text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
in the following figures , the same reference numerals will be used to refer to the same components . in the following description , various operating parameters and components are described for different constructed embodiments . these specific parameters and components are included as examples and are not meant to be limiting . in general , the disclosed invention provides a system and method for allowing the occupant of a vehicle to avoid engagement with either the grab handle or a pillar such as an a - pillar . the disclosed inventive embodiments provide advancements in the art of known curtain airbags according to the prior art illustrated in fig1 and 2 . referring to the prior art curtain airbag shown in fig1 , an environmental view of the passenger side of a vehicle interior of a vehicle 10 is illustrated . the view of the passenger side shown in fig1 is in an elevated view taken from the driver &# 39 ; s side of the vehicle . as is known in the art , the vehicle 10 includes a roof rail 12 . the roof rail 12 includes a forward portion 14 and a rearward portion 16 . an a - pillar 18 extends from the forward portion 14 while a b - pillar 20 extends from a point on the roof rail 12 intermediate the forward portion 14 and the rearward portion 16 . a grab handle 22 is fitted to the a - pillar 18 but it is to be understood that the placement on the a - pillar 18 may be other than that shown . furthermore , the b - pillar 20 may be fitted with a grab handle as well . a curtain module 24 is conventionally provided and is substantially embedded within the roof rail 12 . as is known in the art , the curtain module 24 includes an inflator 26 and an inflatable curtain 28 made from a resilient flexible material such as reinforced nylon . the inflatable curtain 28 is shown rolled up as shown . a sail cloth 30 attached to the inflatable curtain 28 and is also rolled up within the a - pillar 20 . referring to fig2 , the inflatable curtain 28 includes a main body 32 . the main body 32 includes a leading edge 36 . extending from the leading edge 36 of the main body 32 of the inflatable curtain 28 is the sail cloth 30 . in an impact event the inflator 26 is signaled by an impact sensing system ( not shown ) to cause the curtain filling gas to enter and fill the inflatable curtain 28 . the sail cloth 30 either peels through the trim of the a - pillar or the cover of the a - pillar may be hingedly attached , thus allowing at least a portion of the cover to pivot out of the way , thus allowing deployment of the sail cloth 30 as illustrated in fig2 . the inventive concept of the disclosed embodiment provides of elongated and inflatable extensions of different lengths that extend from an inflatable curtain . this concept is illustrated in fig3 through 6 . referring to fig3 and 4 , an inflatable curtain assembly according to an embodiment of the disclosed inventive concept is generally illustrated as 50 . the inflatable curtain assembly 50 is shown in fig3 and 4 in its fully deployed condition . the inflatable curtain assembly 50 includes an inflatable curtain 52 having an inflatable cushion main body 54 . the inflatable cushion main body 54 has a leading edge 56 . an elongated and inflatable medium - length extension 58 extends vehicle forward from the inflatable cushion main body 54 . while the shape of the inflatable extension 58 is illustrated as being tubular it is to be understood that the shape of the inflatable extension 58 may be rectangular , triangular or virtually any other shape that may be appropriate for this component . the elongated and inflatable medium - length extension 58 includes a trailing edge 60 that is also attached to the inflatable cushion main body 54 at the leading edge 56 . attachment of the elongated and inflatable extension 58 to the inflatable cushion main body 54 may be made in any known fashion including stitching or riveting provided that a fluid - passing channel is formed between the elongated and inflatable extension 58 and the inflatable cushion main body 54 to allow inflating gas to enter the elongated and inflatable extension 58 from the inflatable cushion main body 54 upon inflation by the inflator 26 . as illustrated in fig3 and 4 , the elongated and inflatable medium - length extension 58 partially covers the grab handle 22 when the inflatable curtain assembly 50 is in its illustrated deployed condition . as discussed below and as illustrated in fig5 and 6 , the length of the elongated and inflatable extension and thus its position over the grab handle 22 when deployed may be varied by design . regardless of the length of the elongated and inflatable extension 58 , the objective of minimizing or eliminating the risk of the occupant &# 39 ; s head from impacting any of the roof rail 12 , the a - pillar 18 , or the grab handle 22 is achieved as the occupant &# 39 ; s head is deflected from any of these components in an impact event . an optional triangular - shaped extension or sail cloth 62 may be fitted to the inflatable curtain assembly 50 . if so fitted , the triangular - shaped extension or sail cloth 62 may be inflatable or non - inflatable . when provided , the extension or sail cloth 62 extends vehicle forward from the inflatable cushion main body 54 . the triangular - shaped extension or sail cloth 62 preferably includes an upper tether 64 that may or may not be attached to the lower edge of the elongated and inflatable extension 58 and a lower tether 66 . both the upper tether 64 and the lower tether 66 as well as the extension or sail cloth 62 are attached to the leading edge 56 of the inflatable cushion main body 54 . if the extension or sail cloth 62 is inflatable then the attachment to the inflatable cushion main body 54 is made in such a way that that a fluid - passing channel is formed between the inflatable cushion main body 54 and the triangular - shaped extension or sail cloth 62 to allow inflating gas to enter the triangular - shaped extension or sail cloth 62 from the inflatable cushion main body 54 upon inflation . as noted above , the length of the elongated and inflatable medium - length extension can be other than that illustrated in fig3 and 4 . particularly , and with respect to fig5 , an inflatable curtain assembly according to an alternate embodiment of the disclosed inventive concept is generally illustrated as 70 . the inflatable curtain assembly 70 is shown in its fully deployed condition . the inflatable curtain assembly 70 includes an inflatable curtain 72 having an inflatable cushion main body 74 . the inflatable cushion main body 74 has a leading edge 76 . an elongated and inflatable full - length extension 78 extends vehicle forward from the inflatable cushion main body 74 . while the shape of the inflatable extension 78 is illustrated as being tubular it is to be understood that the shape of the inflatable extension 78 may be rectangular , triangular or virtually any other shape that may be appropriate for this component . the elongated and inflatable full - length extension 78 includes a trailing edge 80 that is also attached to the inflatable cushion main body 74 at the leading edge 76 . attachment of the elongated and inflatable extension 78 to the inflatable cushion main body 74 may be made in any known fashion including stitching or riveting provided that a fluid - passing channel is formed between the elongated and inflatable extension 78 and the inflatable cushion main body 74 to allow inflating gas to enter the elongated and inflatable extension 78 from the inflatable cushion main body 74 upon inflation by the inflator ( not shown ). the elongated and inflatable full - length extension 78 almost entirely covers the grab handle 22 when the inflatable curtain assembly 70 is in its illustrated deployed condition . an optional triangular - shaped extension or sail cloth 82 may be fitted to the inflatable curtain assembly 70 . if so fitted , the triangular - shaped extension or sail cloth 82 may be inflatable or non - inflatable . when provided , the extension or sail cloth 82 extends vehicle forward from the inflatable cushion main body 74 . the triangular - shaped extension or sail cloth 82 preferably includes an upper tether 84 that may or may not be attached to the lower edge of the elongated and inflatable extension 78 and a lower tether 86 . both the upper tether 84 and the lower tether 86 as well as the extension or sail cloth 82 are attached to the leading edge 76 of the inflatable cushion main body 74 . the length of the elongated and inflatable extension can also be shorter than that illustrated in fig3 , 4 and 5 . particularly , and with respect to fig6 , an inflatable curtain assembly according to an alternate embodiment of the disclosed inventive concept is generally illustrated as 90 . the inflatable curtain assembly 90 is shown in its fully deployed condition . the inflatable curtain assembly 90 includes an inflatable curtain 92 having an inflatable cushion main body 94 . the inflatable cushion main body 94 has a leading edge 96 . an elongated and inflatable shorter extension 98 extends vehicle forward from the inflatable cushion main body 94 . while the shape of the inflatable shorter extension 98 is illustrated as being tubular it is to be understood that the shape of the inflatable shorter extension 98 may be rectangular , triangular or virtually any other shape that may be appropriate for this component . the elongated and inflatable shorter extension 98 includes a trailing edge 100 that is also attached to the inflatable cushion main body 94 at the leading edge 96 . attachment of the elongated and inflatable shorter extension 98 to the inflatable cushion main body 94 may be made in any known fashion including stitching or riveting provided that a fluid - passing channel is formed between the elongated and inflatable shorter extension 98 and the inflatable cushion main body 94 to allow inflating gas to enter the elongated and inflatable shorter extension 98 from the inflatable cushion main body 94 upon inflation by the inflator ( not shown ). as illustrated , the elongated and inflatable shorter extension 98 partially covers the grab handle 22 when the inflatable curtain assembly 90 is in its illustrated deployed condition . optionally the elongated and inflatable shorter extension 98 may not cover the grab handle 22 at all . an optional triangular - shaped extension or sail cloth 102 may be fitted to the inflatable curtain assembly 90 . if so fitted , the triangular - shaped extension or sail 102 may be inflatable or non - inflatable . when provided , the extension or sail cloth 102 extends vehicle forward from the inflatable cushion main body 94 . the triangular - shaped extension 102 preferably includes an upper tether 104 that may or may not be attached to the lower edge of the elongated and inflatable extension 98 and a lower tether 106 . both the upper tether 104 and the lower tether 106 as well as the extension or sail 102 are attached to the leading edge 96 of the inflatable cushion main body 94 . the disclosed inventive concept as set forth above overcomes the challenges faced by known curtain airbag arrangements for vehicles which offer limited protection to an occupant of a passenger seat during an impact event . the disclosed inventive concept either eliminates or significantly reduces the possibility of the head of the vehicle passenger seat occupant impacting the grab handle fitted to the vehicle &# 39 ; s a - pillar . of course , while the arrangement of the disclosed inventive concept is shown in relation to the vehicle &# 39 ; s a - pillar , it could easily be positioned as well relative to the pillars , including , for example , the vehicle &# 39 ; s b - pillar . thus the disclosed inventive concept has broad application to a variety of vehicle pillar arrangements . in addition , the width of the elongated and inflatable extension may be varied . furthermore , the disclosed inventive concepts may find application in vehicles having roof rail and pillar configurations other than that shown and described herein are possible and that the disclosed inventive concept may be adapted to such alternative configurations without deviating from the spirit or scope of the disclosed inventive concept . accordingly , one skilled in the art will readily recognize from such discussion , and from the accompanying drawings and claims that various changes , modifications and variations can be made therein without departing from the true spirit and fair scope of the invention as defined by the following claims . | 1 |
main load chute 1 is welded in a vertical position to a mounting plate 10a , that is bolted to the top of the main support structure ( frame ) 10 . a combination positive and negative air line 36 is welded to an aperture opening into the main load chute 1 and the air line extends down inside the chute . the positive air line is controlled by a valve 35 . the negative air line is controlled by a valve 34 . loading through the main load chute 1 , flow is controlled by an air - activated butterfly valve assembly 17 , 18 including the valve 19 per se . the main load chute 1 is surrounded by an air - activated sliding nose cone 5 actuated by a double - acting air cylinder 20 , fig2 . between the air cylinder 20 and the nose cone 5 there is a dual cable sling including a pair of cables 3a and 3b running over pulley assemblies 2 , 3 and 22 . the cables are connected at one end to a flange 9 on the nose cone and at the opposite end are connected to an adjustable coupling 23 which connects to the frame 10 using a connection block 24 . the cables may be actuated , either extended or slackened , by an air cylinder 20 as will be described . embracing the nose cone in a displaceable complemental fit are a pair of semicircular clamps or collars 6 , each carried by an arm 7 . each arm 7 is secured at its upper end on a rock shaft 8 supported for rotation in pillow blocks 28 in turn supported by flange 9 welded to the nose cone . the clamps are opened and closed by an air cylinder 26 . the nose cone 5 has eight casters ( not shown ) inside of the cone which ride in tracks 38 , fig2 on the main load chute 1 . there are stoppers as 38a at the top and bottom of tracks 38 limiting movement of the nose cone in each direction . the apparatus has a fully adjustable frame and bag support system as follows : the bag supports allowing split fork assemblies to be used are 30 , 31 and 39 , four sets . 39 is a short slide tube , presenting a pin hole for receiving an adjusting pin 32 ; this slide is able to slide on the cross brace support tube 11 which is apertured for the adjusting pin 32 . a pair of laterally projecting strap support rods 31 are welded to a bracket 30 , welded to the related slide tube 39 . the slide tubes 39 may be positioned laterally and held by pins 32 for bags of different size . the support tubes 11 are also adjustable laterally for bags of different size . thus , the ends of the tubes 11 have apertured ears 11e welded thereto , projecting outward , fig1 and these slide on an apertured cross bar 11r , the adjusted position being held by a pin 11p . the frame structure includes uprights 11a which are also apertured at 11b . by telescoping the uprights 11a into the vertical tubes 10 to complete the framework , and by providing apertures in selected of the tubes 10 to mate with the apertures 11b additional pins 32a may be used to adjust the frame vertically for bags of different size . a bottom support plate 14 is welded to the bottom of the frame which assures a flat bottom bag during and after filling . there is a weighing system which consists of four floor - supported load cells 15 connected to a control panel ( not shown ). the bulk - bag comprises an outer bag 40 of sturdy construction and an inner more flexible liner 41 , such as the construction noted above . each has an open mouth at the top and the two are connected at the bottom only , 43 . four loop straps 45 of strong webbing are sewn to the outer bag and can be easily looped over the four sets of support fingers or bars 31 . it can be seen that forklift forks can be easily entered into the loop straps when hung on the supports 31 . the air cylinder 20 which raises and lowers the nose cone is secured and centered at one side of the machine frame so its piston can be extended ( down ) or withdrawn ( up ) on a vertical axis . a horizontal arm ( not shown ) is secured to the free end of the piston and this arm carries a pulley 22 at each end . the cables 3a and 3b are played around these pulleys before being connected to their couplers 23 . ( 1 ) the machine in fig2 is at full rest position . switch the system to &# 34 ; power on &# 34 ; position ( on panel not shown ). ( 2 ) turn the remote station switch 37 ( fig1 ) to &# 34 ; clamp open &# 34 ; position . this actuates a double - acting air cylinder 26 and related piston supported between and linked to the cranks 7 depending from the rock shaft 8 , opening the clamps 6 . ( 3 ) place the bulk bag onto the frame by hooking the support straps 45 of the bag to the bag support assemblies on the machine . the bag should hang about two inches off of the base 14 . pull the neck of the liner 41 through the the top of the bag 40 and slide the neck of the liner up inside of the clamping assembly 6 which has been opened . ( 4 ) turn the remote station switch 37 to &# 34 ; clamp closed &# 34 ; position . this activates the air cylinder 26 which is gauged to slowly close the clamp , giving the operator ample time to remove his hands from the clamp area . the inner liner is soon clamped firmly to the nose cone . ( 5 ) press the &# 34 ; auto tare &# 34 ; button ( on the control panel not shown ). this automatically deducts or makes allowance for the weight of the machine , bag and liner . ( 6 ) press the &# 34 ; auto load &# 34 ; button ( on the control panel not shown ). this starts the fully automated load cycle , which is as follows : the cylinder 20 is actuated to draw the cables 3a and 3b up and the nose cone is raised by the cables to lift the container to its preload position . the outer bag will usually be about two inches above support 14 ; the inner liner a little more . the raised liner will pull the bottom sections of the liner and bag tight where they are fastened together ( fig2 ). as the nose cone reaches preload position a limit switch ( not shown ) is activated sending a signal to start the timed air inflation period . the positive air line valve 35 opens and the negative line valve closes . air under pressure is admitted to inflate the liner 41 as seen in fig2 . this removes folds and wrinkles so there can be effective filling . when the inflation cycle is timed as complete , a signal is generated which activates the butterfly valve 17 - 18 to one - quarter open piston (&# 34 ; trickle &# 34 ; load ) on the main load chute and the positive air valve closes . the same signal that starts the air inflation cycle starts a timer to delay the dedust control valve from opening until the flow has been established . this avoids a vacuum in the liner . the dedust ( negative air ) valve 34 stays activated ( open ) until the system goes to full rest position ( off ). this is a health feature to avoid ambient dust . the four load cells mounted between the frame and the floor measure the preload flow into the liner in pounds . when the system reaches the first predetermined ( preloaded ) set point ( in pounds ) the nose cone air cylinder 20 is reversed and returns the nose cone toward home or full - load position . the butterfly valve is turned to full open position for bulk loading and as the bag fills it stretches to rest on the support plate 14 so there will be a flat bottomed bag when full . when the weighing system reaches the second predetermined set point ( in pounds ) signifying a nearly full load in the bag a signal is generated to close the butterfly valve to its one - fourth open position , reestablishing the controlled trickle rate to ensure close accuracy in final filling . when the third predetermined set point ( in pounds ) is reached the system returns to &# 34 ; rest &# 34 ; position . this restores the sliding nose in a down position and the negative air valve and butterfly valve are closed as seen in fig2 . ( 7 ) turn the remote station switch to &# 34 ; clamp open &# 34 ; position , which opens the clamping assembly 6 - 9 to release the liner so it can be tied off . ( 8 ) the full bag can now be removed with a fork truck by driving the forks through the openings in the straps , lifting the forks to the split fork assemblies so the bag assembly may now be supported on the forks . the truck is backed out slowly and transports the bag to the distribution point . this arrangement eliminates the need for pallets . | 1 |
fig2 shows a block diagram for the nqr detection system for a preferred embodiment of the present invention . a radio frequency source 60 , a pulse programmer and rf gate 50 and an rf power amplifier 40 are provided to generate a train of random or pseudo - random radio frequency pulses having a predetermined frequency distribution to be applied to irradiating and detecting means ( typically a coil ) 10 . a coupling network 20 conveys the train of radio frequency pulses from the radio frequency source 60 , the pulse programmer and rf gate 50 and the rf power amplifier 40 to the coil 10 . the coupling network 20 also conducts the signal to the receiver / rf detector 30 from the coil 10 while a specimen is irradiated with the train of radio frequency pulses . a central processing unit ( cpu ) 70 controls the radio frequency source 60 and the pulse programmer and rf gate 50 to a predetermined frequency which coincides or is near to an nqr frequency of the type of explosive ( e . g ., all rdx - based explosives ) or narcotic desired to be detected . the cpu 70 also processes the data and compares the nqr signal with a predetermined threshold value . when the predetermined threshold value is exceeded , an optional alarm 80 is activated in response to the comparison by the cpu 70 . the receiver / rf detector 30 , the rf power amplifier 40 , the pulse programmer and rf gate 50 , the radio frequency source 60 , the cpu 70 and the alarm 80 may be contained in a console 100 with only the coil 10 and the coupling network 20 being outside of the console 100 . although in this embodiment the same means is used for both irradiating the sample with the excitation radiation and detecting the nqr signal ( e . g ., one coil is used for both functions ), this is not a requirement of the invention . separate irradiation and detection means ( e . g ., separate irradiation and detection coils ) may be employed if desired . for simplicity , only one coil is used typically . the train of radio frequency pulses is preferably a pseudo - random train of pulses , ( such as the pseudo - random train of radio frequency pulses shown in fig4 upper trace , discussed infra ) may be generated using a shift - register pseudo - random sequencer , such as the one shown in fig3 . as shown in fig3 a shift - register pseudo - random sequencer 200 has several ( as shown here , six ) stages 210 . each stage 210 has an input 212 , a clock connection 214 , and an output 216 . the stages are connected in series , with the output of the ith stage connected to the input of the ( i + 1 ) th stage . with each clock 218 pulse , the input from the previous clock cycle is transferred to the output , and thus transferred to the input of the next stage . the outputs of the nth and nth - 1 stages are input to an exclusive or ( xor ) gate 220 , and the output of this xor gate 220 is input to a not gate 222 . the not gate 222 output is input to the first stage in the sequencer 200 . typically , the clock 218 is connected in parallel to the clock connections 214 . more typically , this circuit is a software - generated virtual circuit . the pulses in this pseudo - random pulse train will have equal amplitude and pseudo - randomly shifted phase ( shifted between 0 ° and 180 °). see generally lancaster ttl cookbook pp . 277 - 83 ( howard w . sam & amp ; co . 1979 ). see also paff et al . adv . in magn . & amp ; optical reson . 17 1 ( 1992 ) and blumich , prog . nmr spectrosc . 19 331 ( 1987 ). as used herein , a pseudo - random pulse train will have a selected pulse width τ and a selected interval δt between pulses . the pseudo - random pulse train will have a selected number of steps to go through before the sequence repeats . the maximum number of steps for an n - stage shift - register pseudo - random sequencer is given by 2 n - 1 . a pseudo - random sequencer with this number of steps is referred to herein as a maximal length pseudo - random sequencer . there are several characteristic features to this pseudo - random pulse train . one is that for any short (& lt ; δt ·( 2 n - 1 )) sample , this pulse train will look and behave like random noise , but it will repeat every 2 n - 1 clock cycles . during excitation by a stochastic ( random or pseudo - random ) rf pulse train , a sample containing a quadrupolar target will return a stochastic response curve ( such as the one shown in fig4 second trace , discussed infra ). in the case of pseudo - random excitation , this stochastic response curve preferably may be cross - correlated to the free induction decay curve using a hadamard transform . a hadamard transform converts a stochastic response vector x into a free induction decay curve y , according to the equation : y = hx where h is a hadamard matrix . a hadamard matrix is a unique square n × n matrix for a given pseudo - random sequence of n steps , where the first row is the sequence , the second row is the sequence shifted by 1 , the third row is the sequence shifted by 2 , and the nth row is the sequence shifted by n - 1 . alternatively , or in the case where true random excitation is used , true cross - correlation may be used to generate the free induction decay curve . in true cross - correlation , the signal output y ( t ) is correlated to the input sequence x ( t ) via the memory function k ( τ ) such that ## equ1 ## the free induction decay curve is a time domain curve . by performing a fourier transform on this curve , a frequency domain nqr spectrum of the target species may be obtained . having described the invention , the following examples are given to illustrate specific applications of the invention , including the best mode now known to perform the invention . these specific examples are not intended to limit the scope of the invention described in this application . pseudo - random stochastic nqr analysis was performed on a 74 g sample of para dichlorobenzene ( pdcb ). the 35 cl resonance is at 34 . 27 mhz at room temperature . the rf coil used was a four - turn ribbon wire solenoid with an internal copper sheath , to provide a coil volume of about 225 cm 3 . the coil was overcoupled to reduce the quality factor , q , to 40 . results are shown in fig4 . the upper trace shows the pseudo - random excitation pulse train , the second trace shows the stochastic response of pdcb to this excitation , the third trace shows the fid of this stochastic response , and the bottom trace shows the frequency spectrum of pdcb . a 127 - step maximal length pseudo - random binary sequence was used to modulate the rf phase by 0 ° or 180 °. the rf pulses were 5 μs long , and the time between pulses was 40 μs , providing a nyquist frequency of 12 . 5 khz ( 25 khz bandwidth ). the tip angle of the rf pulses was approximately 5 °. the peak rf power was about 170 w . for a coil of this volume , the conventional single - pulse nqr approach would require a peak power of 55 kw (!) for a 5 μs 90 ° pulse . the 127 - step sequence was repeated every 5 ms . here , 128 sequences were co - added to improve the s / n ratio . the nqr signal at 34 mhz was demodulated ( conventionally ) and a 100 khz low pass filter was applied . the response of the spin system is shown as the stochastic response . when cross - correlated against the stochastic excitation , the conventional free induction decay ( fid ) is obtained . in this case , however , a hadamard transform was used in place of the conventional cross - correlation . the fid was then conventionally fourier transformed to produce the spectrum of the nqr signal . note that the baseline in fig4 is reasonably flat , an advantage characteristic of the stochastic approach . this particular spectrum is rather broad , with intensity in the wings due to stray magnetic field of about 5 gauss across the sample . this example compares the nqr fid of the 34 . 27 mhz 35 cl resonance of a 74 g sample of pdcb obtained by conventional one - pulse and stochastic methods . the top trace in fig5 is the conventional response to a one - pulse excitation . the bottom trace in fig5 was the result of stochastic excitation and was obtained by cross - correlating the stochastic nqr response with the stochastic pseudo - random excitation sequence , as described in example 1 . note that the s / n ratios are comparable : the stochastic approach is shown to be as efficient as the conventional one - pulse method . the experimental parameters in the two sequences were shown to facilitate comparison for an equivalent sampling time , with the parameters separately optimized on both the one - pulse and stochastic sequence to provide optimal signal - to - noise ratios . for the one - pulse sequence , an equivalent recycle delay of 25 ms was chosen to approximate the nqr t 1 value ( 22 ms ) in order to maintain the maximum signal - to - noise ratio per unit time for the 90 ° excitation . the one - pulse sequence was repeated 20 times for a total sampling time of 0 . 5 s . a 5 ms duration , 127 - step pseudo - random pulse train was used for the stochastic experiment , with a 5 ° rf pulse . the sequence was repeated 100 times , for a total sampling time of 0 . 5 s . in both cases , a 100 khz low pass filter was applied to the demodulated nqr signals . obviously , many modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described . | 6 |
the following description is not to be taken in a limiting sense , but is made for the purpose of describing the general principles of the present disclosure . the scope of the present disclosure should be determined with reference to the claims . exemplary embodiments of the present disclosure are illustrated in the drawings , like aspects and identifiers being used to refer to like and corresponding parts of the various drawings . and although the present disclosure is described with reference to specific embodiments and components , one skilled in the art could apply the principles discussed herein to other solar cell structures and materials ( e . g ., mono crystalline silicon or multi - crystalline silicon ), fabrication processes ( e . g ., various deposition methods and materials such as metallization materials ), as well as alternative technical areas and / or embodiments without undue experimentation . rear wide band gap passivated - passivated emitter rear cells perc , referred to as rgp - perc herein , structures and fabrication solutions are provided . the solar cell structure solutions leverage the relative simplicity of the perc cell to increases cell efficiency while reducing the number of fabrication process steps — in other words the solutions provided both reduce the complexity and improve the efficiency of the standard perc cell . rgp - perc not only allows for cell efficiency much higher than a standard perc cell , rgp - perc also allows for cell efficiency higher than the more complex , expensive , and traditionally higher efficiency perl cell architecture — in other words the innovative solution outlined in this document allows solar cells to achieve performance better than that possible by perl , yet at a substantially reduced number of process steps . the present application provides a wide bandgap rear passivation which provides not only high quality passivation to silicon , but at the same time provides superior contact to the right type of carriers thus obviating the need of patterning dielectrics and doping areas in the back as it relies on blanket depositions of the film . the wide band gap semiconductor passivation in the back is different material / film for p - type and n - type substrate . additionally , high quality solar cell front ( frontside ) passivation and doping is provided which may further reduce fabrication process steps . forming doped al 2 o 3 on the cell frontside ( e . g ., doped al 2 o 3 deposited using atmospheric pressure chemical vapor deposition apcvd ) provides superior passivation and also provides a dopant source ( for n - type solar cell having a boron based emitter ) thus further reducing fabrication process steps . fig2 is a cross - sectional diagram showing a high - level rgp - perc cross - section using an n - type substrate having blanket back metal . n - type substrate 2 has a front side emitter layer 8 and front side passivation layer or stack 10 ( e . g ., al 2 o 3 ). front metal 12 contact front side emitter layer 8 through front side passivation layer or stack 10 . rear ( or back ) wide band gap layer or stack 4 ( e . g ., tio x ) is on the rear ( or back ) of n - type substrate 2 . blanket back metal 6 is on wide band gap layer or stack 4 . fig3 is a cross - sectional diagram showing a high - level rgp - perc cross - section using an n - type substrate having patterned back metal . n - type substrate 14 has a front side emitter layer 20 and front side passivation layer or stack 22 ( e . g ., al 2 o 3 ). front metal 24 contact front side emitter layer 20 through front side passivation layer or stack 22 . rear ( or back ) wide band gap layer or stack 16 ( e . g ., tio x ) is on the rear ( or back ) of n - type substrate 14 . patterned back metal 18 is on wide band gap layer or stack 16 . the device is possible for both n and p - type silicon substrates . a defining characteristic of the rgp - perc structure is that it is passivated in the back / rear ( non - sunnyside ) of the silicon semiconductor using a single wide band gap semiconductor / dielectric or a multi - layer dielectric stack which consists of a wide bandgap semiconductor . this is followed by a suitable metal on the back which may be either blanket ( as shown in fig2 ) or patterned ( as shown in fig2 ). patterned metal allows for a bifacial solar cell implementation by letting the light through . for example , in consideration of other factors such as cell structure and fabrication , the rear passivating wide band gap semiconductor / dielectric of the rgp - perc should satisfy the following three important properties : it should allow the passing of the suitable photo carrier ( electrons for n - type and holes for p - type ) with minimal contact resistance ; it should be a high quality passivation layer with low surface recombination velocity ( e . g ., a surface recombination velocity srv less than 20 cm / s ); it should present a large and effective barrier for the other photo carrier which is not supposed to go to the rear contact ( holes for n - type and electrons for p - type semiconductor ). the rgp - perc using an n - type substrate may have a wide band gap semiconductor such as titanium oxide tiox followed by metal on the rear side . this allows the rear stack to be simple while at the same time , because the surface passivation is excellent , hole rejection is superior , and contact resistance to electrons is relatively low , the stack provides a relatively high performance from the stand point of voc and ff . note , in a conventional traditional solar cell scheme this type of performance for n - type substrates would be accomplished with a perl design requiring complex steps ( for example , laser fired doping ) to create heavy n + doping under the metal on the rear side while using passivation , such as al 2 o 3 + sin , everywhere else on the cell rear side . not only is this conventional traditional solar cell scheme more cumbersome , the quality of the passivation under the contact with n + is inferior to that created using tio x . it should be noted that tio x is an example of a wide band gap material that may be used for this purpose . in general , a single or multi - layer stack ( such as , but not limited to , al 2 o 3 + tio x or al 2 o 3 + zno or any combinations ) which satisfies the properties following may be used to form rgp - perc . key properties for this rear single or multi - layer material stack are : there should be at least one wide bandgap material which creates a large band offset with holes ; the stack creates reasonably good passivation to n - type silicon ( e . g ., srv less than 200 cm / s ); and , the stack gives reasonable contact resistance to electrons . in a specific and particularly advantageous embodiment for an n - type silicon perc , the rear wide band gap semiconductor material is titanium oxide tio x deposited using atomic layer deposition ( ald ) which serves as an n - doped wide bandgap semiconductor . alternative deposition techniques such as physical vapor deposition pvd of tio x may also be suitable if the qualities of the deposited film may be similar to those obtained using ald . the tio x may be annealed at a temperature in the range of 375 to 450 ° c . either in n 2 or in a forming gas anneal fga environment ( e . g ., 400 ° c . in fga ) to activate it . the bandgap of tio x is approximately 3 . 2 ev with majority of the band discontinuity in the valence band with silicon ( e . g ., approximately 2 . 1 ev ). the conduction band of the tio x tends to line up with the conduction band of silicon . this band alignment presents an excellent low contact resistance flow of carriers for electrons ( superior ohmic contact ) and a large barrier of approximately 2 . 1 ev to holes . this large barrier to holes serves as a superior rejection of the holes from the back side base . in addition , ald deposited tio x has the property of being an excellent passivation , for example providing srv less than 50 cm / s while being relatively thin ( e . g ., having a thickness less than 5 nm ). the relative thin thickness is also an attribute provides the aforementioned low contact resistance . thus , tio x satisfies the aforementioned properties and attributes of an rgp - perc single or multi - layer material rear stack . for tio x , the cell backside metal may be for example either aluminum , titanium by itself or followed by another metal such as aluminum to increase conductivity . the addition of tio x wide bandgap semiconductor unpins the fermi level of the metal and raises it close to the charge neutrality level cnl of tio x which itself is close to the conduction band of silicon . this substantially lowers the barrier for electrons to flow between metal and silicon . alternatively nickel may be used as a backside metal . although , nickel &# 39 ; s vacuum workfunction is close to the valence band of silicon , it is likely that when deposited on top of a material like tio x , nickel &# 39 ; s workfunction gets pulled toward the cnl of tio x which is near the conduction band of silicon — thus providing a lower barrier for electrons . nickel as a backside may be advantageous as there are relatively easy patterned deposition schemes available with nickel ( e . g ., nickel deposition using ink jet ). in another embodiment , a rear wide band gap semiconductor / dielectric ( and passivation ) may be al 2 o 3 , for example an atomic layer deposited ald al 2 o 3 . alternatively al 2 o 3 deposition techniques such as metal organic chemical vapor deposition mocvd may be used . because al 2 o 3 is a true insulator , it is imperative that an al 2 o 3 layer be thin ( e . g ., having a thickness less than 3 nm ) to ensure that the contact resistance may be low because of tunneling . al 2 o 3 also serves as an excellent passivation for n - type silicon . a tradeoff with al 2 o 3 is that as it gets thinner its passivation quality reduces . however , there is a possibility of an optimization with respect to al 2 o 3 thickness such that both passivation and contact resistance are sufficient for rgp - perc . in yet another embodiment of the rgp - perc , the back side deposited wide bandgap semiconductor / dielectric may be a bilayer of al 2 o 3 and tio x . this bilayer having a thin al 2 o 3 ( e . g ., having a thickness less than 2 nm ) is characterized is a high quality passivation and contact for electrons . in one possible fabrication process flow , the bilayer may be deposited in - situ inside an ald reactor . other bilayers such as al 2 o 3 and zno or a combination of al 2 o 3 , zno , tio in single or multi - layer formation which meet the properties of hole rejection , passivation quality , and contact resistance may be used as a rear single wide band gap semiconductor / dielectric or a multi - layer dielectric stack . a bifacial solar cell is compatible with all the rear wide band gap / dielectric embodiments provided herein . functionally , the back side of the solar cell structure provided may be bifacial to allow the light to be captured from the rear side . this may be accomplished by patterning the backside metal in a grid or other pattern to allow light to come through . alternatively a patterned metal may be deposited using techniques such as inkjet or screen printing . an additional indium tin oxide ito layer may be deposited on the solar cell backside as an anti - reflection coating arc . for example , ito may be grown using ald reactor in - situ with the other wide band gap semiconductors or ito may be sputtered deposited . silicon nitride sin may also be used as a solar cell backside arc . relating to the n - type silicon solar cell frontside , solar cells having doped al 2 o 3 which serves the dual function of being a superior passivation and the dopant source for the emitter while allowing for the reduction fabrication process steps are provided . for example , atmospheric pressure chemical vapor deposition apcvd deposited al 2 o 3 despite being driven at a high temperature retains its passivation quality yielding positive jos on boron emitter down to less than 20 fa / cm 2 . additionally , the jo values are found to remain low with the anneal apcvd al 2 o 3 for lower sheet resistivity ( rho ) emitters down to 50 ohms / sq . thus providing a high performance without necessarily going to a selective emitter process , thus saving additional process steps . front side options for combination with the aforementioned backside options of an rgp - perc include a standard perc non - selective emitter and selective emitter and non - selective emitter option using apcvd doped al 2 o 3 . front side embodiments which may be used with the rear side stack include , but are not limited to : al 2 o 3 selective emitter , non - selective emitter , apcvd al 2 o 3 emitter , and non al 2 o 3 standard stacks with sin . note , a class of front side possibilities include options where the boron , p + emitter is passivated using al 2 o 3 ( followed by an arc in the form of sin or ito ) are used in combination with the rgp - perc rear side . another class includes sin or a thin sift layer followed by sin used for this purpose . with both of these options , either selective or non - selective emitter options are possible . two manufacturing solutions for an al 2 o 3 boron passivated front side for selective and non - selective emitter are provided . these fabrication solution options allow for reducing manufacturing steps and when taken in conjunction with the rear side fabrication solution options provided herein dramatically reduce the processing steps and cost for manufacturing an rgp - perc solar cell . an al 2 o 3 boron passivated front side is currently viable with an n - type substrate as it is applicable for a boron doped emitter . inventive aspects pivot on the fact that an apcvd doped al 2 o 3 is used as both the passivation and the dopant source . al 2 o 3 is doped with boron and is initially deposited using apcvd . it is then annealed at a high temperature ( e . g ., a temperature in the range of 950 to 1100 ° c .) to drive the boron into silicon and form an emitter . conventional traditional wisdom is that since al 2 o 3 will start to crystallize at these temperatures , the passivation quality may deteriorate thus requiring the al 2 o 3 to be stripped and a fresh al 2 o 3 deposited . however , an optimal anneal temperature is used where despite al 2 o 3 crystallizing , its passivation quality remains relatively superior thus obviating the need for stripping it . passivation quality has been measured to have a jo of less than 15 fa / cm 2 . the mechanism is thought to be related to the interfacial layer . apcvd deposited interfacial layer becomes richer in si as it approaches silicon . the silicon richness allows the interfacial layer to not crystallize during anneal and thus retain its passivation qualities . this film may also be used as an adequate arc when an adjusted thickness of sin is formed on top . using these properties , a non - selective emitter front side may fabricated simply by using the following steps . note the sequence may be altered when integrated with rgp - perc fabrication as described below . 2 . anneal at an optimal temperature ( 950 to 1100 ° c .) in n2 environment if appropriate metallization paste is used , the laser opening can be eliminated and paste can be fired through the sin / al 2 o 3 stack thus reducing the process flow above to four steps . while the above non - selective emitter may be expected to be superior as compared to a conventional non - selective emitter because of the ability for al 2 o 3 to passivate boron emitter with a low jo despite the doping concentration increasing , if selective emitter may be fabricated , for example , with the following modification to the process outlined above . 1 . apcvd lightly boron doped al 2 o 3 2 . laser open areas where there is heavily doped emitter 3 . apcvd heavy boron doped al 2 o 3 4 . anneal at an optimal temperature ( 950 to 1100 ° c .) in n2 environment 5 . sin deposition ( thickness of sin adjusted to provide high quality arc along with the already present al 2 o 3 ) 6 . laser ablation using pico second laser or skip if suitable firing paste is used 7 . metallization ( screen printed or pvd ) from device point of view , whenever non - selective emitter is used for cost reasons as compared to a selective emitter , the following trade - offs in performance must be considered : jo of emitter ( voc ); jo of contact recombination ( voc ); sheet resistance of the emitter ( ff ); contact resistance of the emitter ( ff ); and , blue response of the cell ( jsc ). out of the these five device factors , jo of contact recombination , contact resistance of the emitter , and sheet resistance of the emitter prefer heavier doping ( smaller sheet rho ), while jo of emitter and blue reasons of the cell prefer light doping ( higher sheet rho ). with a selective emitter and by having an option of putting a heavier doping under the contact and a lighter doping in the emitter passivation areas , all five parameters may be optimized . non - selective emitters may not have this option . however , going to al 2 o 3 with apcvd , the emitter jo may remain despite emitter sheet resistance as low as 50 - 70 ohms / sq . this helps expand the process window for optimization without a selective emitter . with a non - selective emitter and apcvd al 2 o 3 , by going to lower sheet resistivity ( rho ), the listed parameters outside of blue response above are addressed while the blue response needs to be optimized . thus , apcvd doped al 2 o 3 with non - selective emitter for the perc cell not only reduces the number of process steps compared to a non - selective emitter standard perc but also may provide performance approaching that of a selective emitter . in the case of a p - type silicon solar cell rgp - perc , nickel oxide nio may be used for the rear wide bandgap semiconductor / dielectric and al 2 o 3 plus nio for the front side structure . representative exemplary fabrication process flows are provided below organized by relevancy to n - type silicon . n - type silicon fabrication process flows may be categorized according to the following characteristics : whether the emitter is passivated by al 2 o 3 + sin or only sin ; whether the device has a selective emitter ; whether the device is bifacial or unifacial ; and , the metallization strategy . relating to metallization strategy , exemplary backside metallization fabrication options and material choice for an rgp - perc with n - type substrate include pvd of aluminum , titanium , or titanium plus aluminum or nickel inkjet deposition . exemplary frontside metallization fabrication options and material choice for an rgp - perc with n - type substrate may be characterized the use of laser processing . for example , if suitable metallization paste is used and no laser opening of the frontside layer or stack ( e . g ., al 2 o 3 ) is used on the front then aluminum paste may be screen printed and fired . if laser ablation is used to open the frontside layer or stack , the following example metals and deposition methods may be performed : a patterned screen print of aluminum ; patterned pvd of aluminum , copper , titanium , or nickel ; or , patterned metal inkjet of nickel . subsequently , to increase conductivity , additional metal may be formed on top of already patterned metal . whether or not laser is used , the metal may be built up for example by screen printing silver or plating copper on the previously formed front side metal . relating to the backside metal choice , it may be advantageous that the selected metal for use alongside tio x has a workfunction which is closer to that which aligns with the conduction band of silicon . hence , al ( 4 . 1 ev ) and ti (˜ 4 . 3 ev ) may be considered ideal materials for this purpose . however , ni may also be used albeit with a slightly higher but acceptable contact resistance . for example , when tio x is inserted between silicon and the metal , the work function of the metal tends to gravitated toward the charge neutrality level ( cnl ) of tio x independent of the vacuum work function of the metal . the cnl of tio x is relatively close to the conduction band of silicon , hence despite that nickel &# 39 ; s vacuum workfunction is close to the valence band of silicon , nickel &# 39 ; s workfunction tends to approach the conduction band of silicon when on top of tio x . in addition to the above listed deposition techniques for the backside ( e . g ., screen printing ), other suitable deposition techniques which may provide direct patterned metallization deposition or blanket metallization deposition and subsequent metallization patterning are implicitly included . for n - type substrates , front metal makes contact to the boron doped emitter . thus front side metal material should be selected such that it makes high quality contact to p - type boron doping , for example al , ni , and ti . in cases where there is no explicit opening of the frontside layer or stack ( e . g ., al 2 o 3 ), the metal may need to be fired ( e . g ., using standard paste screen print / fire sequence with a fritted paste or using a laser ). for the case where an explicit contact is opened using a laser , similar metal types are possible including materials such as al , ti , and ni . however , in this case there is a larger availability of deposition techniques as the metal need not be fired and is in direct contact with the emitter . in an advantageous fabrication process , a patterned seed layer is first deposited ( e . g ., a patterned see layer deposited using techniques such as inkjetting of , for example , nickel , or direct patterned screen printing of , for example , aluminum ). subsequently , additional metal may be deposited , for example , using screen printing of silver or plating to dramatically increase the conductivity to levels less than 5 ohm / sq sheet resistance to allow single digit metal coverage ( to obtain high jsc ). the following tables are provided as descriptive process flow examples for making an rgp - perc . the process flows provided herein are representative flows serving as examples and should not be interpreted in a limited sense . tables 1 and 2 show representative fabrication flows for making an rgp - perc on n - type silicon without an explicit frontside passivation opening process . tables 3 through 8 show representative fabrication flows for making an rgp - perc on n - type silicon with laser opening and various metallization options and no selective emitter and al 2 o 3 passivated emitter . other deposition techniques and adjusted process sequence may be possible and apparent by those skilled in the art . for example instead of an arc using pecvd sin arc an ito based arc using either pvd deposition or ald deposition may be utilized . several fabrication steps in the process flows provided are not explicitly mentioned . for example , these may include edge isolation , saw damage removal , and an anneal of tio 2 film after ald if the sin deposition temperature does not anneal tio 2 film . if a tio 2 film anneal is required , it may be performed in an fga or n62 environment at temperatures in the range of 375 to 450 ° c . ( e . g ., 425 ° c . in fga environment ). advantageous aspects of the metallization options provided herein may include cases where the back metal is pvd al , pvd ti / al , or inkjet ni ( if the contact resistance is found to be acceptable with ni on tio x ), and cases where the front metallization fabrication uses contact opening process to open a contact to p - doped silicon through the front passivation using laser . subsequently , either al paste , patterned pvd , or ni inkjet followed by either ag screen print or plating may be used ( only if conductivity requirements are high ) to form the front metal . al paste which can be fired in temperature ranges between 510 to 560 ° c . and makes an excellent contact to p - type silicon down to 180 ohms / sq sheet resistance may be used . the conductivity of this al paste may be brought down to 50 uohm - cm . this al paste may serve as an excellent patterned metal seed along with patterned nickel inkjet to make high quality contact to the silicon emitter . subsequently , metal for increased conductivity may be formed using techniques such as , but not limited to ag screen print or cu plating . tables 9 through 14 show representative fabrication flows for making an rgp - perc on n - type silicon where the emitter doping layer is stripped and a new al 2 o 3 layer is deposited . while the re - deposited al 2 o 3 may be advantageously deposited using ald , other techniques such as pecvd al 2 o 3 followed by sin or apcvd al 2 o 3 may also be used . note , that if ald al 2 o 3 is performed , it is desirable that the al 2 o 3 thickness be greater than 10 nm to provide high quality passivation . optionally , ald al 2 o 3 and ito may be performed in - situ in the ald reactor . ito may form the arc and obviate the need for sin . table 9 shows a representative fabrication flow with al 2 o 3 and sin passivation stack on the cell front side and advantageous metallization fabrication of al paste print followed by ag paste print on the front side after opening the contact . al is formed by pvd on the cell back side on top of tio x . alternatively , as previously described , ni inkjet may be used as a seed layer followed by plating or screen print of ag . tables 10 through 14 shows representative fabrication flows with a stripped dopant source and using ito arc instead of sin arc and where the ito is deposited in - situ in the ald reactor after al 2 o 3 . fabrication flows of tables 10 through 14 show al 2 o 3 passivated emitter and non - selective emitter . in the case of complexity of firing the metal paste through ito , the contact may be opened ( e . g ., laser opening ) and sin may be used as arc . a parallel set of process flows where the arc is sin instead of ito may be obtained by the person skilled in the art . various exemplary fabrication flows provided above ( particularly those involving ito ). a bifacial cell rgp - perc is similar to a unifacial rgp - perc with two noted modifications . a bifacial rgp - perc may benefit from an arc on the back side which for example , in one advantageous embodiment may be grown in - situ with the tio x in the back in the same ald reactor . alternatively , ito may also be sputtered on top of tio x . the second noted modification is that the metal in the back should not be blanket but instead patterned so that the light can get through . tables 15 through 18 show representative fabrication flows for making a bifacial rgp - perc on n - type with al 2 o 3 passivated emitter and non - selective emitter ( nse ). metallization schemes mentioned for the unifacial cell may be applicable also be applicable in the fabrication of a bifacial structure . additionally , the stripped apcvd al 2 o 3 fabrication processes may also be applicable . among other embodiments , the following exemplary embodiments are specifically provided herein . for a non - bifacial with single dielectric stack ( tio x , nio , and al 2 o 3 ) specific embodiments include , but are not limited to the following : a front contact solar cell where the non - sunny ( rear ) interface consists of silicon , wide - bandgap semiconductor and metal a . a front contact silicon solar cell where the silicon is n - doped with a wide band gap semiconductor and metal constitute the rear interface b . where the wideband gap semiconductor such that its conduction band lines up with silicon for n - type solar cell and valence band exhibits a large band discontinuity with silicon &# 39 ; s valence band i . where wide bandgap semiconductor provides excellent passivation to silicon ii . where wide band gap semiconductor provides a high rejection barrier for holes iii . where the wide band gap semiconductor is titanium oxide deposited by atomic layer deposition iv . where the wide band gap dielectric is aluminum oxide deposited by atomic layer deposition c . where the metal in the back is blanket and consists of a vacuum workfunction which is close to the conduction band of silicon i . where the metal in the back is aluminum deposited using physical vapor deposition ii . where the metal in the back is al deposited using screen printing metal paste . iii . where the metal in the back is titanium deposited by various deposition schemes such as ink jet and pvd . d . where the metal in the back is patterned , thus forming a bifacial cell , and consists of a workfunction which is close to the conduction band of silicon , i . where the metal in the back is aluminum deposited using physical vapor deposition ii . where the metal in the back is al deposited using screen printing metal paste . iii . where the metal in the back is titanium deposited by various deposition schemes . a front contact silicon solar cell where the silicon is p - doped with a wideband gap semiconductor and metal constitute the rear interface i . where wide bandgap semiconductor provides excellent passivation to p - type silicon ii . where wide bandgap semiconductor provides a high rejection barrier for electrons iii . where the wide bandgap semiconductor is nickel oxide deposited by atomic layer deposition or other means iv . where the wide bandgap dielectric is al 2 o 3 deposited using ald or other means . b . where the metal in the back is blanket and consists of a workfunction which is close to the valence band of silicon i . where the metal in the back is ni deposited using physical vapor deposition ii . where the metal in the back is ni deposited using inkjet . c . where the metal in the back is patterned forming a bifacial cell and consists of a workfunction which is close to the valence band of silicon . i . where the metal in the back is nickel deposited using physical vapor deposition ii . where the metal in the back is ni deposited using inkjet for a front contact solar cell where the front ( sunny - side ) emitter passivation is al 2 o 3 in combination with the rear ( non - sunny side ) interface consisting of silicon , wide - bandgap semiconductor , and metal a front contact solar cell where the front al 2 o 3 is deposited using apcvd a front contact solar cell where the al 2 o 3 which is the passivation also serves as a dopant source for emitter formation a front contact solar cell , where the al 2 o 3 is deposited using ald , apcvd , or pecvd after dopant sources have been stripped . where combination of al 2 o 3 and sin serve as the arc a front contact solar cell where both selective and non - selective emitter perc designs are combined with the non - sunny ( rear ) interface consisting of silicon , wide - bandgap semiconductor , and metal . a front contact solar cell where the non - sunny ( rear ) interface consists of silicon , a multi - layer dielectric stack including a wide - bandgap semiconductor , and a metal a . where the stack for n - type is al 2 o 3 / tio x / al or al 2 o 3 / tio x / ti a front contact solar cell where the front ( sunny - side ) emitter passivation is al 2 o 3 in combination with the rear ( non - sunny side ) interface consisting of silicon , a multi - layer dielectric stack including a wide - bandgap semiconductor , and a metal . a . where the stack for n - type is al 2 o 3 / tio x / al or al 2 o 3 / tio x / ti a front contact solar cell where both selective and non - selective emitter perc designs are combined with the non - sunny ( rear ) interface consisting of silicon , a multi - layer dielectric stack including a wide - bandgap semiconductor , and metal . a . where the stack for n - type is al 2 o 3 / tio x / al or al 2 o 3 / tio x / ti for a bifacial structure having a single stack ( for n - type and p - type silicon ): a bifacial solar cell ( not limited to perc ) where the bifaciality is achieved by growing a wide band gap semiconductor and ito in - situ in an ald reactor and using a patterned metal on top . a bifacial solar cell where the rear side ( non - sunny side ) stack consists of silicon semi - conductor , a wide bandgap semiconductor / dielectric such as tio x on n - type and nio on p - type , and al 2 o 3 for both n and p - type , and an optional transparent conducting oxide ( tco ) such as ito , and a patterned metal . a . where the tco layer on the rear side ( non - sunny side ) is optional , but the patterned metal is a must . b . where the tco layer , when present is ito and is optimized to serve as an arc . c . where the ito layer , when present , is deposited in - situ along with the wide bandgap semiconductor in the ald reactor d . where the ito layer , when present , is deposited separately using a different deposition scheme such as pvd . e . where the patterned metal is a metal with a vacuum workfunction close to the conduction band edge of silicon for n - type silicon i . where this metal is aluminum deposited using pvd , screen print , or other means ii . where this metal is titanium deposited using pvd f . where the patterned metal is a metal with a vacuum workfunction close to the conduction band edge of silicon for the p - type silicon i . where this metal is nickel deposited using pvd , inkjet , or other means . a bifacial solar cell where the rear side ( non - sunny side ) stack consists of silicon semi - conductor , a multi - layer dielectric stack with a wide bandgap semiconductor / dielectric such as tio x on n - type and nio on p - type along with thin al 2 o 3 , and an optional transparent conducting oxide ( tco ) such as ito , and a patterned metal . the foregoing description of the exemplary embodiments is provided to enable any person skilled in the art to make or use the claimed subject matter . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without the use of the innovative faculty . thus , the claimed subject matter is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . | 8 |
the following description and drawings are illustrative and are not to be construed as limiting . numerous specific details are described to provide a thorough understanding . however , in certain instances , well known or conventional details are not described in order to avoid obscuring the description . references to one or an embodiment in the present disclosure are not necessarily references to the same embodiment ; and , such references mean at least one . reference in this specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the disclosure . the appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment , nor are separate or alternative embodiments mutually exclusive of other embodiments . moreover , various features are described which may be exhibited by some embodiments and not by others . similarly , various requirements are described which may be requirements for some embodiments but not other embodiments . this application is related to an fr patent number fr2996034 bi that has been incorporated by reference in its entirety for all purposes . referring now to fig1 , a flow chart of a method 100 for enhancing quality of an image media is illustrated , in accordance with an embodiment of the invention . image media can be a video or burst images . the image media is storable in a digital file in a conventional picture or video encoding format such as e . g . raw , jpeg or png , avi , mov , etc . further , this image media is also displayable on conventional and new age displays such as a display screen . at step 102 , image media is acquired by a processor to initiate enhancement of the image media . the image media acquired can be previously stored as digital files , or from an imaging sensor . however , preferably , the image media includes images that can be stored in digital files in a conventional picture encoding format such as e . g . raw , jpeg or png , avi , mov , etc . also , such image media can also be displayed on a conventional display device such as a screen . the image media may also be encoded in 8 bits , or 16 bits per color . also , the enhanced version of the image media will also be encoded in same format as the image media . hence , the image media and the enhanced version are coded pictures on a comparable number of color intensity levels . the image media includes a plurality of image frames . further , at step 104 , a plurality of neighboring frames within the image media identified are isolated or identified by the processor . exposure level of a frame is a function of the amount of light or light energy received at the imaging sensor , for an incident light intensity on the given optical imaging system . this exposure level depends in particular the opening of the imaging device and the exposure time of the sensor . as a general practice in photography , the exposure level is expressed in indices ev il , i . e . ‘ exposure value ’ ev . a +/− 1 ev ( or +/− 1 ev ) of the exposure level corresponds respectively to a making half or double of the amount of light incident on the imaging sensor ( for a light intensity incident on the optical system data imaging ). it is preferable that the neighboring images to be as similar as possible . neighboring images can be acquired for e . g . in burst mode or continuous acquisition mode with a digital camera , in a very short time interval . there are various devices available in the market that can acquire up to 60 frames per second or even more , and / or create videos at 24 or 60 frames / s . this allows to acquire images with short exposure time ( 1 / 1000 for instance ), and so it helps in minimizing blur due to movements . at step 106 , a processed neighboring image is formed . for this step , each pixel of the neighboring image out of the plurality of neighboring images is moved . the movement of pixels is so as to correspond completely to the image media identified to be enhanced . thereafter at step 108 , the previous process of step 106 is re - executed for all the plurality of identified neighboring frames . hence forming a set of processed neighboring frames . further , at step 110 , all the processed neighboring frames , are stacked up together to generate a composite image at a further step 112 . this composite image is the enhanced version of the image media . the composite image is on the same format as the acquired image media . summation of each pixel of the neighboring frames is performed . this summation generates a noise only due to the addition of each pixel noise and no additional noise are created as a result of the summation . it follows that the signal to noise ratio of n neighboring frames snrc ( x , y ) in each pixel of the composite image obtained by combination of n neighboring frames is equal to : snrc ( x , y )= n /✓( n )× snr ( x , y ), where snr ( x , y ) is the signal to noise ratio of the pixel in the neighboring frames in the image media . in other words , by normalizing the intensity levels , there is a net reduction of the noise level by a factor of a square root of n ( 1 /✓( n )). the improved signal to noise ratio improves representation of the scene in low - risk areas of the composite image , compared to the image media . it also lowers the exposure limit at which an object is detected in the composite image , which limit being about snrc = 1 . therefore , an object can be detectable in the composite image , whereas in the image media the object is not clearly detected because it is buried in noise . this process of digital summation of n processed neighboring frames generates , for low lights , a result comparable with that , which would produce an increase by a factor of n exposure level on the imaging sensor in the acquisition of image media , albeit with significant advantages :— the motion sensitivity is less , since acquisitions can be done with short exposure time and the neighboring frames are readjusted before to be combined , there is no saturation effects in the highlights because there is no coding dynamic problems . in practice , using a number n ( for example lets take n = 10 ) of neighboring images , a composite image is obtained with a noise level reduced by a factor 1 /✓( n ) ( approximatively 3 in this case when n = 10 ). further at step 114 , an image sequences is created using the enhanced composite images . referring now to fig2 , a flow chart of a method 200 to enhance image quality is illustrated , in accordance with another embodiment of the invention . at step 202 image media is acquired by a processor . details of this step have been described earlier in conjunction to fig1 . thereafter , at step 204 , the processor performs isolation of neighboring frames . details of the step have been described above in conjunction with fig1 at step 206 , forms processed neighboring frames . the processed neighboring frames are formed by moving entire pixel map or all the neighboring frames in order to correspond to the image media to be enhanced . each pixel of the neighboring frame is moved to correspond to the image media . the image media acquired , thereafter at step 204 , undergoes an identification , wherein the processor further identifies an image sequence within the image media that needs to be enhanced . this is done by determining and comparing moisture , dust spots and pixels within the image sequence . thereafter , at step 208 , stacking of these processed neighboring frames takes place . the changed pixel map of each processed neighboring frames is placed one over the other in order to produce an enhanced or composite image . summation of each pixel of the neighboring frames is performed . the summation generates a noise only due to the addition of each pixel noise and no additional noise are created as a result of the summation . it follows that the signal to noise ratio of n neighboring frames snrc ( x , y ) in each pixel of the composite image obtained by combination of neighboring frames is equal to : snrc ( x , y )= n /✓( n )× snr ( x , y ), where snr ( x , y ) is the signal to noise ratio of the pixel in the neighboring frames in the image media pixel . in other words , by normalizing the intensity levels , there is a net reduction of the noise level by a factor of a square root of n ( 1 /✓( n )). the improved signal to noise ratio improves representation of the scene in low - risk areas of the composite image , compared to the image media . it also lowers the exposure limit at which an object is detected in the composite image , which limit being about snrc = 1 . thereafter , at step 210 , an enhanced composite image is formed . this composite image has very less noise level . therefore , an object can be detectable in the composite image whereas , in the image media the object is not clearly detected because it is buried in noise . this process of digital summation of n processed neighboring frames generates for low lights , a result comparable with that , which would produce an increase by a factor of n exposure level on the imaging sensor in the acquisition of image media , albeit with significant advantages :— the motion sensitivity is less , since acquisitions can be done with short exposure time and the neighboring frames are readjusted before to be combined , there is no saturation effects in the highlights because there is no coding dynamic problems . in practice , using a number n ( for example lets take n = 10 ) of neighboring frames , and a composite image is obtained with a noise level reduced by a factor 1 /✓( n ) ( approximatively 3 in this case when n = 10 ). method 200 , further involves a step 212 , wherein high dynamic range ( hdr ) images of the composite image are processed . the composite image as obtained at step 210 includes all the useful information in areas of low , medium and high exposure . however , the composite image is coded high dynamics that is for e . g . 32 bits so as to be directly displayed on a display device with both the shadowed areas and highlight areas distinctly reproduced . therefore , an hdr image , that can be stored in a digital file with a classic encoding format that is 8 or 16 bits per color . whereas correct representation of areas of high and low lights is allowed . according to embodiment of the invention , multiple composite images correspond to images of different exposure levels . it recreates images as they would have been obtained by varying the exposure . for example :— to reproduce the equivalent of shooting with levels of one show + 1 , 0 , − 1 ev , it must generate three composite images with at least 1 , 2 , and 4 neighboring frames to obtain the equivalent of shooting with exposure levels of + 2 , 0 , − 2 ev , it must generate three composite images with at least 1 , 4 and 16 images . the composite images are then normalized on a dynamic of mi levels corresponding to the dynamics of the hdr image . this standardization is carried out to reproduce the sensor saturation process :— the pixels of the composite image whose intensity level is lower than the peak intensity levels m , retain their value , the pixels of the composite images , whose intensity level is higher than the maximum level of intensity m , take the maximum level of intensity m . if the composite image of lower dynamic is generated from 5 to more than a picture of acquisition , intensity levels are also normalized accordingly . the hdr image is then generated by using an exposure fusion technique (‘ exposure blending ’):— the light areas corresponding to areas of low lights of the scene are taken from the composite image with the highest level of exposure , and the light areas corresponding to areas of medium stage lights are extracted from the composite image with the average level of exposure , the light areas corresponding to highlight areas of the scene are taken from the composite image with the level of the lowest exposure , that is to say one that is generated with one image acquisition . the extractions of the light areas are based on the levels of intensity of the pixels that compose them . the light areas corresponding to zones of low , medium and high lights are then combined to generate the hdr image . thereafter , at step 214 , all hdr images processed are patched together to form a sequence of images may be in burst mode or in a video . referring now to fig3 , a block diagram of an image media 300 is illustrated , in accordance to an embodiment of the invention . image media 300 , as displayed , includes multiple neighboring frames 302 a - 302 n which will be collectively named as neighboring frames 302 . these neighboring frames have similar properties . these properties include exposure levels . so all the neighboring frames are of similar exposure . these neighboring frames 302 are then processed , wherein each and every pixel of the neighboring frames 302 are moved so that they correspond to the image media 300 . the processed neighboring frames 304 a - 304 n are then stacked together as displayed in fig3 to obtain a final enhanced composite image 306 . in further steps , these composite images 306 can be further processed to obtain hdr images or videos . aspects of the present subject matter are described herein with reference to flowchart illustrations and / or block diagrams of methods and apparatus ( systems ) according to embodiments of the subject matter . it will be understood that each block of the flowchart illustrations and % or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer readable program instructions . while there has been shown and described herein what are presently considered the preferred embodiments of the present disclosure , it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the scope of the present disclosure as defined by the appended claims . the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods , and computer program products according to various embodiments of the present subject matter . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of instructions , which comprises one or more executable instructions for implementing the specified logical function ( s ). in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts or carry out combinations of special purpose hardware and computer instructions . while certain embodiments have been described , these embodiments have been presented by way of example only , and are not intended to limit the scope of the present disclosure . indeed , the novel methods , devices , and systems described herein may be embodied in a variety of other forms . furthermore , various omissions , substitutions , and changes in the form of the methods , devices , and systems described herein may be made without departing from the spirit of the present disclosure . the accompanying claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of the present disclosure . | 6 |
the pneumatic tire or radial ply tire 1 illustrated in fig1 for vehicle wheels , not illustrated further , has a torus - shaped body 2 of elastomeric material with beads 3 formed on it for engaging the wheel , not shown . embedded in each bead 3 there is a core or wire 4 of inextensible material such as wire rope . extending within the torus - shaped body from bead to bead is a cord insert 5 which serves as a kind of protection or reinforcement for the rubber material of the torus - shaped body 2 . within the torus - shaped body 2 and underneath the tread 6 of it there is embedded in the rubber material in addition to a circumferential belt , not shown here , a belt - shaped reinforcing insert 7 which is described in the following in detail in conjunction with three embodiments by way of example illustrated in fig2 and 4 . in the embodiment according to fig2 the belt - shaped insert 7 comprises a flat strip 8 which can be made of steel or of synthetic resin and extends in the direction of the circumference of the tire 1 as a transverse strip of the belt . this strip 8 contains a multitude of strip - shaped or slot - like openings 9 which extend transverse to the circumferential direction of the tire 1 and thereby of the insert 7 . these openings are arranged in successive rows and within these rows they are offset parallel to one another in a transverse direction , as can be seen in fig2 . between adjacent openings 9 in each row of openings there are webs 10 which separate the openings 9 from one another and which , as a consequence of their zig - zag sequence , hold the strip 8 together as a whole . in this arrangement each web 10 lies opposite an opening 9 of the adjacent row of openings so that elastic extension of the strip 8 in a longitudinal direction or also elastic compression is achieved by the co - operation of the individual openings 9 and the webs 10 lying opposite them . at the longitudinal edges 11 of the strip 8 there are outwardly open notches 9a in every second row of openings 9 so that also in the region of the side edges or longitudinal edges 11 of the strip 8 the desired elastic extensibility , pre - loadability , restoring action and compression ability of the strip 8 in a longitudinal direction is achieved . between the rows of mutually offset openings 9 and 9a there are respective uninterrupted transverse webs 21 which extend from one longitudinal edge 11 of the strip 8 to the other and take care of providing the transverse stiffness of the strip 8 . by matching the material thickness of the strip 8 and the relationship of the dimensions of the openings 9 , the webs 10 and the transverse webs 21 there can be set a predetermined progressive tangential spring characteristic of the strip 8 which if necessary makes it possible to do without further tangential spring elements of the belt without adversely affecting the lateral stiffness of the belt and thereby of the radial ply tire 1 as a whole . the spring characteristic of the strip 8 according to fig2 can furthermore be modified by the shore hardness of the rubber mixture and its coating thickness . thus , for a given rubber mixture , thin rubber layers engaging the strip 8 on both sides stiffen the spring characteristic of the strip 8 as a consequence of their low deformation clearance whereas thicker layers of the same mixture engaging against the strip lead to a softer spring characteristic . accordingly , the volume and thereby also the weight of the belt and of the tire as a whole can be significantly reduced . in the embodiment according to fig3 the strip 8 forming the belt - shaped insert 7 is formed as an endless filament 12 which follows a zig - zag path . at the side edges 11 of the strip 8 there are arcuate reversals of direction 13 which on the one hand take care of providing sufficient lateral stability and on the other hand achieve the elastic stretchability , pre - load ability and restoring action of this particular strip . in the embodiment according to fig4 the belt - shaped insert 7 is manufactured from a strip - shaped body 14 of stiff synthetic resin or steel . this metal - strip - shaped or foil - shaped strip 14 contains , extending alternately from its side edges 15 and 16 , substantially rectangular deep inwards cuts 17 and 18 , which overlap one another , so that the strip - shaped body 14 comprises meandering web - shaped portions 19 extending parallel to one another and transversely with respect to the strip 14 and alternating with these there are webs 20 connecting them at one or the other side edge 15 or 16 . accordingly , the strip 14 is capable of stretching and contracting or squeezing together in a longitudinal direction but is laterally stable in a transverse or lateral direction . in the embodiments according to fig3 and 4 the filaments 12 ( fig3 ) or the web - shaped portions 19 ( fig4 ) which run in a direction transversely with respect to the strip take care of providing the necessary transverse stiffness of the strip in question . in a most preferred embodiment , the strip has substantially transversely extending stiffening portions having opposed ends , each end of a stiffening portion being joined to a corresponding end of an adjacent stiffening portion , whereby the stiffening portions are joined alternately by the ends . preferably , in all the foregoing embodiments the slot - like structured strip is dimensioned , for example by material strength and relationship between width and length of the webs such that under tangential tension loading ( through internal pressure in the tire and centrifugal force ) of the strip the transversely extending webs lift away somewhat from their flat state and thereby allow bulging respectively between the nodes or webs that connect them together in an offset manner , so that an elastic spring action arises as a result of this deformation of the webs . therefore the webs alter their angle with respect to the circumferential curvature of the tire under tension loading . a transverse belt strip of such dimensions is preferably applied to the carcass blank in a stress - free and therefore flat condition with a circumferential length corresponding to 100 % of the shaped body ( hot mould ) so that the transversely extending webs remain flat and therefore free of stress when the tire has been vulcanized . when a radial ply tire manufactured in such a way as described immediately above and provided with a rate of resistance to or allowable extension of around 101 to 104 %, is put under tension loading in operation , it stretches its transversely extending webs in a circumferential direction with a change in angle . in this process the transverse belt strip increases its structural height significantly as a consequence of the radially rising webs . from the flat strip which lies in a single plane there is produced by deformation of the transverse belt under tension a geometrically three - dimensional structure . when the transverse belt strip structured with slits and deformed under , tension loading in accordance with the invention is subjected radially to a large force as is the case in the supporting surface of the tire by carrying the wheel load , the upstanding transversely extending webs are thereby pressed back from their increased structural height again into their original flat position , whereby however , simultaneously in this loaded portion of the circumference of the belt the elastic stretching of for example 102 % to 100 % allowed by the alteration in angle previously of the transversely extending webs is mechanically restored . by this mechanical load - controlled forced return deformation of the transverse belt strip the spring action of the circumferential belt is kinematically extremely effectively assisted . in the tire as ready for use there result for the slit - shaped structured transverse belt strip according to the invention thereby in the transverse and longitudinal section two geometrically completely independent shapes : a ) in the unloaded periphery the transverse belt strip receives as a consequence of the elastic extension caused by the tension load a radially increased structural height through the alteration in angle of the webs . this geometrical alteration acts significantly on the inherent oscillation behavior of the belt , which suppresses premature occurrence of resonance nodes ( standing waves ). b ) in the loaded state the radially acting wheel load forces the mechanical kinematic shortening of the transverse belt strip back - into the original flat structural height . in this flat state the slot - shaped structured transverse belt strip can also very easily match itself to all unevenesses which occur in the ground by local bending actions ( within the composite structure ). therefore in the unstressed state the transverse belt strip extends flat in one plane and alters itself under tension load , in modified embodiments , by increasing the web angle radially in its structural height , that is three - dimensionally , and can thereby stretch elastically . in the elastically stretched state of the strip the webs are deformed back by radial loading again flat into the original plane , whereby the circumferential stretching is kinematically forcibly restored . the transverse belt strip is incorporated in the tire blank in its flat condition with a circumferential length which is about 100 % with reference to the dimension of the shape of the tire press and under operating conditions it can stretch elastically up to 105 %. in operation the structural height of the belt strip alters between the loaded and unloaded circumference and thereby its longitudinal section . in a preferred embodiment , the strip is adapted to stretch by up to about 4 % in a circumferential direction from a stress - free rest condition . in a most preferred embodiment , the strip is adapted to stretch by up to about 2 % in a circumferential direction from a stress - free rest condition . | 8 |
while the invention is susceptible to various modifications and alternative forms , a specific embodiment thereof has been shown by way of example in the drawings and will herein be described in detail . it should be understood , however , that it is not intended to limit the invention to the particular form disclosed , but on the contrary , the invention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention as defined by the appended claims . it is known in the art to receive information in units called packets in a packetized communication system and to recognize valid information by analysis of a header portion of a received packet . valid information so recognized is then passed to other elements in a receiving node for processing of the information content of the received packet . invalid packets not recognized are ignored by the receiving node . recognition of valid and invalid packets may include recognition of an address field indicative that the particular receiving node is to process the packet as well as recognition of particular types of packets which are to be processed by the receiving node . both such recognition approaches involve analysis of the header portion of a received packet . in particular , a fibre channel packetized communication system may recognize received transmissions by analysis of the received ordered set -- a 32 bit word which defines the type of information transmitted . ordered sets may indicate the start of further data transmissions , or may constitute a completed transmission in and of themselves . recognition of valid packets has been performed in the past by &# 34 ; hard - wired &# 34 ; logic ( e . g . electronic circuits which are designed to recognize certain valid packets or by fixed parser programmed instructions in a data processing element ). such hard - wired logic is complex and costly to change as new packet types ( ordered sets ) are added to the protocol implemented by the receiving node . for example , if the underlying communication protocol implemented by the receiving node is changed the hard - wired logic must be redesigned at potentially significant cost to support the new features . the present invention provides for flexibility in the update of the receiving node to recognize new types of packets ( ordered sets ). in particular , a filtration table structure of the present invention has one or more entries each of which define a type of packet and associated rules to be applied to recognize a packet type . a recognition filter element processes the filtration table entries responsive to receipt of a packet to determine if the received packet is recognized by the receiving node . in addition , each entry of the filtration table defines actions to be initiated automatically in response to receipt of a particular recognized packet . actions to be automatically initiated may include generation and transmission of a response packet , or starting or stopping of processing of particular packet types by modification of the filtration table entries . a programmable register file associated with the communication system receiving node allows for programming of parameters in the transmission of packets from the receiving node . such transmission parameters may include , for example , controls related to the number of times a packet is transmitted . fig1 is a block diagram of a receiving node 100 operable in accordance with the present invention . transmission source 140 sends packets to receiving node 100 over link 150 and receives replies ( and other transmissions ) from receiving node 100 over link 152 . one of ordinary skill in the art will readily recognize that links 150 and 152 may be any physical link medium appropriate to the communication application . in fibre channel applications of the present invention , links 150 and 152 provide a connection between a device and the corresponding network topology ( e . g . the fabric or an arbitrated loop ). a packet received in receiving node 100 over link 150 is first applied to , and processed by , packet recognition filter 106 to determine if the packet is recognized by the receiving node 100 for further processing . packets which are recognized by packet recognition filter 106 are applied over bus 154 to recognized packet processing element 108 . packets not wholly processed within receiving node 100 may then be applied over bus 158 to a host computer system 120 to complete further processing . replies generated by processing of a received and recognized packet within recognized packet processor element 108 or host computer system 120 are applied via bus 156 to packet generator parameters 110 . packet generator parameters 110 then controls automated transmission aspects of applying the generated packet to link 152 . for example , depending upon the parameters defined in the packet generator parameters 110 , the packet may be applied once to link 152 or may be applied multiple times to link 152 with the termination conditions for such repetitive transmission being defined by the packet generator parameters 110 . packet recognition filter 106 determines the validity of the received packets by applying various rules and masks defined by each entry 104 in a filtration table 102 stored in a memory ( not shown ) associated with the receiving node 100 . the filtration table 102 may be easily altered to add , delete , or modify entries therein . such simple alteration of the filtration table 102 enables extension or modification of the underlying communication protocol implemented by the receiving node 100 . new packet types to be recognized by the receiving node require the simple addition of new entries 104 to the filtration table 102 . changes in underlying communication protocol require simple deletion or modification of entries to the entries 104 of the filtration table 102 . control bus 160 permits recognized packet processor element 108 or host computer system 120 to manipulate entries in either filtration table 102 or packet generator parameters element 110 . this control enables the recognition of valid packets to be modified by alteration of the contents of filtration table 102 . in addition , parameters of packet generation and transmission may be modified as packets are generated in response to received packets . fig2 depicts an exemplary entry 200 of the filtration table 102 of fig1 . filtration table entry 200 is comprised of a number of fields defining the conditions required for recognizing a received packet and actions to be initiated automatically in response to recognition of a received packet . packet mask 202 is a mask field which is applied to a portion of a received packet to determine if the packet is of interest to the receiving node . packet mask 202 may include , for example , a bit field relevance mask which defines the relevant bits to be tested by the application of the mask and an expected value compared with the masked relevant bits . the packet header is bitwise and &# 39 ; d with the relevance mask and that result is compared with the expected value . depending upon the result of the comparison , the packet may not be of interest to the receiving node in accordance with the corresponding filtration table entry ( other entries may then be similarly applied to recognize a received packet ). field 204 represents a variable number of rules ( denoted rule1 . . . rulen in fig2 ) which serve to further qualify recognition of a received packet . a packet which qualifies for recognition by application of the packet mask field 202 described above must also qualify for recognition by the further application of the rules field 204 . the rules defined by rules field 204 are specific to the particular protocol implemented within receiving node 100 of fig1 . actions field 206 represents a variable number of actions to be initiated automatically in response to recognition of a valid received packet by application of packet mask 202 and rules field 204 as described above . exemplary of such automatic actions is the automatic generation and transmission of a reply packet responsive to receipt of a recognized packet . fig3 is a flowchart describing the methods of the present invention operable within packet recognition filter 106 of fig1 to recognize valid received packets by use of the entries 200 of filtration table 102 . responsive to receipt of a packet ( or a header portion of a packet ), element 300 is first operable to initialize a local flag variable , recognized , to indicate that the packet is not yet recognized by operation of the method . elements 302 - 320 are then operable iteratively until each entry 200 in the filtration table 102 has been processed . element 302 is operable to determine whether all entries 200 in the filtration table 102 have been processed by the remaining elements 304 - 320 . if all entries 200 in filtration table 102 have been processed by elements 302 - 320 , then processing of the packet by the packet recognition filter 106 is completed . otherwise processing continues with element 304 to attempt recognition of the received packet . element 304 is operable to retrieve the next entry 200 from the filtration table 106 . element 306 is then operable to apply the packet mask field 202 of the next entry 200 to the received packet . application of the packet mask field 202 , as discussed above , may involve isolating the relevant bits from the header portion of the packet and then comparing the isolated , relevant bits to an expected value corresponding to the particular entry 200 being processed . element 308 then determines whether the application of the packet mask field 202 results in a potentially recognized packet ( i . e . the result of the comparison operations discussed above ). if element 308 determines that the application of the packet mask 202 field of the current entry 200 being processed does not identify a potentially recognized packet , then processing continues by looping back to element 302 to process other entries 200 in the filtration table 102 . if the application of the packet mask field 202 of the current entry 200 identifies a potentially recognized packet , then element 310 and 312 are next operable to determine if the packet is in fact recognized according to the rules field 204 of the current entry 200 . the rules field 204 defines a number of rules specific to the particular protocol implemented within receiving node 100 to further qualify a potentially recognized packet in the context of the protocol state . in effect , the rules in the rules field 204 define a state machine for determining the specific context in which a received packet may be recognized . as noted above , the filtration table 102 of the present invention may be easily modified to alter the protocol implemented by the receiving node 100 of fig1 . such alterations may include dynamic redefinition of the mask and rules for recognition of packets based upon the reception of other earlier packets . in this manner , the entries of the filtration table 102 may implement a state machine for the dynamic recognition of packets based upon state information and context of the receiving node in the form of the present entries in the filtration table 102 . in particular , element 310 applies the rules field 204 of the current entry 200 being processed . element 312 is then operable to determine whether the application of the rules in the rules field 204 resulted in recognition of the received packet . if the application of the rules field 204 by operation of element 310 resulted in recognition of a valid packet , then processing continues with element 314 discussed below , otherwise processing continues by looping back to element 302 to evaluate other entries 200 in the filtration table 102 . if the packet mask 202 and rules field 204 of the current entry 200 being processed recognize the received packet , then element 314 is next operable to determine whether the packet was already recognized by application of the mask and rules of another entry 200 in the filtration table 102 . specifically , element 314 tests the local flag variable , recognized to determine whether an earlier entry processed by elements 302 - 320 already recognized the packet as valid . if the packet was already recognized by processing of an earlier entry 200 in filtration table 102 , then processing continues with element 320 discussed below . otherwise , element 316 is operable to set the local flag variable recognized to boolean true to indicate that the received packet has now been recognized . element 318 is then operable to pass the received packet on to the recognized packet processor element 108 of fig1 to further process the received packet . element 320 is next operable to perform all actions defined by the actions field 206 of the current entry 200 of the filtration table 102 . as noted above , the actions field 206 of the entry 200 defines actions to performed automatically in response to the recognition of a valid received packet . exemplary of such actions may be the automatic generation and transmission of a reply packet in response to the recognition of a valid received packet . processing of the method of the present invention then continues by looping back to element 302 to process other entries in the filtration which may recognize the received packet . although only one entry 200 in the filtration table 102 need recognize the received packet to permit the packet to be passed on to the recognized packet processor element 108 for further processing , each entry 200 in the filtration table is processed to assure performance of all automatic actions defined by the actions field of each entry which recognizes the received packet . one of ordinary skill in the art will recognize many variations of the methods described above with respect to fig2 and 3 . for example , the specific data structure used to represent fields in the various entries 200 as well as the data structures used to store entries 200 in filtration table 102 may be varied widely within the intended scope of protection of the present invention . one of ordinary skill will readily recognize many equivalent data structures and variations in the method to provide the same function and result , namely recognizing received packets while providing flexibility through the use of a modifiable filtration table structure . fig4 and 5 depict a variation of the structures and methods depicted and described by fig2 and 3 as applied to fibre channel communications . in standard fibre channel communication , information exchange is framed by 32 bit words called &# 34 ; ordered sets .&# 34 ; ordered sets provide control information pertaining to the fibre channel protocols operable over the link medium . ordered sets are 32 bit values encoded into 40 bit values using the well known 8b / 10b encoding methods . valid values for fibre channel ordered sets are sparsely distributed through the range of possible values of the 32 bit word . fig4 depicts an exemplary structure of an entry 400 in a filtration table 102 of fig1 adapted to represent information required to recognize valid ordered sets received from a fibre channel transmission node . entry 400 is similar in overall structure to the more general structure depicted in fig2 . ordered set mask field 402 , like packet mask field 202 , is used to determined that a received ordered set is potentially recognized depending upon the application of the protocol specific rules . as above , the ordered set mask field 402 may be implemented by a relevance bit mask to isolate relevant bits from the received ordered set . also as above , an expected value is compared against the isolated relevant bits to recognize the received ordered set . the sequence field 404 , similar to the rules field 204 described above , defines a fibre channel protocol specific rule for further qualifying the recognition of a received ordered set . some ordered sets , as defined by the fibre channel specification , require that a particular ordered set be received three times in sequence to be properly recognized by the receiving node . if set , the sequence field 404 indicates that the ordered set potentially recognized by application of the ordered set mask field 402 must be received three times in sequence to be properly recognized by the fibre channel receiving node . the fill field 406 , if set , indicates to the transmission portion a new ordered set value is to be used as the current fill word . like actions field 206 of fig2 the fill field 406 defines an action applicable to fibre channel applications to be automatically initiated in response to the recognition of the corresponding ordered set . count field 408 is used as discussed below in conjunction with the sequence field 404 to count the number of sequential receptions of a potentially recognized ordered set . the count field is incremented responsive to each reception of a particular ordered set if the sequence field 404 flag is set . when the count field 408 reaches a value of three ( for example ), the ordered set is recognized as valid for further processing . fig5 is a flowchart describing the method of the present invention operable within packet recognition filter 106 of fig1 to recognize valid ordered sets received from a fibre channel transmission source . the flowchart of fig5 is similar to that of fig3 but is adapted to process filtration table entries 400 as defined above to recognize valid ordered sets in a fibre channel receiving node . element 500 is first operable in response to receipt of an ordered set to determine whether further entries 400 remain to be processed in the filtration table 102 . if all entries 400 in the filtration table 102 have been evaluated and the received ordered set is not recognized , then the method of fig5 is completed and the ordered set is not recognized as valid for further processing by the receiving node . if further entries 400 remain to be processed in the filtration table 102 , then elements 500 - 512 are operable iteratively until all entries are processed or until an entry is encountered which recognizes the received ordered set as valid . element 502 is next operable to retrieve the next entry 400 in the filtration table 102 . element 504 is then operable to apply the ordered set mask field 402 to the received ordered set to determine whether the received ordered set is potentially recognizable by the receiving node as valid for further processing . as above , the application of the ordered set mask 402 may include the bitwise and &# 39 ; ing and comparison of the ordered set to determine if relevant bits in the ordered set are set to expected values . element 506 is then operable to determine if the application of the ordered set mask by operation of element 504 results in potential recognition of a valid ordered set . if the received ordered set is not recognized by application of the ordered set mask field 402 , then processing continues by looping back to element 500 to process other entries 400 in the filtration table 102 . if elements 504 and 506 potentially recognize the received ordered set by application of the ordered set mask field 402 , element 508 is then operable to determine if the sequence flag field 404 is set for the corresponding entry 400 in the filtration table 102 . if the sequence flag field 404 is not set , processing continues with element 516 , discussed below , to process the valid recognized ordered set . if the sequence flag field 404 is set , the element 510 is next operable to increment the count field 408 of the entry 400 being processed . if element 512 next determines that the received ordered set has not yet been received three times in sequence , then processing continues by looping back to element 500 to process other entries 400 in the filtration table 102 . if the received ordered set has now been received three time as determine by element 512 , then processing continues with element 514 operable to reset the count field 408 to zero in preparation for recognition of another ordered set . elements 516 - 520 are next operable in response to recognition of a valid received ordered set . in particular , element 516 is operable to determine whether the fill action flag field 406 is set in the entry 404 currently being processed . if the fill flag field 406 is set , then processing continues with element 518 to alter the fill ordered set value for the transmission portion . processing then continues with element 520 to pass the valid , recognized ordered set on to the recognized packet processor element 108 of fig1 for further processing of the recognized ordered set . one of ordinary skill in the art will recognize many variations of the methods described above with respect to fig4 and 5 . for example , the specific data structure used to represent fields in the various entries 400 as well as the data structures used to store entries 400 in filtration table 102 may be varied widely within the intended scope of protection of the present invention . one of ordinary skill will readily recognize many equivalent data structures and variations in the method to provide the same function and result , namely recognizing ordered sets received from a fibre channel transmission source while providing flexibility through the use of a modifiable filtration table structure . fig6 depicts an exemplary register file shown as packet generator parameters 110 of fig1 . ordered set word register 612 is programmed to the desired 32 bit ordered set data word by the generator of the ordered set ( for example a host computer system 120 of fig1 or the packet processor element 108 of fig1 ). parameter register 600 of fig6 provides a plurality of programmable bits useful in a fibre channel communication node for automated control of the generation of ordered sets ( or generation of other packets in other packetized communication systems ). the sc bit field 602 of parameter register 600 indicates that the transmitter is to transmit the provided ordered set word ( in register 612 ) continuously . the sf bit field 604 indicates that the provided ordered set word is to be transmitted continuously until the same ordered set word is received at the receiving node ( unaltered ) in a loop topology . the sa bit field 606 indicates that the provided ordered set word is to be transmitted once , and the operation completed when the transmitted word is received ( unaltered ) by the receiving node in a loop topology . the s3 bit field 608 and the s1 bit field 610 indicate , respectively , that the provided ordered set word be transmitted three times and one time . these parameter register 600 control bits are programmed by the generator of the ordered set word along with the ordered set word 612 register to control automated transmission of the desired ordered set word according to rules of the fibre channel protocol . one of ordinary skill in the art will readily recognize that the particular control bit fields are peculiar to the particular communication protocol implemented within the receiving node . while the invention has been illustrated and described in detail in the drawings and foregoing description , such illustration and description is to be considered as exemplary and not restrictive in character , it being understood that only the preferred embodiment and minor variants thereof have been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected . | 7 |
