formula , hydrolysis must be conducted while regulating the quantity of water so r 2 o groups will remain . r 2 is exemplified by methyl , ethyl , propyl , isopropyl , butyl , isobutyl , allyl , isopropenyl , methoxyethyl and methoxypropyl . r 3 is exemplified by alkyl groups such as methyl , ethyl , propyl , isopropyl and butyl ; alkenyl groups such as vinyl , allyl , isopropenyl and isobutenyl ; phenyl ; phenethyl ; phenylisopropyl and trifluoropropyl . when an alkenyl group or the phenyl group is used as r 3 instead of alkyl , the curing reaction tends to proceed rapidly . a is from 2 to 4 inclusive because the curing reaction will not proceed well when a is less than 2 . a is preferably 3 or 4 . this component is to be added at 0 to 50 weight parts per 100 weight parts component ( i ). this is because curing becomes slow at greater than 50 weight parts and the mechanical properties of the cured product are adversely affected . while an addition within the range of 1 to 10 weight parts is in general preferred , the optimal quantity may not always fall within the range of 1 to 10 weight parts because it will vary with the character of component ( i ) and the amount of water present in the composition . thus , in the presence of a sufficient quantity of silicon - bonded or 1 , when r 1 is other than hydrogen , in component ( i ), the quantity of this component may be much less than 1 weight part , or may even be zero . when component ( i ) contains substantial silicon - bonded oh , this component is preferably present at 10 or greater weight parts in some cases . on the other hand , when a large quantity of water is present in the composition due to the effect of the filler , this component will be hydrolyzed by the water and greater than 10 weight parts of this component must be added in some cases in order to obtain an effective quantity of this component . component ( iii ) characterizes the composition of the present invention , and it acts as a catalyst in the crosslinking of the composition by the reaction of component ( i ) and component ( ii ), while also acting to promote good bonding between the composition and the substrate in contact with it during curing . this component consists of the silyl esters of phosphoric acid in which the -- oh groups of phosphoric acid are replaced by -- osir 4 3 groups and the silyl esters of polyphosphoric acid in which the -- oh groups in polyphosphoric acid are replaced by -- osir 4 3 groups . in the formula , the groups r 4 , which may nor may not be identical to each other , are to be monovalent organic groups . concrete examples of the phosphoric and polyphosphoric acids specified herein are orthophosphoric acid , pyrophosphoric acid , metaphosphoric acid , tripolyphosphoric acid , tetrapolyphosphoric acid and the condensate of metaphosphoric acid - polymetaphosphoric acid . while the silyl esters of phosphoric acid and polyphosphoric acid are effective in the present invention as component ( iii ) regardless of the species of phosphoric acid or the molecular weight of the polyphosphoric acid , the silyl esters of orthophosphoric acid are preferably used because they have low viscosities and so are easily handled , they have good compatibility with the other components , and they have a mild reactivity . also , exceeding six phosphoric acid atoms in a single molecule is undesirable because the resulting high viscosity makes handling difficult . the groups r 4 , which are to be monovalent organic groups , are exemplified by alkyl groups such as methyl , ethyl , propyl , isopropyl , butyl and isobutyl ; cycloalkyl groups such as cyclopentyl and cyclohexyl ; alkenyl groups such as vinyl , allyl and isopropenyl ; and aryl groups such as phenyl , tolyl , xylyl and naphthyl . alkoxy groups may comprise a small amount of r 4 . also , a portion of r 4 may be replaced by the hydroxyl group or halogen . there is no specific restriction on the number of carbon atoms in r 4 , but the number of carbon atoms is preferably 10 or less from the standpoints of reactivity and production costs . moreover , preferably 60 percent of greater of r 4 is methyl from the standpoints of stability during phosphate ester synthesis , ease of purification of the phosphate ester , and low starting material costs . the aforementioned component ( iii ) can be synthesized by known synthesis methods . a typical example , as reported in yuki gosei kagaku kyokai - shi , volume 43 , number 12 , page 1163 ( 1985 ), is to heat hexamethyldisiloxane with phosphorus pantoxide in benzene under reflux . in this example , replacing the starting phosphorus pentoxide with orthophosphoric acid affords the orthophosphate ester . other silyl phosphate esters are easily produced by replacing the methyl group in the siloxane with another organic group . the quantity of addition of this component is specified at 0 . 01 to 20 weight parts per 100 weight parts component ( i ). this is because curing is inadequate at below 0 . 01 weight part . exceeding 20 weight parts is essentially meaningless and , furthermore , the quantity of liberated phosphoric acid or polyphosphoric acid becomes excessive , adversely affecting the physical properties of the cured material itself or any metals or plastics in the vicinity . accordingly , the preferred quantity of addition falls within the range of 0 . 1 weight part to 5 weight parts . the mechanism for the catalytic activity of this component remains unresolved , but is thought that an active phosphoric acid species is produced by scission of the siop bond by reaction with an active hydrogen - containing compound such as water or alcohol , and that this acts as a catalyst to promote the curing reaction . in addition to components ( i ) through ( iii ), the following components may be added to the composition of the present invention unless this adversely affects the object of the present invention : dry - method silica , precipitated silica , natural silica , quartz powder , silica balloons , calcium carbonate , aluminum , alumina , carbon black , titanium oxide , iron oxide , mica , talc and these powders whose surfaces have been treated with silane , silazane , siloxane , fatty acids or fatty acid esters ; silane coupling agents possessing the epoxy , methacryloxy , acryloxy or aminoalkyl group ; organic and inorganic colorants ; and flame retardants such s platinum compounds and hydrazines . the curable composition of the present invention is produced by simply mixing components ( i ) through ( iii ) and any other components ; any mixer known in the relevant art may be used for this mixing . actual examples of the mixers are kneader mixers , planetary mixers and single - screw and double - screw extruders . in general , the curable composition of the present invention will be used as a moisture - curing composition in which the curing reaction is initiated by means of atmospheric moisture . accordingly , when the composition of the present invention is to be used in single - package form , that is , the so - called single - liquid form , care must be exercised to exclude moisture during mixing and packaging of the composition . in the case of a so - called two - liquid type , with division into two packages , it is recommended that component ( iii ) be packaged separately from the other components . in the coating and bonding of the composition of the present invention on another substrate , dilution with organic solvent is permissible in order to reduce the viscosity of the composition . the invention is illustrated using examples . unless otherwise specified , &# 34 ; part &# 34 ; is &# 34 ; weight part &# 34 ; and &# 34 ; percent &# 34 ; is &# 34 ; weight percent &# 34 ;. the various properties were measured at 25 ° c . unless otherwise specified . fifteen parts of orthophosphoric acid ( 90 percent aqueous solution ) and 60 parts hexamethyldisiloxane were placed in a flask and this was heated under reflux at 110 ° c . while the water was removed via a water - separation tube . this was allowed to cool when the contents become homogeneous and transparent . the fraction boiling at 80 ° to 90 ° c . under 5 mmhg pressure ( this fraction is designated as pse - a ) was collected by vacuum distillation . the pse - a was confirmed to be the tris ( trimethylsilyl ) ester of orphophosphoric acid by nmr , gas chromatography and mass spectroscopy . a mixture of 100 parts of a hydroxyl - terminated polydimethylsiloxane with a viscosity of 4 pa . s , 1 . 5 parts of the partial hydrolyzate of ethyl silicate ( 60 percent ethoxy group content ) and 1 part pse - a was coated to a thickness of approximately 1 mm on glass and aluminum plates . the coated mixture was cured into a rubber after 12 hours , and bonded well to the glass and aluminum plates . in a comparison example , a mixture was prepared using dibutyltin dilaurate in place of pse - a . while this mixture similarly cured in 12 hours , it did not adhere to the glass or aluminum plates . the fraction boiling at 115 ° to 125 ° c . under 5 mmhg pressure ( designated as pse - b ) was collected in synthesis by the method described in example 1 using 1 , 1 , 3 , 3 - tetramethyldivinyldisiloxane instead of the hexamethyldisiloxane used in example 1 . the analytical results confirmed that pse - b was the tris ( dimethylvinylsilyl ) ester of orthophosphoric acid . a mixture of 100 parts of dimethoxymethylsiloxy - terminated polydimethylsiloxane with a viscosity of 12 pa . s , 15 parts dry - metod silica ( specific surface approximately 200 m 2 / g , surface treated with hexamethyldisilazane ), and 0 . 5 parts pse - b were mixed in a planetary mixer . this mixture was applied in a thickness of approximately 2 mm on glass and aluminum plates as in example 1 . the coated mixture was cured into a rubber after 12 hours , and bonded well to the glass plate although it does not bond to the aluminum plate . in a comparison example , a mixture was prepared using tetrabutyl titanate in place of pse - b . the mixture cured in 24 hours , but it did not bond to either the aluminum or glass plates . twenty parts of phosphorus pentoxide was placed in a flask equipped with a reflux condenser , 38 parts hexamethyldisiloxane and 80 parts benzene were added , and this was heated under reflux with stirring under an argon atmosphere for 1 hour . the resulting solution was concentrated on an evaporator to obtain the trimethylsilyl ester of polyphosphoric acid ( pse - c ). a mixture of 100 parts hydroxyl - terminated dimethylsiloxane - methylphenylsiloxane copolymer having a viscosity of about 0 . 8 pa . s and a molar ratio of dimethylsiloxane to methylphenylsiloxane of 80 : 20 , was thoroughly mixed with 8 parts vinyltrimethoxysilane and 1 part pse - c . this mixture was applied in a thickness of approximately 1 mm on a quartz plate . the coated mixture was cured into a rubber after 1 hour , and it bonded well to the quartz plate . in a comparison example , a mixture prepared using tin octylate in place of pse - c similarly cured within 1 hour , but it absolutely did not adhere to the quartz plate . a mixture of 100 parts trimethoxysiloxy - terminated polydimethylsiloxane , having a viscosity of about 6 pa . s , 0 . 5 parts isopropyl silicate , and 0 . 8 parts of the pse - a described in example 1 was applied in a thickness of 1 mm on a glass fiber - reinforced polyester plate . the coated mixture was cured into a rubber after 12 hours , and bonded well to the polyester plate . in a comparison example , a mixture prepared using tetrabutyl titanate in place of pse - a similarly cured within 12 hours , but it did not adhere to the polyester plate . | 8 |
as used herein , the terms “ microelectronic workpiece ” or “ workpiece ” refer to substrates onto or in which microelectronic devices are formed , such as microelectronic circuits or components , thin - film recording heads , micromachines or micromechanical elements , data storage elements , and similar devices . micromachines or micromechanical elements are included within this definition because the manufacturing processes that are used to make them are typically the same as or similar to the manufacturing processes used in the fabrication of integrated circuits . the substrates can be semiconductive pieces ( e . g ., doped silicon wafers ), non - conductive pieces ( e . g ., various ceramic substrates ), or conductive pieces . typical workpieces are relatively thin and disk - shaped , although not necessarily circular , as ordinarily understood in the microfabrication industry . several embodiments of the apparatus and methods are described in the context of depositing an electrophoretic photoresist ( epr ) onto a workpiece , but the present invention is by no means limited to deposition of epr . as noted earlier , many of the following embodiments can be used to deposit suitable electrophoretic emulsions ( epes ) other than epr emulsions . for example , other materials that can be contained in an emulsion and deposited by electrophoresis include phosphor materials for use in high resolution flat panel display devices and various selectively depositable dielectric materials . in epe applications , the charged particles in suspension are typically “ micelles ” ( i . e ., stable organic particles suspended in the aqueous phase of the bath ). deposition by electrophoresis in accordance with the following apparatus and methods has advantages over other methods of deposition . for example , electrophoresis is especially useful to deposit a material on three dimensional structures because it can cover even highly topographical surfaces with a conformal layer of material . additionally , several embodiments of the following apparatus and methods can eliminate edge beading that results in spin - on or rack - and - tank deposition techniques . furthermore , electrophoretic deposition techniques can accurately deposit much thicker layers of resist compared to spin - on techniques . another benefit of several embodiments of the present invention is automated deposition of an electrophoretic material that enables epr - based photolithography to be integrated with other automated semiconductor processes . still another benefit of several embodiments of the apparatus and methods described below is that they mitigate problems caused by bubbles in the system . epe deposition reactors electrochemically deposit eprs or other epes onto microelectronic workpieces . as used herein , the term “ electrochemically ” includes ( a ) electrical processes that establish an electrical field in a bath using the workpiece as an anode or a cathode and ( b ) electroless processes that rely on the electrochemical interaction between the workpiece and the bath without inducing an electrical field in the bath . in general , the epe deposition reactors are suitable for microfabrication techniques used in manufacturing semiconductor devices or other micro - devices that have small features ( e . g ., feature sizes less than 10 microns or even less than 1 micron ). several embodiments of reactors for use in processing tools are single - wafer units that hold a workpiece at least substantially horizontally so that the epe bath contacts only one side of the workpiece . this allows the other side of the workpiece to remain “ clean ” so that single - wafer handling equipment is not fouled by the epe . several embodiments of reactors also hold the workpiece in a manner that prevents an edge bead from forming around the perimeter of the workpiece . as explained in more detail below , the reactors are also configured to control bubbles to mitigate pinholes , and the reactors can also optionally include in - situ rinse capabilities to rinse either the microelectronic workpieces or components of the reactor to mitigate cross contamination of fluids and consumption of resist micelles . fig2 illustrates one embodiment of a reactor assembly 100 that defines the deposition station 11 for use in a processing tool for depositing epes on workpieces . generally stated , the reactor assembly 100 comprises a reactor head 105 and a reactor base 110 . the reactor head 105 includes a stator 70 , a rotor 120 carried by the stator 70 , and a workpiece holder 125 carried by the rotor 120 . the reactor base 110 includes a processing area or vessel suitable for epr deposition or deposition of other epes . the general design of the reactor depicted in fig2 can also be used to implement other processing operations and , as such , can be modified for use at other processing stations within a processing tool . for example , the reactor assembly 100 can be modified to execute rinse / dry processes , etching processes , and electrochemical processes ( e . g ., electropolishing , anodization , electroless plating , electroplating , seed layer enhancement , etc .). for such other processes , the reactor base 110 may be modified to contain different chemistry and / or different chemical delivery mechanisms . reactors in accordance with several embodiments of the invention provide gas control systems to control bubbles in the epe fluids in a manner that mitigates the formation of pinholes on the workpiece . as explained in more detail below , several embodiments of gas control systems can entrap existing bubbles before they reach the workpiece , sweep bubbles away from the workpiece , and / or prevent the formation of bubbles . in general , several different methods and devices can be used either individually or together to control bubbles in the reactor . fig2 illustrates one embodiment of the reactor base 110 for depositing an epe on the workpiece 16 . in this embodiment , the workpiece 16 is positioned with respect to the reactor base 110 so that the side of the workpiece which is to be processed faces downward in a generally horizontal plane . the particular reactor base 110 shown in fig2 can be functionally divided into four principal , vertically separate regions or subassemblies . a first region 135 provides an environmentally controlled reservoir of processing fluid . a second region 140 defines a fluid input / output region including channels and passageways through which processing fluids flow to and from the reactor base 110 . a third region 145 defines a deposition region in which the photoresist or other electrophoretic solution / emulsion is deposited onto the workpiece 16 . the third region 145 may include one or more components that reduce and / or eliminate bubbles that can cause pin - hole formations in the deposited layer . a fourth region 150 can be an in - situ secondary processing region in which the workpiece may be rinsed in - situ , the contact assembly 125 may be cleaned in - situ , or other pre - or post - deposition procedures can take place . as illustrated , the first region 135 includes an emulsion tank 155 and a temperature control apparatus 160 disposed in the tank 155 . the temperature control apparatus 160 can be an element that heats and / or cools the epe chemistry in the tank 155 . the epe chemistry is contained and maintained at a desired temperature within the tank 155 for delivery to a processing area 215 area in the deposition region 145 . the temperature control apparatus 160 may be constructed from a relatively inert material , such as stainless steel . one such temperature control apparatus suitable for use in the illustrated embodiment is available from thermo haake , inc . ( paramus , n . j .). the fluid input / output region 140 includes a chamber base 165 having several channels including a first primary chemical delivery conduit 170 a , a second primary chemical delivery conduit 170 b , and an emulsion return conduit 175 . the chemical delivery conduits 170 a and 170 b are connected for fluid communication with corresponding flow channels within chamber base 165 . the location and arrangement of the flow channels within chamber base 165 can be altered depending on the position of the chamber base within the reactor and the position of the reactor in the automated processing tool 10 . in an alternate embodiment , the first and second conduits 170 a and 170 b can be at the same elevation in the chamber base 165 , but extend along different radial positions . the fluid input / output region 140 also includes one or more drainage passages 180 ( only one such passage shown ). the drainage passage 180 may be an annular channel that is generally concentric with the center of and formed integrally with the chamber base 165 . the deposition region 145 includes an overflow cup 185 stacked vertically above the emulsion tank 155 and a concentrically disposed processing cup 190 mounted within the overflow cup 185 . the overflow cup 185 can be a generally cylindrical member that peripherally surrounds the processing cup 190 . both the overflow cup 185 and the processing cup 190 may be mounted on the chamber base member 165 . in the illustrated embodiment , the processing cup 190 has an annular upper structure and a tapered , frusto - conical lower portion 210 that slopes downwardly and radially inwardly . as shown , drainage passage 180 extends between the overflow cup 185 and the emulsion tank 155 so that processing fluid flowing over the rim of the upper portion of processing cup 190 flows downwardly through the overflow cup 185 and the drainage passage 180 to the emulsion tank 155 . the dimensions of the overflow cup 185 may be similar to other