fig1 which shows a top view of a card inserting and ejecting unit of a cash dispenser ( remote teller ) indicates in connection with the cross section of fig4 how a credit card can be inserted into the machine . a front plate 2 which has an inner block portion 4 forms the outside of the unit . a slot 6 which is illustrated in fig4 but not actually visible in fig1 extends through the front plate 3 with its block portion 4 so as to allow lengthwise insertion of a credit card . a frame 8 with posts 10 is provided to hold an upper movable portion 12 and a complementary lower portion 14 , which portions are superimposed and engage each other at a vertical line 16 when the unit is in its closed position ( fig2 ). beveled planes 18 ( fig2 , 5 and 6 ) allow relative movements of the movable portions 12 and 14 against one another , thus causing an aperture a between them ( fig3 and 6 ). each of the movable portions 12 and 14 has on its front side a block attached thereto . block 20 at the upper movable portion 12 and block 22 at the lower movable portion 14 are visible in fig1 and 3 . block 20 also appears in fig4 . the blocks have inclined surfaces 26 suitable for engagement with the edges of an inserted credit card . the movable portions 12 and 14 are pressed together by spring means 24 which urge them against each other so that they are kept inter - engaged in normal position which means that no slot is formed between them . at the rear side of the portions 12 and 14 there are inclined edges 28 ( fig4 ) along the vertical line 16 . their purpose is explained under &# 34 ; operation &# 34 ;. when a credit card c is inserted into slot 6 in the front plate 2 , the card is urged against the inclined surfaces 26 of the blocks 20 and 22 . by pushing the card further into slot 6 , the upper movable portion 12 is urged sideways against the tension of spring means 24 due to the card &# 39 ; s engagement with block 20 . the lower movable portion 14 is urged sideways in the opposite direction due to the card &# 39 ; s engagement with block 22 . this is the case because in normal position the distance between the ends of blocks 20 and 22 is smaller than the width of the inserted credit card . by pressure of the card &# 39 ; s edges against the inclined surfaces 26 of the blocks 20 and 22 a relative movement of the two portions 12 and 14 occurs which is schematically illustrated in fig6 . it is obvious that by such outward movement of both portions a slot is formed which is just wide enough to let the credit card enter into the machine . the anti - vandal effect of the device can now be clearly seen . if any other object than a credit card of correct width is inserted , the blocks 20 and 22 are not engaged . this means that no opening pressure is exerted upon them and the movable portions 12 and 14 remain in interengagement along line 16 ( no slot opening ) as schematically illustrated in fig5 . in this manner all attempts by vandals to immobilize a cash dispenser by means of inserting foreign objects , like coins , are foiled . it is shown in fig4 that by means of the inclined edges 28 at the rear side of the movable portions 12 and 14 the inserted credit card can be pushed back so as to exit from slot 6 without the need of any opening mechanism of the type provided by blocks 20 and 22 . | 6 |
embodiments of a memory transfer controller and method of transfer control of video line data and macroblock data are described herein . in the following description , numerous specific details are given to provide a thorough understanding of embodiments of the invention . one skilled in the relevant art will recognize , however , that the invention can be practiced without one or more of the specific details , or with other methods , components , materials , etc . in other instances , well - known structures , materials , or operations are not shown or described in detail to avoid obscuring aspects of the invention . reference throughout this specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , the appearances of the phrases “ in one embodiment ” or “ in an embodiment ” in various places throughout this specification are not necessarily all referring to the same embodiment . furthermore , the particular features , structures , or characteristics may be combined in any suitable manner in one or more embodiments . an embodiment of the invention is described in relation to fig1 , which shows a mpeg - 2 video compression system 100 , including a video pre - processor sub - system 101 and video encoder sub - system 102 . the video pre - processor sub - system 101 makes a set of video line data transfer requests in each line period while the video encoder sub - system 102 makes a set of macroblock line transfer requests in each macroblock period . the data requests of the two sub - systems 101 , 102 are handled by a dedicated hardware block , referred to as memory transfer controller 103 , that receives data requests from the sub - systems 101 , 102 , prioritizes them , initiates bus protocols and schedules data transfers to the memory 105 via a shared system bus 104 . the status of each transfer request may then be fed back to the sub - systems 101 , 102 through path 106 , for example via a peripheral bus . an example embodiment of the video pre - processor sub - system 101 is shown in fig2 . a video input interface 201 extracts video data and synchronization signals from a real time digital input . a spatio - temporal noise filter 202 reduces spatial and temporal noise on the video image . a film detector 203 performs inverse 3 : 2 pulldown and a format converter 204 filters and decimates the original video to a desired format for encoding . when a video pre - processor sub - system 101 is processing a field n , an example set of possible data transfers includes luminance and chrominance video line data of the previous field n - 1 205 and n - 2 206 for noise reduction and inverse 3 : 2 detection , chroma - sampled and noise - filtered luminance and chrominance video line data output 207 of a main picture and chroma - sampled and noise - filtered luminance and chrominance video line data output 208 of a “ picture in picture ” application ( for example , where a small picture is laid on top of the main picture , which is a full screen picture running at the refresh video rate ). an example embodiment of the video encoder sub - system 102 is shown in fig3 . the video encoder sub - system 102 includes a motion estimator 301 that searches for motion vectors and generates prediction data from the searched motion vectors , a dct loop encoder 302 that performs discrete cosine transformation , quantization , and motion compensation on the video data and reconstructs the video data that appears on the decoder , and a variable length coder 303 that performs zigzag scan , run length and huffman encoding to form mpeg - 2 bitstreams . for the video encoder sub - system 102 , the possible data transfers include the loading of the reference luminance and chrominance macroblock data 304 into the motion estimator for coding and prediction data generation , the updating of the search window 305 for the motion vector search and the storing of computed motion vectors 306 . the reconstructed luminance and chrominance macroblock data 307 is output from the dct loop encoder 302 for motion compensation and the motion vectors 308 are input to the variable length coder 303 for variable length coding outputs of the encoded mpeg - 2 bitstreams 309 . the video line transfers occur at a line frequency determined by the real time constraint of the input video format . as an example , a pal system has a line period of 1 /( 625 lines per frame * 25 frames per second )= 64 : s while an ntsc system has a line period of 1 /( 525 lines per frame * 30 frames per second )= 63 . 5 : s . as an embodiment , the macroblock data transfers can occur at a macroblock frequency that is designed to satisfy the maximum processing period of macroblock data for each component in the video encoder sub - system 102 , the period required for maximum sum of all i / o transfers that may occur in processing a macroblock and the software processing overhead time incurred for each macroblock . the chosen macroblock period is under the real time constraint of 1 /( 1350 macroblocks per ntsc frame * 30 frames per second ) or 1 /( 1620 macroblocks per pal frame * 25 frames per second )= 24 . 7 : s in an embodiment . excess macroblock periods other than 1620 per pal frame or 1350 per ntsc frame are also be considered in order to be able to respond to additional bus loads and frame and or slice processing . the data transfers occur at different rates and size on the system bus 104 that has a maximum bandwidth capacity defined as the multiple of the width and clock frequency of the bus . ideally , the system bus 104 should be designed to operate efficiently at 100 % capacity but there are overheads in bus hand - shaking protocols . the lower operating frequency of the memory and memory operation overheads like row activation in double data rate synchronous dynamic random access memory ( ddr - sdram ) results in a lower memory access bandwidth capacity than system bus 104 bandwidth capacity . due to the changing bus load conditions , an average memory access bandwidth that guarantees relatively constant bus loads in a time period can be defined as an alternative target . the peak memory access bandwidth , defined as the maximum memory access bandwidth at any point in time , should be below the capacity of the system bus . by dividing each set of video line data to be transferred within the video line period according to multiples of the macroblock period within the video line period , the peak memory access bandwidth can be reduced and then an average memory access bandwidth is achieved . for a line period of 64 : s and a macroblock period of 23 . 1 : s , there are at least two and sometimes three macroblock clock edges between two line clock edges . as an example embodiment , the set of video line data transfers can be divided into two subsets : one comprising of input video line data of field n - 1 , output luminance video line data of main picture and picture in picture ; and the other comprising of the input video line data of field n - 2 , output chrominance video line data of main picture and picture in picture . for each entity of data transfer , there is an associated latency between the time when the request is first activated on the system bus and when the first response packet is received , depending on the architecture of the bus node ( e . g ., the number of arbiters and size of buffers , number of peripherals on the shared bus , number , size and pre - emption of requests granted currently and priority , size and grouping of data requests ). the entity of data transfer can be implemented as a series of short transfers driven by fullness of buffers at the bus interface or as one long transfer at a pre - determined time coupled with double buffering at the bus interface . the latter , known as burst mode transfer , is used in the present invention to reduce the overhead memory operations in for example ddr - sdram and thus utilize the memory access bandwidth more efficiently . by aligning the burst transfers of a divided set of video line data transfers and an original set of the macroblock data to the macroblock period , the two subsets of the video line data can be aligned to the first and second macroblock periods encountered in the line period , and prioritization of each entity of data transfer relative to the set of data transfers within the macroblock period can be done . the sequence of data transfers within each set can be fine - tuned for more graceful degradation measures . degradation here refers to the processing of erroneous data by the video pre - processor arising when the video line i / o transfers are not completed within a line period . some measures to minimize the impact of erroneous data can include software programming of the transfer controller in order to effect more quality - critical i / o transfers prior to less quality - critical i / o transfers . burst transfers of the divided set of video line data are processed before the set of macroblock data as the video pre - processor sub - system 101 has a tighter real time constraint of line period whereas the video encoder sub - system 102 is designed to have spare macroblock periods . for higher differentiation of priorities , the set of video line data transfers can be given higher priority than other data requests on the system bus 104 including the macroblock data from the video encoder sub - system 102 . the burst transfer of two sets of data transfers are initiated at the start of each macroblock period consecutively , increasing the maximal response time of data transfers and thus reducing the possibility of the data transfer not being completed before it is required by the peripherals . in the event that the macroblock data transfers are not completed before the start of the next macroblock cycle where they are processed , the video encoder sub - system 102 holds the processing of the next macroblock data for one macroblock period and the memory transfer controller 103 delays the onset of the next set of macroblock transfers so that there is an additional macroblock cycle time to complete the current macroblock data transfers . by designing spare macroblock cycles in the video encoder sub - system 102 , the occasional higher system bus traffic or worst case bandwidth can be handled without the need for any degradation mechanisms in the video encoder sub - system 102 or faster or wider memory access , thus increasing the robustness of the video compression system 100 at little implementation cost . a more graceful degradation mechanism is included as a separate embodiment for the video line data transfers that have a more critical real time constraint . the n divided sub - sets of a set of video line transfers can be classified into the first n - 1 subsets and the nth subset for handling of the worst case bandwidth . the former has to complete the data transfers within one macroblock period while the latter has to complete the data transfers before the start of the next line period . in the event that the former does not meet the macroblock period constraint , the next subset of video line data transfers ( instead of the current macroblock data transfers ) is initiated immediately after the current subset of video line transfers completes . in this case , the current macroblock data transfers are delayed until the next subset of video line transfers completes and the video encoder sub - system 102 is on hold as described previously . the priority inversion of current macroblock data transfer and the subset of video line data transfer is done in view of the more critical time constraint of the preprocessor sub - system 101 . in event that the latter does not meet the line period constraint , the memory transfer controller 103 ignores the incoming video line data , terminates any outstanding requests of the current sub - set to the memory and enters a waiting state until all granted requests have been handled before resuming normal operation . the double buffering of the bus interface of peripherals for burst transfer mode localizes the outstanding data transfers to the current line period . this degradation is transparent to the preprocessor sub - system 101 as operations continue as normal ( except if worse case bandwidth is prolonged ). in a further embodiment , the invention may be implemented using a video compression system 400 having a memory transfer controller 401 as illustrated in fig4 . in this particular embodiment , the video compression system has an overall system processor 402 that controls the operation of the video pre - processor sub - system 403 , the video encoder sub - system 404 and the memory transfer controller 401 and is responsible for generating data transfer requests . double buffering of macroblock data is done at the interface between the video encoder sub - system 404 and the memory transfer controller 401 while double buffering of video line data is done at the interface between the video preprocessor sub - system 403 and the memory transfer controller 401 to facilitate the burst transfers of the macroblock data and video line data . the double buffer accumulates the output macroblock data and video line data for transfer to memory in the next macroblock period and various macroblock periods of the next line , respectively . similarly , the double buffer collects the input macroblock data and video line data from memory for the video encoder sub - system 404 processing in the next macroblock period and the video preprocessor sub - system 403 in the next line period . the data transfers for both sub - systems 403 , 404 can be made programmable by the system processor in the form of dma command registers , downloaded via path 406 for macroblock data transfers to an encoder command fifo buffer 408 and path 405 for video line data transfers to a pre - processor command fifo buffer 407 , whereby the memory transfer controller hardware schedules individual data transfers according to the method described above . the software flexibility of this scheme allows for fine prioritization by sequential ordering within the set of data transfers . the macroblock data transfers are processed with respect to the macroblock clock as shown in fig5 . in an example macroblock period 501 , the system processor 402 generates the macroblock data requests of all sub - blocks for a macroblock processing in the video encoder sub - system 404 , organizes the i / o information in registers and sends them to memory transfer controller 401 via path 406 for storage in the encoder command fifo buffer 408 . in the next macroblock period 502 , the memory transfer controller 401 reads from the fifo buffer 408 and services the data transfers sequentially according to their priority so that data is ready in the video encoder sub - system 404 before the start of the one after the next macroblock period 503 for further processing . the video line data transfers , on the other hand , are processed with respect to both the macroblock clock and line clock , as shown in fig6 . for an example line period of 64 : s and macroblock period of 23 . 1 : s , the set of video line transfers is processed in two macroblock periods . the system processor 402 checks a new line indication flag given by the memory transfer controller 401 . if a new line 601 is detected at the start of the macroblock period , the software of the system processor 402 has the flexibility to generate half of the vpp requests for the line in the current macroblock period 602 and the other half in the next macroblock period 603 . the detection of the new line is at 601 , which is the start of the first macroblock period 602 after the line clock trigger . similarly , the memory transfer controller 401 determines the first two macroblock periods 605 , 606 of the next new line 604 to service half the video line data transfers for the current line in each macroblock period so that the data 608 is ready in the video pre - processor sub - system 403 before the start of the next line period 607 for further processing . the advantages of the scheme are to minimize peak bandwidth usage of system bus and to simplify the design of memory transfer controller and simplify the scheduling of processes in the system processor . when triggered by the macroblock clock , the memory transfer controller 401 reads the command entries from the two command fifos 407 and 408 through a prioritization logic circuitry 410 ( the function of which is described by the state machine of fig7 ). the memory transfer controller 401 is normally reset to mtc_idle state 701 . on detecting a macroblock clock signal , the memory transfer controller 401 moves to mtc_vpp state 702 to process video line data requests if a vpp_done signal is low or there are video line data transfers for the current macroblock period in the pre - processor command fifo buffer 407 . after the completion of burst transfer of all video line data and if enc_done is low or there are macroblock data transfers for the current macroblock period in the encoder command fifo buffer 408 , memory transfer controller 401 moves to a mtc_enc state 703 to process macroblock data requests , else if enc_done is high or there are no macroblock data transfers , the memory transfer controller resets back to mtc_idle 701 . otherwise on detecting a macroblock clock in mtc_idle state , if vpp_done is high or there are no video line transfers and enc_done is low or there are macroblock data transfers for the current macroblock period in the encoder command fifo buffer 408 , the memory transfer controller moves to mtc_enc state 703 to process video line data requests and moves back to mtc_idle on completion . a command processor 409 co - ordinates the operation of the memory transfer controller 401 , interprets the command entries from the fifo buffers 407 , 408 , initiates the burst transfers of the macroblock and line data transfers and provides feedback response on the operation status of the system processor 402 , video pre - processor sub - system 403 and video encoder sub - system 404 . the memory transfer controller 401 employs a centralized data transfer scheme . a bus request module 411 handles the bus request protocols and interfaces with the peripheral devices to download data to system bus 413 for a store operation . a prioritization field may also be set for individual data transfers to facilitate an arbitration scheme for the system bus 413 . on the other hand , a bus response module 412 receives the response packets from the system bus and interfaces with the peripheral devices to upload data for load operations . the situation when the macroblock data transfers are not completed before the start of the next macroblock cycle where they are processed is defined as enc_panic , as illustrated in fig8 . in the example illustration of fig8 , macroblock data transfers enc1 are serviced in the first macroblock period . more macroblock data transfers enc2 and a first subset of video line data transfers vpp1 are serviced in the second macroblock period . a second subset of video line data vpp2 is serviced in the third macroblock period . the state diagram in fig9 illustrates the operation of the memory transfer controller 401 . on software reset , the memory transfer controller 401 enters a mtc_idle state 901 and waits for events to trigger its operation . in response to a first macroblock clock trigger ( e . g ., as shown in fig8 ) the memory transfer controller 401 enters a mtc_enc state 903 where enc1 is serviced immediately in the first macroblock period as there are no vpp requests to be serviced . after completion of the i / o transfer , the memory transfer controller 401 transits back to the mtc_idle state 901 . in response to the second macroblock clock trigger ( in fig8 ), memory transfer controller 401 transits from the mtc_idle state 901 to a mtc_vpp state 902 where vpp1 is serviced first in the second macroblock period ( as it has higher priority than macroblock data transfer requests ), after which it transits to the mtc_enc state 903 where enc2 is serviced in the same macroblock period . in this case enc2 did not complete within the same macroblock period and this gives rise to the enc_panic situation . on detecting enc_panic , the memory transfer controller 401 transits back to the mtc_vpp state 902 immediately and gives priority 905 to the processing of video line data transfers vpp2 aligned to the next macroblock period , stalling current macroblock data transfers temporarily . in addition , the memory transfer controller 401 raises the hold signal 801 and outputs the same hold signal 414 to the system processor 402 and video encoder sub - system 404 that can be used to disable generation of macroblock data transfer requests in the system processor 402 and or can be used to mask out the macroblock clock to the video encoder sub - system 404 ( as indicated by the masked macroblock clock signal at 802 ) such that the current macroblock processing is extended automatically by one macroblock period . a degradation handling method for the video line data transfer is shown in fig1 . in this example , there are five video line transfer request grants rg1 to rg5 in the respective time periods as shown by example 1001 . during normal operation ( example 1002 ), the video line data request services rs1 to rs3 are completed before the macroblock data request services ( denoted by e ). however , if the first n - 1 divided subsets of video line transfers ( in this example , the request service 1 , or rs1 ) are not completed before the start of the next macroblock period , the memory transfer controller 401 continues rs1 and gives priority to request service 2 ( rs2 ) over the current outstanding set of macroblock data transfers service e , as illustrated by example 1003 . on the other hand , if the nth divided subset of video line transfers ( in this example rs2 ) is not completed before the start of the next line period , the vpp_panic situation is defined ( as illustrated by example 1004 ) and the memory transfer controller 401 transits from the mtc_vpp state 902 to a mtc_recover state 904 , where it completes the current bus request . the memory transfer controller 401 flushes the remaining video line data transfer requests for the current line in the fifo buffers and does not upload the received previous line data to the video pre - processor sub - system 403 . additionally , the vpp_panic_hold signal 1005 is raised . normal operation only resumes when all pending system bus transactions are received and the memory transfer controller 401 then makes a transition back to the mtc_vpp state 902 for processing the video line data request service rs3 . the scheme has the added advantage that it is transparent to the system processor 402 and video pre - processor sub - system 403 and the line error is localized by the double buffering of the interfaces . however , if the worst case bandwidth is prolonged and new video line data transfer requests for the next line are continuously generated in the two constrained macroblock periods , there may exist a situation when the pre - processor command fifo buffer 407 overflows and the system processor 402 is interrupted at 1006 via a hardware pin 415 to resend its video line data transfer request at a later point of time . ideally , this situation should not happen given careful consideration of the fifo buffer size and the detailed simulation of possible bus traffic conditions . the operation of the memory transfer controller 401 , including handling of both vpp_panic and enc_panic situations is represented in the state diagram of fig1 . the occurrence of enc_panic causes a transition from the mtc_enc state 902 to a mtc_vpp state 903 to process the next sub - set of video line data transfers ( if necessary ) before the current set of macroblock data transfers . however , both operational states mtc_vpp 902 and mtc_enc 903 transition to the mtc_recover state 904 during vpp_panic , as it has the highest priority . on recovery , the memory transfer controller 401 transitions to mtc_vpp state 902 if there are outstanding video line data transfers , or else to mtc_enc state 903 if there are outstanding macroblock data transfers , or else back to the reset mtc_idle state 901 if there are no data transfers to be performed . an embodiment of the present invention advantageously provides a higher resolution of memory access bandwidth control at the macroblock level for video line data and video macroblock data memory read / write transfers . it advantageously enables operation of systems at a peak close to or equal to the average memory access bandwidth . the operation of the video compression system 400 described above may alternatively be embodied in a video decompression system having corresponding video decoder and post - processing sub - systems . all of the above u . s . patents , u . s . patent application publications , u . s . patent applications , foreign patents , foreign patent applications and non - patent publications referred to in this specification and / or listed in the application data sheet , are incorporated herein by reference , in their entirety . the above description of illustrated embodiments of the invention , including what is described in the abstract , is not intended to be exhaustive or to limit the invention to the precise forms disclosed . while specific embodiments of , and examples for , the invention are described herein for illustrative purposes , various equivalent modifications are possible within the scope of the invention and can be made without deviating from the spirit and scope of the invention . these and other modifications can be made to the invention in light of the above detailed description . the terms used in the following claims should not be construed to limit the invention to the specific embodiments disclosed in the specification and the claims . rather , the scope of the invention is to be determined entirely by the following claims , which are to be construed in accordance with established doctrines of claim interpretation . | 7 |
referring now to the figures , and in particular to fig1 which discloses a display device 10 affixed upon a shelf 12 normally found in a supermarket . the forward facing edge 14 of the shelf 12 has affixed thereon a pricing sticker 16 that is divided into two portions 18 and 20 which contain , respectfully , the unit pricing indicia thereon and the cost of the particular object mounted on the shelf thereabove . the pricing sticker is required to be visible to the customer at all times as he approaches the shelf to make his selection of an object mounted thereon . thus , the need arises for a display device , such as that of the instant invention , which will catch the customer &# 39 ; s eye as he is walking down the aisles in a supermarket , as well as , maintain the pricing sticker in clear view as he approaches the shelf . the extending portion 22 of the display device may include indicia thereon such as printed slogans , prices , photographs , etc ., adapted to attract the customer as he walks down the aisle . pricing information such as for example , a special sale occuring on a particular day or week may also be indicated and appear on the extending portion 22 of display device 10 . additionally , the extending portion 22 may be provided with a plurality of slits 24 which are placed diagonally proximate the edges thereof . if the material of the display device 10 is transparent then a card or paper 26 with indicia thereon may have its corners tucked into the slits 24 and held in position thereon . the card or paper 26 may be removed as desired when the sale is over or when different material is to be placed on the shelf . preferably , the display device is fabricated from paper or cardboard having sufficient weight and stiffness to allow it to stand in an upright position when mounted on the shelf 12 . it may also be fabricated from a transparent material such as vinyl , celluloid or any other transparent material to create different effects or permit the insertion of a card 26 thereon . the material preferably , should be flexible so that a customer brushing against the sign , would not destroy it ; instead , it should snap back into its normal position where it extends into the aisle . the cost of manufacturing this display device is minimal and the display device may be readily removed from the shelf and disposed of . the manner in which the display device 10 is fabricated , assembled , and made available for affixing to the shelf 12 , is more clearly shown in fig2 , and 4 . fig2 is a perspective view of the display device 10 as it appears prior to assembly for installation on a shelf . the display device 10 , is fabricated from a unitary sheet material preferably rectangularly shaped , although it may be fabricated in any other shape desired to create novel effects . a cut 28 extends inwardly from one edge 30 for approximately one - half the distance between edges 30 and 32 . another cut 34 extends inwardly from the opposite edge for a distance approximately equal to one - fourth of the distance between edges 30 and 32 . cuts 28 and 34 are coaxially aligned leaving a non - cut portion 36 defining an elongated section 38 , which is partially severed from the extending portion 22 of the material . the elongated section 38 is divided into four equal parts by three score lines 28 , 50 and 52 that divide the elongated section 38 into parts which are equal in length , width and to each other . preferably , the elongated section is one - fourth the distance between edges 54 and 56 , with the remaining area of material being in the extending portion 22 available for advertising indicia , which may be provided on both sides of the display device 10 . an adhesive means 58 , which preferably is double sided adhesive tape , is applied along the longitudinal axis of the elongated section 38 extending from edge 30 to edge 32 . a covering 60 is placed over the adhesive tape 58 during shipment or storage of the display device 10 . prior to mounting the display device on the shelf 12 the adhesive covering 60 is removed exposing the adhesive material 62 . in order to prepare the display 10 for installation on a shelf 12 , parts 40 and 42 are simultaneously bent in the direction of arrow 64 along score line 50 until parts 42 and 44 cooperate with each other and are bound together by the adhesive 62 leaving parts 46 and 54 to be bent in the direction of arrows 66 and 68 , which is opposite in direction to arrow 64 . the parts 46 and 54 thus , extend outwardly from the plane of the extending protion 22 with the adhesive contact material 62 exposed and available for mounting the display device on to a shelf 12 as desired , as shown in fig1 . hereinbefore has been disclosed a display device which is inexpensive , disposable , and readily adaptable for mounting on supermarket shelves . this display device may contain an assortment of indicia to attract the attention of a consumer walking down the aisle . it will be understood that various changes in the details , materials , arrangement of parts and operating conditions which have been herein described and illustrated in order to explain the nature of the invention may be made by those skilled in the art within the prinicpals and scope of the present invention . | 6 |
a stereo speaker system 10 in accordance with the present invention in fig1 through 3 removably mounted in position on the backrest 30 of an overstuffed easy chair c . as a setting for the present invention , the chair c is conventional and includes a seat portion 24 , arm rests 26 , 28 , backrest 30 , and legs 32 . in turn , the basic components of the stereo speaker system 10 primarily comprise two speaker housings 12 , 14 supported in spaced - apart relation over the chair c by support arms 16 , 18 , attached to mounting bracket 11 . mounting bracket 11 includes a front portion 20 adjustably attached to the rear portion 22 by bolt 70 and nut 72 . the front portion 20 includes a horizontal section 34 and two spaced - apart members 36 , 38 extending downwardly from the forward edge of the horizontal section 34 for gripping the front surface of the seat back 30 , and the rear portion 22 likewise includes a horizontal section 54 and a rear gripping member in the form of a back plate 56 extending downwardly from the rear edge of the horizontal section 54 for gripping the rear surface of the seat back 30 . the distal ends 37 , 39 of members 36 , 38 , respectively , and the distal end 57 of member 56 are curved slightly outwardly to minimize the possibility of those ends tearing or causing wear spots in the fabric of the chair as said members are being slipped into position on the chair or while mounted in that position . also , the mounting bracket 11 can be formed with a slightly obtuse angle between the horizontal section 34 and each gripping member 36 , 38 , respectively , of the front portion 20 , and an acute angle between the horizontal section 54 and gripping member 56 of rear portion 22 to more closely conform to a chair c with its back 30 inclined slightly backward , as shown in fig2 . a slotted hole 64 with its longer dimension oriented forward and backward in relation to the chair c is provided through the horizontal section 54 of rear portion 22 , and a hole 35 is provided through horizontal section 34 of front portion 20 in alignment with slotted hole 64 . the front and rear portions 20 , 22 are adjustably secured together by bolt 70 which extends through both slotted hole 54 and hole 35 , and can be snugly tightened against each other by nut 72 threaded on bolt 70 . consequently , the distance between the front gripping members 36 , 38 and the rear gripping member 56 can be adjustably varied to accommodate different sized backrests 30 of different chairs by loosening the nut 72 on bolt 70 , sliding the front portion 20 in relation to the rear portion 22 , and when the proper distance in obtained to securely clamp the mounting bracket 11 onto the backrest 30 , and then securely tightening down nut 72 . in order to maintain the front gripping members 36 , 38 , in parallel relation with the rear gripping member 56 , ribs 50 , 52 are provided on the lower surface of horizontal section 34 of the front portion 20 , and mating grooves 60 , 62 of corresponding size and shape are provided in the upper surface of horizontal section 54 of rear portion 22 . when the front portion 20 and back portion 22 are properly aligned , ribs 50 , 52 protrude into mating engagement with grooves 60 , 62 , respectively . consequently , relative forward and backward motion between the front portion 20 and rear portion 22 is allowed , but relative lateral or twisting movement is prevented . as best seen in fig6 one set of rib 50 and groove 60 is located in spaced relation to one side of the slotted hole 64 , and the other set of rib 52 and groove 62 is located a spaced distance on the opposite side of slotted hole 64 . also , as best seen in fig6 slotted hole 64 includes a widened portion 65 in the lower surface of horizontal section 54 to accomodate the head 71 of bolt 70 both to keep the head 71 from protruding below the remainder of the horizontal section 54 to preclude undue wearing or marking of the fabric on the chair c , and to retain the bolt 70 from turning as the nut 72 is screwed on or off . two speakers 90 , 92 , preferably a woofer and a tweeter , are mounted in each speaker housing 12 on a facia panel 93 . the facia panel 93 is comprised of two panel segments 96 , 98 in a concave configuration enjoined together at 97 , as best seen in fig8 . grille screens or fabric 94 , 95 are stretched over the speaker openings in panel 93 in the conventional manner to protect the speakers 90 , 92 from dust or damage . this concave configuration of the facia panel 93 results in both speakers 90 . 92 being aimed substantially at a focal point near the listener &# 39 ; s head . as best seen in fig7 a cylindrical sleeve 100 with a bore 102 extending inwardly from one end is integrally molded in the upper section of speaker housing 12 . a radial internally threaded hole 104 is included in the wall of the sleeve 100 , and a set screw 105 is threaded therein . one end 80 of a support arm 16 is slidably inserted into the sleeve 100 and can be secured in any desired position therein by tightening set screw 105 onto the arm 16 . the left speaker housing 14 is also provided with a similar sleeve 101 and set screw 107 for receiving the end 84 of the left support arm 18 , as best seen in fig1 through 3 . the opposite ends of support arms 16 , 18 are adjustably attached to the mounting bracket 11 as best seen in fig1 through 3 . for this adjustable attachment , an elongated sleeve 40 is rigidly attached on the upper surface of horizontal section 34 of front portion 20 . the cylindrical sleeve 40 has a bore 41 extending longitudinally therethrough from right end 42 to left end 44 . ( see also fig4 .) the ends 82 , 86 of support arms 16 , 18 , respectively , opposite those attached to the speaker housings 12 , 14 , respectively , are received in opposite ends 42 , 44 of sleeve 40 . end 82 of support arm 16 is slidably inserted into end 42 of sleeve 40 , and end 86 of support arm 18 is slidably received in end 44 of sleeve 40 . sleeve 40 also includes two spaced - apart internally threaded holes 46 , 48 into which set screws 47 , 49 , respectively , can be screwed for snugly engaging support arms 16 , 18 , respectively . thus , speaker housings 12 , 14 can be adjustably set inwardly and outwardly in relation to the chair c by sliding their respective ends 82 , 86 in sleeve 40 , and they can be adjusted upwardly and downwardly by rotating arms 16 , 18 in sleeve 40 . speaker housing 12 , 14 can also be adjusted forwardly and rearwardly by sliding arms 16 , 18 respectively the desired distances into sleeves 100 , 101 , respectively . also , by rotating speaker housing 12 , 14 on support arms 16 , 18 , respectively , the speakers 90 , 92 can be adjustably directed upwardly or downwardly . these adjustable features allow an individual listener some latitude for positioning the respective speaker housing 12 , 14 in locations that best suit his particular height , position of most comfort in the chair , and hearing ability in each ear . although not shown , it can be readily understood by one skilled in the art that electrical wires must be provided to power the speakers . the support arms 16 , 18 are fabricated with hollow cores to accommodate passage of wires therethrough from the mounting bracket 11 to the respective speaker housings 12 , 14 and appropriate conduits or ducts can be provided in the bracket 11 and speaker housings 12 , 14 to lead the wires into the support arms and to the speakers 90 , 92 . the components of the alternate embodiments illustrated in fig9 through 12 are quite similar to those just described in the preferred embodiment , including speaker housings 12 , 14 , support arms 16 , 18 , and mounting brackets 11 with front portion 20 and back portion 22 . however , instead of the slotted adjustment hole 64 in the preferred embodiment , the alternate embodiment includes a plurality of individual internally threaded holes 66 through the horizontal section 54 of rear portion 22 . a set screw 68 is inserted through the hole 35 in horizontal section 34 of front portion 20 and is screwed into a selected one of the holes 66 which provides the desired spacing between the front gripping legs 36 , 38 and the rear gripping plate 56 . also , as best seen in fig1 and 12 , the support arms 16 , 18 are asjustably connected to the speaker housings 12 , 14 , respectively , and to the mounting bracket 11 by ball and socket joints . an enlarged ball insert 83 is provided on the rear end 82 of support arm 16 and is positioned in a correspondingly sized and shaped socket 130 on the horizontal section 34 of front portion 20 . an annular lip 134 retains the ball insert 83 in socket 130 , but rotational as well as forward / backward and up / down adjustment of support arm 16 in socket 130 is accommodated . a spring 146 in chamber 144 can be provided to bias the ball insert 83 against lip 135 to frictionally maintain support arm 16 in the desired set position . a radial internally threaded hole 138 can also be provided in the wall of socket 130 for receiving a set screw 140 to maintain support arm 16 in the desired adjusted position as an alternative to or in addition to the bias spring 146 . a conduit 148 is also provided through which electrical wires can be run into the hollow core support arm 16 to the speakers 90 , 92 . the rear end 86 of support arm 18 is similarly adjustably connected to mounting bracket 11 with socket 132 and annular lip 136 and set screw 142 for a bias spring ( not shown ) to retain the support arm 18 in position . a similar ball joint connection is provided to attach speaker housing 12 to support arm 18 as best seen in fig1 . an enlarged ball - shaped insert 81 is provided on the forward end 80 of support arm 16 and is positioned in the correspondingly sized and shaped socket 110 in speaker housing 12 . an annular lip 112 retains the ball insert 81 in socket 110 , and a spring 120 in chamber 118 biases the ball insert 81 against the lip 112 to frictionally retain it in any desired adjusted position . also , a set screw 116 can be threaded into a radial hole 114 in the socket wall to engage ball insert 81 to retain it in the desired adjusted position either in addition to or an alternative to the spring 120 . the conduit 122 is provided to lead the electrical wires from support arm 16 into the speaker housing 12 for connection to speakers 90 , 92 . although the present invention has been described with a certain degree of particularity , it is understood that the present disclosure has been made by way of example and that changes in details and structure may be made without departing from the spirit thereof . | 7 |
a ) a kinetic biological component : refers to any cellular component which executes is biological function by moving from one location in the cell ( site of origin or s . o ) to another location ( site of destination or s . d ). and binding to that location . the process of movement is called translocation . the kinetic component can therefore be a protein , a polypeptide , a carbohydrate , a mucopolysaccharide , lipids or lipoproteins , nucleic acids , histones or non - histones , or components termed receptors . b ) ligand : specific ligands are those which upon binding to the normal kinetic component initiates the intracellular movement of that protein from s . o to its s . d . control ligands are those which do not bind or initiate movement of the kinetic component . ligands belong to the category of steroids hormones or non - steroid hormones , metals such as iron , molybdenum , zinc , calcium , phosphorus , or polypeptides , histones , nonhistones , nucleic acids , polynucleotides , either naturally occuring in the cells or their synthetic analogs . attachment or removal of phosphate groups also acts to trigger intracellular movement of a kinetic component ( 21 ). c ) normal versus abnormal variety of translocation : normal translocation is the pattern of translocation observed for the kinetic component found in the normal cell and is known to be crucial for the execution of its biological function . abnormal varieties refer to any deviation from that normal pattern . example : movement of the kinetic component from s . o to s . d in the absence of the specific ligand or an absence of movement of the kinetic component to s . d even in the presence of inducers . abnormalities of er translocation have been identified in malignant tissues and found to be predominant among hormone therapy resistant er + breast cancers . studying normal and abnormal translocation of the kinetic protein er and sub - classification er + breast cancers on the basis of er translocation . imprints are made from either fresh or cryopreserved ( at - 80c or lower temperature ) breast cancer biopsies on to histological glass slides . 1 . replicates of tumor imprints are made on plain glass slides for examining the cellular location of er as they exist in the tumor . 2 . replicates of tumor imprints are made on glass slides pre - coated with saline solution ( 0 . 9 % sodium chloride in distilled water ) and transferred to moisture chamber and kept at 37c for 30 minutes , to examine the effect of exposure to ligand - free saline solution at 37c . 4 . replicates of imprints are made on glass slides precoated with specific ligands to study their effect on er translocation . ( for pre - coating , saline solution of estrogen or des ( 1 - 5 nanomolar concentration ) are allowed to coat the entire surface of the glass slides and allowed to air dry ) the imprints are incubated at 37c for 30 minutes in moisture chamber . 5 . replicates of imprints are made on glass slides precoated as described above , with 1 - 5 nanomolar solution of the drug tamoxifen , to study its effect on tumor er translocation and incubated at 37c for 30 minutes . 6 . replicates of imprints are made on glass slides pre - coated with solutions of control ligands ( 1 - 5 nanomolar concentrations of org 2058 or r5020 which are specific ligands for pr , but control ligands for er ); these slides help verify whether or not tumor er translocation requires specific ligand . all the slides are processed by ethanol dehydration - rehydration procedure as described under &# 34 ; automation with varistain &# 34 ; in the specification section of this report or manually , as described in prior publications ( 1 , 3 , 5 - 7 ,). this mode of tissue fixation is mandatory for detection of er with the rabbit polyclonal ( 1 - 3 , 5 - 7 ) and monoclonal anti - er antibody 1 - f11 ( 19 , 20 ). note : ethanol dehydration rehydration procedure can be replaced with other modes of tissue fixation , previously found suitable for immunohistochemical detection of the kinetic component under scrutiny . the fixed slides are washed in saline 3 times and incubated with rabbit polyclonal or monoclonal 1 - f11 anti - er antibody ( ie : primary antibody ) for 30 minutes at 37c in moisture chamber . unbound antibody is removed by 3 saline washes and the cellular location of the antibody - bound er is detected by one of the conventional staining procedures known to prior art : indirect immunofluorescence or immunoperoxidase procedure or biotin - avidin amplified immunofluorescent or immunoperoxidase procedure , or with the use of chemiluminescent probe labelled antibodies . for staining er in tumor imprints , biotin - avidin immunoperoxidase technique was routinely employed ( 19 , 20 ). the slides were incubated for 30 minutes at room temperature , with biotin - labelled secondary antibodies ( ie : anti - rabbit antibodies , if rabbit polyclonal anti - er antibodies were employed as primary antibodies ; anti - mouse immunoglobulins , if mouse monoclonal antibody 1 - f11 was used as primary anti - er antibody ). after washing 3 times in saline to remove the excess secondary antibodies , the slides are incubated for 30 minutes with avidin which is labelled with either fluorescein or chemiluminescent probe ( immunoflourescent detection ) or enzymes ( eg : immunoperoxidase ( 19 , 20 ). detection of fluorescence is done uv microscope after removing the excess avidin reagent by three sline washes . when enzyme labelled avidin is used , the slides after washing in saline 3 times , are soaked in substrate buffer ( 0 . 1 m tris , ph 7 . 6 ) for 5 minutes , followed by five minutes in the substrate solution ( dab for peroxidase ) to allow color development , and counter stained for 5 - 8 minutes with 1 % methyl green solution ( purchased from kirkegaard and perry laboratories ). excess methyl green is washed off by rinsing the slides quickly through 90 % ( 2x ), absolute ethanol ( 3x ) and xylene ( 2x ). the slides are mounted with permount and viewed under the light microscope for brown stain indicative of peroxidase activity . color development is different , dependent upon the enzyme and the substrate system chosen for immunodetection . for each tissue specimen , an antibody - negative control is prepared as follows : one of the replicates of slides with the imprint , crysection or cell is exposed to 1 mg / ml gelatin solution made in saline instead of the primary antibody . these slides are subsequently processed identical to other slides as described above . any staining observed in these slides is to be interpreted as non - immunospecific and therefore caused by secondary reagents . these antibody control slides should be negative before the staining in other slides processed with the primary antibody is accepted as antibody specific or immunospecific staining . the stained slides are examined microscopically and percent tumor cells in which the immunospecific staining is exclusively cytoplasmic ( c + n -), both cytoplasmic and nuclear ( c + n +), or exclusively nuclear ( c - n +) are are recorded either manually or with the aid of any commercially available protocols for computerised image analysis systems . tumors in which no immunospecific staining is seen are recorded as er (-) tumors . following the protocol detailed in background section of the specification and as published previously ( 6 , 7 ), the er + tumors are subclassified as either tr + l ( with normal , ligand mediated translocation ), tr + nl ( with abnormal , non - ligand mediated translocation ) or tr (-) ( abnormal , with no evidence of translocation ). this subclassification step is accomplished either manually or with the aid of computerised image analyser . tr + l : in the absence of the specific ligand the staining is cytoplasmic ( c + n -); only in tissues on the ligand coated slides , the staining is either c + n + or c - n + among & gt ; 30 % of stained ( er +) cells . the tumor cell er is normal requiring specific ligand binding for its transformation and translocation to the nucleus and nuclear binding . tr + nl : in all the tumor cells incubated at 37 ° c ., immunospecific staining is either c + n + or c - n + among ≧ 30 % of stained ( er +) tumor cells . the tumor cell er is abnormal because translocation and nuclear binding occurs in the absence of specific ligand . tr (-): in all the slides , the immunospecific staining is c + n - among ≧ 70 % of er + cells . er is abnormal because it is unable to either transform or translocate and bind to the nucleus . method for prediction of clinical response to hormone therapy for evaluating the value of this mode of subclassification in prospective clinical trials : the mode of prediction is based on the correlative results obtained in the pilot study of retrospective analysis of 25 patients treated with hormone therapy ( 7 ). the primary tumors of these patients were among the 88 er + tumors subclassified as tr + l , tr (-) or tr + nl ( 6 , 7 ), employing polyclonal anti - er antibodies and immunofluorescent detection technique . when the tumors recurred or metastasied after surgical removal of the primaries ( as was the normal clinical practice ), these patients were treated with hormone therapy ( 7 ). current practice is to treat immediately after surgery . tr + l : tumors in this subgroup are predicted to respond to hormone therapy ( 5 / 6 patients in this category responded in the pilot study ). specific ligand is essential for er to translocate and bind to the er specific sites in the tumor cell nucleus . hormone therapy , either estrogen deprivation ( eg : surgical or chemical oophorectomy ), or oral intake of antiestrogen tamoxifen is predicted to be an effective treatment in these tumors because , er in the absence of estrogen or blocked by antiestrogen , is unable to execute its biological function . the tumor is unable to grow . tr + nl : tumors in this subgroup are predicted to fail hormonal treatment because er is able to bind to the nucleus even in the absence of specific ligand . either estrogen deprivation or antiestrogen blockers will not affect the ability of this tumor er to execute its function and therefore the cells will continue to grow under these conditions . ten out of ten patients with tr + nl tumors failed to respond to hormone therapy . tr (-): tumors in this subgroup are likely to fail hormone therapy . six out of nine patients in this category failed to respond to hormone treatment ( 7 ). er , although can bind the specific ligand , is unable to translocate and bind to the tumor cell nucleus . in the absence of normally functioning er , the tumor cells continue to grow . therefore , neither estrogen deprivation , nor antiestrogen block aborts the tumor growth . quality assurance procedures : inter - assay variability , inter - assesor consistency in sub - grouping , are performed as described in detail ( 6 ) to maintain high quality of performance . automation of the procedural steps and computerization of data collection ( computerized image analysis ) ensure high degree of reproducibility . use of staining procedures such as immunoperoxidase staining , allows storage of slides for extended period , repeat review of slides if necessary . for objective evaluation of the predictive significance of this subgrouping via clinical trials , following parameters are to be recorded for each tumor . when clinical responses are ready and available , correlation between various subgroups and clinical response , correlation between predicted clinical outcome with the observed clinical results are determined . statistical significance of the correlative data are calculated as described for retrospective analysis ( 7 ). procedure for identifying abnormalities in kinetic components other than steroid hormone receptors : illustrative example : identification of abnormalities in the translocation from cytoplasmic transcription factors associated with interferon alpha response to the cell nucleus . interferon alpha is known to prevent virus entry into normal healthy cells . interferon alpha therapy therefore became popular for certain types of cancers . not all tumors responded to this therapy . recent advances in technology has revealed that a kinetic protein , the transcription factor tf ( also called isgf3 or interferon stimulated growth factor )) is important for the functioning of interferon alpha to prevent virus entry into the cell ( 21 ). immunohistochemical test described in this invention will be useful for identifying the abnormalities in the translocation of tf which will render the cells unresponsive to interferon alpha . in the normal cell , the enzyme tyrosine kinase associated with the cell surface interferon alpha receptor is activated when the interferon ( ligand ) binds to its receptor . the activated enzyme phosphorylates the cytoplasmic tf . phosphorylated tf then translocates to the cell nuclei where it binds to interferon - responsive nuclear sites . any defect either in the interferon receptor , its tyrosine kinase , or mutation in the tf will manifest itself as a translocation abnormality of tf : inability of tf to translocate to the nucleus ; or translocation of tf in the absence of interferon binding to its receptor . in either case , the cell will be unresponsive to interferon therapy . procedural steps to identify whether or not tf shows normal or abnormal transclocation in the malignant tissue , are identical to the those described above for er , with the following modifications : interferon alpha serves as the specific ligand for coating ligand coated slides . interferon beta serves as the control ligand . imprints of tumors to be examined are made on these slides . cell smears from normal body fluids , made on ligand coated and control ligand coated slides serve as a reference standard for demonstrating normal kinetics of tf in non malignant cells . polyclonal antibodies to tf which are capable of reacting with unphosphorylated and phosphororylated forms of tf whether it is cytoplasmic or bound to the cell nuclei are used to the location of tf ( anti - tf described by chris schindler et al as referenced in the publication by jean marx ( 21 ). the processing of the slides after ligand incubation step is identical to what is described for er . the sub - classification of tf + cells is done similarly and the groups are tr + l ( normal , showing translocation only in interferon - alpha coated slides ), tr + nl ( abnormal , translocating to the nucleus in the absence of ligand ) and tr (-) ( abnormal , showing no translocation ). application of immunohistochemical test for first level screening of drugs in order to select those which have the capcity to alter the intra - cellular translocation of kinetic components found in malignancies . definitions : a drug is a pharmaceutical compound ; a component of an extract of a biological source ; a synthetic polypeptide , a polynucleotide , a mineral , metal , a nucleic acid , a carbohydrate or a lipid . a drug binds to any site present either on the kinetic component or on cellular factors which are necessary for the translocation of the kinetic component and thereby either inhibits the translocation process , or alters the abnormal patterns of translocation exhibited by the kinetic component . the term &# 34 ; pilot drug screening &# 34 ; refers to the process of examining an array of several drugs to detect which ones among them , when used in the immuno - histochemical assay system show evidence of inhibiting or altering the translocation process of the kinetic component under study . the term &# 34 ; pilot screening &# 34 ; does not include the process of proving the efficacy of the drug as a therapeutic drug via in - vivo experiments and clinical testing . procedural modifications consistent with the use of immunohistochemical test as a drug screening test include the following : a ) in addition to the specific ligand coated and control ligand coated slides , slides coated with the solution of the drug / s to be tested are included . b ) imprints of tumors pre - tested and found to contain normal or abnormal variety of translocation are made on each one of the drugs and the results compared . c ) either cryosections of normal tissues which contain the kinetic component or cell smears made from normal body fluids serve as reference standards to study effect of the drug on translocation of kinetic component expressed by normal tissues . to achieve this purpose , cryosections are thaw mounted or cell smears are made on drug coated slides and on plain glass slides for comparison . the incubation steps , tissue fixation , primary and secondary antibody application , immunostaining , sub - grouping , data collection are identical to those decribed previously for procedure a . a ) in the tr (-) tumor imprints , ( but not in the normal tissue samples ) an identification of c + n + or c - n + immunostaining in & gt ; 50 % of er + cells only in the drug coated slides is an indication of drug induced in - vitro translocation of otherwise non - translocating er . absence of such an effect in normal tissues indicates that the drug alters only the defective tr (-) variety of er found in malignancy . this drug is therefore selected for additional scrutiny for in - vivo studies . b ) in the tr + nl tumor imprinted on the drug - coated slides , an observation of c + n - immunospecific staining among & gt ; 50 % of stained cells is indicative of inhibition of abnormal nuclear binding by the drug . this drug is therefore selected for evaluating its effect on normal ligand induced nuclear binding . this is accomplished by imprinting tr + l tumors on slides coated with a mixture of the drug and specific ligand solution , in addition to the ligand coated and control ligand coated slides which are routinely included in the procedure . on comparative analysis of results , a pre - dominence of c + n + and c - n + staining in all the ligand coated slides ( whether or not drug was also present ) is indicative of exclusivity of the drug &# 39 ; s inhibitory effect to the abnormal nuclear binding only . this drug is therefore selected for further in - vivo testing . instead , a presence of predominant c + n - staining in tumor imprinted on the &# 34 ; drug plus ligand &# 34 ; slides demonstrates an inhibition of even normal nuclear binding by the drug . this drug is therefore likely to be toxic to the normal cells . table 3 illustrates these points of interpretation succintly . table 3______________________________________reference + both ligand std : type (-) ligand (+) ligand (+) drug and drug______________________________________tr (-) c + n - c + n - c + n +, c - n + c + n +, c - n + tr + nl c + n +, c - n + c + n +, c - n + c + n - c + n - tr + nl c + n - c - n + c + n - c - n + ______________________________________ note : normal type of translocation is unaffected , while the abnormal types are altered in the presence of the drug . this type of staining in the presence of the drug , even when either one of the two abnormal types of translocation are altered , the drug is to be selected for additional in - vivo studies . application of immunohistochemical test to identify the presence of components ( toxins ) in drinking water , food extracts , solutions of non - prescription drugs , food dyes , serum or plasma collected from individuals . definition of a toxin : &# 34 ; toxin &# 34 ; as specified with reference to the kinetic substances , is a component which is capable of interacting with the normal kinetic substance and inhibiting its normal ligand mediated translocation from s . o to s . d . for example , with reference to er , its ligand mediated nuclear binding is prevented . alternately , the toxin , is a component which promotes the translocation of a kinetic component in the absence of its specific ligand , thus coverting tr + l to tr + nl variety . definition of &# 34 ; toxin screening &# 34 ; as specified in this report , is restricted to the process of identification of the presence of a component in the test sample which is detrimental to the normal translocation of kinetic substances . the definition does not include the process of identifying which component is the toxin . preliminary screening as described below is the initial step towards the identification and purification of the toxin . procedural modifications are identical to those described for drug screening but the end point is different . the desirable effect of a drug is its capacity to affecting the abnormal while a toxin identified by its ability to alter the normal to abnormal . instead of drug coated slides , the solutions or body fluids to be examined for the presence of &# 34 ; toxins &# 34 ; are coated on the slides . the tr + l variety of tumor is imprinted or normal cells are smeared on these slides , along with the experimental set of slides described for procedure a . in addition , another slide is precoated with a mixture of ligand and the solution to be tested for toxin . the tr + l tumor imprinted or normal cells smeared on this slide as well . incubations , fixation , immunostaining and sub - grouping steps are performed as described for procedure a . criteria for labelling a sample as containing &# 34 ; a toxin &# 34 ; are the following : a ) presence of c + n - staining among & gt ; 50 % of er + normal cells or the reference tumor of tr + l type in the presence of a mixture of specific ligand and the solution being tested , is indicative of inhibition of normal ligand mediated translocation by the toxin . b ) the presence of c + n + or c - n + staining in normal cell smears or tr + l tumor imprints on slides coated only with the solution being tested for toxins is indicative of induction of translocation in the absence of specific ligand . in either of the situations described above , the the solution is said to contain a component which affects the translocation pattern and is therefore selected for additional verification by in - vivo culture studies . identification of the toxin - positive sample by first level screening is an initial step essential for purification of the toxic components . definition : hybridoma screening as specified in this report refers to the selection of monoclonal hybridomas which secrete anti - er antibodies with unique features : broad spectrum reactivity with both cytoplasmic and nuclear er , ligand complexed or uncomplexed ; or narrow spectrum antibodies which are specific to only defective er of tr (-) variety ; or to tr + nl variety . broad spectrum antibodies are essential for use in immunohistochemical procedures utilized for sub - classifying kinetic components on the basis of translocation abnormalities . thus , hybridoma screening does not refer to production of hybrids and selection of clones by sub - cloning , nor to the differential selection of antibody secretors from non - secretors . immunohistochemical procedure was successfully employed to screen and select a hybridoma which secretes monoclonal anti - er antibody molecules , as described in prior publications ( 19 , 20 ). the unique feature of this antibody designated 20 - f8 - 1 - g7 - 1 - f11 ( abbreviated 1 - f11 ) for which it was selected , is its ability to bind specifically to cytoplasmic er , uncomplexed or complexed with the specific ligand and with the uncomplexed or ligand complexed nuclear bound er equally well ( 19 , 20 ). in this respect , 1 - f11 , although monoclonal , is similar to the rabbit polyclonal anti - er antibody which was the primary antibody in the immunohistochemical procedure to sub - group er + tumors ( 5 , 6 , 7 ), and as reference antibody for screening 1 - f11 . this unique feature is attributed to the fact that the epitope in the er molecule which is recognized by 1 - f11 is unaffected by ligand binding , transformation and nuclear binding of er and therefore always antibody - accessible . the specificity of 1 - f11 antibodies to er and only er was documented by a variety of standard procedures known to prior art : 1 ) demonstration of ability to complex with radio - ligand bound er by sucrose density gradient centrifugation and by non - denaturing acrylamide gel electrophoresis ; c ) reduced , sds denatured cytosolic er derived from human breast tumors ; an absence of reactivity with cytosolic proteins derived from er negative tumors ; recognition of a single 65 - 69 kilodalton protein in the reduced and sds denatured cytosol of er + lamb uterine tissue and of mcf - 7 cells ; identification of a single 65 - 69 k protein in the reduced sds extracted antigen , dissociated from 1 - f11antibody - sepharose beads reacted with crude extracts of lamb uterus . 4 ) immunohistochemical procedures to show the antibody recognition of un - liganded , or ligand complexed cytosolic and nuclear er of mcf - 7 cells and to demonstrate ligand mediated translocation of er in them . 5 ) immunohistochemical procedure to document the utility of 1 - f11 antibody to identify defective er among the cell lines of human origin : mcf - 7 cells were found to contain predominantly of tr + l variety of er with polyclonal anti - er antibodies and with 1 - f11 monoclonal anti - er antibody ; anti - estrogen resistant cell line , ly - 2 was found to contain tr (-) variety of defective er with the use of polyclonal antibodies , as with 1 - f11 antibody . 6 ) immunohistochemical procedure to demonstrate the utility of 1 - f11 antibody , to sub - classify the er + breast tumors , as defective tr (-) or tr + nl or normal tr + l . the screening of hybridoma supernates ( diluted 6x or 1ox ) at the first and second level cloning resulted in the identification of 20 - f8 - 1 - g7 hybrid and subsequent selection of the final clone of 20 - f8 - 1 - g7 - 1 - f11 hybridoma ( monoclonal with igg - 1 isotype ) as a broad spectrum anti - er antibody secretor was achieved in the following manner as described in the abstracts ( 19 , 20 ). the hybridoma supernates , free of dyes were reacted with 5 micron sections of several paraffin embedded er + human breast tumors and er (-) tumors and antibody binding verified by biotin - avidin amplified immunoperoxidase staining . those hybridoma supernates which were non - reactive with er (-) tumors but were immunoreactive with all er + tumors were further examined for their recognition of cytosolic er complexed with radioactive estradiol with biochemical procedures and selected if positive , for final cloning . the secretory product of the final clones ( 1 - f11 is an example ) was additionally scrutinised for its monospecificity to er , its capacity to react with and bind to ligand - free , ligand bound , cytosolic and nuclear - bound er by a variety of biochemical and immunohistochemical procedures outlined above . the antibodies were also verified for their capacity to recognize er in the cryosections or in the imprints of tr + l , tr + nl and tr (-) sub - classes of er + tumors when tested by immunohistochemical ( procedure a ) and by biochemical procedures . procedural steps for screening hybridomas : selection of broad spectrum versus narrow spectrum monoclonal antibodies . 1 . hybridoma culture medium containing the antibody secreted by monoclonal hybridomas are dialyzed in 0 . 1m tris - edta - borate buffer ( teb ), ph 8 . 0 to remove all the phenol red dye and other small molecules . only dialyzed culture supernates are utilized for screening . 2 . employing steps described in procedure a , one set of coated slides are to be prepared for each culture supernate to be evaluated . 3 . tumor imprints are made from tumors which were pre - tested employing polyclonal anti - er antibody and classified as tr + l ( 90 % of the tumor cells showing tr + l variety of er ). 4 . after ligand incubation and fixation steps , one set of slides are to be incubated with the reference antibody ( polyclonal anti - er antibody ); each of other sets should receive one of the hybridoma culture supernates . 5 . the immunostaining procedure and data collection is the same as described for procedure a . 6 . those culture supernates which yield results identical to the reference antibody are selected as broad spectrum antibodies . these will stain cytoplasmic er in slides without the specific ligand and nuclear bound er in the ligand coated slides . 1 ) instead of tumor imprints , cultured cell lines known to be uniformly tr + l and grown on histological slides are also suitable for hybridoma screening . specific ligand or control ligand is introduced in the growth medium as described previously for mcf - 7 cells ( 3 ). slides are to be thoroughly washed free of phenol red prior to incubation with the hybridoma culture supernate . immunohistochemical staining steps and data collection are as described for procedure a . 2 ) identification of tr (-) specific or tr + nl specific hybridomas is by repeating the procedure with either imprints of tumors with these type of defects or cultured cells pre - tested to contain one of those defective types of er . hybridoma culture supernates which stain only the tr (-) or tr + nl tumors or cell lines are chosen as narrow spectrum antibodies . the selected hybridomas are expanded in tissue culture or ascites employing standard hybridoma technology known to prior art . their secretory products are re - evaluated for monospecificity to er , by employing procedures described above for 1 - f11 or as consolidated in the book &# 34 ; immunology of steroid hormone receptors vol i : estrogen receptors &# 34 ; ( 22 ). although this invention is disclosed with reference to particular embodiment , the principles involved are susceptible for use in numerous other embodiments which will be apparent to persons skilled in art . a few of those embodiments are outlined below to demonstrate the scope of this invention . the invention however is to be limited only as indicated by the scope of the appended claims . 1 . the immunohistochemical procedure described is the most economical way to detect the presence of translocation defects in a kinetic component . prior knowledge of what causes the translocation defect or the exact location of the defect are not necessary . what is required is a broad spectrum antibody , either poly or monoclonal , which reacts with both the normal and defective kinetic component . therefore , an immunohistochemical staining kit can be devised containing the embodiments of this procedure for detecting translocation defects of kinetic component . 2 . either the polyclonal anti - er antibodies ( 1 - 3 , 5 - 7 ) or monoclonal anti - er antibodies designated 1 - f11 , may be used in a kit either as a whole molecule , as fab fragments which retain the antibody &# 39 ; s unique characterisitics , or as genetically engineered antibody fragment with identical properties , for predicting which among er + malignancies are clinically susceptible to hormone therapies and which will be resistant to such therapies . thus , these antibodies or their biologically active fragments may be supplied in a kit designed as predictive kit for cancers of the breast , endometrium , prostate or cancers of the nervous system and of those tissues which are er + and hormone therapy is offered as a treatment modality . 3 . the embodiments of this procedure may be included in a kit for sub - classification of er + malignancies , a kit to screen for drugs which may have potential use to treat those malignancies , or a kit intended for both subclassificaton of tumors and for drug screening . this procedure offers a convenient method for simultaneous screening of er + malignancies for defective and non - defective er and for customising a most effective drug treatment for each tumor . testing the efficacy of the drug to alter the nuclear binding of er in each tumor can be achieved with this method . 4 . the embodiments of this procedure may be included in a kit for use in the identification of toxins in food , drinks , drinking water or in non - prescription drugs , since this procedure offers an economical method for screening for toxins which affect the translocation process of kinetic components , including steroid hormone receptors . 5 . the embodiments of this procedure may be included in a kit for hybridoma screening because this procedure is useful for selecting hybridomas which secrete broad spectrum antibodies specific to any kinetic component ( example : interferon induced translocation of transfer factors ) or cellular factors related to kinetic components which are capable of interacting with and binding to a kinetic component whether it is ligand free , or ligand bound ; whether it is present in s . o or as bound to s . d . 6 . the immunohistochemical procedure can be applied to identify whether or not a newly discovered gene product is a kinetic component ; if it is , to define inhibitors and inducers of its intracellular translocation ; to detect abnormalities of translocation in diseased tissues in which the component is present . 7 . with the described procedure , the individual chromosomes to which a nuclear binding component binds , can easily be identified ; abnormalities in chromosome binding of the component detected . diseases in which erroneous binding of a regulatory protein to a ` wrong ` chromosome or to a wrong location in the ` right ` chromosome can easily be identified with the use of cells which are programmed to enter the growth phase . 7 . the immunohistochemical procedure should become an excellent tool for molecular biologists and biochemists who are investigating gene regulation and signal transduction . identification of transcription factors which are essential for transcribing a newly discovered regulatory pathway or a gene product , is an expensive multistep process , with biochemical or molecular cloning approaches . applying the immunohistochemical procedure as described , equipped with a broad spectrum antibody to a kinetic regulatory protein , a straight forward identification of defects in its translocation are identified first . next , a comparison of structural components of a normal translocator versus defective non - translocator will provide a clue regarding those transcription factors which are essential to induce intracellular translocation of a nuclear binding component . | 8 |
hereinafter , a description will be made to embodiments of the present invention with reference to the accompanying drawings . fig1 is a schematic diagram showing a schematic configuration of a steam turbine to which the present invention may be applied . in fig1 , a reference numeral 1 denotes a steam turbine , which comprises a high - pressure turbine 2 , a middle - pressure turbine 3 , and two low - pressure turbines 4 a and 4 b . among those , the geothermal steam supplied e . g . from a geothermal fluid production well 5 of a geothermal power plant is separated by a high - pressure separator 6 into steam and hot water . the separated steam is washed and supplied to the high - pressure turbine 2 through a scrubber 7 to remove mist . with the steam supplied to the high - pressure turbine 2 , a turbine rotor 2 r is rotated . the steam of which kinetic energy for rotating the turbine rotor 2 r is released in the high - pressure turbine 2 is then supplied to the middle - pressure turbine 3 where a turbine - rotor 3 r is rotated . the steam of which kinetic energy for rotating the turbine rotor 3 r is released in the middle - pressure turbine 3 is finally supplied to the low - pressure turbines 4 a and 4 b where a turbine rotor 4 r is rotated . then , the steam of which most of kinetic energy is exhausted that is emitted from the low - pressure turbines 4 a and 4 b is condensed by a steam condenser 8 for condensation and the condensed water is heated by a hot well pump 9 . the greater part of the heated condensed water is in turn supplied to a cooling tower 10 for cooling , and the residual is reheated by a condensed water re - injection pump 11 . the reheated condensed water is supplied to an injection well 12 to ultimately return buck to the underground . cold water cooled in the cooling tower 10 is returned buck to a water sprinkle header 8 a of the steam condenser 8 . hereupon , each of the low - pressure turbines 4 a and 4 b , as shown in fig2 , is provided with casing 21 and a turbine rotor 4 r rotatably arranged within the casing 21 . the casing has a steam inlet 22 formed at its center to which steam supplied from the middle - pressure turbine 3 flows . at a position opposed to the steam inlet 22 of the turbine rotor 4 r , a pair of reaction blades 23 is provided . further , at the outside of the reaction blades 23 of the turbine rotor 4 r , a low - pressure blade cascade 24 is respectively provided as a turbine blade cascade , and at a shaft end of the low - pressure blade cascade 24 , a steam outlet 25 is formed . the low - pressure blade cascade 24 , as shown in large sizes in fig3 , is alternately provided with a moving blade 24 m mounted on the turbine rotor 4 r and a static blade 24 s mounted on the casing 21 . the length of the moving blade 24 m and and the static blade 24 s in a radial direction is set such that the length gets longer in order as it goes toward outside from the center of the turbine rotor 4 r . here , the turbine rotor 4 r is made e . g . of 1 % crmov steel and 12 % cr steel , etc ., and the moving blade 24 m is made e . g . of 13 % cr steel . at an upper position at a rotor fitting section side in an inner peripheral surface of the casing 21 that is positioned close and opposite to a tip of the moving blade 24 m at the center in an axial direction of the low - pressure blade cascade 24 , a corrosion factor measuring device 31 of a corrosion factor monitoring device 30 is arranged . as shown in fig3 and 4 , the corrosion factor measuring device 31 has a communication hole 32 open to an inner peripheral surface of the casing 21 drilled at a position shifted to the inside in an axial direction from the tip of the moving blade 24 m which is provided in an inner wall 21 a of the casing 21 . further , the corrosion factor measuring device 31 , as shown in fig4 , has a condensing mechanism 33 which communicates with an inner end of the communication hole 32 . the condensing mechanism 33 has a condensation chamber 34 communicating with the communication hole 32 and a temperature control section 35 surrounding the communication chamber 34 . the condensation chamber 34 comprises a condensed water storage 37 , one end of which communicates with the communication hole 32 and the other end of which communicates with a low - pressure side of the inside of the casing 21 via a single - stage or a multi - stage orifice 36 to extend in an axial direction of the turbine rotor 4 r ; and a condensation chamber 38 upwardly extending from a middle part of the condensed water storage 37 . herein , the condensed water storage 37 is configured to have a structure for imitating a clearance gap of corrosive - prone parts at an inner peripheral side of the casing 21 . an example of the structure imitating the clearance gap includes fitting clearance formed between the moving blade 24 m and the turbine rotor 4 r , and a clearance gap formed between the tip of the moving blade 24 m and the casing inner wall 21 a of the casing 21 , etc . the temperature control section 35 comprises a cooling section 39 surrounding the condensing section 38 , and a communicating section 40 communicating with the cooling section 39 to further communicate with the outside of the casing 21 . in the cooling section 39 , a peltier element 41 is arranged , as a cooling member , at the outside of a peripheral wall of the condensation section 38 . the cooling section 39 and the communicating section 40 have at an outer peripheral side an air passageway 42 to supply cooled air from the outside of the casing 21 to the cooling section 39 , the inside of which is communicated with an air inlet of a heat radiating fan 43 . this emits toward the outside air within the cooling section 39 by activating the heat radiating fan 43 , which is heated by a heating section at the outer peripheral side of the peltier element 41 . then , a tip of a corrosion potential sensor 51 , a ph sensor 52 , and a chloride ion sensor 53 as a corrosion factor sensor is immersed into the condensed water stored in the condensed water storage 37 . the corrosion potential sensor 51 has a sample member electrode 51 a made of the same material ( 13 % cr steel ) as that of the moving blade 24 m serving as a structural member , and a reference electrode 51 b . lead wires 51 c , 51 d , 52 a , and 53 a pulled out from the corrosion ion sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 are extended to the outside of the casing 21 , through the inside of the cooling section 39 and the communicating section 40 , and are connected to the corrosion factor analyzer 54 . in the corrosion factor analyzer 54 , evaluation and judgment processing of the corrosion factors is performed based on corrosion potential , ph , and chloride ion concentration detected by the corrosion potential sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 . ( a ) an account is given of plural corrosion factors ( corrosion potential , ph , and chloride ion concentration ) of the steam turbine . the chloride ion concentration is a main corrosion factor of the steam turbine , which brings about formation of chloride , generation of hydrogen ion by hydrolysis of the chloride , a rise in hydrogen ion concentration . that is , in the event of occurrence of corrosion pitting caused by chloride ion , it tends to rise in the chloride ion concentration in the corrosion pitting . ph is representative of the hydrogen ion concentration in solution . the raise in the hydrogen ion concentration ( i . e ., ph decrease ) accelerates ionization ( i . e ., oxidation reaction ) of a member . the corrosion potential is indicative of corrosivity versus the solution to which each member is touched . the higher the potential is , the larger the corrosion - prone is . the higher the hydrogen ion concentration is , the higher the corrosion potential is . ( b ) as for a specific corrosion factor , the geothermal steam turbine includes carbonic dioxide gas and hydrogen sulfide . the carbonic dioxide gas changes into carbonic acid in the condensed water where hydrogen ion is generated . the hydrogen sulfide constitutes iron sulfide that plays a role of protection of a surface of the member , but may decompose by an action of chloride ion , causing pitting corrosion . as stated in the above , the corrosion potential is affected by chloride ion concentration and ph , and therefore it could be a parameter representing to what extent corrosion is progressed in the member . what is important from a prevention maintenance standpoint is to know a primary factor of corrosion potential fluctuations . measuring basic factors such as the ph and the chloride ion concentration provides more accurate understanding and prospection of corrosion conditions , and improves the accuracy of what for attention should be paid in steam environment , which helps precise determination as to which countermeasures have to be taken to operation and maintenance . hereupon , the measures to operation and maintenance include setting of a replacement cycle of the moving blade 24 m and injection control of corrosion protection chemicals , etc . as evaluation and judgment processing of the corrosion factors , the processing involves measuring by means of a potentiometer corrosion potential by measuring potential of the sample member electrode 51 a and potential of the reference electrode 51 b detected by the corrosion potential sensor 51 for measuring corrosion potential ; comparing fluctuations of the measured corrosion potential with fluctuations of simultaneously measured ph and chloride ion concentration ; determining whether fluctuation factors of the corrosion potential are due to a decrease in a ph and a rise in the chloride ion concentration ; and conducting injection control of corrosion protection chemicals efficacious to suppress the ph decrease and the rise in the chloride ion concentration depending on the determined results . the corrosion factor analyzer 54 is provided with the residual life diagnostic equipment for predicting the life of the moving blade 24 m using e . g . the corrosion potential and damage degradation characteristic data for the moving blade 24 m . herein , the damage degradation characteristic data which is data obtained e . g . by experimentally finding in advance a correlation between a damage degradation rate indicative of influence on corrosion damage to the moving blade 24 m and the corrosion potential for representing the correlation as a characteristic map or a prediction model formula . the characteristic map or the prediction model formula is previously stored in a storage device . by referring to the characteristic map based on the measured corrosion potential , or by substituting the measured corrosion potential for the prediction model formula , a prediction is made about to what extent the damage degradation is progressed in the moving blade 24 m , thus predicting the residual life of the moving blade 24 m . subsequently , based on the predicted residual life of the moving blade 24 m , a replacement period of the moving blade 24 m is set . moreover , the corrosion potential analyzer 54 has a corrosion environment state determining device installed therein for comparing the corrosion factor measured data , such as corrosion potential , ph , and chloride ion concentration , etc ., measured by the corrosion factor measuring device 31 with a range of control criterion of a corresponding corrosion factor , and for raising an alarm when the corrosion factor measured data goes beyond the range of control criterion . an explanation will next be made to an operation of the above - mentioned embodiment . as shown in fig1 , geothermal steam belched out from the geothermal fluid production well 5 is separated by the high - pressure separator 6 into steam and hot water , and the separated steam is supplied to the scrubber 7 where the steam is washed to remove mist , and thereafter flows to the high - pressure turbine 2 of the steam turbine 1 . the steam causes the turbine rotor 2 r of the high - pressure turbine 2 to rotate where kinetic energy of the steam is released to rotate the turbine rotor 2 r , then is supplied to the middle - pressure turbine 3 to rotate the turbine rotor 3 r , and finally is supplied to the low - pressure turbines 4 a and 4 b to rotate the turbine rotor 4 r . the steam of which most of energy is exhausted that is emitted from the low - pressure turbines 4 a and 4 b is condensed by the steam condenser 8 for condensation and the condensed water is heated by the hot - well pump 9 . the greater part of the heated condensed water is supplied to the cooling tower 10 for cooling , and the residual is reheated by the condensed water re - injection pump 11 to supply to the injection well 12 . the reheated residual is ultimately returned back to the underground . steam temperature of the steam turbine 1 in operation reaches 500 to 600 ° c . or so at a high temperature section , and rises to 100 to 200 ° c . at a low pressure section as well . the reason why the corrosion factors occur and progress are primarily due to condensation of steam , a change into aqueous solution , production of water , occurrence of an electrochemical corrosion reaction of the member , and progress of the corrosion reaction . there is some possibility that the condensed water could occur incidental to temperature reduction within the turbine in suspension , or in fitting clearance between the moving blade 24 m and the turbine rotors 2 r to 4 r in operation . the condensed water is more likely to occur in the low - pressure section at which temperature in the turbine is relatively low . therefore , with measurement of the corrosion factors at the low - pressure turbines 4 a and 4 b , it enables understanding of corrosion environment conditions . in the present embodiment , as shown in fig3 and 4 , the corrosion factor measuring device 31 of the corrosion factor monitoring device 30 is arranged , which communicates with an inner peripheral surface opposing , at slight intervals , a tip of the moving blade 24 m of the turbine rotor 4 r of the casing 21 of the low - pressure turbines 4 a and 4 b , for allowing introduction of steam thereinto . in the corrosion factor measuring device 31 , steam is introduced through a communication hole 32 formed in an inner peripheral wall of the casing 21 into the condensation chamber 34 . more particularly , the steam introduced through the communication hole 32 enters a condensing section 38 provided upward thereof via the condensed water storage 37 at its low pressure side end of which an orifice 36 is provided . in the condensing section 38 , a peltier element 41 is arranged therearound . thus , supplying a direct current to the peltier element 41 exhibits its cooling effect , and cools the inside of the condensing section 38 . this condenses steam into condensed water , and then is stored in the condensed water storage 37 . at that moment , the heating section at the outer periphery side of the peltier element 41 generates heat , but heated air in the temperature control section 35 is suctioned by the heat radiating fan 43 to the outside of the casing 21 by actuating the cooling fan 43 . in keeping with this , cooling air standing outside of the casing 21 is introduced through an air passageway 42 into the cooling section 39 . since in the condensed water storage 37 , the tip of the corrosion potential sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 as a corrosion factor sensor is immersed into the condensed water , it allows detection of corrosion potential , ph , and chloride ion concentration , during operation of the low - pressure turbines 4 a and 4 b , by means of the corrosion potential sensors 51 , the ph sensor 52 , and the corrosion potential sensor 53 . these sensors 51 , 52 , and 53 are coupled to the corrosion factor analyzer 54 arranged outside of the casing 21 through the cooling section 39 and the communicating section 40 of the temperature control section 35 . on this account , in the corrosion factor analyzer 54 , a potential difference between the sample member electrode 51 a and the reference electrode 51 b of the corrosion potential sensor 51 is measured by the potentiometer for measuring corrosion potential . the measured corrosion potential is stored in a corrosion factor memory area in the storage device , and an input ph value and a chloride ion concentration value are also stored simultaneously in the corrosion factor memory area . in this way , since the corrosion potential , the ph , and the chloride ion concentration are stored , at predetermined time intervals , in the corrosion factor memory area , comparing the present corrosion potential , the ph , and the chloride ion concentration with the past corrosion potential , the ph , and the chloride ion concentration stored in the corrosion factor memory area allows correct understanding of fluctuations of the corrosion potential , the ph , and the chloride ion concentration . at this time , the comparison of fluctuations of the corrosion potential with the fluctuations of the ph and the chloride ion concentration enables discrimination of whether fluctuation factors of the corrosion potential are due to a rise in hydrogen ion concentration caused by ph a decrease , due to a rise in hydrogen ion concentration caused by a rise in the chloride ion concentration , or due to the both of the ph decrease and the rise in the chloride ion concentration . for this reason , if the fluctuation factors are due to the ph decease , injection of corrosion protection chemicals , efficacious to increase ph , into a steam system of the steam turbine 1 is controlled to suppress the rise in hydrogen ion concentration . otherwise , if the fluctuation factors of the corrosion potential are due to the rise in the chloride ion concentration , injection of corrosion protection chemicals , efficacious to suppress the rise in the chloride ion concentration , into the steam system of the steam turbine 1 is controlled for carrying out corrosion protection processing . by referring to a characteristic map of the damage degradation characteristic data stored in the storage device based on the measured corrosion potential , or by substituting the measured corrosion potential for a prediction model formula , the residual life of the moving blade 24 m is predicted and a replacement period of the moving blade 24 m is set based on the predicted residual life of the moving blade 24 m . in this manner , according to the above - mentioned embodiment , the condensing mechanism 33 is provided within the casing 21 of the low - pressure turbines 4 a and 4 b of the steam turbine 1 to introduce steam standing between the moving blade 24 m and a casing inner wall 21 a for condensation . therefore , it is allowed to produce condensed water by condensing steam by means of the condensing machine 33 during operation of the low - pressure turbines 4 a and 4 b ; detect the corrosion potential , the ph , and the chloride ion concentration , as corrosion factors , contained in the produced condensed water by means of the corrosion potential sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 , respectively ; and supply a detection signal to the corrosion factor analyzer 54 . thus , it enables at all times correct measurement of the corrosion factors contained in the steam in the low - pressure turbines 4 a and 4 b in operation . consequently , it makes it possible to take an exact measure of operation and maintenance such as prediction of the residual life of the moving blade 24 m , and injection control of the corrosion prevention chemicals by the corrosion factor analyzer 54 based on the measured corrosion factors . what is more , since it is configured to energize the peltier element 41 to the condensing section 38 in the condensing mechanism 33 to cool steam for condensation , downsizing of the arrangement of the condensing mechanism 33 can be achieved . moreover , since the orifice 36 is provided at the low - pressure side of the condensed water storage 37 in the condensing mechanism 33 , it prevents a direct outflow of steam having relatively high pressure supplied from the communication hole 32 to the low - pressure side in the casing 21 . this keeps pressure in the condensed water storage 37 at a relatively high level , thereby exerting no influence on the steam within the casing inner wall 21 a of the casing 21 . while in the aforesaid embodiment , a description was made , giving an example , where the heat radiating fan 43 is provided to introduce cooling air into the temperature control section 35 , not limited thereto , a blower fan may of course be communicated with the air passageway 42 , in place of the heat radiating fan 43 . further , in the aforesaid embodiment , while a description was made , giving am example , where the corrosion factor analyzer 54 is provided in both of the low - pressure turbines 4 a and 4 b to analyze corrosion factors of the low - pressure turbines 4 a and 4 b in operation , not limited thereto , it may of course analyze the corrosion factors of the low - pressure turbines 4 a and 4 b by one corrosion factor analyzer 54 . furthermore , a description was made , giving an example , where the damage and degradation life of the moving blade 24 m is predicted based on a measured value of the corrosion factors in operation by the corrosion factor analyzer 54 . in this occasion , it may sample the condensed water produced with temperature reduction of steam in the casing 21 when the low - pressure turbines 4 a and 4 b are stopped , detect corrosion factors of the sampled condensed water by means of the corrosion potential sensor , the ph sensor , and the chloride ion sensor , supply the corrosion factors to the corrosion factor analyzer 54 . subsequently , a correlation between a corrosion factor measured value in operation and a corrosion factor measured value of the condensed water sampled from an actual machine in suspension is found to take it as a management factor , which strives for accuracy improvement of the measured value of the corrosion factors . in this case , as a candidate of condensed water sampling parts by the actual machine , it would be preferable to select corrosion - prone parts , including a fitting clearance gap formed between the moving blade 24 m and the turbine rotor 4 r , a surface of the moving blade 24 m , and a surface of the turbine rotor 4 r , etc . further , while in the aforesaid embodiment , a description was made , giving an example , where the corrosion factor analyzer 54 is installed outside of the casing 21 , not limited thereto , it may of course install the corrosion factor analyzer 54 inside of the casing 21 , on condition that one takes measures so as not to be subject to influence of temperature and humidity . moreover , since in the aforesaid embodiment , the condensed water storage 37 is provided in the condensing mechanism 33 , with any condensed water sampling mechanism provided to take out , outside of the casing 21 , the condensed water stored in the condensed water storage 37 , it allows sampling of the condensed water in operation . besides , with the corrosion factors of the sampled condensed water detected by the corrosion factor sensor , it becomes possible to determine aging degradation of the corrosion potential sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 of the corrosion factor measuring device 31 , thereby correcting detected values from each sensor 51 to 53 . an explanation will next be made to a second embodiment of the present invention in terms of fig5 . the second embodiment is excogitated for ease of replacement of the corrosion factor sensor . namely , in the second embodiment , as shown in fig5 , it is configured to arrange a conduit 61 in the casing 21 of the low - pressure turbines 4 a and 4 b , which extends from an outermost periphery outer casing 210 to the condensed water storage 37 of the condensing mechanism 33 passing through the inner casing 21 i ; insert the corrosion potential sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 , as a corrosion sensor , into the conduit 61 to immerse a lower end of these sensors 51 to 53 into the condensed water stored in the condensed water storage 37 . an end projecting from the outer casing 210 of the conduit 61 is sealed by a detachable sealing lid 62 for holding lead wires 51 c , 51 d of the corrosion potential sensor 51 , a lead wire 52 a of the ph sensor 52 , and a lead wire 53 a of the chloride ion sensor 53 , with inserting these lead wires thereinto . the conduit 61 is movably attached between a condensed water blocking position at which a lower surface of the conduit 61 contacts the base of the condensed water storage 37 and a condensed water passing position at which the passing position is substantially flush with an upper surface of the condensed water storage 37 . according to the second embodiment , when replacing one or plural sensors consisting of the corrosion potential sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 , the lower surface of the conduit 61 first contacts the base of the condensed water storage 37 to thereby block intrusion of high - pressure steam within the casing inner wall 21 a . in this state , the sealing lid 62 is detached from an upper end of the conduit 61 to open the upper end of the conduit 61 , and a lead wire of the sensor to be replaced is pulled out . thereby , the sensor to be replaced is taken out outside of the outer casing 210 from the conduct 61 and the lead wire is also removed from the sealing lid 62 . then , a new lead wire of the sensor is inserted into the sealing lid 62 , a sensor is inserted into the conduit 61 , under conditions where the sensor is adjusted to the length enough for the sensor to immerse into the condensed water , the sensor is inserted into the conduit 61 , and the sealing lid 62 is attached on the upper end of the conduit 61 . next , the conduit 61 is raised such that its lower surface is substantially flush with the upper surface of the condensed water storage 37 , and condensed water is poured into the conduit 61 , so that the lower surface of the corrosion potential sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 is immersed into the condensed water . in this wise , constructing the conduit 61 in a movable fashion between the condensed water blocking position and the condensed water passing position blocks outflow of steam inside of the casing inner wall 21 a to the outside of the casing 21 , through the conduit 61 , even when the low - pressure turbines 4 a and 4 b are in operation . this ensures easy and safety once or multiple times replacements of the corrosion potential sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 serving as a corrosion factor sensor . it is to be noted that while in the first and the second embodiments , a description was made , giving an example , where the three sensors consisting of the corrosion potential sensor 51 , the ph sensor 52 , and the chloride ion sensor 53 are applied , as a corrosion factor sensor , not limited thereto , only the corrosion potential sensor 51 may be provided , or may be added an electric conductivity sensor to detect electric conductivity of the condensed water , to simultaneously measure electric conductivity of the condensed water in order to aim at accuracy improvement of the corrosion factor analysis . in addition , where steam contains carbonic dioxide gas and hydrogen sulfide as in the case of steam of a geothermal plant facility , it may also add a carbonic dioxide gas sensor and a hydrogen sulfide sensor , as a corrosion factor sensor , for the purpose of further improving accuracy of corrosion factor analysis . further , whereas in the first and the second embodiments , a description was made , giving an example , where the steam turbine 1 is applied to the geothermal plant facility , not limited thereto , the steam turbine 1 may apply to a thermal power station facility and another any facilities . furthermore , while in the first and the second embodiments , a description was made , giving an example , where the steam turbine 1 is provided with two low - pressure turbines 4 a and 4 b , not limited thereto , the present invention may be applied to an instance where only one low - pressure turbine is provided . moreover , while in the first and the second embodiments , a description was made , giving an example , where the peltier element is applied as a cooling member of the condensing mechanism 33 , not limited thereto , another cooling device may be applied . industrial applicability according to the present invention , the present invention may provide the corrosion environment monitoring system and the corrosion environment monitoring method capable of measuring corrosion factors within the steam turbine for ensuring accurate corrosion environment monitoring . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiments but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims , which scope is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures as is permitted under the law . | 6 |
a system in accordance with the invention receives information in an open , non - proprietary form , concerning articles and circumstances affecting articles . this information becomes physical objects and context objects , and their attributes , in the system . in this specification , the term ‘ physical object ’ will be used to refer to data that corresponds to and is used as a representation of any article . in any particular implementation , a physical object can be implemented as an object in the object - oriented programming sense of the term ; however , it can also be implemented in any other convenient way , for example , by a record in a database . similarly , the term ‘ context object ’ will be used to refer to data that corresponds to and is used as a representation of tangible and intangible things , including , by way of example , relationships and events . physical and context objects may also be referred to as virtual articles and virtual circumstances . generally , context objects are created and maintained because they represent something — which may generically be called a circumstance — that has the potential of affecting an article represented by a physical object . one example of circumstances are geospatial events , which can include , for example , hurricanes which can impede the transit of a transport ship carrying the articles being tracked , a labor strike which can prevent the unloading of the articles from the transport ship , and a traffic accident which can delay delivery of the articles . the term hierarchies refers to associations or relationships between and among articles and circumstances . for example , given a can in a pallet of cans , events that affect the pallet also affect the can . context objects can represent hierarchies . the system receives information from a variety of sources , which can be coupled to the system through a network such as the internet or directly . the system can be configured to receive information from sources with proprietary or non - open interfaces , in which case the format of the information is converted to be compatible with the system . the system includes data input devices , for example , tag readers , sensors , and scanners . through such devices , the system can continuously track and log the state of the articles and circumstances represented by physical and context objects . the state of an article can includes its status , attributes , and location . as shown in fig1 a context - aware and real - time tracking system in accordance with the invention can be implemented with a tagging component (“ tc ”) 102 , an object interface component (“ oic ”) 104 , a communication middleware component (“ cmc ”) 106 , a context - aware intelligence component (“ caic ”) 108 , and a human interface component (“ hic ”) 110 . in an alternative implementation , the hic 110 is integrated with the other components . each of these components can be implemented as computer programs executing on one or more computers and controlling devices performing data acquisition , output , and transmission functions . fig1 also shows communication flows ( represented by arrows ) between and among the components of the context - aware and real - time tracking system as well as between the system and external applications 112 , external marketplaces 114 , and other , external context - aware and real - time tracking systems 116 . the communication flows can be implemented in any convenient , open fashion , such as through the exchange of xml documents . the components are arranged in a distributed , real - time , and event - based architecture . each or all components or any combination of the system &# 39 ; s components can be implemented on a micro up to a macro level . micro level implementation refers to implementation on a single device and macro level implementation refers to implementation on multiple devices such as computers in a network . each component can be distributed across multiple devices , including computers , that are interconnected by a network . each component can be made up of , that is , implemented as , multiple different applications , which in the aggregate perform the functions of the component . the described component architecture allows the system to group and scale functionality from a local to a global level while assuring that hardware and software can be readily integrating using non - proprietary , standard interfaces . a component can include software systems — which includes any software , applications , computer program products — and related devices . for example , a software system can be applications and servers operating on an enterprise - level . communication between or among software systems can take place through a communications network . the components expose non - proprietary , open interfaces for services that are accessible through a network , such as one based on open standards like xml over http . the following text further describes the components . articles introduced to the system are tagged with a unique identifier by any available article - level tagging technology , for example , active and passive radio frequency identification (“ rfid ”) tags , barcodes , and tags that can be applied on a molecular basis . when the system first becomes aware of an article or circumstance , it will be said to be introduced to the system ; and a corresponding object is created . this physical or context object will also be said to be introduced to the system , and it will be referred to as an “ introduced object .” the system assigns a specific dynamic n - dimensional context and attribute space to introduced objects . for example , the system can assign owner , price , lot number , and temperature to an introduced object . optionally , the system attaches specific rules to the introduced objects . for example , the system can attach a rule specifying that if the temperature of the corresponding article reaches level y , then cause action z . the tc 102 of a particular implementation specifies in an open way which tagging technologies can be used with the system and how they are used . the tc 102 includes a distributed knowledge system based on internet technology . specifically , the tc 102 generally will include and provide a specification of the globally unique identifier and how to apply it ; catalogues describing the specifications of compliant tags , their reader / writer hardware and all aspects concerning their use ; specific standards and laws that apply to the tagging of articles ; specifications of standardized communication and context data formats and interfaces ; specifications of read and write processes , processing and transmission requirements for active tags , and telemetry data specifications ; best industry practices , that is , knowledge relating to selection and deployment of tags and tag content ; security and authorization requirements and standards ; benchmarks ; implementation guides ; and frequently asked questions . in addition , the tc 102 can provide tools , content , software development kits , and applications that enable manufacturers , system integrators , and customers to identify , validate , and implement optimal article - tag - reader / writer combinations and standards for specific scenarios . the tc 102 can be built with any software development environment to fulfill the above - mentioned requirements . the oic 104 transforms data from attached hardware to the system and vice versa . the oic 104 can also perform any required local processing . the oic 104 is a sophisticated , generic , bi - directional , and smart software interface between the system and the real world . here , physical objects and context objects are introduced to the system and their status and telemetry data are received , filtered , transformed , pre - processed , and processed as necessary . because physical objects and context objects can be implemented to carry rules that can trigger alert events or cause actions depending on current context or status data , the oic 104 can be implemented to embed or link to a rule engine to process these kinds of rules . by customizing the oic 104 , customers can specify what the oic 104 should do if one of the customer &# 39 ; s tag readers detects an article tag — which will have an identifier that the system can map to a unique system identifier (“ uid ”)— for the first time . such actions can include communication with external applications , for example , erp ( enterprise resource planning ) applications . the oic 104 also generically specifies and validates how tag interface hardware , for example , rfid readers , barcode scanners , polymer tag readers , and sensors , and its operating software communicate with the system . consequently , oic 104 acts as a generic software wrapper around all tag - specific read / write devices , which provides standardized integration ; data validation , filtering , and transformation ; bi - directional , event - based secure communication ; and data pre - processing . because the oic 104 is not only able to receive data but also can send data to hardware and software attached to the system , and ultimately to the tagged articles themselves , the system can use the oic to write data to such articles or control them remotely , if they are configured for such control . the oic 104 can apply and enforce a sophisticated security scheme for all inbound and outbound communication , for example , one based on digital certificates . the oic 104 can be built with any software development environment that fulfills the above - mentioned requirements . the components communicate by sending and receiving standardized events , which the components can send and receive through a network . the cmc 106 validates and routes standardized events between the oic 104 and the caic 108 ( which will be described below ) and , in general , between or among any of the system components . the cmc 106 can also validate and route standardized events between or among any of the system components and other applications , devices , and components . the cmc 106 performs functions such as data and authentication validation , storage and retrieving , archiving , data decryption / encryption , and multicasting of events . the cmc 106 can apply and enforce a sophisticated security scheme for all inbound and outbound communication , e . g ., one based on digital certificates . the cmc 106 can be built with any software development environment that fulfills the above - mentioned requirements . the caic 108 includes logic that provides the intelligence for the system to receive , process , and respond to queries concerning what , where , and how tagged articles represented by introduced objects are , were , or will be at a specific time in relation to each other or in relation to features of the real world . the caic 108 offers open internal and external interfaces to plug - in additional features such as applications and rules , extending its generic set of services . as mentioned earlier , the system can include context objects that represent events that potentially can affect articles . examples of such events include hurricanes , points or areas of high temperatures , and slow traffic . context objects can also describe a specific relationship between or among articles . context objects can also describe attributes of articles . examples of attributes include a geospatial route , a velocity , and a destination . telemetry readings of sensors can also be introduced as context objects . the caic 108 includes a database that allows the system to store and retrieve the current state of introduced objects as well as the history of state changes of these objects . this database can process geospatial data and can be distributed over multiple computers and multiple sites . the caic 108 can apply and enforce a sophisticated security scheme , such as one based on digital certificates , for all inbound and outbound communications . the caic 108 can be built with any software development environment that fulfills the above - mentioned requirements . the hic 110 generically integrates a multitude of technologies suited to allow human beings easy access to and control of the system . these technologies include , e . g ., html or xml - based , voice controlled , stylus controlled and multi - modal human interfaces including all kinds of data visualization technologies and the like . the hic 110 separates the application and infrastructure layer from the representation and human interaction layer . the hic 110 can apply and enforce a sophisticated security scheme , such as one based on digital certificates , for all inbound and outbound communication . the hic 110 can be built with any software development environment that fulfills the above - mentioned requirements . in operation , physical and context objects can be introduced to the system using standardized parameterized events that include at least a system uid . additionally , specific attributes , methods , and rules can be attached to the introduced object ( e . g ., current temperature , current owner , manufacturer , temperature exceptions , alerts , rules , data access , and authority specifications ). the system maps all introduced objects to a system uid . for the system to be able to scale from a local to a global level and also integrate satisfactorily with other systems , this identifier should be globally unique . if the referent of the object has a tag with an identifier that is globally unique , that identifier can be — but need not be — used as the uid . one such unique identifier is the electronic product code ( epc ) of the mit ( massachusetts institute of technology ) autoid center . fig2 illustrates the format of the epc . one way of uniquely tagging articles is to attach rfid chips to them . these electronic chips hold at least a relatively unique identifier that can be read by specific reader devices . more sophisticated chips feature dynamic data storage with external read / write abilities and smart chips include built - in processing power . one advantage of rfid technology is the ability to automatically identify a multitude of articles over a distance without the need to disassemble or unpack them . alternatively , the system can use other technologies , such as item - level bar codes , magnetic tags , and polymer tags , to tag physical objects with identifiers that can be mapped to a system uid . the system communicates internally and externally by using events . table 1 provides an example an xml document representing such an event . any convenient form of representing events can be used . the system maps every introduced object to system - wide standardized dimensions of time , space ( 3 - d ), unique identity ( uid ), and context . the system saves input data with system - wide synchronized time stamps . space refers to everything from a point ( pure location ) to a complex three - dimensional polyhedron in a three - dimensional space ( representing , e . g ., location , size , and shape of an article ). context can be n - dimensional ( representing , e . g ., attributes such as temperature , velocity , and weight ). each dimension is measured in system - wide standard units , e . g ., units based on international standards like coordinated universal time (“ utc ”), and the international system of units (“ si ”). because time and space are universal dimensions , the system &# 39 ; s core space is compatible with all other systems , such as gis , that also work in these dimensions or subsets of them . introduced objects can be part of dynamic hierarchies . hierarchies can be described by context objects . based on internal or external event data , the system tracks and logs the state of articles represented by introduced objects within the above - described space . it is then able to answer questions or provide alerts about the state of , and relationships between , introduced objects in that space , such as : where are all articles ( uid ) of type x within a radius of y of address z ? where are the nearest spare parts for asset x and how fast could they be delivered to plant y ? where are all delivered products with lot number x right now ? where is the nearest demand for my products x with an expiration date before y ? alert ! chemical assets x and y are stored too close to each other . alert ! employee x is not allowed to carry laptop y out of building z . based on historical data , statistical or other methods , the system can also derive the future state or behavior of introduced objects or groups of them . the location of articles can be described to the system in a variety of ways . an example for a direct description is a latitude , longitude , and altitude data set configured in a standard way . an example for a derived location description is the street address of a facility where a tag reader is located . the system maps the street address of the tag reader to the system &# 39 ; s standard coordinate system , assumes that the article ( as represented by its uid ) encountered by the tag reader is near the tag reader , and associates the reader &# 39 ; s location with the article &# 39 ; s location . the object model may include a uid , attributes , and a definition of which system users have read / write / change authorities of which attributes , methods , and rules . the system assigns to each of its users a globally unique identifier , which may be based on the electronic product code ( epc ), the epc manager part of the epc , or the like . depending on the assigned authorization and using standardized parameterized events , system users write , read , and change data of introduced objects . object data access is dependent on defined authorization settings . table 2 provides an example an xml document representing a physical object implementing the described authorization model . this is just an example , however , and any convenient representation can be used . the system includes a generic authentication and security scheme ( such as one based on digital certificates and encryption ) for communication with and between the components and for communication to other systems and external devices . one application of the system will now be described in which the system tracks and logs location and temperature of high quality fish products that a shipper y is transporting from a manufacturer x to a retailer z . the following generally describes how the system accomplishes the described functions . manufacturer x boxes the products and attaches a rfid tag to each box . the rfid tag includes a uid and , in addition , can store an expiration date , a maximum temperature threshold , and a maximum encountered temperature reading ( t max ). manufacturer x loads the boxes on pallets and attaches an active , recyclable temperature - sensor device to each pallet . alternatively , and at greater expense , such a sensor could be attached to each box . these devices have an rfid tag attached that includes a uid and , in addition , can store temperature readings and a maximum encountered temperature reading ( t max ). the devices periodically measure the current temperature and store the readings on their attached rfid tag . alerts are triggered when temperature exceeds a specific threshold . upon arrival at the retailer , updated expiration dates and maximum encountered temperature data based on the temperature history logs of the sensor devices is written to the rfid tags of each box . manufacturer x wants to decrease the number of boxes rejected by retailer z (“ rejects ”) for which shipper y is to be held responsible , for example , boxes exposed to high temperatures during shipping . shipper y wants to gain market share by providing better customer satisfaction by ensuring full visibility of the current location and temperature of shipments . in addition , shipper y wants to detect quality problems and theft caused by contractors . retailer z wants to be able to identify and reject spoiled products upon arrival and , thus , cut costs by decreasing returns while , at the same time , achieve higher customer satisfaction . the following describes in detail how the system helps each party achieve its goals . fig3 illustrates one implementation in which manufacturer x , shipper y , and retailer z procure and implement a local installation of the object interface component ( oic ) 34 x , 34 y , 34 z of the system behind their respective firewalls 33 x , 33 y , 33 z . in addition , they jointly use the tagging component ( tc ) 32 , communication middleware component ( cmc ) 36 , context - aware intelligence component ( caic ) 37 and human interface component ( hic ) 38 of an external application service provider , who provides these services through a network such as the internet . alternatively , each party can subscribe to an implementation of the system which is provided by a service provider . in this latter case , each party need not procure and install an oic . in yet an another alternative , one or more of the parties can install all five component of the system for use by all of them . in this case , the parties need not subscribe to a service provider ; their cmcs can communicate by sending events over a network such as the internet . based on the specifications , standards , best industry practices , and other information obtained from the tc , manufacturer x procures read - write rfid tags and interrogators compliant with the above - described product and scenario requirements ( e . g ., active or passive rfid tag , frequency , reader range , temperature sensor built - in , memory size , price point , case material , and bonding requirements ). based on the specifications , standards , best industry practices , and other information obtained from the tc , shipper y and retailer z each procure a number of rfid interrogators ( which can be read - only ) that are compliant with the rfid tags of manufacturer x and the system . when manufacturer x produces a box of products , manufacturer x attaches one rfid tag and introduces to the system its unique identifier , allowed temperature ranges , and initial expiration date to the system . fig4 illustrates this introduction operation . a box is manufactured and a tag is attached ( step 20 ). the manufacturer &# 39 ; s oic - connected tag reader senses the tag and reads its uid ( step 21 ). the oic generates and sends a seen event including the uid to the cmc ( step 22 ), which routes it to the caic ( step 23 ). if an object for the uid is known , the caic updates the status and status history log of the object according to the input data (“ yes ” branch of step 24 ; step 28 ); otherwise , the caic determines whether the event is a new physical object event ( decision step 25 ). if the event is a new object event , the caic generates a new physical object for the uid according to the specified data ( step 26 ) and stores the new object data ( step 27 ). otherwise , the following actions occur . the caic sends an object unknown event for the uid to the cmc ( step 46 ). the cmc routes this event to the manufacturer &# 39 ; s production system ( step 45 ), which generates an introduce physical object event for the uid with attributes , access rights , rules , and alerts and sends this event to the cmc ( step 44 ). the cmc routes this event to the oic ( step 43 ), which generates and sends a new physical object event for the uid to the cmc ( step 42 ). the oic also determines whether there is a request to write data to the tag ( step 41 ). if there is , the oic writes the data to the tag ( step 40 ). in this illustration , the data is a “ good until ” date , a temperature threshold , and a maximum encountered temperature reading ( step 40 ). in any case , the new physical object event is routed by the cmc to the caic ( step 23 ) for handling as has been described . as shown in fig5 when manufacturer x loads a pallet for delivery , manufacturer x attaches an active temperature sensor to the pallet , resets the memory of the sensor and activates it ( step 50 ). the sensor measures temperature on a time schedule ( step 52 ), saving the measured temperatures with time stamps to a history log on the tag ( step 54 ). if the temperature exceeds the maximum encountered , this new maximum is also stored on the tag ( step 56 ). [ 0103 ] fig6 illustrates the system &# 39 ; s response to the loading of boxes onto the pallet with a sensor ( step 60 ). the manufacturer &# 39 ; s oic - connected tag reader senses the tags and their uids ( step 62 ) and generates seen events for the uids that it sends to the cmc ( step 64 ). the cmc routes these events to the caic ( step 66 ). the caic updates the status and status history log of the objects identified by the sensed uids according to the input data from the events ( step 68 ). when shipper y &# 39 ; s oic - connected readers sense a tag , the caic updates the system . fig7 illustrates this update operation . the shipper &# 39 ; s oic - connected tag reader senses the tags of the boxes on the pallet including the sensor tag , reading their uids and t max data ( step 70 ). the oic generates and sends seen events to the cmc with the data ( step 71 ). the cmc routes the events to the caic ( step 72 ). the caic updates the status and history log of the corresponding objects according to the received input data ( step 73 ). the caic determines whether the t max is within limits ( step 74 ). if not , the caic sends an alert event to the cmc (“ no ” branch from step 74 ; step 75 ), and the cmc routes the alert to the manufacturer &# 39 ; s and the shipper &# 39 ; s erp applications ( step 76 ). on receipt of the shipment , retailer z reads and validates the products &# 39 ; actual maximum temperature data from the attached rfid tags and expiration date . fig8 also illustrates this reading operation . when spoiled boxes are detected , they are identified and the caic alerts the store manager using the hic component . sms ( short message service ) messages , pager messages , or any other convenient form of message transmission , can be used for this purpose . fig8 also illustrates this alert operation where a retailer &# 39 ; s oic - connected tag reader senses and reads the uids of tags of boxes on a pallet include a sensor tag carrying a uid , a maximum temperature t max and a temperature history t history ( step 80 ). the oic generates and sends to the cmc seen events with the uid , t max and t history information ( step 81 ). the cmc routes the events to the caic ( step 82 ). the caic updates the status and history log of objects according to the input data ( step 83 ). the caic also computes a new expiration date for each box based on the t max and t history information and the manufacturer &# 39 ; s rules ( step 84 ). if the caic determines that the box is spoiled (“ yes ” branch from decision step 85 ), the caic sends an alert event with uid and t max to the cmc ( step 86 ), which routes the alert to the hic ( step 87 ). the hic then sends an sms message alerting the retail store manager ( step 88 ). whether or not the box is spoiled , the oic determines whether there is a request that data be written to the tag ( step 89 ), and if it there is , the caic generates and sends write data events with the uid and data for the tags to the cmc ( step 90 ). the cmc routes these events to the oic ( step 91 ), which writes “ good until ” and t max data to the tags ( step 92 ). the system can receive context information from third party providers , for example , traffic or weather information . in general , information can be brought into the system either by having the providers push the information , or having the system pull the information . having such information enables the system to report or forecast shipping delays or other situations that can affect the movement or condition of introduced articles . fig9 illustrates this implemented with the providers feeding information into the system . in this illustration , a traffic information provider generates an introduce context object event with a uid and attributes and sends the event to the cmc ( step 120 ), which routes the event to an oic ( step 122 ). the receiving oic generates a new context object event with uid to the cmc ( step 124 ), which routes the event to the caic ( step 126 ). the caic determines that the event is of the type new context object event (“ yes ” branch of decision step 128 ), generates a new context object for the uid according to the specified data ( step 130 ), and stores the new object data ( step 132 ). the system can provided data flow and bi - directional data flow on tags . fig1 illustrates one scenario . a tag 152 is attached to a box 150 . the tag contains a uid , and , in addition , can store an expiration date , a maximum temperature threshold , a maximum encountered temperature reading , and a price . the temperature data on tag 152 can be updated as often as the temperature of box 150 is measured , e . g ., at a temperature measuring station that can write its readings to tag 152 or , by a temperature sensor operably coupled to tag 152 . the data on tag 152 can be automatically read by tag reader 158 , e . g ., using rfid technology . in one embodiment , tag reader 158 periodically “ scans ” its environment within a specific range . in another embodiment , tag reader 158 is triggered to scan its environment , e . g ., by a proximity sensor . if a scan returns valid read data ( through communication 154 ), e . g ., because tag 152 has been moved into the scanned range , tag reader 158 will send the received data to system 166 ( through communication 162 ). for this example , it is assumed that the system 166 maintains a physical object 168 previously introduced by an external application 174 ( through communication 172 ) and that the external application 174 also defined and attached a rule 170 to physical object 168 . rule 170 is defined as “ if the maximum encountered temperature of the box as stored on its tag is higher than 45 degrees fahrenheit , then write the current date as new expiration date to its tag .” rule 170 can be defined in any format , syntax or computer code that is compatible with system 166 . whenever system 166 receives new data read from tag 152 , it will execute rule 170 . if rule 170 returns a positive result , system 166 will compute a new expiration date , such as the current date , send the new expiration date and the uid of tag 152 to tag writer 160 ( by communication 164 ), and cause tag writer 160 to write the new expiration data to the expiration data field on the tag 152 ( through communication 156 ). [ 0110 ] fig1 illustrates another scenario , in which external application 174 periodically queries system 166 for the latest status of the maximum encountered temperature of the box 150 as stored on its tag 152 . in this scenario , the logic , which may again be identified as a rule 171 , is part of the external application 174 . the external application 174 transmits an event to system 166 that contains the uid of tag 152 , a new expiration date , an updated price , and updated regulatory information . this event triggers system 166 to send the received expiration date , price , and uid to a tag writer 160 ( through communication 164 ). the system 166 then causes the tag writer 160 to write the received data to the corresponding data fields on the tag 152 . the communications that have been mentioned can take place through any communication medium , including over a network , for example , the internet . in these scenarios , with a tag reader that is able to read the data stored on the tag 152 , a receiver of the box 150 will be able to identify an expiration date and price that is based on the temperature that the box 150 has been exposed to during tracking . [ 0112 ] fig1 illustrates one aspect of the process of data flow . in an illustrative example , the system receives attribute information for a first article including its uid by reading a first tag bound to the first article ( step 1202 ). the system similarly receives attribute information for a second article and context information derived from data read automatically from a sensor coupled to the second article ( step 1204 ). the system maintains a virtual first and second article using this information ( step 1206 ). the system also receives relationship information specifying a relationship between the articles and maintains a virtual relationship ( step 1208 ). having this information , the system can recognize an alert condition relating to the first article based at least in part on one of the virtual articles ( step 1210 ). in response to the alert condition , the system generates updated attribute information to be written to the first article ( step 1212 ). the system then detects the presence of the first tag at a tag writer station ( step 1214 ) and causes the tag writer station to write the updated information to the first tag ( step 1216 ). in these scenarios , the alert condition can be recognized , and the rules for responding to the alert and computing updated information , in the system itself , or this can be done in an application external to the system . in the latter case , the application receives from the system information from objects maintained by the system and generates the updated attribute information and provides it to the system with a request that it be written to the first tag . [ 0114 ] fig1 illustrates another aspect of the process of data flow . in an illustrative example , the system receives attribute information for a first article derived from tag data read automatically by a first tag reader from a first tag bound to the first article ( step 1302 ). the system also receives updated attribute information for the first article ( step 1304 ). the system later detects the presence of the first tag at a different tag writer station ( step 1306 ) and causes the tag writer station to write the updated information to the first tag ( step 1308 ). in this scenario , the updated information can be computed in the system itself , or this can be done in an application external to the system . in the latter case , the application receives from the system information from objects maintained by the system and generates the updated attribute information and provides it to the system with a request that it be written to the tag . the system can be applied to other scenarios . the system supports the development of a range of new and enhanced applications across industries on a local to global scale . other applications of the system includes supply chain management , asset tracking management , security and access control , transportation , toll collection , point of sales applications , and baggage handling . these examples are further described below . rfid systems are ideally suited for the identification of high - unit high - value products moving through an assembly process ( such as automobile or agricultural equipment production ). rfid systems also offer the durability essential for permanent identification of product carriers such as boxes , crates , and pallets . other applications within supply chain management include work - in - progress tracking and parcel delivery . asset tracking and management applications include those for monitoring the flow of equipment , people , and documents within a space such as a building , yard , or terminal , for example , to tighten control over assets and keep good track of articles , including individuals . specific applications within asset management include : records / document tracking , people tracking , yard management , and equipment tracking . the movement and use of valuable equipment and personnel resources can be monitored through transponders attached to equipment or carried by the equipment or personnel . transponders can also be embedded in credit card size security badges . home security call systems and building access are two examples of security and access control applications . transponders can be attached to vehicles ( e . g ., aircraft , rail cars , trucks ) and can contain important information about the vehicle and its contents . transportation applications include aircraft identification , rail car and shipping container tracking , public transportation ticketing , and weigh station applications . toll collection applications involve attaching a transponder to a vehicle . the transponder transmits a code , which identifies a prepaid account , to a reader which automatically deducts the toll from the prepaid account . these applications include electronic surveillance of retail items , forgery prevention , and sales transactions and usually involve tagging individual retail items with low cost transponders , which are essentially active tags . in a baggage handling application , airline luggage is tagged with rfid transponders such as smart labels to allow airline baggage handling operations to track baggage from the moment a traveler checks into an airport to the moment the traveler reaches his final destination . the invention has been described in terms of particular embodiments . other embodiments are within the scope of the claims . for example , the steps of the invention can be performed in a different order and still achieve desirable results . the system is flexible and offers many business methods for tracking articles . in one method , one or more customers subscribe to the system , which is provided by a service provider who distributes the services over a network such as the internet . in this case , the customers need not procure components or the entire system , thereby saving capital costs . alternatively , the customers procure components of or the entire system , thereby saving operational cost . alternatively , the system can support any combination of the described business methods . for example , some customer can subscribe to the system and some customer can procure components or the entire system . | 6 |
in fig1 an electric guitar 1 is illustrated comprising a head 2 at one end , a body 3 at the other end , with a neck 4 extending between the head and the body . six strings 6 extend from head 2 to body 3 over neck 4 . neck 4 forms fret board 5 for guitar 1 . at head 2 , each of the strings extends over nut 7 forming the first critical point for the strings . nut 7 is located at the transition of neck 4 to head 2 . each string 6 is secured on the head by anchor 8 and each anchor has a corresponding tuner 9 . on the body 3 , strings 6 are secured to fulcrum tremolo 12 . fulcrum tremolo 12 has arm 11 for pivoting the tremolo and providing the vibrato effect on the strings . fulcrum tremolo 12 has six intonation modules 13 . the intonation modules present improvements to the macro - tuning invention which incorporates the function of the bridge element and tail - piece in its structure as well as the capacity to adjustably secure the individual strings to the instrument . the intonation modules are movable and thereby provide a means to change the distance between the first and second critical points or the harmonic tuning as such . the invention is shown for us on electric guitar 1 and it should be understood that the invention could be used on a variety of stringed musical instruments . in the following description , fulcrum tremolo 12 will be described in greater detail . fulcrum tremolo 12 forms a second critical point for strings 6 , sometimes characterized as an intonation point or bridge point . in fig2 fulcrum tremolo 12 is shown on an enlarged scale compared to fig1 . fig3 displays fulcrum tremolo 12 of fig2 in a cross - section view . the second critical point is located near the front intonation modules 13 . outwardly from intonation modules 13 on each side of the opposite sides of base plate 14 extending in the direction of the strings there are bearing housings 30 . the bearing housing 30 supports base plate 14 pivotally relative to body 3 . global tuner 50 is positioned between spring block 40 extending downwardly from the bottom of base plate 14 and counter springs 44 connected to instrument body 3 . in fig2 and 3 , one of the intonation modules 13 is shown including a shaped barrel - like base 10 with a second critical point formed at string opening 17 . base 10 is adjustably secured to base plate 14 of fulcrum tremolo 12 by machine screws 28 through slots 29 . loosing machine screws 28 permits longitudinal movement of base 10 and associated parts for harmonic tuning of string 6 . adjustment bolt 18 first passes through opening 20 in base 10 and threaded portion 19 of adjustment bolt 18 is engaged with threaded portion 21 of string tensioning element 22 within sleeve - like portion 23 of base 10 . string 6 of the musical instrument makes critical contact with base 10 at the string opening 17 to passageway 15 sloping downwardly and rearwardly through base 10 until the string passes into a sleeve - like portion 23 . string 6 continues passing through clamping point 16 of string tensioning element 22 , through slots 25 between upper fork 72 and lower fork 73 of fork - like string clamping means 24 , through string passageway 27 of string tensioning element 22 and is secured at exit 26 . annular flange - like portion 71 of fork - like string clamping means 24 of string tensioning element 22 is in bearing contact with restricted portion 70 of sleeve - like portion 23 of base 10 . threading adjustment bolt 18 displaces the string tensioning element 22 relative to string opening 17 providing an adjustment whereby tension or pull on string 6 is applied and varied for raising and adjusting the strings 6 from an untensioned condition to a pitched string condition ; simultaneously , annular flange - like portion 71 of fork - like string clamping means 24 of string tensioning element 22 is drawn within restricted portion 70 of sleeve - like portion 23 , clamping string 6 between upper fork 72 and lower fork 73 at clamping point 16 adjacent to string opening 17 . in fig2 , 4 and 5 outwardly from intonation modules 13 on each side of the opposite sides of base plate 14 shown at the forward end of fulcrum tremolo 12 extending in the direction of the strings , there is bearing housing 30 . bearing housing 30 is adjacent to base plate 14 . housing 30 is adjustably supported relative to body 3 of the instrument by threaded post 31 with annular flange 32 . post 31 is threaded into insert 33 in body 3 . by threading post 31 into insert 33 , the spacing between body 3 and housing 30 is selectively adjustable . adjustment of post 31 is effected through an oval opening 34 in the top of housing 30 . in housing 30 rearward post 31 , there is opening 76 extending transversely of the string direction of guitar1 containing bearing assembly 35 , formed by four side - by - side roller bearings 36 . insert 37 fits into cut - out 38 in the side of base plate 14 with pin 39 with annular flange 39a extending outwardly through bearings 36 . annular flange 39a on pin 39 spaces the side - by - side roller bearings 36 from base plate 14 . accordingly , by manipulating tremolo arm 11 , fulcrum tremolo 12 can be pivoted about pin 39 to achieve the desired tremolo effect . as can be seen in fig2 and 3 there is spring attachment means 40 extending downwardly from base plate 14 . the preferred embodiment incorporates thumb screw 42 with shaft 45 threadedly engaged with threaded opening 47 in spring block 40 on one side of thumb screw 42 and another shaft 46 with reverse threads in the opposite direction of shaft 45 threadedly engaged with reverse threaded opening 48 in spring holder 41 . counter springs 44 are attached at one end to spring holder 41 and to body 3 on the other end of counter springs 44 . guide pin 43 extending outwardly from spring block 40 towards spring holder 41 passes through guide pin opening 49 in spring holder 41 limiting longitudinal rotational movement of spring holder 41 relative to spring block 40 . by threading thumb screw 42 clockwise relative to spring holder means 41 , spring holder 41 moves closer to spring block 40 increasing the tension of the counter springs 44 and by threading thumb screw 42 counter - clockwise relative to spring holder means 41 , spring holder 41 moves away from spring block 40 decreasing the tension of the counter springs 44 providing the means to adjust the equilibrium point and globally tune fulcrum tremolo 12 . fig6 displays an improved &# 34 ; semi - headless &# 34 ; tuner arrangement for stringed musical instruments . in fig7 at the end of 4 is shown with strings 6 each of a different size . the strings 6 pass over nut 7 and each string is secured by string tensioning tuning device 51 , a &# 34 ; semi - headless tuner &# 34 ; adjacent the nut . there is a separate macro - tuning device 52 for each string . the devices , as set forth in fig6 & amp ; 7 includes bracket 53 secured to and projecting from the end of neck 4 . l - shaped lever 54 is pivotally connected by pin 55 as shown in fig6 . the other or second arm 56 of lever 54 extends from pivot pin 44 toward the end of neck 4 . at the end of second arm 56 there is sleeve - like portion 57 . string slot 58 extends longitudinally along sleeve - like portion 57 continuing disposed at an angle towards the top of the sleeve . slot 59 at the free end of the sleeve extends towards the connected end of second arm 56 . adjacent the free end and within sleeve - like portion 57 , there is string clamping means 60 with fork - like portion 61 with upper fork 62 and lower fork 63 and at the opposite end there is threaded opening 64 . thumb screw 65 passes through slot 59 in sleeve - like portion 57 and through unthreaded opening 66 in upper fork 62 and is threadedly engaged with threaded opening 67 in lower fork 63 . string 6 is arranged through slotted opening 58 and into slotted opening 75 between upper fork 62 and lower fork 63 . threading thumb screw 65 clamps the upper fork 62 and lower fork 63 on string 6 , securing string 6 to string clamping means 60 . adjustment bolt 68 is adjustably mounted within sleeve - like portion 57 opposite the free end . threaded portion 69 of adjustment bolt 68 is threadedly engaged with threaded opening 64 adjustably securing string clamping means 60 to macro - tuner 52 . by threading adjustment bolt 68 the clamping means can be displaced relative to nut 7 wherein the tension on string 6 can be raised and varied whereby the macro tuning can be achieved . in fig8 shows a single macro - tuning device where string 6 passes through slots 58 of sleeve - like portion 57 and is arranged between upper fork 62 and lower fork 63 of fork - like portion 61 of string clamping means 60 and clamped and secured by thumb screw 65 wherein threaded portion 69 of adjustment bolt 68 is threadedly engaged with threaded opening 64 of string clamping means 60 . by threading adjustment bolt 68 the position of string clamping means 60 relative to the anchoring means at the opposite end string 6 is increased and varied whereby tension or pull on string 6 is applied and varied for raising and adjusting the strings 6 from an untensioned condition to a pitched string condition . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the inventive principles , it will be understood that the invention may be embodied otherwise without departing from such principles . | 6 |
the receiver of fig1 comprises an antenna 10 for receiving a broadcast television signal s1 having a teletext component . signal s1 is applied to a television signal processing unit which includes a tuner and associated circuits for providing a baseband video output signal s2 that is applied to a switch 14 and to a pulse code modulation ( pcm ) detector 16 . for normal viewing of entertainment programming , switch 14 is placed in the &# 34 ; tv &# 34 ; position of coupling signal s2 to a display unit 18 ( e . g ., a kinescope and associated drive circuitry ). for teletext viewing , switch 14 is placed in the &# 34 ; teletext &# 34 ; position ( as shown ) for coupling a teletext video output signal s3 , processed in accordance with the invention , to display unit 18 . the signal s3 comprises a teletext video component s4 produced by a teletext decoder 20 and a cursor video component s5 produced by a teletext page selection unit 30 . decoder 20 is of conventional design and comprises pcm detector 16 which detects luminance signal level variations of the baseband signal s2 and provides a digital output signal s6 representative of teletext information transmitted during a selected line ( or lines ) of the vertical interval of signal s2 . signal s6 is supplied to a control unit 22 ( e . g ., a microprocessor ) and to a page memory 24 . unit 22 has an input port 23 coupled to an output port 32 of page selection unit 30 for receiving a selection code signal s7 . in response to the selection code s7 , unit 22 supplies a write enable signal s8 to memory 24 which causes pages of information conveyed by signal s6 and which correspond to the selection code to be stored in memory 24 . the user controls the selection code , as will be explained , and thus controls what portions of the information conveyed by signal s6 are stored in memory 24 and ultimately displayed on unit 18 . the information stored in memory 24 may receiver further processing by control unit 22 to place it in a desired form for display purposes ( e . g ., the &# 34 ; pages &# 34 ; may be reordered or reformatted , overlays may be added and so forth ). when the pages are in a form for display , memory 24 is &# 34 ; read &# 34 ; by control unit 22 and a teletext data signal s9 is applied to pixel ( picture element ) generator 26 which translates signal s9 to form appropriate character and graphic symbols representative of the stored page information . a typical graphic / character display format might comprise , illustratively , a 6 × 10 array of bits for each character or graphic symbol . the translated symbol signal s10 produced by pixel generator 26 is stored in a bit map memory 27 . memory 27 is the principal means for refreshing display unit 18 during the teletext operating mode . illustratively , memory 27 may be organized to provide storage of 21 lines of symbols with 42 symbols per line and four bits per symbol added to convey color or brightness information . the stored symbols ( alphanumerics and graphaics , for example ) are read from memory 27 at video rates in a timed relationship with the scanning of display 18 to provide an output signal s11 conveying the stored teletext information in raster scan form . signal s11 is applied to a video display processor 28 which translates the digital signals to a video format ( analog ) in which each pixel and its associated color are represented by appropriate luminance and chrominance components to thereby form the teletext video output signal s4 . signal s4 , as previously noted , is combined with the cursor signal s5 for display of the teletext information on unit 18 . teletext page selection unit 30 provides the functions of generating the cursor signal s5 and the teletext page selection code s7 in accordance with proximity of the cursor with certain predefined symbols displayed on unit 18 . the selection unit comprises an output port 32 coupled to the input port of control unit 22 for supplying the selection code thereto , and input port 34 coupled to the output of pixel generator 26 for receiving the teletext data signal s10 ( i . e ., symbols and display addresses ) therefrom , an input terminal 36 coupled to the output of video display processor 28 for receiving the teletext video signal s4 therefrom and a video output terminal 38 coupled to switch 14 for supplying the composite teletext video and cursor signals thereto ( i . e ., signal s3 ). the cursor control signal is initiated and controlled by means of a remote control unit 60 comprising a vertical position control 62 , a horizontal position control 64 and a select key 66 . unit 60 may comprise , illustratively , a &# 34 ; joy stick &# 34 ; type of control wherein controls 62 and 64 are potentiometers providing analog output voltages proportional to the joy stick position and wherein key 66 is a push button switch . alternatively , unit 60 may comprise other suitable means for providing vertical and horizontal control and selection signals such as a &# 34 ; track ball &# 34 ;, a &# 34 ; mouse &# 34 ;, a simple key pad or the like . the output signals of remote control 60 are applied to a coupling unit 40 which conditions the signals for use by an address decoder 42 and a gate 44 . unit 40 may comprise a sonic or infra - red transmission system or the like . where , as assumed , control 60 comprises a joy stick , unit 40 would include analog to digital conversion means for converting the output voltages of the vertical and horizontal position controls to digital signals . the &# 34 ; select signal &# 34 ; s12 , being produced by a switch closure , need only be translated in unit 40 to an appropriate logic level for use by gate 44 . the cursor address signal s13 is applied to a cursor generator unit 46 which receives vertical and horizontal timing information from display unit 18 and generates a cursor video signal s5 in timed relationship with scanning of the display . ( to simplify the drawing , raster scan timing signals are not shown ). the cursor , symbol , illustratively , may be of block form or of some other suitable shape so as to be visible when displayed with the teletext video signal . the cursor signal s5 is added to the video signal s4 by means of an adder 48 which supplies the resultant combined signals s3 to display 18 via switch 14 . generation of the selection code signal s7 involves determination of the proximity of the cursor to specific displayed teletext symbols which represent user choices of information to be displayed . to facilitate this , the teletext data signal s10 is applied to a read / write control unit 50 which is coupled to a &# 34 ; vocabulary &# 34 ; read only memory ( rom ) 52 and to a random access memory ( ram ) 54 . vocabulary rom 52 is programmed with data corresponding to the &# 34 ; working vocabulary &# 34 ; of the control symbols in the teletext system syntax ( i . e ., number and control words or symbols corresponding to user information access or control commands ). unit 50 compares the teletext data at port 34 with the contents of rom 52 and if there is a match stores in ram 54 the identities and addresses of all teletext control symbols which are displayed on unit 18 . ram 54 must have sufficient data which does not correspond to a recognized control symbol ( or word ) is not stored in ram 54 but is simply ignored by unit 50 . the addresses of the data stored in ram 54 are continuously compared with the cursor address provided by decoder 42 by scanning through the memory addresses of ram 54 by scanning means ( not shown ) to produce symbol address information which is supplied to address compare logic unit 56 . any control data in ram 54 having an address equal to or within a predetermined vertical and horizontal range of the cursor address will cause logic unit 56 to supply a priming signal pulse s15 to gate 44 . if , at the same time , the user has depressed select key 66 in remote control 60 , the select signal s12 will cause gate 44 to transfer the control code from ram 54 to the teletext selection code input port 23 of control unit 22 in the teletext decoder 20 . unit 22 , in turn , will interpret the selection code and load page memory 24 with teletext information in accordance with the selection code and the information will be processed and displayed on unit 18 as previously described . the &# 34 ; proximity &# 34 ; feature of the invention with regard to the address comparison provided by logic unit 56 enables the user to err to a certain extent in the placement of the cursor on the screen of display unit 18 . it is only necessary for the user to place the cursor near the desired page or menu selection symbol to effect the desired control function . an examplary comparison range is 5 scan lines vertically and 16 &# 34 ; pixels &# 34 ; horizontally . the use of a range of values for address comparison frees the user from any need to exactly position the cursor over a desired control function word or symbol and greatly enhances the speed and ease of use of the selection system . fig2 and 3 provide further illustration of the operation of the teletext page selection unit of the invention . in fig2 a television receiver 202 equipped with a teletext decoder and a page selection unit as described in shown in operation displaying a page of weather information transmitted via teletext . the remote control unit 60 is of the joy stick type previously described . the text of the weather report is seen to include the words &# 34 ; next &# 34 ; and &# 34 ; more &# 34 ;. these words are also control words in the teletext system vocabulary and appear in the prompting area at the bottom of the screen . in this example , the control word next , when selected as a system command will cause the next forecast to be displayed . the control word more will cause a summary to be displayed . selection of the controls or commands next or more may be made by placing the cursor 204 close to the desired word either in the text area or in the prompt area of the displayed message . this is done by manipulation of the joy stick 62 / 64 . when cursor is positioned near the desired word , the user depresses the select push button switch 66 and the control system will implement the choice as previously described . if the cursor should be misplaced then depression of switch 66 will have no effect since gate 44 will not be primed by signal s15 unless the cursor is near a recognized &# 34 ; command &# 34 ; word in the system vocabulary stored in rom 52 . fig3 provides a more detailed view of the proximity of the cursor 204 to the command word next . the center of the word is defined by a vertical line aa corresponding to a horizontal address and a horizontal line bb corresponding to a vertical address . an address field is formed corresponding to all addresses falling within five scan lines vertically and sixteen pixels horizontally of the intersection of aa and bb . if the cursor address equals any member of the address feild 206 when switch 66 is activated , then gate 44 will transfer the command code for &# 34 ; next &# 34 ; to control unit 22 for effecting the control function so identified . to further facilitate selection of control functions by means of a cursor , the system of fig1 may be modified so as to place cursor 204 in the center of the selected word &# 34 ; next &# 34 ; whenever the generated cursor address lies within any portion of the address field 206 . this is illustrated by the position of the cursor 204 &# 39 ; in fig3 which is centered with respect to lines aa and bb . in this mode of control the cursor 204 , in effect , &# 34 ; jumps &# 34 ; to the center of any word in the command vocabulary of the teletext system when the cursor address is within the address field of the word . this provides a positive indication to the user that he has placed the cursor on a system command word ( or other symbol ) and thus eliminates any doubt as to what function will be implemented when switch 66 is depressed . additionally , to provide a further indication that a given symbol corresponds to a particular page or menu selection code ( or some other function ) the cursor appearance may also be altered after the cursor jump to a code symbol location . it is also possible to alter the appearance of the displayed word or symbol as will be explained . fig4 provides an illustration of how the cursor jump and appearance alteration may be implemented by modifying the page selection unit of fig1 . the modification comprises the addition of an address gate 70 having inputs coupled to the address information output lines of ram 54 and decoder 42 and an output coupled to supply selected ones of the addresses to cursor generator 46 . gate 70 is controlled by the signal s15 which indicates proximity of the cursor address to the displayed information address . when signal s15 is low , indicating that the cursor is not near a control symbol , gate 70 couples the cursor address s13 to cursor generator 46 which functions as previously described to cause the cursor to be displayed at the address produced by the remote control unit 60 . however , when signal s15 is high ( indicating proximity of addresses ) gate 70 couples the address of the control symbol produced by ram 54 to the cursor generator thereby causing a &# 34 ; jump &# 34 ; of the displayed cursor to the symbol address . this jump is illustrated in fig3 by the position of cursor 204 &# 39 ; which , as shown , is centered with respect to the control symbol ( word ) next . to prevent the ram address from changing after the &# 34 ; jump &# 34 ; signal , signal s15 is applied to an address change inhibit input 55 of the ram . accordingly , as long as there is no change in the cursor address signal , s15 will remain high and the cursor will remain centered on the control symbol . if the cursor address changes by an amount such that the true address is outside the address field 206 then signal s15 will go low and the cursor will &# 34 ; jump &# 34 ; to its actual address as determined by signal s13 . to highlight the cursor mode ( i . e ., its true address versus its ram controlled address ), the signal s15 is applied to a luminance level control input of the cursor generator 46 . the generator may include an interruptor or modulator responsive to the signal s15 for altering the cursor luminance signal level thereby causing the cursor to blink when in the ram addressing mode . this provides a further alert to the user of the system that the cursor is properly positioned with respect to the control word ( or other control symbol ). in the alternative ( or in addition ) to blinking the cursor , the cursor generaator 46 may include suitable shape altering circuitry responsive to signal s15 for providing a visible alteration of the appearance of the cursor when in the ram address control mode . the shape alteration may comprise a change from a &# 34 ; block &# 34 ; cursor ( as shown in fig3 ) to an underline cursor , for example . another alternative would be to alter the appearance of the displayed word or symbol by applying the signal s15 to decoder 20 to effect a video reversal or other change . it will be appreciated that the principles of the invention are of general utility and may be applied to videotext as well as to teletext systems and to other systems in which a control symbol vocabulary is defined and used to facilitate system information selection or some other control function . the various control functions in the information selection unit may be combined and executed by different structure than that shown . for example , a microprocessor , suitably programmed in accordance with the invention , may be used for providing the ram read / write control functions as well as the rom comparison function and the address comparison function and the cursor address decoding function . the remote control 60 may comprise a simply joy stick as discussed or some other means such as a three key keyboard having up / down and left / right rocker type keys plus a &# 34 ; select &# 34 ; key . | 7 |
referring to fig1 the load 1 is shown as an elongated cylindrical body . load 1 is suspended from a parachute 2 by a belt assembly having three longitudinal belts 4 which are coupled together at the top of the load 1 by a further belt 3 . the ends 5 of belts 4 are provided with loops . belt ends 5 are connected together on the lower front surface 6 of the load 1 by a connecting component or coupling mechanism 7 so that the load is retained between the belt parts 3 , 4 and 5 . if the connection of the belt ends 5 established by connecting component 7 is broken the load 1 falls free from the belt assembly . an impact component in the form of impact plate 8 is attached to the load and spaced from the lower front surface 6 thereof . the parachute 2 is dimensioned with respect to the size of the load so that the load is stabilized after being dropped and arrives safely on the ground with its lower end ( i . e . the impact plate 8 ) first , as shown in fig2 . as indicated by the force arrows in fig2 the side of the impact plate 8 is bent upward by the impact of the edge of the impact plate 8 with the ground . thus , the impact plate 8 is deformed by absorbing the shock of the landing impact . understandably , there is allowance for greater landing angles . moreover , the invention is operable in the case where the load is stabilized by the parachute in such a way that it hits the ground with the edge of its lower front surface or impact plate at considerable horizontal speed . as shown in fig4 the ends 5 of the belts 4 are guided in groove - like recesses 9 in the area of the lower front surface 6 of the load 1 so that the ends 5 are not jammed between the impact plate 8 and the lower front surface 6 upon distortion of the impact plate 8 as shown in fig2 and therefore the ends 5 may easily slip away from each other upon disconnection . the releasable coupling mechanism 7 is located at the middle of the lower front surface 6 of the load 1 , the coupling mechanism providing for the connection and separation of the belt ends 5 with one another respectively . the mechanism 7 includes a body 10 which is centrally disposed and securely mounted to the front surface 6 . body 10 defines three pairs of guide grooves 12 which have center lines angularly spaced at about 120 degrees . grooves 12 extend radially from an intersection point 11 located within a centrally located circular recess . as shown in fig3 the center line of each pair of grooves 12 is aligned with one of the groove shaped recesses 9 which receives a belt end 5 . a cord 13 is passed through all the loop - like belt ends 5 and fed along the grooves 12 as shown in fig3 . since the cord 13 is positioned in opposite aligned grooves 12 , the lengths of the cord intersect in a central region of body 10 of coupling mechanism 7 . the ends of cord 13 are secured together by a knot 14 or the like . the region of intersection 11 is defined by a central recess in body 10 which is limited laterally by a straight side wall or walls 15 . the walls 15 form a guide for a cylindrical knife body 16 with a ring - shaped cutting edge 17 , cutting edge 17 facing inwardly towards the base 18 of the recess and the intersecting lengths of cord 13 . the knife body 16 is biased away from the base 18 of the recess by a compression spring 19 so that its cutting edge 17 is in a state of rest at a safe distance from the cord 13 . the knife body 16 is supported , at the end disposed oppositely with respect to its cutting edge 17 , by a cap member which defines a capping point 20 . capping point 20 is coaxial with the cylindrical knife body 16 and is defined by a projection which contacts the impact plate 8 . besides the spring 19 , an additional force can be provided to prevent the knife body when in a resting state from approaching the cord 13 as , for example , in the form of a graduated narrowing of the wall 15 . as shown in fig4 the impact plate 8 is mounted on three bolts 21 which are generally spaced about the perimeter of the impact plate . the bolts 21 are surrounded by deformable protective plastic casings 22 . the bolts 21 thus define the resting place of the knife body 16 . since the plastic casings 22 are deformable in response to an applied compressive force , the edges of the impact plate 8 affected directly by an impact with the ground can be distorted as represented in fig2 . any impact which produces movement or distortion of the landing shock absorber will cause the central portion of the plate 8 to drive the knife body 16 inwardly such that , upon impact of the edge of the plate 8 with the ground , the plate 8 presses the knife body 16 into the guide 10 so that the cutting edge 17 strikes through the overlying lengths of the cord 13 . in order to ensure a safe cut , the guide 10 , or at least the bottom surface of the base 18 of recess 11 thereof opposite the cutting edge 17 , consists of soft material such as plastic or light metal so that the cutting edge can penetrate when cutting in order to separate the last thread of the cord 13 with certainty . when the cord 13 is cut the belt ends 5 fall free from one another and the parachute will be released from the load on the moment of impact and without any delay . the cap 20 of the knife body is , when the cord cutting stroke is complete , at a predetermined distance from the lower front surface 6 of the load 1 which is more than half the distance of the impact plate 8 from the load front surface 6 in its original or resting place . therefore , as disclosed in fig2 the bending of the plate upon impact absorbs the forces produced whereupon the releasable coupling mechanism of the present invention may also function as a landing shock absorber for the load 1 . the above - described embodiment of the invention has the further advantage that the compressing force for moving the knife body and cutting the rope can easily be calculated and determined to insure an adequate amount of force even under the most unfavorable conditions . the above - described device for separating the connecting belt ends 5 is centrally disposed between the impact plate 8 and the lower front surface 6 of the load and such positioning has the advantage that the separating device can be made very small and very uncomplicated and that the risk of error in the transferral of energy is minimal . the further embodiments of the invention hereinafter described also have this advantage . referring to fig5 an alternate embodiment of the invention is shown wherein the cord 23 which connects the belt ends 5 takes the form of a continuous , non - circular loop and the knife body , which is developed as a guide pin 25 disposed in an axial bore 24 , holds one ( or more ) radially extending blades 26 which preferably travel in guide slots . the operation of this embodiment is essentially the same as that of the embodiment of fig3 and 4 . referring to fig6 and 7 , a further embodiment is shown wherein loops 27 formed from rope or cord are affixed to and define extension of the belt ends . the loops 27 may be comprised of elastic material , by springs or may include springs . a support finger 28 passes through all of the loops 27 . the forces applied to the loops , by the belts are adjusted to be substantially equal . accordingly , the support finger 28 is required only to transfer force from loop to loop and not from the belts to the load . the support finger 28 extends axially through a bore 29 in a cover 30 which extends over a recess 31 and is secured to a support plate 32 within the recess 31 . the support plate 32 is biased outwardly by the force of a compression spring 33 as shown in fig7 so that the support finger 28 extends beyond the outer surface of the cover 30 as far as possible . a plurality of actuator pins 34 are affixed to support plate 32 and extend outwardly through apertures in cover 30 . pins 34 are evenly spaced about the periphery of plate 32 and extend approximately to the impact plate 8 . the position of plate 8 is defined by a plurality of mounting bolts . each of the mounting bolts is encircled by a compression spring 35 , the springs urging plate 8 outwardly . in the manner described above in the discussion of fig2 if the impact plate 8 is deformed on the landing of the load , at least one of the pins 34 will be forced upwardly thus causing support plate 32 to move against the bias of spring 33 toward the bottom of recess 31 . accordingly , the loop retaining support finger 28 will be withdrawn into the recess 31 through the bore 29 . as the rope loops 27 are not able to follow the loop retaining support finger 28 , the loops 27 are released whereupon the parachute and belts are freed from the load . as an alternative construction , three support fingers may be distributed nonconcentrically and in the form of an angle on the support plate 32 , namely one for each loop . if deemed necessary , provision can be made to prevent or delay the return of the loop retaining support finger 28 to the locking position thereby ensuring that the loops 27 will always be moved away out of the center of the cover 30 before the support finger 28 re - emerges from the bore 29 . such provision is not required in the described device in general since the support plate 32 assumes a non - parallel relationship to impact plate 8 upon impact because one or at the most two pins 34 will be pushed upwardly upon an impact . accordingly , as soon as the support finger 28 is withdrawn to the inside of cover 30 through the bore 29 the plate 32 will be displaced diagonally and the support finger will no longer be aligned with the bore 29 and cannot return to the locking position . referring to a still further embodiment in fig8 the impact plate 8 is supported from three long plungers 36 movably mounted within a cover 37 which is concentric with the load 1 . the plungers 36 are guided for movement in a longitudinal direction and define , if necessary with the use of bias springs as shown in fig7 the stable or &# 34 ; rest &# 34 ; position of the impact plate 8 . on the upper end of each plunger 36 , a cutting edge 38 is provided . a securing cord 39 is tied about the circumference of load 1 . securing cord 39 passes through the loops formed on the ends of belts 40 which are connected to the parachute lines . cord 39 is positioned , by suitable supports , immediately above the cutting edges 38 . on landing , the load is shifted by the force of impact at least to one of the plungers 36 , whereby the cutting edge 38 runs through the area of the support in which the cord 39 is located so that the cord 39 is severed . in order to limit the cord cutting stroke , and also to employ the deformation of impact plate 8 to absorb landing shock , a stop 41 can be provided on the central lower front surface 6 of the load 1 . the above - description of the impact component 8 as a plate should not be construed as limited to being a disc shaped member . to the contrary , component 8 may have an irregular shape such as , for example , a star or may be in the form of a ring , a cap or the like . where an embodiment of the invention is indicated as having a destructible connecting link for connecting the belt ends , i . e ., a severable cord or the like , it is preferable that a separate element of the belt ends be provided although , alternately , the belt ends which are not yet in an uninterrupted separated condition ( for example as a traversing belt ) may proceed into one another and then take on the character of the belt ends . before separation , there can be no outward differentiation between belt , belt end and connecting link . | 1 |
fig1 is a block diagram of a contact center environment 100 . the contact center 100 is staffed by agents who handle incoming and / or outgoing contacts . although the traditional and most common form of contact is by phone , other types of contacts can be used , such as text chat , web collaboration , email , and fax . an agent workspace includes an agent phone 110 and a workstation computer 120 . a network 130 connects one or more of the workstations 120 . a contact router 140 distributes or routes contacts ( incoming or outgoing ) to an agent position . voice over internet protocol ( voip ) calls and computer - based contacts ( e . g ., chat , email ) are routed over one or more data networks , and distributed over network 130 to one of the agent workstations 120 . contact router 140 may include an automatic call distributor ( acd ) 120 to route phone contacts . the embodiments described herein will refer to the acd 120 instead of contact router 140 , but analogous contact router actions and operations are intended to be captured by this disclosure . if an agent is not available to handle a particular call , acd 120 puts the call into a queue , which effectively places the caller on hold . when an agent is available , acd 120 connecting the outside trunk line 150 carrying the phone call to one of the agents . more specifically , acd 120 connects the outside trunk line 150 to the trunk line 160 of the selected agent . when an agent is ready to handle contacts , the agent first logs into the contact router 140 . this login notifies the contact router 140 that the agent is available to generate outgoing contacts or to handle incoming contacts . an agent &# 39 ; s state with respect to the router changes throughout the workday , as the agent performs work activities such as handling calls , performing after - call work , and taking breaks . an example list of states includes available , busy , after - call work , and unavailable . while handling a contact , the agent interacts with one or more applications 170 running on workstation 120 . by way of example , workstation applications could provide the agent with access to customer records , product information , ordering status , and transaction history . the applications may access one or more business databases ( not shown ) via network 130 . the contact center 100 also includes a work force management system ( wfms ) 180 . wfms 180 performs many functions . one of these functions is calculating staffing levels and agent schedules based on historical patterns of incoming calls . another function of wfms 180 is collecting call center contact statistics and providing this information , both historical and real - time , to the call center supervisor or manager . some of these statistics are typically displayed on a periodic basis in a “ pulse ” window . the pulse window is used by a call center manager to obtain a quick summary of call center operations during the last period . one statistic commonly shown in a pulse window is an actual staff count for the last period . the wfms 180 also maintains a list of agents and skills associated with each agent . examples of agent skills include knowledge of a particular product or process ( e . g ., customer service or sales ), and the ability to speak a particular language ( e . g ., spanish ). this agent - skill association information is provided to contact router 140 so that contact router 140 can route calls based on agent skills , as shown in fig2 . as each agent 210 begins work in the contact center , the agent 210 logs in to contact router 140 . contact router 140 uses the agent login information to determine the skills associated with an agent . each skill is associated with one or more queues 230 . for example , the scenario shown in fig2 includes four agents ( 210 a - d ) and three queues ( 230 a - c ). agent 210 a has only one skill ( 1 ), and is therefore associated with queue # 1 ( 230 a ). agent 210 b has two skills ( 1 , 2 ) and is therefore associated with queue # 1 ( 230 a ) and queue # 2 ( 230 b ). agent 210 c also has two skills ( 2 , 3 ), and is therefore associated with queue # 2 ( 230 b ) and queue # 3 ( 230 c ). finally , agent 210 d has a single skill ( 3 ), and is therefore associated with queue # 3 ( 230 c ). the contact router 140 receives incoming contacts and distributes each contact 220 to one of a set of queues 230 , where each queue 230 is associated with a particular agent skill . the contacts 220 remain queued until an agent 210 with appropriate skills is available . to determine in which queue 230 a contact is to be placed , the contact router 140 identifies which agent skills the contact relates to . the contact router 140 makes this determination by classifying the contact based on various parameters , such as customer input ( e . g ., touchtone or interactive voice recognition ) or contact information ( e . g . called number or calling number ). based on this classification , the contact is then distributed to a particular queue 230 , handled by agents having that skill . two simple examples of classification are : customer presses 1 for english , or 2 for spanish ; customer dials one toll - free number for sales or a different number for customer service . in that example , contacts classified as “ spanish ” would be routed to a queue associated with an agent having a spanish - speaking skill . as an agent 210 becomes available to handle a contact 220 , the contact router 140 routes , to that agent 210 , the next contact in one of the queues 230 associated with that agent 210 . in this scenario , all four agents are available to handle contacts . thus , the first contact in queue # 1 ( 220 a ) could be routed to agent 210 a or agent 210 b . the first contact in queue # 2 ( 220 b ) could be routed to agent 210 b or agent 210 c . the first contact in queue # 3 ( 220 c ) could be routed to agent 210 c or agent 210 d . fig3 is a block diagram showing several components of the wfms 180 , including an activity collector 310 , an activity database 320 , a staff statistics calculator 330 , and a user interface 340 . as an agent handles contacts throughout a workday , the contact router 140 reports changes in the state of the agent &# 39 ; s phone to the wfms 180 , as acd events 350 p . as an agent interacts with various applications 170 on his workstation 120 , an application monitor 360 tracks and reports application events 350 a to the wfms 180 . in some embodiments , the granularity of application events 350 a is application - level , so that events describe when applications start and exit , and when a user switches from one application to another . in other embodiments , the granularity is screen - level ( events describe a particular screen displayed within an application ) or low - level ( events describe input and / or output associated with each application such as keystrokes , mouse clicks , and screen updates ). the collector 310 receives these events 350 from multiple sources . an event 350 has an occurrence time and a descriptor which includes fields such as event source ( e . g ., acd , application monitor ), type , and agent identifier . if the event 350 does not include an agent identifier , the collector 310 maps the phone or workstation identifier to a corresponding agent identifier based on information obtained at agent login . thus , the event 350 indicates , either directly or indirectly , an agent identifier . from the reported events 350 , the collector 310 creates agent activity records 370 , and stores them in the database 320 . in some embodiments , the activity records 370 stored in the database 320 include an agent identifier , an activity source , an activity code , a start time , a stop time , and a duration . the database 320 stores various other types of records also . a contact center manager uses the user interface 340 to create agent records 375 , each of which includes the skill ( s ) possessed by each agent . the user interface 340 is also used to create campaign records 380 , each of which includes a set of acd queues which is associated with the campaign . a person of ordinary skill in the art of software development will understand that the data organization described above is only one way among many to organize database 320 . database 320 can be organized in many other ways that allow the same relationships to be expressed , and all such organizations are intended to be captured by this disclosure . the staff statistics calculator 330 uses the information provided by the activity records 370 , agent records 375 , and campaign records 380 to calculate per - queue staff statistics 390 for a staffing interval . the staff statistics calculator 330 produces queue - specific staff counts for the interval , based on activity records , skill sets associated with agents , and skill sets associated with contact queues . in some embodiments , staff statistics 390 include a body , or staff , count . as will be understood by one skilled in the art , a staff count is the number of agents logged into a queue in some time interval . the body count does not take into account the fact that agents with multiple skills can handle multiple queues , and therefore divide their time among specific queues ( associated with the agent &# 39 ; s skills ). in some embodiments , staff statistics 390 include a full - time equivalent ( fte ) count . as will also be understood by one skilled in the art , an fte count is the number of dedicated agents needed to achieve the service levels being seen on a queue . thus , the fte count does take into account the way agents divide their time among queues , and that agents with multiple skills are more efficient . in some embodiments , the calculation of staff statistics 390 is run periodically , and in others the calculation is performed on demand . the staff statistics calculator 330 will now be described in further detail . although an activity record 370 describes which agent 210 performed the activity , an activity record 370 does not directly specify which of the queues 230 the agent was servicing at the time associated with the activity . therefore , the staff statistics calculator 330 performs further processing to determine which acd queue or queues 230 an agent 210 is counted against when calculating the per - queue staff statistics 390 . fig4 is a flowchart depicting functionality of an embodiment of the staff statistics calculator 330 . at block 410 , the activity records 370 for an agent 210 are retrieved . next ( block 420 ), the activity records 370 are examined to determine the duration of all activities occurring within the desired time period . at block 430 , the total duration is compared to a threshold . if the threshold is not met , then processing continues with the next agent 210 , at block 410 . if the total duration threshold is met , then processing continues at block 440 , where a subset of queues is selected . the queue selection process will be described in further detail later , in connection with fig5 . next ( block 450 ), the body count in each of the per - queue staff statistics 390 is incremented by one for each of queues selected in block 440 . at block 460 , the full time equivalent ( fte ) count in the per - queue staff statistics 390 is calculated for each of queues selected in block 440 . by way of example , calculation of fte counts can be performed using a reverse erlang c formula , as follows p c = e n n ! × n n - e ∑ ( e x x ! + ( e n n ! × n n - e ) ) where p c is the probability that a customer will experience a non zero delay , e is the total traffic offered ( in erlangs ), and n is the total number of resources available . one of ordinary skill in the art should understand erlang calculations , so this will not be discussed in further detail . at block 470 , a determination is made as to whether all agents 210 have been processed . if yes , then processing is finished . if no , then processing continues with the next agent 210 , at block 410 . fig5 is a data flow diagram of an embodiment of the queue selection process 440 . an agent record 510 is provided as input to the queue selection process 440 . in the implementation shown in fig5 , the agent record 510 has an association ( 520 ) with one or more campaign records 530 , and each campaign record 530 has an association ( 540 ) with one or more queue records 550 . thus , each agent record 510 is associated , through one or more campaign records 530 , with a set ( 560 ) of one or more queue records . in another implementations ( not shown ), the campaign feature may not be present , thus an agent can be directly associated with a queue . using information in the agent record 510 , a subset 570 of the set 560 of queue records is selected for update as follows . for each queue record 550 in the set 560 , the skill list ( 580 ) of the queue record 550 is compared with the skill list ( 590 ) of the agent record 510 . in the case of a queue skill list 580 with no skills , then the queue record 550 is put into the selection subset 570 . otherwise , the matching queue record 550 goes into the selection subset 570 if all skills in the queue skill list 580 are found in the agent skill list 590 . instead of adding queues to an initially - empty selection subset , an alternative embodiment could instead produce a selection set by removing queues with non - matching skills from the original set 560 of queue records . for example , in the scenario shown in fig5 , agent record 510 has an association with two campaigns ( 530 a , 530 b ). campaign 530 a has an association with two queues ( 550 a , 550 b ). campaign 530 b has an association with two queues ( 550 c , 550 d ). the original queue set 560 thus comprises four queues , 550 a - d . the agent skill list 590 includes two skills : 2 and 5 . only one of the four queues has a skill list 580 that includes both skill 2 and skill 5 : queue 550 a . thus , queue 550 a goes into the selection subset 570 . queue 550 d also goes into the selection subset 570 because queue 550 d has no skills in the queue skill list 580 . another implementation of queue selection process 440 ( not shown ) handles distributed campaigns . a distributed campaign uses at least one distributed queue , which is represented as a parent queue having a list of ( normal ) child queues . in this implementation , queue selection process 440 further expands the selection subset 570 by including in the selection subset 570 the parent of each child queue record . thus , the staff statistics 390 are incremented for the parent queue as well as the child queue . in another variation of staff statistics calculator 330 , each contact queue 230 is associated with a media type ( e . g ., phone , e - mail , or chat ). the staff statistics calculator 330 in this embodiment computes the staff counts for a particular media , or across all media ( a feature called “ combined staffing ”.) when this multi - media embodiment is combined with a distributed campaign embodiment , the staff statistics 390 for the child queue are incremented only if that queue is associated with the same data source as the agent under consideration . fig6 is a hardware block diagram of a general - purpose computer 600 which can be used to implement the system and method for calculating workforce staffing statistics from activity records . the computer 600 contains a number of components that are well known in the art of contact center software , including a processor 610 , a network interface 620 , memory 630 , and non - volatile storage 640 . examples of non - volatile storage include , for example , a hard disk , flash ram , flash rom , eeprom , etc . these components are coupled via a bus 650 . the memory 630 contains instructions which , when executed by the processor 610 , implement the system and method for calculating workforce staffing statistics from activity records such as the process depicted in the flowcharts and dataflow diagrams of fig4 and 5 . omitted from fig6 are a number of conventional components , known to those skilled in the art , that are unnecessary to explain the operation of system 600 . the systems and methods for calculating workforce staffing statistics from activity records disclosed herein can be implemented in software , hardware , or a combination thereof . in some embodiments , the system and / or method is implemented in software that is stored in a memory and that is executed by a suitable microprocessor situated in a computing device . however , the systems and methods can be embodied in any computer - readable medium for use by or in connection with an instruction execution system , apparatus , or device . such instruction execution systems include any computer - based system , processor - containing system , or other system that can fetch and execute the instructions from the instruction execution system . in the context of this disclosure , a “ computer - readable medium ” can be any means that can contain , store , communicate , propagate , or transport the program for use by , or in connection with , the instruction execution system . the computer readable medium can be , for example but not limited to , a system or propagation medium that is based on electronic , magnetic , optical , electromagnetic , infrared , or semiconductor technology . the functionality could also be implemented in logic embodied in hardware or software - configured media . specific examples of a computer - readable medium using electronic technology would include ( but are not limited to ) the following : an electrical connection ( electronic ) having one or more wires ; a random access memory ( ram ); a read - only memory ( rom ); an erasable programmable read - only memory ( eprom or flash memory ). a specific example using magnetic technology includes ( but is not limited to ) a portable computer diskette . specific examples using optical technology includes ( but are not limited to ): an optical fiber ; and a portable compact disk read - only memory ( cd - rom ). any process descriptions or blocks in flowcharts should be understood as representing modules , segments , or portions of code which include one or more executable instructions for implementing specific logical functions or steps in the process . as would be understood by those of ordinary skill in the art of the software development , alternate embodiments are also included within the scope of the disclosure . in these alternate embodiments , functions may be executed out of order from that shown or discussed , including substantially concurrently or in reverse order , depending on the functionality involved . this description has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the disclosure to the precise forms disclosed . obvious modifications or variations are possible in light of the above teachings . the embodiments discussed , however , were chosen to illustrate the principles of the disclosure , and its practical application . the disclosure is thus intended to enable one of ordinary skill in the art to use the disclosure , in various embodiments and with various modifications , as are suited to the particular use contemplated . all such modifications and variation are within the scope of this disclosure , as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly and legally entitled . | 6 |