types of reaction vessels used in wet processing tools ( e . g ., electroless plating reactors , etching reactors , rinse / dry capsules , etc .). as such , the reactor 100 is readily interchangeable with other reactors in designing a tool so that a single processing tool frame may be used as a basis for a wide range of different types of processing tools . the reactor assembly 100 also includes a counter electrode 195 . as shown , the counter electrode 195 is an annular ring in which the height of the material from which it is formed is greater than the width of the material . the counter electrode 195 sits upon a shelf 200 at the interior of the processing cup 190 . the counter electrode 195 is coupled to one or more electrical connecting members 205 that conduct electrical power from a power supply to the counter electrode 195 . the counter electrode 195 can alternatively comprise a plurality of linear or curved segments positioned around the shelf 200 of the processing cup 190 . the deposition region 145 includes a processing area 215 in which the workpiece 16 contacts the processing fluid to effect the desired photoresist deposition process . in the illustrated embodiment , the photoresist emulsion and associated solvents enter the processing area 215 through a diffuser 220 in the processing cup 190 . the first delivery conduit 170 a and / or the second delivery conduit 170 b can provide the fluid flow to the diffuser 220 . fig2 also illustrates one manner of supplying and recycling the emulsion or other type of solution in the reactor 100 . as shown , a pump 310 is provided to generate the flow of the emulsion through the system . a manifold 330 is disposed in line with the pump 310 to control the flow of the emulsion . fluid within the emulsion tank 155 flows through the inlet 335 of the manifold 330 . a filter 311 can be disposed in the flow to remove particles and / or bubbles from the flow . the manifold 330 allows the emulsion to flow to one or more of the inlet conduits 170 a and / or 170 b that , in turn , direct the flow of the emulsion to the diffuser 220 in the cup 190 . optionally , the diffuser 220 may include a dual port system whereby emulsion from the first inlet conduit 170 a provides a flow of the emulsion to holes in the peripheral portion of the diffuser 220 and emulsion from the second inlet conduit 170 b provides a flow of the emulsion to holes in the central portion of the diffuser 220 . the distribution of the flow between the first and second inlet conduits 170 a and 170 b may be tailored using one or two pumps to independently control the flows between the conduits 170 a and 170 b . other manners of implementing a dual port system are also feasible . in some circumstances , there should not be a flow of the emulsion through the diffuser 220 or otherwise through the deposition region 145 . to this end , an auxiliary flow path may be provided to maintain circulation of the emulsion when the primary flow path to the deposition region 145 is closed . in the illustrated embodiment , this feature is implemented using a recirculation pump 345 that generates an auxiliary flow of emulsion through inlet 335 to the return conduit 175 . this prevents the emulsion within the emulsion tank 155 from remaining stagnant when it is not being supplied to the deposition region 145 to increase the longevity of the emulsion . as explained above in the background section , one problem of photoresist deposition is the accumulation of bubbles proximate the process side of the workpiece . when a workpiece is horizontally oriented in the bath in the manner shown in fig2 , it traps such gases on its underside because gas bubbles in the electrolytic bath tend to float the surface toward the workpiece . the bubbles entrapped on the workpiece result in pinhole - sized voids in the surface of the photoresist that significantly decrease the quality of the deposited material and thus the overall component yield . it is for this reason that conventional electrophoretic photoresist deposition processes have used systems that hold the workpiece vertically in the deposition tank . the present inventors , however , recognized several advantages of holding the workpiece horizontally . for example , one advantage of holding the workpiece horizontally is that the epe contacts only one side of the workpiece . as such , the other side of the workpiece can be isolated from the epe solution to remain clean for handling by the automated robotics . to obtain this advantage , the inventors developed several gas control systems that reduce and / or eliminate bubbles at the surface of the workpiece . the gas control systems are generally integrated with the reactor base 110 and / or the reactor head 105 of the reactor 100 . in several embodiments , the deposition station may include a gas control system configured to inhibit bubbles from migrating to and / or residing on the workpiece . as explained in more detail below , the gas control systems can include : ( a ) rotating the workpiece during deposition ; ( b ) agitating the electrolytic bath during deposition ; ( c ) vibrating the workpiece during deposition ; ( d ) creating an impinging flow of emulsion directed substantially transversely and / or parallel to the workpiece ; ( e ) trapping bubbles in the electrolytic bath before they reach the workpiece ; ( f ) removing bubbles from the electrolytic bath before they reach the workpiece ; ( g ) applying a voltage to the electrode or the workpiece according to a predetermined delay ; ( h ) providing a plurality of counter electrodes adapted to be positioned within the processing chamber and further adapted to receive a voltage potential ; ( i ) using mechanical agitation of the bath and / or components to remove bubbles from the workpiece ; ( j ) separating the counter electrode from the workpiece using a membrane or other member through which electrical current can flow ; ( k ) providing a low velocity flow to allow bubbles to rise to the surface of the reservoir 155 ; and / or avoiding turbulence in the fluid flow over the weir 265 into the reservoir by keeping the fluid level in the overflow cup 185 near the level of the weir 265 ( see , e . g ., fig3 ). in accordance with one embodiment of a gas control system , the reactor base 110 includes a chemical delivery system that provides a flow of epe which sweeps bubbles away from the surface of the workpiece . for example , the diffuser 220 in the cup 190 can direct fluid flows from the conduits 170 a and / or 170 b to desired zones of the processing area 215 . the diffuser 220 , for example , can be configured to direct a portion of the flow to the counter electrode 195 and another portion toward the center of the workpiece 16 . in the illustrated embodiment , the diffuser 220 is dome - shaped and includes a hole pattern that directs one portion of the flow to the workpiece surface and another portion toward the counter electrode 195 . the portion directed toward the counter electrode 195 should flow toward the upper portion of the electrode 195 so that bubbles generated at the electrode 195 can be trapped before reaching the workpiece as explained in more detail below . the portion of the flow directed to the central portion of the workpiece sweeps bubbles proximate to the workpiece surface toward the outer periphery of the workpiece where they can escape . in accordance with another embodiment of a gas control system , the rotor 120 may rotate the workpiece during a plating cycle to drive bubbles from the area proximate the workpiece surface . the workpiece is preferably rotated throughout a majority of the deposition cycle . the flow of photoresist chemistry impinging the workpiece surface and the rotation of the workpiece 16 combine to generate a fluid flow within the processing area 215 that moves radially outward from the center of workpiece 16 . such an outward flow physically sweeps bubbles toward the workpiece periphery where they can escape from the processing fluid . this aspect of controlling bubbles can be combined with the flow aspects of the diffuser 220 . the gas control system of the embodiment illustrated in fig2 can also include structures that trap the bubbles present in the photoresist emulsion before they reach the surface of the workpiece 16 . this embodiment differs from the foregoing embodiments in that it does not necessarily physically remove bubbles from the surface of the workpiece or a zone adjacent to the workpiece . rather , this embodiment reduces the presence of bubbles in the photoresist emulsion in the area below the workpiece surface to prevent bubbles from reaching the workpiece . this effect may be achieved , in part , by directing the flow of the photoresist chemistry through the reactor base so that bubbles are trapped at a trapping area . for example , as explained above , the diffuser 220 can direct a portion of the fluid flow toward a bubble trapping region that is vertically above the counter electrode 195 . once the bubbles are trapped , they may be directed to an area remote of the workpiece . for example , they may be directed outside of the reactor base through a bubble exhaust vent , and from there to a reactor base exhaust vent . fig2 illustrates one embodiment of a bubble trap 225 for use in the reactor 100 , and fig3 illustrates the bubble trap 225 in greater detail . as shown in fig2 , the bubble trap 225 can be an annular component located at the top of the counter electrode 195 . referring to fig3 , the bubble trap 225 may include a sloped ledge 229 having an upper surface 230 and a lower surface 235 . the upper surface 230 defines a flow area 240 through which the photoresist emulsion passes before reaching the processing area 215 . the sloped lower surface 235 extends radially inward so that it overlies the counter electrode 195 . the lower surface 235 , which is radially exterior to flow area 240 , can slope downwardly toward the center of the cup 190 to define a bubble trap region 245 that entraps bubbles generated at the counter electrode 195 or otherwise entrained in the fluid flow . the bubble trap 225 operates in coordination with the diffuser 220 and the shape of the counter electrode 195 . during deposition , the diffuser 220 directs a portion of the photoresist emulsion radially outward over the surfaces of the counter electrode 195 , which then flows upward toward the bubble trap region 245 of bubble trap 225 . without being limited to theory , it is believed that many of the bubbles present in the photoresist emulsion are generated by chemical reactions that occur at the counter electrode during epr deposition . by directing a portion of the flow over the surfaces of the counter electrode , bubbles formed on the counter electrode are swept upward and then radially outward through the bubble trap region 245 of the bubble trap 225 . the vertical sides of the counter electrode facilitate in entraining the bubbles at the electrode 195 in the upward flow of emulsion flowing toward the top 225 . the bubbles swept into the bubble trap 225 can then be directed through a bubble vent 250 to remove the bubbles from the process flow in the cup 190 . in the illustrated embodiment , the bubble vent 250 may be an annular channel through which the bubbles may escape . however , as shown in fig4 , the bubble vent 250 can be a plurality of distributed holes . referring to fig2 and 3 , the exterior and uppermost portion of the upper surface 230 of the bubble trap 225 may define a weir 265 . the photoresist chemistry in the processing area 215 flows over the weir 265 and into the overflow cup 185 . the weir 265 accordingly creates an upper surface of the bath . the volume of fluid purged over processing weir 265 can equal the volume of fluid flowing through the bubble vent 250 so that the proportion of emulsion and solvent directed over counter electrode 195 substantially equals the proportion of emulsion directed toward the center of workpiece 16 . a balanced flow of this kind depends on the rate at which the photoresist emulsion is introduced into the processing area 215 and the relative size and shape of the bubble vent 250 . it is well within the scope of the present invention to alter the relative size of processing weir 265 and the bubble vent 250 to achieve a balanced flow so that the volume of processing fluid flowing over processing weir 265 is substantially equal to the amount of processing fluid flowing through the bubble vent 250 . in an optional embodiment shown in broken lines in fig3 , the bubble trap 225 can further include a bubble weir 270 extending annularly around the exterior sidewall of the processing cup 190 . as shown , the bubble weir 270 includes an annulus 275 and a lower shelf 280 that extends in a radially inward direction from the annulus 275 . the upper portion of annulus 275 terminates at a vertical elevation that is just slightly below the top of weir 265 . the lower shelf 280 engages and seals with the exterior surface of the processing cup 190 in an area just below the bubble vent 250 . as the fluid flows through the reactor 100 , the difference in elevation between the upper portion of annulus 275 and the weir 265 results in a radially outward flow of the photoresist emulsion in the interstitial region between these structures . bubbles exiting through the bubble vent 250 , therefore , travel up to the surface of the photoresist emulsion where this radially outward flow sweeps the bubbles further away from the workpiece 16 . this action may assist in further reducing and / or eliminating bubbles that have already made their way to the surface of the workpiece thereby giving rise to higher product yields . with reference to both fig2 and 5 , the in - situ secondary processing region 150 of the reactor base 110 may include components for performing other processes on the workpiece and / or the contact assembly 125 at the same reactor site . typically , such secondary processes are ancillary to the deposition process that takes place in the deposition region 145 . for example , the secondary processing region 150 of the reactor base 110 may include an in - situ rinse assembly 285 . fig5 illustrates one embodiment of an in - situ rinse assembly 285 suitable for use in the secondary processing region 150 . the in - situ rinse assembly 285 shown in fig5 is described in more detail in international application pct / us00 / 28210 , filed oct . 12 , 2000 and published apr . 19 , 2001 as wo 01 / 27357 , the disclosure of which is hereby incorporated by reference . in the illustrated embodiment , a permeate solution comprised of the continuous aqueous phase of the electrophoretic emulsion may be used to rinse the workpiece and / or the contact assembly after a deposition cycle . the in - situ rinse assembly 285 can include one or more nozzles 290 that spray the rinsing solution at the underside of the workpiece 16 . the nozzles 290 can also spray the permeate solution at the electrical contact assembly 125 . by rinsing the workpiece and the contact assembly with the permeate solution , residual epe is removed from the contact assembly so that a more consistent and reliable engagement may be achieved between the electrical contact assembly and the workpiece . this further enables automated epe deposition because single - wafer assemblies need not be manually cleaned after only a few deposition cycles . it is sometimes desirable , although not necessary , to at least partially inhibit mixing of the processing chemicals used in different processing steps . the reactor base 110 therefore includes a separate collection system for collecting spent permeate ( e . g ., permeate that has contacted one or more surfaces of the workpiece 16 ). the collection system can include one or more fluid channels 300 that are disposed around the inner periphery of the in - situ rinse assembly 285 . as shown , the fluid channels 300 are annular lips that project radially inwardly and upwardly in the secondary processing region 150 proximate to the position of the workpiece 16 as it undergoes processing in the secondary processing portion 150 . to operate the in - situ processing system , the control system 46 causes the reactor head 105 ( fig2 ) to move the workpiece 16 to an intermediate position above the main processing area 215 but below the lower boundary of the collection channels 300 . while at this position , the workpiece 16 is spun at a high rotation rate to fling off a bulk portion of any excess epe used in the cup 190 . this reduces “ drag out ” of epe and waste of the photoresist . after the bulk portion of the excess epe has been removed from the workpiece , the control system 46 causes the reactor head 105 to move the workpiece 16 to a second processing position at the elevation of the collection channels 300 . in this position , a stream of permeate or other secondary processing solution is sprayed from the nozzles 290 to contact the lower surface of the workpiece 16 . this spray impinges a deposited film on the workpiece 16 . as the liquid stream is directed toward the workpiece surface , the rotor assembly 120 rotates at a high rotation rate so that the liquid impinging on the workpiece surface is flung radially outward under the influence of centrifugal forces . the liquid sprayed from the nozzles 290 is thus collected by the collection channels 300 where it may be reintroduced into the reservoir or removed from the reactor for recycling , disposal , etc . the one or more nozzles 290 may direct the stream of permeate or other secondary solution at a fixed angle with respect to the horizontal plane . in such instances , the control system 46 may direct the reactor head 105 to gradually raise the workpiece as the permeate is provided through the nozzles . this creates a “ chasing ” effect whereby the point of contact between the permeate stream and the workpiece surface varies with the height of the reactor head 105 . the secondary processing region 150 can also include an exhaust shroud 340 above the in - situ rinse assembly 285 . referring to fig4 , the exhaust shroud 340 may include an annulus 345 having an opening 350 through which the arm that carries the processing head 105 ( fig2 ) may move vertically as the processing head 105 is lowered into the processing position or raised to the load / unload position . the annulus 345 opens to an exhaust vent 355 that may be connected to a pump ( not shown ). the exhaust shroud 340 is particularly useful for use with epes , such as some eprs that contain volatile components or harmful vapors . the vapor phase of the epe can thereby be confined to the processing base 110 to prevent contamination of the exterior environment and / or the tool region 13 of the tool . fig6 is a cutaway isometric view of a further embodiment of a reactor base 110 a suitable for use in the reactor 100 . similar components are labeled with the same reference numerals in fig2 – 6 . the reactor base 110 a includes a bubble trap 225 a that is similar to the bubble trap 225 shown in fig2 and 3 , except that the bubble trap 225 a includes a ledge having a downwardly extending lip 360 . the lip 360 may provide more protection against defects caused by bubbles . the inventors , however , have discovered that the radial width of the ledge and the extent that the ledge has a downwardly depending lip affects the quality of the deposited layer of resist . the size and configuration of the ledge and / or lip is a function of several factors , such as the percentage of solids in the epe ( e . g ., micelle concentration ), strength of the electrical field , configuration of the counter electrode , and distance between the bubble trap and the workpiece . it will be appreciated that the radial width of the ledge , the distance between the ledge and the workpiece , the extent that the lip depends downwardly , and other factors can be varied according to the specific application to provide the desired surface quality without undue experimentation . fig7 illustrates another embodiment of a reactor base 110 b suitable for use in the reactor 100 . similar components are labeled with the same reference numerals in fig2 – 7 . in this embodiment , the reactor base 110 b includes a dual chemical delivery system that provides an agitated fluid flow to the surface of the workpiece that assists in driving bubbles at the workpiece surface radially outward away from the workpiece . in addition to the primary chemical delivery conduits 170 a and / or 170 b that direct a primary flow of the photoresist through the diffuser 220 b , the reactor base 110 b can further include a secondary conduit 365 and a sprayer bar 370 coupled to the conduit 365 . an additional flow of photoresist chemistry is delivered to the processing area 215 b through the spray bar 370 , which may be disposed immediately adjacent the process side of the workpiece 16 . the spray bar 370 may be configured as a cross - like structure having several linearly disposed holes on the side facing workpiece 16 for the diffusion of photoresist emulsion toward the workpiece surface . together , the diffuser head 220 b and the spray bar 370 direct an agitated flow of photoresist emulsion toward the workpiece 16 during deposition . this agitated flow , which in the illustrated embodiment is primarily directed to the central portions of the workpiece , assists in