the embodiment example shows a workpiece mounting for a laser working machine . in particular with this working machine heavy workpieces can be worked . the working machine can be used , for example for the purpose of eliminating and reworking by means of laser beams defects in injection mold form tools . underneath the conventional laser beam generator and focusing unit , not shown in the drawing , is disposed a horizontal table surface 10 . the table surface 10 is produced of metal sheets adhered one to the other under pressure and comprises a planarity of better than 0 . 1 mm . on the table surface 10 is disposed an x - y conveying unit , which comprises an x linear guidance 12 and a y linear guidance 14 . the y linear guidance 14 comprises a positioning drive 16 fixed on the table surface 10 , which comprises an electric motor and a position sender serving for feed back . the positioning drive 16 drives via a spindle 18 , for example a ballscrew , a linearly guided y carriage 20 . the y carriage 20 carries a positioning drive 22 , which also comprises an electric motor and a position sender for reporting - back . the positioning drive 22 drives via a spindle 24 , for example a ballscrew , a linearly guided x carriage 26 . due to the linear guidances 12 and 14 disposed at right angles to one another , the x carriage can be moved via the positioning drives 16 and 22 with coordinate control on the plane of the table surface 10 . the coordinate control can take place via a joy stick , if an individual manual positioning of the workpiece to be worked is desired . a coordinate control via a programmable cnc control is also possible . the linear guidances 12 and 14 are structured in a manner known per se such that a detailed description is not required . for chucking the workpiece a circular mounting plate 28 is provided which has a diameter adapted to the application purpose , for example a diameter of approximately 350 mm . the mounting plate 28 carries at its top side a pattern of apertures known per se which serves for inserting chucking means for the workpiece to be chucked . formed on at the circumference of the mounting plate 28 is a margin 30 directed downwardly , into which is set a base of a porous sintered aluminum plate . via a ( not shown ) connection line and a controllable magnet valve , air under pressure , for example at a pressure of approximately 3 bar , is introduced into the hollow body formed by the mounting plate 28 and the base . this air emanates through the porous base over its entire surface and forms an air cushion which bears the mounting plate 28 with an air gap 32 of up to approximately 0 . 2 mm between the table surface 10 and the base , or the lower edge of margin 30 . if the compressed air is introduced under the mounting plate 28 , the mounting plate 28 is supported in this way through the air cushion and is mounted freely floating and thus free of friction . at an air consumption of approximately 17 l / min at a pressure of 3 bar , a bearing force of the mounting plate 28 is obtained of , for example , up to 200 kg . if the air supply is switched off via the magnet valve , the mounting plate 28 becomes deposited with its margin 30 on the table surface 10 and is seated immovably and securely . when the air cushion under the base of the mounting plate 28 is built up , the mounting plate 28 , due to its friction - free air support , can readily be displaced manually on the table surface 10 and be rotated about its vertical axis . by rotating the mounting plate 28 , in this way a workpiece chucked on the mounting plate 28 can be aligned , in particular in its angular position , such that the axes of the workpiece correspond to the x and y axes of the linear guidances 12 and 14 . as soon as the mounting plate 28 is manually aligned , it is clamped on the x - y conveying unit in order to be securely connected with it . for this purpose the mounting plate 28 comprises at the outer circumference approximately at half the height of its margin 30 a flange 34 extending over the entire circumference and projecting radially outwardly . on the x carriage 26 , displaceable on the x linear guidance 12 , is fastened a metal connection sheet 36 projecting parallel to the plane of the table surface 10 . the metal connection sheet 36 is , as evident in fig3 bolt - connected with the x carriage 26 and projects from it . on the outer edge facing away from the x carriage 26 , of the metal connection sheet 36 is fastened a seat 38 on the underside of the metal connection sheet 36 , which has the form of a circular arc segment with the radius of the mounting plate 28 . if the mounting plate 28 while being air supported is slid against the seat 38 , the seat 38 extends under the flange 34 of the mounting plate 28 and comes to rest on the outer circumference of the margin 30 . outside of the outer circumference of flange 34 are provided in the seat 38 , offset angularly with respect to one another in the circumferential direction , two threaded bores 40 . onto the metal connection sheet 36 are set clamping jaws 42 in such position that a vertical continuous bore 44 of the clamping jaw 42 is axially aligned with one of the threaded bores 40 of the seat 38 . clamping levers 46 are each inserted with a threaded bolt 48 through the bores 44 and screwed into the threaded bores 40 . the clamping levers 46 are each seated on the clamping jaws 42 , in order to tension these axially against the seat 38 . each of the clamping jaws 42 comprise a jaw segment 50 , which extends over the flange 34 and is in contact on the outer circumference of margin 30 . if the mounting plate 28 is slid with its flange 34 against the seat 38 , such that it extends beneath the flange 34 , the jaw segments 50 are set on the flange 34 . by tightening the clamping levers 46 , the jaw segments 50 are tensioned against the flange 34 such that this flange 34 and , consequently , the mounting plate 28 is clamped on the seat 38 and is securely connected with the x carriage via the metal connection sheet 36 . through the clamping the mounting plate 28 is attached torsionally tight on the x carriage and thus on the conveying unit . via the positioning drives 16 and 22 the mounting plate 28 can be moved under control in the x and y direction . the metal connection sheet 36 has sufficient elasticity in the vertical z direction , perpendicular to the plane of the table surface 10 , such that the mounting plate 28 can move vertically over the height of the air gap 32 without a force being transmitted in the z direction onto the x - y conveying unit . the present invention having been herein described in reference to a preferred embodiment thereof , it will be apparent to one skilled in the art that various changes and modifications may be made to this invention without departing from the scope of the following claims . | 1 |
in order to facilitate the reader &# 39 ; s understanding of the present invention , the following list of acronyms and their general meanings are provided : ac if — aircraft interface atflir — a targeting pod developed by raytheon . ccd - tv — charged couple device television cp — core pod flir — forward looking infrared red ins — inertial navigation system lantirn — a lockheed martin developed targeting pod . litening — a northrop grumman developed targeting pod . ofp — operational flight program pvi — pilot vehicle interface sniper — a lockheed martin developed targeting pod . a “ host aircraft ” is defined to be any known family of aircraft . a “ host aircraft variant ” is defined to be any existing variation of interface signal protocol to the above - mentioned known family of aircraft . a “ virtual translation layer ” is defined to be a plurality of store interface objects utilizing inherited attributes of a parent interface class to isolate host aircraft commands and status from a predefined core store protocol . an “ auto detection scheme ” is defined to be a method by which the specific host aircraft and host aircraft variant can be determined . a “ store ” is defined to be a targeting pod , a weapon system or other device interfacing to a predetermined suite of host aircraft and host aircraft variants . an “ object ” means a self - contained module of data and its associated processing . objects are the software building blocks of object technology . “ encapsulation ” means the creation of self - sufficient modules that contain the data and the processing ( data structure and functions that manipulate that data ). these user - defined , or abstract , data types are called “ classes .” the term “ functionally mapped ” means commanded data is translated to a subsystem software module . the term operational flight program “ ofp ” is the terminology the u . s . air force uses to describe the software programmed into avionics systems . such software is often reviewed and updated regularly . referring now to fig1 a , an illustration of an aircraft 10 having a targeting pod 11 is provided . while the present invention is described in the context of the aircraft 10 and the targeting pod 11 , it should be understood that the present invention is applicable to any aircraft store including a missile , a bomb , a radar system , an electronic warfare system , a telecommunication system or any other device attached to or disposed in an aircraft or other vehicle . referring now to fig1 b , a block diagram of the hardware and software of the targeting pod 11 is provided . the targeting pod 11 includes a resident central electronics unit ( ceu ) 13 and a single operational flight program ( ofp ) 14 . the ofp 14 comprises pod software 15 having an aircraft interface ( acif ) software object and a core pod ( cp ) object . referring now to fig2 , a block diagram illustrates the details of the pod software 15 including the acif software object 20 and the core pod object 25 . the acif software object 20 preferably performs functions that are spread across three layers . these layers include a passive auto detection layer 21 , a dynamic object instantiation layer 22 , and a dynamic translation layer 23 . the acif software object 20 receives input from the aircraft crew , performs the necessary interface unique functions and transmits messages to the core pod object 25 . the core pod object 25 processes these messages and provides input to or receives output from the pod 11 via the internal pod interfaces . referring now to fig3 , a more detailed block diagram illustrates the cp object 25 as being embedded within two processors 26 , 27 disposed within the ceu 13 of the pod 11 . the system control processor 26 contains the acif object and a first portion of the cp object 25 . the track control processor 27 contains a second portion of the cp object 27 and interfaces with the internal pod interfaces . the processors 26 , 27 may be a single cpu or distributed among multiple processor configurations . referring now to fig4 , a flow chart illustrates the operation of the acif interface software object 20 and the core pod software object 25 . this flowchart is described in the context of an exemplary 1553 physical interface . it should be noted that other physical interfaces could be used in place of the 1553 physical interface . the acif interface software object 20 provides a first auto - detection layer 21 which is initiated with the execution of the start step 41 . in step 42 , the targeting pod 11 is powered on . in step 43 , the terminal address of the aircraft 10 is evaluated , and in step 44 , 1553 messages are transmitted between the aircraft 10 and the targeting pod 11 . in step 45 , there is an interrogation of the 1553 message characteristics / behaviors which completes the auto - detection layer 21 . the event completion within the auto - detection layer 21 , however , will vary depending upon which type of aircraft 10 acts as the host . in step 46 , the software enters a dynamic instantiation layer 22 in which the matching acif object 20 , corresponding to the host aircraft 10 , is dynamically instantiated . in object technology , instantiate means to create an object of a specific class . this is essentially a one - time event . in step 51 , the software enters a translation layer 23 , by capturing the currently received 1553 messages from the aircraft 10 . in step 52 , the received 1553 messages are translated to the targeting pod 11 . in step 53 , the targeting pod 11 responds to the translated messages . in step 54 , the pod status is translated to a 1553 message . in step 55 , the pod status is transmitted via a 1553 message to the aircraft 10 . the steps 51 - 55 of the translation layer 23 are a continuous series of events which occur as long as the pod 11 is operational . the auto detection interrogation scheme of the store or pod 11 dynamically determines the host aircraft type from a predetermined suite of host aircraft via 1553 multiplexer protocol or other protocol . the auto detection is accomplished without the use of jumpers or other non - 1553 hardware components . the specific host aircraft 10 is determined by evaluating a predetermined suite of known terminal addresses and polling the 1553 mux traffic until a valid command / response is received from the mated host 10 . the resultant host / terminal address pairing can then be validated by evaluating specific message protocol and characteristic . this validation step is necessary to prevent a potential host / terminal address pairing to a non - unique terminal address . different host platforms may share a terminal address with existing stores . a predetermined timeout for each terminal address is preferably utilized to provide for sufficient response time . once the host aircraft 10 is identified via valid communication , the specific host variant can be determined , if necessary . the store utilizes predetermined and unique interface protocol attributes possibly relating to message size and number of host sub - addresses to identify the correct host variant . once auto detection is complete and has identified the mated host aircraft 10 and host variant , the acif object 20 is instantiated to provide specific translation between host aircraft 10 and store 11 . the architecture of aircraft interface software object 20 is designed to provide an encapsulated isolation layer comprising layers 21 - 23 so future and current aircraft platforms and interface variants can be configured and adapted into the software core baseline with minimal modifications . this encapsulation layer truly isolates and adapts the aircraft interface software object 20 from core pod functionality of cp object 25 . the key features of the software architecture include the ability to auto detect aircraft platform and variant , the aircraft interface ( ac if ) modularity , and the intelligent pod functional mapping . the ability to auto detect aircraft platform and variant is a distinct and desirable feature . the use of c ++ development software , however , provides the ability to encapsulate the auto - detected aircraft interface into an acif object 20 separate from the other pod control functions ( core pod functionality ) of the cp object 25 to provide a modular design . therefore , using the power of object inheritance , two objects 20 and 25 are used to create the software interface between the aircraft 10 and the pod 11 . referring to fig5 , the acif object 20 preferably contains two objects consisting of a first communication control object 27 and a second translation object 28 the first acif object 27 inherits the properties of the aircraft interface object class ( parent ) and captures the incoming control computer data from the host aircraft 10 . the second object 28 inherits the properties of the pod level commands object class ( parent ). this second object 28 translates the control computer data captured in the first object 27 into the functionally mapped pod software architecture to be used by the pod 11 . referring now to fig6 , a simplified block diagram illustrates the hardware of the pod 11 . the pod 11 may include a laser control module 31 for laser tracking and a flir sensor 32 for imaging . the flir sensor 32 is coupled to a digital video module 33 which processes the image data and preferably records it on a recorder 34 . both the laser module 31 and the digital video module 33 are coupled to an ins / navigation system 35 . the term “ functionally mapped ” means commanded data is translated to a subsystem software module . for example , ins data would be mapped to the ins / navigation module 35 , laser data would be mapped to the laser control module 31 . pod functionality can also be increased or decreased without affecting the ac if control layer because of this modularity . overall , the two part encapsulated modular aircraft interface of the present invention ensures the core pod control software has no direct interaction with the specific control computer of the aircraft 10 . this architecture allows the present invention to operate on multiple platforms and variants with minimal or no core software modifications . the present invention allows for highly efficient “ asset pooling ” of delivered assets . a single pod 11 with one software executable will configure and adapt automatically to all defined host aircraft platforms . a “ common hardware adapter ” may be required to adapt the pod 11 mounting surface to multiple bomb and wing rack mounting points on the aircraft 10 . moving an atp targeting pod 11 from one aircraft host 10 to another , however , does not require reprogramming and can be accomplished by remounting to the second host aircraft 10 and powering up the pod 11 . this entire operation should take less than fifteen minutes . this is a capability unique in the embedded targeting pod product suite and allows for a smaller number of assets to be shared among host platforms or aircraft 10 during deployment and training exercises . the software associated with the present invention provides maximum host / variant encapsulation in the virtual space of the targeting pod 11 . more specifically , hardware , except for common mounting is not needed for translation of messages between the aircraft 10 and the pod 11 . the software of the present invention provides auto detection of host / variant for each pod application . minimal modification of the software is necessary when the new hosts / variants are developed , since less than 5 % of the total ofp is dedicated to aircraft interface software . when the core pod functionality is updated , there is a minimal impact to existing hosts / variants . in addition to the ease of modifying the software of the present invention , certain characteristics are isolated to the host interface . for example , issues relating to pvi switchology , host ins / gps characteristics , sub - address / message content are minimized as a result of host isolation . in addition , isolation facilitates pod functions related to multiplexer timing , units / scale , change requests , and symbology characteristics . the ability to have one evolving ofp for all aircraft hosts and variants provides several advantages over the prior art . a single ofp minimizes customer cost to formally re - validate every change , and it maximizes the ability to quickly integrate new capabilities into user pod suite . since the host interface suite is entirely located on one cpu , there is no global data connecting the host interfaces to pod functions . since the acif class is object oriented and highly encapsulated , it provides strong virtual separation from core system functionality . moreover , all core capabilities are retained for all hosts making it possible to interface the targeting pod with multiple hosts and variants . | 6 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . improving the contrast ratio is reduced when using the column spacers improves the quality of large - area ips - mode liquid crystal display devices . however , there are realistically few methods for effectively removing a region where the rubbing is incompletely performed because of the column spacers . the most efficient method is that an incomplete rubbing region ( alignment defective region ), that is , a region where light leakage occurs , is located at a region where a black matrix is formed . since such a method can eliminate the alignment defective region by simply blocking the inferior alignment region without changing a structure or a process ( because the alignment defective region exists in the pixel ), the contrast ratio can be improved without a cost increase or yield deterioration . in addition , since an additional black matrix is not formed but the already formed black matrix blocks the alignment defective region , the contrast ratio can be improved without reducing an aperture ratio . by changing a location where a column spacer is formed or by changing a shape of a data line , the column spacer is aligned with a black matrix formed along the column spacer to thereby prevent light leakage . in addition , light leakage is prevented by aligning column spacers which are formed not inside a pixel but outside an liquid crystal panel with column spacers inside the pixel , that is , with the black matrix formed along the data line . hereinafter , with reference to the accompanying drawings , the present invention will be described in more detail . fig3 is a view illustrating a structure of an ips - mode liquid crystal display device in accordance with one embodiment of the present invention . as shown in fig3 , an ips - mode liquid crystal display device of the present invention includes a plurality of pixels defined by a plurality of gate lines 103 and a plurality of data lines 104 . a thin film transistor 110 which includes a gate electrode 111 , a semiconductor layer 112 formed on the gate electrode 111 and forming a channel layer , which is activated when a scan signal is applied , and a source electrode 113 and a drain electrode 114 formed on the semiconductor layer 112 is disposed on the crossing of the gate line 103 and the data line 104 in the pixel . the data line 104 is bent in a zigzag shape to divide a pixel into two domains . that is , the pixel is bent at a certain angle on the basis of the center of the pixel and therefore is symmetric , so that the pixel is divided into two domains which compensate a main viewing angle . the data line 104 has a bending direction opposite to the data line of the related art ips - mode liquid crystal display device illustrated in fig1 . that is , in the related art ips - mode liquid crystal display device , a bent portion of the data line is convex toward a region where the thin film transistor is formed ( i . e ., the right region of the data line ), while in the present invention , a bent portion of the data line 14 is convex toward a region where the thin film transistor 110 is not formed ( i . e ., the left region of the data line ). in other words , the bending direction of the data line 104 in the present invention is opposite to that of the data line in the related art ips - mode liquid crystal display device illustrated in fig1 . a common electrode 105 and a pixel electrode 107 substantially parallel with the data line 104 is disposed in the pixel . like the data line 104 , the common electrode 105 and the pixel electrode 107 are also bent to be convex toward the region where the thin film transistor 110 is not formed . in addition , a common line 116 connected to the common electrode 105 is disposed at an upper portion of the pixel . a pixel electrode line 117 connected to the pixel electrode 107 is disposed on the common line 116 , so that an accumulated capacity is formed between the common line 116 and the pixel electrode line 117 . as shown in fig3 , a column spacer 118 is formed on the gate line 103 on the left of the data line 104 . that is , the column spacer 118 is formed on the gate line 103 where the thin film transistor 110 is not formed . since the column spacer 118 is formed at each pixel , the column spacers are arranged in a line along a direction of the y - axis on the left side of the data line 104 over the liquid crystal panel 101 . the column spacer 118 is formed of a thermosetting resin . the thermosetting resin and the like is applied and then patterned to form the column spacer 118 . formed by the patterning , the column spacer 118 is also referred to as a patterned spacer . at this time , the column spacer 118 may be formed on the first substrate where the thin film transistor 110 is formed or on the second substrate 130 where the black matrix 132 and the color filter layer 134 are formed . when the liquid crystal panel 101 is rubbed , a region where the rubbing is incompletely performed ( i . e ., an alignment defective region ) is formed on the left side of the data line 104 along a direction where the column spacer 118 is arranged . as a result , light leakage occurs on the liquid crystal panel through the alignment defective region and therefore a light leakage region 119 in a band shape is formed on the left side of the data line 104 in the direction of the y - axis . meanwhile , the common electrodes 105 are arranged adjacent to both sides of the data line 104 . the common electrode 105 prevents distortion of a horizontal electric field generated between the common electrode 105 and the pixel electrode 107 by shielding an electric field generated therebetween . accordingly , since a black matrix ( not shown ) formed on the data line 104 region blocks not only light transmitted through the data line 104 region but also light transmitted through the common electrode 105 regions disposed at both side surfaces of the data line 104 , the black matrix should be formed to cover the common electrodes 105 formed at both side surfaces of the data line 104 as well as the data line 104 . as shown in fig3 , the light leakage region 119 is arranged along the data line 104 and the common electrode 105 disposed on the left side of the data line 104 . the light leakage region 119 is arranged by the data line 104 whose bent portion protrudes toward the left region ( i . e ., a region where the thin film transistor is not formed ). such an arrangement of the light leakage region 119 will be clearly shown in comparison with the ips - mode lcd device in the related art . as the light leakage region 119 is arranged along the data line 104 and the common electrode 105 on the left side of the data line 104 , the light leakage region 119 is arranged substantially along the black matrix . thus , the black matrix blocks light which leaks outside the liquid crystal panel 101 . meanwhile , the ips - mode lcd device in accordance with the present invention has almost the same structure of the ips - mode lcd device illustrated in fig2 , other than a planar structure of the data line 104 , the common electrode 105 , and the pixel electrode 107 . however , the ips - mode lcd device of the present invention is not limited to such a structure . as shown in fig4 a , in the ips - mode liquid crystal display device of the present invention , the common electrode 105 may be formed on a first substrate 120 by the same process as the gate electrode 111 of the thin film transistor , and the pixel electrode 107 formed of a transparent conductive material such as ito ( indium tin oxide ) or izo ( indium zinc oxide ) may be formed on the passivation layer 124 . alternatively , as shown in fig4 b , both the common electrode of 105 and the pixel electrode of 107 formed of the transparent conductive material such as ito ( indium tin oxide ) or izo ( indium zinc oxide ) may be formed on the passivation layer 124 . the common electrode 105 and the pixel electrode 107 are formed of the transparent conductive material so as to improve brightness and aperture ratio of the ips - mode lcd device . as described , the ips - mode lcd device in accordance with the present invention can block the light leakage region by the black matrix by allowing bending direction of the data line 104 , the common electrode 105 and the pixel electrode 107 to be opposite to that of the ips - mode lcd device of the related art and aligning the column spacer 118 with the data line 104 . thus , the ips - mode lcd device in accordance with the present invention can improve the contrast ration of the liquid crystal panel 101 . in terms of alignment of column spacer 118 and the data line 104 , when the column spacer is formed on the right side of the data line , not on the left side thereof , that is , when the column spacer is formed on a region where the thin film transistor is formed , the column spacer and the data line are also aligned with each other to thereby block the light leakage region effectively . the liquid crystal display device having this structure can be included as another embodiment of the present invention . in addition , in terms of alignment of the data line and the column spacer , or alignment of the black matrix and the column spacer which are formed on the data line region , in which a column spacer 218 is formed at an intersection of a gate line 203 and a data line 204 is shown in fig5 . in such a structure , a black matrix formed along the data line 204 can block a light leakage region 219 because the light leakage region 219 formed by the column spacer 218 is disposed along the data line 204 . meanwhile , the ips - mode lcd device of the present invention is not limited to a bent structure illustrated in fig3 and 5 . fig6 shows an ips - mode lcd device having a structure in which a data line 304 , a common electrode 305 and a pixel electrode 307 are not bent . since a column spacer 318 is formed at the crossing of a gate line 303 and the data line 304 like the structure illustrated in fig5 , a rubbing defective region resulting from the column spacer 318 is formed along the data line 304 . thus , the rubbing defective region is blocked by a black matrix formed long the data line 304 , thereby preventing a decrease of a contrast ratio which results from light leakage . as described , the ips - mode lcd device of the present invention may have various forms of a data line , a common electrode and a pixel electrode , and besides a column spacer may be disposed at various locations . in addition , the common electrode and the pixel electrode may be also formed on various locations ( e . g . ; a first substrate , a gate insulating layer or a passivation layer ). the ips - mode lcd device of the present invention , view in this light , is not limited to a specific structure illustrated in the drawings or described above . though only the ips - mode lcd device having a two - block ( bock means a region where an image is substantially implemented ) structure where two common electrodes and one pixel electrode are disposed in a pixel is illustrated in fig3 , 5 and 6 , a four - block ips - mode lcd device where three common electrodes and two pixel electrodes are disposed or a six - block ips - mode lcd device where four common electrodes and three pixel electrodes are disposed , or an ips - mode lcd device having more blocks may be included in the present invention . meanwhile , processes for fabricating an ips - mode lcd device is substantially performed on a glass substrate . that is , after a thin film transistor process and a color filter process are performed on the glass substrate where a plurality of liquid crystal panels are formed , the ips - mode lcd device is completed by separating the glass substrate into unit panels . however , as the demand for a large - area ldc device increases , the glass substrate also increases in size and accordingly in weight . thus , when processes are performed on a unit of the glass substrate , though the column spacer is formed on a panel region , it is hard to main a desired cell gap , because of the weight of the glass substrate . to solve such a problem , a uniform cell gap of the overall glass substrate , not of the liquid crystal panel , should be maintained by forming a column spacer on a dummy area where the liquid crystal panel is not formed . as shown in fig7 , a large - area glass substrate 400 where a plurality of liquid crystal panels 401 are formed is illustrated . though only four liquid crystal panels 401 are formed on the glass substrate 400 in fig7 for the purpose of simplicity , two , six or more liquid crystal panels 401 may be formed on the glass substrate 400 . as shown in fig7 , column spacers 458 are formed on a dummy area 450 where the liquid crystal panel 401 is not formed . the column spacers 458 of the dummy area 450 support the glass substrate of the dummy area 450 and maintain a cell gap of the overall glass substrate , thereby maintaining a uniform cell gap inside the liquid crystal panels 401 . a rubbing process carried out on an alignment layer formed on the liquid crystal panels 401 is performed by a unit of the glass substrate 400 , not by units of one liquid crystal panel 401 . in other words , an alignment direction of each liquid crystal panels 401 is determined by rubbing the overall glass substrate 400 by using a large - size rubbing roll . however , since the column spacers 458 are disposed on the dummy area 450 of the glass substrate 400 , an alignment defective region 419 is formed by the column spacers 458 during the rubbing . since the alignment defective region 419 of the dummy area 450 which is formed by the column spacers 458 is formed on the entire glass substrate 400 along a rubbing direction , the liquid crystal panels 401 also has the alignment defective region 419 . accordingly , since the column spacers 458 of the dummy area 450 cause the same problem as the column spacers disposed in the pixel , light leakage due to the column spacers disposed on the dummy area 450 of the glass substrate 400 should be eliminated in order to improve the ips - mode lcd device in quality . fig8 is an enlarged view of an a area of fig7 . as shown in fig8 , a plurality of column spacers 458 are formed on the dummy area 450 of the glass substrate adjacent to the liquid crystal panel 401 . although the liquid crystal panel has the structure illustrated in fig3 , it may have the structures illustrated in fig5 and 6 . a column spacer 418 is arranged on the left side of a data line 403 , that is , on a gate line 404 where a thin film transistor 410 is not formed . the column spacer 458 of the dummy area 450 is also aligned with the column spacer 418 of the liquid crystal panel 401 . accordingly , when a rubbing process is performed on the glass substrate , an alignment defective region resulting from the column spacer 418 of the liquid crystal panel 401 and an alignment defective region resulting from the column spacer 458 of the dummy area are formed on the same location 419 in the pixel . meanwhile , since the alignment defective region 419 is disposed along a black matrix formed along a data line 404 ( a black matrix formed over the data line 404 and common electrodes 405 at both side surfaces of the data line 404 ), the black matrix blocks light leakage through the alignment defective region 419 . consequently , a contrast ratio can be improved by removing the light leakage region . as described , in the present invention , the light leakage region can be effectively eliminated by aligning the column spacer 458 formed on the dummy area 450 of the glass substrate with the column spacer 458 of the liquid crystal panel 401 ( i . e ., by aligning the column spacer 458 of the dummy area 450 with the black matrix of the liquid crystal panel 401 ). the column spacer 458 of the dummy area 450 may be formed at various locations according to a structure of the liquid crystal panel 401 . in other words , when the liquid crystal panel 401 is formed of the structure of fig5 or 6 , a location where the dummy area 450 is formed may change according to a location of the column spacer 418 formed on the panel having the corresponding structure . since the column spacer 418 formed on the liquid crystal panel 401 is aligned with the data line 404 , the column spacer 458 of the dummy area 450 which is aligned with the column spacer 418 may be considered to be aligned with the data line 404 of the liquid crystal panel 401 , strictly speaking , with the black matrix formed along the data line 404 . as described so far , since a column spacer formed on a liquid crystal panel and a column spacer of a dummy area are aligned with a black matrix formed along a data line , a light leakage region resulting from an alignment defective region by the column spacer is blocked by the black matrix . as a result , light leakage occurring on a screen can be blocked in a normally black mode , thereby improving a contrast ratio of an ips - mode lcd device . as the present invention may be embodied in several forms without departing from the spirit or essential characteristics thereof , it should also be understood that the above - described embodiments are not limited by any of the details of the foregoing description , unless otherwise specified , but rather should be construed broadly within its spirit and scope as defined in the appended claims , and therefore all changes and modifications that fall within the metes and bounds of the claims , or equivalence of such metes and bounds are therefore intended to be embraced by the appended claims . | 6 |
hereinafter , the present invention will be described in detail with reference to the drawing accompanying the most preferred embodiments which those skilled in the art practice the present invention easily . [ 0030 ] fig1 is a block diagram of lcd driving structure according to an embodiment of the present invention . referring to fig1 the lcd includes an lcd panel 1 , a gate driver 2 , a data driver 3 , a von voff vcom generator 4 , a timing controller 5 , and a gray voltage generator 6 . the lcd panel 1 receives data signals from the data driver 3 and scanning signal from the gate driver 2 . the data driver 3 transmits data signals to the lcd panel 1 . the gate driver 2 transmits gate signals to the pixels to turn on or off a thin film transistor ( tft ) . the von voff vcom generator 4 generates von voltage for turning on the gate , voff voltage for turning off the gate , and vcom voltage as a reference voltage for the tfts . the timing controller 5 generates timing control signals to controls the timing of the data inputted to the data and gate drivers 2 and 3 . the gray voltage generator 6 generates gray voltage inputted to the data driver 3 . [ 0032 ] fig2 shows a schematic structure of lcd according to a first embodiment of the present invention . referring to fig2 the lcd includes a tft array panel 110 , a printed circuit board ( pcb ) 120 , and a signal transmission film f disposed between the tft array panel 110 and the pcb 120 . the tft array panel 110 includes a plurality of gate driving ics 21 ˜ 2 m located at one edge thereof , a plurality of first data driving ics 31 ˜ 3 k located at another edge thereof , a plurality of second data driving ics 3 k + 1 ˜ 3 n located proximal to the plurality of first data driving ics 31 ˜ 3 k , and a display region 100 at the middle thereof . the display region 100 includes a plurality of gate lines 111 in the horizontal direction and a plurality of date lines 112 in the vertical direction . the plurality of the gate lines 111 are connected to the plurality of the gate driving ics 21 ˜ 2 m . the plurality of data lines 112 are connected to the plurality of the first data driving ics 31 ˜ 3 k and the plurality of the second data driving ics 3 k + 1 ˜ 3 n . according to an embodiment of the present invention , the plurality of first date driving ics 31 ˜ 3 k , the plurality of second data driving ics 3 k + 1 ˜ 3 n , and the plurality of gate driving ics 21 ˜ 2 m are mounted in the form of a chip on glass ( cog ) on the tft array panel 110 , and connected to the pcb 120 through the signal transmission film f . according to a preferred embodiment of the present invention , the signal transmission film f includes at least two signal transmission films f 1 and f 2 . the first transmission film f 1 includes a first lead wire for transmitting scanning signals and data signals ( gray data ) provided from the printed circuit board 120 to the plurality of gate driving ics 21 ˜ 2 m and the plurality of first data driving ics 31 ˜ 3 k , respectively . the second transmission film f 2 includes a second lead wire for transmitting data signals provided from the printed circuit board 120 to the plurality of second data driving ics 3 k + 1 ˜ 3 n . according to an embodiment of the present invention , the first and the second transmission films f 1 and f 2 can be a merged type or a separate type . the first and second transmission films f 1 and f 2 are preferably electrically connected to the tft array panel 110 through an anisotropic conducting film ( acf ) ( not shown ). however , one skilled in the art can readily appreciate that the first and second transmission films f 1 and f 2 can be connected in a number of different ways to the tft array panel 110 . the first lead wire is connected to a gate signal wire of the first gate driving ic 21 and a data signal wire of the first data diving ic 31 of the plurality of first data driving ics 31 ˜ 3 k for transmitting scanning signals and data signals , respectively . the second lead wire is connected to the nth data driving ic 3 n of the plurality of second data driving ics 3 k + 1 ˜ 3 n for transmitting data signals . therefore , the scanning signals and data signals passed through the first transmission film f 1 are inputted to the first gate driving ic 21 and the first data driving ic 31 , respectively . the scanning signals are shifted by the first gate driving ic 21 , the shifted gate signals are transmitted to the second gate driving ic 22 , and finally transmitted to the mth gate driving ic 2 m by shift operation . the data signals are shifted by the first data driving ic 31 , the shifted data signals are transmitted to the second data driving ic , and finally transmitted to the 3 kth data driving ic 3 k by the shift operation . the data signals transmitted through the second transmission film f 2 are inputted to the nth data driving ic 3 n , shifted by the nth data driving ic 3 n , and transmitted to the ( n − 1 ) th data driving ic by the shift operation . the shifted data signals from the nth data driving ic are transmitted from the nth data driving ic 3 n to the ( k + 1 ) th data driving ic 3 k + 1 . that is , according to an embodiment of the present invention , the plurality of first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n are disposed in parallel , data signals are inputted from both sides concurrently and shifted , wherein k and n are integers with 0 & lt ; k & lt ; n and k is preferably n / 2 . [ 0037 ] fig3 is a schematic diagram of wire connections of a plurality of data driving ics according to an embodiment of the present invention . referring to fig3 each data driving ic can shift data signals in forward direction , that is , from left side to right side . alternatively , each data driving ic can shift data signals in the reverse direction , that is , from right side to left side . according to an embodiment of the present invention , the shift direction is determined by a signal applied to a shift direction selecting terminal s formed of the plurality of first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n . either a vdd or a gnd voltage is applied to the shift direction selecting terminal s of the data driving ics to thereby select the shift direction . according to an embodiment of the present invention , a power wire l vdd and a ground wire l gnd are formed in the tft array panel 110 or in the pcb . the shift direction selecting terminal s is selectively connected to the power wire l vdd and the ground wire l gnd . when data signal is shifted forwardly from the first data driving ic 31 to the kth data driving ic 3 k , the shift direction selecting terminal s is connected to the power wire l vdd . when scanning signal is shifted backwardly from the nth data driving ic 3 n to the ( k + 1 ) th data driving ic 3 k + 1 , the shift direction selecting terminal s is connected to the ground wire l gnd that is , each of the shift direction selecting terminal s of the plurality of first data driving ics 31 ˜ 3 k is connected to the power wire l vdd for shifting data signals transmitted through the first transmission film f 1 , and each of the shift direction selecting terminal s of the plurality of second data driving ics 3 k + 1 ˜ 3 n is connected to the ground wire lgnd for shifting data signals transmitted through the second transmission film f 2 . therefore , data signals are inputted concurrently to both sides of the plurality of first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n , thereby fast and constantly transmitting the data signals to each of the plurality of first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n . an operation of the lcd according to an embodiment of the present invention is described below . referring again to fig1 and 2 , a timing controller 5 on the printed circuit board 120 receives image signals from a signal source ( not shown ) and generates data signals for supplying to the tft array panel 110 . and the timing controller 5 also generates a variety of timing signals , for example , scanning signals necessary to drive the tft array panel 110 . in the following , for the simplicity of explanation , data signals transmitted through the lead wire on the first transmission film f 1 are called “ the first data signals ”, and data signals transmitted through the lead wire on the second transmission film f 2 are called “ the second data signals ”. the scanning signals generated from the timing controller 5 are inputted to the first gate driving ic 21 through the first transmission film f 1 , the inputted scanning signals are shifted by the first gate driving ic 21 , and then transmitted to the mth gate driving ic 2 m . also , the first data signals are inputted to the first data driving ic 31 through the first transmission film f 1 , the inputted first data signal is shifted by the first data driving ic 31 , and then transmitted to the kth data driving ic 3 k . since the shift direction selecting terminal s of the first data driving ic 31 to the kth data driving ic 3 k is connected to the power wiring l vdd , the first data signal inputted to the data driving ic 31 is shifted forwardly and transmitted to the kth data driving ic 3 k . on the other hand , the second data signals transmitted is inputted to the nth data driving ic 3 n through the second transmission film f 2 , and the nth data driving ic 3 n shifts the inputted second data signal backwardly and transmits it to the ( 3 k + 1 ) th data driving ic . since the shift direction selecting terminal s of the ( 3 k + 1 ) th data driving ic 31 to the nth data driving ic 3 n is connected to the ground wiring l gnd , by the shift operation , the first and second data signals are inputted serially to each of the first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n . the timing controller 5 outputs the first data signals in reverse order and the second data signals sequentially so that the first and second data signals are inputted serially to the first data driving ic 31 to the nth data driving ic 3 n disposed in parallel . for example , a first to an eighth data driving ics are disposed in parallel , when data signals of “ a , b , c , d , e , f , g , h ” are provided to each of the data driving ics , the first data signals of “ a , b , c , d ” are provided sequentially in reverse order as “ d , c , b , a ”, then first transmitted data signal “ d ” is inputted to the fourth data driving ic , the second transmitted data signal “ c ” is inputted to the third data driving ic , and the third and fourth transmitted data signals “ b ” and “ a ” are inputted to the second and first data driving ics , respectively . also , the second data signals of “ e , f , g , h ” are provided in forward order , then the first transmitted data signal “ e ” is inputted to the fifth data driving ic , the second transmitted data signal “ f ” is inputted to the sixth data driving ic , and the third and fourth transmitted data signals “ g ” and “ h ” are inputted to the seventh and eighth data driving ics , respectively . as described above , the first data signals are transmitted in reverse order and the second data signals are transmitted in forward order , thereby data signals are serially inputted to the first to the eighth data driving ics as a whole . according to an embodiment of the present invention , the plurality of first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n store data signals provided from the timing controller 5 in the shift register ( not shown ) and transmit voltages corresponding to each of the data signals to the display region 100 . the plurality of gate driving ics 21 ˜ 2 m selectively turns on the tft ( not shown ) of each pixel so that the voltage is applied to the pixel according to signals transmitted from the plurality of gate driving ics 21 ˜ 2 m . according to such an embodiment of the present invention , since the signal transmission film f for transmitting data signals from the pcb 120 is connected to both sides of the plurality of first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n , the structure having the plurality of first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n in parallel and mounted on the tft array panel 110 , can remarkably reduce the number of the signal transmission film in contrast to the structure in which the transmission film is connected to each of the data driving ics to apply data signals . as a result , the cost of manufacturing is decreased , and the mounting space reduced , thereby the overall structure is simplified and operates effectively . further , since data signals are not inputted to only one side of a plurality of data driving ics disposed in parallel but inputted to both sides thereof , the same level of voltage is applied , thereby reducing errors in operations . although the embodiment mentioned above has been explained with the structure of a plurality of data driving ics being disposed in parallel , and data signals are inputted to both sides , and are shifted forward the middle , the present invention is not limited to such configuration but includes a configuration wherein data signals are inputted to any two of a plurality of data driving ics and shifted toward a centralized portion of the selected data driving ics . [ 0052 ] fig4 shows a schematic structure of an lcd according to a second embodiment of the present invention . referring to fig4 the lcd includes a tft array panel 110 , a pcb 120 , and a signal transmission film having first signal transmission film f 1 and a second signal film f 2 . according to an embodiment of the present invention , the structure of the lcd of the second embodiment is similar to the first embodiment of the present invention except an arrangement of the signal transmission film having the first signal transmission film f 1 and a second signal film f 2 . according to an embodiment of the present invention , the first transmission film f 1 includes a third lead wire for transmitting scanning signals provided from the pcb 120 to the plurality of the gate driving ics 21 ˜ 2 m . the third lead wire is connected to a signal wire of the first gate driving ic 21 for transmitting scanning signals . the second transmission film f 2 includes at least two lead wires , such as a first lead wire connected to the kth data driving ic 3 k for transmitting first data signals and a second lead wire connected to the ( 3 k + 1 ) th data driving ic 3 k + 1 for transmitting second data signals provided from the pcb 120 . thus , scanning signals are transmitted through the first transmission film f 1 and inputted to the first gate driving ic 21 , and the scanning signals are transmitted to the mth gate driving ic 2 m by shift operation like the first embodiment . the first and second data signals are transmitted through the second transmission film f 2 and inputted to the kth data driving ic 3 k and the ( k + 1 ) th data driving ic 3 k + 1 , respectively , and the inputted first and second data signals are transmitted to the first driving ic 31 and the nth driving ic 3 n , respectively . that is , the plurality of first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n are disposed in parallel , data signals are inputted to specific data driving ics disposed adjacently , then diverged from the specific data driving ics to both ends which are the opposite sides . accordingly , the first data signals transmitted through the second transmission film f 2 is inputted to the kth data driving ic 3 k and transmitted to the first data driving ic 31 , and the second data signals transmitted through the second transmission film f 2 is inputted to the ( k + 1 ) th data driving ic 3 k + 1 and transmitted to the nth data driving ic 3 n , wherein k is 1 & lt ; k & lt ; n ( k and n are integers ). preferably , k is n / 2 . similarly to the first embodiment , the direction of shift of the respective plurality of first and second data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n is determined according to whether a vdd or a gnd voltage is applied to the shift direction selecting terminal s of the plurality of first and second data driving ics . according to an embodiment of the present invention , a timing controller 5 of the pcb 120 outputs the first data signals forwardly and the second data signals backwardly so that the first and second data signals are sequentially inputted to the first data driving ic 31 to the nth data driving ic 3 n disposed in parallel . that is , as illustrated by example in the first embodiment , when data signals of “ a , b , c , d , e , f , g , h ” are provided , the first data signals of “ a , b , c , d ” are provided in order of “ a , b , c , d ”, then the first transmitted data signal “ a ” is inputted to the fourth data driving ic and shifted to the first data driving ic , and the second transmitted data signal “ b ” is inputted to the second data driving ic , the third transmitted data signal “ c ” is inputted to the third data driving ic , and the fourth transmitted data signal “ d ” is inputted to the fourth data driving ic . also , the second data signals of “ e , f , g , h ” are provided in reverse order , then the first transmitted data signal “ h ” is inputted to the fifth data driving ic , and the second transmitted data signal “ g ” is inputted to the seventh data driving ic , with the result that “ e , f , g , h ” is inputted to the fifth to the eighth data driving ic , respectively . the input order of the first and the second data signals is controlled by the shift direction selecting terminal s , and respective data signals are applied to pixels by data driving ics depending on gate signals like the first embodiment . according to an embodiment of the present invention , one skilled in the art can readily appreciate that the second transmission film f 2 can be connected to the plurality of data driving ics in other ways . for example , the first lead wire of the second transmission film f 2 can be connected to the first data driving ic 31 for transmitting the first data signals and a second lead wire of the second transmission film f 2 can be connected to the nth data driving ic 3 n for transmitting the second data signals . in accordance with the second embodiment , like the first embodiment , the structure of the plurality of data driving ics 31 ˜ 3 k and 3 k + 1 ˜ 3 n being disposed in 5 parallel and mounted on the tft array panels reduces the transmission frequency of the data signal , and reduces the error rate due to differing levels of voltages applied to each of the data driving ics . alternatively , the lcd according to the embodiment of the present invention can be applied to low voltage differential signaling ( lvds ) and reduced swing differential signaling ( rsds ), and thereby the data signal can be transmitted to the plurality of data driving ics as described above . as described above , the present invention , in the lcd of a plurality of data driving ics being disposed in parallel , reduces the number of transmission films needed for connecting the pcb with the plurality of gate and data driving ics . advantageously , the illustrative structure according to the present invention is less error prone and is less expensive in cost of manufacturing . since data signals are transmitted from both sides of the plurality of the data driving ics , it is possible to transmit data signals at high speed . since resistance of wires is reduced , the same level of data signals is transmitted . also , since the transmission frequency of data signals can be decreased , it is possible to overcome the limit of frequency , and the number of transmission films is smaller to thereby reduce the time of manufacturing and to minimize poor connection . while the present invention has been described in detail with reference to the preferred embodiments , those skilled in the art will appreciate that various modifications and substitutions can be made thereto without departing from the spirit and scope of the present invention as set forth in the appended claims . | 6 |
fig1 is a block diagram of a preferred embodiment of the present invention . the system includes a plurality of traffic management centers 2 (&# 34 ; tmc &# 34 ;) located throughout a region of interest . the tmc &# 39 ; s act as local data processing stations for communicating both with vehicles in the area ( via a communication service provider ), as well as with other sources of traffic information and tmc &# 39 ; s , to calculate an optimal routing scheme . the function of the tmc &# 39 ; s is to provide traffic congestion modelling , trip planning and route selection for vehicles in the system . this information is conveyed to the vehicles in the form of path vectors , travel advisories , mayday responses and gps differential correction data . the tmc &# 39 ; s are nodes on a wide area network ( e . g ., advantis ), with communication capability being provided by , in a preferred embodiment , a fixed data network 4 ( e . g ., a cellular wireless network ) by means of an rf network message switch 5 . the network 4 also provides means for tmc communication with a plurality of in - vehicle communication and processing units 6 located in vehicles participating in the system via a wireless data network service provider . the wired and wireless network communication service providers are connected (&# 34 ; bridged &# 34 ;) together as is the practice today . the network includes a plurality of base stations 8 located in strategic geographic locations as is common in the existing cellular mobile phone system to ensure broad , uninterrupted coverage of a particular region . a preferred tmc 2 is shown in fig2 . each tmc comprises a base processing unit 10 . in a preferred embodiment , the base processing unit is an ibm rs6000 workstation , but any comparable device can be employed without departing from the spirit or the invention . the processing unit 10 is connected via a wide area network to public safety and emergency service providers , such as local police , fire and ambulance services , as well as to private service sources such as road service providers . the processing unit 10 also receives , via antenna 12 , positioned at a known location , global positioning system ( gps ) signals from gps satellites , and acts as a differential gps correction data reference receiver for determining precise locations of vehicles within its geographical area . a wireless cellular digital packet data communication modality e . g ., cdpd ( cellular digital packet data ) is used which can support short but frequent communications between vehicles equipped with mobile computers and one of the tmc &# 39 ; s . each tmc is responsible for servicing the travel data needs of the vehicles in a unique geographic territory . the communication protocols can follow the tcp / ip suite of open protocols used in the internet wide area data network communication scheme . in this way , each tmc is assigned an &# 34 ; internet protocol (&# 34 ; ip &# 34 ;) address &# 34 ;, and likewise each vehicle computer is assigned an ip address . each base unit is equipped with a complete database of road segments (&# 34 ; links &# 34 ;) for the entire nation . each road segment is a uniquely numbered record in the database that includes a latitude and longitude for each end of the road segment , and a pair of pointers to two lists of record numbers each representing other road segments connected to either end of the road segment . in this way , the database contains the most essential geometric information to detail the connectivity of any location on a road segment to any other road segment . in addition to this specific static data , fields are provided in the database for dynamic road segment attributes (&# 34 ; link time &# 34 ;) such as time required to transit the road segment in either direction , and fields to represent expected occupancy of the road at future times as a result of vehicle travel plans computed by a tmc . a field is also provided to indicate the geographic tmc territory ( tmc id ) that a road segment resides in . each link record may have additional attributes that make the link &# 34 ; navigable &# 34 ;, such as one - way restrictions , physical turn restrictions , administrative turn restrictions , etc . the tmc is provided with route planning algorithms so that an optimal or near optimal shortest time route can be selected for a vehicle based on the road database static connectivity information and individual road segment expected delay times . the tmc may also be equipped with algorithms to optimize routes based on other criteria , possibly selected by the driver , such as cheapest route ( shortest time constrained to minimize cost ), or least acceleration / deceleration ( to minimize pollution and / or fuel consumption ). fig3 shows a preferred in - vehicle communication and processing unit 20 for use in the system . the unit preferably is an ibm thinkpad computer , but any comparable computing unit equipped with a communications and location determination interface can be used without departing from the invention . the in - vehicle unit includes a wireless data modem 22 acting as an interface between the unit 20 and the wide area network antenna 33 . a gps receiver 24 is provided for generating vehicle position data , which , when combined with gps differential correction data of the local tmc , will yield precise vehicle position . the gps receiver 24 is linked with the in - vehicle unit via pcmcia slot 26 , but any other data interface would not depart from the scope of the invention . it is , therefore , the function of the in - vehicle units to provide the tmcs with trip planning , location and route guidance information . this information is in the form of destinations and travel preferences , actual link travel times and intersection delay queues ; and also mayday requests . it should be understood by those skilled in the art that alternative position sensing means can be employed without departing from the scope of the invention . for instance , the following are acceptable positioning systems : solid - state gyroscope for inertial dead reckoning ; solid - state gyroscope and odometer for inertial dead reckoning ; wheel encoder and flux gate compass for dead reckoning ; gps or differential gps augmented by any dead reckoning method . the in - vehicle unit is augmented with a keyboard 30 to allow the operator to give simple commands to the computer while driving , such as : repeat last instruction ; repeat remaining instructions ; give current location ; and next navigation way point . in an alternative embodiment , vehicles can be supplied with low - end personal computers ( e . g ., notebook computers or palm - top computers ) running a simple dos operating system . in addition , a cost reduced version could be implemented that does not have a general purpose computer at all , but rather an &# 34 ; application - specific &# 34 ; electronic &# 34 ; navigation computer &# 34 ;. this computer or application - specific unit would connect to or have integrated therewith an antenna for the wireless data communication means , and possibly in addition an antenna or other sensor connections for the position / location subsystem . a speaker and microphone system 28 are provided to allow interaction between the driver and in - vehicle unit . the unit can be provided with speech recognition and synthesis capability to allow the driver to communicate a desired destination , route , speed , etc ., and in turn receive synthesized instructions for reaching the destination . other driver interfaces are possible and would not depart from the scope of the invention . the optimal and stable route planning system of the present invention works as follows . before proceeding with a trip , the driver , using his mobile computer , interacts with the tmc 2 over the wireless system to identify a destination . the starting location is communicated to the tmc from the vehicle position subsystem . subsequently , the tmc computes a &# 34 ; best &# 34 ; route based on the driver &# 39 ; s criteria ( e . g ., &# 34 ; shortest time &# 34 ;) and the tmc &# 39 ; s awareness of the routes selected by other travelers , and then sends to the in - vehicle computer a list of road segments and their expected characteristics ( e . g ., time to transit ) that the in - vehicle computer can use to assist the driver in navigating . the driver begins the trip , following detailed navigation instructions &# 34 ; spoken &# 34 ; by the mobile computer . instructions may be spoken as taught in u . s . pat . no . 5 , 177 , 685 &# 34 ; automobile navigation system using real time spoken driving instructions ,&# 34 ; incorporated herein by reference . the frequency of the instructions can be presented to the driver in descending logarithmic distance to each waypoint , for example : the driver can select the logarithmic spacing of the navigation instructions to suit personal preferences . as each road segment is transited by the vehicle , the on - board computer records the time it took to transit the road segment , and transmits this information over the wireless communication means to the tmc , which uses this information to update its model of the road segment for future travel planning . in this way , each vehicle acts as a probe to measure the real - time dynamic transit information of the road network . the probe data is also used to update the location of the vehicle and its expected future progress through the road network . the tmc 2 is programmed to sense significant changes in the transit time of a road segment , due perhaps to a non - recurring incident . this program is able to filter out &# 34 ; outlier &# 34 ; events due to vehicles stopping for random events that do not impact traffic flow ( e . g ., pulling over to the side of the road to pickup or discharge passengers or cargo ). when the tmc detects a significant change in a road segment &# 39 ; s traffic parameters , it searches its list of travel plans to see if any en route vehicles would be affected , and if so , it computes new travel plans for those vehicles . if the new travel plans result in significantly better performance based on the driver &# 39 ; s criteria , the new plan and an explanation for the change will be sent over the wireless means to the vehicle &# 39 ; s mobile computer . the travel advisory explanation can also be enunciated to the driver using the synthesis means , along with the new travel plan and specific navigation directions . the specific details of guiding a driver using computer generated instructions to follow a particular route are well known in the art and are described in u . s . pat . nos . 5 , 031 , 104 , 4 , 992 , 947 , 4 , 939 , 662 , 4 , 937 , 751 , 4 , 782 , 447 and 4 , 733 , 356 , incorporated herein by reference . each tmc computer has a geographic territory for which it is responsible . each tmc operator updates the static information ( e . g ., road geometry , one - way restrictions , etc .) in his tmc computer &# 39 ; s database to correspond to the actual road infrastructure . changes to the static part of the road database will be broadcast to all the other tmcs over the wide area network . when a tmc is computing a route for a client vehicle in its territory , and the destination ( or any part of the route ) is outside the territory , the optimum path algorithm will request over the wide area network dynamic data for specific road segments from the tmc that owns the territory in which the road segment resides . furthermore , when a route is selected , the tmcs owning the selected road segment will be notified of the expected time that the vehicle will be occupying the specific road segments , so that a properly timed &# 34 ; token &# 34 ; can be instantiated in the database record to allow for the expected occupancy of the vehicle at an approximate time . when substantial numbers of vehicles cross the boundaries of tmcs , it may be necessary to implement an even tighter coupling of the operations of several contiguous tmcs , involving a cooperative computation of the routes for all the client vehicles in a set of cooperating tmcs . such cooperative processing can be implemented , for example , over a high - bandwidth , asynchronous transfer mode ( atm ) network . in order to enhance the reliability of the system , the dynamic data in each tmc can be shadowed in at least one other tmc , so that if any tmc should become unavailable due to maintenance or failure , the load can be picked up by another tmc . this will require a high availability message &# 34 ; router &# 34 ; 11 to be associated with each tmc . the message router senses when a tmc is non - operational , then forwards messages for a particular tmc to the designated backup tmc . high availability routers can be constructed using any of a number of techniques well known in the art ( e . g ., triple modular redundancy and uninterruptable power supplies ), and in general will be expected to be much cheaper to construct than a high availability tmc . when a vehicle sends a message to a tmc ( such as a transit time message ) that should be redirected to a different tmc ( such as when a vehicle crosses a tmc territorial border ), the message is forwarded to the correct tmc , and the vehicle computer is sent a message indicating the correct address for the tmc controlling the territory it has just entered . the algorithmic task of route selection for a large number of drivers is fairly complex , if one wishes to achieve global optimization of a system involving many drivers . moreover , the optimization may be difficult to achieve if a large number of drivers choose not to follow the routing instructions provided by the tmc . for this reason , a route selection process which results in a very complex path involving many turning movements may be unattractive to drivers , particularly if it does not ultimately result in very superior performance . another factor pointing to the desirability of selecting relatively &# 34 ; smooth &# 34 ; route choices is the possible desire of drivers to confine their choice of routes to a few relatively known alternatives . for these reasons , a possible choice of implementation of the invention involves offering drivers an indication of the best of several pre - designed route choices from a given origin to a given destination . a variant of this alternative , applicable to arbitrary origins and destinations , is to offer drivers the best of a few alternate routes between key &# 34 ; nodes &# 34 ; in a network , plus an optimum route from the driver &# 39 ; s origin to a starting node , and from a terminal node to the driver &# 39 ; s destination . many methods for computing optimal shortest time ( or shortest distance ) routes between two locations on a map are known in the art . one of the earliest , known as the &# 34 ; djikstra &# 34 ; algorithm , begins with one of the locations and expands from that point perimeters of &# 34 ; iso - time &# 34 ;. that is , it takes exactly the same time to get to any location on the iso - time perimeter . the perimeter is continuously expanded one road segment at a time , until an iso - perimeter intersects the destination . finally , the route to the destination is computed by &# 34 ; backtracking &# 34 ; from the last iso - time perimeter ( which represents the total travel time ) to the first iso - time perimeter ( which represents the first route segment ). an iso - time configuration is shown in fig5 . fig6 and 7 show how the djikstra algorithm works in the presence of blocked streets . the x &# 39 ; s in the grid indicate streets that are closed . like numerals indicate a like iso - time perimeter , i . e ., the same amount of time to reach that destination from the origin o . as shown in fig6 various ones of the streets could also be slower or faster , accumulating more or less time to transit . in the invention , the queue delay at intersections will be accumulated as well , considering the different delays for left turns , right turns and no turns . fig7 shows how the djikstra algorithm works in the presence of one - way streets . fig7 indicates that there are two alternative routes from the given origin to the destination . based on the actual congestion on the individual links , resulting in longer link travel times , one of the routes may be significantly shorter . if the tmc has already assigned routes to vehicles on one of the routes , the resulting marginal expected congestion caused by these vehicles occupying the links may cause the next routed vehicle to be assigned the alternate route ( as the best available route ). fig4 shows a typical relationship of several link characteristics by time - of - day . such relationships are well known in the traffic monitoring art . vehicle demand is shown in this example to have an am and pm &# 34 ; rush hour &# 34 ; of about 1800 cars / hour ( per lane ). at night , the demand drops to under 200 cars / hour . vehicle speed at night when uncongested has a &# 34 ; freeflow &# 34 ; of about 80 mph ( although drivers will generally limit their speed by &# 34 ; speed limits &# 34 ;) but during the rush hours the free flow speed drops to about 20 mph . transit time for this one - mile segment is inversely proportional to speed , and varies from about 42 seconds at night to about 2 minutes during the rush hour peaks . note that the predicted periodic characteristics for each link will vary based on link geometry and periodic travel demand . in addition , if a large number of vehicles are guided by the tmc , the tmc may be able to influence actual link transit times by diverting vehicles from links with high demand to links with lower demand , thus balancing the load on the road network , resulting in lower travel times for guided vehicles ( as well as the beneficial side effect of lower travel times for unguided vehicles since the guided vehicles will be diverted from congested links , leaving them with less congestion ). the tmc is also provided with databases which allow the driver to easily specify locations in latitude and longitude , an address to latitude / longitude database , possibly augmented with a phone number to address database , etc . these databases and their use are well known in the art . while the invention has been described with respect to preferred embodiments thereof , it will be understood by those skilled in the art the modifications to the disclosed embodiments can be made without departing from the spirit of the invention . | 6 |
fig1 shows that platen 100 of a surface finishing machine is constructed so that pad 150 is somewhat permanently mounted to platen 100 by any convenient means . “ somewhat permanently ” refers to the preferred embodiment , in which pad 150 is mounted to a plate 151 , which in turn is connected to platen 100 in any conventional manner . thus , plate 151 may be removed only when it is necessary to replace pad 150 , which is not required as frequently as it is may be necessary or desirable to replace the abrasive material , as described below , and platen 100 need not be removed from the apparatus at all ( unless that is the most convenient way to replace pad 150 and plate 151 ). platen 100 further comprises rails 201 and 202 , at least one of which is moveably and adjustably mounted to the sides of platen 100 so that its longitudinal position with respect to their respective sides of platen 100 may be adjusted by any convenient means . ( in this and the other figures , the longitudinal direction is left - to - right or vice versa in the plane of the figure . the workpiece having the surface finished by the machine also moves in the longitudinal direction , i . e ., longitudinal corresponds to “ forward ” or “ reverse ” directions of the workpiece . the transverse direction is into or out of the plane of the figure , i . e ., perpendicular to the longitudinal direction in the plane of the workpiece .) for example , the piston illustrated as 230 moves rail 202 longitudinally away from its respective side of platen 100 . in this preferred embodiment , other similar pistons ( not shown ) behind piston 230 ( that is , located transverse to piston 230 ) similarly move rail 202 longitudinally away from its respective side of platen 100 . this is only a preferred embodiment , because the scope of the invention includes any subsystem that places the abrasive material ( described below ) under increased or decreased tension ( i . e ., a “ means for tensioning the abrasive material ” or similar language ), preferably by moving either or both of rails 201 and 202 with respect to platen 100 ( and thus with respect to each other ), but not necessarily in the longitudinally opposed directions indicated in the preferred embodiment of the figure . for example , a system of generally cylindrical members could hold an abrasive material in the same general manner as described below , and then either or both members could be rotated about its axis of rotation to increase or decrease the tension on the abrasive material . ( the axis of rotation could be a concentric or an eccentric axis .) thus , the use of pistons as in the preferred embodiment is only a preference , and even if used , the number of pistons is not a limitation on the scope of the invention . fig2 is a view similar to fig1 , but also shows abrasive material 152 suspended between its edges . fig2 shows the invention in a position in which the piston 230 has not been used to increase the distance between rails 201 and 202 , and thus abrasive material 152 is not yet drawn into a taut position . for purposes of the illustration only , the combination of mounts 210 and 211 and abrasive material 152 is shown partially slid out of working position , towards the viewer ( up out of the plane of the figure ), but the majority of the length of each mount still lies in its respective rail . fig3 is a close - up view of mount 210 , and fig8 is a schematic view similar to fig3 but having more detail of preferred but not required features . in this preferred embodiment , mount 210 holds the edge of abrasive material 152 in place with a frictional holding element , specifically shown as the preferred spline 220 that is wedged , along with the edge of abrasive material 152 , into a channel 211 formed within mount 210 , thus frictionally holding abrasive material 152 in mount 210 . the size and configuration of both channel 211 and spline 220 are selected so that there is sufficient frictional coupling against the edge of abrasive material 152 to hold that edge in place . in this regard , fig8 schematically indicates the thickness of abrasive material 152 , as less than the thickness would be in actual use , for purposes of clarity only . the circular cross - sectional shape of spline 220 is preferred but not required , as elliptical , rectilinear , wedge - shaped , and other spline shapes are within the scope of the invention . the exact configuration of mount 210 shown in fig3 and 8 is not a requirement of the invention . nor are the materials selected for mount 210 , which is preferably lightweight extruded aluminum but can be any other material that serves its intended purpose . for example , fig8 shows that features such as indent 240 can be included ; this feature is an example of how mount 210 may be shaped to reduce the stress on abrasive material 152 in appropriate locations . ( a similar stress reduction feature could be provided at corner 241 of rail 201 , if desired .) spline 220 is preferably a synthetic resilient material but could be a natural material provided that sufficient resilience and strength to perform the functions required by a particular design are provided . the preferred extruded aluminum mount 210 may be formed by a single piece of aluminum stock that is bent to form a hollow frame , the two ends of the material secured to each other by any conventional means . as illustrated schematically in fig7 , an alternative embodiment of the abrasive material , denoted as 252 , is formed with an integral feature 320 analogous to frictional holding element 220 . this provides a single disposable unit that may be rapidly replaced within the surface finishing apparatus according to the principles of the invention . fig4 illustrates schematically the general conceptual arrangement of mount 210 , spline 220 , abrasive material 152 , and rail 201 , to emphasize that specific features illustrated in the previous figures are not necessarily requirements of the invention . in this regard , fig5 shows an alternative embodiment , one that illustrates the more general nature of the invention . in general , all that is required is that the edge of the abrasive material 152 be frictionally secured to mount 210 ( when a non - integral mount is employed ). channel 211 is shown within the uppermost portion of mount 210 but this is not a requirement of the invention . frictionally securing abrasive material 152 to mount 210 may not require an inserted frictional holding element 220 if the configuration and materials of mount 210 and / or channel 211 are properly designed . for example , an integral frictional holding element such as a crimp is within the scope of the invention , as illustrated in fig6 ( which is also schematic and should not be taken as a limitation on the scope of the invention ). the crimp 250 schematically represents any feature that extends from a base to grip the abrasive material by compression on at least one surface of the abrasive material . one or more individual or paired crimps 250 may be employed . the use of a generally rectangular ( in cross - section ) mount 210 permits abrasive material 152 to be wrapped around mount 210 without subjecting abrasive material 152 to extreme shear and other tearing forces near the edge of abrasive material 152 . preferred abrasive materials include the so - called “ j weight ” cloth backed materials , as they are more flexible than “ x weight ” materials commonly used in the industry . however , other cross - sectional shapes of mount 210 are within the scope of the invention . for example , a generally circular or oval cross - sectional shape could be employed , and a variety of crimp - type features used to hold the edge of the abrasive material in place . the selected shape may also dictate the cross - sectional configuration , size , or other features of rail 201 . in any embodiment of the invention , the abrasive material need not necessarily have constant grit rating throughout its extent . it is possible to have a dual - value ( or , in general , a plurality of values ) of grit rating , including a continuously variable grit value , as one considers various locations along the extent of abrasive material 152 . for example , as the workpiece moves through the apparatus , it could encounter a course grit first , followed by one or more finer grits before leaving the apparatus . this could be accomplished by varying the grit of the material actually attached to abrasive material 152 , or it could be accomplished by assembling abrasive material 152 from two or more pieces of material having different grits , such as by using pressure sensitive or other adhesive to splice or otherwise assemble the pieces together . the prior art approaches disclosed in the patents above use two separate motors to impart two distinct motions to the platen . in the preferred embodiment , the invention employs a single motor to provide the two distinct motions to the platen . in cross - sectional view , the mounting of abrasive material 152 appears similar to that shown in u . s . pat . no . 6 , 001 , 004 ( botteghi ), assigned on scm group , s . p . a . of rimini , italy . however , that patent uses a continuous supply of abrasive fed from rollers in a direction transverse to the direction that the workpiece travels . the edges of the abrasive material are not supported in a mount and rail system as described above . | 1 |
a first embodiment of a plunger rod 1 according to the invention is illustrated in fig1 a - 1 e , wherein the plunger in its cross section , as in the state of the art includes two crossed ribs 3 . 1 , 3 . 2 . according to the embodiment in fig1 a - 1 e , the plunger rod also includes a tubular segment 5 . in the embodiment according to fig1 a - 1 e , the tubular segment extends practically over 100 % of length l of the plunger rod , from first plunger rod end 7 . 1 to second plunger rod end 7 . 2 . tubular segment 5 provides a cross sectional surface , distant from torsional axis ta , thus increasing the torsion and bending rigidity of the plunger rod . in the embodiment according to fig1 a - 1 b reinforcement elements 9 are provided in addition to tubular element 5 on the outside of tubular element 5 in the region of first plunger rod end 7 . 1 that , on the one hand serve to provide additional cross sectional surfaces outside the torsional axis ; as well as support ribs in the region of first plunger rod end 7 . 1 that corresponds with the plunger plug , that ensure that the syringe after insertion into the syringe barrel cannot cant . fig1 b and 1 c illustrate a syringe barrel according to fig1 a in detail and in various views , whereby same components have been identified with same reference numbers . in the case of an injection molding tool the direction of demolding is consistent with the direction of stamping . the direction of stamping points from the mold core side toward the side of the mold nozzle . fig1 d illustrates the crossed arrangement of reinforcement elements 9 . fig1 e is a sectional view through the arrangement per fig1 c , along line a - a and clearly shows tubular segment 5 in a cross - sectional view . fig1 e also shows the plunger rod end 7 . 1 , synonymous with the plug and second plunger rod end 7 . 2 that can be equated with a pressure plate in the form of a thrust plate that serves to move the plunger rod in the axial direction . moreover , inferred in fig1 e are ribs 3 . 2 and the fact that the tubular segment 5 is a hollow barrel . such a completely enclosed hollow barrel can only be produced in a special process , for example an internal gas pressure process . alternatively , a hollow barrel can also be obtained with the assistance of an injection molding tool with a long core that is inserted into the plunger rod from the plunger plug side . the resulting tube is then closed off on only one side . fig2 a and 2 b illustrate a comparison of the inventive plunger rod according to fig 1 a . the plunger rod according to fig2 a is consistent with the plunger rod according to fig1 a . same components as in fig1 a are identified with the same reference numbers . fig2 b illustrates a plunger rod according to the state of the art with crossed ribs 3 . 1 , 3 . 2 . the first plunger rod end with the plunger plug is identified with 7 . 1 ; the second plunger rod end with the thrust plate is identified with 7 . 2 . to avoid canting of the plunger rod , as in the state of the art , disks 20 . 1 , 20 . 2 , 20 . 3 can be provided in the state of the art in the region of the first piston rod end as shown for example in u . s . pat . no . 7 , 824 , 380 b2 . the weight of the plunger rod according to the state of the art is 17 g ; the weight of the plunger rod per fig2 a and 1 a is 14 . 5 g . the inventive plunger rod according to fig2 a and 1 a has a torsional stress that is lower by a factor of 11 than the embodiment according to the state of the art ( fig2 b ), and a torsional displacement that is lower by a factor of 16 compared to the embodiment according to the state of the art ( fig2 b ). in fig3 a - 3 e an alternative design of a plunger rod with tubular barrel is depicted . tubular barrel 5 has a diameter that is substantially consistent with the diameter of the plunger rod . the first plunger rod end , including the plunger plug is identified with 7 . 1 , the second plunger rod end is identified with 7 . 2 . in the design per fig3 a no additional reinforcement elements as in fig1 a - 1 e are provided . tilting during insertion of the syringe plunger is avoided in that the tubular barrel has substantially the same outside diameter as the syringe barrel itself . fig3 b - 3 e are alternative views , including sectional a - a according to fig3 e . same components are identified with the same reference numbers as in fig3 a . as can be clearly seen in fig3 e , the tubular barrel 5 is hollow on the inside , in other words it has a hollow space 30 . the design per fig3 a - 3 e illustrates another embodiment of a plunger rod . however the embodiment according to fig3 a - 3 e may be expensive to manufacture , for example due to the high manufacturing costs for the hollow barrel . one possible manufacturing method is the 3d - pressure . the design of the plunger rod according to fig1 a - 1 e and fig2 a can be easier to produce than a complete hollow barrel , since the ribbing provided in the embodiments per fig1 a - 1 e require minimal tools . fig4 a and 4 b again illustrate the inventive plunger rod according to fig3 a , compared to a plunger rod according to the state of the art ( fig4 b ). the plunger rod according to the state of the art ( fig4 b ) is consistent with that in fig2 b . in this respect , the reference numbers from fig2 b were adopted for fig4 b . the weight of the plunger rod according to fig4 b is 17 g ; the weight of the inventive plunger rod according to fig4 a is only 11 . 46 g due to the fact that the tubular barrel is in the embodiment of a hollow barrel . compared to the conventional component according to fig4 b , the inventive plunger rod per fig4 a has a torsional stress that is greater by a factor of 11 than the component according to the state of the art ; and a torsional displacement that is greater by a factor of 55 . another embodiment of a plunger rod according to the invention is illustrated in fig5 a - 5 e . the plunger rod does not include one single tubular segment 5 along its length l , but a multitude of tubular segments 50 . 1 , 50 . 2 , 50 . 3 , 50 . 4 , 50 . 5 , 50 . 6 , 50 . 7 , wherein the present segments are partial segments , that is 90 ° segments of a tubular segment . the tubular 90 ° segments in the illustrated embodiments are thus quarter - tubes . half - tubes , that is 180 ° segments would also be possible , however 90 ° segments are generally more effective . this is due to the fact , that an ideal structure of a tube designed for torsional stress with an open tube shell generally includes more contradirectional spirals . due to this realization , a plunger rod with 90 ° segments has a more ideal , more uniform flow of forces and greater rigidity than 180 ° segments . in the design according to fig5 a - 5 e it is possible with a plunger rod that is produced in a standard injection molding process to increase the torsional rigidity . as is the case in the embodiment per fig1 a , additional reinforcement elements 9 are provided in the region of first plunger rod end 7 . 1 . as is the case in fig1 a , these are designed as cross - over . second piston rod end 7 . 2 is again designed as a thrust plate . moreover , an opening on the face on plunger rod 7 . 1 is shown , as well as a hollow space under the reinforcement ribs in that location . in this embodiment , fig5 a - 5 e illustrate a plunger rod with sectional tubular segments 50 . 1 , 50 . 2 , 50 . 3 , 50 . 4 , 50 . 5 , 50 . 6 , and 50 . 7 in the form of quarter - tubes . the additional reinforcement elements are identified with 9 and are arranged in the region of the first plunger rod end . fig5 d is a section according to intersection a - a in fig5 c the individual tubular partial segments 50 . 1 , 50 . 2 , 50 . 3 , 50 . 4 , 50 . 5 , 50 . 6 , as well as the crossed reinforcement elements are easily recognizable . fig6 a - 6 e show an alternative embodiment to fig5 a - 5 e , also with tubular partial segments . the partial segments are again 90 ° segments , in other words quarter - tubes . in contrast to fig5 a - 5 e , the additional reinforcement elements are designed differently . the additional reinforcement elements 9 in the embodiment according to fig6 a - 6 e have a honeycomb shape , the tubular partial segments 50 . 1 , 50 . 2 , 50 . 3 , 50 . 4 , 50 . 5 , 50 . 6 , 50 . 7 are arranged offset to one another as in fig6 a - 6 e . in principle , the tubular segments 50 . 1 , 50 . 2 , 50 . 3 , 50 . 4 , 50 . 5 , 50 . 6 , 50 . 7 themselves also represent reinforcement elements . the additional reinforcement elements in the form of honeycombs can reduce the possible tilt angle of the plunger rod in the syringe barrel since the syringe barrel edge makes contact sooner with ribbing during tilting , and since the areas in which there is no ribbing have become much smaller . this positive effect exists also in diagonal ribbing ( i . e . 45 °). an equivalent reduction of tilting cannot be achieved with simple plates . fig7 a and 7 b illustrate a comparison of an inventive plunger rod with tubular segments 50 . 1 , 50 . 2 , 50 . 3 , 50 . 4 , 50 . 5 , 50 . 6 , 50 . 7 according to fig5 a , compared to a conventional plunger rod according to fig7 b . the weight of the inventive plunger rod is 15 . 71 g ( fig7 a ); the weight of the conventional plunger rod is 17 g ( fig7 b ). the torsional stress of the inventive plunger rod is lower by a factor of 3 than that of the reference plunger rod according to fig7 b . the torsional displacement is lower by a factor of 7 . in fig8 a and 8 b an inventive plunger rod according to fig6 a is compared with a conventional plunger rod according to fig8 b . the weight of the inventive plunger rod is 16 g ( fig8 a ); the weight of the conventional plunger rod is 17 g ( fig8 b ). the torsional displacement of the inventive plunger rod is lower by a factor of 4 that that of the plunger rod according to the state of the art . fig9 a illustrates another embodiment of a plunger rod according to the invention . the embodiment according to fig9 a does not include any tubular segments , but instead of the tubular segment 5 or segments 50 . 1 , 50 . 2 , 50 . 3 , 50 . 4 , 50 . 5 , 50 . 6 , 50 . 7 it has braces 200 that can be designed cross - shaped , like the reinforcement elements in the first section of the plunger rod . the reinforcement elements in the front plunger rod section can be designed diagonally to the torsional axis , as in fig1 a and serve to prevent canting of the syringe . front plunger rod end 7 . 1 represents a segment with a thread . the thread in turn accommodates a plunger plug . the connection between plunger plug and plunger rod can be produced via an undercut . rear plunger rod end 7 . 2 is designed as a thrust plate . braces 200 in place of the tubular segment in the embodiment according to fig9 a provide the cross - sectional surface outside the torsional axis to increase the torsional or bending rigidity in the rear section of the plunger rod toward rear plunger rod end 7 . 2 . fig9 b - 9 e illustrate detailed views of the plunger rod according to fig9 a . same components as in fig9 a are identified with same reference numbers . fig9 e shows a sectional view along line b - b in fig9 d . fig9 d shows the arrangement of reinforcement ribs 200 for increasing the torsion and bending rigidity of the plunger rod . fig1 a and 10 b illustrate again a comparison of the inventive plunger rod according to fig9 b , with a plunger rod according to the state of the art in fig1 b . the plunger rod according to the state of the art has a weight of 17 g ( fig1 b ), the inventive plunger rod per fig1 a has a weight of 16 . 78 g . the torsional stress of the inventive plunger rod is less by a factor of 2 than that of the plunger rod according to the state of the art ; the torsional displacement is lower by a factor of 4 . to keep the weight of the plunger rod low , the plunger rod may consist of plastic . the plunger rod consisting of plastic can be used in a plastic syringe as well as in a glass syringe . plastic materials such as thermoplastic materials may be used . one possible thermoplastic material can be polyethylene ( pe ) or polyoxymethylene ( pom ) or polystyrene ( ps ). another polymer can be polypropylene ( pp ). hard polymers , such as cycloolefin copolymer ( coc ) or cycloolefin polymer ( cop ) are used in particular as materials for the syringe barrel . to be able to use the syringe barrel for storage of pharmaceutical products , the materials of the syringe barrel can be sterilized at temperatures & gt ; 100 ° c ., for example 121 ° c ., for example at a maximum of 180 ° c . whereas cycloolefin polymer ( cop ) and cycloolefin copolymer ( coc ) cycloolefin copolymer ( coc ) cycloolefin copolymer ( coc ) are hard materials in which pharmaceutical media can be stored for several months , polypropylene or polyethylene are a softer material which can absorb stresses but which , due to its diffusion characteristics may not permit storage of pharmaceutical products over a longer period of time if used as the material for the syringe barrel . if the plunger rod is designed as a hollow barrel in a thermoplastic material , the plunger rod thus produced in an injection molding process can be produced — with the assistance of an injection mold — with a long core that for example is inserted into the plunger rod from the plunger plug side . alternatively , a closed hollow barrel could also be produced from a plastic with the assistance of an internal gas pressure process as a special injection molding process . by using a plastic material instead of a glass material , as disclosed in u . s . pat . no . 2 , 392 , 104 b , considerable weight reductions can be achieved , for example if the plunger rod is a plastic component . the current invention cites for the first time designs of plunger rods that have higher torsional and bending rigidity compared to conventional plunger rods , as known from the state of the art , for example from u . s . pat . no . 7 , 824 , 380 . moreover , tipping of the plunger rod inside the syringe barrel is countered . while this invention has been described with respect to at least one embodiment , the present invention can be further modified within the spirit and scope of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the invention using its general principles . further , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims . | 0 |
as used herein , the phrase &# 34 ; adhesive layer &# 34 ; refers to any material which is more cohesive than adhesive to the surface to be protected from laser damage and / or burn and which is mechanically connected more firmly to the foil than to the surface to be protected . appropriate adhesives are well known in the art , and include any waterproof and / or water resistant , hypoallergenic adhesive such as an acrylic adhesive and those available from 3m ( st . paul , minn ). in one embodiment , the adhesive layer is a hydrogel . after the adhesive is applied to the foil , that two - layer structure is referred to herein as &# 34 ; adhesive - backed foil &# 34 ;. the layer of hydrogel provides insulation from the heat of an incident laser beam as described below . the hydrogels may be specifically a polyurethane ; polyacrylonitrile ; polymer of acrylic acid , methacrylic acid , ethacrylic acid , alpha - chloracrylic acid , alpha - cyanoacrylic acid , beta - methylacrylic acid ( crotonic acid ), alpha - phenyl acrylic acid , beta - acryloxypropionic acid , sorbic acid , angelic acid , cinnamic acid , itaconic acid , maleic acid , fumaric acid , tricarboxyethylene , maleic anhydride , vinylsulfonic acid , allyl sulfonic acid , acrylic and methacrylic sulfonic acid , sulfoethyl acrylate , and methacrylate ; block polymers of poly ( ethylene oxide ); acrylonitrile - acrylamide copolymers ; polyhydroxyalkylmethacrylates ; polyacrylamide ; polymethylamide ; poly ( n - vinyl - 2 - pyrrolidone ); polyvinyl alcohol ; hydroxylated polyvinyl alcohol ; polyvinyl acetates ; polyvinyl acetals ; collagen ; and co - polymers of styrene , ethylene , propylene , butylene , or isobutylene with maleic or fumaric anhydride . those hydrogels available under the trademarks hypan ( kingston technologies , dayton , n . j . ), hypol and biopol ( w . r . grace & amp ; co .) and vigilon ( nepara chemical co ., harrison , n . y .) are particularly preferred for use in connection with the composite of the present invention . in addition to the high water content of the hydrogel , which helps prevent ignition of objects which are comprised of flammable materials to which the composite of the present invention is applied , the hydrogel insulates against the heat produced by the incident laser beam . any of the hydrogels listed above may be used to advantage as the insulative layer in connection with the composite of the present invention as long as they are not themselves flammable or do not give off a significant quantity of toxic fumes or other by - products upon exposure to heat or flame . as used herein , the phrase &# 34 ; fire retardant fabric &# 34 ; refers to any high temperature resistant or fire retardant woven , knitted , braided , non - woven , or random dispersion of fibers which can be laminated to the hydrogel and bonded to the adhesive backed foil to form the composite of the present invention and which , upon exposure to heat or flame , does not give off a significant quantity of toxic fumes or by - products . suitable fibers are nylon , polyamide ( especially aramid ), polyimide , carbon , quartz , fused or leached silica , ceramic , and polybenzimidazole ( pbi ) fibers such as are sold in fabric form under the trademarks nomex ( e . i . du pont de nemours & amp ; co . ), kevlar ( e . i . dupont de nemours & amp ; co . ), nextel ( 3 - m company , st . paul , minn . ), the kc series of uncoated aramid fabrics available from bentley - harris ( lionville , pa . ), bentley - harris kkd . 1200 ceramic cloth , bentley - harris gkp 1106 and 1306 &# 34 ; thermoshield &# 34 ;- treated fiberglass fabric , the bentley - harris gkpg range air textured glass fabrics , and upjohn 20 - 80 . suitable fire retardant fabrics also include those fabrics to which a fire retardant treatment has been applied such as treatment with an inorganic salt of ammonium sulfamate , zinc borate , or antimony oxychloride , chlorinated organic compounds such as chlorendic anhydride , alumina trihydrate , and certain organic phosphates and phosphonates , as well as those fabrics made from polymers to which a flame retardant chemical is chemically linked . an example of the latter is the polyester fiber sold under the trademark trevira ( hoechst fibers industries ) which , on information and belief , is a polymer of polyethylene terephthlate . the fabrics made from aramid fibers such as those sold under the trademarks nomex and kevlar are particularly preferred fire retardant fabrics for use in the composite of the present invention . by the use of the term &# 34 ; laminated &# 34 ; herein , it is intended to refer to the joining of the hydrogel / insulative layer and the fire retardant fabric in such a manner as to insure the adherence of the hydrogel / insulative layer to the fire retardant fabric so that the composite of the present invention can be removed from the surface of the object which is intended to be protected , e . g ., retractor blades , specula , endoscopes , etc . if desired . in one presently preferred embodiment , this lamination is accomplished by embedding a layer of fire retardant fabric into a layer of a suitable hydrogel as described above . embedding the fire retardant fabric into the hydrogel is accomplished , for instance , by applying pressure to the fabric and hydrogel after laying one on top of the other between two flat surfaces . in the case of catheters , nasotracheal tubes , and endotracheal tubes , a convenient method of laminating the hydrogel to the fabric is to wrap the tube with an adhesive / foil / fire retardant fabric strip and then laminate the fabric and hydrogel . two layers of fabric can be embedded into two hydrogel / insulative layers as follows . many hydrogels , because of their capacity for adherence , are supplied packaged between sheets of , for instance , polyethylene film . such a three - layer package ( polyethylene / hydrogel / polyethylene ) is preferably laid on a flat surface and the top layer of film is pulled off of the hydrogel . two layers of the fire retardant fabric ( or fabrics ) are then laid on a portion of the hydrogel and the reminder of the hydrogel folded over both layers of the fabric . pressure is then applied and , because the hydrogel permeates the spaces between fibers of the fabric , the result is two hydrogel / fabric laminates from which the original , remaining sheet of polyethylene film can be peeled , the film providing a convenient way to handle the laminate until the laminate is bonded to the foil . as will be set out below , the same result is accomplished using a pre - bonded foil / fabric such that the result is two foil / fabric / hydrogel laminates to which an adhesive is applied . another preferred method for laminating the fabric to the hydrogel is to form the hydrogel in the shape of a tube , with or without the foil and fabric layers , into which the endotracheal or other tube is inserted . the adhesion of the tube to the composite of the present invention is then accomplished by hydrating the hydrogel / insulative layer by wetting the hydrogel , the swelling of the gel preventing relative movement between the composite and the endotracheal or other tube . another embodiment illustrates the advantageous use of a hydrogel as the adhesive layer : the endotracheal or other tube is inserted into a tube formed of a hydrogel ( adhesive layer )/ foil / fire retardant fabric / hydrogel ( insulative layer ) and when water or other aqueous solution ( e . g ., an aqueous topical anesthetic ) is added , not only is the entire assembly made moist and relatively slippery ( facilitating insertion of the tube ), but the hydrogel ( adhesive layer ) swells into such tight engagement with the endotracheal or other tube that the composite of the present invention is effectively adhered to that tube . similarly , the fire retardant fabric can be knitted , braided , or woven in the shape of a tube , slipped over the endotracheal or other tube , and the hydrogel poured over the tube of fabric and crosslinked . the hydrogel / insulative layer is also laminated to the fire retardant fabric by embedding the fire retardant fabric into the hydrogel prior to cross - linking ( e . g ., addition of water ), thus creating an integral structure to which the foil is bonded . the foil is preferably a metallic foil such as aluminum , copper , silver , or stainless steel foil , and may or may not be corrugated . in a particularly preferred embodiment , the foil and the fire retardant fabric are bonded to each other when purchased . such products as bentley - harris aka 327 , which is a herringbone woven fabric from that company &# 39 ; s tba fortamid range of fire retardant fabrics that has been aluminized with highly reflective gemini film are particularly preferred because the composite of the present invention is then conveniently manufactured by applying , for instance , a double - sided tape to the foil and laminating the insulative layer to the fire retardant fabric by pressure as described above . there are a number of double sided , pressure - sensitive tapes which are appropriate for use in this manner ; a particularly preferred tape is obtained from the health care specialties division , 3m health care group ( st . paul , minn . ), product specification nos . 1509 , 1512 , 1513 , 1522 and 9873 . in addition to the adhesives described above , other adhesives may also be used to advantage , including the use of a hydrophilic polymer and &# 34 ; releasable &# 34 ; adhesive layers comprised of adhesives such as those available from 3m company ( st . paul , minn .) on one side of the fire retardant fabric . both embodiments exhibit the capability of an adhesive layer which is mechanically connected , e . g ., bonded , more firmly to the foil than to the skin or other tissue , plastic or metal to which the composite is applied . as a general rule , it is preferred to use fire retardant fabrics which are relatively thick or dense ( as that term is explained below ). the resistance of the composite to the present invention to burn through by a laser is directly related to increasing thickness or density for a particular weave and type of fabric . particular success has also been achieved by doubling and tripling the fire retardant fabric in the fabric layer and by the use of more than one type of fabric , thereby achieving the protective thickness desired without the need for using more expensive fire retardant fabrics woven in a thick weave , for instance a pile weave . however , if desired , such thicknesses can be obtained by using single and double velour , terry , or cut weaves , or by a weft or warp knit fabric . resistance to burn through is also improved by what might be termed &# 34 ; the density &# 34 ; of the fire retardant fabric , although changes in thickness demonstrated a greater effect on resistance than changes in density . by density , it is intended to refer to the use of coarser yarns , higher yarn counts , or tighter weaves e . g ., increases in the weight of the fabric ( as may be measured in , for instance , ounces per yard of fabric ); in the case of non - woven and / or random dispersion fire retardant fabrics , use of the term density refers to fabrics having a higher ratio of fibers to binder . the following experiments conducted with the presently preferred composites are illustrative of the protection which can be achieved in accordance with the teachings of the present invention . several composites were constructed and tested for resistance to burn through as follows . in a first test , a composite was constructed of the above described aka 327 foil - backed fortamid fire retardant fabric and laminated to hypan ( kingston technologies , dayton , n . j .) hydrogel as an insulative layer . with a co 2 laser at 35 watts , a 90 ° angle of incidence , and a 0 . 2 mm beam diameter , that composite resisted burn through for between 4 and 5 seconds . in a second test , that same foil - backed fire retardant fabric was laminated to a second layer of fire retardant fabric , specifically , du pont kevlar 440 , and an insulative layer , in the form of the same hypan hydrogel was laminated to that double - layer composite . when tested with a 0 . 2 mm co 2 laser beam at 35 watts at a 90 ° angle of incidence , the test was discontinued after 25 seconds with no visible sign of laser burn through . in a third test , a mallinckrodt 7 . 0 mm i . d . no . 86450 endotracheal tube was wrapped with a composite comprised of the above - described 3m double - sided tape and bentley harris aka 327 foil / fabric , and then an insulative layer , specifically the hypan hydrogel listed above , was laminated to the tube by crosslinking the gel to the fire retardant fabric of the adhesive / foil / fabric - wrapped endotracheal tube by wetting a hydrogel that was poured over the wrapped tube . when tested with a 0 . 2 mm co 2 laser beam at 35 watts and a 90 ° angle of incidence , the wrapped tube resisted burn through for between 4 and 5 seconds . fig1 shows a cross - section through a composite in accordance with the present invention . fig2 shows the composite in the form of an elongate strip which is wound on a spool into a roll . referring now to the figures , a cross - section through a composite in accordance with the present invention is indicated generally at reference numeral 10 in fig1 . the composite 10 is comprised of an adhesive in the form of a double layer , pressure sensitive tape , shown generally in fig1 at reference numeral 12 . tape 12 includes a layer of adhesive 14 , a second layer of adhesive 18 , and the film 16 to which adhesive layers 14 and 18 are applied , the second layer of adhesive 18 acting to adhere the tape 12 to the layer of foil 20 , e . g ., the adhesive - backed foil . as shown in fig2 the foil 20 is corrugated as at reference numeral 22 , but as noted above , need not be corrugated to be appropriate for use in connection with the present invention . foil 20 is bonded to a layer of fire retardant fabric 24 , and a hydrogel / insulative layer 26 is laminated to the fabric 24 . the composite 10 , as shown in fig2 can be supplied in the form of an elongate strip which is wound on a spool 28 into a roll 30 . an endotracheal tube made laser resistant by application of the composite 10 thereof is shown in fig3 . as known in the art , the endotracheal tube 32 is comprised of a tube 34 , inflatable cuff 36 , tube 38 for inflating the cuff 36 , and connector 40 . the strip of composite 10 is applied to the tube 34 of endotracheal tube 32 by wrapping the strip around the tube 32 in spiral , or &# 34 ; barber - pole &# 34 ; fashion , using the adhesive layer 14 of the tape 12 to adhere the composite 10 to the surface of the tube 34 . as noted above , the hydrogel / insulative layer 26 can also be laminated to the wrapped endotracheal tube 32 after a composite of adhesive - backed foil / fire retardant fabric is wrapped around the tube 34 thereof . the external appearance of such an endotracheal tube is the same as shown in fig3 . in either method of application , when wrapped around the tube 34 in this manner , the hydrogel 26 is outermost , providing a moist surface which facilitates insertion of the endotracheal tube 32 by reducing the potential for trauma and easing the insertion of the tube into the patient &# 39 ; s airway . if desired , the hydrogel provides a convenient vehicle for application of an aqueous solution of a topical anesthetic as described above . either way , the patient &# 39 ; s airway is not damaged . having described these presently preferred embodiments as being exemplary of the present invention as required by § 112 of the patent statute , it is not intended that the scope of the present invention be so limited . those skilled in the art who have the benefit of this disclosure will recognize , for instance , that there are fire retardant fabrics other than those listed above which may be used to advantage in the composite of the present invention . likewise , adhesives other than those described herein may be suitable for use as the adhesive layer of the composite of the present invention . all such changes and / or variations are intended to fall within the scope of the following claims . | 1 |