driving bubbles proximate to the workpiece surface toward the outer periphery of the workpiece where the bubbles can escape the fluid flow . as above , the workpiece may be rotated to further assist in driving bubbles from the area proximate the workpiece surface . to this end , as the flow generated by the diffuser head 220 b and the spray bar 370 impinges on the surface of the workpiece , the rotor assembly 120 ( fig2 ) rotates the workpiece . the impinging flow of emulsion toward the workpiece surface and the rotational motion of the workpiece 16 combine to generate a flow moving radially outward from the center of workpiece 16 to physically move bubbles toward the workpiece periphery . fig7 illustrates another bubble trap 225 b . in this embodiment , the bubble trap 225 b may have an annular cross - section in the horizontal plane and a funnel - shaped cross - section in the vertical plane . as shown , this particular shape substantially surrounds the counter electrode 195 in such a manner that nearly all of the bubbles forming on the electrode are captured by the bubble trap 225 b . the particular configuration of the bubble trap 225 b will depend upon the parameters explained above to ensure adequate surface quality . fig8 shows another variation of the reactor base 110 b of fig7 that is adapted to process a smaller diameter wafer using the same basic reactor base components . the reactor 110 b shown in fig8 includes a bubble trap 225 e and a spray bar 370 e . the bubble trap 225 e has a maximum outer diameter d 1 that is the same as the maximum outer diameter of the bubble trap member 225 b of the reactor base shown in fig7 . as a result , the bubble trap member 225 e of fig8 and the bubble trap member 225 b of fig7 are effectively interchangeable inserts that can be used in the same reactor base . however , the bubble trap member 225 e terminates at a process weir 265 e that defines an opening having a smaller diameter d 2 than the corresponding diameter of the reactor base shown in fig7 . this results in a virtual electrode at the opening that is smaller than the virtual electrode of the reactor base of fig7 . whereas the larger virtual electrode of the reactor base of fig7 may be suitable for processing of 300 mm diameter wafers , the reactor base of fig8 may be tailored for processing of a smaller diameter wafer , such as a 200 mm or 150 mm wafer . similarly , the length of the spray bar 370 e in fig8 is reduced in comparison to the spray bar 370 of the embodiment shown in fig7 so that it can fit within the diameter d 2 of the opening . the exterior walls of the bubble trap member 225 e present a sloped surface over which the electrophoretic emulsion flows as though reactor base is initially filled with fluid . in this manner , gas entrapment and bubble formation that might otherwise occur with the agitation that would result from an abrupt vertical transition over the process weir 265 may be reduced and / or completely avoided . fig9 and 10 illustrate another embodiment of a reactor base suitable for use in reactor 100 . this embodiment includes a reactor base 110 c that is substantially similar to those previously described , with the exception that it includes a plurality of counter electrodes 375 . in certain applications , a plurality of counter electrodes can be helpful in controlling the rate of deposition and the thickness of the resist . for example , one problem of depositing thick layers of resist is that bubbles are more likely to form . by using a plurality of counter electrodes , it may be possible to provide greater control over the rate of deposition . such control of the deposition rate can ensure that bubbles do not get caught up in the resist layer during deposition . in the specific embodiment shown in fig9 , the reactor base 110 c includes counter electrodes 375 a – c and corresponding bubble trapping members 380 a – c immediately above the counter electrodes . the bubble trapping members 380 may be comprised of inverted u - shaped rings having an internal dimension that is just slightly larger than the width of each counter electrode 375 . with particular reference to fig1 , the counter electrodes 375 may be interconnected with one another by a conductive or non - conductive web of material 382 to form a single counter electrode unit 390 . similarly , the bubble trap members 380 may be interconnected by webbing 384 to form a single bubble trap structure 385 . in general , the principles described in relation to the reactor bases above also apply to reactor base 110 c , with the exception that the flow of the emulsion from the diffuser 220 is directed up and over electrodes 375 in a manner that causes any bubbles to be trapped within trapping members 380 . the bubbles can remain in the trapping members 380 or flow to a corresponding vent in the periphery of the bubble trap structure 385 . the remaining parts of reactor base 110 c generally operate substantially the same as described above . various other structures can be incorporated into the reactor to reduce and / or eliminate bubbles proximate to the surface of the workpiece 16 . for example , the workpiece can be vibrated during deposition through the use of a common vibration device that is attached to the rotor assembly 120 ( fig2 ). alternatively , the vibration device may be attached to the stator 70 ( fig2 ). in each instance , such vibration assists in preventing the bubbles from adhering to the surface of the workpiece . a suitable vibration device that may be used is a series mvs1 & amp ; msp ( 3000 rpm ) from vibratechniques , ltd . ( new england house , brighton , u . k .). the generation of an agitated flow of photoresist emulsion at the surface of the workpiece can also be accomplished through the use of a moveable paddle . such a paddle can be placed just below the surface of the workpiece 16 where it can oscillate to drive bubbles that are present at the surface of the workpiece toward the peripheral portions thereof . the paddle may have a triangular cross - section and may be mounted just below the surface of the workpiece in a right - side up or upside down orientation . an oscillating drive may then be attached to the paddle to effect the back - and - forth , horizontal oscillation of the paddle during the epr deposition process . the paddle may also have holes through which the epe can flow . suitable paddles are similar to the plating systems disclosed in articles by rice et al ., “ copper electrodeposition studies with a reciprocating paddle ,” j . electrochem . soc . , vol . 135 , no . 11 , november 1988 , mehdizadeh et al ., “ the influence of lithographic patterning on current distribution in electrodeposition : experimental study and mass . transfer effects ,” j . electrochem . soc . , vol . 140 , no . 12 , december 1993 and schwartz et al ., “ mass - transfer studies in a plating cell with a reciprocating paddle ,” j . electrochem . soc ., vol . 134 , no . 7 , july 1987 . still another embodiment for controlling bubbles is a process for operating the reaction vessel . the present inventors have found that the use of pulsed plating current during deposition may also reduce the overall bubble content of the bath . without being limited to the following theory , it is believed that a continuous current generates more bubbles at the counter electrodes or the workpiece surface because gas is not given time to diffuse into solution . when the electrical current is interrupted for even a brief period of time , many bubbles will simply break up and dissolve into solution . bubbles that would otherwise inherently evolve at the workpiece surface or the counter electrode during the deposition , such as o 2 or h 2 bubbles , may not form at the electrode or the workpiece . still further , an ultrafiltration system can be used to remove some gas bubbles and prevent the same from entering the electrolytic bath with introduction of the photoresist emulsion . for example , filters 311 ( fig2 ) can remove bubbles , or other filters in the system for filtering permeate solution can be used to remove bubbles . although not required , it is useful to employ one or more of the gas control systems described herein in a combined manner to achieve the desired result . for example , in view of the teachings herein , it is possible to combine ultrafiltration , rotation of the workpiece , agitation of the bath , vibration of the workpiece , impinging flow , short distance from the overflow weir 265 to the fluid level in the overflow cup 185 , and bubble traps in the same reactor to produce relatively void - free photoresist films . reactor heads for use in epe reactors in accordance with several embodiments of the invention mitigate pinholes formed by bubbles in the epe bath and enable the integration of electrochemical deposition of eprs and other epes in microfabrication processes . one feature of the reactor heads that mitigates pinholes is that the reactor heads are configured to rotate the workpiece during the electrochemical processing . additionally , as explained in more detail below , several embodiments of reactor heads enable the integration of electrochemical epe deposition with other microfabrication processes because the reactor heads are configured to limit the contact between the workpiece and the epe bath to only selected processing regions of the workpiece so that other regions of the workpiece are isolated from the epe bath . as such , single - wafer handling equipment used in other microfabrication techniques can be used to handle workpieces processed by the epe reactors . a reactor head that is suitable for use in the illustrated reactor is described in international patent application nos . pct / us99 / 15847 and pct / us99 / 15850 , the disclosures of which are hereby incorporated by reference . referring back to fig2 , the illustrated embodiment of the reactor head 105 for the reactor assembly 100 includes a stator assembly 70 and a rotor assembly 120 . the reactor head 105 receives and carries an associated microelectronic workpiece 16 , positions the microelectronic workpiece 16 in a process side down orientation within the processing area 215 of the base 110 and rotates or spins the workpiece 16 . the reactor head 105 also includes the contact assembly 125 with contacts that engage the electrically conductive surface of the workpiece 16 to electrically couple the workpiece to a voltage potential . the contact assembly 125 also includes structures that effectively isolate the non - processed side (“ backside ”) or other regions of the workpiece from fluids used during the deposition process . this is in contrast to the rack - and - tank epr processes used in printed circuit board manufacturing that immerse the entire workpiece vertically in the electrolyte causing both sides of the workpiece to be covered with the photoresist . the reactor head 105 may be mounted on a “ lift and rotate ” apparatus 130 configured to rotate the reactor head 105 from an upwardly facing disposition in which it receives the microelectronic workpiece 16 ( not shown ) to a downwardly facing disposition in which the surface of the microelectronic workpiece 16 may be brought into contact with the photoresist chemistry contained in the epr base 110 ( shown in fig2 ). a robot unit can load the microelectronic workpiece 16 on the rotor assembly 120 for processing and remove the microelectronic workpiece 16 from the rotor assembly 120 after processing . a reactor head that is suitable for use in the illustrated reactor is described in international patent application nos . pct / us99 / 15847 and pct / us99 / 15850 , the disclosures of which are hereby incorporated by reference . one embodiment of the contact assembly 125 is shown in more detail in fig1 and 12 . the contact assembly 125 is removably attached to the rotor assembly 120 and provides electrical contact between the microelectronic workpiece 16 and a source of electrical power . in the illustrated embodiment , electrical contact between the workpiece 16 and the contact assembly 125 occurs at a large plurality of discrete flexure contacts 425 ( fig1 ) that are effectively separated from the epe when the workpiece 16 is loaded in the contact assembly . referring to fig1 , the contact assembly 125 can have a central open region 430 within which the workpiece is exposed . as shown in fig1 and 12 , the contact assembly 125 includes a primary support member 445 , an outer body member 435 carried by the support member 445 , a plurality of flexure contacts 425 projecting radially inwardly from the support member 445 , and an interior wafer guide 450 on the interior of the support member 445 . referring to fig1 alone , the contact assembly 125 can further include an annular wedge 440 that secures the flexural members 425 to the support member 445 . the annular wedge 440 , the flexure contacts 425 , and the support member 445 are preferably formed from platinized titanium ; the wafer guide 450 and the outer body member 435 are preferably formed from a dielectric material that is compatible with the processing environment . fig1 shows one embodiment of a flexure contact 425 in greater detail . the flexure contact 425 can include an upstanding portion 470 , a transverse portion 475 , a vertical transition portion 480 , and a wafer contact portion 485 . similarly , the wedge 440 includes an upstanding portion 490 and a transverse portion 495 . the upstanding portion 490 of the wedge 440 and the upstanding portion 470 of the flexure contact 425 are secured within a first annular groove 455 of the support member 445 . in operation , a workpiece is centered to rest on the wafer contacts 425 . the contact portions 485 contact a perimeter portion of the workpiece around a first diameter . the outer body member 435 includes an upstanding portion 520 , a transverse portion 525 , a vertical transition portion 530 , and a further transverse portion 535 that terminates in a lip 540 . the upstanding portion 520 includes an annular extension 545 that extends radially inward to engage a corresponding annular notch 550 disposed in an exterior wall of the support member 445 . the transverse portion 535 extends radially inward beyond the contact portions 485 of the flexure contacts 425 . the transverse portion 535 and contacts 425 resiliently deform as a wafer is driven downwardly through the central opening . with the workpiece 16 in proper engagement with the contact portions 485 , the lip 540 engages workpiece 16 and provides a barrier between the processing solution and the outer peripheral edge of the workpiece , the backside of workpiece , and the flexure contacts 425 . a seal , such as a polymeric material , can extend around the lip 540 to prevent epe from leaking into the region of the contacts 425 or around the backside of the workpiece . the outer number 435 accordingly isolates the backside and peripheral portion of the processing side of the workpiece 16 from the epe . as such , the backside remains clean and the edge is not covered by an edge bead of resist . although the flexure contacts 425 shown in fig1 and 12 are discrete components , they may be joined with one another as an integral assembly in other embodiments . for example , the upstanding portions 470 of the flexure contacts 425 may be joined to one another by a web of material , such as platinized titanium , that is either formed as a separate piece or is otherwise formed with the flexures from a single piece of material . the web of material may be formed between all of the flexure contacts or between select groups of flexure contacts . for example , a first web of material may be used to join half of the flexure contacts ( e . g ., 18 of the flexure contacts in the illustrated embodiment ) while a second web of material is used to join a second half of the flexure contacts ( e . g ., the remaining 18 flexure contacts in the illustrated embodiment ). different groupings are also possible . fig1 illustrates one embodiment of a fluid flow control system , shown generally at 800 , that may be used in connection with the reactor of fig2 . although not mandatory , it is beneficial to place the fluid flow control system 800 under the control of the control system 46 ( fig2 ) so that the control system may coordinate the flow of fluid with the various other operations executed within the processing tool 10 . in the illustrated system , fluid flow begins generally in emulsion tank 155 . the photoresist emulsion contained therein is maintained at a predetermined temperature by the thermal unit 160 , as explained above . during normal operation , a suction is created through activation of pump 805 to draw emulsion from emulsion tank 155 through line 810 to valves 815 and 820 . valves 815 and 820 are normally open and generally lead to lines 825 and 830 which feed , for example the diffuser 220 shown in fig2 . optional filters 831 can be placed in lines 825 and 830 . the lines 825 and 830 generally correspond to the primary chemical delivery conduits 170 a – b ( fig2 ) that provide the epr emulsion to the processing area 215 of the reactor base 110 . the fluid flow in lines 825 and 830 may be monitored by flow meters that may be in communication with the control system 46 . information regarding the rate of fluid flow can be obtained from the meters and used by the control system 46 to control the overall epr deposition process . turning now to the fluid flow generated through activation of a pump 855 , it can be seen that fluid is drawn from the emulsion tank 155 through a line 865 and through an open valve 835 into a particle filter 860 . the particle filter 860 is chosen to remove particles within the range of 5 – 10 microns and separate such large particles from the flow of the photoresist chemistry . the flow of emulsion continues through the particle filter 860 and into an ultrafilter unit 870 . suitable ultrafilter units are available from koch international ltd . ( part # p4 - hfm - 183 - lpp ). the ultrafilter unit 870 separates the flow of photoresist chemistry into a permeate solution that is drawn into a permeate tank 875 through line 867 and a concentrated emulsion that is provided through line 846 . a valve 880 controls the flow through line 867 , and a value 847 controls the flow through line 846 . the ultrafiltration unit 870 has a semipermeable membrane filter which retains large molecules or colloidal particles while permitting the passage of water , solvents and other small molecules . in other words , it separates the photoresist emulsion into a concentrate and a permeate . the permeate solution is a conservation - type solution that is used for rinsing the contacts and workpiece . in this manner , the processing chemistry does not have to be replaced after each cleaning because the permeate can flow back into emulsion tank 155 and mix with the concentrated emulsion to be used again for deposition . the permeate is comprised of mostly water , solvents , and other small molecules . after the permeate is separated , a concentrated emulsion is drawn through line 846 through valve 847 and through flow meter 848 to flow into the emulsion tank 155 . the emulsion separated using ultrafilter 870 is of a slightly higher concentration than the emulsion in the emulsion tank because the permeate solution containing mostly water is pulled from the total bath chemistry . after ultrafiltration , the permeate solution is stored for use during a conservation in - situ rinse at a desired temperature maintained by another thermal unit 856 within the permeate tank 875 . the thermal unit 856 may be of the same type and configuration as the thermal unit 160 . during in - situ rinsing and / or contact cleaning operations , fluid is drawn from the permeate tank 875 through line 858 by way of pump 890 . fluid flow from the permeate tank 875 proceeds through pump 890 , valve 862 , and a particle filter 864 . the particle filter 864 can suitably be a 0 . 