referring to the drawings , and first , more specifically to fig1 and 2 , at 10 as indicated generally apparatus according to the invention . it includes an elongate frame indicated generally at 12 on which the operating elements to be described herein are mounted . secured to the frame and extending laterally thereof are plates 14 , 16 and rollers 20 , 22 , 24 , all of which have their upper surfaces aligned in a substantially common horizontal plane to define a conveyor for supporting and carrying slabs of lumber sawn from logs along a path through the apparatus , as will be described in greater detail below . a first slab 28 illustrated in fig1 and 2 is supported on plates 14 , 16 and rollers 20 , 22 for movement along the substantially horizontal path in the direction of arrow 32 through the apparatus . a second slab 30 , which is thinner than slab 28 , is indicated at the right end of fig1 and 2 entering the apparatus and being supported on plate 14 and roller 24 . a plurality of hold down rollers noted generally at 34 , 36 , 38 , 40 are suspended on hydraulic cylinders 42 , 44 , 46 , 48 , respectively . these rollers may be raised or lowered by the hydraulic cylinders as necessary to press against the tops of slabs carried through the apparatus to hold the slabs in tight contact with the underlying plates and rollers . various ones of the underlying and hold down rollers are powered for rotation to drive slabs in a downstream direction through the apparatus along a path , the underside of the path being defined by the upper sides of plates 14 , 16 and the upper surfaces of rollers 20 , 22 , 24 . an elongate , multi - knife , rotating lower planer head 52 extends laterally of the frame 12 between the upstream end of plate 16 and the downstream end of plate 14 . a motor 54 ( fig1 ) is operatively connected to planer head 54 for rotating the head in a clockwise direction as illustrated in fig2 . the lower planing head 52 is supported on a screwjack 56 . the jack may be operated to position the planer head so that its rotating knives project a short distance above the plane of the tops of plates 14 , 16 thus to remove a minor portion of the underside of a slab carried therepast to produce a smooth lower surface on the slab . once the lower planing head is set in position , it seldom needs to be raised or lowered . positioned downstream on frame 12 from lower planing head 52 is an elongate , multi - knife , rotating upper planing head 60 . head 60 extends transversely of the frame and overlies the path along which slabs are conveyed . a motor 62 is operatively connected to planer head 60 to provide rotation in a counter clockwise direction as illustrated in fig2 . head 60 is supported for vertical shifting by an overlying setworks including a plurality of hydraulic cylinders , such as that indicated generally at 66 . the setworks is operable to raise and lower planer head 60 to vary the vertical spacing between lower head 52 and upper head 60 . the upper and lower ends of cylinder 66 are connected through pressure fluid lines 70 , 72 to a valve 74 . the valve , in turn , is connected to a source of pressurized fluid through inlet line 76 and exhaust line 78 . shifting of the valve is operable either to raise or lower the upper head 60 , or to hold it in a selected position . adjacent the upstream end of the apparatus is a slab thickness sensing device , or switch , indicated generally at 82 . it includes a swing arm 84 which rides on the upper surface of a slab introduced to the apparatus to sense the thickness of such slab . the thickness thus sensed is transmitted to a controller 88 which , through a predetermined program actuates valve 74 to operate setworks cylinder 66 . explaining further , as illustrated in fig2 upper head 60 is positioned to plane the upper surface of slab 28 whereby the slab is shaved to a selected thickness that produces a slab of maximum common lumber thickness while assuring a smooth upper surface for the slab . it will be noted that slab 30 being introduced into the apparatus at the upstream end is substantially thinner than slab 28 . this is detected by sensor 82 and a signal is provided to controller 88 indicating the thickness of slab 30 . after prior slab 28 passes beyond upper planing head 60 , controller 88 actuates valve 74 to lower planer head 60 to a vertical spacing from head 52 to plane slab 30 to a selected thickness that is the maximum common lumber thickness that can be produced from slab 30 while assuring planed smooth upper and lower surfaces . although not shown in the drawings similar valving and control mechanism is associated with cylinders 42 , 44 , 46 , 48 to properly position them above the conveyor path to provide desired slab hold - down operation . positioned downstream from the planing heads are a plurality of upright circular saw blades 94a , 94b , 94c , 94d , 94e , 94f , 94g mounted on a common shaft 96 . shaft 96 is rotated by a motor 100 through a plurality of belts 102 . the saw blades are of a thin kerf carbide tip style which run very true to produce smooth sides on boards cut thereby . in the preferred embodiment , the blades are of a type to cut a kerf - width of 0 . 080 to 0 . 125 inch . the blades may be mounted for shifting independently of each other transversely of the apparatus and axially of shaft 96 to provide selected spacing therebetween to produce boards of selected width . associated with each blade is a blade trueing and shifting device 106a , 106b , 106c , 106d , 106e , 106f , 106g , respectively . devices are known in the industry for shifting blades longitudinally of a shaft and maintaining substantially true running of the blades . they include a pair of plates on opposite sides of each blade with babbitt metal to engage the sides of the blade . describing operation of the apparatus , and referring first to fig3 a log 110 would be sawn longitudinally by a known headrig saw into a number of slabs with varying thicknesses as noted 0 , a , b , c . the side segments indicated as &# 34 ; o &# 34 ; generally are unusable because of their configuration . slabs a are the thinnest of those sawn from the log , slabs b are thicker , and slabs c are the thickest . a slab b is illustrated in fig4 laid substantially horizontally . from this slab it is noted that six boards numbered 1 , 2 , 3 , 4 , 5 , and 6 are to be obtained . it should be recognized that a slab sawn from log 110 is somewhat thicker than the boards intended to be produced therefrom , so that the upper and lower surfaces of the slab may be planed to smooth usable surfaces . it will be recognized also that small triangular sections 112 are produced at outer edges of slab b which will be unusable for producing boards . the slab is introduced to the upstream end of apparatus 10 , at the right end of fig1 and 2 , and is moved substantially horizontally in a downstream direction , to the left in the figures . finger 84 of sensing device 82 rests atop the slab as it is introduced to determine its thickness and sends a signal to controller 88 indicating to valve 74 whether to raise , lower , or leave upper planer head 60 in its present position relative to lower planer head 52 . the vertical spacing between heads 52 , 60 will be established such as to produce a slab thickness that is the maximum for boards obtainable from the slab . as the slab is moved downstream through the apparatus it is supported in a substantially horizontal path by plates 14 , 16 and rollers 20 , 22 , 24 . further , it is held down against these plates and rollers by rollers 34 , 36 , 38 , 40 and the operations of their supporting cylinders . as the slab moves over planer head 52 , its underside is planed to a smooth surface . as it moves under planer head 60 its upper surface is planed smooth . continuation of movement along the path brings the slab into contact with saw blades 94a , 94b , 94c , 94d , 94e , 94f , 94g which saw the slab into individual boards 1 , 2 , 3 , 4 , 5 , 6 . the saw blades run substantially true and cut smoothly . all four sides of a board 3 , such as that indicated at 3a , 3b , 3c , 3d in fig5 are substantially smooth surfaces . there is thus no further operation needed outside the apparatus described for producing , from a slab , multiple boards having all four sides surfaced smooth . the operation of the apparatus is such that a slab is moved therethrough at a speed of approximately 130 to 200 feet per minute . this is approximately one - half the speed of normal sawmill operations . such slower movement through the planer heads and saw blades provides for much smoother surfaces being produced on all sides , while allowing sizing , planing and sawing to be accomplished in one efficient , continuous operation . it has been found that by having the combined apparatus producing the method described above such slower operational speeds can be used and still substantially improve the efficiency of the overall production of lumber . this occurs by eliminating the many steps required in prior apparatus for sorting , stacking , and running individual pieces through a variety of operations as has occurred commonly in prior commercial practices . while a preferred embodiment of the invention has been described herein , it should be apparent to those skilled in the art that variations and modifications are possible without departing from the spirit of the invention . | 1 |
the present invention relates to the production of polyorganosiloxanes , both linear and cyclical , having at least one aliphatic isocyanate group pendant thereon . the present invention further relates to a process for the production of said polyorganosiloxanes . the polyorganosiloxanes produced in the practice of the present invention have the following nominal formula . ## str4 ## wherein r , which may be the same or different , represents an alkyl group having from about 1 to about 8 carbon atoms ; r &# 34 ; represents the group ## str5 ## q represents either r or h ; x is an integer having a value ranging from about 0 to about 200 ; y is an integer having a value ranging from about 0 to about 200 ; and z is an integer having a value ranging from about 1 to about 200 , with the proviso that q is hydrogen if y is zero . preferably , r , which may be same or different , represents an alkyl group having 1 to about 4 carbon atoms ; r &# 34 ; is either a , a &# 39 ; - dimethyl meta - or para - isopropenyl benzyl isocyanate x is an integer having a value ranging from 0 to about 50 ; y is an integer having a value ranging from 0 to about 50 ; and z is an integer having a value ranging from 1 to about 50 . further , the sum of x , y and z preferably ranges from 2 to about 50 . r &# 34 ; is derived from a , a &# 39 ; - dimethyl meta - isopropenyl benzyl isocyanate ; x is an integer having a value ranging from 0 to about 20 ; y is an integer having a value ranging from 0 to about 20 ; z is an integer having a value ranging from 2 to about 20 ; and the sum of x , y and z is no greater than 20 . the polyorganosiloxanes of the present invention can be prepared by means well known to those skilled in silicone chemistry . for example , the precursor of the polyorganosiloxanes of this invention , have the nominal formula : ## str6 ## wherein the variables are as previously defined with the proviso that q is hydrogen if y is zero . these compounds can be conveniently prepared by reacting a mixture containing hexamethyldisiloxane , octamethylcyclotetrasiloxane , trimethyl end blocked methyl hydrogen polysiloxane and an acid catalyst . the number of repeating units can be varied , as desired , by varying the mole ratio of the reactants . a specific procedure for preparing compounds falling within the scope of the formula ( iii ) is set forth in example 2 of u . s . pat . no . 4 , 046 , 930 granted sep . 6 , 1977 . compounds of formula iii are then reacted with α , α - dimethyl meta or para - isopropenyl benzyl isocyanate . the meta isomer is commercially available from american cyanamid company which markets it under the trademark of m - tmi ( which designation will be used hereinafter to refer to this reactant and to describe the remaining aspects of the invention ). preferably , m - tmi is purified prior to its reaction with the reactant of formula iii . this may be accomplished for example through vacuum distillation under an inert gas , such as nitrogen . the molar amount of m - tmi introduced to form the reaction mixture with compound iii depends upon the degree of reaction over the si -- h linkage sought and can readily be adjusted accordingly by one of average skill in the art . if complete reaction of all si -- h linkages is desired , excess m - tmi should be introduced and any excess can be readily removed from the resulting product mixture . the reaction of m - tmi and the compound iii is conducted at a reaction temperature of from about 20 to about 120 ° c ., preferably about 25 ° to about 80 ° c ., in the presence of a catalyst to induce reaction of the double bond present on m - tmi with the si -- h linkage in compound iii . among the catalysts generally useful in the reaction are compounds of a platinum group metal , especially platinum - olefin complex catalysts such as those disclosed in u . s . pat . nos . 3 , 159 , 601 ; 3 , 159 , 662 ; 3 , 220 , 972 ; 3 , 775 , 452 and 4 , 808 , 634 , the contents of which are hereby incorporated by reference . the preferred platinum group metals are platinum and rhodium , although ruthenium - based catalysts may also be employed . specific catalysts useful in the practice of the present invention include chloroplatinic acid , endocyclopentadiene platinum and platinum divinyl tetramethyldisiloxane . the catalyst ( calculated as the weight of metal ) should be present in the reaction mixture in quantities ranging from about 1 to about 250 ppm , based on the weight of the polyorganosiloxane reactant . the catalyst may be present in greater amounts although this is generally uneconomical and leads to coloration of the final product which is often undesirable . preferably , the catalyst is present in amounts ranging from about 5 to about 100 ppm on the same basis . reaction times will very according to reaction temperature and catalyst content and may range up to 50 hours in order to completely react the si -- h linkages although reaction times of 6 to 24 hours are preferred . additional catalyst may be introduced into the reaction mixture during the course of the reaction to aid in its completion . the reaction is then carried out through the maintenance of the above described reaction temperature until the reaction proceeds to the desired degree . this can be determined by measuring the presence of si -- h linkages through such means as &# 39 ; h - nmr . any m - tmi present upon reaction completion can be removed such as by the application of high vacuum and elevated temperature , thereby isolating the final product , compound i . compounds of formula ii may be prepared in a similar fashion to that above except that a cyclic siloxane reactant is initially substituted for compound iii . cyclic siloxanes are commercially available to use in the production of compounds of formula ii . preferred in the practice of this aspect of the present invention are cyclic siloxanes wherein the sum of a , b and c is no greater than 10 . most preferably , the sum of a , b and c does not exceed 6 . especially useful in the practice of this embodiment of the present invention is tetramethylcyclotetrasiloxane . compounds of formula ii may further be converted to acyclic molecules through treatment with base . in addition to the above - described polyorganosiloxane reactants , other organo - hydrosilane oligermers , polymers and copolymers should be useful in the practice of the present invention . these include 1 , 1 , 3 , 3 - tetramethyldisiloxane . the products of the present invention are useful as precursors for star polymers or starburst dendrimers or as crosslinking agents . further , the compounds claimed herein can be further reacted with agents reactive with the aliphatic isocyanate moiety pendant thereon . for example , dialkanol amine may be reacted with a compound within formula ii via its amine group to yield a polyol useful in the production of starburst polymers such as those which are generally disclosed in macromolecules 19 , p . 2466 ( 1988 ). reactions with polyalkylene glycols and diamines produce network polymers having urethane and urea linkages , respectively . whereas the scope of the instant invention is set forth in the appended claims , the following specific examples are provided to further illustrate certain aspect of the present invention . these examples are set forth for illustration only and are not to be construed as limitations on the present invention . all parts and percentages are by weight unless otherwise specified . the isocyanate m - tmi ( 100 grams ) was vacuum distilled under a slow flow of nitrogen . the fraction boiling at 127 °- 128 ° c ./ 12 . 7 mm hg was then collected for use in the hydrosilation reaction . tetramethylcyclotetrasiloxane ( 10 . grams , 0 . 0395 moles ) was mixed with the freshly distilled m - tmi ( 50 grams , 0 . 2488 moles ) in a three neck flask . to the resulting clear solution was added 0 . 3 ml of a 3 % solution of platinum divinyltetramethyldisiloxane in xylene . the mixture was then heated under nitrogen at 40 ° c . the reaction was continued until no sih absorption could be detected in the &# 39 ; h - nmr spectrum . total reaction time was 30 - 40 hours . in the latter stages of the reaction , a small quantity of fresh catalyst was added to complete the reaction . excess m - tmi was removed under high vacuum at a temperature of about 120 ° c . the product , a slightly colored viscous liquid was analyzed by ir , nmr , gel permeation chromatography and elemental analysis , the results of which are set forth below . 1 hnmr ( cdcl 3 ) w - 0 . 90 ( si -- ch 3 , s , 3 ); 0 . 93 ( si -- ch 2 , d , 2 ); 1 . 30 ( ch -- ch 3 , d3 ); 1 . 69 ( c -- ch 3 , s , 6 ); 2 . 95 ( ch , m , 1 ); 7 . 10 ( arom ch , s , 1 ); 7 . 30 ( arom ch , m , 3 ). 13 c nmr ( cdcl 3 ), w , 1 . 51 ( sich 3 ); 25 . 55 ( ch 3 ); 27 . 22 ( si -- ch 2 ); 33 . 10 ( c -- ch 3 ); 35 . 35 ( ch ); 60 . 77 ( c -- n ); 121 . 82 , 122 . 75 , 125 . 30 , 128 , 53 ( arom c ); 123 . 27 ( c ═ o ). anal . calc ., c 64 . 33 ; h 7 . 33 ; n 5 . 35 . found , c 64 . 02 ; h 7 . 34 ; n 5 . 30 . the absence of a si -- h absorption in the 1 h nmr spectrum of tetra [ 2 - methyl - 2 { 3 -( 1 - isocyanato - 1 - methylethyl ) phenyl } ethyl ] tetramethyl cylcotetrasiloxane , ( abbreviated as d4tmi ) and represented schematically below , suggests complete substitution of the silanic hydrogen by m - tmi . this is was confirmed by the results of elemental analysis and by gpc . the gel permeation chromatogram depicted only one sharp peak with a very small shoulder on the higher molecular weight side . the latter may result from the reaction of m - tmi with pentamethylcyclotetrasiloxane , a likely impurity in tetramethylcyclotetrasiloxane which typically has a purity of about 95 %. the 13 c nmr spectrum only showed the expected carbon absorptions . from all observations , it appeared that the conversion to the tetrafunctional aliphatic isocyanate d4tmi is quantitative . the color of the product is believed to be due to the presence of the platinum catalyst which may be removed through the application of such treatments as contact with activated charcoal . the procedure of example 1 is followed except that the polyorganosiloxane reactant was replaced with polymethylhydrodimethylsiloxane . a small amount of toluene was further added to lower the viscosity of the reaction mixture . the resulting product is a linear polysiloxane containing pendant aliphatic isocyanate groups . | 8 |
the bifurcating double - stent apparatus 10 of the present invention comprises a generally cylindrical main stent 12 and a generally cylindrical flared stent 15 , which are shown as fully dilated in a subject main vessel 8 and a subject branch vessel 7 , as illustrated in fig1 . the main stent 12 contains at least one generally circular opening 16 located between the proximal end 26 and the distal end 28 of the main stent 12 ( fig2 ), which opening is positioned over the opening 48 of a branch vessel in a vessel bifurcation 50 , as shown in fig2 . the ends of the stent 12 and the opening are imaged during imaging procedures by placing markers 56 around the edges of the opening 16 in the main stent 12 and at the proximal end 26 and distal end 28 of the main stent , as illustrated in fig4 . the flared stent apparatus 15 of the present invention comprises a generally cylindrical flared stent comprising a proximal end 30 and a distal end 32 , as shown in fig3 . the proximal end 30 comprises a flared portion , illustrated here as extended loops 18 , which flared portion , when dilated , is positioned within the lumen 58 of the main vessel 8 ( fig3 ). the ends of the flared stent 15 and the flared portion 18 are imaged during imaging procedures by placing markers 56 around the flared portion 18 and at the proximal - end 30 and distal end 32 of the flared stent , as illustrated in fig5 . as shown in the embodiment of the invention illustrated in fig4 a guidewire 20 is inserted into the vessel 8 prior to insertion of the main stent 12 , and is used to guide the main stent 12 into position within the vessel 8 . prior to insertion and dilation , the main stent 12 is disposed around the distal end of a catheter 48 which may include an inflatable balloon 24 . the main stent / catheter apparatus is then threaded onto the main guidewire 20 and into the vessel 8 . the main stent 12 is dilated by inflation of the balloon 24 until it expands the walls of the vessel 8 , and is thus affixed into place . as shown in the embodiment of the invention illustrated in fig5 prior to insertion of the flared stent 15 , a guidewire 36 and a stabilizing catheter 44 are inserted through the opening 16 in the main stent 12 , and into a branch vessel . the stabilizing catheter 44 is used to place the opening in the main stent 12 over the opening 16 in the bifurcation . the guidewire 36 is used to guide the flared stent 15 into position within a vessel . during insertion and prior to dilation , the flared stent 15 is disposed around the distal end of a branch catheter 54 which may include an inflatable balloon 25 , and the flared portion 18 of the flared stent 15 is held in a compressed position by a protective sheath 34 . in the bifurcating double - stent apparatus 10 of the invention , once the main stent 12 is dilated and the stabilizing catheter 44 is removed , the flared stent 15 is inserted over the branch guidewire 36 and through the opening 16 of the main stent 12 substantially as shown in fig5 and affixed in place by the expansion of the flared portion 18 positioned at the proximal end 30 of the flared stent , as shown in fig1 and 5 . the angle at which the flared stent 15 is affixed depends upon the vessel structure into which the bifurcating stent apparatus 10 is inserted ( fig1 ). the inventive two - stage method for implanting the novel bifurcating double - stent apparatus 10 begins with insertion of the main guidewire 20 into the subject main vessel 8 and across the bifurcation 50 . once the main guidewire 20 is in position in the main vessel 8 , the main stent 12 is mounted around a catheter 48 ( which may also comprise a balloon 24 ), and the catheter 48 and stent 12 are inserted into the main vessel 8 . the stent 12 is positioned so that the opening 16 is directly over the bifurcation point 50 in the subject vessel ( fig6 a ). in order to aid such positioning , a side branch guidewire 36 and a stabilizing catheter 44 ( as depicted in fig5 and 6 ) are also inserted through the opening 16 of the main stent 12 and into the branch vessel 7 ( fig6 a ). in an alternative embodiment of the method of the invention , the main stent 12 , the catheters 44 and 48 and the side branch guidewire 36 may be assembled in advance of insertion ( with the stabilizing catheter 44 and the side branch guidewire positioned through the opening 16 of the main stent ) into the subject , and then inserted into the bifurcation point 50 in the main vessel 8 simultaneously , after which the side branch guidewire 36 and the stabilizing catheter 44 are threaded into the branch vessel 7 in order to properly align the opening 16 in the main stent 12 ( fig6 a ). to affix the main stent 12 in the desired position within the vessel 8 , the stent 12 may be dilated by inflating the balloon 24 until the main stent 12 is in contact with the walls of the vessel 8 ( fig6 b ). once the - main stent 12 is dilated , the catheters 44 and 48 are withdrawn , leaving the fully positioned main stent 12 and the main guidewire 20 in the main subject vessel , and the side branch guidewire 36 in the subject branch vessel ( fig6 c ). in the second stage of the method of deploying the bifurcating double - stent of the invention , the flared stent catheter 54 , containing the compressed flared stent 15 in a protective sheath 34 and which may further contain a balloon 25 disposed around the flared stent catheter 54 and inside the compressed flared stent 15 , is inserted into the subject branch vessel 7 around the side branch guidewire 36 as shown in fig6 c . the compressed flared stent 15 is initially positioned so that the compressed proximal end 30 of the flared stent extends into the lumen 42 of the main stent 12 to facilitate full expansion of the flared portion 18 after withdrawal of the protective sheath 34 , prior to the final positioning of the flared stent 15 into the branch of the bifurcation ( fig6 c ). the distal end 32 of the flared stent is initially positioned within the branch vessel 7 ( fig6 c ). after the proximal end 30 of the compressed flared stent is properly placed within the lumen 42 of the main stent , the protective sheath 34 is withdrawn from the vessel 8 , and the flared portion 18 of the flared stent 15 is decompressed to extend radially , at least in part , to the longitudinal axis of the flared stent 15 , as shown in fig6 d . after the flared portion 18 of the flared stent 15 is in its flared configuration ( as shown in fig6 d ), the flared stent 15 is advanced into the side branch 7 at its proximal end 30 until at least a portion of flared portion 18 of the flared sheath 15 contacts at least a portion of an edge of the opening 16 of the main stent 12 , as shown in fig6 e . in this example , a balloon 25 is inflated in order to dilate the flared stent 15 to bring the walls of the flared stent 15 into contact with the walls of the branch vessel 7 , as shown in fig6 f . all remaining catheters and guidewires are then withdrawn from the subject , leaving the fully deployed bifurcating double - stent apparatus of the invention 10 , comprising the main stent 12 with at least one opening 16 , and the flared stent 15 positioned through the opening 16 into the branch vessel 7 , as shown in fig6 g . when treating ostial lesions , the flared stent 15 alone is used , and is positioned utilizing catheters and guidewires as described above , except that a stabilizing catheter is not used , and the flared portion 18 of the flared stent is positioned at the ostium of a vessel , instead of into a side branch through the an opening 16 in a main branch . after the flared stent 15 is positioned near the ostium of a subject vessel , the protective sheath 34 is retracted in order to allow the flared portion to fully expanded and the flared stent 15 is further advanced with the proximal end of the catheter until the unfolded hooks 18 are in contact with the walls of the subject vessel . all the stents of the invention may be deployed using the methods of the invention without resort to a balloon catheter . for example , a self - expanding compressed stent contained within a protective sheath could be self - dilated by retraction of a protective sheath . other methods of dilation of the stents of the invention may exist , or may become available in the future , and such methods are contemplated as being within the scope of this invention . while this example used self - unfolding loops to demonstrate one means of creating a flared portion , any other means of creating a flare , such as but not limited to creating a roll in the stent material which is then compressed , is contemplated as within the scope of this invention . it is the intent that the invention include all modifications and alterations from the disclosed embodiments that fall within the scope of the claims of the invention . | 0 |
aspects , features and advantages of the invention will be appreciated when considered with reference to the following description of preferred embodiments and accompanying figures . the same reference numbers in different drawings may identify the same or similar elements . furthermore , the following description is not limiting ; the scope of the invention is defined by the appended claims and equivalents . fig1 presents a schematic diagram of a computer network 100 depicting various computing devices that can be used in a networked configuration in accordance with aspects of the invention . for example , computer network 100 may have a plurality of computers 102 , 104 , 106 and 108 as well as other types of devices such as portable electronic devices such as a mobile phone 110 and a pda 112 . such computing devices may be interconnected via a local or direct connection 114 and / or may be coupled via a communications network 116 such as a lan , wan , the internet , etc . the communications network 116 may include multiple nodes comprising switches or routers , as will be discussed below . each computing device may include , for example , one or more processing devices ( e . g ., a cpu ) and have user inputs such as a keyboard 118 and mouse 120 and / or various other types of input devices such as pen - inputs , joysticks , buttons , touch screens , etc ., as well as a display 122 , which could include , for instance , a crt , lcd , plasma screen monitor , tv , projector , etc . each computer 102 , 104 , 106 and 108 may be a personal computer , server , etc . by way of example only , computers 102 and 106 may be personal computers while computer 104 may be a server and computer 108 may be a laptop . each computer such as computers 102 and 104 contains a processor , memory / storage and other components typically present in a computer . for instance , memory / storage stores information accessible by processor , including instructions that may be executed by the processor and data that may be retrieved , manipulated or stored by the processor . the memory / storage may be of any type or any device capable of storing information accessible by the processor , such as a hard - drive , rom , ram , cd - rom , flash memories , write - capable or read - only memories . the processor may comprise any number processing elements , such as sub - processing units operating in a parallel - processing configuration . alternatively , the processor may be a dedicated controller for executing operations , such as an asic . the communications network 116 is preferably configured to handle data packets ( e . g ., packets p 1 and p 2 ) using one or more nodes . fig2 illustrates a network configuration 200 , where a source device 202 ( e . g ., computer 102 ) may send data to a destination device 204 ( e . g ., computer 104 ) via one or more nodes 206 in the network . as shown , each node may comprise a router / switch such as router r 0 , r i , etc . the routers may include a processor such as a cpu , as well as memory for storing / queuing buffered data packets . the packets are preferably queued in a first - in , first - out (“ fifo ”) order . the routers may be arranged in the network so that packets from the source device 202 may be passed to the destination device 204 via multiple alternative routes . identifying such routes enables the system to efficiently route the packets . by way of example , fig2 illustrates a first path 208 along the route r 0 , r l , r l + 1 1 , r m 1 and r m + 1 , as well as a second path 210 along the route r 0 , r l , r l + 1 2 , r m 2 and r m + 1 . in accordance with aspects of the invention , several propositions or requirements regarding analyzing packet routing through the network are set forth . the first proposition is that there is no out of order delivery of packets sent from the source device to the destination device if these packets traverse the same route , unless a link failure occurs and causes a route change at a router in between its transmissions of these packets . a second proposition is that if two consecutive packets traverse different routes , they may arrive out of order at the destination . the probability of out of order delivery is maximized when the size of first probe packet is maximized and that of second probe packet is minimized . and a third proposition is that if two consecutive probe packets p 1 and p 2 of respective lengths l max and l min ( e . g ., the largest and smallest packet lengths supported by node r 0 ) traverse different routes yet arrive in order at the destination , the path traversed by p 2 experiences much larger queuing and / or transmission delay than p 1 . in this case , it may be of little gain to split the data traffic across the two paths traversed by p 1 and p 2 , since the throughput improvement is marginal . assume source device 202 is configured to initiate a data intensive application ( such as a file transfer ) that sends a large amount of traffic ( e . g ., 10 mbytes ) from its port x to destination device 204 . according to one aspect , s d is defined as a set of destination ports p the destination device 204 is listening to and can receive data from the source device 202 . in this embodiment , the invention allows the source device 202 or other associated device to discover n paths each served by a destination port in s n d ( s n d ⊂ s d ) of the destination device 204 . the source device 202 thus can split its traffic across these n paths , for example by establishing n tcp / udp sessions , one to each destination port in s n d . in one embodiment , a process is executed iteratively to arrive at a solution . fig3 illustrates a flow diagram 300 for identifying multiple paths to a given destination device and a set of ports on the destination serving these paths . the process desirably executes iteratively for up to n − 1 rounds . as shown in block 302 , a counter k of the rounds is incremented ( and which may be initialized to 0 ). in the k th round , the process starts with s k d , which is a subset of k ports in s d to serve traffic from the source device to the destination device over k unique paths . this is done to discover the ( k + 1 ) th path from the source to the destination , as well as a port p in s d to serve packets traversing this path . this process is desirably done by exchanging at least one probe pair or acknowledgement (“ ack ”) packet between the source device and the destination device . in one example , two destination ports , namely p 1 , and p 2 , “ collide ” if packets destined to p 1 traverse the same path as those destined to p 2 . the source device ( e . g ., router r 0 or source 202 ) searches for a port p in s d that does not collide with any ports in s k d , and eliminates ports from s d that collide with ports in s k d . first , in block 304 a port p is removed from s d . preferably , the port p is randomly selected for removal in block 304 . then , in block 306 , it is determined if the port p just removed from s d collides with any port in s k d . if so , the removed port p is not added back to s d such that it is skipped in the next round k + 1 , and the process returns to block 302 . if there is no collision , the process proceeds to block 308 , where s k + 1 d , is assigned to be s k + 1 d = s k d ∪ p . here , port p is added to s k + 1 d . the “∪” symbol in this equation is a union or addition operator . as shown in block 310 , if the counter k is less than n − 1 , then the process returns to block 302 ; otherwise it ends at block 312 . to determine if a given port p collides with any port in s k d without modifying s k d , the process 400 shown in fig4 may be employed . first , as shown in block 401 , a set of ports s y is initialized to be the same as the set of ports in s k d . as shown in block 402 , a port p ′ is removed from the set s y . the port p ′ is preferably randomly selected for removal from s y . next , as shown in block 404 , for each port p ′ in s k d , a pair of probe packets is sent back to back via ports p ′ and p respectively . the size of the first probe packet is preferably a maximum transmission unit ( l max ) supportable by the network between the source 202 and the destination 204 , while the second probe is preferably of a minimum packet length ( l min ) supported by the network between the source 202 and destination 204 . the destination device 204 may send an acknowledgement ack back to the source device 202 , as shown in block 406 . as shown in block 408 , the ack may indicate whether the ports p and p ′ collide . in particular , if the destination device 204 received the two probe packets out of order , it is determined that ports p ′ and p do not collide at block 410 . if the packets are received in order , it is determined that p ′ and p collide ( e . g ., port p collides with port p ′ in s k d ) as shown in block 412 . as shown in block 414 if s y is not empty , the process preferably returns to block 402 and repeats until a port p ′ is found in s y that collides with p , or until it is determined that no ports in s y collides with p . if s y is empty or a collision is found , the process terminates at bock 416 . one of the propositions discussed above was that if two consecutive packets traverse different routes , they could arrive out of order at the destination . the probability of out of order delivery is maximized when the size of first probe is maximized and that of second probe is minimized . to prove this observation , consider the following network model depicting two routes between a source node and a destination node . in this example , two probe packets , p 1 of length l 1 , and p 2 of length l 2 , are sent back to back from the source node to the destination node . the probe packets each traverses one of two routes , which may initially share certain routers , e . g ., r 0 , r 1 , . . . r l . in this example , the two routes branch off after r l and re - merge at r m . the transmission rate of a router r ( rε { r i | 0 ≦ i ≦ l }∪{ r i 1 | l & lt ; i ≦ m }∪{ r i 2 | l & lt ; i ≦ m }) is r ( r ), and q 2 ( r ) and q 1 ( r ) represent the queuing delays experienced by p 1 and p 2 at r , respectively . assume there is no cross traffic and the queuing delay is zero for p 1 and p 2 at r 0 to r l . it is straightforward to prove that : t l 2 and t l 2 are the arrival times of p 1 and p 2 at r l , and min { r ( r i )| 0 ≦ i ≦ l } is the bandwidth of bottleneck link between r 0 and r l . when there is cross traffic , t l 2 − t l 1 , the dispersion of p 1 and p 2 , can expand or compress . to express this phenomena , we let : cross traffic , such as a packet p 3 , may be serviced in between p 1 and p 2 . as shown in fig5 , if this occurs , then the dispersion between p 1 and p 2 increases . the probability of such cross traffic expanding the dispersion of p 1 and p 2 decreases with the length l 2 of packet p 2 . thus , if the length l 2 of packet p 2 is minimized , the probability of cross traffic packet p 3 increasing the dispersion between p 1 and p 2 is minimized . if cross traffic p 3 is serviced before p 1 as shown in fig6 , the dispersion of p 1 and p 2 is decreased . the probability of such cross - traffic p 3 decreasing the dispersion of p 1 and p 2 increases with the length l 1 of packet p 1 . furthermore , it can be proved that : thus t l 2 − t l 1 is minimized if l 2 is minimized and l 1 is maximized . next , t m 1 and t m 2 , the arrival times of p 1 and p 2 at r m , respectively , and the condition for t m 1 & gt ; t m 2 , that is p 2 arrives at r m and eventually at the destination node before p 1 are derived . in particular : in the above formula , when l 1 is maximized and l 2 is minimized , t l 2 − t l 1 is minimized , and is maximized . assume the sum of queuing delays experienced by p 1 and p 2 , are independent of l 1 and l 2 . the probably of t m 2 & lt ; t m 1 is maximized when l 1 is maximized and l 2 is minimized . it can be further proved that if between r m and the destination node , p 1 and p 2 traverse on different routes , the lead time of p 2 over p 1 is also maximized when is l 1 maximized and l 2 is minimized . with regard to the third proposition , if two consecutive probe packets p 1 and p 2 of length l max and l min ( denoting the largest and smallest packet length supported by the network &# 39 ; s nodes ) traverse different routes yet arrive in order at the destination , the path traversed by p 2 experience much larger queuing and / or transmission delay than p 1 . it is thus of little gain to split the application traffic across the two paths traversed by p 1 and p 2 , since the throughput improvement is marginal . when l 1 = l max and l 2 = l min , the probability of cross traffic in between p 1 and p 2 is close to zero , and it may be assumed that : if the queuing delays of p 1 and p 2 are equal , once a pair of non - colliding ports has been found , the system may configure packet transmission to send one or more packets along the different routes from the source node to the destination node . in one alternative , the system evaluates the network to determine whether more than two non - colliding destination ports are present . if so , the packet traffic may be split among all non - colliding routes . furthermore , the processes discussed herein , such as the operations discussed with regard to fig3 and 4 , may be performed by one or more processors in the system . by way of example only , processing may be performed by the source device 202 , destination device 204 or one of the routers 206 of fig2 . the processor ( s ) may execute a program recorded / stored on a computer - readable recording medium , such as rom , ram , flash memory , cd - rom , dvd - rom or the like . although aspects of the invention herein have been described with reference to particular embodiments , it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
fig2 shows a frequency - to - voltage convertor ( fvc ) circuit 200 that can be divided into two sections . the triggering and timing of the single - shot are performed in the left hand section of the circuit 200 beginning with the timing capacitor c616 . the amplitude of the pulse is set by the right section of the circuit 200 , beginning with emitter coupled pair q545 , q577 . starting at the input of the circuit 200 , note that input hhv1 . l is a current mode signal . the required signal is a negative - going pulse train having nominal 100 ua amplitude ( source - only ), a duty cycle of between 5 % and 20 % and frequency between 10 - 150 khz . when input signal hhv1 . l is off ( during a pulse ), the collector voltage of npn device 612 equals 4 * vbe due to voltage division by resistors r580a and r580b and the vbe of device q583 . between sync pulses , device q612 is on and its collector voltage equals ˜ 0 . 3 v . thus , the signal on the collector of device q612 is a positive - going sync pulse . between sync pulses , input signal hhv1 . l is sourcing current . therefore , as stated above , device q612 is on and its collector voltage equals ˜ 0 . 3 v . since npn device q563 is off , the base drive voltage of pnp device q590 is 8 v . current ifvc1 charges capacitor c616 until device q590 tums on at about 8 . 7 v ; then the emitter current of device q590 equals ifvc1 . since ifvc1 = 2 * ifvc2 , npn device q622 can only sink half of the collector current of device q590 . therefore , the collector current of device q567 equals ifvc2 . the collector of device q622 rises until device q571 tums on . thus , the collector voltage of device q590 equals 2 . 2 v + vbe . current ifvc1 is split equally between transistors q567 and q571 . the base current of transistor q590 must flow through resistor r607 to reference voltage supply vcca ; the base voltage of device q590 actually rises above 8 v during this interval . at the start of a horizontal sync pulse , input signal hhv1 . l stops sourcing current and the collector of device q612 goes from quasi - saturation to 4 * vbe . device q563 is turned on and , in fact , goes into saturation very quickly , discharging capacitor c616 through the base of device q590 , which remains saturated during and after the discharge of capacitor c616 . at the same time , transistors q556 and q591 turn on , pulling the collector voltage of device q622 to 3 vbe . current ifvc1 then flows out of the base of transistor q590 , which is still saturated , and into the saturated collector of transistor q563 . thus , the voltage of capacitor c616 quickly moves from 8 . 7 v to 0 . 7 v and remains at that level during the sync pulse . note that until this time in the operation of the circuit 200 , the collector voltage of device q622 has been at about 3 vbe : before the sync pulse , it equalled ˜ 2 . 2 v , and during the sync pulse it equalled 3 vbe . as discussed below , this node goes to ground ( sat ) momentarily after the sync pulse ends ; this is the information that allows production of a single - shot output pulse . at the trailing edge of the horizontal sync pulse , input signal hhv1 . l starts sourcing current once again . the collector voltage of device q622 returns to 0 . 3 v and device q563 turns off so that the base voltage of device q590 immediately rises to 8 v . device q590 turns off and current ifvc1 begins charging capacitor c616 from 0 . 7 v . since the collector of device q612 is low , the collector of device q622 is no longer being held up by device q556 ; since no current is entering the q622 collector node , the collector voltage of device q622 equals vce -- sat . this represents the start of the output pulse . when the capacitor c616 has charged to ˜ 8 . 7 v , device q590 turns on and the collector current of device q590 equals ifvc1 . since ifvc1 = 2 * ifvc2 , current ifvc1 quickly dominates and pulls the collector voltage of device q622 up until clamp device q571 turns on and the collector voltage of device q622 equals ˜ 2 . 2 v . this represents the end of the output pulse . thus , the signal at the collector of device q622 is a waveform which rests at 2 . 2 v between sync pulses , equals 2 vbe during sync , and equals vce -- sat from just after the trailing edge of sync until the capacitor c616 is fully charged , when it returns to 2 . 2 v at the next sync pulse . this signal then is applied to a vertical pnp emitter follower q549 , a 2 . 2 v clamp ( devices q584 , q627 ) and an npn emitter follower q562 . at the emitter of device q562 , the signal is now a cleaned up , negative - going pulse that rests at 2 . 2 v - vbe before and during sync . the ( vce -- sat ) pulse starts just after the sync trailing edge and ends when the capacitor c616 has charged . the 8 v voltage clamp includes the npn emitter coupled pair q545 and q577 . in its resting state ( between output pulses ), the base voltage of device q611 equals vce -- sat and , at the output pulse node , the collector voltage of device q574 equals vce -- sat . during an output pulse , npn devices q619 and q574 are off . the feedback amplifier ( which comprises the devices to the right of device q575 in fig2 except devices q619 and q574 and associated resistors ) is active and keeps the output node at the collector of device q574 equal to 8 v , where the 8 v input to device q545 is provided by a bandgap reference external to the circuit 200 under consideration . experiments with an integrated circuit realization , as well as simulation , of the , above - described fvc 200 have shown its temperature coefficient to be less than 20 ppm / degrees celsius over the temperature range 0 - 85 degrees c . the design techniques utilized to achieve this performance are described below . note that the die layout for the above - described circuit 200 uses no cross - coupling , common - centroid or other rigorous device matching methods . the most important and fundamental technique is the use of a single transistor , pnp q590 , which sets both of the pulse - time - controlling integration thresholds . the vbe of device q590 is added to both the thresholds , rendering device matching considerations irrelevant . during the integration , transistor q590 is off , and there are no transistor bases attached to the integration node ; thus , changes in beta do not affect the integration . one - shot fvcs typically exhibit nonlinearity resulting from reduced pulsewidth at higher frequencies . this is due to incomplete resetting of the capacitor voltage between pulses . in accordance with the invention , the 18 pf capacitor c616 discharges through the base of lateral pnp q590 and the collector of npn q563 . the naturally low base resistance of the lateral pnp q590 , and conventional layout measures taken for low npn collector resistance , result in a discharge rc time constant no longer than 20 ns . since the shortest available discharge time is 500 ns , the capacitor c616 is always discharged to a level corresponding to at least 25 time constants -- an error of 14e - 12 , or 14 ppt ( parts per trillion ). the saturation voltages of transistors q563 and q574 are crucial in assuring low drift . note that these two saturation voltages cancel first order , since a nonzero saturation voltage produces , for transistor q563 , a narrowed output pulse resulting m lowered dc output , and , for transistor q574 , a higher dc output . using empirical data for saturation voltage versus temperature , current , and forced beta , the base drive for both these devices ( q563 , q574 ) is designed to have a strong positive temperature coefficient . for example , the base drive current for transistor q563 is set by the current of resistor 20 k r557 . the voltage across resistor r557 , when transistor q563 is on , is 8 v - 5 vbe . similarly , the base drive current in transistor q574 is set by 1 . 7 k resistor r146 , the voltage across which is 2 . 2 v - 2 vbe . the simulation waveforms of the signals at nodes 19 , 32 , 57 , 64 , 68 and 70 of the fig2 circuit 200 are shown in the fig3 a - fig3 c diagrams to further illustrate the operation of the fig2 circuit 200 . it should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention . for example , those skilled in the an will appreciate that the polarity of the fig2 circuit 200 may be reversed while still achieving the desired results . it is intended that the following claims define the scope of the invention and that structures and methods within the scope of the claims and their equivalents be covered thereby . | 6 |
referring to fig1 - 3 , the two greenhouses indicated generally at no . 1 and no . 2 are of identical construction , each having a curved substantially cylindrical framework for supporting the roof , the framework being supported on a rectangular , vertically disposed wainscot wall 20 , 20 &# 39 ; extending around the base . the wall 20 may comprise panels of thermal insulating moisture - proof material and may extend below the ground level , as indicated in fig2 to inhibit heat loss from the greenhouse through the ground . the wainscot wall 20 &# 39 ; preferably extends across the ends of the greenhouse , and is provided with doors 21 therein . the wainscot wall 20 extending along the sides of each greenhouse has vertical pipes or tubes 22 enclosed therein at intervals longitudinally of the greenhouse and the tubes have coupling sleeves 23 on their upper ends . a series of tubular arches or bows 24 are supported at their lower ends in coupling sleeves and extend transversely of the greenhouse . these arches 24 may be in two sections joined together at the top by couplings 25 . preferably , there is an arch at each end of the structure , with the remaining arches spaced equally therebetween . the arches 24 are preferably connected by purlin tubes 26 extending longitudinally of the structure to complete the framework for the roof , and , as indicated in fig2 and 3 , the purlin tubes 26 are preferably spaced inwardly of the arches 24 by stub connectors 27 , for a purpose to be described . the spaces between the end arches and the end walls 20 &# 39 ; are closed by a glazing of glass or plastic sheeting 28 in a usual manner . an inner flexible layer of plastic sheeting 30 , such as polyethylene , is stretched over the arches 24 and secured thereto in a usual manner , as by clips ( not shown ). as best shown in fig8 the bottom edge portions of the plastic layer 30 are secured to the inner edges of troughs 32 extending longitudinally of the framework just above the wainscot walls 20 on both sides of the structure . thus , condensation on the inner surface of layer 30 will not drain into the troughs and wet the beads . the troughs 32 may be of sheet metal or plastic material having beaded edges 33 around which the marginal edges of the layer 30 are crimped . preferably , the troughs are lined with thermal insulating material . an outer flexible layer of plastic sheeting 34 , which may be the same material as layer 30 , overlays the layer 30 and has its lower edges secured to the outer beaded edges 33 &# 39 ; of troughs 32 . at the ends of the roof the layers 30 and 34 are sealed together in a well - known manner to provide a closed chamber between the layers . the arcuate length of the layer 34 is calculated to be such that when the chamber between the layers is inflated as in fig2 the distance between layers is approximately 4 inches . as indicated in fig3 when the chamber is deflated , the outer layer collapses upon the inner layer . between the arches , the inner plastic layer bulges inward due to the air pressure from the blowers used to fill and empty the space between the layers . the purlin tubes 26 are spaced several inches inwardly from the arches 24 to prevent the plastic layer 30 from resting on the purlins and obstructing the smooth flow of the beads during the emptying cycle . the troughs 32 are preferably adjustably supported above the wainscot wall 20 to compensate for expansion and contraction of the plastic layers 30 and 34 . such a support may comprise rotatable rods 36 extending longitudinally under the troughs and having series of cams 37 thereon to raise and lower the troughs 32 . between each trough 32 and wall 20 is an insulated panel p which is attached to arches 24 . this panel provides a smooth surface over which the trough may ride when removing slack from layers 30 , 34 . as shown in fig1 air ducts 38 and 39 and 38 &# 39 ; and 39 &# 39 ; are connected into the chambers between the plastic layers 30 and 34 at opposite upper ends of the no . 1 and no . 2 structures . air ducts 40 are connected into the front ends of troughs 32 in no . 1 structure , and air ducts 40 &# 39 ; are connected into the rear ends of troughs 32 in no . 2 structure . in accordance with the present invention , the chambers in the roof walls of the greenhouse structures are filled with granular thermal insulating material during the nighttime to conserve heat within the structures , and the insulating material is removed during the daytime to allow transmission of solar energy through the roof walls . a preferred thermal insulating material is expanded polystyrene beads which are preferably treated to inhibit static electricity tending to cause coagulation of the beads . fig9 shows schematically the fluid circulation system for inserting and removing the polystyrene beads into and from the chambers between the plastic layers comprising the roof walls of the no . 1 and no . 2 structures . each air duct 38 and 38 &# 39 ; is connected to the bottom of a bin for storing the beads when they are removed from the roof walls of the structures . duct 38 from no . 1 structure is connected to the bottom of a bin a and duct 38 &# 39 ; from no . 2 structure is connected to the bottom of a bin b . the ducts 40 from no . 1 structure are connected by a duct 41 to the supply port of a centrifugal blower 42 , the exhaust port of which is connected by conduits 43 and 44 to the top of bin a . similarly , the ducts 40 &# 39 ; from no . 2 structure are connected by a duct 41 &# 39 ; to the supply port of a blower 42 &# 39 ;, the exhaust port of which is connected by conduits 43 &# 39 ; and 44 &# 39 ; to the top of bin b . the bins a and b are substantially airtight . the ducts 41 and 41 &# 39 ; are also connected to the ducts 38 and 38 &# 39 ;, respectively , and butterfly valves 46 and 47 and 46 &# 39 ; and 47 &# 39 ; are provided in ducts 38 and 38 &# 39 ;, respectively , on opposite sides of their connections with ducts 41 and 41 &# 39 ;. valves 49 and 49 &# 39 ; are provided in ducts 40 and 40 &# 39 ;, respectively . the ducts 39 and 39 &# 39 ; are connected to the ducts 44 and 44 &# 39 ;, respectively , and valves 50 and 51 and 50 &# 39 ; and 51 &# 39 ; are provided in ducts 39 and 39 &# 39 ; on opposite sides of the connections with ducts 43 and 43 &# 39 ;. in the operation of the improved system , assuming that the roof wall chambers of both structures are empty and the insulating material m stored in the bins , the filling operation will be described . the air flow during filling is indicated in fig9 in solid line arrows and during emptying in broken line arrows . before starting the blowers 42 and 42 &# 39 ;, valves 49 and 49 &# 39 ; are closed , valves 46 and 46 &# 39 ; and 47 and 47 &# 39 ; opened , 50 and 50 &# 39 ; closed , and 51 and 51 &# 39 ; opened . when the blowers are started , material will be entrained in the air flow from bin a and conducted through conduits means 43 and 39 into the roof wall chamber of structure no . 2 . the material will separate out in the chamber and fall down the sides into the troughs . the air will exhaust through duct 38 &# 39 ; and valve 47 &# 39 ; to the supply port of blower 42 &# 39 ; so that the plastic layers will not be damaged by excess pressure . at the same time , material from bin b will be conducted through blower 42 &# 39 ; and conduits means 43 &# 39 ; and 39 &# 39 ; into the roof wall chamber of structure no . 2 , the air flow exhausting through duct 38 to blower 42 , and the material separating out to fill the chamber of no . 2 . when it is desired to remove the insulating bead material from the roof wall chambers , valves 46 and 46 &# 39 ;, 51 and 51 &# 39 ; are closed , and valves means 50 and 50 &# 39 ; are opened . when the blowers are started the air flow from the blowers through conduits 44 and 44 &# 39 ; into bins a and b and out through conduits 54 and 54 &# 39 ; will flow through the tops of the wall chambers and evacuate beads to form longitudinal air channels c through the chambers , as indicated in fig5 and 6 . in bins a and b baffles 53 and 53 &# 39 ; are provided to separate beads returned through conduits 44 and 44 &# 39 ; from the air flowing into the bins and exhausting through outlet conduits 54 and 54 &# 39 ;. the conduits 54 and 54 &# 39 ; are connected to conduits 39 and 39 &# 39 ;, and have valves 55 and 55 &# 39 ; therein . the valves 55 and 55 &# 39 ; are also opened at the start of the emptying cycle . when channels c have been formed to about two feet in width , valves 49 and 49 &# 39 ; are opened , so that the blowers will draw the bead material m through ducts 40 and 40 &# 39 ; to the bins a and b . this withdrawal action causes the air flow through each channel c to form two air streams s from the end of the channel to the ducts 40 at the ends of troughs 32 , and the air streams entrain beads and peel them off of the aggregate m , as indicated in fig5 . as the beads are evacuated , the outer plastic layer 34 collapses progressively in a substantially triangular configuration onto the area of inner layer 30 from which the beads have been evacuated , and effectively shuts off flow from the channel c into the duct 38 . thus , it may not be necessary to close the valves 47 , 47 &# 39 ; after the valves 49 , 49 &# 39 ; are opened . the ducts 54 , 54 &# 39 ; are preferably provided with vents 57 , 57 &# 39 ; leading to the atmosphere and having valves 58 , 58 &# 39 ; therein , for reducing incoming air to the tops of the structures to allow the plastic layers 34 to collapse . in order to insure the complete evacuation and filling of the beads , the curves of the arches 24 must be designed to allow free flow of the beads from the channels c downward into the troughs 32 . the arches should be at an angle of at least 15 ° from the vertical at the exit channels to prevent the beads from piling up during filling and causing bulging out of the layers above the troughs . it has been determined that the improved greenhouse structure and circulation system used in cold weather seasons results in a savings of 75 % in heating fuel over a 24 - hour period as compared with a greenhouse using an air chamber between two layers of plastic sheeting . moreover , the cost of construction materials including the polystyrene beads is minimal , and the beads can be used continuously over long periods . the structure and system is adapted for use in extremely hot weather by filling or partially filling the roof wall chamber with insulation beads during the daytime , thus eliminating the necessity of spraying the outer layer to reduce transmission of energy , or using curtains or other expedients . also , during hot nights the insulating beads would reduce the energy required to circulate cool air within the structures . | 0 |
the following description of preferred embodiments of the invention is not intended to limit the invention to these embodiments , but rather to enable any person skilled in the art to make and use this invention . as shown in fig1 , the implantable device system of the preferred embodiments includes a guide tube 10 , a first electrical subsystem 12 , and a second electrical subsystem 14 . the first electrical subsystem 12 is connected to the second electrical subsystem 14 . the guide tube 10 functions to facilitate the insertion of at least one first electrical subsystem 12 into tissue by preventing buckling and maintaining a generally straight trajectory through the tissue , functions to allow the first electrical subsystem ( s ) 12 to move freely with the tissue ( i . e . not being rigidly constrained ), and functions to allow the placement of the first electrical subsystem 12 without disconnecting the second electrical subsystem 14 . the implantable device system may be implanted into the brain , spinal cord , peripheral nerve , muscle , or any other suitable anatomical location . the guide tube 10 of the system , however , may be alternatively used in any suitable environment and for any suitable reason . the guide tube 10 of the preferred embodiments functions to facilitate the insertion of at least one first electrical subsystem 12 , functions to allow the first electrical subsystem ( s ) 12 to move freely with the tissue ( i . e . not being rigidly constrained ), and functions to allow the placement of the first electrical subsystem 12 without disconnecting the second electrical subsystem 14 . therefore , the guide tube preferably operates in the following modes : active mode , during which the guide tube is rigid in the axial direction and facilitates insertion of the first electrical subsystem into tissue , and inactive mode , during which the guide tube allows the first electrical subsystem to move freely with the tissue . the guide tube 10 is preferably made of a rigid material , which can be inserted into tissue or other substances without buckling and can maintain a generally straight trajectory through the tissue . the material may be uniformly rigid , or rigid only in a particular direction ( such as the axial direction ). the material is preferably plastic such as a medical grade plastic , but may alternatively be any suitable material such as metal or a combination of materials . the guide tube 10 may further include a sharpened end adapted to penetrate the tissue and aid in the insertion of the guide tube 10 into the tissue . the guide tube 10 may also include alignment and or fixation features to facilitate positioning and stabilizing the first electrical subsystem 12 in the tissue , particularly during removal of the guide tube . the transition of the guide tube between active mode and inactive mode preferably occurs in one of several variations . in the first two variations , the guide tube 10 is adapted to be removable from the system of electrical subsystems . in another variation , the guide tube 10 is adapted to remain with the system of electrical subsystems . although the guide tube 10 is preferably adapted in one of the several following variations , the guide tube 10 may be adapted in any suitable fashion or combination thereof to allow the transition of the guide tube between active mode and inactive mode such that the first electrical subsystem 12 to moves freely with the tissue , following the placement of the first electrical subsystem 12 , without disconnecting the second electrical subsystem 14 . 1 . 1 the guide tube removed from a portion of the system as shown in fig2 , the guide tube 10 of the first variation defines a slit 18 , which functions to allow the guide tube to be removed over a portion of the system . the slit 18 preferably does not prevent the guide tube 10 from maintaining rigidity as the guide tube 10 is inserted . preferably a cable connecting the first electrical subsystem 12 and the second electrical subsystem 14 of the implantable device system slides through the slit 18 , but any suitably thin portion of the implantable device system may slide through the slit 18 . the slit 18 preferably is a linear slit , as shown in fig2 , which runs generally perpendicularly to the end of the guide tube . the slit 18 may alternatively be a spiral slit , as shown in fig3 , and may run at any suitable angle to the end of the guide tube 10 . in a second version , as shown in fig4 and 5 , the guide tube 10 may define a plurality of perforations 22 , which function to allow the guide tube to be removed over a portion of the system . the perforations 22 may supplement or replace the slit 18 of the first variation . as the guide tube 10 is removed over a portion of the system , the portion of the system will apply a generally radial force to the guide tube 10 , which will cause the perforations 22 to uncouple , creating an opening or a slit , and allow the guide tube 10 to be removed . there are preferably two perforations 22 , such that the guide tube 10 is uncoupled into two portions . the two portions may be generally equal halves , or one portion may be larger than the other . alternatively , there may be just one , or may be more than two perforations 22 uncoupling the guide tube 10 . additionally , the perforations 22 preferably run a portion of the guide tube 10 ( as shown in fig4 ), but may alternatively run the length of the guide tube 10 ( as shown in fig5 ). the perforations 22 are preferably linear and run generally perpendicularly to the end of the guide tube . the perforations 22 may alternatively be any suitable geometry and run at any suitable angle to the end of the guide tube 10 . in a third version , the guide tube 10 is made of a brittle material that functions to crack and widen as the guide tube is moved over a portion of the system . the brittle material will not prevent the guide tube 10 from maintaining rigidity as the guide tube 10 is inserted . the material is preferably adapted to crack in response to a force in the radial direction , while allowing the guide tube 10 to maintain rigidity in the axial direction . as the guide tube 10 is moved over a portion of the system , the portion of the system will apply a generally radial force to the guide tube 10 , which will cause the material to crack , creating an opening or a slit , and allow the guide tube 10 to be removed . the guide tube 10 may be entirely made of the brittle material adapted to crack in response to a force in the radial direction and to rigid in the axial direction or a portion of the guide tube may be the brittle material while the remainder is conventional guide tube material . preferably , the brittle material runs the length of the guide tube 10 , but may alternatively run any suitable portion of the length of the guide tube 10 . the portion of brittle material preferably runs generally perpendicularly to the end of the guide tube , but may alternatively be any suitable geometry and run at any suitable angle to the end of the guide tube 10 . in a second variation , the guide tube 10 is adapted to break open , or at least expand its diameter to allow the removal of the guide tube 10 over the second electrical subsystem 14 . the guide tube 10 is preferably adapted to break open , or at least expand its diameter in one of several versions . the first three versions are similar to the first three versions of the first variation of the guide tube 10 , as shown in fig2 - 5 , except that the guide tube 10 is made from a material that can be opened or expanded in the radial direction to allow the guide tube 10 to be removed over the second electrical subsystem 14 . in a fourth version , as shown in fig6 , the guide tube 10 is preferably made of a flexible material that functions to widen as the guide tube is moved over the second electrical subsystem 14 of the system . the flexible material will not prevent the guide tube 10 from maintaining rigidity as the guide tube 10 is inserted . the material is preferably adapted to be flexible in the radial direction , while allowing the guide tube 10 to maintain rigidity in the axial direction . as the guide tube 10 is moved over a portion of the system , the portion of the system will apply a generally radial force to the guide tube 10 , which will cause the material of the guide tube 10 to widen and allow the guide tube 10 to be removed . the guide tube 10 may be entirely made of an anisotropic material adapted to be flexible in the radial direction and rigid in the axial direction , a portion of the guide tube may be the anisotropic material while the remainder is conventional guide tube material , or a portion of the guide tube may be flexible material while the remainder is conventional guide tube material . preferably , the flexible or partially flexible material runs the length of the guide tube 10 , but may alternatively run any suitable portion of the length of the guide tube 10 . the portion of flexible material preferably runs generally perpendicularly to the end of the guide tube , but may alternatively be any suitable geometry and run at any suitable angle to the end of the guide tube 10 . in a fifth version , as shown in fig7 , the guide tube 10 includes a flexible material and splines 24 that are rigid in the axial direction , which functions to widen as the guide tube is moved over a portion of the system . the splines 24 will allow the guide tube 10 to maintain rigidity as the guide tube 10 is inserted . as the guide tube 10 is moved over a portion of the system , the portion of the system will apply a generally radial force to the guide tube 10 , which will cause the splines 24 to move apart and the material of the guide tube 10 to flex , widening the diameter of the guide tube 10 , allowing the guide tube 10 to be removed . alternatively , the guide tube 10 may include the splines 24 alone , and not further include a flexible material or only include the flexible material along a portion of the splines 24 . the splines 24 are preferably strips of any suitable width and thickness and preferably run along the length of the guide tube 10 and run generally perpendicularly to the end of the guide tube . the splines 24 may alternatively be any suitable geometry , run any suitable portion of the length of the guide tube 10 , and run at any suitable angle to the end of the guide tube 10 . the splines 24 are preferably rigid , or may alternatively be flexible in the radial direction and rigid in the axial direction . the splines 24 may alternatively run circumferentially around the guide tube 10 or spiral around the guide tube 10 , such that there are multiple circular splines , or a spring , stacked along the length of the guide tube . the circular splines preferably expand in the radial direction and due to the stacking , would be rigid in the axial direction . 1 . 3 the guide tube adapted to remain with the electrical subsystems the guide tube 10 of the third variation is adapted to remain with the implanted system of electrical subsystems . the guide tube 10 is preferably adapted to be resorbable into the tissue after a period of time . the guide tube 10 in this variation is preferably made from a material that is resorbable such as polyglycolide or polylactide , but may alternatively be made from any suitable bioresorbable material . in a second variation , as shown in fig7 , the guide tube 10 includes a flexible material and splines 24 that are rigid in the axial direction . the flexible material and splines 24 will not prevent the guide tube 10 from maintaining rigidity as the guide tube 10 is inserted . the splines 24 are preferably strips of any suitable width and thickness and preferably run along the length of the guide tube 10 and run generally perpendicularly to the end of the guide tube . the splines 24 are preferably rigid . the splines 24 may alternatively be any suitable geometry , run any suitable portion of the length of the guide tube 10 , and run at any suitable angle to the end of the guide tube 10 . the splines 24 may alternatively run circumferentially around the guide tube 10 or spiral around the guide tube 10 , such that there are multiple circular splines 24 , or a spring , stacked along the length of the guide tube . in this version , the flexible guide tube 10 may remain implanted , while the splines 24 are removed . the first electrical subsystem 12 of the preferred embodiments functions to interface with the tissue , or any other suitable substance , within which it has been implanted . the first electrical subsystem 12 may include multiple different electrical subsystems or a plurality of the same subsystems . as shown in fig8 , the first electrical subsystem 12 may include a plurality of electrical subsystems and the guide tube 10 may be adapted to guide multiple first electrical subsystems 12 . the first electrical subsystem 12 is preferably at least one of several versions or any combination thereof . in a first version , the first electrical subsystem 12 is a multi - banded cylindrical electrode with a linear arrangement of four equally spaced cylindrical electrodes , which can be used in monopolar or bipolar modes to deliver electrical stimulation to the surrounding tissue . the electrodes can deliver approximately spherical potential fields from separate locations along the cylindrical carrier . in a second version , as shown in fig1 and 8 , the first electrical subsystem 12 is a neural interface electrode array . the electrode array preferably has a plurality of electrode sites , and more preferably a plurality of electrode sites that is more than 4 . the neural interface electrode array is adapted to provide dynamic tunable electrical stimulation ranging from stimulation with macroscale specificity to microscale directional patterning . the electrode array is preferably adapted to optimally sample ( record ) and / or selectively activate ( stimulate ) neural populations . the plurality of electrode sites can be tuned for recording , stimulation , or any combination thereof . additionally , at least two electrode sites may be grouped to form a larger composite site that enables tuning the neural interface region for recording and / or stimulation . the neural interface electrode array is preferably made from a thin - film polymer substrate such that there is high density electrode sites at a first end of the array ( the distal end ) and bonding regions at a second end of the array ( the proximal end ). the polymer substrate is preferably parylene or some combination of parylene and inorganic dielectrics , but may alternatively be made out of any suitable material . the distal end of the array is preferably coupled to a carrier to provide structural support . the electrode array may further include fluidic channels providing the capability to deliver therapeutic drugs , drugs to inhibit biologic response to the implant , or any other suitable fluid . the first electrical subsystem 40 may be adapted for long term implantation as in the first two variations , or alternatively may be adapted for short - term intraoperative use as in the following third variation . in the third version , the first electrical subsystem 12 is a mapping electrode system , which is adapted to perform clinical deep brain electrophysiological mapping for use in neurosurgerical applications . more specifically , the mapping electrode system is preferably adapted to perform simultaneous multichannel neural recording from precisely known locations along the deep microelectrode track . the mapping electrode may further have extended functionality such as multichannel recording and / or stimulation or fluid delivery . although the first electrical subsystem 12 is preferably one of these several versions , the first electrical subsystem 12 may be any suitable element or combination of elements to perform the desired functions . the second electrical subsystem 14 of the preferred embodiments functions to operate with the first electrical subsystem 12 . the second electrical subsystem 14 may include multiple different electrical subsystems or a plurality of the same subsystems . additionally , the guide tube 10 may be adapted to be removable over multiple second electrical subsystems 14 . the second electrical subsystem is preferably at least one of several versions or any combination thereof . in a first version , as shown in fig3 , the second electrical subsystem 14 is a suitable electronic subsystem to operate with an implantable neural interface . the second electrical subsystem 14 may be a printed circuit board with or without on - board integrated circuits and / or on - chip circuitry for signal conditioning and / or stimulus generation , an application specific integrated circuit ( asic ), a multiplexer chip , a buffer amplifier , an electronics interface , an implantable pulse generator , an implantable rechargeable battery , integrated electronics for either real - time signal processing of the input ( recorded ) or output ( stimulation ) signals , integrated electronics for control of the fluidic components , any other suitable electrical subsystem , or any combination thereof . although the second electrical subsystem 14 is preferably one of these several subsystems , the second electrical subsystem 14 may be any suitable element or combination of elements to operate any suitable first electrical subsystem 12 . the system may further include a connector such as a cable 16 that functions to couple the first electrical subsystem 12 to the second electrical subsystem 14 . the cable 16 is preferably one of several versions . as shown in fig1 and 8 , the cable is preferably a flexible ribbon cable . the ribbon cable is preferably a polymer ribbon cable , but may alternatively be any other suitable ribbon cable . the cable 16 may alternatively be any suitable element to couple the first electrical subsystem 12 to the second electrical subsystem 14 , such as wires , conductive interconnects , etc . the ribbon cable may be encased in silicone or any other suitable material . in some situations , the electrical subsystem may have multiple ribbon cables . preferably , multiple ribbon cables would be physically attached along their entire length , using a suitable adhesive such as medical grade adhesive or any other suitable connection mechanism . the cable is preferably connected to the electrical subsystems through ball bonds , ball bond , or any other suitable connection mechanisms . the cable 16 may alternatively be seamlessly manufactured with the first and or second electrical subsystem . the cable 16 may further include fluidic channels adapted to deliver therapeutic drugs , drugs to inhibit biologic response to the implant , or any other suitable fluid . as shown in fig9 , a method of implanting an implant and its corresponding electrical components preferably includes any combination of the following steps ( or any other suitable steps ): attaching a cranial chamber to the scull ( preferably in a cranial burr - hole ) of a patient ; implanting , through the guide tube 10 , a first electrical subsystem 12 which is preferably a mapping electrode system ; removing , through the guide tube 10 , the mapping electrode system following microelectrode recording ; implanting , through the guide tube 10 , a first electrical subsystem 12 which is preferably a neural interface electrode array coupled via a cable 16 to a second electrical subsystem 14 ; although omitted for conciseness , the preferred embodiments include every combination and permutation of the various guide tubes 10 , the various expansion elements , the various electrical subsystems , the various cables , and the various methods of use . as a person skilled in the art will recognize from the previous detailed description and from the figures and claims , modifications and changes can be made to the preferred embodiments of the invention without departing from the scope of this invention defined in the following claim . | 0 |
according to the invention the pump contains an external tube 1 with a conductor fluid inlet 2 and outlet 3 supported by bearing blocks 4 . an internal pipe 5 is installed inside external pipe 1 and with the same axis ( see fig2 and 5 ). the internal pipe 5 is blanked off on the inlet side by a tapered shield 6 welded to ribs 7 , themselves welded to the external pipe 1 . on the outlet side the internal pipe is blanked off by a fusiform shield 8 containing an elongated axial section 9 , which can slip inside ribs 10 welded to the external pipe 1 . around the external pipe 1 two magnetic half - yokes are installed 11 , 11 &# 39 ; separated by joint plane v -- v &# 39 ;. the two half - yokes 11 , 11 &# 39 ; consist of longitudinal bundles of magnetic plates 12 containing slots 14 separated by v - shaped shims 13 . the two half - yokes 11 , 11 &# 39 ; are installed in two half - carcasses 15 , 15 &# 39 ; in the form of half - cores with extensions 16 , 16 &# 39 ; parallel to joint plane v -- v &# 39 ;. between the half - carcasses 15 and 15 &# 39 ; and the external pipe 1 insulating shims 17 are provided . the half - carcasses 15 and 15 &# 39 ; are rigidified by stiffening ribs 18 . half - coils 19 , 19 &# 39 ; terminating by involutes 20 , 20 &# 39 ; parallel to the joint plane are installed in slots 14 . the involutes 20 are used to connect the half - coils 19 on one side of the joint plane to produce a first half - winding 35 and involutes 20 &# 39 ; are used to connect the half - coils 19 &# 39 ; on the other side to form a second half - winding 35 &# 39 ;. involutes 20 , 20 &# 39 ; are wedged by insulating shims 21 inside extensions 16 , 16 &# 39 ; or the half - carcasses 15 , 15 &# 39 ;. to cool the half - coils 19 , 19 &# 39 ;, water is made to flow inside , the which is conveyed by an inlet drain 22 resp . 22 &# 39 ; and flows out through an outlet drain 23 resp . 23 &# 39 ;. a magnetic core 24 is installed inside the internal pipe 5 , contained between the wall of pipe 5 and four longitudinal walls 25 arranged in cylinder form with the same axis as pipe 5 . these walls 25 are welded to metal rings 26 with the same axis as pipe 5 . walls 25 are separated by separators 27 crossing the joint plane v -- v &# 39 ; and by separators 28 crossed by the plane perpendicular to the joint plane passing through the axis of pipes 1 , 5 . separators 27 have two concave side faces which extend outside pipe 5 via two longitudinal partitions 29 , 29 &# 39 ;. separators 28 contain two convex side faces . it is thus possible to stack , between the wall of internal pipe 5 and the four longitudinal walls 25 , finned longitudinal magnetic plates 30 , curved along a circle involute profile providing total and uniform filling so as to form magnetic core 24 . the longitudinal partitions 29 , 29 &# 39 ; of each of the separators 27 arrived in the vicinity of the wall of external pipe 1 and divide duct 31 located between internal pipe 5 and external pipe 1 into two active half - ducts 32 , 32 &# 39 ; and two passive streams 33 . the longitudinal partitions 29 , 29 &# 39 ; have practically the same spacing as involutes 20 located on either side of the joint plane . between the longitudinal partitions 29 and 29 &# 39 ; a certain number of transverse partitions 34 ( see fig5 ) have been installed which prevent any fluid circulating in the passive streams 33 . partitions 29 , 29 &# 39 ; and 34 are , for example , in stainless steel which is sodium - resistant . fig3 shows a connection diagram obtaining a polyphase half - winding , e 1 , e 2 , e 3 representing the low frequency , three - phase current inputs and s 1 , s 2 , s 3 the three - phase current outputs forming the neutral n . the right - hand parts located between the two longitudinal lines correspond to the half - coils 19 forming half - winding 35 . the half - coils are coupled together by involutes 20 . fig4 shows a cross - sectional view of an electromagnetic functional diagram . duct 31 is filled with liquid sodium . when the polyphase half - windings are supplied with current , they produce a flow through duct 31 closing by the magnetic core . as this flow is variable circular currents i are induced in the circumferential direction . partitions 29 are fairly thin and in any event are electricity conductors so that the lines of current can close by going around duct 31 . owing to the geometry of half - coils 19 , the radial magnetic induction b is only created in the active half - ducts 32 , 32 &# 39 ;. so that force f due to the reaction of the induction b on the currents i only originates in the active half - ducts 32 , 32 &# 39 ;. movement is imparted to the conductor fluid ( sodium ) by the force f and flows with no turbulence along longitudinal partitions 29 . per contra , in the passive streams , the fluid is not subject to the force f and the side partition 34 prevent the fluid flowing back . the active half - ducts have , for example , an angle of opening of 72 ° and 77 °, the passive streams have an additional angle of opening of 18 ° to 13 °. it must be observed that the arrangement of the magnetic plates in the magnetic core provides highly homogeneous distribution of the magnetic field through the two active half - ducts , whence correct distribution of the motive force resulting in a regular and turbulence - free flow of the fluid . finally the slight fluid leak between the two active half - ducts and the passive streams provides the initial filling of the passive streams with fluid then its renewal , preventing any excessive heating in this stream . the two half - carcasses can be fitted around the internal pipe after pipes 1 and 5 have been placed in position with duct 31 full of sodium . the two half - carcasses simply have to be assembled on the spot . to disassemble , separate the two half - carcasses and remove them , there being no need to drain the sodium inside duct 31 . | 7 |