1 micron filter . the fluid flow continues through line 885 to valves 895 and 900 . during an in - situ rinse procedure , valve 895 is closed and valve 900 is open to administer the permeate rinse through line 905 and into the in - situ rinse assembly 285 . when the in - situ rinse procedure is not in operation , valve 900 is closed and valve 895 is open so that any overflow from permeate tank 875 can return to the deposition chamber through line 910 . this permeate return is continued given that ultrafiltration continues through ultrafilter 870 during normal operation of the reactor 100 . the permeate level in tank 875 is constantly being fed through a circuit including line 858 , pump 890 , valve 872 , and line 866 . if the recirculation flow just described exceeds capacity , excess or overflow permeate may be returned to the deposition chamber via valve 895 and line 910 . the photoresist used in the foregoing system and reactors may be any electrodepositible resist material such as , for example , those available under the trade designation pepr ™ 2170 available from shipley company , inc . ( newton , massachusetts ). it will be apparent to one skilled in the art that the process parameters used to electrodeposit the photoresist will vary depending upon the photoresist used . the following description of the deposition process includes parameters that may be used in connection with the pepr ™ 2170 photoresist , but they are believed to be generally applicable to the deposition of most electrophoretic photoresists or other patternable materials . the deposition of pepr ™ 2170 is an anodic process , where the workpiece functions as the anode . the resist described here is mostly self - limiting and deposits between 5 and 12 microns of photoresist , although thicker resist films may be achieved by manipulation of the solids content and solvent content of the bath . the thickness of the resist film is controlled by varying the concentration of the plasticizer ( pepr 2170 ® tc , a solvent comprised mainly of octonone ). the plasticizer is added by either manual or automatic dosing and has proven to be a simple , reliable means of controlling resist thickness . an electrolytic bath containing 10 to 13 percent solids ( pepr ™ 2170 photoresist ) and 10 percent solvents ( primarily octonone or the “ thickness controller ” provided by the shipley company ). the bath can contain 5 – 15 % solids in other applications . no pre - cleaning steps were used and the bath was held at 30 ° c . a workpiece was inserted into the epr reactor and the head was closed . the total epr deposition process for a 200 mm workpiece in this particular example took slightly under 95 seconds ( see table 1 ). a first dwell step was conducted with the workpiece rotating at 75 rpm for 5 seconds , and a second dwell step was conducted with a reduction in rotation of the workpiece down to 10 rpm up to the 1 minute mark . at the 1 minute mark rotation was increased to 150 rpm and a voltage of 150 volts was applied to the electrolytic bath for the next 30 seconds . at the 90 second mark , the head was lifted to approximately 700 cts out of level and rotation of the workpiece was slowed to 75 rpm . a spin - off step was then conducted at 200 rpm for 3 seconds . ( see table 1 ). an electrolytic bath containing 10 % solids ( pepr ™ 2170 photoresist ) and 10 % solvents ( primarily octonone or the “ thickness controller ” provided by the shipley company ). no precleaning steps were used and the bath was held at 30 ° c . a workpiece was inserted into the epr processing chamber when the head of the chamber was held in a cracked position at an angle of 700 cts out of level . the total epr deposition process for a 200 mm workpiece in this particular example took slightly under 95 seconds ( see table 2 ). a spin up step was initiated for 5 seconds while the workpiece was spinning at an rpm of 60 with the head in a cracked position . next , a dwell step was performed with the head closed for a period of 1 minute with a rotation of 60 rpm wherein vibration was applied to the head for the final 10 seconds of the dwell step . voltage was applied at the 80 second mark with a potential of 150 volts and the workpiece was spun at 150 rpm while vibration was applied to the reactor head ( see table 2 ). at the 85 second mark , the reactor head was again cracked at approximately 700 cts and the voltage was turned off while the workpiece rotated at 60 rpm for 5 seconds . the final 3 seconds of the procedure included a spin off step , where the head was cracked and the substrate was spun at 200 rpm . the following description of automated processing tools provides several examples of methods and systems for performing automated epe deposition . the automated processing tools can be integrated with additional microfabrication processing tools to form a complete microfabrication processing system in which the system includes an automated epe processing tool . for example , it is well within the scope of the present invention to have different configurations of automated processing tools that include other types of processing stations , such as an exposure station , a chemical etching station , or metal depositing station . such other processing stations could be contained within an enclosed or a partially enclosed housing including epe processing stations , or they could be located in automated processing tools separate from the epe processing stations . as explained in more detail below , the microelectronic workpieces can be transferred between the automated processing tools manually or by automatic robotic handling equipment . fig1 is an isometric view of an automated microelectronic processing tool 10 having an epe deposition station 11 for deposition of epr or other electrophoretic materials . the processing tool 10 may include a cabinet 12 having an interior region 13 that is at least partially isolated from an exterior region 14 , such as a clean room . the cabinet 12 may be an enclosed structure including a plurality of apertures 15 ( only one shown in fig1 ) through which microelectronic workpieces 16 contained in cassettes 17 can be moved to and from a load / unload station 18 . in other embodiments , the cabinet can be open , such as the layouts and tool platforms shown in u . s . application ser . nos . 10 / 080 , 914 and 10 / 080 , 915 , which are herein incorporated by reference . the load / unload station 18 may have one or more container supports 20 each housed in a corresponding protective shroud 22 . the container supports 20 are configured to position the workpiece cassettes 17 proximate to the apertures 15 in the cabinet 12 . in this position , the microelectronic workpieces 16 can be accessed by one or more robotic transfer mechanisms inside or along the cabinet 12 . the workpiece cassettes 17 can be configured to house the microelectronic workpieces 16 in a “ mini ” clean environment in which groups of microelectronic workpieces may be transferred , automatically or manually , between processing tools . the particular embodiment shown in fig1 illustrates a load / unload station suited for handling foup wafer holders that are typically used in connection with 300 mm semiconductor workpieces . the cassettes 17 , however , can be open cassettes that do not provide “ mini ” clean environments . as such , other load / unload station configurations may be used depending on the characteristics of the particular type of workpiece that is to be processed in the tool 10 . the embodiments of the tool 10 shown in fig1 include one or more epe deposition stations 11 , one or more fluid processing stations 24 , a workpiece handling system 26 , and a photoresist baking station 25 . one or more of the epe deposition stations 11 may also incorporate structures that are adapted for executing an in - situ rinse or other secondary in - situ process . following epe deposition , the in - situ rinse may be used to rinse the workpiece at the epe station 11 before it is transferred to another station . in this way , cross - contamination with other reactors is reduced and the footprint of the processing tool is more efficient . further , the in - situ rinse may be used to clean the electrodes and / or any seals that contact the workpiece during deposition . any buildup of material on the electrodes and / or seals may thereby be removed to ensure consistent wafer - to - wafer contact . this in - situ cleaning process may be accomplished by subjecting only the electrodes to the rinse cycle without a workpiece loaded in the epe station 11 . the fluid processing stations 24 may execute one or several process sequences , such as pre - cleaning and / or pre - wetting the workpiece before epr deposition , cleaning the workpiece after epr deposition , developing the epr coating following patterning , depositing a metallization layer on the workpiece , enhancing the seed layer prior to either epr deposition or metallization deposition , and so forth . the particular embodiment of the processing tool shown in fig1 is a “ linear ” tool in which the processing stations are aligned in a generally linear fashion on opposite sides of the workpiece handling system 26 . in this type of system , the workpiece handling system 26 includes a linear track 28 and one or more robotic transfer mechanisms 30 that travel along the linear track 28 . in the particular embodiment shown in fig1 , a first set of processing stations is arranged in a generally linear manner along a first row r 1 - r 1 and a second set of processing stations is arranged in a generally linear manner along a second row r 2 - r 2 . the linear track 28 extends between the first and second rows of the processing stations so that the robot unit 30 can access one or more of the processing stations along the track 28 to load and / or unload workpieces . the robotic transfer mechanisms 26 , as well as the actuatable components of the processing stations 11 and 24 , are in communication with a control unit 46 . the control unit 46 can implement software programming or other computer operable instructions in response to user input parameters . the control unit 46 may include at least one graphical user interface 48 including , for example , a user - friendly display through which the user input parameters are entered into the control unit 46 . optionally , the user interface may be located on an area of the tool or at a remote location . in the case of the latter implementation , the control unit 46 may also include a communicating link for communicating with the remote user interface . it will be recognized , that a number of control units 46 may be connected to a common control system ( not illustrated ) that is used to control and oversee the operations performed in the microfabrication facility or sections thereof . among its many functions , the control unit 46 is programmed to control the transfer of microelectronic workpieces between the various processing stations and between the input / output section and the processing stations . further , the control unit 46 is programmed to control the operation of the components at the individual processing stations to implement specific processing sequences in response to the user input parameters . fig1 – 17 illustrate alternate layouts for processing stations in epe deposition tools in accordance with additional embodiments of the invention to implement an automated epe deposition process . with specific reference to fig1 , tool 10 a comprises epe deposition stations 11 , the load / unload station 18 , one or more fluid processing stations 32 , and a thermal processing station 34 . the fluid processing stations 32 may execute one or several process sequences , such as pre - wetting the workpiece prior to epr deposition , cleaning the workpiece subsequent to epr deposition , developing the epr coating following patterning , depositing a metallization layer on the workpiece , enhancing the seed layer prior to either epr deposition or metallization deposition , and so forth . the workpieces are transferred between the processing stations 11 , 34 and 32 using one or more robotic transfer mechanisms 36 , 38 that are disposed for linear movement along a central track 28 . all of the processing stations , as well as the robotic transfer mechanism , are disposed in a cabinet , such as the one shown in fig1 . the cabinet can be provided with filtered air at a positive pressure to thereby limit airborne contaminants that may reduce the effectiveness of the workpiece processing . to further enhance the resistance of the overall process to cross - contamination between processing stations , the robotic transfer mechanisms 36 and 38 may be dedicated to specific processing stations . fig1 illustrates another embodiment of a processing tool 10 b in which a processing station 40 is located in a separate portion of the integrated tool set . unlike the embodiment of fig1 , in this embodiment , at least one processing station , such as a thermal processing station , is serviced by a dedicated robotic mechanism 42 . the dedicated robotic mechanism 42 accepts workpieces that are transferred to it by the robotic transfer mechanisms 36 and / or 38 . transfer may take place through an intermediate staging door / area 44 . as such , it becomes possible to separate one portion of the workpiece processing tool , such as the thermal processing portion 45 , from other portions of the tool . additionally , using such a construction , the illustrated further processing station may be implemented as a separate module that is attached to upgrade an existing tool set . for example , processing portion 45 may be added to an existing electrochemical metallization deposition tool so that the metallization deposition and the epr deposition take place in the same processing tool . it will be recognized that other types of processing stations may be located in portion 45 in addition to or instead of the thermal processing station 40 . other types of processing tool layouts may also be used . for example , in certain tools sold under the brand name equinox ( tm ) available from semitool , of kalispell , mont ., the processing stations are disposed radially about a centrally located robotic transfer mechanism and a load / unload station . this platform is illustrated in fig1 . as illustrated in fig1 , a rotary tool 10 c may include the same basic processing stations and similar robotic transfer apparatus to the linear tool . accordingly , the same reference numerals are utilized here . additional configurations are possible , such as those used in the processing tools available from applied materials of santa clara , calif ., and novellus , inc ., of portland , oreg . the robotic transfer mechanisms 36 , 38 and 42 as well as the actuatable components of the processing stations 11 , 34 , 32 and 40 are in communication with the control unit 46 that implements software programming in response to user input parameters . it will be recognized , that a number of control units 46 may be connected to a common control system ( not illustrated ) that is used to control and oversee the operations performed in the microfabrication facility or sections thereof . among its many functions , the control system 46 is programmed to control the transfer of microelectronic workpieces between the various processing stations and between the input / output section and the processing stations . further , the control unit 46 is programmed to control the operation of the components at the individual processing stations to implement specific processing sequences in response to the user input parameters . the control unit 46 can operate the processing tool 10 to deposit an electrophoretic material onto a workpiece in accordance with several different control sequences . the control sequences generally provide automated deposition of resists or other materials onto semiconductor wafers or other types of microelectronic workpieces in a manner that can be integrated with the other types of single - wafer processing equipment used in patterning microfeatures . several embodiments of such control sequences provide automated sequences by maintaining clean surfaces on the workpiece . as such , the control sequence can use single - wafer handling equipment compatible with stepper machines and other microfabrication equipment . several embodiments of control sequences also limit cross - contamination between the epes and other fluids which can reduce throughput and increase maintenance . fig1 illustrates one processing sequence 50 of a number of possible sequences . the particular sequences and parameters used in the epe deposition processes depend on the particular manufacturing processes that are to be implemented . in the illustrated embodiment of the processing sequence 50 , the processing tool 10 ( fig1 ) receives a microelectronic workpiece from a cassette 17 ( fig1 ) and transfers it to one of the processing stations . the processing sequence 50 , for example , can include a first fluid process 52 , such as a pre - clean / pre - wetting process , in a fluid processing station 24 ( fig1 ). in an alternate embodiment , the processing sequence 50 can include a seed layer repair / enhancement procedure before the first fluid process 52 because it may be useful to enhance or otherwise deposit additional conductive material onto the microelectronic workpiece before it is subject to the pre - clean / pre - wetting process . such enhancement or repair of the seed layer may provide better photoresist film characteristics . methods and apparatus for processing a conductive seed layer are shown and described in u . s . pat . no . 6 , 197 , 181 , which is hereby incorporated by reference in its entirety . after the pre - clean / pre - wetting process or other type of first fluid process 52 , the control system 46 causes the robotic transfer mechanism 30 to remove the workpiece from the pre - clean / pre - wetting station and transfer it to the electrophoretic deposition station 11 . at the electrophoretic deposition station 11 , the sequence 50 further includes a deposition process 54 in which a microelectronic workpiece is subject to an epe deposition process , such as depositing epr . the specific parameters used in the deposition process 54 are input either directly or indirectly into the control system 46 by the user . it will be recognized that the particular parameters depend on the epe type , the size of the workpiece , the type of underlying conductive layer , the thickness of the photoresist layer desired , and several other parameters . after completing the deposition process 54 , the sequence 50 includes subjecting the microelectronic workpiece to an in - situ rinse process 56 carried out in the deposition station 11 . this process reduces contamination of other components because residual epe is rinsed from the workpiece before it is loaded onto the robot 30 ( fig1 ). further , the control system 46 may direct the execution of an in - situ contact cleaning operation at any time . this latter process assists in ensuring that there is consistent contact between the contacts used to provide electroplating power and the conductive surface on a workpiece . after the in - situ rinse process 56 , the sequence 50 further includes a second fluid process such as a rinsing process 58 . for example , the control system 46 may direct the robotic transfer mechanism 30 to remove the microelectronic workpiece from the deposition station 11 and transfer it to a deionized water rinse station for executing the rinsing process 58 . after the rinsing process 58 , the workpiece can be removed from the tool 10 for subsequent processing . in an alternate embodiment , the sequence can optionally include a thermal process 59 . for example , the control system 46 may also be programmed to direct the workpiece to a station at which the thermal process 59 is executed after completing the rinsing process 58 . the thermal process 59 may include both heating and subsequent cooling of the workpiece to effectively cure the photoresist . when the thermal process 59 occurs in the tool 10 , the workpiece can be removed from the tool 10 after baking and cooling the resist . as explained in more detail below , the workpiece is typically processed in additional tools for further processing the resist or other electrophoretic material deposited on the workpiece . fig1 is a flow diagram illustrating a control sequence 50 a in accordance with another embodiment of the invention . in addition to the control sequence 50 described above in fig1 , subsequent processes of the control sequence 50 a that may be executed on the microelectronic workpiece include an exposure procedure 60 followed by a photoresist development procedure 62 . although the exposure procedure 60 and the development procedure 62 may be implemented in the processing tool 10 ( fig1 ), it is more frequently executed in a separate tool . after the exposure procedure 60 and the development procedure 62 have been executed , the microelectronic workpieces may be transferred back to the processing tool 10 for execution of a chemical etching and / or metallization plating operations 64 . as shown at stage 66 , the overall process may be repeated as necessary until the desired structures are formed on or in the substrate . it should be understood that the present invention may be practiced in many different ways and that the description above is merely exemplary . the description is not intended to limit the invention in any way to the illustrated embodiments . rather , it is the intention of the inventors to both literally and through equivalents encompass all changes and improvements that validly fall within the bound of the claims below . | 6 |
as illustrated in fig1 there is shown a vehicle in the form of a riding mower 20 supported upon ground engaging wheels 22 and having a drive and driven portion 24 , 26 , respectively . further included is a seating apparatus 28 for accomodating an operator and positioned so as to allow the operator to be within easy reach of the mower drive controls 30 . forming a rear of the mower 20 is an air filtration device in the form of a screened enclosure 32 , as seen in fig1 and which is housed below a hood 34 of the mower 20 . looking now to fig2 attachment of the enclosure 32 to a frame portion 36 of the mower 20 is shown . specifically , the enclosure 32 is fitted in proximity to and against a radiator plate 38 which frames and / or supports an upstanding radiator ( not shown ) for the vehicle 20 . once enclosure 32 is fitted beyond an outer peripheral edge 40 of and underneath hood 34 , the enclosure 32 connects with brackets or catches 42 welded to plate 38 so as to secure the enclosure 32 to the plate 38 and thus also , to brackets 36 which are available for connection with the frame of the vehicle 20 . referring to fig3 enclosure 32 includes an exterior surface 44 including a front side 46 , intermediate sides 48 and rear side 50 . intermediate sides 48 include connected vertical and horizontal partitions 52 spaced throughout and have screening portions 54 interposed between the partitions 52 . handles 56 are bolted onto an extension 58 contained in each of two identical , yet parallel partitions 52 as best seen in fig4 and 5 . adjoined to the rear side 50 of the enclosure 32 is a seal 60 , preferably made of rubber , for use in sealing the enclosure 32 to the plate 38 , as seen specifically in fig6 a as well as in fig1 a . included at the front side 46 of the enclosure 32 is a sheet 62 of undulating screening , preferably made of metal and having perforations therethrough , and having vertically wavering portions or ribs 64 throughout . one of ordinary skill in the art will recognize that materials other than metal may be used in the construction of the provided screening . the undulations 64 may also be provided in a horizontal pattern . however , it is preferred , in this embodiment , that they be provided in a vertical configuration so as not to create a shelf upon which debris may lie . both fig4 and 5 illustrate a left and right rear perspective of the enclosure 32 , respectively . as shown by both figures , the enclosure 32 incorporates a pair of left and right clips 66 and center clip 68 respectively , each of which is mounted to an interior side 70 of at least three of the partitions 52 . clips 66 , 68 are spring assisted and maintain both a buckled portion 72 and upwardly inclined portion 74 , and are attached to the partition 52 with fastening devices 76 such as bolts and nuts . held opposite clips 66 on the exterior 44 of enclosure 32 are the handles 56 which include a circular loop 78 that may be grasped so as to maneuver the enclosure 32 . as shown in fig5 each of clips 66 and handles 56 include flattened mounting plates 80 , 82 extending therefrom , respectively . when assembled , as shown in fig4 and 5 , mounting plates 80 , 82 align with each other relative to interior and exterior surfaces 70 , 44 of the enclosure 32 . buckled portion 72 and loop 78 extend laterally opposite one another about an axis extending transversely to each of the clips 66 and handle 56 so as not to exert unnecessary forces on enclosure 32 upon removal or installation on vehicle 20 . additionally , to absorb forces applied to center clip 68 when enclosure 32 is installed onto or removed from the vehicle 20 , exterior surface 44 includes a brace or stiffening plate 84 attached thereto , as seen in fig6 a . brace 84 includes a downwardly bent tongue 86 which compresses against seal 60 , as best shown in fig6 a . attachment of brace 84 is made by use of the same bolt and nut combination 76 as is used to connect center clip 68 to enclosure 32 , as illustrated in fig6 . assembly of the enclosure 32 is shown in fig7 and 8 . included as part of its construction is a frame assembly consisting of both an exterior and interior , or alternatively first and second shell members 88 , 90 , respectively . each member is constructed in substantially similar fashion and of similar material , preferably plastic allowing for lightweight design , with the exception that interior member 88 is slightly smaller in dimension when compared with exterior member 90 . thus , manufacture of only the interior member 90 will be discussed in detail . as also seen in fig9 interior member 90 consists of a front edge 92 , intermediate sides 94 and rear edge 96 . adjacent a border 98 , shown in fig9 a , of front bottom edge 92 is a transversely and rearwardly extending sill or shoulder 100 that receives a wave - shaped screen mounting structure 102 . a similarly shaped screen mounting structure 104 , shown in fig7 is provided in the other shell member 88 that would be positioned adjacent the wave - shaped structure 102 in the first shell member 90 with the screen element 62 being sandwiched between the two wave - shaped structures 102 and 104 . since the two wave - shaped structures 102 and 104 are essentially identical , only the one illustrated in fig9 will be discussed in detail . the wave - shaped screen mounting structure 102 is of a generally sinusoidal shape with alternating vertically extending fore and aft spaced ribs 106 . the ribs 106 are connected with web portions 108 to provide a generally u - shaped channel or slot 110 . sill 100 continues upward from the left and right junctures 112 from front bottom side 92 . interconnecting the web 102 beyond the junctures 112 are straight extensions 114 of the sill 100 . intermediate side 94 contains hollowed segments or openings 116 defined by partitions 52 spaced at unequal intervals throughout . along side 94 , portions 118 of at least two partitions 52 are angled so as to allow left and right sections 120 , 122 of side 94 to maintain a outwardly bowed configuration with sections 120 , 122 extending both upwardly and downwardly on either side of the bow 124 . as further seen in fig9 partition 52 extends upwardly from the bow 124 and includes an extension 58 . holes 126 are formed therein so as to allow reception of bolts 76 used to secure clips 66 and handles 56 on either side of extension 58 . at a rear side 96 of interior member 90 is an outwardly extending ledge or edge 128 provided along its entire length , as seen in fig7 . as shown in fig7 two sheets 130 of perforated screening having apertures 132 illustrated in detail by fig8 are brought together to overlay intermediate side 94 . apertures 132 provide openings in screens 130 to allow the attachment of fastening devices 76 to each of extensions 58 . looking now to fig6 and 10 - 11 , screens 62 and 130 , exterior member 88 and interior member 90 together form a sealed frame that restricts entry of foreign matter or debris at their joint from passing into the radiator and surrounding engine area . with focus on fig6 and 11 , coupling of interior and exterior members 88 and 90 to sandwich screens 62 and 130 is shown . this construction provides a housing or frame assembly in the form of a shell 134 with screens 130 covering hollowed portions 116 extending between partitions 52 and screen 62 positioned at the front of each of the members 88 and 90 . to assemble enclosure 32 which is illustrated in an exploded fashion to form the shell - like structure 134 illustrated in fig3 screening panel 62 is seated within and adhesively mounted on sill or shoulder 100 to the wave shaped structure 102 of interior member 90 . next , the two screening sheets 130 are mounted to the side 94 . exterior member 88 is then pressed onto interior member 90 and thus , encases sheets 130 and screening panel 62 . members 88 and 90 are held securely together by use of an adhesive placed on an inside surface of partitions 52 so as to hold the members 88 and 90 together when overlay of members 88 and 90 takes place . additionally , seal 60 is attached to edges 128 and 136 of both interior and exterior members 90 , 88 respectively , as seen in both fig7 and 11 - 11 a . finally , clips 66 and 68 and handles 56 are attached to surface 44 of exterior member 88 through connection to extensions 58 . connection is accomplished upon installation of nut and bolt combination 76 . looking as well to fig3 - 5 , allowing for the easy removal and reinstallation of the enclosure 32 to the vehicle 20 without the use of tools or other hardware , clips 66 , 68 permit adjustment of the enclosure 32 with the catches 42 formed on radiator plate 38 . attachment may be accomplished by the operator maneuvering enclosure 32 into alignment with catches 42 through use of handles 56 . thereafter , each buckled portion 72 of the clips 66 presses against or is clasped against each of catches 42 , an instance of which is shown in fig1 , so as to secure the enclosure 32 to the plate 38 and thus , to the vehicle 20 . removal of the enclosure 32 from the vehicle 20 is achieved by the operator grasping loop 78 of handle 56 and pulling , thereby allowing the buckled portion 72 to slide free of each catch 42 to disengage enclosure 32 from the plate 38 . sealing of the enclosure 32 to the vehicle 20 is permitted by compression of seal 60 against the radiator plate 38 . attachment of the strip 60 to the shell 134 is seen best in fig6 a , 11 and 11 a . seal 60 includes a bumper 138 in the form of an elongated member to which is adjoined a u - shaped extension 140 , comprising rubber having a metal stiffening component therein ( unshown ) and having legs 142 , 144 , as shown in fig6 a . as again seen in fig6 a , edges of members 88 , 90 fit between legs 142 , 144 when enclosure 32 is fully assembled . sealing of enclosure 32 to plate 38 is further assisted when spring - assisted clips 66 , 68 latch onto catches 42 . as buckled portion 72 clasps onto catch 42 , bumper 138 is compressibly forced into abutment with plate 38 so as to ensure constant and uniform contact therewith , as seen in fig1 a . further and as shown in fig2 after enclosure 32 has been seatably positioned against plate 38 , the outward bow created by portions 118 in the partitions 52 reduce the space between the enclosure and the hood to decrease the area through which debris may enter . accordingly , the likelihood and amount of debris entering the radiator and surrounding engine area is greatly diminished . with the instant invention , there is provided an enclosure assembly 32 which effectively limits the amount and type of debris which can enter the engine compartment of a vehicle . additionally , provision of clips 66 , 68 on an interior of enclosure 32 permits an aesthetically pleasing and streamlined appearance often desired by operator &# 39 ; s of lawn and garden equipment such as riding mowers . while the present invention has been described in conjunction with a specific embodiment , it is understood that many alternatives , modifications , and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly , this invention is intended to embrace all such alternatives , modifications and variations which fall within the spirit and scope of the appended claims . | 1 |
fig1 illustrates a step up converter 1 in the center , which is configured so that it converts a variable input voltage into an increased output voltage adapted to a forward voltage of the leds 6 , wherein the current that is simultaneously put out is constant . the step up converter 1 includes the following eight contacts : a control input 11 ; two low voltage detection contacts 12 and 13 ; a reference voltage input 14 ; an activation contact 15 ; a ground contact 16 ; an input voltage input 17 ; and a voltage output 18 . the connections 17 and 18 are connected with one another through a diode ( not illustrated ), so that a voltage of the batteries 3 can reach through the step up converter 1 to the motion sensor 2 or to a switch ( not illustrated ) that is automatically operated by the motion sensor . as soon as the switch is closed due to a respective sensor signal , current flows to a switch - on - logic 4 . the switch - on - logic 4 can include a transistor that opens as soon as the switch is closed . opening the transistor facilitates a current flow through the switch - off - logic and voltage regulation 5 to the input 15 of the step up converter 1 , so that the step up converter 1 is activated . when the power supply to the transistor is interrupted by closing the switch , no current flows anymore and the step up converter 1 and a voltage divider are deactivated . then the circuit is in a passive mode . when the step up converter 1 is activated , it generates a higher voltage at the output 18 than the input voltage delivered by the batteries 3 at the connection 17 . the regulation of the output voltage at the connection 18 is provided through the switch - off - logic and voltage regulation 5 , wherein a voltage drop is measured at a resistor ( not illustrated ) which is connected with a ground , for example , through the transistor of the switch - on - logic 4 , wherein the voltage drop is provided to the regulation input 11 . this facilitates that the step up converter puts out a constant current and the voltage automatically adapts itself to the forward voltage of the leds . this facilitates that the leds 6 are always illuminated with the same light intensity irrespective of the input voltage at the input 17 . the schematic diagram of fig1 furthermore illustrates a low voltage leveling and feedback 7 which is connected between the connections 12 and 13 of the step up converter 1 . the low voltage regulation and feedback 7 have the effect that the leds 6 start to blink in a timely manner before the end of the battery service life as soon as the voltage of the battery 3 has undercut a threshold value . the threshold value is typically , approximately 1 . 6 v . the flashing function is implemented through a capacitor ( not illustrated ), which is included in the feedback circuit between the connections 13 and 12 . in the schematic diagram of fig1 additionally installed are an energy storage for charge pump 8 , a reference voltage filter 9 and a low pass filter 10 , which are provided for sifting or stabilizing the voltage generated by the step up converter . fig2 presents a light - and / or signal element configured like a dog collar . fig2 shows a cross - sectional view through the dog collar , which is formed from a first sub - ring 21 and a second sub - ring 27 which can be connected to the first sub - ring 21 by connectors 29 . the two sub - rings 21 and 27 are each made from tubing into the ends of which the connectors 24 for mutually connecting the sub - rings 21 and 27 can be inserted . in this regard , sub - ring 21 is formed especially as a transparent fabric tubing . in addition , the sub - rings 21 and 27 are connected by two rubber or silicone rubber tubes 25 or are sealed at the connecting points 29 . the two rubber or silicone tubes 25 have a smaller diameter than the sub - rings 21 and 27 of preferably of fabric tubing , such that sealing contact is made between the rubber or silicone tubes 25 and the sub - rings 21 and 27 at the connecting points 29 on account of the elastic extension of the rubber or silicone tubes 25 . the sub - ring 27 , which may also be called the battery tube or battery sub - ring , accommodates an arrangement of several batteries 26 or rechargeable batteries ( accumulators ) that provide the power supply . in the embodiment shown in fig2 , three batteries 26 in the sub - ring 27 are arranged one behind the other . sub - ring 21 , which may also be called the led sub - ring , accommodates the electronic arrangement of the illuminated dog collar of fig2 with several leds 23 , which are connected to each other and to the module 28 and the connectors 24 via flat cables or strip cables 22 . at the connectors 24 , the strip cable 22 is connected to battery contacts , which , in turn , make contact with the batteries 26 of the battery sub - ring 27 when sub - rings 21 and 27 are pushed together to form the dog collar . preferably , the battery contacts can be chosen from corresponding spring elements , whose elastic deformation affords adequate contact when the sub - rings are pushed together . the module 28 , which is only shown schematically in fig2 , comprises the components of the circuit being shown in fig1 . fig3 illustrates wherein the circuit includes a resistor 30 , which is connected with the step up converter , so that the output voltage adapted to the characteristic forward voltage of the at least one led is controllable through a voltage dropped at the resistor . fig4 illustrates wherein the step up converter includes regulation input 11 and the resistor is connected between the regulation input and a ground , in particular in series with the second contacts . fig5 illustrates wherein the resistor is connected through a transistor 31 to a ground . fig6 illustrates wherein the circuit includes a component with a defined forward voltage , in particular a semi - conductor component 32 with a defined threshold voltage of a semi - conductor junction . fig7 illustrates wherein the component is a diode 33 that is connected between the resistor and the step up converter . fig8 illustrates wherein the diode is connected between the resistor and regulation input 11 of the step up converter . fig9 illustrates wherein the diode includes one or plural schottky diodes or a double schottky diode 34 . fig1 illustrates wherein the circuit is configured so that it includes a voltage divider 35 and a transistor 36 that are each connected between the first contacts and the step up converter , so that only a quiescent current of the step up converter flows in standby mode or hibernation . the circuit according to the invention for controlling leds and the light - and / or signal elements thus in conclusion facilitate an optimum utilization of the energy of a battery or accumulator up to a minimum voltage of approximately 0 . 6 v , while conventional circuits only facilitate utilizing the battery voltage up to the level of the led forward voltage ( typically 2 . 5 v ). thus , the circuit furthermore provides uniform light intensity for the leds of light - and / or signal elements with identical configurations . other energy sources are also suitable which put out a relatively low voltage to assure a constant light intensity of the leds . eventually the circuit according to the invention and the light - and / or signal element facilitate preventing a leakage current during standby mode or hibernation . thus , the present invention provides numerous advantages over the prior art . | 7 |
fig1 a through 1c illustrate the structure and operation of a tip assembly 100 for a data storage device including the data storage medium according to the embodiments of the present invention . in fig1 a , probe tip assembly 100 includes a u - shaped cantilever 105 having flexible members 105 a and 105 b connected to a support structure 110 . flexing of members 105 a and 105 b provides for substantial pivotal motion of cantilever 105 about a pivot axis 115 . cantilever 105 includes an indenter tip 120 fixed to a heater 125 connected between flexing members 105 a and 105 b . flexing members 105 a and 105 b and heater 125 are electrically conductive and connected to wires ( not shown ) in support structure 110 . in one example , flexing members 105 a and 105 b and indenter tip 120 are formed of highly - doped silicon and have a low electrical resistance , and heater 125 is formed of lightly doped silicon having a high electrical resistance sufficient to heat indenter tip 120 , in one example , to between about 100 ° c . and about 500 ° c . when current is passed through heater 125 . the electrical resistance of heater 125 is a function of temperature . also illustrated in fig1 a is a storage medium ( or a recording medium ) 130 comprising a substrate 130 a , and a cured polyaryletherketone resin layer 130 b . in one example , substrate 130 a comprises silicon . in one example , curing is performed at a temperature between about 300 ° c . and about 400 ° c . cured polyaryletherketone resin layer 130 b may be formed by solution coating , spin coating , dip coating or meniscus coating polyaryletherketone copolymer and reactive diluent formulations and performing a curing operation on the resultant coating . in one example , cured polyaryletherketone resin layer 130 b has a thickness between about 10 nm and about 500 nm . the composition of cured polyaryletherketone resin layer 130 b is described infra . an optional penetration stop layer 130 c is shown between cured polyaryletherketone resin layer 130 b and substrate 130 a . penetration stop layer 130 c limits the depth of penetration of indenter tip 120 into cured polyaryletherketone resin layer 130 b . turning to the operation of tip assembly 100 , in fig1 a , an indentation 135 is formed in cured polyaryletherketone resin layer 130 b by heating indenter tip 120 to a writing temperature t w by passing a current through cantilever 105 and pressing indenter tip 120 into cured polyaryletherketone resin layer 130 b . heating indenter tip 120 allows the tip to penetrate the cured polyaryletherketone resin layer 130 b forming indentation 135 , which remains after the tip is removed . in a first example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being not greater than about 500 ° c ., to form indentation 135 . in a second example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being not greater than about 400 ° c ., to form indentation 135 . in a third example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being between about 200 ° c . and about 500 ° c ., to form indentation 135 . in a fourth example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip being between about 100 ° c . and about 400 ° c ., to form indentation 135 . as indentations 135 are formed , a ring 135 a of cured polyaryletherketone resin is formed around the indentation . indentation 135 represents a data bit value of “ 1 ”, a data bit value of “ 0 ” being represented by an absence of an indentation . indentations 135 are nano - scale indentations ( several to several hundred nanometers in width ). fig1 b and 1c illustrate reading the bit value . in fig1 b and 1c , tip assembly 100 is scanned across a portion of cured polyaryletherketone resin layer 130 b . when indenter tip 120 is over a region of cured polyaryletherketone resin layer 130 b not containing an indentation , heater 125 is a distance d 1 from the surface of the cured polyaryletherketone resin layer ( see fig1 b ). when indenter tip 120 is over a region of cured polyaryletherketone resin layer 130 b containing an indentation , heater 125 is a distance d 2 from the surface of the cured polyaryletherketone resin layer ( see fig1 c ) because the tip “ falls ” into the indentation . d 1 is greater than d 2 . if heater 125 is at a temperature t r ( read temperature ), which is lower than t w ( write temperature ), there is more heat loss to substrate 130 a when indenter tip 120 is in an indentation than when the tip is not . this can be measured as a change in resistance of the heater at constant current , thus “ reading ” the data bit value . it is advantageous to use a separate heater for reading , which is mechanically coupled to the tip but thermally isolated from the tip . a typical embodiment is disclosed in patent application ep 05405018 . 