the skein of this invention may be used in a liquid - liquid separation process of choice , and more generally , in various separation processes . the skein is specifically adapted for use in microfiltration processes used to remove large organic molecules , emulsified organic liquids and colloidal or suspended solids , usually from water . typical applications are ( i ) in a membrane bioreactor , to produce permeate as purified water and recycle biomass ; for ( ii ) tertiary filtration of wastewater to remove suspended solids and pathogenic bacteria ; ( iii ) clarification of aqueous streams including filtration of surface water to produce drinking water ( removal of colloids , long chain carboxylic acids and pathogens ); ( iv ) separation of a permeable liquid component in biotechnology broths ; ( v ) de - watering of metal hydroxide sludges ; and , ( vi ) filtration of oily wastewater , inter alia . the problem with using a conventional membrane module to selectively separate one fluid from another , particularly using the module in combination with a bioreactor , and the attendant costs of operating such a system , have been avoided . in those instances where an under - developed country or distressed community lacks the resources to provide membrane modules , the most preferred embodiment of this invention is adapted for use without any pumps . in those instances where a pump is conveniently used , a vacuum pump is unnecessary , adequate driving force being provided by a simple centrifugal pump incapable of inducing a vacuum of 75 cm hg on the suction side . the fibers used to form the skein may be formed of any conventional membrane material provided the fibers are flexible and have an average pore cross sectional diameter for microfilitration , namely in the range from about 1000 å to 10000 å . preferred fibers operate with a transmembrane pressure differential in the range from 7 kpa ( 1 psi )- 69 kpa ( 10 psi ) and are used under ambient pressure with the permeate withdrawn under gravity . the fibers are chosen with a view to perform their desired function , and the dimensions of the skein are determined by the geometry of the headers and length of the fibers . it is unnecessary to confine a skein in a modular shell , and a skein is not . preferred fibers are made of organic polymers and ceramics , whether isotropic , or anisotropic , with a thin layer or “ skin ” on the outside surface of the fibers . some fibers may be made from braided cotton covered with a porous natural rubber latex or a water - insoluble cellulosic polymeric material . preferred organic polymers for fibers are polysulfones , poly ( styrenes ), including styrene - containing copolymers such as acrylonitrile - styrene , butadiene - styrene and styrene - vinylbenzylhalide copolymers , polycarbonates , cellulosic polymers , polypropylene , poly ( vinyl chloride ), poly ( ethylene terephthalate ), and the like disclosed in u . s . pat . no . 4 , 230 , 463 the disclosure of which is incorporated by reference thereto as if fully set forth herein . preferred ceramic fibers are made from alumina , by e . i . dupont denemours co . and disclosed in u . s . pat . no . 4 , 069 , 157 . typically , there is no cross flow of substrate across the surface of the fibers in a “ dead end ” tank . if there is any flow of substrate through the skein in a dead end tank the flow is due to aeration provided beneath the skein , or to such mechanical mixing as may be employed to maintain the solids in suspension . there is more flow through the skein in a tank into which substrate is being continuously flowed , but the velocity of fluid across the fibers is generally too insignificant to deter growing microorganisms from attaching themselves , or suspended particles , e . g . microscopic siliceous particles , from being deposited on the surfaces of the fibers . for hollow fiber membranes , the outside diameter of a fiber is at least 20 μm and may be as large as about 3 mm , typically being in the range from about 0 . 1 mm to 2 mm . the larger the outside diameter the less desirable the ratio of surface area per unit volume of fiber . the wall thickness of a fiber is at least 5 μm and may be as much as 1 . 2 mm , typically being in the range from about 15 % to about 60 % of the outside diameter of the fiber , most preferably from 0 . 5 mm to 1 . 2 mm . as in a &# 39 ; 424 array , but unlike in a conventional module , the length of a fiber in a skein is essentially independent of the strength of the fiber , or its diameter , because the skein is buoyed both by bubbles and the substrate in which it is deployed . the length of fibers in the skein is preferably determined by the conditions under which the skein is to operate . typically fibers range from 1 m to about 5 m long , depending upon the dimensions of the body of substrate ( depth and width ) in which the skein is deployed . the fixing material to fix the fibers in a finished header is most preferably either a thermosetting or thermoplastic synthetic resinous material , optionally reinforced with glass fibers , boron or graphite fibers and the like . thermoplastic materials may be crystalline , such as polyolefins , polyamides ( nylon ), polycarbonates and the like , semi - crystalline such as polyetherether ketone ( peek ), or substantially amorphous , such as poly ( vinyl chloride ) ( pvc ), polyurethane and the like . thermosetting resins commonly include polyesters , polyacetals , polyethers , cast acrylates , thermosetting polyurethanes and epoxy resins . most preferred as a “ fixing ” material ( so termed because it fixes the locations of the fibers relative to each other ) is one which when cured is substantially rigid in a thickness of about 2 cm , and referred to generically as a “ plastic ” because of its hardness . such a plastic has a hardness in the range from about shore d 50 to rockwell r 110 and is selected from the group consisting of epoxy resins , phenolics , acrylics , polycarbonate , nylon , polystyrene , polypropylene and ultra - high molecular weight polyethylene ( uhmw pe ). polyurethane such as is commercially available under the brand names adiprene ® from uniroyal chemical company and airthane ® from air products , and commercially available epoxy resins such as epon 828 are excellent fixing materials . the number of fibers in an array is arbitrary , typically being in the range from about 1000 to about 10000 for commercial applications , and the preferred surface area for a skein is in the range from 10 m 2 to 100 m 2 . the particular method of securing the fibers in each of the headers is not narrowly critical , the choice depending upon the materials of the header and the fiber , and the cost of using a method other than potting . however , it is essential that each of the fibers be secured in fluid - tight relationship within each header to avoid contamination of permeate . this is effected by potting the fibers essentially vertically , in closely - spaced relationship , either linearly in plural equally spaced apart rows across the face of a header in the x - y plane ; or alternatively , randomly , in non - linear plural rows . in the latter , the fibers are displaced relative to one another in the lateral direction . [ 0076 ] fig1 presents the results of a comparison of three runs made , one using the teachings of yamamoto in his &# 39 ; 89 publication ( curve 2 ), but using an aerator which introduced air from the side and directed it radially inwards , as is shown in chiemchaisri et al . a second run ( curve 1 ) uses the gas - scrubbed assembly of the &# 39 ; 424 patent , and the third run ( curve 3 ) uses the gas - scrubbed skein of this invention . the specific flux obtained with an assembly of an inverted parabolic array with an air distributor means ( yarnamoto et al ), as disclosed in wat . sci . tech . vol . 21 , brighton pp 43 - 54 , 1989 , and , the parabolic array by cote et al in the &# 39 ; 424 patent , are compared to the specific flux obtained with the vertical skein of this invention . the comparison is for the three assemblies having fibers with nominal pore size 0 . 2 μm with essentially identical bores and surface area in 80 l tanks filled with the same activated sludge substrate . the differences between the stated experiment of yamamoto et al , and that of the &# 39 ; 424 patent are of record in the &# 39 ; 424 patent , and the conditions of the comparison are incorporated by reference thereto as if fully set forth herein . the vertical skein used herein differs from the &# 39 ; 424 skein only in the vertical configuration of the 280 fibers each of which was about 1 % longer than the distance between the spaced apart headers during operation . the flow rate of air for the vertical skein is 1 . 4 m 3 / hr / m 2 using a coarse bubble diffuser . it will be evident from fig1 in which the specific flux , liters / meter 2 hr / kpa ( conventionally written as ( lmh / kpa ), is plotted as a function of operating time for the three assemblies , that the curve , identified as reference numeral 3 for the flux for the vertical skein , provides about the same specific flux as the parabolic skein , identified as reference numeral 1 . as can be seen , each specific flux reaches an equilibrium condition within less than 50 hr , but after about 250 hr , it is seen that the specific flux for the inverted parabolic array keeps declining but the other two assemblies reach an equilibrium . referring to fig2 there is illustrated , in exploded view a portion of a membrane device referred to as a “ vertical skein ” 10 , comprising a lower header 11 of a pair of headers , the other upper header ( not shown ) being substantially identical ; a collection pan 20 to collect the permeate ; and , a permeate withdrawal conduit 30 . the header shown is a rectangular prism since this is the most convenient shape to make , if one is going to pot fibers 12 in a potting resin such as a polyurethane or an epoxy . though the fibers 12 are not shown as close together as they would normally be , it is essential that the fibers are not in contact with each other but that they be spaced apart by the cured resin between them . as illustrated , the open ends of the terminal portion 12 ′ of the fibers are in the same plane as the lower face of the header 11 because the fibers are conventionally potted and the header sectioned to expose the open ends . a specific potting procedure in which the trough of a u - shaped bundle of fibers is potted , results in forming two headers . this procedure is described in the &# 39 ; 424 patent ( col 17 , lines 44 - 61 ); however , even cutting the potted fibers with a thin , high - speed diamond blade , tends to damage the fibers and initiate the collapse of the circumferential wall . in another conventional method of potting fibers , described in u . s . pat . no . 5 , 202 , 023 , bundled fibers have their ends dipped in resin or paint to prevent potting resin penetration into the bores of the fibers during the potting process . the ends of the bundle are then placed in molds and uncured resin added to saturate the ends of the fiber bundle and fill the spaces between the individual fibers in the bundle and the flexible tubing in which the bundle is held . the cured molded ends are removed from the molds and the molded ends cut off ( see , bridging cols 11 and 12 ). in each art method , sectioning the mold damages the embedded fibers . therefore a novel method is used to form a header 11 in the form of a rectangular prism . the method requires forming a composite header with two liquids . a first liquid fugitive material , when solidified ( cured ), forms a “ fugitive lamina ” of the composite header ; a second liquid of non - fugitive fixing material forms a “ fixing lamina ”. by a “ fugitive material ” we refer to a material which is either ( i ) soluble in a medium in which the fibers and fixing material are not soluble , or ( ii ) fluidizable by virtue of having a melting point ( if the material is crystalline ) below that which might damage the fibers or fixing material ; or , the material has a glass transition temperature tg ( if the material is non - crystalline ), below that which might damage the fibers or material ( s ) forming the non - fugitive header ; or ( iii ) both soluble and fluidizable . the first liquid is poured around terminal portions of fibers , allowed to cool and solidify into a fugitive lamina ; the fibers in the fugitive lamina are then again potted , this time by pouring the second liquid over the solid fugitive lamina . in greater detail , the method for forming a finished header for skein fibers comprises , forming a stack of at least two superimposed essentially coplanar and similar arrays , each array comprising a chosen number of fibers supported on a support means having a thickness corresponding to a desired lateral spacing between adjacent arrays ; holding the stack in a first liquid with terminal portions of the fibers submerged , until the liquid solidifies into a first shaped lamina , provided that the first liquid is unreactive with material of the fibers ; pouring a second liquid over the first shaped lamina to embed the fibers to a desired depth , and solidifying the second liquid to form a fixing lamina upon the first shaped lamina , the second liquid also being substantially unreactive with either the material of the fibers or that of the first shaped lamina ; whereby a composite header is formed in which terminal portions of the fibers are potted , preferably in a geometrically regular pattern , the composite header comprising a laminate of a fugitive lamina of fugitive material and a contiguous finished header of fixing lamina ; and thereafter , removing the first shaped lamina without removing a portion of the fixing lamina so as to leave the ends of the fibers open and protruding from the aft face of the header , the open ends having circular cross - section . the step - wise procedure for forming an array “ a ” with the novel header is described with respect to an array illustrated in fig3 as follows : a desired number of fibers 12 are each cut to about the same length with a sharp blade so as to leave both opposed ends of each fiber with an essentially circular cross - section . the fibers are coplanarly disposed side - by - side in a linear array on a planar support means such as strips or cards 15 and 16 . preferably the strips are coated with an adhesive , e . g . a commercially available polyethylene hot - melt adhesive , so that the fibers are glued to the strips and opposed terminal portions 12 ″ respectively of the fibers , extend beyond the strips . intermediate portions 12 ′ of the fibers are thus secured on the strips . alternatively , the strips may be grooved with parallel spaced - apart grooves which snugly accommodate the fibers . the strips may be flexible or rigid . if flexible , strips with fibers adhered thereto , are in turn , also adhered to each other successively so as to form a progressively stiffer stack for a header having a desired geometry of potted fibers . to avoid gluing the strips , a regular pattern of linear rows may be obtained by securing multiple arrays on rigid strips in a stack , with rubber bands 18 or other clamping means . the terminal portions 12 ″ are thus held in spaced - apart relationship , with the center to center distance of adjacent fibers preferably in the range from 1 . 2 ( 1 . 2 d ) to about 5 times ( 5 d ) the outside diameter ‘ d ’ of a fiber . spacing the fibers further apart wastes space and spacing them closer increases the risk of fiber - to - fiber contact near the terminal end portions when the ends are potted . preferred center - to - center spacing is from about 1 . 5 d to 2 d . the thickness of a strip and / or adhesive is sufficient to ensure that the fibers are kept spaced apart . preferably , the thickness is about the same as , or relatively smaller than the outside diameter of a fiber , preferably from about 0 . 5 d to 1 d thick , which becomes the spacing between adjacent outside surfaces of fibers in successive linear arrays . having formed a first array , a second array ( not shown because it would appear essentially identical to the first ) is prepared in a manner analogous to the first , strip 15 of the second array is overlaid upon the intermediate portions 12 ′ on strip 15 of the first array , the strip 15 of the second array resting on the upper surfaces of the fibers secured in strip 15 of the first array . similarly , strip 16 of the second array is overlaid upon the intermediate portions 12 ′ on strip 16 of the first array . a third array ( essentially identical to the first and second ) is prepared in a manner analogous to the first , and then overlaid upon the second , with the strips of the third array resting on the upper surfaces of the fibers of the second array . additional arrays are overlaid until the desired number of arrays are stacked in rows forming a stack of arrays with the adhesive - coated strips forming the spacing means between successive rows of fibers . the stack of arrays on strips is then held vertically to present the lower portion of the stack to be potted first . referring to fig4 there is schematically illustrated a rectangular potting pan 17 the length and width dimensions of which correspond substantially to the longitudinal ( x - axis ) and transverse ( y - axis ) dimensions respectively , of the desired header . the lower stack is submerged in a first liquid which rises to a level indicated by l 1 , in the pan 17 . most preferred is a liquid wax , preferably a water - soluble wax having a melting point lower than 75 ° c ., such as a polyethylene glycol ( peg ) wax . the depth to which the first liquid is poured will depend upon whether the strips 15 are to be removed from , or left in the finished header . a . first illustrated is the potting of skein fibers in upper and lower headers from which the strips will be removed . ( 1 ) a first shaped lamina having a thickness l 1 ( corresponding to the depth to which the first liquid was poured ) is formed to provide a fugitive lamina from about 5 - 10 cm thick . the depth of the first liquid is sufficient to ensure that both the intermediate portions 12 ′ on the strips and terminal portions 12 ″ will be held spaced apart when the first liquid solidifies and plugs all the fibers . ( 2 ) the second liquid , a curable , water - insoluble liquid potting resin , or reactive components thereof , is poured over the surface of the fugitive lamina to surround the fibers , until the second liquid rises to a level l 2 . it is solidified to form the fixing lamina ( which will be the finished header ) having a thickness measured from the level l 1 to the level l 2 ( the thickness is written “ l 1 - l 2 ”). the thickness l 1 - l 2 of the fixing lamina , typically from about 1 cm to about 5 cm , is sufficient to maintain the relative positions of the vertical fibers . a first composite header is thus formed having the combined thicknesses of the fugitive and fixing laminae . ( 3 ) in a manner analogous to that described immediately hereinabove , a stack is potted in a second composite header . ( 4 ) the composite headers are demolded from their potting pans and hot air blown over them to melt the fugitive lanminae , leaving only the finished headers , each having a thickness l 1 - l 2 . the fugitive material such as the peg wax , is then reused . alternatively , a water - soluble fugitive material may be placed in hot water to dissolve the wax , and the material recovered from its water solution . ( 5 ) the adhered strips and terminal portions of the fibers which were embedded within the fugitive lamina are left protruding from the permeate - discharging aft faces of the headers with the ends of the fibers being not only open , but essentially circular in cross section . the fibers may now be cut above the strips to discard them and the terminal portions of the fibers adhered to them , yet maintaining the circular open ends . the packing density of fibers , that is , the number of fibers per unit area of header preferably ranges from 4 to 50 fibers / cm 2 depending upon the diameters of the fibers . b . illustrated second is the potting of skein fibers in upper and lower headers from which the strips will not be removed , to avoid the step of cutting the fibers . ( 1 ) the first liquid is poured to a level l 1 ′ below the cards , to a depth in the range from about 1 - 2 . 5 cm , and solidified , foriming fugitive lamina l 1 ′. ( 2 ) the second liquid is then poured over the fugitive lamina to depth l 2 and solidified , forming a composite header with a fixing lamina having a thickness l 1 ′- l 2 . ( 3 ) the composite header is demolded and the fugitive lamina removed , leaving the terminal portions 12 ″ protruding from the aft face of the finished header , which aft face is formed at what had been the level l 1 ′. the finished header having a thickness l 1 ′- l 2 embeds the strips 15 ( along with the rubber bands 18 , if used ). c . illustrated third is the potting of skein fibers to form a finished headers with a cushioning lamina embedding the fibers on the opposed ( fore ) faces of the headers from which the strips will be removed . the restricted swayability of the fibers generates some intermittent ‘ snapping ’ motion of the fibers . this motion has been found to break the potted fibers around their circumferences , at the interface of the fore face and substrate . the hardness of the fixing material which forms a “ fixing lamina ” was found to initiate excessive shearing forces at the circumference of the fiber . the deleterious effects of such forces is minimized by providing a cushioning lamina of material softer than the fixing lamina . such a cushioning lamina is formed integrally with the fixing lamina , by pouring cushioning liquid ( so termed for its function when cured ) over the fixing lamina to a depth l 3 as shown in fig4 which depth is sufficient to provide enough ‘ give ’ around the circumferences of the fibers to minimize the risk of shearing . such cushioning liquid , when cured is rubbery , having a hardness in the range from about shore a 30 to shore d 45 , and is preferably a polyurethane or silicone or other rubbery material which will adhere to the fixing lamina . upon removal of the fugitive lamina , the finished header thus formed has the combined thicknesses of the fixing lamina and the cushioning lamina , namely l 1 - l 3 when the strips 15 are cut away d . illustrated fourth is the formation a finished header with a gasketing lamina embedding the fibers on the header &# 39 ; s aft face , and a cushioning lamina embedding the fibers on the header &# 39 ; s fore face ; the strips are to be removed . whichever finished header is made , it is preferably fitted into a permeate pan 20 as illustrated in fig2 with a peripheral gasket . it has been found that it is easier to seal the pan against a gasketing lamina , than against a peripheral narrow gasket . a relatively soft gasketing material having a hardness in the range from shore a 40 to shore d 45 , is desirable to form a gasketing lamina integrally with the aft face of the finished header . in the embodiment in which the strips are cut away , the fugitive lamina is formed as before , and a gasketing liquid ( so termed because it forms the gasket when cured ) is poured over the surface of the fugitive lamina to a depth l 4 . the gasketing liquid is then cured . upon removal of the fugitive lamina , when the strips 15 are cut away , the finished header thus formed has the combined thicknesses of the gasketing lamina ( l 1 - l 4 ), the fixing lamina ( l 4 - l 2 ) and the cushioning lamina ( l 2 - l 3 ), namely an overall l 1 - l 3 . in another embodiment , to avoid securing the pan to the header with a gasketing means , and , to avoid positioning one or more gas - distribution manifolds in an optimum location near the base of the skein fibers after a skein is made , the manifolds are formed integrally with a header . referring to fig5 there is illustrated in perspective view an “ integral single skein ” referred to generally by reference numeral 100 . the integral single skein is so termed because it includes an integral finished header 101 and permeate pan 102 . the pan 102 is provided with a permeate withdrawal nipple 106 , and fitted with vertical air - tubes 103 which are to be embedded in the finished header . the air - tubes are preferably manifolded on either side of the skein fibers , to feeder air - tubes 104 and 105 which are snugly inserted through grommets in the walls of the pan . the permeate nipple 106 is then plugged , and a stack of arrays is held vertically in the pan in which a fugitive lamina is formed embedding both the ends of the fibers and the lower portion of the vertical air - tubes 103 . a fixing lamina is then formed over the fugitive lamina , embedding the fibers to form a fixing lamina through which protrude the open ends of the air - tubes 103 . the fugitive lamina is then melted and withdrawn through the nipple 106 . in operation , permeate collects in the permeate pan and is withdrawn through nipple 106 . [ 0111 ] fig6 illustrates a cross - section of an integral single skein 110 with another integral finished header 101 having a thickness l 1 - l 2 , but without a cushioning lamina , formed in a procedure similar to that described hereinabove . a permeate pan 120 with outwardly flared sides 120 ′ and transversely spaced - apart through - apertures therein , is prefabricated between side walls 111 and 112 so the pan is spaced above the bottom of the reservoir . a pair of air - manifolds 107 such as shown in fig7 a or 7 b , is positioned and held in mirror - image relationship with each other adjacent the permeate pan 120 , with the vertical air - tubes 103 protruding through the apertures in sides 120 ′, and the ends 104 and 105 protrude from through - passages in the vertical walls on either side of the permeate pan . permeate withdrawal nipple 106 ( fig6 ) is first temporarily plugged . the stack of strips 15 is positioned between air - tubes 103 , vertically in the pan 120 which is filled to level l 1 to form a fugitive lamina , the level being just beneath the lower edges of the strips 15 which will not be removed . when solidified , the fugitive lamina embeds the terminal portions of the fibers 12 and also fills permeate tube 106 . then the second liquid is poured over the upper surface of the fugitive lamina until the liquid covers the strips 15 but leaves the upper ends of the air - tubes 103 open . the second liquid is then cured to form the fixing lamina of the composite header which is then heated to remove the fugitive material through the permeate nozzle 106 after it is unplugged . [ 0113 ] fig7 a schematically shows in perspective view , an air - manifold 107 having vertical air - tubes 103 rising from a transverse header - tube which has longitudinally projecting feeder air - tubes 104 and 105 . the bore of the air - tubes which may be either “ fine bubble diffusers ”, or “ coarse bubble diffusers ”, or “ aerators ”, is chosen to provide bubbles of the desired diameter under operating conditions , the bore typically being in the range from 0 . 1 mm to 5 mm . bubbles of smaller diameter are preferably provided with a perforated transverse tube 103 ′ of an air - manifold 107 ′ having feeder air - tubes 104 ′ and 105 ′, illustrated in fig7 b . in each case , the bubbles function as a mechanical brush . the skein fibers for the upper header of the skein are potted in a manner analogous to that described above in a similar permeate pan to form a finished header , except that no air manifolds are inserted . referring to fig8 there is schematically illustrated , in a cross - sectional perspective view , an embodiment in which a bank of two skeins is potted in a single integral finished header enclosure , referred to generally by reference numeral 120 b . the term “ header enclosure ” is used because its side walls 121 and 122 , and end walls ( not shown ) enclose a plenum in which air is introduced . instead of a permeate pan , permeate is collected from a permeate manifold which serves both skeins . another similar upper enclosure 120 u ( not shown ), except that it is a flat - bottomed channel - shaped pan ( inverted for use as the upper header ) with no air - tubes molded in it , has the opposed terminal portions of all the skein fibers potted in the pan . for operation , both the lower and upper enclosures 120 b and 120 u , with their skein fibers are lowered into a reservoir of the substrate to be filtered . the side walls 121 and 122 need not rest on the bottom of the reservoir , but may be mounted on a side wall of the reservoir . the side walls 121 and 122 and end walls are part of an integrally molded assembly having a platform 123 connecting the walls , and there are aligned multiple risers 124 molded into the platform . the risers resemble an inverted test - tube , the diameter of which need only be large enough to have an air - tube 127 inserted through the top 125 of the inverted test - tube . as illustrated , it is preferred to have “ n + 1 ” rows of air - tubes for “ n ” stacks of arrays to be potted . crenelated platform 123 includes risers 124 between which lie channels 128 and 129 . channels 128 and 129 are each wide enough to accept a stack of arrays of fibers 12 , and the risers are wide enough to have air - tubes 127 of sufficient length inserted therethrough so that the upper open ends 133 of the air - tubes protrude from the upper surface of the fixing material 101 . the lower ends 134 of the air - tubes are sectioned at an angle to minimize plugging , and positioned above the surface s of the substrate . the channel 129 is formed so as to provide a permeate withdrawal tube 126 integrally formed with the platform 123 . side wall 122 is provided with an air - nipple 130 through which air is introduced into the plenum formed by the walls of the enclosure 120 b , and the surface s of substrate under the platform 123 . each stack is potted as described in relation to fig6 above , most preferably by forming a composite header of fugitive peg wax and epoxy resin around the stacks of arrays positioned between the rows of risers 124 , making sure the open ends of the air - tubes are above the epoxy fixing material , and melting out the wax through the permeate withdrawal tube 126 . when air is introduced into the enclosure the air will be distributed through the air - tubes between and around the skeins . referring to fig9 there is shown a schematic illustration of a skein having upper and lower headers 41 u and 41 b respectively , and in each , the protruding upper and lower ends 12 u ″ and 12 b ″ are evidence that the face of the header was not cut to expose the fibers . the height of the contiguous intermediate portions 12 u ′ and 12 b ′ respectively , corresponds to the cured depth of the fixing material . it will now be evident that the essential feature of the foregoing potting method is that a fugitive lamina is formed which embeds the openings of the terminal portions of the fibers before their contiguous intermediate portions 12 u ′ and 12 u ″ and 12 b ′ and 12 b ″ respectively are fixed in a fixing lamina of the header . an alternative choice of materials is the use of a fugitive potting compound which is soluble in a nonaqueous liquid in which the fixing material is not soluble . still another choice is to use a water - insoluble fugitive material which is also insoluble in non - aqueous liquids typically used as solvents , but which fugitive material has a lower melting point than the final potting material which may or may not be water - soluble . the fugitive material is inert relative to both , the material of the fibers as well as the final potting material to be cast , and the fugitive material and fixing material are mutually insoluble . preferably the fugitive material forms a substantially smooth - surfaced solid , but it is critical that the fugitive material be at least partially cured , sufficiently to maintain the shape of the header , and remain a solid above a temperature at which the fixing material is introduced into the header mold . the fugitive lamina is essentially inert and insoluble in the final potting material , so that the fugitive lamina is removably adhered to the fixing lamina . the demolded header is either heated or solvent extracted to remove the fugitive lamina . typically , the fixing material is cured to a firm solid mass at a first curing temperature no higher than the melting point or tg of the fugitive lamina , and preferably at a temperature lower than about 60 ° c . ; the fin solid is then post - cured at a temperature high enough to melt the fugitive material but not high enough to adversely affect the curing of the fixing material or the properties of the fibers . the fugitive material is removed as described hereinafter , the method of removal depending upon the fugitive material and the curing temperature of the final potting material used . since , during operation , a high flux is normally maintained if cleansing air contacts substantially all the fibers , it will be evident that when it is desirable to have a skein having a cross - section which is other than generally rectangular , for example elliptical or circular , or having a geometrically irregular periphery , and it is desired to have a large number of skein fibers , it will be evident that the procedure for stacking consecutive peripheral arrays described above will be modified . further , the transverse central air - tube 52 ( see fig9 ) is found to be less effective in skeins of non - rectangular cross - section than a vertical air - tube which discharges air radially along its vertical length and which vertical air - tube concurrently serves as the spacing means . such skeins with a generally circular or elliptical cross - section with vertical air - tubes are less preferred to form a bank , but provide a more efficient use of available space in a reservoir than a rectangular skein . referring further to fig2 the header 11 has front and rear walls defined by vertical ( z - axis ) edges 11 ′ and longitudinal ( x - axis ) edges 13 ′; side walls defined by edges 11 ′ and transverse ( y - axis ) edges 13 ″; and a base 13 defined by edges 13 ′ and 13 ″. the collection pan 20 is sized to snugly accommodate the base 13 above a permeate collection zone within the pan . this is conveniently done by forming a rectangular pan having a base 23 of substantially the same length and width dimensions as the base 13 . the periphery of the pan 20 is provided with a peripheral step as shown in fig2 a , in which the wall 20 ′ of the pan terminates in a step section 22 , having a substantially horizontal shoulder 22 ″ and a vertical retaining wall 22 ′. [ 0124 ] fig2 b is a bottom plan view of the lower face of header 13 showing the open ends of the fibers 12 ′ prevented from touching each other by potting resin . the geometrical distribution of fibers provides a regular peripheral boundary 14 ( shown in dotted outline ) which bounds the peripheries of the open ends of the outermost fibers . permeate flows from the open ends of the fibers onto the base 23 of the pan 20 , and flows out of the collection zone through a permeate withdrawal conduit 30 which may be placed in the bottom of the pan in open flow communication with the inner portion of the pan . when the skein is backwashed , backwashing fluid flows through the fibers and into the substrate . if desired , the withdrawal conduit may be positioned in the side of the pan as illustrated by conduit 30 ′. whether operating under gravity alone , or with a pump to provide additional suction , it will be apparent that a fluid - tight seal is necessary between the periphery of the header 11 and the peripheral step 22 of the pan 20 . such a seal is obtained by using any conventional means such as a suitable sealing gasket or sealing compound , typically a polyurethane or silicone resin , between the lower periphery of the header 11 and the step 22 . as illustrated in fig2 permeate drains downward , but it could also be withdrawn from upper permeate port 45 u in the upper permeate pan 43 u ( see fig9 ). it will now be evident that a header with a circular periphery may be constructed , if desired . headers with geometries having still other peripheries ( for example , an ellipse ) may be constructed in an analogous manner , if desired , but rectangular headers are most preferred for ease of construction with multiple linear arrays . referring to fig9 and 2a , six rows of fibers 12 are shown on either side of a gas distribution line 52 which traverses the length of the rows along the base of the fibers . the potted terminal end portions 12 b ″ open into permeate pan 43 b . because portions 12 u ′ and 12 b ′ of individual fibers 12 are potted , and the fibers 12 are preferably from 1 % to 2 % longer than the fixed distance between upper and lower headers 41 u and 41 b , the fibers between opposed headers are generally parallel to one another , but are particularly parallel near each header . also held parallel are the terminal end portions 12 u ″ and 12 b ″ of the fibers which protrude from the headers with their open ends exposed . the fibers protrude below the lower face of the bottom header 41 b , and above the upper face of the upper header 41 u . the choice of fiber spacing in the header will determine packing density of the fibers near the headers , but fiber spacing is not a substantial consideration because spacing does not substantially affect specific flux during operation . it will be evident however , that the more fibers , the more tightly packed they will be , giving more surface area . since the length of fibers tends to change while in service , the extent of the change depending upon the particular composition of the fibers , and the spacing between the upper and lower headers is critical , it is desirable to mount the headers so that one is adjustable in the vertical direction relative to the other , as indicated by the arrow v . this is conveniently done by attaching the pan 43 u to a plate 19 having vertically spaced apart through - passages 34 through which a threaded stud 35 is inserted and secured with a nut 36 . threaded stud 35 is in a fixed mounting block 37 . the density of fibers in a header is preferably chosen to provide the maximum membrane surface area per unit volume of substrate without adversely affecting the circulation of substrate through the skein . a gas - distribution means 52 such as a perforated air - tube , provides air within the skein so that bubbles of gas ( air ) rise upwards while clinging to the outer surfaces of the fibers , thus efficiently scrubbing them . if desired , additional air - tubes 52 ′ may be placed on either side of the skein near the lower header 41 b , as illustrated in phantom outline , to provide additional air - scrubbing power . whether the permeate is withdrawn from the upper header through port 45 u or the lower header through port 45 b , or both , depends upon the particular application , but in all instances , the fibers have a substantially vertical orientation . the vertical skein is deployed in a substrate to present a generally vertical profile , but has no structural shape . such shape as it does have changes continuously , the degree of change depending upon the flexibility of the fibers , their lengths , the overall dimensions of the skein , and the degree of movement imparted to the fibers by the substrate and also by the oxygen - containing gas from the gas - distribution means . referring to fig1 there is illustrated a typical assembly referred to as a “ wall - mounted bank ” which includes at least two side - by - side skeins , indicated generally by reference numerals 40 and 40 ′ with their fibers 42 and 42 ′; fibers 42 are potted in upper and lower headers 41 u and 41 b respectively ; and fibers 42 ′ in headers 41 u ′ and 41 b ′; headers 41 u and 41 b are fitted with permeate collecting means 46 u and 46 b respectively ; headers 41 u ′ and 41 b ′ are fitted with permeate collecting means 46 u ′ and 46 b ′ respectively ; and , the skeins share a common gas - distribution means 50 . a “ bank ” of skeins is typically used to retrofit a large , deep tank from which permeate is to be withdrawn using a vacuum pump . in a large reservoir , several banks of skeins may be used in side - by - side relationship within a tank . each skein includes multiple rows ( only one row is shown ) of fibers 42 and 42 ′ in upper headers 41 u and 41 u ′, and lower headers 41 b and 41 b ′ respectively , and arms 51 and 51 ′ of gas - distribution means 50 are disposed between the lower headers 41 b and 41 b ′, near their bases . the upper headers 44 u and 44 u ′ are mounted by one of their ends to a vertical interior surface of the wall w of a tank , with mounting brackets 53 and 53 ′ and suitable fastening means such as bolts 54 . the wall w thus functions as a spacer means which fixes the distance between the upper and lower headers . each upper header is provided with a permeate collection pan 43 u and 43 u ′, respectively , connected to permeate withdrawal conduits 45 u and 45 u ′ and manifolded to permeate manifold 46 u through which permeate being filtered into the collection pans is continuously withdrawn . each header is sealingly bonded around its periphery , to the periphery of each collection pan . the skein fibers ( only one array of which is shown for clarity ) shown in this perspective view have an elongated rectangular parallelpiped shape the sides of which are irregularly shaped when immersed in a substrate , because of the random side - to - side displacement of fibers as they sway . an elongated rectangular parallelpiped shape is preferred since it permits a dense packing of fibers , yet results in excellent scrubbing of the surfaces of the fibers with bubbles . with this shape , a skein may be formed with from 10 to 50 arrays of fibers across the longitudinal width ‘ w ’ of the headers 41 u , 41 b , and 41 u ′, 41 b ′ with each array having fibers extending along the transverse length ‘ l ’ of each header . air - tubes on either side of a skein effectively cleanse the fibers if there are less than about 30 arrays between the air - tubes . a skein having more than 30 arrays is preferably also centrally aerated as illustrated by the air - tube 52 in fig9 . thus , if there are about 100 fibers closely spaced - apart along the transverse length ‘ l ’ of an array , and there are 25 arrays in a skein in a header of longitudinal width ‘ w ’, then the opposed terminal end portions of 2500 fibers are potted in headers 41 u and 41 b . the open ends of all fibers in headers 41 b and 41 b ′ point downwards into collection zones in collection pans 43 b and 43 b ′ respectively , and those of all fibers in headers 41 u and 41 u ′ point upwards into collection zones in collection pans 43 u and 43 u ′ respectively . withdrawal conduits 45 u and 45 u ′ are manifolded to permeate manifold 46 u through which permeate collecting in the upper collection pans 43 u and 43 u ′ is typically continuously withdrawn . if the permeate flow is high enough , it may also be withdrawn from the collection pans 43 b and 43 b ′ through withdrawal conduits 45 b and 45 b ′ which are manifolded to permeate manifold 46 b . when permeate is withdrawn in the same plane as the permeate withdrawal conduits 45 u , 45 u ′ and manifold 46 u , and the transmembrane pressure differential of the fibers is in the range from 35 - 75 kpa ( 5 - 10 psi ), manifold 46 u may be connected to the suction side of a centrifugal pump which will provide adequate npsh . in general , the permeate is withdrawn from both the upper and lower headers , until the flux declines to so low a level as to require that the fibers be backwashed . the skeins may be backwashed by introducing a backwashing fluid through the upper permeate collection manifold 46 u , and removing the fluid through the lower manifold 46 b . typically , from 3 to 30 skeins may be coupled together for internal fluid communication with one and another through the headers , permeate withdrawal means and the fibers ; and , for external fluid communication with one another through an air manifold . since the permeate withdrawal means is also used for backflushing it is generally referred to as a ‘ liquid circulation means ’, and as a permeate withdrawal means only when it is used to withdraw permeate . when deployed in a substrate containing suspended and dissolved organic and inorganic matter , most fibers of organic polymers remain buoyant in a vertical position . the fibers in the skein are floatingly buoyed in the substrate with the ends of the fibers anchored in the headers . this is because ( i ) the permeate is essentially pure water which has a specific gravity less than that of the substrate , and most polymers from which the fibers are formed also have a specific gravity less than 1 , and , ( ii ) the fibers are buoyed by bubbles which contact them . fibers made from ceramic , or , glass fibers are heavier than water . adjacent the skeins , an air - distribution manifold 50 is disposed below the base of the bundle of fibers , preferably below the horizontal plane through the horizontal center - lines of the headers . the manifold 50 is preferably split into two foraminous arms 51 and 51 ′ adjacent the bases of headers 41 b and 41 b ′ respectively , so that when air is discharged through holes in each portion 51 and 51 ′, columns of bubbles rise adjacent the ends of the fibers and thereafter flow along the fibers through the skeins . if desired , additional portions ( not shown ) may be used adjacent the bases of the lower headers but located on the outside of each , so as to provide additional columns of air along the outer surfaces of the fibers . the type of gas ( air ) manifold is not narrowly critical provided it delivers bubbles in a preferred size range from about 1 mm to 25 mm , measured within a distance of from 1 cm to 50 cm from the through - passages generating them . if desired , each portion 51 and 51 ′ may be embedded in the upper surface of each header , and the fibers potted around them , making sure the air - passages in the portions 51 and 51 ′ are not plugged with potting compound . if desired , additional arms of air - tubes may be disposed on each side of each lower header , so that fibers from each header are scrubbed by columns of air rising from either transverse side . the air may be provided continuously or intermittently , better results generally being obtained with continuous air flow . the amount of air provided depends upon the type of substrate , the requirements of the type of microorganisms , if any , and the susceptibility of the surfaces of the fibers to be plugged , there always being &# 39 ; sufficient air to produce desired growth of the microorganisms when operated in a substrate where maintaining such growth is essential . referring to fig1 , there is schematically illustrated another embodiment of an assembly , referred to as a “ stand - alone bank ” of skeins , two of which are referenced by numeral 60 . the bank is referred to as being a “ stand - alone ” because the spacer means between headers is supplied with the skeins , usually because mounting the skeins against the wall of a reservoir is less effective than placing the bank in spaced - apart relationship from a wall . in other respects , the bank 60 is analogous to the wall - mounted bank illustrated in fig1 . each bank 60 with fibers 62 ( only a single row of the multiple , regularly spaced apart generally vertical arrays is shown for the sake of clarity ) is deployed between upper and lower headers 61 u and 61 b in a substrate ‘ s ’. the lower headers rest on the floor of the reservoir . the upper headers are secured to rigid vertical air tubes 71 and 71 ′ through which air is introduced into a tubular air manifold identified generally by reference numeral 70 . the manifold 70 includes ( i ) the vertical tubular arms 71 and 71 ′; ( ii ) a lower transverse arm 72 which is perforated along the length of the lower header 61 b ′ and secured thereto ; the arm 72 communicates with longitudinal tubular arm 73 , and optionally another longitudinal arm 73 ′ ( not shown ) in mirror - image relationship with arm 73 on the far side of the headers ; and ( iii ) transverse arms 74 and 74 ′ in open communication with 72 and 73 ; arms 74 and 74 ′ are perforated along the visible transverse faces of the headers 61 b an 61 b ′, and 74 and 74 ′ may communicate with tubular arm 73 ′ if it is provided . the vertical air - tubes 71 and 71 ′ conveniently provide the additional function of a spacer means between the first upper header and the first lower header , and because the remaining headers in the bank are also similarly ( not shown ) interconnected by rigid conduits , the headers are maintained in vertically and transversely spaced - apart relationship . since all arms of the air manifold are in open communication with the air supply , it is evident that uniform distribution of air is facilitated . as before , headers 61 u and 61 u ′ are each secured in fluid - tight relationship with collection zones in collection pans 63 u and 63 u ′ respectively , and each pan has withdrawal conduits 65 u and 65 u ′ which are manifolded to longitudinal liquid conduits 81 and 81 ′. analogously , headers 61 b and 61 b ′ are each secured in fluid - tight relationship with collection zones in collection pans 63 b and 63 b ′ respectively , and each pan has withdrawal conduits 65 b and 65 b ′ which are manifolded to longitudinal conduits 82 and 82 ′. as illustrated , withdrawal conduits are shown for both the upper and the lower headers , and both fore and aft the headers . in many instances , permeate is withdrawn from only an upper manifold which is provided on only one side of the upper headers . a lower manifold is provided for backwashing . backwashing fluid is typically flowed through the upper manifold , through the fibers and into the lower manifold . the additional manifolds on the aft ends of the upper and lower headers not only provides more uniform distribution of backwashing fluid but support for the interconnected headers . it will be evident that , absent the aft interconnecting upper conduit 81 ′, an upper header such as 61 u will require to be spaced from its lower header by some other interconnection to header 61 u ′ or by a spacer strut between headers 61 u and 61 b . in the best mode illustrated , each upper header is provided with rigid pvc tubular nipples adapted to be coupled with fittings such as ells and tees to the upper conduits 81 and 81 ′ respectively . analogously , each lower header is connected to lower conduits 82 and 82 ′ ( not shown ) and / or spacer struts are provided to provide additional rigidity , depending upon the number of headers to be interconnected . permeate is withdrawn through an upper conduit , and all piping connections , including the air connection , are made above the liquid level in the reservoir . the length of fibers ( between headers ) in a skein is generally chosen to obtain efficient use of an economical amount of air , so as to maintain optimum flux over a long period of time . other considerations include the depth of the tank in which the bank is to be deployed , the positioning of the liquid and air manifolds , and the convection patterns within the tank , inter alia . in another embodiment of the invention , a bioreactor is retrofitted with plural banks of skeins schematically illustrated in the elevational view shown in fig1 , and the plan view shown in fig1 . the clarifier tank is a large circular tank 90 provided with a vertical , circular outer baffle 91 , a vertical circular inner baffle 92 , and a bottom 93 which slopes towards the center ( apex ) for drainage of accumulating sludge . alternatively , the baffles may be individual , closely spaced rectangular plates arranged in outer and inner circles , but continuous cylindrical baffles ( shown ) are preferred . irrespective of which baffles are used , the baffles are located so that their bottom peripheries are located at a chosen vertical distance above the bottom . feed is introduced through feed line 94 in the bottom of the tank 90 until the level of the substrate rises above the outer baffle 91 . a bank 60 of plural skeins 10 , analogous to those in the bank depicted in fig1 , each of which skeins is illustrated in fig9 is deployed against the periphery of the inner wall of the bioreactor with suitable mounting means in an outer annular permeate extraction zone 95 ′ ( fig1 ) formed between the circular outer baffle 91 and the wall of the tank 90 , at a depth sufficient to submerge the fibers . a clarification zone 91 ′ is defined between the outer circular baffle 91 and inner circular baffle 92 . the inner circular baffle 92 provides a vertical axial passage 92 ′ through which substrate is fed into the tank 90 . the skeins form a dense curtain of fibers in radially extending , generally planar vertical arrays as illustrated in fig9 potted between upper and lower headers 41 u and 41 b . permeate is withdrawn through manifold 46 u and air is introduced through air - manifold 80 , extending along the inner wall of the tank , and branching out with air - distribution arms between adjacent headers , including outer distribution arms 84 ′ on either side of each lower header 41 b at each end of the bank . the air manifold 80 is positioned between skeins in the permeate extraction zone 95 ′ in such a manner as to have bubbles contact essentially the entire surface of each fiber which is continuously awash with bubbles . because the fibers are generally vertical , the air is in contact with the surfaces of the fibers longer than if they were arcuate , and the air is used most effectively to maintain a high flux for a longer period of time than would otherwise be maintained . it will be evident that if the tank is at ground level , there will be insufficient liquid head to induce a desirable liquid bead under gravity alone . without an adequate siphoning effect , a centrifugal pump may be used to produce the necessary suction . such a pump should be capable of running dry for a short period , and of maintaining a vacuum on the suction side of fro cm ( 10 ″)− 51 cm ( 20 ″) of hg , or − 35 kpa (− 5 psi ) to − 70 kpa (− 10 psi ). examples of such pumps rated at 18 . 9 l / min ( 5 gpm )@ 15 ″ hg , are ( i ) flexibly - impeller centrifugal pumps , e . g . jabsco # 30510 - 2003 ; ( ii ) air operated diaphragm pumps , e . g . wilden m2 ; ( iii ) progressing cavity pumps , e . g . ramoy 3561 ; and ( iv ) hosepumps , e . g . waukesha sp 25 . the skein may also be potted in a header which is not a rectangular prism , preferably in cylindrical upper and lower headers in which substantially concentric arrays of fibers are non - removably potted in cylindrical permeate pans , and the headers are spaced apart by a central gas tube which functions as both the spacer means and the gas - distribution means which is also potted in the headers . as before , the fibers are restrictedly swayable , but permeate is withdrawn from both upper and lower headers through a single permeate pan so that all connections for the skein , when it is vertically submerged , are from above . permeate is preferably withdrawn from the lower permeate pan through a central permeate withdrawal tube which is centrally axially held within the central gas ( air ) tube . the concentric arrays are formed by wrapping successive sheets of flat arrays around the central air - tube , and gluing them together before they are potted . this configuration permits the use of more filtration surface area per unit volume of a reservoir , compared to skeins with rectangular prism headers , using the same diameter and length of fibers . referring to fig1 there is schematically illustrated another embodiment of skein 180 in which rigid permeate tube 185 is held concentrically within a rigid air - supply tube 186 which is potted axially within skein fibers 112 held between opposed upper and lower headers 183 and 184 in upper and lower rings 120 u and 120 b which are in turn sealed in end - caps 181 and 182 respectively . for ease of manufacture , the lower end 185 b of permeate tube 185 is snugly fitted and sealed in a bushing 187 . the bushing 187 and end 185 b are then inserted in the lower end 86 b of the air supply tube 186 and sealed in it so that the annular zone between the outer surface of permeate tube 185 and the inner surface of air supply tube 186 will duct air to the base of the fibers but not permit permeate to enter the annular zone . the air supply tube is then placed on an array and the array is rolled into a spiral which is held at each end with rubber bands . the lower end of the roll is placed in a ring 120 b and a lower ring header is formed with a finished header 184 as described above . it is preferred to use a relatively stiff elastomer having a hardness in the range from 50 shore a to about 20 shore d , and mostpreferred to use a polyurethane having a hardness in the range from 50 shore a to about 20 shore d , measured as set forth in astm d - 790 , such as ptu - 921 available from canadian poly - tech systems . to form the upper finished header 183 the air supply tube is snugly inserted through an o - ring held in a central bore in a plate such as used in fig5 to avoid loss of potting resin from the ring 120 , and the fugitive resin and finishing resins poured and cured , first one then the other , in the ring . lower finished header 184 is formed with intermediate portions 112 b ′ embedded , and terminal portions 112 b ″ protruding from the header &# 39 ; s aft face . upper finished header 183 is formed with intermediate portions 112 u ′ embedded , and terminal portion 112 u ″ protruding from the header &# 39 ; s fore face . after the finished headers 183 and 184 are formed and the fibers checked for defects , the upper end 186 u of the air supply tube 186 is inserted through a central bore 188 in upper end - cap 181 and sealed within the bore with sealing compound or a collar 189 . preferably the permeate tube 185 , the air supply tube 186 and the collar 189 are all made of pvc so that they are easily cemented together to make leak - proof connections . as shown , permeate may be withdrawn through the permeate tube 185 from the permeate collection zone in the lower end - cap 182 , and separately from the upper end - cap 181 through permeate withdrawal port 181 p which may be threaded for attaching a pipe fitting . alternatively , the permeate port 181 p may be plugged and permeate withdrawn from both end - caps through the permeate tube 185 . upper end 185 u of permeate tube 185 and upper end 186 u of air supply tube 186 are inserted through a t - fitting 201 through which air is supplied to the air supply tube 186 . the lower end of 201 b of one of the arms of the t 201 is slip - fitted and sealed around the air supply tube . the upper end 201 u of the other arm is inserted in a reducing bushing 202 and sealed around the permeate tube . air supplied to intake 203 of the t 201 travels down the annular zone between the permeate tube and the air supply tube and exits through opposed ports 204 in the lower portion of the air supply tube , just above the upper face 184 u of the lower header 184 . it is preferred to thread ports 204 to threadedly secure the ends of arms 141 to form a sparger which distributed air substantially uniformly across and above the surface 184 u . additional ports may be provided along the length of the vertical air supply tube , if desired . microfiltration of an activated sludge at 30 ° c . having a concentration of 25 g / l ( 2 . 5 % tss ) is carried out with a skein of polysulfone fibers in a pilot plant tank . the fibers are “ air scrubbed ” at a flow rate of 12 cfm ( 0 . 34 m 3 / min ) with a coarse bubble diffuser generating bubbles in the range from about 5 mm to 25 mm in nominal diameter . the air is sufficient not only for the oxidation requirements of the biomass but also for adequate scrubbing . the fibers have an outside diameter of 1 . 7 mm , a wall thickness of about 0 . 5 mm , and a surface porosity in the range from about 20 % to 40 % with pores about 0 . 2 μm in diameter , both latter physical properties being determined by a molecular weight cut off at 200 , 000 daltons . the skein which has 1440 fibers with a surface area of 12 m 2 is wall - mounted in the tank , the vertical spaced apart distance of the headers being about 1 % less than the length of a fiber in the skein . the opposed ends of the fibers are potted in upper and lower headers respectively , each about 41 cm long and 10 cm wide . the fixing material of the headers is an epoxy having a hardness of about 70 shore d with additional upper an lower laminae of softer polyurethane ( about 60 shore a and 30 shore d respectively ) above and below the epoxy lamina , and the fibers are potted to a depth sufficient to have their open ends protrude from the bottom of the header . the average transmembrane pressure differential is about 34 . 5 kpa ( 5 psi ). permeate is withdrawn through lines connected to the collection pan of each header with a pump generating about 34 . 5 kpa ( 5 psi ) suction . permeate is withdrawn at a specific flux of about 0 . 7 lm 2 h / kpa yielding about 4 . 8 l / min of permeate which has an average turbidity of & lt ; 0 . 8 ntu , which is a turbidity not discernible to the naked eye . it will now be evident that the membrane - device and basic separation processes of this invention may be used in the recovery and separation of a wide variety of commercially significant materials , some of which , illustratively referred to , include the recovery of water from ground water containing micron and submicron particles of siliceous materials , preferably “ gas scrubbing ” with carbon dioxide ; or , the recovery of solvent from paint - contaminated solvent . in each application , the choice of membrane will depend upon the physical characteristics of the materials and the separation desired . the choice of gas will depend on whether oxygen is needed in the substrate . in each case , the simple process comprises , disposing a skein of a multiplicity of hollow fiber membranes , or fibers each having a length & gt ; 0 . 5 meter , together having a surface area & gt ; 1 m 2 , in a body of substrate which is unconfined in a modular shell , so that the fibers are essentially restrictedly swayable in the substrate . the substrate is typically not under pressure greater than atmospheric . the fibers have a low transmembrane pressure differential in the range from about 35 kpa ( 0 . 5 psi ) to about 350 kpa ( 50 psi ), and the headers , the terminal portions of the fibers , and the ends of the fibers are disposed in spaced - apart relationship as described hereinabove , so that by applying a suction on the aft face of at least one of the headers , preferably both , permeate is withdrawn through the collection means in which each header is mounted in fluid - tight communication . having thus provided a general discussion , and specific illustrations of the best mode of constructing and deploying a membrane device comprising a skein of long fibers in a substrate from which a particular component is to be produced as permeate , bow the device is used in a gas - scrubbed skein , and having provided specific illustrative systems and processes in which the skein is used , it is to be understood that no undue restrictions are to be imposed by reason of the specific embodiments illustrated and discussed , and particularly that the invention is not restricted to a slavish adherence to the details set forth herein . | 8 |
referring to fig1 a nanomechanism 10 for use in a nanoscale memory element is illustrated as including a first element 12 in the form of a nanoassembly 14 having a cavity 16 and a second element 18 in the form of a nanostructure 20 which is movably disposed within the cavity . while the nanomechanism will be described in terms of moving the nanostructure relative to the nanoassembly , it should be understood by those skilled in the art that the nanostructure can be held in a fixed position with the nanoassembly being moved relative thereto to effectuate a change in state as will be described below . additionally , it is fully comprehended that the nanostructure and nanoassembly can be configured to both be movable . for illustrative purposes , the nanoassembly is demonstrated as a c 480 capsule and the nanostructure is demonstrated as a charged c 60 fullerene molecule . it should be noted by those skilled in the art that the nanostructure 20 can also be in the form of other charged particles , molecules or nanotubes provided such can be housed within the cavity of a nanotube nanoassembly . further , as shown in fig6 two or more nanostructures represented by reference numerals 20 and 20 a , may be disposed within a single nanoassembly . it has been determined that the above described nanomechanism can be utilized in nanomemory elements 30 such as those illustrated in fig1 , 7 , 8 and 9 to write and read information fast and reliably . additionally , the data can be readily analyzed and stored in a non - volatile manner . the energetics of the c 60 molecule within the c 480 is demonstrated in fig2 . the ends of the outer capsule are halves of the c 240 fullerene , a preferred structure to hold a c 60 molecule at an inter - wall distance of 3 . 4 å . these end - caps connect seamlessly to the cylindrical portion of the capsule , a 1 . 5 nm long segment of the nanotube . the interaction between the unmodified c 60 molecule and the enclosing capsule is similar to that found in graphite , c 60 crystals and nanotube bundles ; that is , it is dominated by a van der waals and a weak covalent inter - wall interaction that is proportional to the contact area between the constituents . an additional image charge interaction , which is nearly independent of the c 60 position , occurs if the c 60 molecule carries a net positive charge , as will be discussed below . it should be recognized that the van der waals interaction stabilizes the c 60 molecule at either end of the capsule , where the contact area is largest . this is reflected in the potential energy behavior shown in fig2 and results in the likelihood of c 60 to be found near the ends of the capsule . in view of the foregoing , the concept of utilizing a nanomechanism , as an information storage medium will now be described . in order to move the nanostructure 20 from one end of the nanoassembly 14 to the other ( the molecular analog of writing ) and to determine its position within the nanoassembly ( the molecular analog of reading ) most efficiently , the nanostructure contained within the nanoassembly should carry a net charge . this net charge can be accomplished , for example , by utilizing a k @ c 60 complex , which can be formed spontaneously under synthesis conditions in presence of potassium ( k ), wherein the valence electron of the encapsulated k atom is completely transferred to the c 60 shell . the k @ c 60 complex , when in contact with the neutral c 480 nanoassembly , spontaneously transfers this valence electron from the c 60 shell to the enclosing nanoassembly , thus resulting in a k @ c 60 + ion enclosed in the c 480 nanoassembly . the writing process corresponds to switching the state or equilibrium position of the c 60 + ion between a first end 22 of the nanoassembly , hereinafter the “ bit 0 ” end and a second end 24 of the nanoassembly , hereinafter the “ bit 1 ” end . to accomplish a change in state , an electric field must be applied within the cavity 16 of the nanoassembly 14 . preferably , the nanoassembly 14 is provided with one or more electrodes 26 which are attached during the formation of the nanoassembly to reduce the field screening by the nanoassembly . the energetics of c 60 + in absence of an applied field and in the switching field of e s = 0 . 1 v / å , generated by applying a voltage of ˜ 1 . 5 v between the nanoassembly ends , is displayed in fig2 . one of the local minima becomes unstable above a critical field strength , causing the c 60 + ion to move to the only stable position . since the switching field e s = 0 . 1 v / å is relatively small , it should not have a dramatic effect , if any , on the integrity of the nanomechanism , since graphitic structures disintegrate only in fields greater than 3 . 0 v / å . an alternative way to displace the nanostructure within the nanoassembly could be achieved by irradiating the nanoassembly by a laser beam , fig1 , thus inducing an electric current capable of dragging along the nanostructure , as reported by kral and tomanek in physical review letters 82 , 5373 ( 1999 ), which is hereby incorporated by reference as if fully set forth herein . another method to displace the nanostructure within the nanoassembly would make use of the tip of a scanning probe microscope , such as atomic force microscope ( afm ), illustrated in fig1 . locally applied force would deform the nanoassembly in such a way to cause the nanostructure to move from one end to the other . the information , physically stored in the position of the nanostructure , i . e ., c 60 + ion contained within the nanoassembly , is stable and does not change unless a field greater than the switching field is present in the cavity 16 of the nanoassembly 14 , resulting in non - volatility of the stored information . in view of the data storage capability of the nanomechanisms of the present invention , the information generated by the nanomechanisms can be read in a number of ways . by way of a non - limiting example , a read function can be carried out by determining the state of the device by examining its polarity , detecting the movement of the nanostructure or examining its resistance . examining the polarity of the nanoassembly would indicate the proximity of the charged nanostructure within the nanoassembly and , thus , its location . the polarity can be examined by measuring the difference in the electrochemical potential between the ends 22 and 24 . to measure the polarity , a voltage meter can be connected to the nanomechanism along both ends as shown in fig1 . the voltage meter would detect different polarity depending on the position of a nanostructure . a destructive read process would involve measuring the current pulse in the connecting electrodes , caused by the motion of the charged nanostructure due to an applied probing voltage . the total charge transfer associated with the current pulse ( which is one electron in the present example ) may be increased by connecting several nanoassemblies in parallel to represent one bit as shown in fig9 and by using higher charged complexes such as la @ c 82 3 + carrying a net charge of + 3e , instead of the k @ c 60 + ion that carries a net charge of + 1e . the current pulse can be measured by using a current amplifier similar to the differential amplifiers used in dram cells . while it may be difficult to precisely detect the current caused by the motion of a single electron change , this becomes much more accurate when multiple charges cause the current pulse as in the array embodiments described below . another method of carrying out a read function involves utilizing a nanoassembly having alternating conductive and non - conductive segments 28 and 28 a , respectively . by using this type of nanoassembly , the resistance of the entire nanomemory device would be made to vary based upon the location of the ( conducting ) nanostructure within the nanoassembly . if the nanostructure is located along the first end 22 ( on the left ), as shown in fig7 the resistance of the nanomemory device is less than when the nanostructure is at the second end 24 ( on the right ). when the nanostructure is at the first end , it acts as an electrical bridge allowing current to flow between the ends of the nanoassembly . in contrast , when the nanostructure is on the right , no conducting path exists between the ends of the nanoassembly , thus yielding a higher resistance which can be measured . the conductive and non - conductive segments of the nanoassembly 14 can be made of different materials or may optionally be made from the same material but differ in atomic arrangement , which in case of nanotubes is referred to as chirality . the resistance can be measured in a number of ways including , for example , attaching a resistor to the electrodes in series with the nanomechanism . a small potential difference would then be applied across both the resistor and the nanomechanism , with the difference between the resistor and nanomechanism being measured . the read function can also be carried out by employing a plurality of spaced apart electrodes attached to a nanomechanism as illustrated in fig8 and 14 . first and second electrodes 26 and 26 a would be located at opposite ends of the nanoassembly 14 and separated from each other by one or more insulating segments 28 a ; a third electrode 26 b would be disposed along the midpoint 40 . the three electrodes are operationally associated with control logic 43 . preferably , each of the electrodes are equidistantly spaced from adjacent electrodes . when the nanostructure is at one end , it provides a low - resistance connection between this end and the electrode at the mid - point , whereas the resistance between the mid - point electrode and the other end remains high . therefore , the location of the nanostructure is detectable by comparing the resistance between the mid - point electrode and one end to the resistance between the mid - point electrode and the other end using a resistor as described above . another method to detect the location of the nanostructure within the nanoassembly would make use of the tip of a scanning probe microscope , such as atomic force microscope ( afm ). due to the fact that the nanoassembly is locally less compressible near the nanostructure , as illustrated in fig1 , the scanning probe microscope would show a different deflection when in the vicinity of the nanostructure . still another way to detect the position of the nanostructure within the nanoassembly relies on the fact that the opaque nanostructure , when located near the left end (“ bit 0 ”) of the nanoassembly , may obstruct a beam of light from transmission through a window consisting of a transparent section of the nanoassembly , as shown in fig1 . when the nanostructure is located near the right end (“ bit 1 ”) of the nanoassembly , as shown in fig1 a , the beam of light is not obstructed , but rather transmitted through this window and can be detected . unlike in most conventional solid state random access memory elements ( such as dram or sram ) where information has to be sustained by an external power source , the non - volatility of the stored information , mentioned above , results from a relatively deep trap potential near the “ bit 0 ” or “ bit 1 ” ends of the nanomechanism and thus does not rely upon external power . thermal stability and non - volatility of data depend on the depth of this trap potential , which in turn can be adjusted by changing the encapsulated fullerene complex . for example , the calculated trap potential depth of 0 . 24 ev for the k @ c 60 + ion near the ends of the nanoassembly in zero field suggests that stored information should be stable well beyond room temperature and require temperatures on the order of 3000 k to be destroyed . further improvement of the thermal stability can be achieved using higher charged endohedral complexes containing di - or trivalent donor atoms , such as la @ c 82 3 + as mentioned above . when targeting high storage densities , the addressability of the stored information becomes important . one possible way to realize a high - density memory board is presented in fig3 . maximum density is achieved by packing the nanotube memory elements in a honeycomb fashion . rows of nanoassemblies can be connected at the top and at the bottom by “ nanowire ” electrodes in such a way , that a single memory element is addressed at their crossing point . applying a switching voltage between two crossing electrodes [ e . g . the bc pair in fig3 ( b )] will generate a field sufficient for switching only in that memory element [ e . g . labeled bc ], whereas fields inside other memory elements , in particular the rows of elements connected to electrode c and electrode b , are too small to initiate switching . as in most solid - state memory devices , many memory elements can be addressed in parallel using such an addressing scheme . this arrangement applies both for the writing and the reading processes described above , and allows for multiple bits to be written and read in parallel . in a similar fashion , a matrix of single bit nanoscale memory elements , as illustrated in fig1 , can also be employed as a nanomemory device . a large quantity of nanomechanisms per unit area , i . e ., such as those described in articles by a . thess et al ., science , vol . 273 , pg . 483 ( 1996 ); g . che et al ., jpn . j . appl . phys ., vol 37 , pg . 605 ( 1988 ) and s . j . tans et al ., nature , vol . 393 , 49 ( 1998 ) can be attached to the electrode . a similar technique could be used to create a high quantity of nanomechanisms per unit area disposed between two conducting layers to form a single bit element as illustrated in more detail in fig9 . in general , the number of nanomechanisms per bit will depend upon the minimum line size of the lithography process used for the electrodes . for example , for lithography processes employing a 70 nm wire width there could be nearly 1 , 000 nanomechanisms used to store a single bit of information . writing can be done by assuming that a voltage differential of 2 . 0 v will move the nanostructures from one end of the nanoassembly to the other ( field of about or exceeding 0 . 1 v / å , needed to move a c 60 + ion within the nanoassembly , will thus be achieved if the distance between the two ends is below about 2 nm ). thus , as shown in fig1 , in order to write the information “ bit 0 ” to memory element “ 4 ” one applies a + 1 . 0 v potential to wire b while applying a − 1 . 0 v potential to wire d . if all the other electrodes are held at ground , only at the addressed element will there be a strong enough electric field to move the nanostructures across the nanoassemblies . a “ bit 1 ” information would be written to that element by reversing the voltage at the same electrodes and holding all others at ground . writing to an entire row ( or column ) would be a two - stage process , as the “ bit 0 ” and “ bit 1 ” information would have to be written at different times . the memory arrays of the present invention , which are random accessible in nature , can be fabricated to replace traditional dram capacitor / transistor memory cells with a memory - cell made of one or more nanomemory devices . fig1 illustrates a contemporary memory array employing an array of nanoscale memory devices rather than dram cells which are now commonly used in microelectronic applications . as shown , the decoder 50 selects the appropriate wire ( s ) 52 for reading and writing as described above . the multiplexer ( mux ) 54 collects the signals from the nanoscale memory devices for output . the decoder and mux are conventional devices which can be fabricated using conventional vlsi techniques or can be fabricated from nanotubes . now , consider a destructive read with a large number of nanoassemblies per unit area . a “ forest ” of nanoassemblies would result in movement of a large number of charged ions whose movement would be detectable . while the data will have been destroyed in the process of doing the read , the data can be written back later , similar to how data are handled in a traditional dram . the above described nanomemory devices have a number of useful features . they are non - volatile ; the device itself switches very quickly ; and they appear to be useful in modern lithography processes . under an alternative embodiment , nanomemory devices can be fabricated wherein the metal or polysilicon electrodes are in whole or in part replaced with “ carbon nanowires ”. these so - called nanowires are in the form of conductive carbon nanotubes . each bit of memory would now use only a single nanoscale memory device . the reading and writing of the data in the nanomemory devices would be achieved as described above and as illustrated in fig1 , by way of non - limiting example . to study the efficiency of the writing process , we performed a molecular dynamics simulation of the switching process from “ bit 0 ” to “ bit 1 ” in the microcanonical ensemble of the c 60 + @ c 480 nanoassembly . we used a parametrized linear combination of atomic orbitals ( lcao ) total energy functional augmented by long - range van der waals interactions . our approach to determine the forces on individual atoms had been previously used with success to describe the disintegration dynamics of fullerenes and the growth of multi - wall nanotubes . a time step of 5 × 10 − 16 s and a fifth - order runge - kutta interpolation scheme was used to guarantee a total energy conservation of δe / e ˜& lt ; 10 − 10 between successive time steps . the results of our simulation are shown in fig4 . initially , the nanostructure 20 ( c 60 + ion ) is equilibrated near the “ bit 0 ” position on the left . at time t = 0 , a constant electric field of 0 . 1 v / å is applied along the axis of the nanoassembly 14 . the originally stable “ bit 0 ” configuration becomes unstable in the modified total energy surface as depicted in fig2 . the c 60 + ion is subject to a constant acceleration to the right , and reaches the “ bit 1 ” position only 4 picoseconds ( ps ) later , as seen in fig4 ( a ). during this switching process , the potential energy lost by the c 60 + ion is converted into kinetic energy , as seen in fig4 ( b ). due to the small ( albeit non - negligible ) interaction between the nanostructure ( c 60 + ion ) and the nanoassembly ( nanotube ), the kinetic energy gained initially occurs as rigid - body translational energy of the nanostructure . a nearly negligible energy transfer into the internal degrees of freedom due to atomic - scale friction , manifested in a very small increase of the vibrational temperature , shown in fig4 ( c ), is observed during this initial stage of the switching process . approximately four picoseconds ( ps ) after the switching field is applied , the nanostructure reaches the opposite end of the nanoassembly , having gained 1 . 5 electron - volts ( ev ) of net kinetic energy . this kinetic energy is too small to damage the nanoassembly , as inelastic collisions involving c 60 require energies exceeding 200 ev to occur . upon impact onto the enclosing nanoassembly from the inside , a substantial fraction of this energy is converted into heat , thus increasing the vibrational temperature of the nanoassembly by 10 k and that of the c 60 + ion nanostructure by 2 k . due to the high heat conductivity and melting temperature t m ˜ 4 , 000 k of graphitic nanostructures , this modest heat evolution is unlikely to cause any significant structural damage even at high access rates . as seen in fig4 ( b ), the net kinetic energy of the nanostructure with respect to the nanoassembly is significantly reduced during this collision . the c 60 + bounces back towards the middle of the nanoassembly , slowed down by the opposing electric field , and finally turns again towards the “ bit 1 ” end . fig4 ( c ) indicates that thermal equilibration in the system after the collision is achieved stepwise . the step period of 1 ps results from the beats between the low - frequency quadrupolar deformation modes of the colder encapsulated c 60 + ion and the hotter enclosing nanoassembly , which have been excited during the quasielastic collision . one or few oscillations of the nanostructure inside the nanoassembly , damped by transferring energy from macroscopic to internal degrees of freedom , are necessary to stabilize it in the new equilibrium “ bit 1 ” position , with a kinetic energy not exceeding the depth of the trap potential . as seen in fig4 ( b ), this situation occurs 10 ps after the initial onset of the switching field , thus resulting in an ideal memory switching and access rate close to 0 . 1 thz . in the slower sequential mode , this translates into a data throughput rate of 10 gb / s , many orders of magnitude faster than the data throughput achieved presently in magnetic mass storage devices . in order to further reduce the switching time , the applied field may be increased to shorten the transfer time between the two states , “ bit 0 ” and “ bit 1 ”, keeping in mind that the damping process would be prolonged in such a case . unlike in our model simulation , there is no need to apply a constant switching field during the entire bit flip process . a 0 . 5 ps pulse of a 0 . 1 - 0 . 5 v / å field is found to suffice to detach the c 60 + ion from its stable position and thus to change the memory state . this approach may be of particular use if an increase of the trap potential , due to a different fullerene complex , is desired . mass production of nano memory devices such as the ones discussed herein can be accomplished in a cost - effective manner due to affinity of nanotubes and nanocapsules to form ordered , close - packed arrays . it should be noted that since any double - wall nanotube or nanocapsule with the enclosed structure shorter than the outer capsule behaves as a tunable two - level system , the functionality of the proposed nanoscale memory device is basically independent of the exact size and shape of the nanostructure and nanoassembly . instead of a closed nanoassembly as illustrated and described above , an alternative nanoassembly is shown in fig5 as an open ended hollow tube / cylinder . two tubes 34 and 34 a , smaller in diameter and closed at one end , can be positioned inside the cavity 16 of the nanoassembly 14 in such a way that there is a near cylindrical void between the closed ends 36 and 36 a of these two tubes . this cylinder / capsule contains at least one charged nanostructure 20 that can move along the axis of the truncated cylinder portion 38 , once an electric field is produced inside by applying a bias voltage between the tubes 34 an 34 a . with two equally stable equilibrium states in zero field , this is a two level system that can be used for binary data storage . while it will be apparent that the preferred embodiments of the invention disclosed are well calculated to fulfill the objects stated , it will be appreciated that the invention is susceptible to modification , variation and change without departing from the spirit thereof . | 8 |
the equipment for implementing the method of the invention is characterized by 1 . a mold , corresponding to the shape of the glass body to be produced , for receiving the suspension for forming the glass body , this mold being made of a hydrophobic material with a cover which has at least one aperture , through which the dispersing liquid can diffuse out from the suspension during the drying process of the suspension or by 2 . a porous mold , corresponding to the shape of the glass body to be produced , made of a hydrophobic , preferably elastic synthetic material with pores with a diameter in the order of the molecules of the dispersing liquid , by means of which the dispersion liquid can diffuse out during the drying process the suspension . the invention is based on the perception that a particularly high thixotropic effect occurs with suspensions comprising highly disperse sio 2 particles of a diameter in the range from 10 to 500 nm , and that this effect is further enhanced by the addition of an ionogenic substance which promotes the cross - linking of the solid particles in the suspension and shifts the ph - value of the suspension into the acid range ( ph & lt ; 3 ) or towards the basic range ( ph = 5 . 5 to 8 ), this effect being capable of being used first of all to transform the suspension into a state of minimum viscosity , i . e . liquify it , by the action of mechanical forces , preferably sound or ultrasound , in which state it can be efficiently homogenized and whereby the ionogenic additive promoting a cross - linking reaction of the solid particles is very finely distributed in the suspension . after removal of the mechanical forces the suspension solidifies extremely rapidly as a result of the thixotropic effect and this effect can be utilized to obtain dimensionally stable green bodies from a low - viscosity suspension by means of a mold of hydrophobic material . the invention is further based on the knowledge that unwanted cracking occurs in green bodies produced from suspensions due to the fact that the surface tension of the dispersing liquid contracts the solid particles during drying . when the binding forces are insufficient , cracks are readily formed , particularly at inhomogeneities . to reduce this risk , it is necessary to achieve as homogeneous a suspension as possible . to reduce the dry shrinkage of a green body and therefore to also reduce the risk of cracking in green bodies produced from suspension , it is also important to start with green bodies with a higher relative density ; the density should be at least & gt ; 35 % of the density of compact fused silica . with colloidal suspensions such as are described , for example , in de no . 30 01 792 it is impossible to achieve such a high density . to prevent cracking during drying in green bodies produced from suspensions it is important , according to a further finding of the invention , that no stresses can occur between the mold , in which a thixotropic suspension solidifies into a dimensionally stable green body , and the green body . all these findings together have given rise to the method and the equipment suitable for the application of this method . according to advantageous embodiments of the method according to the invention the dispersing liquid used is water and a suspension is used which contains sio 2 particles with a diameter in the range from 10 to 500 nm , preferably 15 to 100 nm , with a mean particle diameter of 40 nm in the case of a solid / dispersing liquid ratio of 0 . 5 : 1 to 1 . 2 : 1 . this has the advantage that green bodies can be produced with an advantageously high density which amounts to 35 to 50 %, preferably 45 % of the density of compact fused silica . according to an additional advantageous embodiment of the method according to the invention , the ionogenic additive is added in a quantity of ≦ 5 wt .% per solids content in the suspension . this has the advantage that the additive which acts as a cross - linking activator is present in such a quantity that the surface of the solid particle in the suspension are just covered with ions of the ionogenic additive . the quantity of ionogenic material added should not be greater than 5 wt .% per solids content of the suspension because otherwise the viscosity of the suspension is raised to such an extent that efficient homogenization becomes difficult . according to another advantageous embodiment of the method according to the invention , the ionogenic additive is an ammonium compound and , in particular , nh 4 f in aqueous solution which shifts the ph - value of the suspension towards the basic range ( ph = 5 . 5 to 8 ). ammonium compounds are readily volatile and , therefore , can be removed without trace from the green body in a subsequent purifying / heating stage so that fused silica bodies of a very high purity can be produced . the addition of an ammonium compound , nh 3 in aqueous solution for example , results in green bodies of relatively high strength because a gel formation occurs at the points of contact of two sio 2 primary particles . for example , at a suspension temperature of 20 ° c . and a ph - value of ≦ 10 , of the order of approx . 100 ppm sio 2 passes into solution and is precipitated at the points of contact and thus forms a bridge layer . if nh 4 f in aqueous solution is used as the ionogenic additive , fluorine doping can be achieved which , for example , is suitable for the production of cladding glasses for optical waveguides . also suitable are ionogenic additives , acting as cross - linking activators , which shift the ph - value of the suspension into the acid region ( ph & lt ; 3 ); here , too , an optimum thixotropic effect occurs . in this case , hcl can be used for example . according to a further advantageous embodiment of the method according to the invention , the starting material is transformed into a state of minimum viscosity by the action of sound at a freqency of f = 10 to 200 hz , preferably 50 hz , or ultrasound at a frequency f = 20 to 50 khz , preferably 35 khz . it has been found that by utilizing the thixotropic effect low - viscosity , pourable sio 2 suspensions can be obtained and efficiently homogenized if they are exposed to the action of sound or ultrasound . a gel - sol transformation occurs in thixotropic systems with any form of mechanical action , e . g . stirring or shaking . if , for the purpose of liquefying a higher - viscosity starting material , a sonic or ultrasonic oscillator is used the amplitude of which is dimensioned in such a way that the sonic or ultrasonic field is introduced into the starting material being liquefied , this results in a particularly effective dissolution of packing cavities in the starting material ( gas bubbles rise upwards in the low - viscosity starting material and are thus automatically eliminated ). such degassing can be further accelerated , for example , by liquefying the starting material in a vacuum . according to further advantageous embodiments of the method according to the invention , the molds of hydrophobic material into which the pourable suspension is poured and solidified by means of the thixotropic effect and then dried are molds made of polytetrafluorethylene , polyethylene , polycarbonate , polymethylmethacrylate or polyvinylchloride , preferably with a polished surface , or of porous elastic synthetic material . the suspension introduced into the molds is dried in this case by diffusion of the dispersing agent through at least one aperture at the top of the mould in the case of molds of polished synthetic material or by diffusion of the dispersing agent through pores in the case of molds of porous elastic synthetic material . the use of such molds provides slow drying of the green body , and stresses between the mold and the drying green body are thus avoided . according to a further advantageous embodiment of the method according to the invention , the material used for the mold is a foil made from a synthetic material which is chemically dissolved in a solvent which has a lower surface tension than the dispersing liquid and is immiscible or largely immiscible with the dispersing liquid . such a mold may be removed chemically from the dried green body , this has the advantage of preventing any damage to the surface of the green body such as might occur with mechanical removal of the mould . the particular advantages that can be achieved with the invention are the fact that green bodies of a relatively high density ( 35 to 50 % of the density of compact fused silica ) can be produced free of cracks from pourable suspensions with highly disperse sio 2 particles by three - dimensional cross - linking of the solid particles and by means of controlled drying . embodiments of the invention will be illustrated and explained in greater detail below with the aid of the drawing which shows : fig1 a solid mold according to the invention for the forming and drying of a green body ( transverse section ). fig2 a porous mould according to the invention for the forming and drying of a green body ( transverse section ). an aqueous , pourable suspension was prepared as the starting material for the production of a glass body . for this purpose , 150 g of commercially available sio 2 having a particle diameter of 10 to 100 nm with a mean particle diameter of 40 nm was mixed into 127 . 3 ml water and 22 . 7 ml 5 % aqueous nh 4 f solution and homogenized in a vessel for approx . 10 min under the action of ultrasound with a frequency of f = 35 khz for the purpose of establishing minimum viscosity . the low - viscosity suspension thus produced is then be poured into molds . because of the thixotropic effect the suspension solidifies into a dimensionally stable green body and is dried in the mold until a shrinkage of approx . 10 % is achieved . in orfer to prevent cracking of the green body due to stresses between it and the mold into which the low - viscosity suspension is poured and in which it solidifies as a result of the spatial cross - linking of the solid particles , a mold is used in which a slow drying process can be performed and in which up to approx . 10 % dry shrinkage can be obtained without crack formation . this was achieved by using a mold made of hydrophobic material which is designed in such a way that part of the dispersing liquid can escape from the mould by diffusion . fig1 shows a cylindrical mold 1 of a polished polycarbonate ( diameter 26 . 0 mm ) into which the starting material 7 in the form of a low - viscosity suspension was formed . the mold was filled almost completely with the suspension and is sealed off with a cover 3 in such a way that at least one aperture 5 was retained , by means of which the dispersing liquid can diffuse out during the drying process . the starting material 7 contained in mold 1 was dried for a period of 12 days at a temperture of 25 ° c . after this drying , a shrinkage of the resultant green body of 10 . 3 % was established . in this condition the green body obtained was removed from the mold and dried for another day at a temperature of 60 ° c . in a drying cupboard . the dried green body had a density of 45 % of that of the density of compact fused silica and is free from cracks . then the green body was heated in 100 min to a temperature of 800 ° c . and was exposed for 2 hours to a socl 2 - saturated o 2 - gas stream for the purpose of removing impurities , particularly water and transition metals . subsequently sintering to form a fused silica body was carried out at 1500 ° c . in a helium atmosphere with 2 vol . % chlorine gas addition , during which process the green body was passed through the furnace at a withdrawal speed of 3 mm / min . a transparent , bubble - free and ream - free glass rod with an outside diameter of 20 mm was obtained which had an impurity content of only & lt ; 10 ppb . the glass produced in this way has a density of 2 . 20 g / cm 3 and a refractive indes of n d = 1 . 4598 . a green body may also be formed and dried in a thin - walled porous hose of , prefrably , an elastic synthetic material , the diameter of the pores of which corresponds to the size of the molecules of the dispersing liquid . such a mold is shown in fig2 . as shown in fig2 a porous hose 9 of silicone rubber with a wall thickness of 0 . 12 mm and an inside diameter of 20 mm is inserted into a divisible porous support mold in the form of a cylinder 11 with an inside diameter of 26 mm and is inflated such that it sits tight against the support mould . then , by way of a filler pipe 13 the hose 9 is filled almost completely with starting material in the form of a suspension 7 such as was produced for the example employed in the mold show fig1 . after a duration of 2 hours at a temperature of 30 ° c . the suspension is totally cross - linked , the green body therefore has solidified as a result of the thixotropic effect and can be removed together with the hose from the support mold . the cylindrical - shaped support mold 11 can be suitably made from high - molecular - weight polyethylene with pores with a diameter of 10 μm . after a drying time of 3 days at a temperature of 25 ° c . the green body has a drying shrinkage of 10 . 3 %. when the green body shrinks , the hose which expanded during the filling with suspension contracts , therefore despite the enforced very much shorter drying period compared with the example illustrated in fig1 no cracks can occur in the green body as the result of stresses between mould and green body . after the drying shrinkage of 10 . 3 % has been achieved , the green body is extracted from the hose 9 . the green body having been removed is then dried for 1 more day at a temperature of 60 ° c . in a drying cupboard and is then further treated as described with regard to the example in fig1 . in accordance with a further expedient procedure the green body may also be removed by using for the mold a foil made of a synthetic material which is soluble in a solvent that has a lower surface tension that the dispersing liquid and which is immiscible or almost immiscible with the dispersing liquid . if , for example , a foil hose made of polycarbonate is used , this can be dissolved in methylene chloride . chemical removal of the mold reliably prevents surface damage of the green body . rod - shaped fused silica bodies have been produced in the moulds described in relation to fig1 and 2 . in a similar manner , tubular fused silica bodies can also be produced if , for example , an inflated resilient plastic hose which may be permeable to water vapour or watertight , is centrically arranged in the porous hose 9 as in fig2 or in the solid mould as in fig1 . | 8 |
for the preferred embodiment we describe the application of our method to imaging of a 2d cardiac slice using a spinwarp pulse - sequence . for notational convenience , x , y and z are chosen to be the desired readout , phase - encoding and slice - select gradient axes respectively . embodiments for other imaging prescriptions , like 3d imaging or projection imaging ( radial sampling in k - space ) can be analogously derived based on the general description discussed above . mr imaging system : referring first to fig1 , there is shown the major components of a preferred mri system that incorporates the present invention . the mri system includes a workstation 10 having a display 12 and a keyboard 14 . the workstation 10 includes a processor 16 which is a commercially available programmable machine running a commercially available operating system . the workstation 10 provides the operator interface which enables scan prescriptions to be entered into the mri system . the workstation 10 is coupled to four servers : a pulse sequence server 18 ; a data acquisition server 20 ; a data processing server 22 , and a data store server 23 . the pulse sequence server 18 functions in response to program elements downloaded from the workstation 10 to operate a gradient system 24 and an rf system 26 . gradient waveforms necessary to perform the prescribed scan are produced and applied to the gradient system 24 which excites gradient coils in an assembly 28 to produce the magnetic field gradients gx , gy and gz used for position encoding nmr signals . the gradient coil assembly 28 forms part of a magnet assembly 30 which includes a polarizing magnet 32 and a whole - body rf coil 34 . rf excitation waveforms are applied to the rf coil 34 by the rf system 26 to perform the prescribed magnetic resonance pulse sequence . responsive nmr signals detected by a separate rf coil array described below are received by the rf system 26 , amplified , demodulated , filtered and digitized under direction of commands produced by the pulse sequence server 18 . the rf system 26 includes an rf transmitter for producing a wide variety of rf pulses used in mr pulse sequences . the rf transmitter is responsive to the scan prescription and direction from the pulse sequence server 18 to produce rf pulses of the desired frequency , phase and pulse amplitude waveform . the rf system 26 also includes a plurality of rf receiver channels . in the preferred embodiment 8 receiver channels are employed although any number of receive channels may be employed depending on the receive coil array being used . each rf receiver channel includes an rf amplifier that amplifies the nmr signal received by the coil to which it is connected . the pulse sequence server 18 also optionally receives patient data from a physiological acquisition controller 36 . the controller 36 receives signals from a number of different sensors connected to the patient , such as ecg signals from electrodes or respiratory signals from a bellows . such signals are typically used by the pulse sequence server 18 to synchronize , or “ gate ”, the performance of the scan with the subject &# 39 ; s respiration or heart beat . the pulse sequence server 18 also connects to a scan room interface circuit 38 which receives signals from various sensors associated with the condition of the patient and the magnet system . it is also through the scan room interface circuit 38 that a patient positioning system 40 receives commands to move the patient to desired positions during the scan . the digitized nmr signal samples produced by the rf system 26 are received by the data acquisition server 20 . the data acquisition server 20 operates to receive the real - time nmr data and provide buffer storage such that no data is lost by data overrun . in some scans the data acquisition server 20 does little more than pass the acquired nmr data to the data processor server 22 . however , in scans which require information derived from acquired nmr data to control the further performance of the scan , the data acquisition server 20 is programmed to produce such information and convey it to the pulse sequence server 18 . for example , during prescans nmr data is acquired and used to calibrate the pulse sequence performed by the pulse sequence server 18 . also , navigator signals may be acquired during a scan and used to adjust rf or gradient system operating parameters or to control the view order in which k - space is sampled . and , the data acquisition server 20 may be employed to process nmr signals used to detect the arrival of contrast agent in an mra scan . in all these examples the data acquisition server 20 acquires nmr data and processes it in real - time to produce information which is used to control the scan . the data processing server 22 receives nmr data from the data acquisition server 20 and processes it in accordance with an image reconstruction method . images reconstructed by the data processing server 22 are conveyed back to the workstation 10 where they are stored . real - time images may be output to operator display 12 or a display 42 which is located near the magnet assembly 30 for use by attending physicians . batch mode images or selected real time images are stored in a host database on disc storage 44 . the workstation 10 may be used by an operator to archive the images , produce films , or send the images via a network to other facilities . referring particularly to fig2 , the rf system 26 includes a transmitter 198 that produces a prescribed rf excitation field . the base , or carrier , frequency of this rf excitation field is produced under control of a frequency synthesizer 200 which receives a set of digital signals from the pulse sequence server 18 . these digital signals indicate the frequency and phase of the rf carrier signal produced at an output 201 . the rf carrier is applied to a modulator and up converter 202 in the transmitter 198 where its amplitude is modulated in response to a signal r ( t ) also received from the pulse sequence server 18 . the signal r ( t ) defines the envelope , or waveform , of the rf excitation pulse to be produced and is produced by sequentially reading out a series of stored digital values . these stored digital values may , be changed to enable any desired rf pulse envelope , or waveform , to be produced by the transmitter 198 . the rf pulses produced by the transmitter 198 can thus be separately controlled by the pulse sequence server 18 . the magnitude of the rf excitation pulse produced at output 205 is attenuated by an exciter attenuator circuit 206 in the transmitter which also receives a digital command from the pulse sequence server 18 . the attenuated rf excitation pulses are applied to a power amplifier 151 in the transmitter 198 . the power amplifier is a current source device that connects to the whole body rf coil 152 , although local coils may also be used in some clinical applications . referring still to fig2 the signal produced by the subject is picked up by a coil array 155 and applied to the inputs of a set of receive channels 157 . a pre - amplifier 160 in each receiver cannel 157 amplifies the signal by an amount determined by a digital attenuation signal received from the pulse sequence server 18 . the received signal is at or around the larmor frequency , and this high frequency signal is down converted in a two step process by a down converter 208 which first mixes the nmr signal with the carrier signal on line 201 and then mixes the resulting difference signal with a reference signal on line 204 . the down converted nmr signal is applied to the input of an analog - to - digital ( a / d ) converter 209 which samples and digitizes the analog signal and applies it to a digital detector and signal processor 210 which produces 16 - bit in - phase ( i ) values and 16 - bit quadrature ( q ) values corresponding to the received signal . the resulting stream of digitized i and q values of the received signal are output to the data acquisition server 20 . the reference signal as well as the sampling signal applied to the a / d converter 209 is produced by a reference frequency generator 203 . in the preferred embodiment of the invention the coil array 155 includes only n = 8 coil elements and eight corresponding receive channels are employed . although a number of fast pulse sequences may be employed to practice the invention , in the preferred embodiment a spoiled gradient - recalled echo sequence or a steady - state gradient - recalled echo pulse sequence such as that shown in fig7 is employed . the pulse sequence includes a selective rf excitation pulse 220 having a prescribed flip angle . the frequency and phase of this excitation pulse 220 can be precisely controlled by the mr scanner hardware as described above . the pulse sequence produces three gradient waveforms g z ( t ) 222 , g x ( t ) 224 and g y ( t ) 226 . g z ( t ) 222 is a slice select gradient , which operates in combination with the selective rf excitation pulse 220 to excite spins in a slice of prescribed thickness and location . g x ( t ) 224 is a readout gradient that frequency encodes the nmr signal 228 as it is acquired by the transceiver 150 . and finally , g y ( t ) is a phase encoding gradient which phase encodes the nmr signal 228 to sample a particular k y line in k - space . this phase encoding gradient is set to a particular value during each pulse sequence and this value is changed each time the pulse sequence is repeated to sample a different k y line in k - space . one aspect of the present invention is the order in which the k y lines of k - space are acquired . as will be explained in more detail below , during a prescan a sampling schedule is produced , and the values in this table are used during the scan to set the phase encoding gradient value during each repeat of the pulse sequence such that the k y lines in k - space are acquired in the proper order and at the proper time . this sampling schedule is adapted to the cardiac model of the subject being imaged and to the coil sensitivity profiles estimated in the prescan stage . detailed description of the optimization criterion used to solve for the optimal sampling schedule is set forth below . imaging method overview : referring particularly to fig8 , the acquisition and display of cardiac images according to the present invention may be separated into four separate stages : ( 1 ) a prescan indicated at process block 250 ; ( 2 ) a scan , or data acquisition step , indicated generally at 266 , ( 3 ) an image reconstruction step indicated at 268 and , ( 4 ) an image display stage indicated at 270 . the prescan 250 itself consists of three stages . as will be explained in detail below , during the prescan at stage 252 , data is acquired from the subject of the examination for the purpose of estimating the coil sensitivity profiles ( also referred to as sensitivity maps or b 1 maps ) to be used in later stages . during the prescan at stage 254 , mr data , auxiliary data , or both are acquired in order to estimate the object motion model parameters . as will be described in more detail below , the data acquired in stages 252 and 254 is employed at prescan stage 256 to produce an optimal sampling schedule indicated at 258 that adapts the mr data acquisition to the particular subject of this examination and the parallel mr hardware . after the prescan 250 is completed , the imaging scan is performed as indicated at process block 266 using the previously described imaging pulse sequence . the order and times in which k y lines of k - space are sampled is determined by the sampling schedule 258 . the acquisition prescribed by this sampling schedule 258 is adapted to the cardiac dynamics of the subject and the coil sensitivity profiles . after the k - space data indicated by the sampling schedule 258 has been acquired , one or more images of the heart at the selected time - instant are reconstructed at process block 268 and displayed as indicated at process block 270 . as will be explained in more detail below , this image reconstruction 268 involves more than the usual sense reconstruction steps or other standard pmri reconstruction steps , but still can be computed efficiently . the same data - set can be used to reconstruct the cardiac tvo at different time - instants corresponding to varying cardiac phases . prescan : referring particularly to fig8 , the purpose of the prescan process 250 is to produce the sampling schedule 258 and an estimate of the coil profiles and dkt support as indicated at 264 , which are used during the mri scan 266 and image reconstruction 268 stages . it should be noted that the order of coil profile estimation 252 and dkt support estimation 256 can be switched . also , the two steps can be combined resulting in a joint estimation scheme . coil profile estimation : this stage consists of two steps : ( 1 ) reference imaging ; and ( 2 ) profile computation . in the first step , we collect fully - encoded mr data ( i . e ., mr data sampled in k - space according to the nyquist sampling requirements determined by the object &# 39 ; s field of view ) to reconstruct low spatial resolution reference images of the slice of interest during a breath - hold . typically , a spatial resolution of 64 × 64 would suffice . alternatively , in order to avoid the need for a breath - hold , interleaved gradient epi with half fourier imaging can be used as described in an article entitled “ cardiac real - time imaging using sense ” by m . weiger et al ., magnetic resonance in medicine , vol . 43 , pp . 177 - 184 ( 2000 ). in the second step , we compute the sensitivity profiles of all coils using methods as described in an article entitled “ sense : sensitivity encoding for fast mri ” by k . p . pruessmann et al ., magnetic resonance in medicine , vol . 42 , pp . 