2 , 13 jan . 2005 . “ erasing ” ( not shown ) is accomplished by positioning indenter tip 120 in close proximity to indentation 135 , heating the tip to a temperature t e ( erase temperature ), and applying a loading force similar to writing , which causes the previously written indent to relax to a flat state whereas a new indent is written slightly displaced with respect to the erased indent . the cycle is repeated as needed for erasing a stream of bits whereby an indent always remains at the end of the erase track . t e is typically greater than t w . the erase pitch is typically on the order of the rim radius . in a first example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is not greater than about 500 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . in a second example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is not greater than about 400 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . in a third example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is between about 200 ° c . and about 400 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . in a fourth example , the cured polyaryletherketone resin layer 130 b is heated by heated indenter tip 120 , the temperature of the indenter tip is between about 200 ° c . and about 500 ° c ., and the erase pitch is 10 nm to eliminate indentation 135 . fig2 is an isometric view of a local probe storage array 140 including the data storage medium according to the embodiments of the present invention . in fig2 , local probe storage array 140 includes substrate 145 having a cured polyaryletherketone resin layer 150 ( similar to cured polyaryletherketone resin layer 130 b of fig1 a , 1 b and 1 c ), which acts as the data - recording layer . an optional tip penetration stop layer may be formed between cured polyaryletherketone resin layer 150 and substrate 145 . in one example , substrate 145 comprises silicon . cured polyaryletherketone resin layer 150 may be formed by solution coating , spin coating , dip coating or meniscus coating uncured polyaryletherketone resin formulations and performing a curing operation on the resultant coating . in one example , cured polyaryletherketone resin layer 150 has a thickness between about 10 nm and about 500 nm and a root mean square surface roughness across a writeable region of cured polyaryletherketone resin layer 150 of less than about 1 . 0 nm across the cured polyaryletherketone resin layer . the composition of cured polyaryletherketone resin layer 150 is described infra . positioned over cured polyaryletherketone resin layer 150 is a probe assembly 155 including an array of probe tip assemblies 100 ( described supra ). probe assembly 155 may be moved in the x , y and z directions relative to substrate 145 and cured polyaryletherketone resin layer 150 by any number of devices as is known in the art . switching arrays 160 a and 160 b are connected to respective rows ( x - direction ) and columns ( y - direction ) of probe tip assemblies 100 in order to allow addressing of individual probe tip assemblies . switching arrays 160 a and 160 b are connected to a controller 165 which includes a write control circuit for independently writing data bits with each probe tip assembly 100 , a read control circuit for independently reading data bits with each probe tip assembly 100 , an erase control circuit for independently erasing data bits with each probe tip assembly 100 , a heat control circuit for independently controlling each heater of each of the probe tip assembles 100 , and x , y and z control circuits for controlling the x , y and z movement of probe assembly 155 . the z control circuit controls a contact mechanism ( not shown ) for contacting the cured polyaryletherketone resin layer 150 with the tips of the array of probe tip assemblies 100 . during a write operation , probe assembly 155 is brought into proximity to cured polyaryletherketone resin layer 150 and probe tip assemblies 100 are scanned relative to the cured polyaryletherketone resin layer . local indentations 135 are formed as described supra . each of the probe tip assemblies 100 writes only in a corresponding region 170 of cured polyaryletherketone resin layer 150 . this reduces the amount of travel and thus time required for writing data . during a read operation , probe assembly 155 is brought into proximity to cured polyaryletherketone resin layer 150 and probe tip assemblies 100 are scanned relative to the cured polyaryletherketone resin layer . local indentations 135 are detected as described supra . each of the probe tip assemblies 100 reads only in a corresponding region 170 of cured polyaryletherketone resin layer 150 . this reduces the amount of travel and thus the time required for reading data . during an erase operation , probe assembly 155 is brought into proximity to cured polyaryletherketone resin layer 150 , and probe tip assemblies 100 are scanned relative to the cured polyaryletherketone resin layer . local indentations 135 are erased as described supra . each of the probe tip assemblies 100 erases only in a corresponding region 170 of cured polyaryletherketone resin layer 150 . this reduces the amount of travel and thus time required for erasing data . additional details relating to data storage devices described supra may be found in the articles “ the millipede — more than one thousand tips for future afm data storage ,” p . vettiger et al ., ibm journal of research and development . vol . 44 no . 3 , may 2000 and “ the millipede — nanotechnology entering data storage ,” p . vettiger et al ., ieee transaction on nanotechnology , vol . 1 , no , 1 , march 2002 . see also united states patent publication 2005 / 0047307 , published mar . 3 , 2005 to frommer et al . and united states patent publication 2005 / 0050258 , published mar . 3 , 2005 to frommer et al ., both of which are hereby included by reference in their entireties . turning to the composition of cured polyaryletherketone resin layer 130 b of fig1 a through 1c . it should be understood that for the purposes of the present invention curing a polymer implies cross - linking the polymer to form a cross - linked polymer or resin . the polyaryletherketone resin medium or imaging layer of the embodiments of the present invention advantageously meets certain criteria . these criteria include high thermal stability to withstand millions of write and erase events , low wear properties ( little or no pickup of material by tips ), low abrasion ( tips do not easily wear out ), low viscosity for writing , glassy character with no secondary relaxations for long data bit lifetime , and shape memory for erasability . cured polyaryletherketone resins according to embodiments of the present invention have high temperature stability while maintaining a low glass transition temperature ( tg ). in a first example , cured polyaryletherketone resins according to embodiments of the present invention have a tg of less than about 180 ° c . in a second example , cured polyaryletherketone resins according to embodiments of the present invention have a tg of between about 100 ° c . and about 180 ° c . the glass transition temperature should be adjusted for good write performance . to optimize the efficiency of the write process there should be a sharp transition from the glassy state to the rubbery state . a sharp transition allows the cured resin to flow easily when a hot tip is brought into contact and quickly return to the glassy state once the hot tip is removed . however , too high a t g leads to high write currents and damage to the probe tip assemblies described supra . a formulation of polyaryletherketone copolymer according to embodiments of the present invention comprises one or more polyaryletherketone copolymers , each polyaryletherketone copolymer of the one or more polyaryletherketone copolymers having the structure : ( i ) m repeat units represented by the structure — r 1 — o — r 2 — o — interspersed with n repeat units represented by the structure — r 1 — o — r 3 — o —, and terminated by a first terminal group represented by the structure r 4 — o — and a second terminal group represented by the structure — r 1 — o — r 4 , or ( ii ) m repeat units represented by the structure — r 1 — o — r 2 — o — interspersed with n repeat units represented by the structure — r 1 — o — r 5 — o —, and terminated by a first terminal group represented by the structure r 4 — o — and a second terminal group represented by the structure — r 1 — o — r 4 , or ( iii ) m repeat units represented by the structure — r 1 — o — r 2 — o — interspersed with n repeat units represented by the structure — r 1 — o — r 3 — o —, terminated by a first terminal group represented by the structure r 6 — o — and a second terminal group represented by the structure — r 1 — o — r 6 , or ( iv ) m repeat units represented by the structure — r 1 — o — r 2 — o — interspersed with n repeat units represented by the structure — r 1 — o — r 5 — o —, a first terminal group represented by the structure r 6 — o — and a second terminal group represented by the structure — r 1 — o — r 6 ; wherein o = oxygen , and occurs as a link between all r groups ; wherein r 1 is selected from the group consisting of : wherein r 2 is selected from the group consisting of : wherein r 3 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein r 4 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein r 5 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein r 6 is selected from the group consisting of mono ( arylacetylenes ), mono ( phenylethynyls ), wherein m is an integer of 2 or more , n is an integer of 1 or more , m is greater than n and m + n is from about 5 to about 50 . the molar ratio of a first repeat unit ( containing r 1 and r 2 groups ) to a second repeat unit ( containing either r 1 and r 5 groups or r 3 and r 2 groups ) in structures ( i ), ( ii ), ( iii ) and ( iv ) is kept greater than 1 , therefore the ratio m / n is greater than 1 . the acetylene moieties in the r 3 , r 4 , r 5 , and r 6 groups , whichever are present , react during thermal curing with each other to cross - link the polyaryletherketone copolymers into a polyaryletherketone resin by cyclo - addition . in a first example , polyaryletherketone copolymers according to embodiments of the present invention advantageously have a molecular weight between about 3 , 000 daltons and about 10 , 000 daltons . in a second example , polyaryletherketone copolymers according to embodiments of the present invention advantageously have a molecular weight between about 4 , 000 daltons and about 5 , 000 daltons . all materials were purchased from aldrich and used without further purification unless otherwise noted . 3 - iodophenol ( 5 . 00 gram , 22 . 7 mmol ), bis ( triphenylphospine ) palladium ( ii ) dichloride ( pdcl 2 ( pph 3 ) 2 ) ( 160 mg ), triphenylphospine ( pph 3 ) ( 420 mg ), and cui ( 220 mg ) were suspended in triethylamine ( net 3 ) ( 150 ml ) under an n 2 atmosphere . phenylacetylene ( 3 . 1 ml , 2 . 9 gram , 28 . 4 mmol , 1 . 25 eq ) was added by syringe . the reaction mixture was then stirred and heated to 70 ° c . using an oil bath for 38 hours . excess net3 was removed under reduced pressure . the remaining solids were extracted with 3 × 50 ml diethyl ether , which was then filtered and evaporated . the crude product was purified by column chromatography ( silica , 3 : 1 hexanes - ethyl acetate ) to give 4 . 1 gram of an orange solid . further purification was accomplished by sublimation ( 100 ° c ., 28 mtorr ) to give 3 -( phenylethynyl ) phenol as a white solid ( 3 . 3 g , 75 % yield ). to a suspension of 3 - iodophenol ( 3 . 73 gram , 17 mmol ), pdcl 2 ( pph 3 ) 2 ( 120 mg ), cui ( 161 mg ), and pph 3 ( 333 mg ) in net 3 ( 100 ml ) under n 2 was added a solution of 3 - hydroxyphenylacetylene ( 2 . 00 gram , 17 mmol ) in net 3 ( 10 ml ). the mixture was stirred and heated to 70 ° c . using an oil bath for 18 h . excess net 3 was removed under reduced pressure , and the remaining solids were extracted with 4 × 50 ml diethyl ether which was then filtered and evaporated . the crude product was purified by suspending in 80 ml ch 2 cl 2 , stirring for 1 hour , and filtering to give the final product as a yellow powder ( 2 . 96 g , 83 % yield ). in a multi - necked flask equipped with a mechanical stiffing apparatus and a dean - stark trap , 4 , 4 ′- difluorobenzophenone ( 1 . 4187 gram , 6 . 502 mmol ), resorcinol ( 0 . 5326 g , 4 . 838 mmol ), 3 , 3 ′- dihydroxydiphenylacetylene ( 0 . 2540 g , 1 . 209 mmol ), 3 - hydroxydiphenylacetylene ( 0 . 1753 g , 0 . 9037 mmol ), and potassium carbonate ( 3 g , 22 mmol ) were suspended in a mixture of dimethylformamide ( dmf ) ( 10 ml ) and toluene ( 20 ml ). the reaction mixture was vigorously stirred and heated to 130 ° c . for 16 hours under a slow flow of dry nitrogen , and toluene was removed periodically via the dean - stark trap . at the end of the 16 h period , the temperature was increased to 150 ° c . for another 8 hours . the reaction was then cooled and the polymer was isolated by multiple precipitations using thf and methanol . molecular weights were adjusted by using different proportions of ( r 1 + r 2 ) to ( r 3 ) and several different molecular weight polymers were prepared . thus , the embodiments of the present invention provide for compositions of matter for the storage media that operate in the nanometer regime . the description of the embodiments of the present invention is given above for the understanding of the present invention . it will be understood that the invention is not limited to the particular embodiments described herein , but is capable of various modifications , rearrangements and substitutions as will now become apparent to those skilled in the art without departing from the scope of the invention . therefore , it is intended that the following claims cover all such modifications and changes as fall within the true spirit and scope of the invention . | 6 |
referring now to the drawing , a geophone 10 is electrically coupled via conductor 11 to an amplifier - rectifier 12 which has its output electrically coupled via electrical line 13 to an adaptive threshold analog - digital converter circuit 14 after the transducer element of the geophone 10 is placed within or upon the earth . a geophone , such as model l14b , manufactured by mark products , houston , tex ., is capable of receiving seismic vibrations through the earth from a short range produced by a physical disturbance such as a person walking . the geophone 10 converts mechanical displacements caused by a seismic vibration into proportional electrical paths . these electrical signals are called footstep signatures when the frequency , amplitude , and wave shape of the electrical signal are related to a specific seismic disturbance , such as a person walking . the amplifier - rectifier 12 amplifies and full wave rectifies the ac signals from microvolts to millivolts within a limited bandpass frequency . the purpose of the adaptive threshold analog - digital converter 14 is to set the threshold value of a triggering circuit therein as a function of the amplitude of an ambient seismic background noise level and an incoming signal generated by an intruder . a minimum noise level is rejected by the fixed threshold in the analog - digital converter 14 . the minimum threshold is set when an intrusion footstep signature first occurs . the adaptive threshold circuit is designed so that as the intruder approaches toward the geophone 10 , the footstep seismic signature signal itself causes the threshold value of the trigger circuit to increase . the increasing of the threshold detector level by the footstep signature causes the duration of the footstep pulse width to be normalized with respect to distances . when the intruder is far from the sensor of geophone 10 , the full width of the seismic footstep pulse is detected . as the intruder gets closer to the sensor of geophone 10 , only a portion of the actual footstep width is detected because the level of the threshold has been increased by the intruder &# 39 ; s signature itself . noise levels above the minimum threshold are integrated ( adapted ) to a new noise background in which the system is operating . pertinent signatures above the adapted threshold response value will generate an output signal from the analog to digital converter 14 which is digital . the digital output of the adaptive threshold analog to digital converter 14 is electrically coupled via electrical conductor 16 to two parallel logic blocks . in the first instance the output signal of the adaptive threshold 14 is rounted to a personnel classification logic circuit which is enclosed within dash line box 18 . the personnel classification logic circuit recognizes individual footsteps by examining their time of duration between disturbances . these individual footsteps are counted until a predetermined number is achieved . when this predetermined number is achieved the seismic signature is classified by the circuit as belonging to an individual . the personnel classification logic circuit enclosed by dash line 18 comprises a sensor processor circuit 20 , a personnel decision logic circuit 22 , a footstep rate logic circuit 24 , and a select zero crossing requirement for output circuit 26 . the sensor processor circuit 20 is electrically connected to the output of the adaptive threshold analog - digital converter 14 at junction point 28 via electrical conductor 30 . the sensor processor 20 circuitry functions as a pulse stretcher , once the input to the analog digital converter 14 is triggered the output from the sensor processor 20 stays high for 40 milliseconds . in the event that another input occurs to the analog digital converter 14 before the sensor processor 20 has timed out ( 40 milliseconds ), the sensor processor 20 timing is started anew and is available to perform its function . however , if a second input pulse does not occur to the analog digital converter 14 within 40 milliseconds the sensor processor 20 will go into its low output state . the output is one digital output pulse ( representing one footstep ) per footstep envelop . personnel decision classifier circuit 22 has its input electrically connected to the output of sensor processor 20 at junction point 32 via conductor 34 . the personnel decision circuit 22 consists of a logic timer and counter circuits . the personnel decision logic circuit 22 performs the function of classifying individual pulses as footsteps by monitoring the duration of the pulse disturbance and the time interval between pulse disturbances . when a disturbance occurs , it is sensed by geophone 10 , amplified by amplifier rectifier 12 and fed to the adaptive threshold analog digital converter 14 via conductor 13 as previously aforedescribed . if the amplitude of the output pulse of the amplifier rectifier 12 is sufficiently large , the adaptive threshold level of the adaptive threshold analog digital converter 14 is exceeded causing an output pulse to be generated via electrical conductor 16 and 30 sufficient to trigger sensor processor 20 . the triggering of sensor processor 20 is counted as a footstep in the counter circuitry of the personnel decision section 22 . the input of the personnel decision 22 cannot be triggered again until the sensor processor 20 has timed out as aforedescribed . subsequent triggerings of the sensor processor 20 will be counted by the counter circuitry of the personnel decision 22 as footsteps . in addition to counting the triggering input pulses to the personnel decision circuit 22 as footsteps additional digital logic circuitry contained therein examines the total time duration that the signal processor stays high as well as the time between successive triggerings of the sensor processor 20 . if the sensor processor 20 stays up longer than 400 milliseconds , or the time between successive triggers is longer than 1 . 