952 - 962 ( 1999 ). note that , if available , body - coil data can also be used in the estimates . since the mr data needed to form the set of reference images is acquired in a short interval of time , cardiac motion during acquisition is negligible and its effect on the profile estimates can be ignored . moreover , by using cardiac gated imaging at this stage , reference images can be made more robust to cardiac motion . in case of low snr , for each channel , a ( weighted ) average of the computed coil profile over several cardiac phases would increase the accuracy of the estimate as described in the article by m . weiger cited above . as mentioned in the general description of the invention , the coil sensitivity estimates can be further improved during or after the imaging scan stage . for example , one can solve for the coil sensitivities and reconstructed images , which would optimize fidelity of the acquired data . alternatively , one could use a joint estimation scheme of the form shown in eq . ( 3b ), and simultaneously solve for both the unknown object , coil sensitivities and dynamic model parameters . such approaches involve solving a nonlinear optimization problem , for which several numerical techniques are available . some of the particular algorithms for solving such problems are discussed in a book by dimitri p . bertsekas , titled “ nonlinear programming ,” isbn : 1 - 886529 - 00 - 0 , athena scientific , 2004 . dynamic model estimation ( dme ): recall that the dkt support of the cardiac tvo ( in the absence of respiratory motion ) is defined as β 1 supp { i ( r , f )} where r denotes a spatial variable and f is the temporal frequency . for 2d spin - warp imaging , data is acquired along k - space lines parallel to the ( readout ) k x - axis . since data along this readout direction is acquired almost instantaneously ( i . e . cardiac motion during the readout time interval is negligible ) and is fully sampled , we ignore the effects of sampling along the k x - dimension . hence we re - define the dkt support β 1 as follows : β i = ⋃ x supp { i ( x , y , f ) } eq . ( 14 ) where denotes the union over all x in the fov . the aim of the dynamic model estimation is to estimate this dkt support β 1 . there are two alternative methods for measuring the dkt support of the tvo as illustrated in fig9 ( a )-( b ). we begin by describing the method illustrated in fig9 ( b ). in this embodiment , we use an mr localizer scan to estimate the spatial components of the dkt support model , i . e ., the fov and the d - fov . these parameters can be derived from the localizer scan by automatically segmenting the dynamic cardiac region in the image field - of - view or by manually designating the cardiac region . alternatively , either the fov or dfov or both can be grossly estimated by other physical measurements on the subject . such gross estimates can be further refined using previously tabulated data bases . ecg or other cardiac monitor data for the subject is also collected and used to estimate the temporal components of the dkt support model , namely ( f 0 , h , w ) ( i . e ., the center frequency of the first harmonic band , the number of harmonic bands and their width ). such estimation may rely on the computation of the temporal fourier transform of the cardiac monitor data , or other extraction of frequency or period information . estimates of the significant number of harmonics and width of harmonic bands may rely on previously tabulated data - bases which correlate these quantities to the measured cardiac monitor data and results of the localizer scan . another embodiment for estimating the dkt support does not require collection of auxiliary , non - mr data . such an approach is outlined in fig9 ( a ) and will be described next . first , we note that the dkt support as defined by eq . ( 4 ), can also be expressed as : β i = ⋃ k x supp { i ( k x , y , f ) } ︸ b i ( k x ) eq . ( 15 ) this indicates that we can estimate the marginal dkt support β 1 ( k )) for a sufficiently dense set of k x - sample locations ( k x 0 , k x 1 , . . . , k x n ) and then estimate the required dkt support by forming the union of these marginal supports . fig5 shows a sampling schedule ψ dme that is used to estimate the required dkt supports by sequentially estimating the marginal dkt supports . in fig5 , a point at ( k x 0 , t ) indicates an mr acquisition at time t 0 of a line in k - space with k y being the readout direction and k x 0 being the sampling location in the phase - encode direction . as seen from the figure , we acquire such k - space data for a fixed k x 0 at a constant temporal rate , over a period of time t n , sufficient to obtain an estimate of the dkt support . for a heart beating at 1 hz , we may need to acquire such navigator data for a few tens of seconds . this acquisition then provides us with the data set { i l ( k x , k y , t )} ψ dma l = 1 . . . l , i . e ., the function i ( k x , k y , t ) sensed by the l - th coil ( l = 1 , . . . , l where l is the number of parallel receiver channels and l = 0 for the body coil , if present ) when sampled according to the dme sampling schedule ψ dme . note that due to inductive coupling , the body coil and the array of surface coils cannot be operated simultaneously , thus requiring acquisition of the dme data in two succeeding steps . panel 360 of fig1 illustrates the data that is acquired for a fixed k x - sample location ( k x 0 ). when body coil data is available , we take a 2d fourier transform of { i l ( k x , k y , t )} ψ dma l = 0 ( w . r . t . k y and t ; for k ×= k x 0 ), to obtain the dkt domain function g 0 ( y , f ). in the absence of a body coil or in case we choose not to collect the body coil data , we compute g 0 l ( y , f ) as the 2d fourier transform of { i l ( k x , k y , t )} ψ dma l = 1 . . . l w . r . t . k y and t ; for k x = k x 0 ; for l = 1 , . . . , l . next , we compute the dkt function using the following sum - of - squares formula : having computed g 0 ( y , f ) using either of the methods described above , we threshold the result in order to obtain the marginal dkt support estimate β 1 ( k x 0 ) shown in panel 364 . the thresholding removes the artifacts in the dkt support due to the subject &# 39 ; s breathing or other effects during the mr data acquisition . instead of thresholding , we can also fit a parametric model to the support of the data shown in panel 362 , to compute the dkt support model parameters . for instance , the marginal dkt support may be characterized in terms of the dimensions of the fov ( fov ), the dimensions of the dynamic fov ( dfov ), the harmonic frequency ( f 0 ), width of harmonic bands ( w ), and number of significant harmonic bands ( h ). then for a measured dkt function g 0 ( y , f ), the marginal dkt support to be used in the model can be found by solving the following optimization problem : arg min β ( fov , dfov , f 0 , h , w ) e β ( g 0 ( y , f ) ) + c ( β ) eq . ( 17 ) where β (·) defines the dkt support for a given set of parameters ( fov , dfov , f 0 , h , w ); the quantity e β ( g 0 ( y , f )) measures the fraction of the mass or energy of g 0 ( y , f ) that is contained outside the set β ; and c ( β ) penalizes the size of the set β , for instance by measuring its area . such an optimization problem can be solved numerically in order to compute the marginal dkt support . minimizing the quantity in eq . ( 17 ) provides an estimate of the dkt support that balances two conflicting aspects : ( i ) the match to the measured dkt domain function g 0 ( y , f ); and ( ii ) the cost c ( β ), which may be related to , for instance , the required t r for a valid sampling schedule for an object with dkt support β (·). by giving up a little on the fit to g 0 ( y , f ), the artifacts introduced into the reconstruction will have a small non - zero energy , but the requirements on t r may be advantageously relaxed . furthermore , because g 0 ( y , f ), is only an estimate , possibly contaminated by respiratory artifacts , a perfect fit to g 0 ( y , f ), is not desired . it is also clear that there is great flexibility available in the choice of the energy function e β (·), and cost function c ( β ), that can be used to tailor the optimization problem and resulting tradeoff to the particular application . instead of combining the dme data from all coils and then proceeding to compute the dkt support , an alternative method is the following two - step method . first , we compute the marginal dkt support as sensed by each of the receiver coils by replacing g 0 ( y , f ) in eq . ( 17 ) by | g 0 l ( y , f )| 2 . next , we take the estimated dkt support to be the union of all the marginal dkt supports . recall that the dme data can be acquired at multiple sampling locations in k x . by computing the 2d fourier transform of the data ( w . r . t . k y and t ) acquired for each of these sampling locations we obtain a series of dkt domain functions g 0 ( y , f ), g 1 ( y , f ), . . . , g n ( y , f ). we jointly estimate the dkt support to be used in the model , by solving the following modified version of optimization problem outlined in eq . ( 17 ): arg min β ( fov , d - fov , f 0 , h , w ) ∑ n = 0 n λ n e β ( g n , ( y , f ) ) + c ( β ) eq . ( 18 ) where the parameters λ n can be used to weight the influence of the different k x sample locations . this approach , although more complicated , can provide better estimates of the dkt support compared to that of eq . ( 17 ). as mentioned in the general description of the invention , the dynamic model estimate can be further refined during the mr data acquisition step . for example , the dynamic model can be updated using by performing a spectral analysis on the mr data as it is being acquired during the imaging scan . the improved dynamic model estimate could then be used to either update the sampling schedule online or in the image reconstruction stage . the final step in the prescan process 250 of fig8 is to calculate the optimal time - sequential sampling schedule at process block 256 and store it in the sampling schedule 258 . we use the estimated dkt support β 1 and the set of coil sensitivity profiles at this stage to determine the sampling schedule . the sampling schedule also depends upon the set of imaging parameters such as the desired image resolution along the phase - encode direction , as well as the predefined image - acquisition cost function in eq . ( 2 ). design of the sampling schedule : the method for calculating the sampling schedule 258 will now be described . in general the time - sequential ( ts ) sampling schedule 258 contains information about : ( 1 ) time - instants at which mr data is acquired ; ( 2 ) the slice that is excited and k - space point or k - space trajectory sampled at each of those time - instants . in the preferred embodiment ( spinwarp imaging of a single 2d slice ) the sampling schedule is a list that indicates the order in which the k y phase encodings are to be applied when acquiring image data from the subject of the examination and the time instants at which each such view should be acquired . recall that the same k - space location or view , may be sampled multiple times at different acquisition time instants , the number of repetitions determined by considerations including : desired temporal coverage and image quality , shape of the dkt support ( in particular width of the bands ), and limits on acquisition time . we now describe how the ts sampling schedule is designed based on the previously estimated dkt support β 1 at process block 254 , the coil sensitivities estimated at process block 252 , and the desired imaging parameters , especially the desired spatial resolution , and image - acquisition cost function . in a 2d parallel imaging acquisition , each receiver coil is characterized by its two - dimensional spatial sensitivity function s l ( r ). given l coils , each with complex spatial sensitivity s l ( r ), l = 1 , 2 , . . . , l , the data acquired by the l - th coil for a tvo is samples of the following function : d l ( k , t ) = ∫ fov s l ( r ) i ( r , t ) ⅇ - j 2 π k t r ⅆ r eq . ( 19 ) acquisition along the frequency encoding ( k x ) direction is sufficiently fast to be assumed instantaneous relative to the temporal dynamics of the image . therefore , the effect of the sampling along k x is ignored in our analysis . consequently , we have a 2d sampling problem in ( k y , t ) domain where each point stands for a line , or view , in ( k x , k y ). following the ts sampling theory , as presented in “ lattice theoretic analysis of time - sequential sampling of spatio - temporal signals , part i ”, by n . p . willis and y . bresler , ieee transactions of information theory , vol 43 , pp 190 - 207 , 1997 , we search for sampling schedules that lie on a ( rational ) ( k y , t ) lattice λ a , defined as follows : λ a = { ( k y , t ) : [ k y t ] = am ; m ∈ ℤ 2 } eq . ( 20 ) where denotes the set of integers and aε 2 × 2 ( referred to as the basis of the lattice λ a ) is an upper triangular matrix of the following form : a general sampling schedule will not satisfy the ts sampling constraint that restricts us to acquiring only one phase - encode line at a given time - instant . to account for this constraint , we first note that in order to reconstruct the tvo to a given spatial resolution , we need to acquire mr data only for a certain set of phase - encodes κ . in general the frequencies in set κ need not be contiguous , but for clarity we discuss the special case in which κ is defined by a range of spatial frequencies x =[ k y , min , k y , max ] and furthermore k y , min =− k y , max . we then define a sampling schedule determined by a lattice λ a *, and the desired phase - encode range , as follows : ψ a κ ={( k y , t ):( k y , t ) ελ a , k y εκ } eq . ( 22 ) hence , we acquire data for only those sets of phase - encodes which fall within the range determined by the required spatial resolution . in order for the sampling schedule ψ a κ to satisfy the ts constraint , we need the lattice with the basis matrix [ a 11 ] ε 1 × 1 to pack the set κ . this can be shown to be equivalent to the condition a 11 ≧ 2k y , max . furthermore , if we choose a 11 = 2k y , max then the resulting sampling schedule will indicate acquisition of data at a constant temporal rate ( referred to as temporally - uniform sampling ), i . e ., fixed t r (= a 22 ). for a lattice λ a , a polar lattice λ a * is defined as the lattice whose basis is the matrix a − t ( i . e transposing the matrix a and then forming its inverse ). consider a temporally - uniform ts sampling lattice λ a with basis matrix a . following the discussion above , it follows that : according to multi - dimensional sampling theory , sampling on a lattice λ a in ( k y , t ) results in replications of the spectrum in the reciprocal domain , i . e ., the dkt or the ( y , f ) domain . the replication is equivalent to convolution of the spectrum in ( y , f ) domain with the following point spread function : h ( y , f ) = 1 det ( a ) ∑ n ∈ ℤ 2 δ ( [ y f ] - a * n ) eq . ( 24 ) where δ denotes the dirac delta function ( distribution ). the transformed mr measurements , d l ( y , f ), are : for a point ( y 0 , f 0 ) εβ 1 and a lattice with basis a , define q ( y 0 , f 0 ) = { [ y f 0 ] ∈ b i i ∃ n -& gt ; ∈ ℤ 2 s . t . [ y f ] = [ y 0 f 0 ] - a * n -& gt ; ∈ b } eq . ( 26 ) which we refer to as the equivalence class ( ec ) of the dkt point ( y 0 , f 0 ). from eq . ( 25 ) it follows that for a fixed ( y 0 , f 0 ) εβ 1 , the set q ( y 0 , f 0 ) contains all the points in β 1 that alias with ( y 0 , f 0 ) when i ( r , t ) is sampled on λ a . fig1 illustrates this aliasing ; the two ends of the arrow in the figure mark members of an ec . it can be shown that the set of all ecs provides a partitioning of β 1 . now , for a fixed ec q ( y 0 , f 0 ) with a representative member ( y 0 , f 0 ) εβ 1 , eq . ( 25 ) is written in matrix form as follows : where d ( y 0 , f 0 )=[ d 1 ( y 0 , f 0 ) . . . d l ( y 0 , f 0 )] t is the collection of transformed measurements from all the coils , and i ( y 0 , f 0 ) = [ i ( [ y 0 f 0 ] - a * n -& gt ; 1 ) … i ( [ y 0 f 0 ] - a * n -& gt ; r ) ] t contains the set of unknowns at locations ( y , f ) εq ( y 0 , f 0 ) and r is the number of elements in the ec . the s ( y 0 , f 0 ) matrix is the forward matrix consisting of coil sensitivities . it is of size l × r and its l - th row is given by : in a practical setting , the measurements are corrupted by additive noise . hence , the previous matrix equation becomes : d ( y 0 , f 0 )= s ( y 0 , f 0 ) i ( y 0 , f 0 )+ v ( y 0 , f 0 ) ( eq . 27 ) a necessary and sufficient condition for the linear inverse problem in eq . ( 27 ) to be solvable is for s ( y 0 , f 0 ) to have a left inverse , i . e ., to have full column rank . for a given set of coil sensitivities , if all of the ecs for a lattice λ a and support β 1 satisfy this condition , we call that lattice “ β 1 - reconstructible .” under this condition any object with dkt support β 1 can be reconstructed from the data sampled on λ a . a general sampling design algorithm , formulated in eq . ( 2 ), finds a ts lattice λ a which is β 1 - reconstructible and that optimizes a predefined quality measure . in one embodiment , the optimality criterion is chosen to be the expected reconstruction error ( averaged over all time and spatial locations ) due to noise in the mr data . for a given ec , define φ ( y 0 , f 0 )= e [ v ( y 0 , f 0 ) v ( y 0 , f 0 ) h ] to be the noise covariance matrix of the noise vector in eq . ( 27 ). it can be shown that φ ( y 0 , f 0 ) is independent of ( y 0 , f 0 ) and is proportional ( with a known constant of proportionality ) to the covariance matrix in the data domain ( k - t space ). the data domain noise covariance matrix is estimated using standard techniques , such as those described in the article by r . m . henkelman , “ measurement of signal intensities in the presence of noise in mr images ,” medical physics , vol . 12 , pp . 232 - 233 , 1985 . in what follows , we will denote the y - f domain noise covariance matrix by φ . discretizing the β 1 support by decomposing it to a set of box - shaped pixels of size α and partitioning the set of pixels to ecs { q i } i = 1 c as defined in the last section , it can be shown that the average reconstruction error due to noise is given by : ɛ _ = e i * - i 2 2 = α ∑ i = 1 c trace { ( s i h φ - 1 s i ) - 1 } eq . ( 28 ) where s i denotes the corresponding s matrix for q i , as described above . considering eq . ( 23 ), we search for b 21 , b 22 ( which , as seen from eq . ( 23 ), specify the basis of the polar lattice ) over a discretized grid such that the number of coils l is greater than or equal to the number of elements in q ( y 0 , f 0 ) for all ( y 0 , f 0 ) εβ 1 . this eliminates most of the lattices which are not β 1 - reconstructible . furthermore , we choose the ( b 21 , b 22 ) pair which corresponds to a lattice with the smallest ε . given this optimal lattice , the sampling schedule is determined through eq . ( 22 ). this sampling schedule is guaranteed to satisfy the ts sampling constraint and achieve the optimal image quality . the sampling schedule design algorithm can be easily adapted to , incorporate several practical imaging constraints . for instance , due to hardware and specific absorption rate ( sar ) limits , we may need to enforce a lower limit on the sampling interval t r . note that t r = 1 / b 22 and hence this constraint can be easily enforced in the sampling design optimization algorithm described above . other examples include an upper limit on the total acquisition time , or a combination of all such constraints . alternatively , given a maximum allowable reconstruction error ε , one can find the ts sampling design with minimum possible t r . besides the expected reconstruction error , expected signal - to - noise ratio ( snr ) or contrast - to - noise ratio ( cnr ) can also be optimized . image reconstruction a preferred method for reconstructing an image at process block 268 ( fig8 ) using the acquired k - space data , the dkt support and coil sensitivity profiles will now be described . eq . ( 19 ) is an example of a linear transformation ( fredholm integral equation of the first kind ) from the object domain ( r , t ) to the data domain ( k , t ). reconstructing the object i ( r , t ) from available samples of d l ( k , t ) is a classical linear inverse problem and methods for reconstruction are discussed in several texts , for instance , “ introduction to inverse problems in imaging ”, by m . bertero and p . boccacci , iop publishing ltd ., 1998 . furthermore , several numerical methods for solving such problems are discussed in a book by per christian hansen entitled “ rank - deficient and discrete iii - posed problems : numerical aspects of linear inversion ”, isbn : 0 - 89871 - 403 - 6 , siam , philadelphia , 1999 . given the special structure of the observation in eq . ( 1 ), the dkt support object model and the lattice sampling locations , we derive very efficient algorithms for reconstructing the tvo from the acquired , parallel mr data . one such embodiment is described below . consider the problem of reconstructing the cine i ( x , y , t ) at specified time - instants for a fixed x = x 0 . given the mri data , we compute d ( y , f ) for all ( y , f ) using eq . ( 25 ). then , for a fixed ( y 0 , f 0 ) εβ 1 , we solve the system of linear equations in eq . ( 27 ) to recover i ( y , f ) for all ( y , f ) εq ( y 0 , f 0 ). this is possible since we have guaranteed that a solution of eq . ( 27 ) exists for all ( y 0 , f 0 ) εβ 1 , when we selected the sampling schedule to be β 1 - reconstructible . repeating the process for different points in the dkt support , we recover i ( y , f ) for all ( y , f ) εβ 1 . in a practical setting , the coil measurements are corrupted by additive noise . if an estimate of the noise covariance matrix is available ( which is usually the case in mri ), the optimal solution for eq . ( 27 ) is the linear minimum - variance estimate : i *( y 0 , f 0 )=[ s ( y 0 ) h φ − 1 s ( y 0 )] † s ( y 0 ) h φ − 1 d ( y 0 , f 0 ) eq . ( 29 ) where † denotes the moore - penrose pseudo - inverse for the term in parenthesis . alternatively , various forms of regularization such as tikhonov - type techniques can be applied , including those described in the book by p . c . hansen entitled “ rank - deficient and discrete iii - posed problems : numerical aspects of linear inversion ”, isbn : 0 - 89871 - 403 - 6 , siam , philadelphia , 1999 . the solution to eq . ( 29 ) is computed using stable numerical methods such as those described in the cited book . following the above steps we recover i ( y , f ) ( for the fixed x = x 0 ) for all points within its dkt support . furthermore , since i ( y , f ) is known to be negligible outside its dkt support β 1 , computing i ( y , f ) for all points in the dkt support is sufficient for recovery of i ( y , t ). specifically , the tvo i ( y , t ) can be reconstructed at the desired time instants , by computing the inverse fourier transform of i ( y , f ) with respect to f . the process can be repeated for different values of x 0 on a discrete grid with spacing δx determined by the desired spatial resolution , in order to recover the complete cine i ( x , y , t ) at specified resolution and time instants . a flowchart summarizing the preferred reconstruction algorithm is depicted in fig1 . denote the length of the fov along x and y by w x and w y , respectively , and the number of desired pixels along x and y by n x and n y , respectively . note that the parameter n y and the parameter k y , max that was used while designing the sampling schedule are inter - related since n y = 2w y k y , max . we also , define the period of the lattice , n p = b 22 / gcd ( b 21 , b 22 ) where b 21 and b 22 are defined in eq . ( 23 ). the number of data samples collected is denoted by n t . referring particularly to fig1 , for each of the l coils , we store the data measured by the l - th coil in a 3d matrix { circumflex over ( d )} l referred to as the data matrix of the l - th coil . the element { circumflex over ( d )} l ( p , m , n ) of the data matrix corresponds to d l ( pδk x , mδk y , nt r ) where δk x = 1 / w x and δk y = 2k y , max / n p (− n x / 2 + 1 ≦ p ≦ n x / 2 ; − n p / 2 + 1 ≦ m ≦ n p / 2 ; 1 ≦ n ≦ n t ). the data matrix at this point represents measurements in the ( k x , k y , t ) domain . given the data matrices of all the l coils {{ circumflex over ( d )} l ( p , m , n )} l = 1 l , the n x - point inverse discrete fourier transform ( idft ) along the first dimension ( corresponding to k x ) for each of { circumflex over ( d )} l ( p , m , n ) is computed and stored in the same data matrix as indicated at process block 400 . thus the data matrix now represents entries in the ( x , k y , t ) domain . a loop is then entered in which each iteration reconstructs a 1d cross section along y of the discretized object for a fixed x location of pδx . in each iteration of the loop , four steps are performed for a fixed p = p 0 which is initialized to be p 0 = n x / 2 + 1 . first , for each of the coils , we upsample the data matrix along its second dimension ( corresponding to k y ) by a factor of ┌ n y / n p ┐ where ┌ u ┐ is defined as the smallest integer larger than or equal to u . this involves interpolating the n p entries along the second dimension to a denser grid with ( n p ┌ n y / n p ┐) points using a desired interpolator such as the sinc - interpolator , or its discrete - time version , a dirichlet - kernel interpolator , or another desired interpolation kernel , which can be computed efficiently using standard signal processing techniques . the n t - point forward dft ( discrete fourier transform ) along the third dimension ( corresponding to t ) and the ( n p ┌ n y / n p ┐)- point idft ( inverse dft ) along the second dimension ( corresponding to k y ) is computed and the result is truncated to n y points ( along the second dimension ) as indicated at process block 402 . thus the data matrix entries are now transformed to the ( x , y , f ) domain . a n y × n t temporary matrix e ( representing entries in ( y , f ) domain for the fixed x 0 ) is initialized to be all zeros as indicated in process block 404 . a solution to eq . ( 27 ) is found at process block 406 using eq . ( 29 ) for discretized pixel locations in β 1 . the results are stored in e at the appropriate locations in the n y × n t matrix with the remaining entries , corresponding to pixel locations outside β 1 remaining unchanged , i . e ., having zero value . finally , the n t - point idft along the second dimension ( corresponding to f ) of the e matrix is computed at process block 408 that gives a 1d cross section ( along the y direction ) of the reconstructed tvo in ( y , t ) for the fixed x 0 location and is stored separately . the pixel index p 0 is then incremented by 1 and the loop is repeated as long as p 0 ≦ n x / 2 is within the region of interest along the x direction ( in the image domain ). after the loop is executed , the complete cine ( a discrete representation of i ( x , y , t )) is recovered by combining the stored 1d cuts as indicated in process block 410 . a preferred method for computing all dft and idft used in the reconstruction scheme is the standard 1d or 2d fast fourier transform ( fft ) routine . a number of variations of the above described reconstruction process should be apparent . for instance , an alternative embodiment would be the use of fast non - uniform transform techniques instead of the conventional fft in process blocks 402 and 406 of fig1 . an example of such techniques is the sparse data fft described in an article entitled “ a sparse data fast fourier transform ( sdfft )” by a . a . aydiner et al ., ieee transactions on antennas and propagation , vol . 51 , pp . 3161 - 3170 , 2003 . other embodiments include imaging methods for time - warped cardiac models such as the time - warped banded spectral model in addition to parametric object models such as the time - warped harmonic model as described above . | 6 |
referring to fig1 in the prior art , foups 2 are stored in a typical prior art storage rack configuration as shown with foups facing each other . the robot 16 holds one foup 2 which is shown in the process of being rotated while being moved from the front storage rack 4 a to the rear storage rack 4 b . referring to the embodiment of the present invention of fig2 the foups 2 are stored in storage racks in the same orientation . robot 16 has an extendable or bi - directional arm 50 which can move a foup 2 from the front storage rack 4 a to the rear storage rack 4 b , in the direction of the arrow , without rotation . storage racks 4 a and 4 b can be placed much closer together using this orientation because space is not needed to rotate a foup 2 as shown in the prior art of fig1 . only enough space is needed for clearance for vertical and horizontal motion of the foup 2 from bin to bin . this clearance space can be under one - half inch between the foup 2 on the bi - directional arm 50 and the racks 4 a and 4 b . however , clearances can vary depending upon the situation at hand . in the embodiment shown in fig2 the racks 4 a and 4 b can be fifteen inches apart . in the prior art shown in fig1 the storage racks 4 a and 4 b are typically twenty - four inches apart . referring to fig3 the foups 2 can be stored in storage racks 4 a and 4 b which are formed from storage rack modules 4 . the foups sit on shelves 6 containing one location or retaining pin 8 ( also known as kinematic pin ) on each shelf . a manual input / output module port 9 contains two load stations to manually input or output a foup 2 into the system . an automatic input / output port 10 can be included in an upper region for access to a factory automated material transport system . a lower frame section 12 supports the storage rack modules 4 . leveling feet 14 are mounted to the lower frame to level the modules horizontally . the rack modules shown are sized to hold three columns of foups 2 vertically and four rows of foups 2 for a total of twelve foups per module . the rack modules 4 can be stacked together both horizontally and vertically to make a larger array of foups 2 . referring to the embodiments depicted in fig2 and 4 , multiple sets of storage racks 4 are mounted on corresponding multiple sets of lower frame sections 12 with a space in between for a robot 16 to traverse . the robot 16 traverses horizontally on linear bearing rails 28 . the linear bearing rails 28 are typically mounted to a u - shaped frame 18 for support . the robot 16 allows vertical motion of the bi - directional arm 50 . the robot 16 moves a horizontal arm mount 52 holding the bi - directional arm 50 using linear motors 24 on a vertically mounted linear bearing 26 . a linear encoder 30 is mounted parallel to the linear rail 26 and linear motor 24 . a horizontally mounted service loop box 20 is mounted parallel to the linear bearing rails 28 and next to the u - shaped frame 18 . the service loop box 20 contains the cables for power and communication to the moving robot 16 . a blower 31 is mounted on the service loop box to exhaust any particles in the service loop box . diagonal stiffeners 22 are mounted to aid in stability of the robot 16 . the robot 16 traverses longitudinally up and down the aisle between the racks 4 a and 4 b . the bi - directional arm 50 is attached to the robot 16 by attaching to the linear bearing blocks on the linear bearing rail 26 to allow travel in the vertical direction . a counter weight 40 is connected to the bi - directional arm assembly 50 using cables 150 passing over grooves in a pulley 152 at the top of the robot tower 16 . the grooves prevent pinching of the cable . the counter weight 40 is sized to balance the bi - directional arm assembly 50 and foup 2 . an electromechanical brake 154 is attached to the pulley 152 to provide braking action of the vertical motion of the bi - directional arm 50 . the space between foup 2 and the storage rack 4 a and a foup 2 resting in the storage rack 4 a can be one - half inch . [ 0032 ] fig5 a - 5c show in schematic fashion an embodiment of a bi - directional arm 50 consisting of baseplate or base stage 52 , middle plate or stage 54 , upper plate or stage 56 and conveyance platform 58 which slide or move relative to each other generally along a linear path or axis in an offset manner . the conveyance platform has three kinematic or retaining pins 8 attached to fit in the bottom grooves of the foup 2 . fig5 a shows the bi - directional arm assembly 50 extended to one side on the right with the middle stage 54 at far right end of travel and upper stage 56 at far right end of travel and the conveyance platform or stage 58 at far right end of travel . fig5 b shows the bi - directional arm assembly 50 retracted to the middle position . the lower stage 52 and upper stage 56 are the dimensionally same length as the foup 2 to provide the minimum aisle width 60 . fig5 c shows the bi - directional arm assembly 50 fully extended to the opposite side on the left to reach under foup 2 . the power and data cables for driving the multiple stages may not need to be routed through all the stages requiring multiple service loops . the bi - directional arm 50 allows a closer spacing of the shelves 6 in the storage racks 4 , thus increasing the possible storage density of the storage racks 4 . referring to fig6 a - 8c , one embodiment of the present invention of the drive mechanism for the lower stage includes a linear motor with an electrical armature coil 62 attached to middle stage 54 and a magnet assembly 64 attached to the baseplate 52 . a separate linear encoder head 66 a and tape 66 b is mounted parallel to each linear motor to provide motor commutation and position location information . a linear bearing rail 68 is attached parallel to the magnet assembly and the linear encoder scale on the baseplate 52 . the drive mechanism for the upper stage 56 is similar , with an electrical armature coil 70 attached to the middle stage 54 and a magnet assembly 72 attached to the upper stage 56 and a linear bearing rail 74 attached to the upper stage 56 to provide directional stability between the upper stage 56 and the middle stage 54 . a third linear bearing rail 76 is attached to the top of the upper stage for the conveyance platform . a linear bearing block 78 assembly for the lower stage 52 linear bearing rail is attached to the middle stage 54 . likewise , a linear bearing block assembly 80 for the upper stage 56 linear bearing rail is attached to the middle stage 54 . a linear bearing block assembly 82 for the conveyance platform 58 is attached to the conveyance platform 58 . referring to fig9 a - 9c , an alternative embodiment of the bi - directional arm in the present invention is shown . three equal length stages are shown . the baseplate 130 remains fixed in the center position . the middle stage 132 moves to the left or right or side to side on a linear bearing rail 142 . the upper stage 134 moves to the left or right on a linear bearing rail 144 . the conveyance platform 136 moves to the left or right on a linear bearing rail 146 . the stages can be connected together using a combination of belts , cables and drive motors . referring to fig1 a - 10c , one embodiment in the present invention of the drive mechanism for the conveyance platform 58 is a continuous loop belt 84 drive mounted on two sprockets and to the conveyance stage 58 on the opposite side of the sprockets . when the upper stage motor drive is commanded to move , the belt rotates around the sprockets 86 with each side moving in opposite directions . with one side of the belt attached to the middle stage 54 and the other side attached to the conveyance platform 58 and moving in the opposite direction , the conveyance platform is moved in the same direction as the upper stage 56 . [ 0036 ] fig1 depicts a sequence of process steps for the manufacture of wafer products such as semiconductor chips from blank bare wafers to the consumer . a bare wafer 100 is stored in a storage pod 102 such as a foup or smif pod or cassette . several of these storage pods are stored in a storage rack 104 until needed for processing . the storage pods are transferred to lithography processing 106 and then can go into more storage racks 108 waiting for the process steps 110 . after processing then metrics measurement 112 may be made and then put into more storage racks 114 . typically , twenty or more additional loops around the process loop will occur . once the wafer has completed processing , the wafers are cut up during chip separation 116 into individual chips and the chip interconnect attachments 118 are attached . the completed chips are then delivered to a vendor 120 who will then deliver them to the end consumer 122 . each storage rack 104 , 108 and 114 can include racks 4 a and 4 b with a robot 16 and bi - directional arm 50 for moving the storage pods . in addition , storage racks for storing tools such as reticles and including a robot 16 with a bi - directional arm 50 can be included in the process wherein reticles are conveyed to a process station . [ 0037 ] fig1 depicts the bi - directional arm 50 and one embodiment of a bi - directional arm mount 51 with a passive foup retainer 150 . the top cross member of the passive foup retainer 150 can be spaced above the foup 2 , when the foup is seated properly on the kinematic pins 8 located on the conveyance plate 58 . the kinematic or locating pins 8 are dimensionally taller than the space between the foup 2 and passive foup retainer top cross member 150 to keep the foup from lifting off the kinematic pins during movement of the bi - directional arm 50 . the passive foup retainer 150 can be rotated on pins 152 out of the way to allow access to the foup 2 if required . pin 154 holds the passive foup retainer 150 in place during normal operation and is removed to allow rotation . alternatively , the passive foup retainer can be designed as a pocket to hold the foup 2 and require lifting of the foup 2 to clear the pocket . in operation , a person can place a foup 2 into the input / output load port 9 to be placed into storage bin located in the storage rack 4 . the robot will move to place the bi - directional arm 50 in proper position below the foup in the input / output load port . the bi - directional arm 50 will extend both the middle stage 54 and the upper stage 56 towards the foup 2 . the conveyance platform 58 will also extend by virtue of the upper stage 56 extending relative to the middle stage 54 . once in proper position , the bi - directional arm assembly 50 will move vertically to engage the foup 2 on the kinematic or locating pins 8 on the conveyance plate 58 . the bi - directional arm assembly 50 will continue moving vertically to allow the foup 2 to clear the kinematic pins 8 on the input / output port 9 . once the foup 2 is clear of all potential obstructions , the middle stage 54 and upper stage 56 will retract towards the middle position . when the bi - directional arm 50 has retracted all stages to the middle location , the bi - directional arm 50 can move both vertically and horizontally to a storage bin . once the foup 2 is in position at a storage bin location , the bi - directional arm 50 will repeat the aforementioned steps to place the foup 2 onto the kinematic locating pins 8 on a shelf 6 . once the foup 2 is seated on the kinematic pins 8 , the bi - directional arm 50 will retract to the center position to repeat the operation with another foup 2 . a similar operation can occur at the automatic input / output port 10 . a benefit of using the storage technique described in the present invention is to minimize the footprint of the storage system . for example , a typical semiconductor facility is very costly to build and equip with process tools and storage racks . the cost per square foot is very high and much effort is entailed to reduce the space required for the non - productive storage of wafers and to allow more room for processing equipment . a typical semiconductor manufacturing facility may use as many as twenty to fifty storage racks for both short term and long term storage of wafers during their processing . the storage technique described in this invention achieves a smaller footprint and higher density for storage racks . eliminating the need to rotate the object to be stored prior to placing the object onto the storage rack eliminates the space needed to rotate the object . the use of the bi - directional arm is one method to move objects from one location to another location inside the storage rack . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims . for example , other preferred embodiments can be made to store smif pods , wafer cassettes , reticles , or any other object such as common inventory items instead of foups 2 . modifications to the conveyance platform 58 and storage rack 4 and shelves 6 can be made depending upon the situation at hand . also , the conveyance platform 58 can be made to grip the object from the top or side in addition to the bottom of the object . an active gripper can be employed in place of a passive gripper on the conveyance platform , as required for the object . typically , objects are stored on both sides of the track axis aisle in the same orientation such that if looking at the object from the track axis aisle , on one side the front of the object is visible and on the other side of the track axis aisle the rear of the object is visible . alternatively , the objects can be stored such that the left side is visible from the aisle on one rack and the right side of the object is visible from the aisle on the opposite rack . also , one rack could be eliminated thus having a rack only on one side of the aisle . the bi - directional arm can be used in a system with storage on one side and the input / output ports on the opposite side . this allows access to the stored items through a door without having to enter the system . the drive mechanism for the bi - directional arm 50 can be made from a single drive motor and belts or cables connecting the remainder of the stage . also , drive motors can be placed on each stage to eliminate the use of belts . a rotary motor can be used in place of linear motors using either rack and pinion gearing or belts or cables . the drive mechanism for the vertical motion of the bi - directional arm or the lateral motion of the robot back and forth along the aisle can be a rotary motor with or without belts in place of linear motors . wheels can be used in place of the linear bearing rails for linear motion . the robot 16 can also be constructed using either a single tower or multiple towers . rotary encoders may be used in place of linear encoders . alternatively , linear positioning technology using the linear motor magnets field or other similar technology can be used in place of the optical based linear encoders . a multi - axis angular motion arm can be mounted to the robot to reach and grip the object in place of the linear motion of the bi - directional arm . an optional rotator may be attached to the bi - directional arm 50 to allow high density storage of this objects such as reticles . by adding the rotator , the slide extension mechanism may not need to extend under or over the object in the storage rack . the rotator can also reduce the number of extension levels required . the rotator may facilitate rotation of the gripping means to permit insertion or retraction of the object in a specialized storage location . various features of the present invention can be omitted or combined . the bi - directional arm can be operated in other orientations such as on edge , vertically or at an angle . the bi - directional arm can be used for non - storage uses . | 1 |
certain embodiments of the present invention provide a mechanism to enable a wlan station ( which may also be referred to as a mobile station ) to query an access point ( ap ) to verify whether a roaming agreement is in place between the mobile station service provider and the provider owning the access point . the mobile station may send a probe request to the access point providing a roaming identifier ( roaming id ) assigned by the mobile station service provider ( sp ). the access point may use the roaming id to verify whether roaming is supported for this mobile station . if roaming is enabled , the access point may reply with a probe response providing the mobile station with the list of ssids to be used to connect to the network . alternatively , the mobile station may send a probe request to the access point providing a string ( for example , “ 3gpp ”) to be used as a wild card in probing for supported ssids . the access point uses the string to verify whether any ssid matching the string are supported . if roaming is enabled , the access point replies with a probe response providing the mobile station with the list of ssids to be used to connect to the network . certain embodiments of the present invention may advantageously move the burden of determining if there is a roaming agreement from the mobile station to the network . certain embodiments of the present invention may also advantageously not require complex clients in mobile station to manage roaming lists . additionally , certain embodiments of the present invention may advantageously enable the access point to assert an identity ( or several ), because the access point may be required to provide a list . certain embodiments of the present invention may require definition of a new field in probe request message , or definition of a new management / action frame . additionally , as with all unauthenticated signaling , security of the reply may be able to be guaranteed only through signatures . as illustrated in fig1 , the mobile station may present 110 a roaming id . the access point may then receive 120 the roaming id . the access point may then determine 130 whether a list of roaming ids that are supported is available locally . if the list is not available locally , the access point may retrieve 140 the list of roaming ids from elsewhere . once the access point has an available list , the roaming id provided by the mobile station can be compared 150 with the list . the access point may then determine 160 whether the roaming id is valid . if the roaming id is not valid , the access point may not provide 170 a list of service set identifiers ( ssids ) to the mobile station . otherwise , if the roaming id is valid , the access point may provide 180 a list of ssids to the mobile node . the roaming id can be in the form of a network access identifier ( nai ) or any other format . in a simple embodiment , illustrated in fig1 , the access point can be pre - configured with a list of roaming ids supported . alternatively , the access point may retrieve the information using a protocol ( e . g . control and provisioning of wireless access points ( capwap )). the access point can compare the provided roaming id with the list and determine whether or not to provide a list of ssids to the mobile station . in one embodiment , illustrated in fig2 , the probe request may be extended to include a wildcard such as “* 3g *” or a group identifier . the group identifier could reference a predefined set of ssids such as ssid 1 , ssid 2 , . . . ssidn . the probe response is extended with a list of information elements ( ies ) containing ssids to be used by the mobile station for access while roaming with the roamingid . if extended service set identifier ( essid ) and path selector are adopted , then the essid and path selector values should also be returned . in another embodiment , illustrated in fig3 , the probe request is extended with the roaming id provided in a nai request information element . if username privacy is required , then the anonymous “@ realm ” form of nai may be used . the ack bit may be set in the flags octet by the access point to indicate whether the nai is acceptable or not . as in the previous embodiment , the probe response can be extended with a list of les containing ssids to be used by the mobile station for access while roaming with the roamingid . if essid and path selector are adopted , then also the essid and path selector values can be returned . there may be certain security considerations . for example , discovery of a roaming agreement takes place before the mobile station associates and authenticates . therefore , the mobile station cannot verify the validity of the reply from the access point , as is the case conventionally with all 802 . 11 management / action frames exchanged before the mobile station associates and authenticates . a rogue access point could thus send a false reply luring the mobile station to try to connect to the rogue access point , or to carry out a denial of service ( dos ) attack . however , such a dos attack is not worse than the dos attacks that are conventionally possible with probe response messages generated by rogue access points , therefore certain embodiments of the present invention do not introduce new security risks . however , if one wanted to optionally improve on the current security level , to avoid such issues one enhancement of the invention would be to allow the access point to return the information to the mobile station signed in such a way that the mobile station can verify its validity . to achieve this , the mobile station can be configured by the mobile station service provider ( sp ) with a set of public / private keys needed to verify the signature by the vsp ( visited sp ). as illustrated in fig4 , a roaming partner visited sp ( vsp ) sends its identity vsp id and public key puk ( vsp ) to the mobile station sp when the roaming agreement is established and as an off - line operation , and the mobile station sp returns a signed copy of puk ( vsp ) and vsp id , together with a key id that denotes which private key has been used by the mobile station sp ( in case the mobile station and the mobile station sp share multiple pairs of public / private keys ). the signed copy of puk ( vsp ) and vsp id , together with the key id , is distributed by vsp to its access points . when the mobile station queries the access point with its roaming id and providing a nonce n , and the access point determines that the roaming id is valid for roaming to that access point , the access point replies with a probe response message providing the ssid to be used by the mobile station ( together with additional optional information ) and the nonce n , both signed together using the private key of the vps , and provides the signed copy of puk ( vsp ) and vsp id together with the key id upon receiving such information , the mobile station first verifies the validity of the vsp public key by verifying the signed copy of puk ( vsp ) and vsp id based on the public key of the mobile station sp corresponding to the key id . the mobile station then proceeds to verify the signature of the vsp based on puk ( vsp ), and determines the validity of the reply by obtaining the same nonce n it initially sent . the mobile station then associates to the access point using the provided ssid . it could be argued that this solution could permit more dos attacks to the access point , since a rogue mobile station can spoof mac addresses and send many requests to the access point using valid roaming id . this could cause the access point to compute several signatures , thus impacting the access point . to solve this , puzzles can be used . a puzzle is a mathematical value that the receiver needs to transform according to predefined rules and that takes some computation to transform . the sender of the puzzle can have pre - computed the transformation offline . only a legitimate receiver will spend the time performing such computation , whereas a rogue node would not do that . puzzles are not waterproof solutions , but serve to limit the number of attacks . with the use of puzzles , the solution works as follows , and is partially illustrated in fig5 . the mobile station is configured by the mobile station sp with a set of public / private keys needed to verify the signature by the vsp . a roaming partner vsp sends its identity vsp id and public key puk ( vsp ) to the mobile station sp when the roaming agreement is established and as an off - line operation , and the mobile station sp returns a signed copy of puk ( vsp ) and vsp id , together with a key id that denotes which private key has been used by the mobile station sp . the signed copy of puk ( vsp ) and vsp id , together with the key id , is distributed by vsp to its access points . when the mobile station queries the access point with its roaming id and providing a nonce n , and the access point determines that the roaming id is valid for roaming to that access point , the access point replies with a probe response message providing a puzzle p . upon receiving the puzzle , the mobile station performs the predefined transformation obtaining p ′, and returns it in a new query to the access point . after verifying the validity of p ′, and only after doing so , the access point generates a probe response message providing the ssid to be used by the mobile station ( together with additional optional information ) and the nonce n , both signed together using the private key of the vps , and provides the signed copy of puk ( vsp ) and vsp id together with the key id . upon receiving the probe response , the mobile station first verifies the validity of the vsp public key by verifying the signed copy of puk ( vsp ) and vsp id based on the public key of the mobile station sp corresponding to the key id . the mobile station then proceeds to verify the signature of the vsp based on puk ( vsp ), and determines the validity of the reply by obtaining the same nonce n it initially sent . the mobile station associates to the access point using the provided ssid . as shown in fig6 , a station 610 , which may be mobile , may communicate with an access point 620 over a communication medium 630 . the communication medium 630 may , for example , be a wireless connection . the station 610 may include a transmission portion 612 , which is able to transmit signals for the station 610 and which is able to communicate with a processor portion 614 of the station 610 . the station may also include a reception portion 616 , which is able to receive signals for the station 610 and which is able to communicate with a processor portion 614 of the station 610 . although they are illustrated as separate portions , the invention is not limited to embodiments with stations having separate receiving , transmitting , and processing portions . the access point 620 may similarly include a transmission portion 622 , which is able to transmit signals for the access point 620 and which is able to communicate with a processor portion 624 of the access point 620 . the access point may also include a reception portion 626 , which is able to receive signals for the access point 620 and which is able to communicate with a processor portion 624 of the access point 620 . although they are illustrated as separate portions , the invention is not limited to embodiments with access points having separate receiving , transmitting , and processing portions . although embodiments of the present invention are described in terms of a 3gpp wlan , embodiments of the present invention extend to other contexts and other wlan environments . additionally , embodiments of the present invention may not necessarily conform to ieee 802 . 11 standards , though some embodiments do so conform . furthermore , the mobile station and access point described above may be implemented variously as one of ordinary skill in the art would understand . for example , the above - described transceiver may be implemented as a separate receiver and separate transmitter coupled by a processor . a general purpose computer or a application specific integrated circuit ( asic ) may be used to implement the invention in hardware . the above description of the invention , therefore , is exemplary and permissive , and should not be understood to limit the invention to the particular described embodiments . | 7 |
fig1 is a plan view of a one piece monolithic actuator block generally designated 2 . the stock material of the block is fabricated in a conventional manner with alternating layers of piezoelectric material silk screened with electrical conductors . this is normally done using either a tape cast process or a &# 34 ; waterfall &# 34 ; process . an array 8 of piezoelectric actuators 10 , 10 is fabricated from the block of stock material with a conventional multi - layer construction as part of the block 2 . the array 8 is made from a one piece laminated block which is subsequently saw cut to create spaces 14 , 14 and 16 , 16 between each actuator 10 . each actuator 10 has a top support surface 16 which is coplanar with the other such surfaces and extends substantially parallel with the lower surface 18 of the base 12 . by way of illustration , the cuts made in the block 2 are such that each actuator is about 5 mm square and has a height taken from the base of between about 10 - 20 mm . the actuators 10 are each integrally connected by a common base 12 to create a &# 34 ; brush &# 34 ; like configuration . the process employed by the invention uses a low &# 34 ; binder &# 34 ; process that permits complete binder burn - off in the solid block state . however , burn off may be done after cutting as an option . in addition , fiducials are placed on the block that ensure consistently accurate placement of the silk screened conductor electrodes on each layer . the location accuracy of these electrodes ensures that the proper ones are duly exposed during the machining process that generates the integral actuators . this process not only exposes the electrodes properly , but eliminates the sand blasting step normally used for electrode exposure in producing conventional circular actuators . the side view shown in fig2 shows the actuators attached to their common base and these exposed alternate electrodes . the other side of the same actuator looks the same , but what is exposed are the other set of electrodes . as shown in fig3 each actuator 10 , 10 has a configuration of multilayers 20 and 22 which are comprised of oppositely charged electrodes which are printed onto stacked layers of piezoelectric ceramic in a vertically interdigitated manner as illustrated . the consecutively ordered layers are oriented such that they are stacked on one another , in an alternating fashion , such that electrodes , of like polarity have an electrode layer of opposite polarity interposed therebetween such that all of the electrodes are in the proper spatial relationship . the internal electrodes are silk screened in a conventional manner onto the piezoelectric ceramic substrate and are aligned with each other using fiducial references . as best seen in fig3 the silk screened electrode pattern on alternate layers is exposed to one side of each actuator and a conductor wire 32 is run the full length thereof making electrical contact with each associated alternate layer . each wire conductor 32 is subsequently connected to the actuator drive electronics for electrical actuation purposes . by connecting all of the conductive layers on each side of the actuator together , they can all be energized simultaneously with the same voltage . the result is that each actuator stack is a minimum capacitance , parallel electrical , series mechanical device . the connection shown in fig3 uses a flexible insulator which has conductor runs silk screened on one surface , making contact via conductive epoxy to the vertically exposed , alternate actuator conductors . each actuator has its own lead so that all of the actuators are capable of being independently actuated . the square cross section of the actuator has an inherent benefit over a circular one in that it is less sensitive during the manufacturing process to dimensional variations in exposing the electrodes . that is , the exposed electrodes are disposed in a &# 34 ; plane &# 34 ; rather than in a &# 34 ; line &# 34 ;. fig4 depicts the actuator array block 2 assembled with a deformable mirror or face plate 44 having a reflective surface 43 and an opposite surface 45 attached to a base plate 46 . typically , the array block 2 has a width sufficient to match the diameter of the mirror 44 . the base plate 46 has a flat support surface 48 and the array block 2 is bonded to the common base at the surface 48 . both the bottom surface 18 of the actuator array block 2 and top surface 48 of the base are configured flat to ensure proper contact . likewise , the top surface 16 of each of the actuators 8 , 8 is made planar to ensure proper mating with the back surface 45 of the face plate 44 of the assembly . as seen in fig2 the tops of all of the actuators are coplanar , and to which the backside 45 of the thin deformable face plate 44 is connected by epoxy . each row of actuators 10 , 10 has a thin flexible conductor with a lead 49 , 49 tracing from each actuator row and terminating on either end of the row with connectors 51 , 51 . for ease of illustration , only the first two rows of the fig4 have been shown with such lead and tracing connectors . shown also in fig4 are areas aa where extra or nonfunctional &# 34 ; actuators &# 34 ; otherwise generated as part of the fabrication process have been removed . in use , the control electronics cause selective ones of the conductors 32 to be energized by a voltage source thereby causing an elongation of the involved actuator ( s ) 10 . since each actuator 8 is fabricated in a conventional tape cast or water fall multi - layer construction using a piezoelectric material , each actuator in each array layer is changeable in length with voltage such that upon energization of selective one ( s ) of the actuators 10 , 10 a local bump or depression is created at the back surface 45 of the mirror 44 . bias voltages of all actuators are sometimes used such that motion of the mirror surface can be in either direction , i . e ., plus or minus . the invention is a unique configuration for a deformable mirror using piezoelectric type actuators made from a single block . the invention thus embodies a monolithic block containing all of the actuators for the deformable mirror , where each actuator has the capability of being actuated individually . accordingly , the invention has been described by way of illustration and not limitation . | 6 |
fig1 is an overall side view of a preparation instrument employing an emulsion preparation device of a first embodiment of the present invention . the preparation instrument 100 is constructed from a device 1 and syringes 8 and 9 linked to both sides of the device 1 . the syringe 8 is constructed from a cylinder 81 and a plunger 82 . the syringe 9 is constructed from a cylinder 91 and a plunger 92 . fig2 is a sectional side view of the device 1 . the device 1 is constructed such that the first cylindrical member 2 and the second cylindrical member 4 are joined into a single piece by outer flanges 29 and 49 in the aperture periphery . here , it is preferable that the device 1 is constructed from a sterilizable material . the first cylindrical member 2 is constructed from a first cylinder part 21 and a second cylinder part 22 continuous to the first cylinder part 21 . the second cylinder part 22 has a smaller diameter than the first cylinder part 21 . in the first cylindrical member 2 , a first mesh part 31 is formed at the boundary between the first cylinder part 21 and the second cylinder part 22 . then , in the first cylindrical member 2 , fibers 32 are pushed in toward the first mesh part 31 and the second mesh part 33 is pushed against the fibers 32 . that is , the fibers 32 are pushed and loaded into a space 30 between the first mesh part 31 and the second mesh part 33 . the first mesh part 31 , the fibers 32 , and the second mesh part 33 constitute a filter part 10 . here , the first mesh part 31 and the second mesh part 33 are disks provided with a large number of through holes . the fibers 32 loaded in the space 30 constitute a fiber aggregate filling the space 30 . in the fiber aggregate , a large number of small voids are formed between the fibers . thus , in the filter part 10 , liquid can move back and forth from the first mesh part 31 to the second mesh part 33 and vice versa passing through the voids in the fiber aggregate . the second mesh part 33 is the bottom face of a concave lid 23 fit onto the first cylinder part 21 . in the concave lid 23 , the outer flange 231 in the aperture periphery abuts against the aperture periphery 211 of the first cylinder part 21 so that the second mesh part 33 is positioned in the inside of the first cylinder part 21 at a predetermined distance to the first mesh part 31 and in parallel thereto . a luer taper 48 is formed at the aperture end of the second cylindrical member 4 . a luer taper 28 is formed also at the aperture end of the second cylinder part 22 of the first cylindrical member 2 . the first cylindrical member 2 and the second cylindrical member 4 are in fluid communication with each other through apertures 20 and 40 of the same size as each other . fig3 is a view of the first mesh part 31 taken in the arrow iii direction . the first mesh part 31 includes a large number of through holes 311 ( i . e ., through holes 311 a , 311 b , and 311 c ) of arc shape arranged uniformly in a concentric manner . all the through holes 311 have the same area as each other within an error range of 10 %. the second mesh part 33 also has the same configuration as the first mesh part 31 . the fibers 32 are of a hydrophobic fiber . as the hydrophobic fiber , polyester , polypropylene , polystyrene , teflon ( registered trademark ), nylon , polyvinyl chloride , acrylics , or the like may be employed . however , polyester is preferable . it is preferable that the fibers 32 are crimped . the fibers 32 have 50 to 150 deniers and are loaded into the space 30 such that 2 . 5 to 17 . 7 mm are present per 1 mm 2 of the 2 c space 30 . here , it is preferable that loading is performed such that 4 . 0 to 12 . 0 mm are present , and it is more preferable that loading is performed such that 5 . 0 to 9 . 9 mm are present . the preparation instrument 100 shown in fig1 is used as follows . that is , an emulsion preparation method employing the device 1 is as follows . here , in the preparation instrument 100 , the syringe 8 is charged with a dispersed phase 101 and the syringe 9 is charged with a continuous phase 102 . however , a reversed situation may be employed . first , the plunger of one syringe is pushed . for example , pumping operation in the direction a is performed on the plunger 82 of the syringe 8 . by virtue of this , the dispersed phase 101 moves through the device 1 to the syringe 9 so that the plunger 92 of the syringe 9 is pushed aside in the direction a . at that time , in the syringe 9 , the dispersed phase 101 is somewhat mixed with the continuous phase 102 . next , pumping operation in the direction b is performed on the plunger 92 of the syringe 9 . by virtue of this , the dispersed phase 101 and the continuous phase 102 somewhat mixed with each other move through the device 1 to the syringe 8 so that the plunger 82 of the syringe 8 is pushed aside in the direction b . at that time , in the device 1 , both phases 101 and 102 somewhat mixed with each other pass through the filter part 10 . that is , both phases 101 and 102 somewhat mixed with each other first pass through the second mesh part 33 so as to be dispersed and mixed at that time , then pass through the fibers 32 so as to be further dispersed and mixed at that time , and then pass through the first mesh part 31 so as to be further dispersed and mixed at that time . thus , both phases 101 and 102 having moved to the syringe 8 are in a state of being mixed more than in the syringe 9 . next , pumping operation in the direction a is performed on the plunger 82 of the syringe 8 . by virtue of this , both phases 101 and 102 mixed more with each other move through the device 1 to the syringe 9 so that the plunger 92 of the syringe 9 is pushed aside in the direction a . at that time , in the device 1 , both phases 101 and 102 mixed more with each other pass through the filter part 10 . that is , both phases 101 and 102 mixed more with each other first pass through the first mesh part 31 so as to be dispersed and mixed at that time , then pass through the fibers 32 so as to be further dispersed and mixed at that time , and then pass through the second mesh part 33 so as to be further dispersed and mixed at that time . thus , both phases 101 and 102 having moved to the syringe 9 are in a state of being mixed more than in the syringe 8 . as such , pumping operation on the plunger 82 of the syringe 8 and pumping operation on the plunger 92 of the syringe 9 are repeated alternately . it is preferable that the number of times of the pumping operation is 50 times or smaller . further , ten times or smaller is more preferable and five times or smaller is the most preferable . by virtue of this , the state of mixing of both phases 101 and 102 progresses further into a state of emulsion which is a target state . here , the fibers 32 are of a hydrophobic fiber . thus , the oil phase serves as a continuous phase and the aqueous phase serves as a dispersed phase so that a water - in - oil type emulsion is formed . according to the device 1 of the configuration , the fibers 32 have 50 to 150 deniers and are loaded into the space 30 such that 2 . 5 to 17 . 7 mm are present per 1 mm 3 of the space 30 . thus , both phases 101 and 102 can be dispersed and mixed efficiently so that a desired emulsion can be formed . further , in the first mesh part 31 and the second mesh part 33 , the through holes 311 of the same area as each other are arranged uniformly . thus , dispersion of both phases 101 and 102 occurs uniformly in the entire region of the mesh part . thus , also from this point , both phases 101 and 102 can be dispersed and mixed efficiently . further , the fibers 32 filling the space 30 have predetermined thickness and length . further , the first mesh part 31 and the second mesh part 33 include a large number of the through holes 311 of arc shape and hence have a large void ratio . thus , the sliding resistance at the time of pumping operation can be reduced . this improves the operability . fig4 is an overall side view of a preparation instrument employing an emulsion preparation device of a second embodiment of the present invention . the preparation instrument 100 is constructed from a device 1 a and syringes 8 and 9 linked to both sides of the device 1 a . the syringe 8 is constructed from a cylinder 81 and a plunger 82 . the syringe 9 is constructed from a cylinder 91 and a plunger 92 . fig5 is a side view of the device 1 a . fig6 is a sectional side view of the device 1 a . the device 1 a is different from the device 1 of the first embodiment in the following points . ( i ) the aggregate of the fibers 32 filling the space 30 is located in the center of the longitudinal direction . ( ii ) the external shape is bilaterally symmetric in the longitudinal direction . ( iii ) liquid surface adjustment ribs 93 and 95 are provided . the device 1 a is constructed such that the first cylindrical member 2 and the second cylindrical member 4 are joined into a single piece by outer flanges 29 and 49 in the aperture periphery . here , it is preferable that the device 1 a is constructed from a sterilizable material . the first cylindrical member 2 is constructed from a first cylinder part 21 and a second cylinder part 22 continuous to the first cylinder part 21 . the second cylinder part 22 has a smaller diameter than the first cylinder part 21 . in the first cylindrical member 2 , a first mesh part 31 is formed at the boundary between the first cylinder part 21 and the second cylinder part 22 . then , in the first cylindrical member 2 , fibers 32 are pushed in toward the first mesh part . 31 and the second mesh part 33 is pushed against the fibers 32 . that is , the fibers 32 are loaded into a space 30 between the first mesh part 31 and the second mesh part 33 . the first mesh part 31 , the fibers 32 , and the second mesh part 33 constitute a filter part 10 . here , the first mesh part 31 and the second mesh part 33 are disks provided with a large number of through holes . the fibers 32 filling the space 30 constitute a fiber aggregate filling the space 30 . in the fiber aggregate , a large number of small voids are formed between the fibers . thus , in the filter part 10 , liquid can move back and forth from the first mesh part 31 to the second mesh part 33 and vice versa passing through the voids in the fiber aggregate . the second mesh part 33 is the bottom face of a concave lid 23 fit onto the first cylinder part 21 . in the concave lid 23 , the outer flange 231 in the aperture periphery abuts against the aperture periphery 211 of the first cylinder part 21 so that the second mesh part 33 is positioned in the inside of the first cylinder part 21 at a predetermined distance to the first mesh part 31 and in parallel thereto . the first cylindrical member 2 and the second cylindrical member 4 are in fluid communication with each other through apertures 20 and 40 of the same size as each other . then , the aggregate of the fibers 32 filling the space 30 is located in the center of the longitudinal direction . that is , the space 30 is located in the center of the longitudinal direction . further , as seen from fig5 , the external shape of the device 1 a is bilaterally symmetric in the longitudinal direction . that is , the first cylindrical member 2 includes an outer flange 29 in the aperture periphery , a large flange 91 , a small flange 92 , a liquid surface adjustment rib 93 , and a connection end part 94 . on the other hand , the second cylindrical member 4 includes an outer flange 49 in the aperture periphery , a liquid surface adjustment rib 95 , and a connection end part 96 . then , when the first cylindrical member 2 and the second cylindrical member 4 abut against each other at the outer flange 29 and the outer flange 49 so as to be joined together , in the device 1 a , the large flange 91 is located in the center of the longitudinal direction . further , on both sides thereof , the small flange 92 and the outer flanges 29 and 49 joined into a single piece are located similarly . furthermore , on both sides thereof , the liquid surface adjustment rib 93 and the liquid surface adjustment rib 95 are located similarly . further , on both sides thereof , the connection end part 94 and the connection end part 96 are located similarly . as a result , the device 1 a is bilaterally symmetric in the longitudinal direction . the first mesh part 31 , the fibers 32 , and the second mesh part 33 are the same as those in the first embodiment . when the preparation instrument 100 shown in fig4 is used similarly to the first embodiment , an emulsion can be formed similarly to the first embodiment . further , in the device 1 a , as shown in fig7 , parts where the formed emulsion remains are spaces 71 and 72 , whose volumes are small . thus , according to the device 1 a , the generation efficiency for an emulsion can be improved . further , in the device 1 a , the liquid surface adjustment ribs 93 and 95 indicate the upper limits for the height positions of the continuous phase and the dispersed phase at the time of air vent , and serve as guides used when the plungers 82 and 92 are pushed for air vent . thus , according to the device 1 a , the workability of air vent can be improved . ( 1 ) the fibers 32 may be of a hydrophilic fiber . for example , cotton , rayon , vinylon , or the like may be employed . in this case , the aqueous phase serves as a continuous phase and the oil phase serves as a dispersed phase so that an oil - in - water type emulsion is formed . ( 2 ) the first mesh part 31 and the second mesh part 33 may be disks as shown in fig8 or 9 . the mesh part in fig8 includes a large number of through holes 312 ( i . e ., through holes 312 a , 312 b , and 312 c ) of arc shape aligned in a concentric manner . then , the area of each through hole 312 becomes larger as being located in the outer side . the mesh part in fig9 includes a large number of circular holes 313 distributed uniformity . then , all the circular holes 313 have the same area as each other . ( 3 ) the first mesh part 31 and the second mesh part 33 may have a shape other than the disk and , for example , may have the shape of a block . ( 4 ) a mixed solution of a dispersed phase and a continuous phase may be loaded in any one of the syringe 8 and the syringe 9 . in this case , no liquid is loaded in the other one . the device 1 of examples 1 to 14 and the device 1 a of example 15 were prepared . then , emulsion check test a and sliding resistance evaluation test a were performed on the device 1 of examples 1 to 11 . further , emulsion check test b and sliding resistance evaluation test b were performed on the device 1 of examples 12 , 13 , and 14 . emulsion check test b was performed on the device 1 a of example 15 . sliding resistance evaluation test c and foreign substance evaluation test were performed on the device 1 of example 12 and the device 1 a of example 15 . the device 1 having the configuration of fig2 . detailed dimensions and the like are as follows . here , the fibers 32 are crimped and loaded into the space 30 . polyester 50 deniers 1000 mm ( 17 . 7 mm is present per 1 mm 3 of space 30 ) through hole 311 a : 0 . 43 mm 2 through hole 311 b : 0 . 45 mm 2 through hole 311 c : 0 . 46 mm 2 opening area : 5 . 42 mm 2 560 mm ( 9 . 9 mm is present per 1 mm 3 of space 30 ) 280 mm ( 5 . 0 mm is present per 1 mm 3 of space 30 ) 140 mm ( 2 . 5 mm is present per 1 mm of space 30 ) 100 deniers 560 mm ( 9 . 9 mm is present per 1 mm of space 30 ) 100 deniers 280 mm ( 5 . 0 mm is present per 1 mm 3 of space 30 ) 100 deniers 140 mm ( 2 . 5 mm is present per 1 mm 3 of space 30 ) 150 deniers 560 mm ( 9 . 9 mm is present per 1 mm 3 of space 30 ) 150 deniers 280 mm ( 5 . 0 mm is present per 1 mm of space 30 ) 150 deniers 140 mm ( 2 . 5 mm is present per 1 mm of space 30 ) 75 deniers 280 mm ( 5 . 0 mm is present per 1 mm 3 of space 30 ) through hole 312 a : 0 . 17 mm 2 through hole 312 b : 0 . 18 mm 2 through hole 312 c : 0 . 35 mm 2 opening area : 4 . 92 mm 2 through hole 313 : 0 . 07 mm 2 opening area : 2 . 45 mm 2 the device 1 a having the configuration of fig6 . detailed dimensions and the like are as follows . here , the fibers 32 are crimped and loaded into the space 30 . polyester 75 deniers 280 mm ( 5 . 0 mm is present per 1 mm 3 of space 30 ) configuration of fig3 through hole 311 a : 0 . 43 mm 2 through hole 311 b : 0 . 45 mm 2 through hole 311 c : 0 . 46 mm 2 opening area : 5 . 42 mm 2 as shown in fig1 and 10 , the following procedure was employed . ( 1 ) the preparation instrument 100 of fig1 was prepared . then , 1 . 5 ml of 2 % l - arginine aqueous solution serving as a dispersed phase , that is , an aqueous phase , was loaded into the space 8 . then , 1 . 5 ml of montanide ( official name : montanide isa 51vg ) serving as a continuous phase , that is , an oil phase , was loaded into the syringe 9 . here , the syringes 8 and 9 were b braun - fabricated and had a capacity of 5 ml . ( 2 ) pumping operation was manually performed alternately on the plunger 82 of the syringe 8 and the plunger 92 of the syringe 9 . this operation was repeated 5 times . as a result , both phases were accommodated into the syringe 8 . ( 3 ) the syringe 9 was removed . then , as shown in fig1 , a mixed solution of physiological saline solution and montanide in the cylinder 8 was dripped through the device 1 to the surface 521 of the water in the vessel 52 . that so - called “ drop test ” was performed . when dripped liquid does not diffuse over the surface 521 , an emulsion has been formed satisfactorily . this situation is indicated by “∘” in the test result . when dripped liquid diffuses over the surface 521 , an emulsion has not been formed . this situation is indicated by “ x ” in the test result . as seen from table 1 , in examples 1 to 11 , a desired emulsion has been formed . in particular , in examples 1 , 2 , 3 , 5 , 6 , 7 , 9 , and 10 , a satisfactory emulsion has been formed . as shown in fig1 and 10 , the following procedure was employed . ( 1 ) the preparation instrument 100 of fig1 was prepared in examples 12 to 14 and the preparation instrument 100 of fig4 was prepared in example 15 . then , 1 . 5 ml of 2 % l - arginine aqueous solution serving as a dispersed phase , that is , an aqueous phase , was loaded into the space 8 . then , 1 . 5 ml of montanide serving as a continuous phase , that is , an oil phase , was loaded into the space 9 . here , the syringes 8 and 9 were b braun - fabricated and had a capacity of 5 ml . ( 2 ) pumping operation of alternately pushing on the plunger 82 of the syringe 8 and the plunger 92 of the syringe 9 was performed manually . this operation was repeated 5 times . as a result , both phases were accommodated into the syringe 8 . ( 3 ) the syringe 9 was removed . then , as shown in fig1 , a mixed solution of l - arginine aqueous solution and montanide in the cylinder 8 was dripped through the device 1 to the surface 521 of the water in the vessel 52 . that is , a so - called “ drop test ” was performed . further , at that time , the presence or absence of falling out of the fibers 32 in the device 1 was also investigated . as seen from table 2 , even when the first mesh part 31 and the second mesh part 33 had whichever configuration of fig3 , and 9 , a satisfactory emulsion has been formed . as shown in fig1 , the following procedure was employed . ( 1 ) the preparation instrument 100 of fig1 was prepared . then , 1 . 5 ml of 2 % l - arginine aqueous solution serving as a dispersed phase , that is , an aqueous phase , was loaded into the space 8 . then , 1 . 5 ml of montanide serving as a continuous phase , that is , an oil phase , was loaded into the space 9 . here , the syringes 8 and 9 were b braun - fabricated and had a capacity of 5 ml . ( 2 ) pumping operation was manually performed alternately on the plunger 82 of the syringe 8 and the plunger 92 of the syringe 9 . this operation was repeated 5 times . as a result , both phases were accommodated into the syringe 8 . ( 3 ) as shown in fig1 , the preparation instrument 100 was installed in an autograph device 55 ( model ez - l - 500n , shimadzu corporation ) provided with a support base 551 and a load cell 552 . then , the sliding resistance at the time of alternately pushing the plunger 82 of the syringe 8 and the plunger 92 of the syringe 9 was measured with the load cell 552 . further , as the resistance , a mean value was calculated for the load during the plunger stroke from 5 to 15 mm . here , the sliding speed of the plungers 82 and 92 of both syringes 8 and 9 was set at 500 mm / min and 1000 mm / min . table 3 shows test results . each test was performed once for the sliding speed of the plunger 82 of 500 mm / min and performed twice for 1000 mm / min . in a case that the pumping operation speed is 500 mm / min , the operability is light and satisfactory when the sliding resistance is lower than 70 n . thus , this situation is indicated by “∘”. further , in case of 70 n or higher , this situation is indicated by “ x ”. further , in a case that the pumping operation speed is 1000 mm / min , the operability is light and satisfactory when the sliding resistance is lower than 140 n . thus , this situation is indicated by “∘”. further , in case of 140 n or higher , this situation is indicated by “ x ”. as seen from table 3 , in examples 1 to 11 , the operability of pumping was satisfactory . as shown in fig1 , the following procedure was employed . ( 1 ) the preparation instrument 100 of fig1 was prepared . then , 1 . 5 ml of 2 % l - arginine aqueous solution serving as a dispersed phase , that is , an aqueous phase , was loaded into the space 8 . then , 1 . 5 ml of montanide serving as a continuous phase , that is , an oil phase , was loaded into the space 9 . here , the syringes 8 and 9 were b braun - fabricated and had a capacity of 5 ml . ( 2 ) pumping operation was manually performed alternately on the plunger 82 of the syringe 8 and the plunger 92 of the syringe 9 . this operation was repeated 5 times . as a result , both phases were accommodated into the syringe 8 . ( 3 ) as shown in fig1 , the preparation instrument 100 was installed in an autograph device 55 ( model ag - 500br , shimadzu corporation ) provided with a support base 551 and a load cell 552 . then , the sliding resistance at the time of alternately pushing the plunger 82 of the syringe 8 and the plunger 92 of the syringe 9 was measured with the load cell 552 . the resistance was measured at the first time , the second time , and the third time of pumping operation . further , as the resistance , a mean value was calculated for the load during the plunger stroke from 5 to 15 mm . the sliding speed was set at 500 mm / min . as seen from table 4 , in examples 12 , 13 , and 14 , the sliding resistance was lower than the conventional art . thus , the operability was satisfactory . in particular , in example 12 , that is , in a case that the mesh part having the configuration of fig3 was employed , the sliding resistance was the lowest . thus , in a case that the mesh part having the configuration of fig3 was employed , the operability was the most satisfactory . as shown in fig1 , the following procedure was employed . ( 1 ) the preparation instrument 100 of fig1 was prepared in example 12 and the preparation instrument 100 of fig4 was prepared in example 15 . then , 1 . 5 ml of physiological saline serving as a dispersed phase , that is , an aqueous phase , was loaded into the syringe 8 . then , 1 . 5 ml of montanide serving as a continuous phase , that is , an oil phase , was loaded into the space 9 . here , the syringes 8 and 9 were b braun - fabricated and had a capacity of 5 ml . ( 2 ) pumping operation was manually performed alternately on the plunger 82 of the syringe 8 and the plunger 92 of the syringe 9 . this operation was repeated 5 times . as a result , both phases were accommodated into the syringe 8 . ( 3 ) as shown in fig1 , the preparation instrument 100 was installed in an autograph device 55 ( model ag - xplus , shimadzu corporation ) provided with a support base 551 and a load cell 552 . then , the sliding resistance at the time of alternately pushing the plunger 82 of the syringe 8 and the plunger 92 of the syringe 9 was measured with the load cell 552 . the resistance was measured at the first time , the second time , and the third time of pumping operation . further , as the resistance , a mean value was calculated for the load during the plunger stroke from 5 to 15 mm . the sliding speed was set at 500 mm / min . ( 1 ) fig1 shows the situation of the test concerning the device 1 of example 12 . here , in example 15 , the device 1 a was employed in place of the device 1 . a glass syringe 62 was attached through a 0 . 8 - μm membrane filter 61 to one end of the device 1 . then , 10 ml of particulate - free deionized water was vigorously ejected through the filter 61 and the device 1 into a clean glass bottle 63 . this operation was performed five times in total . then , the filter 61 and the syringe 62 were removed and then attached to the other end of the device 1 similarly , and then the same operation was performed . by virtue of this , approximately 100 ml of deionized water was collected in the glass bottle 63 . this deionized water was employed as the sample . ( 2 ) japanese pharmacopoeia sixteenth edition “ insoluble particulate matter test for injections , method 1 . light obscuration particle count test ” was performed on the sample . specifically , insoluble particulates per 10 ml of the sample were measured four times with an in - liquid particulate measurement instrument ( product name : rion kl - 04 ). then , the second to the fourth measurement values were converted into the number of particulates per vessel . this measurement was performed five times in total with changing the sample . with reference to a test method “ b . solutions for injection supplied in containers with a nominal content of less than 100 ml ” in the above - mentioned japanese pharmacopoeia , the allowance criterion for the average number of particulates is “ 6000 or fewer for particulates of 10 μm or larger and 600 or fewer for particulates of 25 μm or larger , per vessel ”. however , in the present test , a ten - fold severer allowance criterion was employed that “ 600 or fewer for particulates of 10 μm or larger and 60 or fewer for particulates of 25 μm or larger , per vessel ”. in both of examples 12 and 15 , the severer allowance criterion has been satisfied . thus , both devices 1 and 1 a are excellent in the foreign substance quality and hence have sufficient cleanliness for the use as medical equipment . the emulsion preparation device of the present invention can form an emulsion for a chemical liquid of diverse composition , further can realize a relatively low sliding resistance , and hence has a great advantage in industrial utilization . 1 : 1 a device , 10 : filter part , 100 : preparation instrument , 2 : first cylindrical member , 21 : first cylinder part , 211 : aperture periphery , 22 : second cylinder cart , 23 : concave lid , 231 : outer flange , 28 : luer taper , 31 : first mesh part , 311 : through hole , 32 : fibers , 33 : second mesh part , 4 : second cylindrical member , 29 , 49 : outer flange , 8 , 9 : syringe | 1 |
fig1 shows a simplified block diagram of a portion of a wireless telecommunications system in which the preferred embodiment of the present invention may be practiced . more particularly , wireless telecommunications system 100 includes equipment maintained by a plurality of wireless telecommunications services providers . in this example , a ubiquitous provider maintains gateway switch 110 , a first wireless telecommunications service provider maintains mobile switching center 120 and a second wireless telecommunications service provider maintains mobile switching center 140 . in alternative embodiments , the ubiquitous provider may also maintain an air interface system . gateway switch 110 , mobile switching center 120 and mobile switching center 140 are all interconnected to the rest of public switched telephone network ( pstn ) 101 by provisioned trunks , as described below . in the preferred embodiment , gateway switch 110 is the autoplex ® 1000 manufactured by lucent technologies , and serves the geographic region represented by telecommunications system 100 . gateway switch 110 comprises processor 111 interconnected , via data links 112 , to switch module 113 for establishing call connections , trunk connection facility 115 for establishing connections to digital switches of mobile switching centers and announcement circuit 117 for issuing messages to callers . as is known in the art , processor 111 includes a limited amount of memory for storing data . gateway switch 110 is also interconnected to shared data base 119 via data link 114 . shared data base 119 is accessed by gateway switches maintained by the ubiquitous provider , and stores subscriber - related service feature information and subscriber location information . in alternative embodiments , database 119 may be integrated with the gateway switch . in the preferred embodiment , the ubiquitous provider has many gateway switches located across a wide geographic area ( e . g . across the united states ) and maintains many shared subscriber data bases which are interconnected to shared data base 119 by a direct link , such as data link 102 , or via indirect links through other signal transfer points . gateway switch 110 is shown with established bi - directional trunk connections 116 , 118 to pstn 101 . also shown is signaling link 129 interconnecting the gateway switch to mobile switching center 120 and bi - directional trunk connections 123 , 127 interconnected to digital switch 130 . although bi - directional trunk connections are shown , other embodiments may employ a plurality of uni - directional trunk connections , as known in the art . gateway switch 110 also maintains signaling link 149 to mobile switching center 140 and bi - directional trunk connections 143 , 147 to digital switch 150 . signaling links 129 and 149 relay messages between gateway switch 110 and the mobile switching centers and are sometimes used to initiate service feature applications . bi - directional trunks 123 , 127 143 and 147 are used to establish call connections and may also be used by gateway switch 110 for service feature applications . in this example , shared data base 119 maintains subscriber - related service feature information and subscriber location data as described below . mobile switching center 120 comprises processor 122 interconnected to data base 124 via data link 125 . digital switch 130 is interconnected to pstn 101 via bi - directional trunk 133 and to the mobile switching center via bi - directional trunk 131 . digital switch 130 is also interconnected to gateway switch 110 via bi - directional trunks 123 , 127 . in this example , mobile switching center 120 supports base stations 132 , 134 , 136 and 138 . all mobile subscribers ( that is , subscribers for which mobile switching center 120 is the &# 34 ; home &# 34 ; wireless system and subscribers roaming within the geographic area who are technologically compatible with mobile switching center 120 ) receive air interface services via the aforementioned base stations . in this embodiment , mobile switching center 140 is maintained by a second wireless telecommunications service provider and may , or may not , be located in a geographic area distant from mobile switching center 120 . mobile switching center 140 comprises processor 142 interconnected to data base 144 via data link 145 . also shown is digital switch 150 interconnected to pstn 101 via bi - directional trunk 153 and to mobile switching center 140 via bi - directional trunk 151 . digital switch 150 is also interconnected to gateway switch 110 via bi - directional trunks 143 , 147 . mobile switching center 140 serves base stations 152 , 154 , 156 , 158 and , more particularly , wireless telephone 160 interconnected to mobile switching center 140 via base station 158 . in the preferred embodiment , the user of wireless telephone 160 subscribes to services provided by the ubiquitous provider maintaining gateway switch 110 . in this example , there is no &# 34 ; home &# 34 ; air interface system associated with the ubiquitous provider and hence , no &# 34 ; home &# 34 ; air interface system which serves the mobile subscriber . gateway switch 110 establishes all call connections , and applies appropriate service features to wireless telephone 160 . data base 124 of mobile switching center 120 and data base 144 of mobile switching center 140 maintain identification data allowing these systems to recognize mobile subscribers ( more particularly , directory numbers of mobile terminals ) served by the ubiquitous provider . in alternative implementations with multiple ubiquitous providers , each mobile switching center must maintain data for identifying the mobile terminals of each provider . when a ubiquitous provider terminal is recognized , a trunk interconnecting the gateway switch to a digital switch of a mobile switching center is established , as known in the art . the trunk connection between gateway switch 110 and the digital switch enables the gateway switch to establish call connections and apply service features to mobile terminals served by the ubiquitous provider . fig2 illustrates the steps performed in wireless telecommunications system 100 when a subscriber of the ubiquitous provider originates a call . for clarity , continue with the example of the subscriber who uses wireless telephone 160 served by base station 158 of mobile switching center 140 . the process begins in step 200 in which the subscriber originates a call in mobile switching center 140 . as known in the art , the subscriber originates a call by dialing digits which initiate a series of messages ( including the originating telephone &# 39 ; s directory number ) which are sent by wireless telephone 160 to the serving mobile switching center via the serving base station . in step 202 , mobile switching center 140 recognizes ( by the telephone &# 39 ; s directory number transmitted during the call origination process ) that wireless telephone 160 is a subscriber served by the ubiquitous provider . although ubiquitous provider subscribers are recognized by directory numbers in this embodiment , those skilled in the art may derive other methods for recognizing a subscriber of the ubiquitous provider . the process continues to step 204 in which mobile switching center 140 extends a signaling message to gateway switch 110 via signaling link 149 indicating that wireless telephone 160 has originated a call in mobile switching center 140 . in step 206 , gateway switch 110 receives the call origination information and recognizes the air interface system ( that is , mobile switching center 140 ) from which the message is received using the identity of the signaling link . in decision step 208 , the gateway switch determines whether shared data base 119 should be updated to reflect that mobile switching center 140 is the air interface system &# 34 ; on record &# 34 ; as serving the subscriber using wireless telephone 160 . the database update is unnecessary if processor 111 of gateway switch 110 recognizes that the mobile subscriber &# 39 ; s serving air interface system is unchanged from the &# 34 ; on record &# 34 ; system stored in the processor &# 39 ; s memory from the last time that this particular subscriber attempted to originate a call . if the outcome of decision step 208 is a &# 34 ; yes &# 34 ; determination , the process continues to step 209 in which gateway switch 110 accesses shared data base 119 via data link 102 to update data contained therein before continuing to step 210 described below . if the outcome of decision step 208 is a &# 34 ; no &# 34 ; determination , the process continues directly to step 210 in which a trunk connection between mobile switching center 140 and gateway switch 110 is established as is known in the art . in step 212 , gateway switch 110 establishes a call connection from the subscriber at wireless telephone 160 to a called party , and applies applicable service features to wireless telephone 160 via either the established trunk connection , or the serving air interface system . the serving air interface system applies service features as directed by the gateway switch with messages issued over signaling link 149 . advantageously , subscribers of the ubiquitous provider have universal access to service features . this is because mobile switching centers of other wireless telecommunications service providers are used primarily as air interfaces and provide minimal substantive processing of call connections or service features . although the present invention has been described with respect to the preferred embodiment , those skilled in the art may devise numerous other arrangements without departing from the scope of the invention as defined in the following claims . | 7 |
an hplc system 11 includes a first piston pump 12 operatively coupled to a stepping motor drive 13 and a second piston pump 14 operatively coupled to a stepping motor drive 15 . communicating with inlets of the first and second piston pumps 12 , 14 , respectively , are a first solvent source 17 and a second solvent source 18 . outlets of the first and second piston pumps 12 , 14 communicate with an input 19 of a balloon - type damper . also included in the hplc system 11 is a mixer 25 having an inlet connected to the outlet of the damper 21 by a feed tube 26 . connected to an outlet of the mixer 25 is a discharge tube 27 that communicates with a sample injector assembly 28 . the combined output of the mixer 25 and sample injector assembly 28 is fed into a separation column 29 . receiving the output from the separation column 29 is an analyzer unit 31 . each of the pumps 12 , 14 has an inlet valve 41 communicating , respectively , with the solvent sources 17 , 18 and an outlet valve 42 communicating with the damper 21 . in addition , each of the pumps 12 , 14 is provided with a position detector 44 for detecting piston plunger displacement and a pressure transducer 45 for detecting pumping chamber pressure . operation of the pumps is controlled by a computer control system 51 coupled to the inlet valves 41 , the outlet valves 42 , the position detectors 44 and the pressure transducers 45 . during operation the pumps 12 , 13 produce gradient liquid solvent flow to the damper 21 and separation column 29 . however , since the pumps 12 , 14 are operated identically , the following will provide a detailed operating description only for the pump 12 . illustrated in fig2 is a pump cycle diagram in which chamber pressure is plotted versus piston displacement for the pump 12 if ideal operation of a perfect pump is assumed . chamber pressure is plotted in pounds per square inch ( psi ) and plunger displacement , which represents length of piston stroke in volume displaced by the piston for that length , is plotted in microliters . at a point a in the pump cycle , the piston plunger begins a positive stroke which compresses liquid solvent with the inlet and outlet valves 41 , 42 closed until point b when system pressure is achieved and the outlet valve 42 opens . between points b and c of the pump &# 39 ; s positive cycle , the piston delivers solvent through the open outlet valve 42 to the damper 21 . at a point c , the outlet valve 42 closes and the piston begins its return stroke . during a period c - d , liquid solvent remaining in the chamber is decompressed until atmospheric pressure is reached at point d when the inlet valve 41 opens . between the points d and a , the return stroke of the piston draws solvent through the open inlet valve 41 into the pump 12 from the solvent source 17 . again , assuming ideal operation , the refill stroke period d - a together with the known pumping chamber geometry and piston reciprocation rate can be used to calculate the solvent flow rate delivered by the pump 12 to the damper 21 . a more practical pump cycle for the piston pump 12 operating under typically expected conditions is depicted in fig3 . again , the portion of the curve between points a and c represents a positive piston stroke and the portion between points c and a represents a return piston stroke . included in the positive stroke a - c is a gas compression stroke period a - e during which any gas content of the pump chamber is compressed , a liquid compression stroke period e - b during which liquid solvent in the pump chamber is compressed up to system pressure and a delivery stroke period b - c during which compressed liquid solvent is delivered through the outlet valve 42 to the damper 21 . both the inlet valve 41 and the outlet valve 42 are closed during the gas compression stroke period a - e and the liquid compression stroke period e - b , while during the delivery stroke period b - c the inlet valve 41 is closed and the outlet valve 42 is open . the return stroke c - a includes a liquid decompression period c - f during which remnant liquid solvent in the pump chamber is decompressed , a gas decompression stroke period f - d during which gasses in the pump chamber decompress and expand and an intake stroke period d - a during which the pump chamber is refilled with liquid from the solvent source 17 . both the inlet valve 41 and the outlet 42 are closed during the liquid decompression liquid stroke period c - f and the gas decompression stroke period f - d , while during the intake stroke period d - a the inlet valve 41 is open and the outlet valve 42 is closed . during the stroke period a - e , gasses remaining in the pumping chamber are compressed into a very small volume and finally driven into solution so as to occupy a negligible portion of chamber volume . subsequently , during stroke period e - b , liquid solvent within the pumping chamber is compressed . conversely , during the return stroke d - a , remnant liquid solvent is decompressed during the period c - f after which remnant gasses decompress and expand to occupy all the chamber volume created by piston movement between points f and d . by projecting the substantially straight line portions of the liquid compression stroke period e - b and the liquid decompression stroke period c - f , points g and h , respectively , on the return stroke c - a are determined . the distance between points g and h represents the effective length of an intake stroke required to draw into the pump chamber at atmospheric pressure the volume of liquid solvent delivered during the delivery stroke period b - c . during each operating cycle of the pump 21 , the control system 51 determines the positions g and h by performing a linear progression of chamber pressure detected by the pressure detector 45 to establish a best fit straight line for the liquid compression stroke period e - b and the liquid decompression stroke period c - f . the effective piston displacement g - h together with the known geometry of the pump chamber is used by the computer control system 51 to determine the actual liquid solvent at atmospheric pressure delivered by the pump 12 during each operating cycle . the actual delivered liquid volume information derived in the manner described above is used by the computer control system 51 to establish a desired constant rate of solvent mass flow through the separation column 29 . initially , pump geometry is utilized to establish for the pump &# 39 ; s piston , a stroke length and rate of reciprocation that under ideal conditions would provide a given desired rate of liquid flow to the separation column 29 . utilizing the pump parameters selected to provide the desired rate of liquid flow , the computer control system 51 determines for a predetermined operating period a desired liquid volume that would be delivered to the damper 21 and column 19 by the pump 12 if producing the desired given rate of liquid flow . utilizing the technique described above , the computer control system 51 also determines the total actual liquid volume delivered by the pump during the predetermined operating period by summing for each cycle thereof the actual liquid volume delivered . in response to a comparing step indicating that the total actual volume delivered is different from the desired liquid volume , the control system 51 makes a compensatory change in the stroke length of the pump 12 to correct the calculated difference . for example , if the actual liquid volume is less than the desired liquid volume , the stroke length is increased to establish increased flow . conversely , if the actual liquid volume is greater then the desired liquid volume , the stroke length is diminished to reduce flow . correction is made in a single pump cycle if possible but can be continued for a number of subsequent cycles if necessary to establish a condition in which the total actual liquid volume delivered by the pump 12 during the given operating period is equal to the desired liquid volume that would have been delivered by a perfectly operating pump . preferably , the desired liquid volume and actual delivered liquid volume are compared during each operating cycle of the pump 12 and the control system 51 maintains an existing volume delivery error equal to the algebraic summation of the differences between desired liquid volume and actual delivered liquid volume during each pump cycle . in addition to changing piston stroke length to compensate for delivered volume error , the computer control system 51 establishes during each pump cycle a piston reciprocation velocity that maintains for the selected stroke length the desired predetermined rate of piston reciprocation . the damper 21 functions to smooth solvent flow to the separation column 29 by accumulating liquid solvent during delivery strokes of the pump 12 and delivering solvent to the mixer 25 during refill strokes of the pump . if operating in a conventional manner , the damper output flow would assume the characteristic illustrated in fig4 which plots system flow out of the damper versus time . in the saw - tooth wave illustrated , each upward leg represents a period when the damper is accumulating solvent and each downward leg represents a delivery period during which the damper is releasing solvent to the mixer 25 and column 29 . although such operation improves uniformity , fig4 illustrates that conventional dampers provide a periodic flow rate that continuously varies above and below an average flow rate . the resulting periods of non - average flow are detrimental to chromatographic analysis . to provide a more uniform damper output flow , the computer control system 51 provides for the pump 12 two periods during which output flow rate is increased above a selected predetermined average flow rate . the increased flow rate is produced by increasing the velocity of the pump &# 39 ; s piston during the first and second periods which occur , respectively , at the beginning of the pump &# 39 ; s delivery stroke period b - c ( fig3 ) and at the end of the delivery stroke period . a resulting flow characteristic is illustrated in fig5 in which periods a and c represent the first and second periods of increasing flow straddled by periods b during which the piston velocity is reduced to produce the average flow rate desired for the separation column 29 . during the first and second periods a and c , the damper 21 is accumulating liquid , during periods b the damper is transmitting the received average flow from the pump 12 and during periods d between periods b and a , the damper 21 is delivering retained liquid solvent during refill strokes of the pump . as shown in fig5 the resultant system flow out of the damper 21 includes lengthy periods b of desired average flow separated by combined periods c - d - a of varying flow . however , if the difference between the average flow rate and the rate of the end of a period b is equal to the difference between the average flow rate and the flow rate at the beginning of periods a , the average flow during each period c - d - a will be the predetermined desired average flow . the first period a of increased flow preferably is at the maximum flow rate of the pump 12 and continues until the outlet flow of the damper 21 is at average flow . then , the pump speed is changed to produce average flow during period b . the second period c of increased flow also preferably is at the maximum flow rate of the pump and begins at a time which makes the increases in system flow equal during periods a and c . the manner in which equal increases in flow are obtained will be explained in conjunction with fig6 and 7 which depict variations with time of , respectively , system flow out of the damper 21 and flow out of the pump 12 . in fig6 and 7 is the time at the beginning of the first period when the outlet valve 42 opens and delivery of pressurized liquid begins to the damper 21 ; is the time when flow through the system has reached it &# 39 ; s desired average value ; is the time at the beginning of the second period when flow to the damper again is increased ; and is the time when delivery of pressurized fluid to the damper 21 is terminated . a conventional damper performs according to the following equation : ( 1 ) p d = k d v d where p d is the pressure in the damper , v d is the volume in the damper and k d is a constant based on damper design . a conventional hplc system which operates with laminar flow at very low reynolds numbers performs according to the following equation : ( 2 ) f s = k s p s where f s is the flow rate through the system , p s is the pressure applied to the system and k s is a constant based on system configuration . since the outlet of the damper 21 is connected to the column system , ( 3 ) p s = p d at all times , and ( 4 ) f s = k s k d v d . at time t 1 in fig6 system flow is f 1 . the increasing system flow during interval t 1 - t 2 ( a ) is a short segment of an exponential function which may be approximated as a straight line for engineering purposes . the average flow to the system during t 1 - t 2 is ( 5 ) ( f 1 + f a )/ 2 . the flow to the damper during t 1 - t 2 is ( 6 ) f i . therefore , the damper volume must increase by ( 7 ) ( f i -( f 1 + f a )/ 2 ) ( t 2 - t 1 ) during the first interval ( a ) and system flow increases according to ( 4 ). to make the second interval t 4 - t 3 ( c ) have an equal change in system flow , the change in damper volume must be equal . during that second interval ( c ) the average system flow is ( 8 ) ( f a + f 4 )/ 2 , and the flow to the damper is ( 9 ) ( f i ). therefore , the damper volume must increase by ( 10 ) ( f i -( f a + f 4 / 2 ) ( t 4 - t 3 ) and by the above noted design objective ( 11 ) f 4 - f a = f a - f 1 . by combining ( 4 ), ( 10 ) and ( 11 ) we have ## equ1 ## and since f i , f 1 and f a are constants , t 4 - t 3 = c ( t 2 - t 1 ). therefore , the length of the period ( c ) required to establish a damper volume change equal to that provided during period ( a ) can be determined and applied . that results in a combined period c - d - a ( fig5 ) having the desired average flow . according to a preferred practical method , system pressure which with the outlet valve 42 open is substantially equal to pump chamber pressure . the system pressure which with the outlet valve 42 open is substantially equal to pump chamber pressure is detected at points t 2 and t 3 during each cycle of operation to determine if a uniform flow rate was provided during period ( b ). in the event that the system pressures at points t 2 and t 3 are not equal indicating a changing flow rate during period ( b ), the relative length of periods ( a ) and ( c ) are adjusted for a subsequent cycle to establish a more uniform flow rate during period ( b ). for example , if the pressure at t 2 is greater than the pressure at t 3 during a given cycle indicating decreasing flow during the period ( b ), the length of period ( a ) is decreased and the length of period ( c ) is increased during the subsequent cycle . conversely , if the pressure at t 2 is less than the pressure at t 3 during a given cycle indicating increasing flow during the period ( b ), the length of period ( a ) is increased and the length of period ( c ) is decreased during a subsequent cycle . the time t 1 during each cycle is selected by detecting chamber pressure and making with the computer control system 51 an on - the - fly determination of the point e ( fig3 ) and , consequently , the time required to compress the liquid in the chamber until compressed liquid is available for delivery . the displacement point e is where the slope of the compression curve a - b is substantially equal to the substantially constant slope of the compression curve e - b during the previous pumping cycle . obviously , many modifications and variations of the present invention are possible in light of the above teachings . for example , by providing highly sophisticated equipment , all calculations could be performed in real time rather than by use of past data as described . it is to be understood , therefore , that the invention can be practiced otherwise than as specifically described . | 5 |