5 seconds , an &# 34 ; error &# 34 ; is counted . if five footsteps are counted before two errors occur , the train of pulses is classified by the logic circuitry of the personnel decision 22 as being caused by personnel movement . the circuit counts the number of digital input pulses received from sensor processor 20 and the time between input pulses . a correct footstep is recognized by applying a maximum and minimum time duration requirement to the output of the sensor processor 20 . if the time between input pulses is greater than 400 msec and less than 1 . 5 seconds , a valid footstep ( input pulse ) is recognize . if the output of the sensor processor 20 stays high for greater than 400 milliseconds , the source of the disturbance is considered to be too long or intense to be caused by personnel movement . the disturbance is then classed as an &# 34 ; error &# 34 ; rather than as a footstep . if the time between successive triggering of the sensor processor 20 is longer than 1 . 5 seconds , the nature of the disturbance is considered random and an &# 34 ; error &# 34 ; is also counted . footsteps are recognized when successive disturbances are less than 400 milliseconds and occur at a rate more often than every 1 . 5 seconds . valid footsteps are counted . when 5 footsteps are counted , an output latch is set and an output signal provided to logic a before logic b 36 by conductor 38 . it has been experimentally determined that 5 counted footsteps meeting the requirements of the sensor processor 20 will establish the signal signature as that of an individual . personnel approaching the sensor from any angle are recognized by the sensor processor 20 by a buildup of the signature duration . if the first footstep is of three or more &# 34 ; zero crossings &# 34 ;, where a &# 34 ; zero crossing &# 34 ; is defined as the firing of a pulse of fixed duration from the sensor processor 20 during the footstep disturbance , the signal is considered to be the signature of something other than personnel approaching . when the personnel decision circuit 22 establishes that the footsteps are that of an individual a logic a output signal is generated and delivered to logic a before logic b circuit 36 via conductor 38 . also after footstep recognition by the sensor processor 20 , the occurrence of a footstep causes a signal to be urouted to the input of footstep rate determining logic 24 via electrical conductor 40 . the footstep rate logic circuit 24 comprises a 3 . 5 second timer , a counte and decoding logic for counts of three or less , four , five and eight . the 3 . 5 second timer is enabled in the footstep rate logic circuit 24 when the first footstep signal is recognized by the sensor processor 20 . the timer of footstep rate logic 24 continues to record for a fixed period . the number of footsteps that occur during the 3 . 5 second timer interval determine the footstep rate . the footstep signals of the sensor processor 20 are related by the footstep rate logic circuit 24 to a fixed period as a means of measuring the velocity of the intruder . the rate of occurrence of footsteps is then used to select the zero crossing criteria for an in range indication . the output of the decoded count from the footstep rate logic 24 is sent to the select zero crossing requirement logic via conductor 42 . the relative energy requirement for an &# 34 ; in range &# 34 ; indication is selected as function of the footstep rate by the select zero crossing requirement for output circuit 26 . circuit element 26 comprises a set of logic gates that are enabled depending upon the number of footsteps that occur during this 3 . 5 second interval , a &# 34 ; 3 &# 34 ; output from the footstep counter therein is used to enable a decision circuit that requires three or more zero crossings to occur within a footstep for an in - range indication . if &# 34 ; 4 ? steps occur , then 4 zero crossings are required etc . three zero crossings are required for three footsteps , four zero crossings for four footsteps , five zero crossings for five footsteps and six zero crossings for eight footsteps . the required number 3 , 4 , 5 and 6 as specified above of zero crossings is provided to the footstep rate zero crossing comparator 52 via conductor 44 . footstep rate zero crossing comparator 52 function comprises a digital logic decoder function that is driven by the output of circuit element 26 . comparator 52 counts the number of zero crossings that occurs within a footstep . if the number is equal to or greater than that required by element 26 , the comparator 52 is successfully triggered . after the relationship of footstep duration to footstep rate , which is expected at a given range from the geophone 10 , is set , the select - zero crossing requirement circuit 26 will wait to see if the intruder passes within range and meets the duration level required and if these conditions are met it then will provide an electrical output signal via electrical conductor 44 to the input of a footstep rate zero crossing comparator 52 . a second route which the output signal of the adaptive threshold 14 detected signal takes is via conductor 46 to the energy detector logic circuity enclosed within dash line box 48 . here the relative energy of the seismic footstep signature is measured in terms of the number of &# 34 ; zero crossings &# 34 ; contained within the individual footstep disturbance . a zero crossing detector circuit 60 has its input electrically coupled to the output of the adaptive threshold analog digital converter 14 by conductor 46 . the zero crossing detector generates a one - shot digital signal of a fixed duration for each full wave rectified signal received from the output of the amplifier - rectifier 12 which exceeds the threshold in the analog to digital converter 14 . the number of times that the one - shot zero crossing detector circuit is fired gives the number of zero crossings associated with an individual footstep disturbance . the aforementioned footstep rate zero crossing comparator 52 is electrically connected to the output of the zero crossing detector 50 via conductor 54 . the footstep rate zero crossing comparator 52 consists of a counter that counts the number of digital pulses ( zero crossings ) from the zero crossing detector 50 . when the count exceeds the level set by the select zero crossing requirement for output circuit 26 , and no errors or resets have occurred , a decision is made by comparator 52 by generating an output signal . a target is defined to be within a specified sensing range when the number of &# 34 ; zero crossings &# 34 ; is greater than the zero crossing requirement selected as a function of the footstep rate . the output of footstep rate zero crossing comparator 52 is electrically coupled to decision logic footstep count greater than two circuit 56 via electrical conductor 58 . in addition , the output of sensor processor 20 is electrically connected to decision logic footstep count 56 via conductor 60 . decision logic footstep count greater than two 56 is a two stage counter that counts error signals . an error signal consisting of a digital pulse provided by sensor processor 20 via conductor 60 if the time between footsteps is grater than 1 . 5 seconds or the duration of the footstep is greater than 400 milliseconds . if two error signals are counted before the output of the footstep rate zero crossing comparator occurs , the system is reset by a reset signal sent via conductor 62 . decision logic count greater than two circuit 56 makes a decision which establishes whether there are erroneous electrical signatures for the footsteps , such as steps too close together or of too long duration . decision logic circuit 56 permits two errors during a five step decision making process before the system is reset by a reset signal sent via conductor 62 . decision logic circuit 56 also measures the last two footsteps time period to establish if the pedestrian rate is based on a running person and then only detecting every other step . the output of decision logic 56 is electrically coupled to logic a before logic b 36 via conductor 64 . logic a before lobic b comprises a 4013 dual flip flop such as manufactured by rca of sommerville , n . j ., that provides an output signal when a signal is received from personnel decision logic 22 ( logic a ) and decision logic footstep count greater than two 56 ( logic b ) and logic a condition occurs before logic b . logic a or logic a before logic b 36 establishes that the footstep signature is personnel before logic b establishes that the personnel are within range . the satisfaction of both logic a and b indicates that personnel are within the lethal range of the explosive device , not shown , and an output signal is sent via electrical conductor 66 to the output - personnel &# 34 ; in &# 34 ; range circuit 68 which will than actuate the explosive . if a personnel classification has not already been made , in &# 34 ; in range &# 34 ; indication is ignored until a personnel classification is made . while there has been described and illustrated specific embodiments of the invention , it will be obvious that various changes , modifications and additions can be made herein without departing from the field of the invention which should be limited only by the scope of the appended claims . | 6 |
as can seen in fig1 - 4 , the present invention includes a plate 10 having a first ball supporting device connected thereto . the home plate 10 is provided with a plurality of openings 24 formed therein so that the ball supporting devices can be attached to various positions about the plate . the first ball supporting device includes a first vertical member 12 . the first vertical member 12 extends upward therefrom and mates with a radial member 14 . the radial member 14 mates with a second vertical member 16 . a third vertical member 18 , which supports a baseball 50 on one end thereof mates with the second vertical member 16 . a support 26 , which can be formed to fit about the circumference of the radial member 14 , is provided to prevent excessive sagging of the radial member 14 due to the weight of vertical members 16 and 18 . a second ball supporting device can be connected to the home plate 10 at the same time as the first ball supporting device . the second support device is shown comprised of vertical members 20 , 21 , 22 , and 23 which are similar in construction to the above discussed vertical and radial members . by making the second ball support device with four interconnecting members , a wide range of height adjustment can be provided to simulate multiple pitches at various points in the strike zone . an advantage to using two ball supporting devices together will become clear from the discussion below . the vertical and radial members described above are preferably formed of a heavy duty rubber material , which can be easily molded using a simple molding process . other suitable , stiff yet pliable materials could also be used with the present invention . alternatively , it would be possible to make several of the components out of different materials , such as metal . that is , while it is necessary to have the vertical member 18 ( or possibly vertical member 16 depending the particular use to which the present invention is put ) which supports the baseball be made of a flexible material so that when a batter swings the bat and hits the vertical member 18 , it does not break , the vertical portion 12 and the radial portion 14 could conceivably be made of a less resilient material provided that it is rugged . for example , a heavy duty plastic could be appropriate . support 26 can also be made of metal , rubber or plastic and can also be formed as a single extension extending down from the radial member 14 as opposed to the bi - pod structure shown in the drawings . members 12 , 14 , 16 , and 18 can be formed of any appropriate size . preferably , vertical member 12 extends 10 &# 34 ; above the plate , 18 &# 34 ; along the horizontal plane of the plate , and is 2 . 5 &# 34 ; in diameter . radial member 14 has a length of 18 &# 34 ; along the horizontal and vertical portions and a diameter of approximately 2 . 25 &# 34 ;. vertical member 16 has a length of 20 &# 34 ; and a diameter of approximately 2 &# 34 ;. vertical member 18 has a length of 20 &# 34 ; and a diameter of 1 . 75 &# 34 ;. vertical members 20 , 21 , 22 , and 23 which make up a second ball support for use with the present invention , are preferably sized at 10 &# 34 ; by 2 . 5 &# 34 ;, 20 &# 34 ; by 2 . 25 &# 34 ;, 20 &# 34 ; by 2 &# 34 ;, and 20 &# 34 ; by 1 . 75 &# 34 ;, respectively . in the preferred embodiment , vertical members 12 , 16 , and 18 and radial member 14 fit together utilizing a friction fit which is shown in more detail in fig4 . in particular , the fit between the various members may be a &# 34 ; telescoping &# 34 ; fit in which the individual members slide together in a coaxial fashion with friction holding the individual members at desired positions . to assist in making a proper and secure friction fit , the outer coaxial member can be provided with grooves or ridges 28 formed therein . the plurality of grooves or ridges 28 surrounding the inserted member serve to provide sufficient friction to hold the inserted member in the desired position yet allow the relative positions of the connected members to be adjusted by twisting or otherwise pulling the inserted member with sufficient force to overcome the friction force created by the grooves or ridges 28 . referring in particular to fig3 the interconnection of the vertical member 12 and the plate 10 is illustrated . a bolt 30 having a head 32 and a threaded portion 34 is inserted through an opening 24 in the plate 10 and interconnects with a threaded coupling 36 disposed in the vertical member 12 . threaded coupling 36 is preferably made of metal to provide a secure connection . in addition , coupling 36 can extend up into the vertical member 12 any desired length to assist in providing structural rigidity to the ball support device . as shown , the coupling is disposed in the vertical member 12 which can comprise a heavy duty rubber which is molded about the coupling 36 . alternatively , the vertical member 12 can be made entirely of metal to provide additional structural integrity . the bolt is tightened and the vertical member 12 is held securely to the plate . the plate 10 can include molded detents on the underside of the plate 10 which are formed to fit around the head portion 32 of bolt 30 . thus , the bolt can be held in place while the vertical member 12 including the coupling 36 is twisted about the threaded portion 34 to secure the member 12 to the plate 10 . due to the threaded interconnection of the coupling 36 and the threaded portion 34 , the ball supporting member can be swiveled about the plate 10 to properly position the ball supporting device to simulate a desired pitch . in addition , the telescoping connections between members 12 , 14 , 16 and 18 allow an almost limitless variation of the ball position . the coupling 36 and the bolt 30 are preferably made of metal . alternative methods for connecting the ball supporting devices to the plate 10 are intended to fall within the scope of this invention . in particular , it is clear that the bolt 30 could be permanently attached to the vertical member 12 and extend through the top of plate 10 and protrude from the bottom thereof and be secured by way of a nut . alternatively , the vertical member 12 could be provided with a keyed member protruding therefrom which is inserted into a pre - formed &# 34 ; key - hole &# 34 ; opening in the plate 10 . after insertion , the vertical member 12 could be turned to securely hold the vertical member 12 to the plate 10 . referring to fig5 and 6 , the bat 40 is provided with distinct hit indicators 42 and 44 . the ball 50 is provided with distinct strike indicators 52 and 54 . in practice , hit indicator 42 corresponds to strike indicator 52 and hit indicator 44 corresponds to strike indicator 54 . that will become more clear from the discussion below as to the use of the present invention . the size of the hit indicators 42 , 44 are determined by measuring from the end of the bat 48 farthest from the handle 46 approximately 10 inches down the length of the shaft of the bat . at the measured distance , a line is drawn about the circumference of the bat . a second measurement of approximately three inches is taken from the end 48 toward the handle 46 . a second line is drawn about the circumference of the bat . the two lines define a cylindrically shaped portion 49 of the bat which is approximately seven inches long . depending on the size of the bat , this portion may vary in size ( larger or smaller ). the cylindrical portion 49 is then divided in half along the longitudinal axis thereof and only one half of the cylinder is utilized ( either side ). if a wooden bat is utilized , the division is taken , preferably , along a longitudinal axis which , if extended , would split the manufacturer &# 39 ; s label 41 in half . the half cylinder portion is again divided in half along the longitudinal axis of the bat to produce the areas defining the hit indicators 42 , 44 . these areas are then marked to distinguish them from the rest of the bat . e . g ., one section 42 could be painted blue , while the other 44 could be painted red . the process of providing strike indicators 52 , 54 for the ball 50 is somewhat less complicated . simply put , the ball is divided into two equal halves 52 , 54 , which are then marked to correspond to the hit indicators 42 , 44 . although corresponding markings are not absolutely necessary , it is helpful to avoid confusion . thus , if hit indicator 42 is painted red , strike indicator 52 would be painted red as well . similarly , if hit indicator 44 is painted blue , strike indicator 54 would be painted blue . the operation of the present invention will now be described . referring to fig1 which is set up for left - handed batter , vertical member 23 supports a ball 50 to simulate an outside pitch . the ball supporting device including members 12 , 14 , 16 and 18 would simulate an inside pitch . prior to swinging , using the bat shown in fig5 the batter would stand at the plate 10 ( in a proper batting stance relative to plate 10 ) and hold the bat level over the plate such that the label 41 thereon is facing straight up ( in the opposite direction from the plate ) and the hit indicators 42 , 44 are facing towards the forward portion of the plate 10 . further , balls 50 are positioned on the members 23 , 18 such that the strike indicator 54 corresponding to the top hit indicator 44 ( when bat 40 is held out over the plate ) faces away from the batter and the centerline 53 of ball 50 is substantially parallel to the lateral side edge 11 of the plate 10 . at this point , the batter swings the bat 40 so as to make contact with ball 50 supported by member 18 and ball 50 supported by member 18 . however , when bat 40 contacts ball 50 supported by the member 18 to simulate an outside pitch , the batter needs to utilize that portion of the bat 40 identified as hit indicator 42 . furthermore , hit indicator 42 must meet the ball 50 along the strike portion 52 . in this manner , the outside pitch will be hit to the opposite field , in this case to the left field . as the batter continues swinging the bat 40 , proper hand rotation will cause that portion of the bat 40 identified as hit indicator 44 to contact ball 50 supported by vertical member 18 . hit indicator 44 should make contact with strike indicator 54 on the ball 50 . in this manner , the ball 50 will be pulled to the right field which is proper for an inside pitch . as evident from a review of fig1 ball 50 supported by vertical member 18 , which simulates an outside pitch , is properly struck when the ball 50 has passed the majority of the plate 10 . conversely , ball 50 supported by vertical member 18 and simulating an inside pitch , must be struck before the ball reaches the plate 10 in order to be hit properly . by controlling the swing of the bat 40 to ensure that hit indicator 42 contacts the ball 50 on member 18 on the strike indicator 52 and hit indicator 44 contacts ball 50 on member 18 on the strike indicator 54 , the batter will ensure proper swing technique and wrist release . by repeatedly practicing this motion , the batter will develop proper batting technique . the above discussion illustrates that a proper batting technique will result in the same swing to make contact with an outside pitch as with an inside pitch . given the speed at which the ball 50 is often travelling in actual game situations , this technique teaches the batter that he or she must anticipate an outside pitch in order to correctly hit an inside pitch . since the present invention is able to simulate both inside and outside pitches at the same time , a batter can train to hit the outside ball to the opposite field , and following through , pull the inside pitch down the line to the proper field ( for the left - handed batter set up of fig1 this would be the right field ). finally , the present invention provides instant feedback as to whether a batter is making proper contact with ball 50 . a coach can monitor the performance of a player and determine whether the player is making proper contact between the bat 40 and the ball 50 depending upon which portion of the bat 40 contacts the ball 50 . using the above - described method and apparatus for teaching batting technique , a batter will develop the proper fundamental skills on how to properly hit a baseball . further , an individual will not only learn proper batting technique , but also proper placement of his or her body relative to the plate 10 shown in fig1 . there is no need to use multiple batting tees to teach proper position relative to the plate as with the prior art or to move the ball supporting device and plate to properly position a ball since the present invention accurately positions the ball depending upon the location of the pitch being simulated . accordingly , the present invention overcomes the problems associated with prior art batting tees and teaches individuals of all ages proper batting techniques . | 0 |
combining amines with monochloroacetic acid ( mca ) or sodium vinyl sulfonate ( svs ) results in products are zwitterionic buffers that can buffer in both acidic and basic ph conditions . a limited number amines are currently used for this purpose , such as , tromethamine and ammonia . the reaction of amines , alcohols , and aminoalcohols with acrylonitrile ( via the michaels addition ), followed by reduction results in amines and polyamines that have a broad buffering range . the further derivatization of the amines and polyamines with mca and svs yields a further crop of amine buffers with desirable properties . one skilled in the art will recognize that mca and sodium monochloroacetic acid ( smca ) can be used interchangeably . the reaction of tromethamine as described above yields the products in fig1 . in step 1 in fig1 where the acrylonitrile is added to the amine a branched structure wherein the addition of acrylonitrile results in a tertiary amine is shown . in reality , particularly when n is greater than 1 , a mixture of products is obtained that is both tertiary and secondary . for the invention disclosed herein , n may equal any integer greater than zero , including 1 . controlling the reaction temperature , pressure and agitation will allow the mixture to be predominately secondary ( such as when m = n ) or tertiary amine , m can be any integer less than or equal n . furthermore , this selection can take place in adding acrylonitrile to the amine that results , allowing a progressively more branched product . it is within the scope of the invention disclosed herein to include these additional types of products and their subsequent derivatives described herein . with regard to the reaction of the polyamine resulting from the second step in fig1 . fig1 shows the addition of only one mole of svs or mca , it is known in the art , that a second mole may be added to obtain a product with a second zwitterionic group . furthermore , in the case where the product has repeated additions of acrylonitrile and reduction to the amines , the branched products may have many more zwitterionic groups . also , it is to be noted that , while the sulfonates are shown as sodium salts , other salts and the free acids ( non - salted form ) are also within the scope of this invention . other amines that would make excellent starting materials in place of tromethamine are 2 - amino - 2 - methyl - 1 - propanol , 2 - amino - 1 - butanol , 2 - amino - 2 - ethyl - 1 , 3 - propanediol , 2 - amino - 2 - methyl - 1 , 3 - propanediol , and dihydroxymethylaminomethane . additionally , fatty amines , such as lauryl amine , coco amine , tallow amine , and oleoyl amine , and fatty ether amines , such as bis -( 2 - hydroxyethyl ) isodecyloxypropylamine , when reacted with svs produce mild surfactants that find utility where zwitterionic surfactants are desired , including personal care . other amines that are shown in fig2 are produced via a similar series of reactions , except that fig2 includes zwitterionic buffers from the amine 2 - amino - 2 - methyl - 1 - propanol , as well as the polyamines derived from the reaction with acrylonitrile and the subsequent derivatives described above . other amines can be utilized in addition to 2 - amino - 2 - methyl - 1 - propanol to obtain excellent buffers are 2 - amino - 1 - butanol , 2 - amino - 2 - ethyl - 1 , 3 - propanediol , 2 - amino - 2 - methyl - 1 , 3 - propanediol , and dihydroxymethylaminomethane . reaction conditions could be created such that the alcohol groups on the amines listed above could be reacted with acrylonitrile as well , and then reduced to the amines and , if desired , reacted with svs or mca to impart zwitterionic character . polyamines with good properties for use in biological fermentations , purifications , storage and general handling can also be produced through the reaction of nitroalcohols and acrylonitrile , followed by reduction . additional derivatization with svs or mca will result in zwitterionic buffers with a very large buffering range and capacity . fig3 shows the reaction of 2 - methyl - 2 - nitro - 1 - propanol with acrylonitrile and its derivatives . fig4 shows the reaction of 2 - nitro - 2 - ethyl - 1 , 3 - propanediol with acrylonitrile and its derivatives where x , y , and n are all integers where x and y are chosen independently , such that x + y = n and n is greater than zero . fig5 shows the reaction of 2 - nitro - 2 - methyl - 1 , 3 - propanediol with acrylonitrile and its derivatives where x , y , and n are all integers where x and y are chosen independently , such that x + y = n and n is greater than zero . fig6 shows the reaction of tris ( hydroxymethyl ) nitromethane with acrylonitrile and its derivatives where x , y , z , and n are all integers where x , y and z are chosen independently , such that x + y + z = n and n is greater than zero . fig7 shows the reaction of 2 - nitro - 1 , 3 - propanediol with acrylonitrile and its derivatives where x , y , and n are all integers where x and y are chosen independently , such that x + y = n and n is greater than zero . fig8 shows the reaction of 2 - nitro - 1 - butanol with acrylonitrile and its derivatives . fig2 through 8 are subject to the same clarifications as fig1 with regard to the cyanoethylation and the formation of a more linear or branched structure as well as the addition of svs or mca in molar equivalents of primary amine groups or less than molar equivalents of primary amine groups present . the buffers described thus far may also be ethoxylated , propoxylated , or butoxylated to modify their properties . ethoxylation will tend to impart surfactancy to the resulting product . propoxylation will add surfactancy , but also reduce the water solubility . this is useful in emulsion breaking and reverse emulsion breaking , this will also find utility in breaking up and dissolving biofilms . this is also desired in oil - field applications . butoxylation will similarly shift the hlb to the hydrophobic . combinations of ethoxylation , propoxylation , and butoxylation can be tailored to specific emulsion and reverse emulsion forming and breaking requirements . fig9 shows alkoxylation of aminomethylpropanol . the direct 2 mole ethoxylation of 2 - amino - 2 - methyl - 1 - propanol with 2 moles of ethylene oxide , as shown in fig9 produces an excellent biological buffer with less chelation than 2 - amino - 2 - methyl - 1 - propanol . the reaction of 2 - amino - 2 - methyl - 1 - propanol with propylene oxide or butylene oxide yields a similarly less chelating product , as does the reaction with diethylene glycol . the reaction product of 2 - amino - 2 - methyl - 1 - propanol with 1 mole of diethylene glycol as shown in fig9 produces an ideal amine for gas scrubbing of h 2 s . this product is particularly useful because it does not bind to carbon dioxide and carbon monoxide in any appreciable amount . thus making it ideal for tail gas scrubbing and maximizing the capacity of sulfur plants in refineries . similar performance is seen with the reaction of the following amines 2 - amino - 1 - butanol , 2 - amino - 2 - methyl - 1 , 3 - propanediol , 2 - amino - 2 - ethyl - 1 , 3 - propanediol , tris ( hydroxylmethyl ) aminomethane , and 2 - amino - 1 , 3 - propanediol . the buffers described herein also make excellent starting materials for surfactants . fig1 shows the synthesis of 2 very mild , high foaming , surfactants that are well suited for personal care applications were irritation is problematic , such as baby shampoo and face cleansers . similar results are seen when 2 - amino - 1 - butanol , 2 - amino - 2 - methyl - 1 , 3 - propanediol , 2 - amino - 2 - ethyl - 1 , 3 - propanediol , tris ( hydroxylmethyl ) aminomethane , and 2 - amino - 1 , 3 - propanediol are used as the starting material in place of 2 - amino - 2 - methyl - 1 - propanol . polyamines with good properties for use in biological fermentations , purifications , storage and general handling can also be produced through the reaction of nitroalkanes and acrylonitrile , followed by reduction . additional derivatization with svs or mca will result in zwitterionic buffers with a very large buffering range and capacity . fig1 shows the synthesis of a series of buffers with 2 - nitropropane as the starting material . fig1 shows the synthesis of a series of buffers with 1 - nitropropane as a starting material where n and m are integers where m + n is greater than zero and n is greater than or equal to m . branching can be imparted on the buffers described in fig1 through 14 for the polyamines that have greater than 3 amine groups by reducing the resulting nitrile or polynitrile to the polyamine and then reacting with more acrylonitrile and then reducing the resulting nitrile groups to amine groups . this can be done repeatedly . as in fig1 , conditions can be chosen such that a more branched product results . a more linear product is produced by simply adding all the acrylonitrile in one step , and then reducing the resulting polynitrile to the polyamine . for fig1 through 14 , the zwitterionic products can be made by adding mca or svs as shown in fig2 through 8 . fig1 shows the synthesis of a series of buffers with nitroethane as a starting material where n and m are integers where m + n is greater than zero and n is greater than or equal to m . fig1 shows the synthesis of a series of buffers with nitromethane as a starting material where x , y , z and n are integers and x + y + z = n and n is greater than zero . several descriptions and illustrations have been presented to enhance understanding of the present invention . one skilled in the art will know that numerous changes and variations are possible without departing from the spirit of the invention . each of these changes and variations are within the scope of the present invention . another embodiment of the present invention is the synthesis of zwitterionic buffers with vinyl acids . fig1 shows the synthesis of a family of zwitterionic buffers based on members of the acrylic acid family . however , other vinyl acids may be used . vinyl acids such as acrylic , 3 - butenoic acid , 4 - pentenoic acid , and other carboxcylic acids with a double bond at the terminus . carboxcylic acids with a triple bond at the terminus also can be utilized , similarly , an acid where the multiple bond is not at the terminus , such as hex - 4 - enoic acid , can also be utilized . however , due to the reduced commercial availability of such compounds , the preferred embodiment is the vinyl acid with a double bond at the terminus . one very large benefit of utilizing vinyl acids to make zwitterionic buffers is that the product does not need to be ion exchanged to produce a non - ionized form . in the market , both ionized , or sometimes called salted , and non - ionized forms sometimes called free acid or free base , are required . in situations where ionic strength must be very closely controlled , the non - ionized forms are more popular . for cases where increased water solubility and ease of solution are desired , the salted forms are preferred . it is understood to one skilled in the art , the present invention covers both the ionized and non - ionized forms of the buffers disclosed herein . another embodiment of the present invention is the sulfonate zwitterionic buffers derived from the reaction of an amine with an epichlorohydrin and sodium bisulfate condensate as described in fig1 . it is understood by one skilled in the art that other sulfate salts can be utilized to arrive at the desired molecular structure and is included in the present invention . fig1 through 25 teach the flexibility of the present invention to synthesize a series of a amine sulfonate or amino acid zwitterionic buffers from nitroalcohols or alkanolamines to produce zwitterionic buffers that have primary amino functionality or secondary amino functionality . in cases where there are more than one reactive group , amine , alcohol , or a combination , multiple sulfonate groups or acid groups can be reacted by adding more than one equivalent of the vinyl acid or the oxirane containing sulfonate . another embodiment of the current invention is to make zwitterionic buffers with cylcoamines as the starting material . the cycloamines result in a tertiary amino group that is less chelating and interferes less in biological functions . fig2 shows the reaction of morpholine with a vinyl acid and morpholine with the oxirane sulfonate . fig2 teaches similar products , but utilizing hydroxyethyl piperazine . fig2 teaches the use of diamines as starting materials by using piperazine as the starting material . this is a good example of a synthesis of polyzwittterionic buffers as discussed earlier . fig2 teaches the use of ethylene amines to make zwitterionic buffers through reaction with vinyl acids or oxirane sulfonates . one skilled in the art will recognize that similar compounds can be made by using ethylene amines , such as monoethanolamine and the higher homologs , such as diethylenetriamine and is part of the invention disclosed herein . another embodiment of the current invention is the synthesis of zwitterionic amines that have primary , secondary , tertiary , and quaternary amine functionality . fig3 teaches this via oxirane sulfonate and amines . it is obvious to one in the art that any primary , secondary , or tertiary amine can be used in place of the methyamines in fig3 . while not shown in the figure , it is obvious to one skilled in the art that the resulting amines can be reacted further with vinyl acids , monochloroacetic acid , sodium vinyl sulfonate , or an oxirane sulfonate to further add acidic character to the zwitterionic buffer . another embodiment of the current invention is the synthesis of mild surfactants from nitroalcohols . fig3 through 33 teach the synthesis of these mild surfactants . lower molecular weight acids produce lower foaming mild surfactants , whereas higher molecular weight carboxcylic acids yield higher foam . lauric acid is the preferred embodiment for a high foaming , mild surface . coconut fatty acid performs similarly , but at a lower cost . a good surfactant with low foam can be made using octanoic acid as the carboxcylic acid . another embodiment of the current invention is the synthesis of polyamines from nitroalcohols . fig3 and 35 teach the synthesis of diamines from nitroalcohols . fig3 teaches the synthesis with several hydroxyl groups present . it is understood by one skilled in the art that additional amino groups can be added by reacting more than one equivalent of epichlorohydrin to the nitroalcohol , up to the number of hydroxyl groups , and then reacting the same number of equivalents of amine to the oxirane containing amine . in the case where the nitroalcohol is reduced to the amino alcohol in the beginning , the addition of base , such as caustic , to the amino alcohol will assist in the reaction of the epichlorohydrin with the hydroxyl groups . without the base , the epichlorohydrin will preferably react with the amine as outlined in the 1 equivalent addition depicted in fig3 and fig3 . fig2 demonstrates that tertiary amines can be used to make zwitterionic buffers with quaternary amine functionality from tertiary amines . while not explicitly shown , any other tertiary amine can be used as the starting material and is part of the invention described herein . fig3 and fig3 demonstrate that diamines can be made from nitroalcohols by reacting sequentially the nitroalcohol with epichlorohydrin and then the second equivalent of the nitroalcohol , followed by reduction . also taught is that a reduction step can take place in the beginning to yield a diamine with two secondary amino groups . it is understood by one skilled in the art that the nitroalcohols or alkanolamines do not need to be symmetric , but others may be used in the synthesis of the diamine and is part of the invention disclosed herein . fig4 teaches the synthesis of zwitterionic biological buffers from amino alcohols and itaconic acid . these buffers have two acid groups and increased buffering in the acidic range of ph 3 - 6 . fig4 and 44 show the synthesis of zwitterionic buffers with primary amine groups . these buffers are preferred in applications such as personal care where secondary amines are seen as undesirable . the nitro diacids of fig4 also have great utility as chemical intermediates when synthesizing bioactive molecules . fig4 teaches the synthesis of a family of zwitterionic buffers from itaconic acid . the buffers in fig4 are not limited to amino alcohols as starting materials and provide a wide range of molecular size and solubilities . fig4 teaches the synthesis of a family of amphoteric surfactants . these surfactants are preferred for there mildness , ability to perform in hard water conditions and persistent lather when in the fatty tail is approximately 10 - 12 carbons in length . the r group in fig4 is to encompass the fatty acid family of carbon chain lengths , generally from about 6 to about 22 carbons . in the specific cases illustrated of lauric amine and lauric dimethyl amine reacted with itaconic acid , it is understood by one in the art that any chain length amine can be used and is in within the scope of the invention herein . particularly , but not limited to the fatty amines ( carbon lengths of about 6 to about 22 carbons , branched and linear , saturated and unsaturated ), isopropyl amine and butyl amine . the lower carbon chain lengths produce low foaming hard surface cleaners , while the carbon chains of about 8 to 10 tend to produce the most foam . higher chain lengths find utility as mineral collectors in floatation processes such as those employed in iron and potash mining . fig4 shows the synthesis of nitro acids from nitroparaffins . as stated early , these are very flexible intermediates , particularly when synthesizing bioactive molecules . reduction of the nitro acids , as shown in fig4 produces zwitterionic buffers with primary amine character . in the case of nitroparaffins that have more than one hydrogen bound to the nitro bound carbon , more than one addition of the itaconic acid can occur . the substitution can occur up to the number of hydrogen atoms bound to the nitro bound carbon . fig4 shows the synthesis of zwitterionic buffers from 4 - aminopyridine , fig5 shows using the less stable ketimine conformation as the starting material . fig5 shows the synthesis of sultaine type buffers from 4 - aminopyridine . additional buffers can be made by propoxylating and butoxylating 4 - aminopyridine . the ethoxylating and propoxylating will reduce the water solubility and reduce the bioavailability . this is one method of extending the time a material is bioavailable by making it available slowly , particularly if the molecule is metabolized . additionally , a triamine can be made by reacting 2 - aminopyridine with acrylonitrile and reducing it to the triamine , or reacting with allylamine to keep the aromatic nature of the six membered ring . the resulting buffers are excellent buffers in their own right , but also have great promise in treatment of multiple sclerosis , and other conditions that can benefit from calcium or other cation inhibition . the anionic components , in particular , are all groups that can chelate cations . fig5 outlines the synthesis of taurine derived zwitterionic buffers . these molecules , along with the products in fig5 , homotaurine derived zwitterionic buffers , are expected to find great utility in the purification of proteins and in cell culture media . fig5 shows the synthesis of a series of zwitterionic buffers derived from aspartic acid . these compounds are expected to be very useful in electrophoresis gels as they have a unique charge density and size profile . the sultaine derivatives in fig5 and fig5 are expected to find great utility in cell culture media and in purification due to their zwitterionic nature and pka range . the zwitterionic buffers of fig5 are expected to be primarily useful in cell culture media . as outlined earlier , it is obvious to one skilled in the art that the resulting amines can be reacted further with vinyl acids , monochloroacetic acid , sodium vinyl sulfonate , or an oxirane sulfonate to further add acidic character to the zwitterionic buffer . several descriptions and illustrations have been presented to enhance understanding of the present invention . one skilled in the art will know that numerous changes and variations are possible without departing from the spirit of the invention . each of these changes and variations are within the scope of the present invention . | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.