fig1 illustrates a cross sectional area of an exemplary embodiment of a laser treated semiconductor diode 100 with back - side metal contact pads 110 and 112 . in the exemplary embodiment , the laser treated semiconductor diode is an n - type diode , though persons skilled in the art will recognize that the diode 100 may be with other types ( such as p - type , schottky diodes , etc .). the exemplary laser treated semiconductor diode has a front 102 and a back 104 side . the exemplary laser treated semiconductor diode 100 contains a bulk layer of silicon 106 between the front 102 and the back 104 sides . the bulk layer 106 may be doped with n - type doping , depending on the doping of the laser treated layer 108 . in the exemplary embodiment , the front 102 side is covered by a laser treated semiconductor layer 108 and connected to the bulk layer 106 . the laser treated semiconductor layer 108 is photo active and has an increased sensitivity as compared to an undoped , untreated layer . the back 104 side may be connected to aluminum cathode 110 and anode 112 contacts and may be covered by a thin layer of sio2 teos 114 . the back 104 side may also be doped using n - type dopants 1116 under the cathode contact 10 and p - type dopants 118 under the anode contact 112 . in this embodiment , the laser treated semiconductor layer 108 on the front 102 side acts as a cathode , while the back 104 side p - type doped section 118 acts as an anode . additionally , an embodiment is contemplated wherein the laser treated semiconductor diode 100 is devoid of ohmic contacts . fig2 illustrates a back view of a laser treated semiconductor diode 100 with back - side metal contact pads 110 and 112 . in the exemplary embodiment , aluminum contacts 110 and 112 are coupled to the back side 104 . the outer contact 110 is coupled to the n - type doping area of the back side 102 and acts as a cathode contact point for the diode 100 . the inner contact 112 is connected to the p - type doping area of the back 104 side and acts as an anode contact point for the diode 100 . each of the bounded regions ( e . g ., 112 ) in an array of such regions can act as a discrete pixel . for example , the regions 112 can each represent a pixel providing a color - sensing element in a color imager or a magnitude - sensing element in a monochromatic or gray - scale imager . in the exemplary embodiment , the anode contact 112 is electrically isolated from the cathode contact 110 . a diode using a back side contact configuration allows for single sided fabrication , reducing cost and reducing complexity of manufacture . also , a diode using a back side contact configuration may be substantially fully fabricated before the laser step process is performed . fabrication before the laser step removes the need to re - enter the material into the foundry after the laser step , eliminating the contamination risk typically associated with the re - entry of partially processed material and increasing the number of available fabrication partners . fig3 illustrates an exemplary array of laser treated semiconductor diodes with back - side metal contact pads . in the exemplary embodiment , the cathode contacts 110 are all electrically connected and form a common - cathode configuration . in the exemplary embodiment , the cathode and anode connections are arranged in a grid pattern where the cathode contact 10 is configured in a square grid pattern and the anode contacts 112 a and 112 b are configured as individual square contacts within the cathode grid pattern 110 . an array using the above configuration may be vertically bonded to readout circuitry and create a fully functional imager . fig4 illustrates a cross sectional area of an exemplary embodiment of a laser treated semiconductor diode with back - side metal contact pads including an exemplary circuit diagram approximation of the diode in operation . during operation , the cathode contact 110 may be positively biased in relation to the anode contact 112 . the bias voltage (“ v - bias ”) can be about 1 to 10 volts in some embodiments . in some embodiments the bias voltage can be about 3 to 5 volts . in some embodiments , the required bias voltage is substantially less than that in corresponding conventional devices . when the cathode is sufficiently positively biased , it will create an electric field that extends through the bulk layer 106 to the laser treated semiconductor layer 108 on the front 102 side , attracting the mobile electrons and depleting the laser treated semiconductor layer 108 . the anode contact 112 is held negative with respect to the cathode contact 110 and the laser treated semiconductor layer 108 . during operation , the bulk layer 106 may be modeled as a series resistance 402 between the cathode contact 110 and the laser treated semiconductor layer 108 . while the electric field generated between the anode and the cathode by their p - n junction 404 has a small relative volume , the field generated by the p - n junction 406 between the laser treated semiconductor layer 108 and the anode contact 112 has a larger , or even significantly larger volume . therefore , electron hole / pairs generated by photon absorption at or near the laser treated semiconductor layer 108 are separated in this field . the electrons travel to the cathode contact 110 through the laser treated semiconductor layer 108 , while the holes travel to the anode contact 112 through the field established by the p - n junction 406 between the laser treated semiconductor layer 108 and the anode contact 112 . while the exemplary diode shown was a p - n junction type diode , many other diode types may be implemented as discussed above , including schottky diodes and p - type implementations . the p - type implementation may be implemented by reversing the dopant type throughout the diode and reversing the bias applied to the diode during use . the p - type implementation will function similarly to the n - type implementation except that the electron and hole flow paths will reverse direction . fig5 illustrates an exemplary diagram of the field lines 119 , in a cross sectional area during operation of a laser treated semiconductor diode with back - side metal contact pads . each field line represents a contour of equal voltage , or representing lines of equipotential . a tighter spacing of field lines indicates a stronger electromagnetic field . | 7 |
the nucleotide sequence of a natural cdna encoding human traf6 is shown as seq id no : 1 and the full conceptual translate shown as seq id no : 2 . the traf6 proteins of the invention include incomplete translates of seq id no : 1 and deletion mutants of seq id no : 2 , which translates and deletions mutants have traf6 - specific activity . traf6 - specific activity or function may be determined by convenient in vitro , cell - based , or in vivo assays . preferred proteins are capable of modulating nf - κb activation . such activity or function may be demonstrated in cell culture ( e . g . cell transfections ) or in animals ( e . g . in vivo gene therapy , transgenics ). traf6 specific function can also be demonstrated by specific binding to a traf6 specific binding target , including natural binding targets such as traf6 ( dimerization ) and nonnatural targets such as traf6 - specific antibodies . finally , specific function can be assayed immunologically by the ability of the subject protein to elicit a traf6 specific antibody in a rodent or rabbit . traf6 - specificity of the binding agent may be shown at a populational level by binding equilibrium constants ( usually at least about 10 7 m - 1 , preferably at least about 10 8 m - 1 , more preferably at least about 10 9 m - 1 ). a wide variety of cell - based and cell - free assays may be used to demonstrate traf6 - specific binding ; preferred are rapid in vitro , cell - free assays such as mediating or inhibiting traf6 - protein ( e . g . traf6 -- traf6 , traf2 or traf3 ) binding , immunoassays , etc . in any event , traf6 specificity necessarily distinguishes the subject traf6 protein from traf1 - 5 . the claimed traf6 proteins are isolated or pure and are typically recombinantly produced . an &# 34 ; isolated &# 34 ; protein for example , is unaccompanied by at least some of the material with which it is associated in its natural state , preferably constituting at least about 0 . 5 %, and more preferably at least about 5 % by weight of the total protein in a given sample and a pure protein constitutes at least about 90 %, and preferably at least about 99 % by weight of the total protein in a given sample . a wide variety of molecular and biochemical methods are available for generating , expressing and purifying the subject compositions , see e . g . molecular cloning , a laboratory manual ( sambrook , et al . cold spring harbor laboratory ), current protocols in molecular biology ( eds . ausubel , et al ., greene publ . assoc ., wiley - interscience , ny ) or that are otherwise known in the art . the invention provides traf6 - specific binding agents , methods of identifying and making such agents , and their use in diagnosis , therapy and pharmaceutical development . for example , traf6 - specific agents are useful in a variety of diagnostic and therapeutic applications , especially where disease or disease prognosis is associated with improper utilization of a pathway involving traf6 , e . g . nf - κb activation . novel traf6 - specific binding agents include traf6 - specific antibodies and other natural intracellular binding agents identified with assays such as one - and two - hybrid screens , non - natural intracellular binding agents identified in screens of chemical libraries such as describe below , etc . the invention also provides nucleic acids encoding the subject proteins , which nucleic acids may be part of traf6 - expression vectors and may be incorporated into recombinant cells for expression and screening , transgenic animals for functional studies ( e . g . the efficacy of candidate drugs for disease associated with traf6 - mediated signal transduction ), etc ., and nucleic acid hybridization probes and replication / amplification primers having a traf6 cdna specific sequence contained in seq id no : 1 and sufficient to effect specific hybridization thereto ( i . e . will specifically hybridize with traf6 cdna ( seq id no : 1 ) in the presence of traf1 - 5 cdna ). demonstrating specific hybridization generally requires high - stringency conditions , for example , hybridizing in a buffer comprising 30 % formamide in 5 × sspe ( 0 . 18m nacl , 0 . 01m napo 4 , ph 7 . 7 , 0 . 001m edta ) buffer at a temperature of 42 ° c . and remaining bound when subject to washing at 42 ° c . with 0 . 2 × sspe ; preferably hybridizing in a buffer comprising 50 % formamide in 5 × sspe buffer at a temperature of 42 ° c . and remaining bound when subject to washing at 42 ° c . with 0 . 2 × sspe buffer at 42 ° c . in any event , traf6 specific hybridization probes and primers necessarily distinguish traf6 cdna from cdna &# 39 ; s encoding traf1 - 5 . traf6 cdna homologs can also be characterized by blastx ( altschul et al . ( 1990 ) basic local alignment search tool , j mol biol 215 , 403 - 410 ) probability scores . using this nucleic acid sequence search program blastx , complete coding region traf6 cdna homologs provide a probability p ( n ) score of less than 1 . 0 e - 200 . the subject nucleic acids are isolated , i . e . unaccompanied by at least some of the material with which it is associated in its natural state , preferably constituting at least about 0 . 5 %, preferably at least about 5 % by weight of total nucleic acid present in a given fraction . the subject nucleic acids find a wide variety of applications including use as translatable transcripts , hybridization probes , pcr primers , diagnostic nucleic acids , etc . ; use in detecting the presence of traf6 genes and gene transcripts and in detecting or amplifying nucleic acids encoding additional traf6 homologs and structural analogs . when used as expression constructs , the nucleic acids are usually recombinant , meaning they comprise a sequence joined to a nucleotide other than that which it is joined to on a natural chromosome . the subject nucleic acids may be contained within vectors , cells or organisms . in diagnosis , traf6 hybridization probes and / or primers find use in identifying wild - type and mutant traf6 alleles in clinical and laboratory samples . mutant alleles are used to generate allele - specific oligonucleotide ( aso ) probes for high - throughput clinical diagnoses . the invention provides efficient methods of identifying agents , compounds or lead compounds for agents active at the level of a traf6 modulatable cellular function . generally , these screening methods involve assaying for compounds which modulate a traf6 interaction with a natural traf6 binding target . the methods are amenable to automated , cost - effective high throughput screening of chemical libraries for lead compounds . identified reagents find use in the pharmaceutical industries for animal and human trials ; for example , the reagents may be derivatized and rescreened in in vitro and in vivo assays to optimize activity and minimize toxicity for pharmaceutical development . target indications may include infection , genetic disease , cell growth and regulatory disfunction , such as neoplasia , inflammation , hypersensitivity , etc . a wide variety of assays for binding agents are provided including protein -- protein binding assays , immunoassays , cell based assays , etc . a preferred assay is a high - through put in vitro binding assay . here , the traf6 compositions may be part of a fusion product with another peptide or polypeptide , e . g . a polypeptide that is capable of providing or enhancing protein -- protein binding , stability under assay conditions , or a tag for detection or anchoring , etc . the assay mixtures comprise a natural intracellular traf6 binding target such as traf2 , traf3 or traf6 . while native binding targets may be used , it is frequently preferred to use portions ( e . g . peptides , nucleic acid fragments ) thereof so long as the portion provides binding affinity and avidity to the subject traf6 conveniently measurable in the assay . the assay mixture also comprises a candidate pharmacological agent . candidate agents encompass numerous chemical classes , though typically they are organic compounds ; preferably small organic compounds and are obtained from a wide variety of sources including libraries of synthetic or natural compounds . a variety of other reagents may also be included in the mixture . these include reagents like salts , buffers , neutral proteins , e . g . albumin , detergents , etc . which may be used to facilitate optimal binding and / or reduce non - specific or background interactions , etc . also , reagents that otherwise improve the efficiency of the assay , such as protease inhibitors , nuclease inhibitors , antimicrobial agents , etc . may be used . the resultant mixture is incubated under conditions whereby , but for the presence of the candidate pharmacological agent , the traf6 specifically binds the cellular binding target , portion or analog with a reference binding affinity . the mixture components can be added in any order that provides for the requisite bindings and incubations may be performed at any temperature which facilitates optimal binding , typically between 4 ° and 40 ° c ., more commonly between 15 ° and 40 ° c . incubation periods are likewise selected for optimal binding but also minimized to facilitate rapid , high - throughput screening , and are typically between 1 and 10 hours , preferably less than 5 hours , more preferably less than 2 hours . after incubation , the agent - biased binding between the traf6 and one or more binding targets is detected by any convenient way . for cell - free binding type assays , a separation step is often used to separate bound from unbound components . separation may be effected by precipitation ( e . g . tca precipitation , immunoprecipitation , etc . ), immobilization ( e . g on a solid substrate ), etc ., followed by washing by , for examples , membrane filtration ( e . g . whatman &# 39 ; s p - 81 ion exchange paper , polyfiltronic &# 39 ; s hydrophobic gfc membrane , etc . ), gel chromatography ( e . g . gel filtration , affinity , etc .). in addition , one of the components usually comprises or is coupled to a label . a wide variety of labels may be employed -- essentially any label that provides for detection of bound protein . the label may provide for direct detection as radioactivity , luminescence , optical or electron density , etc . or indirect detection such as an epitope tag , an enzyme , etc . a variety of methods may be used to detect the label depending on the nature of the label and other assay components . for example , the label may be detected bound to the solid substrate or a portion of the bound complex containing the label may be separated from the solid substrate , and thereafter the label detected . labels may be directly detected through optical or electron density , radiative emissions , nonradiative energy transfers , etc . or indirectly detected with antibody conjugates , etc . for example , in the case of radioactive labels , emissions may be detected directly , e . g . with particle counters or indirectly , e . g . with scintillation cocktails and counters . a difference in the binding affinity of the traf6 protein to the target in the absence of the agent as compared with the binding affinity in the presence of the agent indicates that the agent modulates the binding of the traf6 protein to the traf6 binding target . analogously , in the cell - based transcription assay also described below , a difference in the traf6 transcriptional induction in the presence and absence of an agent indicates the agent modulates traf6 - induced transcription . a difference , as used herein , is statistically significant and preferably represents at least a 50 %, more preferably at least a 90 % difference . the following experiments and examples are offered by way of illustration and not by way of limitation . the human traf6 cdna of seq id no : 1 was cloned from human spleen cell and human umbilical vein endothelial cell cdna libraries by high stringency hybridization : hybridization in 40 % formamide , 5 % dextran sulfate , 0 . 5 % sds , 5 × sspe at 42 ° c . followed by washes in 2 × sspe , 0 . 1 % sds at 25 ° c . and in 0 . 1 × sspe , 0 . 1 % sds at 42 ° c . ; using traf oligonucleotide probes . the resultant cdna ( seq id no : 1 ) encodes human traf6 ( seq id no : 2 ). in cotransfection experiments , traf6 was shown to activate an nf - κb - dependent reporter gene , see fig1 . a yeast two - hybrid system was used to identify traf2 , traf3 and traf6 as an intracellular binding targets of the traf6 protein of seq id no : 2 . a transfection based co - immunoprecipitation assay was also used to identify intracellular binding targets of the traf6 protein of seq id no : 2 . briefly , flag - tagged traf1 , 2 , 3 , 4 and 6 were cotransfected with ha - tagged traf6 . lysates were immunoprecipitated with anti - ha antibody and protein a glass beads . western blot analysis using an anti - flag antibody revealed traf6 -- traf6 and traf6 - traf3 complexes . deletion mutagenesis of traf6 indicate that residues 115 - 522 are sufficient to mediate activation of nf - κb , see fig2 . in contrast , continuing the 5 &# 39 ; deletion to the second zn finger domain abolished activity ; as did 5 &# 39 ; deletions through all five zn finger domains , and deletions through the c domain . similarly , an internal delection of the zn finger domains abolished activity . blocking buffer : 5 % bsa , 0 . 5 % tween 20 in pbs ; 1 hour at room temperature . assay buffer : 100 mm kcl , 20 mm hepes ph 7 . 6 , 0 . 25 mm edta , 1 % glycerol , 0 . 5 % np - 40 , 50 mm β - mercaptoethanol , 1 mg / ml bsa , cocktail of protease inhibitors . 33 p human traf6 ( sequence id no : 2 , residues 1 - 522 ) 10 × stock : 10 - 8 - 10 - 6 m unlabeled human traf6 supplemented with 200 , 000 - 250 , 000 cpm of labeled human traf6 ( beckman counter ). place in the 4 ° c . microfridge during screening . protease inhibitor cocktail ( 1000x ): 10 mg trypsin inhibitor ( bmb # 109894 ), 10 mg aprotinin ( bmb # 236624 ), 25 mg benzamidine ( sigma # b - 6506 ), 25 mg leupeptin ( bmb # 1017128 ), 10 mg apmsf ( bmb # 917575 ), and 2 mm navo 3 ( sigma # s - 6508 ) in 10 ml of pbs . δtraf6 : 10 - 8 - 10 - 5 m biotinylated truncated δtraf6 ( sequence id no : 2 , residues 115 - 522 ) in pbs . coat with 120 μl of stock n - avidin per well overnight at 4 ° c . add 10 μl 33 p - human traf6 ( 20 , 000 - 25 , 000 cpm / 0 . 1 - 10 pmoles / well = 10 - 9 - 10 - 7 m final concentration ). add 40 μl biotinylated truncated δtraf6 ( 0 . 1 - 10 pmoles / 40 μl in assay buffer ) stop the reaction by washing 4 times with 200 μl pbs . 293 cells are transiently co - transfected with an e - selectin - luciferase reporter gene plasmid ( schindler et al . ( 1994 ) mol cell biol 14 , 5820 ) and traf6 expression vectors containing the traf6 coding region ( see , sequence id no : 1 ) produced as described for traf1 , 2 and 3 in rothe et al . ( 1995 ) science 269 , 1424 . control cells are transiently co - transfected with a cmv promoter luciferase reporter gene plasmid and / or traf2 expression vectors as described supra . the transfected cells are incubated 24 hours in the presence of the candidate compound or extract and then the cells harvested and luciferase activities determined and normalized on the basis of β - galactosidase expression , as described in fig3 b of rothe et al . ( 1995 ) science 269 , 1424 . all publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding , it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 2 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 2248 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : cdna ( ix ) feature :( a ) name / key : cds ( b ) location : 230 .. 1795 ( xi ) sequence description : seq id no : 1 : ggcacgagccgcagctggggcttggcctgcgggcggccagcgaaggtggcgaaggctccc60actggatccagagtttgccgtccaagcagcctcgtctcggcgcgcagtgtctgtgtccgt120cctctaccagcgccttggctgagcggagtcgtgcggttggtgggggagccctgccctcct180ggttcggcctccccgcgcactagaacgagcaagtgataatcaagttactatgagt235metserctgctaaactgtgaaaacagctgtggatccagccagtctgaaagtgac283leuleuasncysgluasnsercysglyserserglnsergluserasp51015tgctgtgtggccatggccagctcctgtagcgctgtaacaaaagatgat331cyscysvalalametalasersercysseralavalthrlysaspasp202530agtgtgggtggaactgccagcacggggaacctctccagctcatttatg379servalglyglythralaserthrglyasnleuserserserphemet35404550gaggagatccagggatatgatgtagagtttgacccacccctggaaagc427glugluileglnglytyraspvalglupheaspproproleugluser556065aagtatgaatgccccatctgcttgatggcattacgagaagcagtgcaa475lystyrglucysproilecysleumetalaleuargglualavalgln707580acgccatgcggccataggttctgcaaagcctgcatcataaaatcaata523thrprocysglyhisargphecyslysalacysileilelysserile859095agggatgcaggtcacaaatgtccagttgacaatgaaatactgctggaa571argaspalaglyhislyscysprovalaspasngluileleuleuglu100105110aatcaactatttccagacaattttgcaaaacgtgagattctttctctg619asnglnleupheproaspasnphealalysarggluileleuserleu115120125130atggtgaaatgtccaaatgaaggttgtttgcacaagatggaactgaga667metvallyscysproasngluglycysleuhislysmetgluleuarg135140145catcttgaggatcatcaagcacattgtgagtttgctcttatggattgt715hisleugluasphisglnalahiscysgluphealaleumetaspcys150155160ccccaatgccagcgtcccttccaaaaattccatattaatattcacatt763proglncysglnargpropheglnlysphehisileasnilehisile165170175ctgaaggattgtccaaggagacaggtttcttgtgacaactgtgctgca811leulysaspcysproargargglnvalsercysaspasncysalaala180185190tcaatggcatttgaagataaagagatccatgaccagaactgtcctttg859sermetalaphegluasplysgluilehisaspglnasncysproleu195200205210gcaaatgtcatctgtgaatactgcaatactatactcatcagagaacag907alaasnvalilecysglutyrcysasnthrileleuileargglugln215220225atgcctaatcattatgatctagactgccctacagccccaattccatgc955metproasnhistyraspleuaspcysprothralaproileprocys230235240acattcagtacttttggttgccatgaaaagatgcagaggaatcacttg1003thrpheserthrpheglycyshisglulysmetglnargasnhisleu245250255gcacgccacctacaagagaacacccagtcacacatgagaatgttggcc1051alaarghisleuglngluasnthrglnserhismetargmetleuala260265270caggctgttcatagtttgagcgttatacccgactctgggtatatctca1099glnalavalhisserleuservalileproaspserglytyrileser275280285290gaggtccggaatttccaggaaactattcaccagttagagggtcgcctt1147gluvalargasnpheglngluthrilehisglnleugluglyargleu295300305gtaagacaagaccatcaaatccgggagctgactgctaaaatggaaact1195valargglnasphisglnilearggluleuthralalysmetgluthr310315320cagagtatgtatgtaagtgagctcaaacgaaccattcgaacccttgag1243glnsermettyrvalsergluleulysargthrileargthrleuglu325330335gacaaagttgctgaaatcgaagcacagcagtgcaatggaatttatatt1291asplysvalalagluileglualaglnglncysasnglyiletyrile340345350tggaagattggcaactttggaatgcatttgaaatgtcaagaagaggag1339trplysileglyasnpheglymethisleulyscysglnglugluglu355360365370aaacctgttgtgattcatagccctggattctacactggcaaacccggg1387lysprovalvalilehisserproglyphetyrthrglylysprogly375380385tacaaactgtgcatgcgcttgcaccttcagttaccgactgctcagcgc1435tyrlysleucysmetargleuhisleuglnleuprothralaglnarg390395400tgtgcaaactatatatccctttttgtccacacaatgcaaggagaatat1483cysalaasntyrileserleuphevalhisthrmetglnglyglutyr405410415gacagccacctcccttggcccttccagggtacaatacgccttacaatt1531aspserhisleuprotrppropheglnglythrileargleuthrile420425430cttgatcagtctgaagcacctgtaaggcaaaaccacgaagagataatg1579leuaspglnserglualaprovalargglnasnhisglugluilemet435440445450gatgccaaaccagagctgcttgctttccagcgacccacaatcccacgg1627aspalalysprogluleuleualapheglnargprothrileproarg455460465aacccaaaaggttttggctatgtaacttttatgcatctggaagcccta1675asnprolysglypheglytyrvalthrphemethisleuglualaleu470475480agacaaagaactttcattaaggatgacacattattagtgcgctgtgag1723argglnargthrpheilelysaspaspthrleuleuvalargcysglu485490495gtctccacccgctttgacatgggtagccttcggagggagggttttcag1771valserthrargpheaspmetglyserleuargarggluglyphegln500505510ccacgaagtactgatgcaggggtatagcttgccctcacttgctcaaaaacaact1825proargserthraspalaglyval515520acctggagaaaacagtgcctttccttgccctgttctcaataacatgcaaacaaacaagcc1885acgggaaatatgtaatatctactagtgagtgttgttagagaggtcacttactatttcttc1945ctgttacaaatgatctgaggcagttttttcctgggaatccacacgttccatgctttttca2005gaaatgttaggcctgaagtgcctgtggcatgttgcagcagctattttgccagttagtata2065cctctttgttgtactttcttgggcttttgctctggtgtattttattgtcagaaagtccag2125actcaagagtactaaacttttaataataatggattttccttaaaacttcagtctttttgt2185agtattatatgtaatatattaaaagtgaaaatcactaccgccttgaaaaaaaaaaaaaaa2245aaa2248 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 522 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : protein ( xi ) sequence description : seq id no : 2 : metserleuleuasncysgluasnsercysglyserserglnserglu151015seraspcyscysvalalametalasersercysseralavalthrlys202530aspaspservalglyglythralaserthrglyasnleuserserser354045phemetglugluileglnglytyraspvalglupheaspproproleu505560gluserlystyrglucysproilecysleumetalaleuarggluala65707580valglnthrprocysglyhisargphecyslysalacysileilelys859095serileargaspalaglyhislyscysprovalaspasngluileleu100105110leugluasnglnleupheproaspasnphealalysarggluileleu115120125serleumetvallyscysproasngluglycysleuhislysmetglu130135140leuarghisleugluasphisglnalahiscysgluphealaleumet145150155160aspcysproglncysglnargpropheglnlysphehisileasnile165170175hisileleulysaspcysproargargglnvalsercysaspasncys180185190alaalasermetalaphegluasplysgluilehisaspglnasncys195200205proleualaasnvalilecysglutyrcysasnthrileleuilearg210215220gluglnmetproasnhistyraspleuaspcysprothralaproile225230235240procysthrpheserthrpheglycyshisglulysmetglnargasn245250255hisleualaarghisleuglngluasnthrglnserhismetargmet260265270leualaglnalavalhisserleuservalileproaspserglytyr275280285ilesergluvalargasnpheglngluthrilehisglnleuglugly290295300argleuvalargglnasphisglnilearggluleuthralalysmet305310315320gluthrglnsermettyrvalsergluleulysargthrileargthr325330335leugluasplysvalalagluileglualaglnglncysasnglyile340345350tyriletrplysileglyasnpheglymethisleulyscysglnglu355360365gluglulysprovalvalilehisserproglyphetyrthrglylys370375380proglytyrlysleucysmetargleuhisleuglnleuprothrala385390395400glnargcysalaasntyrileserleuphevalhisthrmetglngly405410415glutyraspserhisleuprotrppropheglnglythrileargleu420425430thrileleuaspglnserglualaprovalargglnasnhisgluglu435440445ilemetaspalalysprogluleuleualapheglnargprothrile450455460proargasnprolysglypheglytyrvalthrphemethisleuglu465470475480alaleuargglnargthrpheilelysaspaspthrleuleuvalarg485490495cysgluvalserthrargpheaspmetglyserleuargargglugly500505510pheglnproargserthraspalaglyval515520__________________________________________________________________________ | 0 |
as used herein , the term “ l . intracellularis ” means the intracellular , curved gram - negative bacteria described in detail by c . gebhart et al ., int &# 39 ; l . j . of systemic bacteriology , vol . 43 , no . 3 , 533 - 538 ( 1993 ) and s . mcorist et al ., int &# 39 ; l . j . of systemic bacteriology , vol . 45 , no . 4 , 820 - 825 ( 1995 ), each of which is incorporated herein by reference in their entireties , and includes but is not limited to the isolate designated dk 15540 which was deposited for patent purposes with the american type culture collection (“ atcc ”), 10801 university boulevard , manassas , va . 20110 - 2209 on jan . 9 , 2003 and assigned atcc accession number pta - 4927 ; the causative bacteria which can be obtained from ppe infected swine or other animals throughout the world given the knowledge in the art and the teachings herein ; and variants or mutants of any of the above bacteria , whether spontaneously or artificially obtained . as used herein , the term “ attenuated isolate ” means any l . intracellularis isolate that is prepared according to the cultivation and passaging techniques taught herein to achieve avirulence while maintaining immunogenic properties when administered to a host animal including but not limited to the attenuated isolate designated b - 3903 which was deposited for patent purposes with the american type culture collection (“ atcc ”), 10801 university boulevard , manassas , va . 20110 - 2209 on jan . 9 , 2003 and assigned accession number pta - 4926 . pta - 4927 and pta - 4926 were tested by the atcc on apr . 21 , 2004 , and were found viable . the date of conversion to budapest treaty was oct . 16 , 2007 . the attenuated isolate of the invention can be used as an immunogen in antimicrobial vaccines for animals , including birds , fish , and mammals such as cattle , swine , horses , and primates . such vaccines can be prepared by techniques known to those skilled in the art and given the teachings contained herein . such a vaccine would comprise an immunologically effective amount of the attenuated isolate in a pharmaceutically acceptable carrier . the vaccine could be administered in one or more doses . an immunologically effective amount is determined by means known in the art without undue experimentation , given the teachings contained herein . the amount of avirulent bacteria should be sufficient to stimulate an immune response in disease - susceptible animals while still being avirulent . this will depend upon the particular animal , bacteria , and disease involved . the recommended dose to be administered to the susceptible animal is preferably about 3 . 0 tcid 50 ( tissue culture infective dose 50 % end point )/ dose to about 6 . 0 tcid 50 / dose and more preferably about 4 . 0 tcid 50 / dose to about 5 . 0 tcid 50 / dose . in a preferred embodiment , the titer of the vaccine is about 4 . 9 tcid 50 / dose as determined by tissue culture infective dose 50 % endpoint dilution assay ( tcid 50 ). the carriers are known to those skilled in the art and include stabilizers and diluents . such a vaccine may also contain an appropriate adjuvant . the vaccines of the invention may be used in combination with other vaccines , for example , as a diluent of another vaccine . the vaccine preparations may also be desiccated , for example , by freeze drying for storage purposes or for subsequent formulation into liquid vaccines . accordingly , the invention also comprises a method for inducing an immune response to virulent , wild - type l . intracellularis bacteria in an animal host for the purpose of protecting the host from such bacteria . the method comprises administering an immunologically effective amount of the attenuated bacteria or killed bacteria of the invention to the host and , preferably , administering the vaccine of the invention to the host . as used herein , the term “ large - scale cultivation ” means a level of cultivation of l . intracellularis greater than approximately 2 . 0 to 3 . 0 liters and includes production on a scale of 100 liters or more . “ cultivation ” as used herein , means the process of promoting the growth , reproduction and / or proliferation of l . intracellularis . l . intracellularis can be cultivated by methods known in the art , preferably , according to u . s . pat . nos . 5 , 714 , 375 and 5 , 885 , 823 . for example , culture cells may first be inoculated with an inoculum comprising l . intracellularis bacteria so as to infect the cells with the bacteria . numerous cell lines can be used in practicing the invention , including , but not limited to , iec - 18 ( atcc 1589 )- rat intestinal epithelial cells , hep - 2 ( atcc 23 )- human epidermoid carcinoma cells , mccoys ( atcc 1696 )- mouse ( non - specified ) cells , bgmk ( biowhittaker # 71 - 176 )- buffalo green monkey kidney cells , and swine intestinal epithelium cells . the preferred culture cells are hep - 2 , mccoys or iec - 18 cells . if culture cells are used , prior to being inoculated , the cells may be in the form of a monolayer . to form a monolayer , the cells may be seeded into conventional flasks . each flask is generally seeded with between about 1 × 10 5 cells to about 10 × 10 5 cells per 25 , 75 , 150 , 850 cm 2 flask or roller bottle mixed with growth media . the growth media may be any media for cell cultivation which includes a nitrogen source , necessary growth factors for the chosen culture cells , and a carbon source , such as glucose or lactose . the preferred media is dmem fortified with ham &# 39 ; s f 12 with 1 - 5 % fetal bovine serum , although other commercially available media may be used with good results . successful cultivation of l . intracellularis is enhanced by maintaining the culture cells in a constant state of growth . therefore , the culture cell monolayer should be at about 20 percent to about 50 percent confluency at the time of inoculation . preferably , the cells should be at about 30 percent to about 40 percent confluency at the time of inoculation , most preferably at about 30 percent confluency . alternatively , the cells , prior to being inoculated , may be grown in suspension , as described infra . preferably , the cells are first grown to 100 % confluency in the form of a monolayer in an adherent type system , e . g ., a roller bottle system , and then transferred to 3 - 3000 liters and grown in suspension . alternatively , the cells can be grown in suspension to the desired cell density , e . g . 2 × 10 5 cells / ml , within the 3 - 3000 liter vessel ( bioreactor , fermentor , spinner flask , etc .) using parameters suitable for growth within this system prior to inoculation . the inoculum may be a pure culture of l . intracellularis obtained from infected swine or other animals . preferably the inoculum may be a pure culture of l . intracellularis obtained from atcc accession no . pta - 4927 . the inoculum can be an intestinal homogenate prepared by scraping the mucosa off of the ileum of a swine or other animal infected with ppe . when preparing an intestinal homogenate , ileal sections selected for culture should show severe lesions with gross thickening of the gut . due to the fragile nature of the bacteria , samples should preferably be stored at − 70 ° c . as quickly as possible after necropsy . an antibiotic to which l . intracellularis is resistant such as vancomycin , amphotericin b or members of the aminoglycoside group of antibiotics , including gentamicin and neomycin , to name a few , is preferably added to the inoculum to suppress contaminating bacteria while permitting l . intracellularis growth . whether the inoculum is a pure culture or an intestinal homogenate , inoculation of the culture cells can be performed by various techniques known in the art , given the teachings herein . the bacteria and / or inoculated culture cells are then incubated under a reduced dissolved o 2 concentration . at dissolved oxygen concentrations greater than 10 % l . intracellularis growth is less than optimal with cessation of growth eventually occurring at oxygen concentrations outside this range . preferably , the bacteria and / or inoculated culture cells are incubated in a dissolved oxygen concentration in the range of about 0 % to about 10 %. more preferably , the bacteria and / or cells are incubated in an oxygen concentration in the range of about 0 % to about 8 %, with an oxygen concentration of about 0 % to about 3 . 0 % being most preferred . the proper concentration of carbon dioxide is also important to the proper growth of l . intracellularis . at carbon dioxide concentrations greater than 0 % and less than 4 %, non - optimum growth occurs with cessation of growth eventually occurring at carbon dioxide concentrations outside this range . preferably , the carbon dioxide concentration is in the range from about 6 % to about 10 %, with a carbon dioxide concentration of about 8 . 8 % being most preferred . in addition , the cells are preferably incubated at a hydrogen concentration in the range from about 4 % to about 10 %. most preferably , the cells are incubated in about 0 to about 8 . 0 % o 2 , about 8 . 8 % co 2 , and about 4 % h 2 . nitrogen is used as a “ balance ” in the gas mixture containing nitrogen ( 96 %) and hydrogen ( 4 %) or nitrogen ( 80 %), carbon dioxide ( 10 %) and hydrogen ( 10 %) for growth of this organism . cells are preferably incubated at a nitrogen concentration in the range from about 80 % to 96 %. therefore , cells are most preferably incubated in about 0 to about 8 . 0 % o 2 , about 8 . 8 % co 2 , about 4 % h 2 and about 96 % n 2 . inoculated cells may be incubated in a dual gas incubator or other gas chambers which contain the proper hydrogen , oxygen and carbon dioxide concentrations and which allow the cells to be suspended during incubation . the chamber should comprise a means for maintaining the inoculated cells in suspension , and a gas monitor and supply source to supply and maintain the proper gas concentrations . the incubation temperature should be in the range of from 30 ° c . to about 45 ° c . and is more preferably in the range of from about 36 ° c . to about 38 ° c . most preferably , the temperature is about 37 ° c . the necessary equipment for cultivation and attenuation is readily available to those of ordinary skill in the art given the teachings herein . one example of equipment suitable for carrying out the present invention is a dual gas incubator , e . g ., model 480 ( lab - line , melrose park , ill .) in conjunction with spinner flasks to maintain the cells in suspension . the presently preferred equipment comprises a fermentor , bioreactor , stir plate or rotary shaker containing at least about 2 liters media and capable of maintaining the culture cells in suspension via sparging gas of the appropriate concentration , or other means of mechanical agitation , and continuously monitoring dissolved o 2 levels in the media . new brunswick , braun and other companies make suitable fermentors and bioreactors for this purpose . by maintaining the inoculated cells in a suspended state during incubation , maximum growth of the cells , and hence l . intracellularis , is achieved by increasing each individual cell &# 39 ; s exposure to growth media and the proper mixture of hydrogen , oxygen and carbon dioxide . the culture cells can be agitated and maintained in suspension by a variety of methods known in the art including , for example , culture flasks , roller bottles , membrane cultures , biobags , wave ® bioreactor systems , fermentors and spinner flasks . the cells may be kept in suspension during incubation by incubating the cells in a spinner flask inside a dual gas incubator or similar apparatus . the term “ spinner flask ”, as used herein , means a flask or other container which employs a paddle , propeller or other means to agitate the culture and keep the cells contained therein in suspension . in a preferred embodiment , the inoculated cells are incubated until the cells reach confluency and then the cells are placed in a spinner flask containing growth media and incubated in a dual gas incubator while spinning the flask . preferably , the inoculated cells are scraped or trypsinized and passaged into the spinner flask . this can be achieved by a variety of methods known in the art such as using a cell scraper to detach the cells . once the cells are introduced into the spinner flask , the paddle of the spinner flask is typically rotated in the range of from about 5 to about 500 rpm on a magnetic stir plate in order to maintain the infected cells in suspension . a portion of the cultivated l . intracellularis is then passaged to fresh culture to increase the production of l . intracellularis bacteria . the term “ passaging ” or variations thereof herein means the process of transferring a portion of the cultivated l . intracellularis to fresh culture cells in order to infect the fresh cells with the bacterium . the term “ fresh ”, as used herein , means cells which have not yet been infected by l . intracellularis . preferably such cells are on the average no more than approximately one day old . the passage of l . intracellularis in suspension cultures may be accomplished by removing a portion of the original culture and adding it to a new flask containing fresh culture cells . if the original culture has a high number of bacteria / ml , for example , greater than about 10 4 bacteria / ml , it is preferable to add between about 1 to 10 % ( volume to volume ) of culture from the infected flask to a new flask containing fresh cells . this is preferably done when 50 - 100 % of the cells are infected . if fewer than 50 % of the cells are infected , passaging is preferably accomplished by splitting the culture 1 : 2 into a new flask and scaling - up the volume by adding fresh tissue culture cells and media . in either case , cell lysis and other steps are not required , in direct contrast to the passage of monolayer cultures , as in the prior art . after sufficient growth of the culture cells and subsequent infection by l . intracellularis , as determined by indirect fluorescent antibody ( ifa ) staining , tcid 50 or another comparable method , at least a portion of the cultivated l . intracellularis bacteria is then harvested . harvesting is typically performed at cell infectivity of about 60 % or higher ; however , one skilled in the art knows that harvesting could be performed at a cell infectivity of less than 60 %. the harvesting step may be performed by separating the bacteria from the suspension by various techniques known to those of ordinary skill in the art , given the teachings herein . preferably , the l . intracellularis bacteria is harvested by centrifuging the contents of all or a portion of the suspension to pellet the culture cells , resuspending the resulting cell pellets , and lysing the infected cells . typically , at least a portion of the contents is centrifuged at about 3000 × g for about 20 minutes in order to pellet the cells and bacteria . the pellet may then be resuspended in , for example , a sucrose - phosphate - glutamate ( spg ) solution and passed approximately 20 times through a 25 gauge needle in order to lyse the cells . if further purification is desired , the samples can be centrifuged at about 145 × g for about five minutes to remove cellular nuclei and debris . the supernatant may then be centrifuged at about 3000 × g for about twenty minutes and the resulting pellet resuspended in an appropriate diluent , such as spg with fetal bovine serum ( to prepare harvested bacteria suitable for lyophilization , freezing , or use as an inoculant ) or growth media ( to prepare harvested bacteria more suitable for passaging to fresh cells ). as previously mentioned , effective growth of l . intracellularis for large - scale production is enhanced by keeping the tissue cells actively growing . with monolayers , when cultures become confluent , the rate of cell division decreases substantially . attempts to grow l . intracellularis on monolayer tissue cultures have had limited success and scale - up has not been possible . however , using suspension cultures greatly facilitates keeping the cells actively growing and permits continuous culture expansion and scale - up . using a fermentor and between about 0 to 3 % dissolved o 2 as explained above , enables growth of up to and greater than 10 8 bacteria / ml . when using iec - 18 cells , it is preferable to add gelatin , agarose , collagen , acrylamide or silica beads , such as cultisphere - g porous microcarriers ( hyclone laboratories , logan utah ), along with the growth media . however , hep - 2 cells and others do not require microcarriers according to the methods used herein . for culture maintenance purposes , with hep - 2 cultures , preferably 25 % to 50 % of the culture is removed and replaced with fresh media at weekly intervals . for cell cultures with microcarriers or beads , preferably 25 % to 50 % of the culture is removed and replaced with fresh media 1 - 2 times weekly . for scale - up purposes , an additional 25 % to 50 % of media , or media with microcarriers , may be added to the culture . depending upon the rate at which the culture cells become infected , passage to fresh cells generally occurs between about every 2 to about 7 days . assuming that the culture cells become at least 70 % infected within 2 to 7 days , preferably passage occurs between about every 5 to 7 days . the present invention also provides vaccines and methods for producing vaccines against a novel isolate of l . intracellularis of european origin . preferably , after maintaining the infected cells in suspension for an extended time ( for example , 6 - 8 months ), at least a portion of the cultivated l . intracellularis bacteria are harvested and monitored for potential attenuation . such monitoring is preferably accomplished by host animal or animal model challenges to select for an attenuated isolate . such attenuated isolates are used in vaccines according to the methods taught herein . the present invention allows rapid culture expansion , an increase in yields of 100 - 1000 fold , and reduced cost for production of l . intracellularis of european origin . as a result , the abundant supply of l . intracellularis bacteria produced is readily attenuated for vaccine production purposes . the method of growing l . intracellularis in suspension greatly increases the ease , speed , and number of bacterium available for this purpose . the more cells and cell divisions which occur , the greater the level of mutations occurring which are advantageous in vaccine development . thus , growth in suspensions increases the expression of important immunogens controlled by environmentally regulated genes and their expression products . the resulting attenuated isolates can be cultivated in tissue culture monolayers but are preferably cultivated in suspension cultures . other means of attenuation can include chemical attenuation by the use of , for example , n - methyl nitrosoguanidine and others known in the art . whether by multiple passage or chemical means , an attenuated l . intracellularis is produced and selected for vaccine preparation . in a preferred embodiment , the resulting attenuated isolate is atcc accession no . pta - 4926 . the vaccine antigen can be harvested by centrifugation or microfiltration as described above . the antigen is then standardized at a defined level based on the optimum host animal immune response , determined by a dose titration in the host animal species . the bacteria may be inactivated by methods known in the art , e . g ., by using 0 . 3 % formalin or other inactivating agents to prepare a killed vaccine . the antigen is then incorporated into a suitable adjuvant , such as aluminum hydroxide or mineral oil to enhance the immune response . the antigen is then used to vaccinate the host via intramuscular or subcutaneous infection , in the case of swine at about 3 - 4 weeks of age , with a booster dose if necessary . preferably , the bacteria is serially passaged to induce and select for an attenuated , avirulent live culture . the culture is tested in the host animal for signs of attenuation . the culture is harvested as described earlier and lyophilized . swine , for example , are orally vaccinated with 1 × 10 4 to 1 × 10 6 bacteria . about twenty - eight days after vaccination , the swine are orally inoculated with about 1 × 10 7 organisms from a less passaged ( less than 30 passages in vitro past the original isolation from the intestinal homogenate ) virulent culture of l . intracellularis . infected animals are necropsied 21 days after challenge and the small intestines observed for gross lesions as well as microscopic lesions . pcr , indirect fluorescent antibody ( ifa ) or immunohistochemistry ( ihc ) should also be performed . about eighty percent of the control animals will show gross or microscopic lesions and test positive for the presence of l . intracellularis in the mucosal cells of the intestines using either pcr , ifa or ihc testing methods . vaccinated animals will have normal mucosal surfaces as determined by histological observations and will be negative by pcr testing 3 to 4 weeks post inoculation . generally , an attenuated immunogenic l . intracellularis isolate is produced after continuous culture for about 150 days to about 250 days , during which time the culture is passaged about 50 - 100 times . however , one skilled in the art knows that other attenuated cultures may be produced by varying these figures . the vaccine product of the invention can be lyophilized . after harvesting , the isolate can be concentrated by various methods known in the art and can be mixed with a stabilizer , e . g . sucrose gelatin stabilizer . the vaccine product can then be subjected to freezing and drying ( lyophilization ). generally , the freezing step comprises ramping to about − 45 ° c .± 3 ° c . and holding for about 150 minutes to about 480 minutes . the drying step can comprise primary and secondary drying steps . for example , the primary drying step can comprise : ( a ) ramping to between about − 30 ° c . to about − 5 ° c . and holding for between about 120 minutes to about 1000 minutes , and , optionally ( b ) ramping to between about − 5 ° c . to about 5 ° c . and holding for between about 150 minutes to about 2000 minutes . the secondary step generally comprises ramping to about 27 ° c .± 5 ° c . and holding for between about 330 minutes to about 1120 minutes . one skilled in the art knows that these ranges can be adjusted depending on conditions , e . g ., starting volume . a vaccine is then prepared comprising an immunologically effective amount of the attenuated l . intracellularis in a pharmaceutically acceptable carrier . in a preferred embodiment , a vaccine comprises atcc accession no . pta - 4926 in a pharmaceutically acceptable carrier . the combined immunogen and carrier may be an aqueous solution , emulsion or suspension . an immunologically effective amount is determinable by means known in the art without undue experimentation given the teachings contained herein . in general , the quantity of immunogen will be between 5 and 5000 micrograms , and between 10 2 . 0 and 10 9 . 0 tcid 50 , preferably between 10 3 . 0 and 10 6 . 0 tcid 50 , more preferably between 10 4 . 0 and 10 5 . 0 tcid 50 , when purified bacteria are used . the present invention also encompasses combination vaccines comprising the attenuated l . intracellularis isolate designated atcc accession no . pta - 4926 and antigenic material from at least one other pathogen , including but not limited to : salmonella spp . ( e . g ., salmonella choleraesuis , salmonella typhimurium ), erysipelothrix spp . ( e . g ., erysipelothrix rhusiopathiae ), haemophilus spp . ( e . g ., haemophilus parasuis ), mycoplasma spp . ( e . g ., mycoplasma hyopneumonia ), leptospira spp ., clostridium spp . ( e . g ., clostridium perfingens , clostridium difficile ), streptococcus spp . ( e . g ., streptococcus suis ), brachyspira spp . ( e . g ., brachyspira hyodysenteriae ), bordetella ( e . g ., bordetella bronchiseptica ), pasteurella spp . ( e . g ., pasteurella multocida ), circovirus ( e . g ., porcine circovirus type 2 ), porcine reproductive and respiratory syndrome ( prrs ) virus , swine influenza virus ( siv ), coronovirus ( e . g ., transmissible gastro - enteritis ( tge ) virus , porcine respiratory corona virus ), parvovirus , or escherichia coli ; and a pharmaceutically acceptable carrier . in one embodiment , the combination vaccine comprises the attenuated l . intracellularis isolate designated atcc accession no . pta - 4926 and antigenic material from salmonella choleraesuis , erysipelothrix spp . clostridium spp , brachyspira spp ., transmissible gastro - enteritis ( tge ) virus , and escherichia coli ; and a pharmaceutically acceptable carrier . antigenic material from clostridium spp . can include , but is not limited to , clostridium perfingens and clostridium difficil . antigenic material from erysipelothrix spp . can include , but is not limited to , erysipelothrix rhusiopathiae . in another embodiment , the combination vaccine comprises the attenuated l . intracellularis isolate designated atcc accession no . pta - 4926 and antigenic material from salmonella choleraesuis and erysipelothrix spp . ; and a pharmaceutically acceptable carrier . in another embodiment , the combination vaccine comprises the attenuated l . intracellularis isolate designated atcc accession no . pta - 4926 and antigenic material from salmonella choleraesuis and erysipelothrix rhusiopathiae ; and a pharmaceutically acceptable carrier . in another embodiment , the combination vaccine comprises the attenuated l . intracellularis isolate designated atcc accession no . pta - 4926 and antigenic material from at least one other pathogen , including but not limited to : clostridium spp . e . g ., clostridium tetani ), equine influenza virus ( eiv ) ( e . g ., eiv - 1 , eiv - 2 ), equine herpes virus ( ehv ) ( e . g ., ehv - 1 , ehv - 2 , ehv - 3 , ehv - 4 , ehv - 5 , ehv - 6 , ehv - 7 ,), alphavirus ( e . g ., eastern encephalitis virus , western encephalitis virus , venezuelan encephalitis virus ), or west nile virus . ; and a pharmaceutically acceptable carrier . the vaccines according to the invention are generally administered to susceptible animals , preferably swine , in one or more doses . the live or killed vaccine may be administered 1 or 2 times at 2 week intervals . for the attenuated , live vaccines , one dose is preferred . the preferred routes of administration of attenuated live isolates are intramuscular , oral or intranasal , but intramuscular and subcutaneous injection routes are most preferred for the killed vaccine . effective diagnosis of ppe has also been hindered by the time required to culture the causative bacteria . as a result of the present invention , development of diagnostic tools promoting rapid and accurate assays for the presence of l . intracellularis in biological samples taken from swine and other animals susceptible to ppe is now possible . the l . intracellularis bacteria of european origin of the instant invention , or components derived from such bacteria , can be used as an antigen in an elisa or other immunoassay , such as an immunofluorescent antibody test (“ ifa ”), to detect antibodies to l . intracellularis in the serum and other body fluids of animals suspected of being infected with the bacteria . the presently preferred immunoassay is an ifa as described in the example below . alternatively , the bacteria of the instant invention can be used in a western blot assay . the preferred elisa protocol according to the invention is as follows : 1 . add 0 . 1 ml / well antigen diluted in coating buffer . incubate for 18 hours at 4 ° c . 2 . wash 3 times with pbs . 3 . add 0 . 25 ml of blocking buffer to each well of plate . incubate 1 to 2 hours at 37 ° c . 4 . wash 3 times with wash buffer . 5 . dilute serum in blocking buffer and add 0 . 1 ml to the first wells of plate . make serial 1 : 2 dilutions across the plate . incubate for 1 hour at 37 . 6 . wash 3 to 5 times with wash buffer . 7 . dilute conjugate in blocking buffer and add 0 . 1 ml to wells of plate and incubate for 1 hour at 37 ° c . 8 . wash 3 to 5 times with wash buffer . 9 . add substrate . 10 . measure absorbance of light with a spectrophotometer . 11 . wells in which antigen was not added are used as blanks . 12 . positive and negative control swine serum should also be used with each test . 1 . run antigen on 12 % sds - page and transfer to nitrocellulose membrane . 2 . place membrane in blocking buffer for 2 hours . 3 . remove blocking buffer and rinse with pbs for 1 minute . 4 . dilute serum in blocking buffer and add to membrane . incubate for 2 hours at room temperature . 5 . wash 3 times with wash buffer ( 5 minutes for each wash ). 6 . dilute conjugate in blocking buffer and add to membrane . incubate for 1 hour at room temperature . 7 . wash 3 times with wash buffer . 8 . add substrate for 10 minutes or until strong banding occurs . 9 . rinse with pbs . 10 . air dry and store in the dark . the l . intracellularis bacteria of european origin of the instant invention , or components derived from such bacteria , can also be used to prepare antiserum or antibodies for diagnostic , prophylactic , or therapeutic use . the l . intracellularis bacteria of european origin of the instant invention , or components derived from such bacteria , can be administered to a non - human animal in an amount effective to elicit an immune response and the antiserum or plasma containing antibodies to the l . intracellularis bacteria , or components derived from such bacteria , can be collected according to methods known in the art and described herein . the present invention is further described in the following examples which are provided for illustrative purposes only and are not to be construed as limiting . indeed , other variants of the invention will be readily apparent to one of ordinary skill in the art . all publications and patents cited herein are incorporated by reference in their entireties . isolation and attenuation of l . intracellularis from the intestines of european pigs with porcine proliferative enteropathy ( ppe ): l . intracellularis virulent isolate dk 15540 ( dk 15540 , dk - 15540 and 15540 are used interchangeably herein ) was isolated by the university of minnesota from an ileal homogenate of a danish pig infected with acute porcine hemorrhagic enteropathy . this isolate has been deposited under the budapest treaty with the american type culture collection , 10801 university boulevard , manassas , va . 20110 - 2209 and assigned accession number pta - 4927 . the isolation process included scraping the mucosa from the ileum , homogenizing , trypsinizing for 30 minutes , and passing through a tissue grinder . the ileal homogenate was then passed through a series of filters consisting of 5 . 0 , 1 . 0 , and 0 . 65 μm . the homogenate was diluted in sucrose phosphate glutamate buffer with 10 % fetal bovine serum ( fbs ). aliquots ( 6 × 1 ml ) of homogenate were made and stored at less than − 70 ° c . the homogenate was used as inoculum to infect t - 75 cm 2 flasks of mccoy cells . cultures were monitored daily for mccoy cell infection by scraping mccoy cell monolayers , lysing cells by potassium chloride treatment , and placing the concentrated cell pellet on microscope slides stained by ifa using monoclonal antibodies specific for l . intracellularis . after eleven passages on anchorage dependent cell cultures , inoculum from passage eleven was transferred into a 250 ml spinner flask containing mccoy cells and grown in suspension until harvest . the danish isolate of l . intracellularis ( atcc accession no . pta - 4927 ) was attenuated by continuous in vitro passage in mccoy cells for 80 weeks and tested for identity by monoclonal antibodies . the attenuated isolate was designated b3903 ( b3903 , b 3903 and b - 3903 are used interchangeably herein ). isolate b3903 was deposited under the budapest treaty with the american type culture collection , 10801 university boulevard , manassas , va . 20110 - 2209 and assigned atcc accession no . pta - 4926 . characteristic growth requirements , pcr reactions , and monoclonal antibody reactions were used to identify l . intracellularis master and working seed materials . purity of master seed and working seed of l . intracellularis was determined by examining cultures with monoclonal antibody stains , conventional extraneous agents tests for bacteria and viruses and by sterility mycoplasma tests . master seeds of l . intracellularis were not virulent as demonstrated by the lack of ability of the master seed and back passage inoculum to produce clinical signs and gross lesions that are observed in susceptible swine following exposure of virulent l . intracellularis , as further illustrated in example 2 , infra . final harvested material from production of l . intracellularis did not exceed eleven passages from the master seed . eu mccoy master cell stock ( mcs ) were grown and maintained in dulbecco &# 39 ; s modified eagle medium with ham &# 39 ; s fortified f12 ( dmem / f12 ) and 1 - 10 % ( v / v ) newborn bovine serum ( nbs ) or fetal bovine serum ( fbs ) ( cell growth and maintenance media ). master and working seed were stored in dmem / f12 with 1 - 10 % ( v / v ) nbs or fbs and 5 - 15 % ( v / v ) glycerol ( master and working seed storage media ). the final harvest product was stored in sucrose gelatin stabilizer ( sgs ) ( final product storage media ). master and working seed cultures of l . intracellularis were propagated in eu mccoy mcs using cell growth and maintenance media as described supra and stored at less than or about − 35 ° c . l . intracellularis seed and production organisms were grown in mccoy master cell stock ( atcc accession number crl 1696 , batch number f - 10422 ). the mast cell stock was identified as 3894mmcss at passage x . the master cell stock was passaged an additional six times and identified as eu mccoy mcs x + 0 . eu mccoy mcs passage x + 0 was stored at − 70 ° c .± 5 ° c . or colder . production vaccine was made in eu mccoy mcs cell line subcultures through the 40 th passage . eu mccoy mcs were propagated in tissue culture flasks with 25 - 150 cm 2 surface area , costar cell cubes , in roller bottles with 850 cm 2 to 2 , 2250 cm 2 , in spinner flasks up to 40 l capacity , and in bioreactors having 3 l to 500 l capacity . seed cultures of l . intracellularis were grown in 250 - 40 , 000 ml spinner flasks , 850 cm 2 to 2 , 250 cm 2 roller bottles , tissue culture flasks with 25 - 150 cm 2 surface area , or in bioreactors having 3 l to 500 l capacity . production cultures of l . intracellularis were grown in 6 l to 40 l spinner flasks or in bioreactors having 3 l to 500 l capacity . frozen or fresh l . intracellularis master or expanded working seeds were thawed at room temperature ( 25 ° c .± 3 ° c .) or at 37 ° c .± 2 ° c . bioreactors , spinner flasks or bottles previously seeded with mccoy cells at a cell density of 50 , 000 to 500 , 000 cells / ml were infected with l . intracellularis at a concentration of 1 to 10 % ( v / v ) or moi of 0 . 08 to 1 . 0 . the infected culture was incubated under reduced oxygen concentrations by overlaying with a gas mixture composed of 86 % n 2 , 4 % h 2 and 10 % co 2 . the culture was incubated for 3 to 10 days at 37 ° c .± 2 ° c ., ph 6 . 7 to 7 . 3 , and with continuous agitation ( 10 to 100 rpm ) to maintain adequate mixing for the cells to remain in suspension . frozen or fresh l . intracellularis master or expanded working seeds were thawed at room temperature ( 25 ° c .± 3 ° c .) or at 37 ° c .± 2 ° c . bioreactors or spinner flasks 3 l to 500 l capacity ) previously seed ( 0 to 7 days ) with mccoy cells at a cell density of 50 , 000 to 500 , 000 cells / ml were infected with l . intracellularis at a concentration of 1 to 10 % ( v / v ) or moi of 0 . 08 to 1 . 0 . the infected culture was incubated under reduced oxygen concentrations by overlaying or sparging with a gas mixture composed of 96 % n 2 , 4 % h 2 . the culture was incubated for 3 to 8 days at 37 ° c .± 2 ° c ., ph 6 . 7 to 7 . 3 , and with continuous agitation ( 10 to 100 rpm ) to maintain adequate mixing for the cells to remain in suspension . up to 10 % ( v / v ) of master or working seed are inoculated ( moi = 0 . 08 to 1 . 0 ) into bioreactors , spinner flasks or bottles seed with mccoy cells at 0 - 7 days in growth medium . up to 10 % ( v / v ) of production seed was inoculated ( moi = 0 . 08 to 1 . 0 ) into an appropriate volume of growth medium seeded with mccoy cells at 0 to 7 days with the appropriate mccoy cell density in 3 l to 500 l capacity vessels . the cultures were incubated at 37 ° c .± 2 ° c . for 3 to 10 days in a reduced oxygen atmosphere with agitation to maintain the suspension . additional medium and / or mccoy cells can be added to continue the growth process . cultures were observed macroscopically during the incubation period for evidence of abnormal growth or signs of contamination . cultures were examined for signs of adequate bacterial growth by indirect fluorescent antibody ( ifa ) staining . cultures that were ready for harvest exemplified 60 to 100 % cell infectivity . percent infectivity was determined by observation of at least three fields , each field containing enough mccoy cells to fill at least 80 % of the area . to be considered infected , approximately 50 % of the cell is filled with bacteria . potency of the harvest culture is tested by titration of the sample on mccoy cells which are fixed and stained using specific monoclonal antibody ( anti - l . intracellularis monoclonal antibody vpm 53 lot 31599 or equivalent ; anti - mouse igg - fluorescein conjugate ( fitc ) ( icn no . 55499 ) after 6 days of incubation at 37 ° c .± 2 ° c . cultures were examined visually for any obvious signs of contamination . harvest occurred 3 to 10 days post inoculation . cell and fluid contents in the production culture bioreactor , spinner flasks and bottle were partially or fully collected in a sterile receiving vessel . each production culture bioreactor , spinner flask and bottle was harvested individually or the contents of several vessels were pooled with the addition of sgs and stored at 1 ° c . to 7 ° c . or colder . harvested production culture was sampled for potency by tcid 50 and identification by ifa staining . production cultures exhibited at least 4 . 9 tcid 50 / ml by ifa staining and were free of any evidence of contamination upon microscopic observation . the vaccine product can be concentrated by various methods , e . g ., by allowing the culture to settle with subsequent decanting of the supernatant , by membrane filtration ( 0 . 22 μm or smaller ), perfusion , or by centrifugation . hydrolyzed gelatin solution is prepared by mixing gelatin with deionized water or water for injection at approximately 25 % final total volume of sgs batch size and hydrolyzing in an autoclave for 120 minutes at 121 ° c . the hydrolyzed gelatin solution ( 40 . 0 g / l ) was then mixed with deionized water or water for injection at approximately 75 % final total volume of sgs batch size . potassium hydroxide ( ar ) ( 0 . 548 g / l ), l - glutamic acid ( 1 . 440 g / l ), dipotassium phosphate ( ar ) ( 2 . 508 g / l ), potassium dihydrogen phosphate ( ar ) ( 1 . 030 g / l ), and sucrose ( ar ) ( 150 . 00 g / l ) were added and the solution was thoroughly mixed . the ph of the stabilizer was then adjusted to 6 . 8 to 7 . 0 with hydrochloric acid or sodium hydroxide solutions . deionized water or water for injection was added to 100 % of desired final volume of the sgs . the complete stabilizer was thoroughly mixed , and the entire solution was sterilized by filtration through a 0 . 1 micron filter . example of assembly of units to make a serial is shown in table 1 : the vaccine product was lyophilized according to the procedure outlined in table 2 for a 10 dose cycle ( 6 . 0 ml fill ) or table 3 for a 50 / 100 dose cycle ( 10 . 0 ml fill ). the objectives of this study were two - fold . the first objective of this study was to observe and compare the incidence of disease caused by three different low passage isolates ( two of u . s . origin and one of european origin ) of l . intracellularis in pigs at 6½ weeks of age . the second objective was to observe the safety of two high passage isolates ( both of european origin ) of l . intracellularis in pigs at 6½ weeks of age . 3 . l . intracellularis low passage eu isolate dk 15540 p20 4 . l . intracellularis high passage eu isolate dk 15540 p60 5 . l . intracellularis high passage eu isolate dk 15540 p80 ( master seed designation b3903 ). low passage isolates were grown continuously for 10 - 20 weeks after isolation in mccoy cell suspension . high passage isolates were grown continuously for 60 - 80 weeks after isolation in mccoy cell suspension . all cultures were harvested via centrifugation at 10 , 000 rpm for 15 minutes . the mccoy cell culture pellets containing lawsonia were resuspended in sucrose - phosphate - glutamine ( spg ) solution with 10 % fbs . harvested cultures were stored at − 70 ° c . until the day of challenge . challenge cultures of the same isolate but from various harvest dates were thawed and combined into plastic vaccine bottles , labeled , and stored at 4 ° c . or on ice until the time of challenge . tcid 50 was performed on all pooled challenge isolates at the time of challenge ( day 0 ). the average titers ( n = 3 ) ( tcid 50 / ml ) were as follows in table 4 : the study consisted of five experimental groups and one control group . on day 0 of the study , group 1 ( 10 pigs , 6½ weeks of age ) received one 10 ml or equivalent intragastric ( ig ) dose of l . intracellularis low passage u . s . isolate n343 . group 2 ( 10 pigs , 6½ weeks of age ) received one 10 ml or equivalent ig dose of l . intracellularis low passage u . s . isolate n101494 . group 3 ( 10 pigs , 6½ weeks of age ) received one 10 ml or equivalent ig dose of l . intracellularis low passage eu isolate dk15540 p20 . group 4 ( 10 pigs , 6½ weeks of age ) received one 10 ml or equivalent ig dose of l . intracellularis high passage eu isolate dk15540 60 week . group 5 ( 20 pigs , 6 weeks of age ) received one 10 ml or equivalent dose of l . intracellularis high passage eu isolate dk 15540 p80 . group 6 ( 10 pigs , 6½ weeks of age ) designated as “ strict controls ” did not receive a treatment . daily health observations were made from initiation of study to the day of challenge of appropriate test animals . clinical health ( behavior , appetite , body condition , hair coat , and stool consistency on a scale of 1 to 4 were scored daily from day of challenge ( day 0 ) to termination of study ( day 21 ). average daily weight gains ( adwg ) were calculated from day of challenge ( day 0 ) to termination of study ( day 21 ). fecal shedding of l . intracellularis was evaluated on days 0 , 7 , 14 , and 21 . the one animal that died ( from group 1 ) throughout the study was examined for gross and microscopic lesions . death was determined to be due to lesions associated with ppe confirmed by histology and pcr analysis ; the animal was not replaced . qualitative analysis of lawsonia content in feces was evaluated by pcr along with histological evaluation for l . intracellularis on the ileum and colon . serum was collected on days 0 , 7 , 14 , and 21 of the study . daily health observations were made until challenge . the clinical condition of the animals was evaluated daily following challenge for the duration of the study . observations included : behavior , appetite , body condition , hair coat , and stool consistency . the clinical conditions of these animals were evaluated based on a numerical point system , which reflects the severity of illness . scores ranged from 1 to 4 for each parameter . a score of 1 was given to an animal with a normal , healthy appearance , a score of 3 for an animal demonstrating severe clinical signs , and a score of 4 for an animal that has deceased . the average daily score for the strict controls , dk15540 p60 , and dk15540 p80 was 5 . 0 . the average daily scores for low passage material was n343 ( 5 . 23 ), n101494 ( 5 . 15 ), and dk15540 p20 ( 5 . 01 ). statistical analysis on these results indicated no differences among treatment and control groups using kruskal - wallis rank sum test . average daily weight gains were calculated from the time of challenge ( day 0 ) to the termination of the study ( day 21 ). the average weight gain per day for the strict control group was 0 . 9 pounds . the average weight gain for the low passage treatment groups was only 0 . 6 ( n343 ), 0 . 8 ( n101494 ), and 0 . 86 ( dk15540 p20 ) pounds / day . the high passage treatment groups revealed the same or increased average weight gain per day compared to the strict control group that didn &# 39 ; t receive challenge with 0 . 9 pounds / day ( dk15540 p60 ) and 1 . 05 pounds / day ( dk15540 p80 ) respectively . the mean difference in average daily weight gains was significantly lower in the n343 treatment group compared to higher passage treatment groups ( dk15540 p60 and p80 ) and strict control group at day 21 of the study . ( pearson chi - square p & lt ; 0 . 05 ). seroconversion to lawsonia exposure in pigs was measured by testing for the presence of anti - lawsonia antibodies using an ifat assay . on day 0 , only the n343 treatment group observed detectable seroconversion in 2 / 10 pigs . day 7 observed 2 / 9 pigs ( n343 ) and 1 / 10 pigs ( dk15540 p20 ) ifa positive for lawsonia antibodies . on day 14 , 2 / 9 pigs were ifa positive in n343 treatment group , 1 / 10 in dk15540 p20 and p60 respectively . day 21 revealed 1 / 10 pigs ( n343 ), 4 / 10 pigs ( n101494 ) and 6 / 10 pigs ( dk15540 p20 ) were ifa positive while high passage treatment groups ( dk15540 p60 and p80 ) show no detectable seroconversion . seroconversion to lawsonia exposure increased in treatment groups receiving low passage l . intracellularis of both the u . s . and eu isolates day 21 of the study . pcr testing of the feces demonstrated shedding of l . intracellularis beginning on day 14 where 4 / 9 in the n343 , 4 / 10 in the n101494 , and 5 / 10 in the dk15540 p20 low passage animals tested positive . both high passage treatment and strict control groups were pcr negative for day 14 . on day 21 , dk15540 p20 treatment group had 1 animal pcr positive while all other treatment and control groups were pcr negative . no evidence of shedding was observed in high passage isolate groups ( dk15540 p60 and p80 ) using pcr throughout the study . pcr positive animals indicating active shedding of lawsonia in their feces were more significant in the low passage isolate groups ( n343 , n101494 , and dk15540 p20 ) on day 14 of the study than high passage isolate groups and strict controls ( pearson chi - square p & lt ; 0 . 05 ). pcr testing of mucosal scrapings from ileums and colons was performed after necropsy ( day 21 ). samples that were pcr positive for l . intracellularis colonization were ( 2 / 10 colons ) in n101494 and ( 2 / 10 ileums , and 4 / 10 colons ) in dk 15540 p20 low passage isolate groups . all other treatment and control groups were pcr negative in tissues day 21 of the study . results indicated ileums and colons of pigs in dk15540 p20 were significantly more colonized with l . intracellularis compared to all treatment and control groups (* pearson chi - square p & lt ; 0 . 05 ). sections of the terminal ileum and colon were collected at necropsy ( day 21 ) and placed in buffered formalin for histological analysis . presence of intracellular bacteria and crypt hyperplasia was observed in tissues stained with hematoxylin and eosin ( h & amp ; e ) and warthin - starry silver reagents of 4 / 9 pigs ( n343 ), 3 / 10 pigs ( n101494 ), 2 / 10 pigs ( dk15540 p60 ) and 1 / 20 pigs ( dk15540 p80 ). lesion development was confirmed by florescent antibody staining using monoclonal antibodies against lawsonia intracellularis in 1 / 9 pigs ( n343 ), 3 / 10 pigs ( n101494 ), and 1 / 10 pigs ( dk15540 p60 ). fa detected no lesions caused by lawsonia in the colons of all treatment and control groups . fa results indicated significant lesion development in ileums of pigs in n101494 treatment group compared to all treatment and control groups . h & amp ; e / silver staining showed significant lesion development associated with ppe in n343 treatment group compared to all treatment and control groups . ( pearson chi - square p & lt ; 0 . 05 ). ileums and colons were scored at the time of necropsy ( day 21 ) for lesions associated with ppe . tissues were given a score of 1 for normal appearance ( no lesion development ), a score of 2 for lesions demonstrating mild thickening , 3 for moderate thickening , and a score of 4 for severe thickening . strict controls had an average clinical score of 1 . 05 , n343 ( 1 . 0 ), n101494 ( 1 . 2 ), dk15540 p20 ( 1 . 2 ), and dk15540 p60 and p80 ( 1 . 0 ). average gross lesion scores indicated no statistical difference between control and treatment groups using anova test for multiple comparisons . based on the data collected , this study demonstrated that pigs challenged with a low passage dose of n343 , n101494 , and dk15540 with a tcid 50 greater than 1 × 10 7 bacteria / dose increases the incidence of ppe in these animals . high passage isolates ( dk15540 p60 and p80 ) given to pigs of the same age with a tcid 50 greater than 1 × 10 7 were proven safe and show reduction of colonization and lesion development associated with ppe . this conclusion was based on pcr on the mucosa of the ileum , histopathology , and fa stains of tissue sections . a reduction of shedding l . intracellularis in the feces determined by pcr was evident in high passage isolates compared to low passage isolates . average daily weight gains calculated for all treatment and control groups support this conclusion by demonstrating positive uniform daily weight gain in groups given the high passage isolate and strict controls compared to groups given low passage isolates especially animals in the n343 treatment group . this observation indicates reduction of weight gains in animals given low passage material which supports adequate and similar grow performance of animals given high passage material with animals receiving no challenge material . compared to the strict controls , the high passage isolates showed no negative impact on weight gain and overall health based on clinical scores . the objectives of this study were to determine the minimal protective titer of a vaccine comprising isolate b3903 ( lyophilized ) ( dk 15540 , passage 80 ) (“ b3903 ( lyophilized ) vaccine ” and “ b3903 vaccine ” are used interchangeably herein ) administered by oral drench in pigs 3 weeks of age and to demonstrate efficacy against a virulent heterologous pure culture challenge with low passage l . intracellularis , the causative agent of porcine proliferative enteropathy ( ppe ) in swine . test substance : attenuated live culture of l . intracellularis , isolate b3903 dk 15540 isolates were grown continuously for 80 weeks after isolation in mccoy cell suspension . all cultures were harvested via centrifugation at 10 , 000 rpm for 15 minutes . the mccoy cell culture pellets containing lawsonia were resuspended in sucrose - phosphate - glutamine ( spg ) solution with 10 % fbs . desiccation was performed as described in example 1 , supra . the lyophilized product is reconstituted in water , q . s . ad 2 . 0 ml , for injections . the vaccine was stored at 2 ° c .- 8 ° c . until ready for use . after resuspension , the vaccine was stored on ice until administration . 1 . high dose ( treatment group 1 ): 1 × 2 ml ( 6 . 0 logs / dose ) via direct oral drench on day 0 of the study . 2 . medium dose ( treatment group 2 ): 1 × 2 ml ( 4 . 9 logs / dose ) via direct oral drench on day 0 of the study . 3 . low dose ( treatment group 3 ): 1 × 2 ml ( 3 . 8 logs / dose ) via direct oral drench on day 0 of the study . a placebo consisting of uninfected mccoy tissue culture cells suspended in dmem / f12 growth medium fortified with 5 % nbs was given to treatment groups 4 ( challenge control ) and 5 ( negative control ) on day 0 of the study . this substance was administered to piglets in treatment group 4 by direct oral drench and given 1 × 2 ml of placebo per test animal . l . intracellularis n101494 was obtained from the intestines of a 12 week old pig from an indiana farm ( u . s . pat . no . 5 , 714 , 375 ). l . intracellularis challenge material was grown continuously in mccoy cell suspension no more than 30 passes after initial isolation from infected gut tissue . active cultures ( 2 × 3 l ) identified as sf 1422 and sf 1423 in addition to ( 1 l ) sf 1421 were grown in mccoy cell suspension for 7 days to 15 - 30 % mccoy cell infection . on the day of challenge ( day 21 ), active cultures were harvested via centrifugation at 10 , 000 rpm for 15 minutes and cell pellets resuspended in 350 mls total volume with spg stabilizer . harvested active culture was pooled with 300 mls of frozen 10 × to 20 × concentrated challenge stocks of low passage n101494 at various passages ( pass 24 to 27 post isolation ). final formulations ready for challenge were stored at 2 ° c . to 8 ° c . or on ice until inoculation . results from the tcid 50 assay verified the amount of live l . intracellularis administered to each test animal per dose during vaccination and challenge . the average titers ( n = 5 ) of pre and post titrations for the b3903 vaccine and the challenge material ( l . intracellularis n101494 ) were as follows in table 6 : sixty - five healthy l . intracellularis negative weaned piglets at 3 weeks of age were randomly divided into 5 treatment groups and housed separately throughout the study . on day 0 , treatment group 1 ( 15 pigs ) received a 2 ml dose ( 6 . 0 logs / dose ) of b3903 vaccine by direct oral drench . treatment group 2 ( 15 pigs ) received 1 × 2 ml dose of b3903 vaccine titrated at 4 . 9 logs / dose by direct oral drench . treatment group 3 ( 15 pigs ) received 1 × 2 ml dose of b3903 vaccine titrated at 3 . 8 logs / dose by direct oral drench . treatment groups 4 and 5 ( 10 pigs / group ) received 1 × 2 ml dose of placebo by direct oral drench . on day 21 of the study ( 3 weeks post vaccination ), test pigs in treatment groups 1 - 4 received 1 × 10 ml dose of virulent low passage pure culture l . intracellularis heterologous isolate n101494 by gastric gavage . on day 42 of the study ( 3 weeks post challenge ), all treatment groups ( 1 - 5 ) were euthanized and necropsied for gross and microscopic lesion analysis for ppe . daily health observations were made from study initiation to the day of challenge for each test animal . clinical health ( diarrhea , behavior , and body condition ) were scored daily from day of challenge ( day 21 ) to termination of study ( day 42 ). weights were taken on day of vaccination ( day 0 ), day of challenge ( day 21 ) and on day of study termination ( day 42 ) to calculate average daily weight gains of each treatment group . fecal shedding of l . intracellularis was evaluated by polymerase chain reaction ( pcr ) by testing fecal swabs ( f - pcr ) on days 0 , 7 , 14 , 21 , 28 , 35 , and 42 of the study . all animals euthanized at study termination ( day 42 ) were examined for gross and microscopic lesions . qualitative analysis of bacterial content in tissues was evaluated by pcr ( t - pcr ) along with histological evaluation for l . intracellularis in the ileum , colon , tonsil , and mesenteric lymph node day 42 of the study . serum was collected on days 0 , 7 , 14 , 21 , 28 , 35 , and 42 of the study . serum was tested using the indirect florescent antibody test ( ifat ) to detect anti - lawsonia antibodies in test animals . treatment group comparisons were made by data analysis of average daily weight gains post vaccination and post challenge , clinical scores , seroconversion rates ( ifat ), colonization ( t - pcr ), fecal shedding ( f - pcr ), gross lesion , and microscopic lesion development by immunohistochemistry ( ihc ). final test results for each treatment group revealed significant gross and microscopic lesion development of the ileum and colon in non - vaccinated , challenge control pigs ( group 4 ) compared to vaccinated pigs regardless of dose ( high , medium , and low ) in groups 1 , 2 , and 3 ( p & lt ; 0 . 05 ). average gross lesion scores of the vaccine - low dose colons were not significantly different than challenge controls . the vaccine - low dose group ( group 3 ) is the only treatment group that received vaccine and had significant lesion development ( gross and microscopic ) in comparison to the strict control group which did not receive a vaccination , placebo , or challenge throughout the study . clinical scores were recorded for each animal daily from day of challenge ( day 21 ) to necropsy ( day 42 ). clinical scores were calculated to obtain an average daily clinical score reflecting the severity and duration of sickness among treatment groups due to receiving a virulent challenge of l . intracellularis . average clinical scores for each treatment group are summarized in table 8 . statistical analysis of clinical scores was accomplished by reviewing the data in relation to treatment groups receiving average clinical scores using 1 - way anova . there was no evidence of significant differences among non - vaccinated , challenge controls and strict controls compared to the high , medium , or low dose vaccine groups . average daily weight gains ( adwg ) were calculated from the time of vaccine administration ( day 0 ), to challenge administration ( day 21 ), to the termination of the study ( day 42 ). statistical analysis of weight gain differences ( lbs .= pounds ) between vaccine - high dose and non - vaccine , challenge control treatment groups revealed evidence of a significant difference from the time of challenge administration to necropsy ( p & lt ; 0 . 05 ). the weight data is summarized in table 9 . serum samples were collected weekly from all test animals in each treatment group and tested for presence of anti - lawsonia igg antibodies on days 0 , 7 , 14 , 21 , 28 , 35 , and 42 of the study . positive and negative ifat control samples were 100 % accurate in all assays performed in this study . on days 0 through 21 ( 3 weeks post vaccination ), all test animals in each treatment group were ifa negative . on day 28 ( 1 week post challenge ) of the study 1 / 15 ( 6 . 7 %) test animals in the vaccine - high dose treatment group were ifa positive while all others tested ifa negative . on day 35 ( 2 weeks post challenge ) of the study , 4 / 15 ( 26 . 7 %) pigs in the vaccine - high dose and medium dose treatment groups and 1 / 10 ( 10 %) pigs in the non - vaccine , challenge control treatment group were ifa positive for lawsonia antibodies . both vaccine - low dose and strict control treatment groups were ifa negative on day 35 . on day 42 ( 3 weeks post challenge ) of the study , 8 / 10 ( 80 %) pigs in the challenge control group , 6 / 15 ( 40 %) pigs in the vaccine - medium dose group , 5 / 15 ( 33 . 3 %) pigs in the vaccine - low dose group , and 3 / 15 ( 20 %) pigs in the vaccine - high dose group were ifa positive . the strict control treatment group was ifa negative at study termination ( day 42 ). seroconversion data was analyzed using the chi - square statistic . for results obtained in the strict control treatment group , a chi - square statistic was not computed due to the 100 % negative responses found for each test animal throughout the study . in treatment groups receiving a vaccine or placebo , ifat results were compared using chi - square statistic with an estimation of exact p - value ( monte - carlo ). positive ifat results obtained from challenge groups receiving a virulent pure culture challenge were significantly higher than those receiving vaccine - high dose and vaccine - low dose ( p & lt ; 0 . 05 ) at day 42 ( 3 weeks post challenge ) of the study . fecal swabs were collected weekly from all test animals in each treatment group and tested for the presence of l . intracellularis by pcr on days 0 , 7 , 14 , 21 , 28 , 35 , and 42 of the study . positive and negative dna extraction and pcr reaction controls were 100 % accurate for each assay conducted in this study . all test animals in each treatment group were fecal pcr negative for l . intracellularis from day 0 ( vaccination ) to day 21 ( challenge ). pigs in the strict control group remained fecal pcr negative for l . intracellularis in their feces throughout the study . fecal shedding of l . intracellularis ( fecal pcr positive ) was evident in various treatment groups each week after challenge inoculation . these results are summarized in table 10 . statistical analysis using chi - square statistic with an estimation of the exact p - value ( monte carlo ) compared the positive responses in each vaccine treatment group to the non - vaccine , challenge control group only . results from the strict control group were withdrawn from group comparisons because each pig was 100 % fecal pcr negative for l . intracellularis throughout the study . on day 28 ( 1 week post challenge ), pigs receiving a high dose of vaccine had significantly less shedding of l . intracellularis than non - vaccinated , challenged pigs ( p = 0 . 017 ). on day 35 ( 2 weeks post challenge ), pigs receiving a high dose ( p = 0 . 0024 ) and medium dose ( p = 0 . 041 ) of vaccine had significantly less shedding of l . intracellularis in their feces than non - vaccinated challenged pigs . on day 42 ( study termination ), again , pigs receiving a high and medium dose of vaccine ( p = 0 . 017 ) had significantly less shedding of l . intracellularis in their feces compared to the non - vaccinated , challenged pigs . pigs in the low dose group were not significantly less pcr positive than the challenge controls on any day post challenge . polymerase chain reaction testing of tissue sections of the terminal ileum , colon , tonsil , and mesenteric lymph node were performed after necropsy ( day 42 of the study ). in the vaccine - high dose group , 1 / 15 ( 6 . 7 %) pigs were pcr positive for l . intracellularis colonization in the tonsil while all other treatment groups were pcr negative . ileitis pcr testing of mesenteric lymph tissue revealed 3 / 10 ( 30 %) pigs in the non - vaccinated , challenge controls were positive for l . intracellularis colonization while all other treatment groups were pcr negative . ileitis pcr testing of mucosal scrapings of the terminal ileum revealed 4 / 10 ( 40 %) pigs in the challenge controls , 4 / 15 ( 26 . 7 %) pigs in the vaccine - low dose group , 2 / 15 ( 13 . 3 %) pigs in the vaccine - medium dose group , and 1 / 15 ( 6 . 7 %) pigs in the vaccine - high dose group pcr positive for l . intracellularis colonization . ileitis pcr testing of the colon revealed 3 / 10 ( 30 %) pigs in the challenge controls , 5 / 15 ( 33 . 3 %) pigs in the vaccine - low dose group , 1 / 15 ( 6 . 7 %) pigs in the vaccine - medium dose group , and 2 / 15 ( 13 . 3 %) pigs in the vaccine - high dose group pcr positive for l . intracellularis colonization . no evidence of l . intracellularis colonization was seen in tissues of the strict control group . statistical analysis of ileitis pcr positive results were compared among treatment groups using chi - square statistic with monte carlo approximation of the exact p - value . mesenteric lymph node pcr results indicated evidence of a significant difference among non - vaccinated , challenge controls and all treatment groups receiving a vaccine treatment ( p = 0 . 054 ). no statistical significance was evident among treatment groups in l . intracellularis colonization in the ileum , colon , or tonsil at day 42 of the study . sections 2 to 4 cm in length of tonsil , mesenteric lymph node , terminal ileum , and colon were collected at necropsy ( day 42 ) and placed in 10 % buffered formalin for histological analysis . lawsonia intracellularis was not detected by ihc staining of tonsil sections in all treatment groups at necropsy . the strict control group was negative for l . intracellularis by ihc in all tissue samples taken at necropsy . presence of l . intracellularis and microscopic lesions associated with ppe were found in the ileums of 9 / 10 ( 90 %) pigs of the non - vaccinated , challenge controls , 6 / 15 ( 40 %) pigs of the vaccine - low dose group , 3 / 15 ( 20 %) pigs of the vaccine - medium dose group , and 1 / 15 ( 6 . 7 %) pigs of the vaccine - high dose group respectively . microscopic lesions were evident in the colon of 8 / 10 ( 80 %) pigs in the challenge control group , 3 / 15 ( 20 %) pigs in the vaccine - low dose group , and 1 / 15 ( 6 . 7 %) pigs in the vaccine - high dose group . the vaccine group receiving a medium dose was ihc negative for l . intracellularis in the colon . stained sections of mesenteric lymph node produced only 1 / 10 ( 10 %) pigs in the challenge control that had l . intracellularis . positive ihc results in sections of the ileum and colon among treatment groups correlated well to the presence of marked crypt hyperplasia demonstrated by h & amp ; e methodology . statistical analysis of quantitative ihc data was accomplished using 1 - way anova and kruskal - wallis rank sum tests followed by specific contrasts of p - values between the challenge group and strict control groups to each vaccine dosage group . statistical analysis reveal evidence of a significant lesion development due to l . intracellularis in the ileum and colon of the challenge control group compared to vaccinated pigs regardless of dose on day 42 of the study ( p & lt ; 0 . 001 ). statistical significance was not evident in average ihc lesion scores of the ileum and colon in vaccinated animals receiving a high or medium dose of vaccine compared to the strict control treatment group ( p & gt ; 0 . 05 ). pigs receiving a low dose of vaccine had significantly higher mean microscopic lesion scores due to l . intracellularis in the ileum compared to the strict control group ( p & lt ; 0 . 05 ). the ileum and colon of each test animal were scored at the time of necropsy ( day 42 ) for gross lesions associated with ppe . tissues from test pigs in the strict control were normal , did not contain lesions , and received average lesion scores of 1 . 1 ( ileum ) and 1 . 0 ( colon ). tissues of test animals in the non - vaccinated , challenge control group received the highest average gross lesion score for the ileum ( 3 . 6 ) and colon ( 2 . 0 ) among treatment groups . test pigs in the vaccine - low dose group received average gross lesion scores of 2 . 5 ( ileum ) and 1 . 5 ( colon ). vaccine - medium dose test pigs received average gross lesion scores of 1 . 5 ( ileum ) and 1 . 0 ( colon ). tissues of the vaccine - high dose group received average gross lesion scores of 1 . 5 ( ileum ) and 1 . 2 ( colon ). statistical analysis of average gross lesion scores among treatment groups was accomplished by using 1 - way anova . average gross lesion scores indicated evidence of a significant difference between ileums in non - vaccinated , challenge control group and vaccine - medium and high dose groups respectively ( p & lt ; 0 . 001 ). evidence of a significant difference was observed among average gross ileum scores of the challenge control compared to the vaccine - low dose group ( p & lt ; 0 . 01 ). average gross lesion scores of the colon were significantly higher in the challenge control group compared to the vaccine - medium and high dose groups respectively ( p & lt ; 0 . 05 ). in addition , significant gross lesion development was observed in the ileum of the vaccine - low dose group compared to the strict control group ( p & lt ; 0 . 001 ). no evidence of a statistical significance in average gross lesion scores ( ileum and colon ) were evident in vaccine - medium and high dose groups compared to the strict control treatment group . this study demonstrated protection in 3 - week - old pigs against ppe was accomplished when given an oral 2 ml dose of b3903 ( lyophilized ) vaccine containing a minimum of 4 . 9 logs of live l . intracellularis per dose . similar if not slightly better protection was evident in the vaccine - high dose treatment group that received 6 . 0 logs / dose 3 weeks prior to challenge . the low dose vaccine group ( 3 . 8 logs / dose ) did not indicate adequate protection against a virulent pure culture heterologous challenge compared to the test animals receiving a high or medium dose of the experimental vaccine . statistical differences were evident among the vaccine - low dose group and non - vaccinated , challenge controls regarding the severity of microscopic lesions in the ileum and colon ( p & lt ; 0 . 001 ) and average gross lesion scores of the ileum ( p & lt ; 0 . 01 ). however , significant ppe lesions were observed in the ileum ( microscopic lesions ) and colon ( gross lesions ) of this group compared to the strict control group that did not receive vaccine or challenge . in summary , the data from this study demonstrated that : ( 1 ) the minimum protective titer of a single oral administration of b3903 ( lyophilized ) vaccine to 3 week old pigs is 4 . 9 logs / dose ; ( 2 ) b3903 ( lyophilized ) vaccine is efficacious against a virulent low passage pure culture l . intracellularis , heterologous isolate n101494 ; and ( 3 ) b3903 ( lyophilized ) vaccine aids in the reduction of gross and microscopic lesions , tissue colonization , and fecal shedding of l . intracellularis in vaccinated pigs compared to non - vaccinated pigs . | 8 |
terms are used within their accepted meanings . the following definitions are meant to clarify , but not limit , the terms defined . as used herein the term “ alkyl ” refers to a straight or branched chain hydrocarbon , preferably having from one to twelve carbon atoms . examples of “ alkyl ” as used herein include , but are not limited to , methyl , ethyl , propyl , isopropyl , isobutyl , n - butyl , tert - butyl , isopentyl , n - pentyl , and the like . as used throughout this specification , the preferred number of atoms , such as carbon atoms , will be represented by , for example , the phrase “ c x - c y alkyl ,” which refers to an alkyl group , as herein defined , containing the specified number of carbon atoms . similar terminology will apply for other preferred terms and ranges as well . as used herein the term “ alkenyl ” refers to a straight or branched chain aliphatic hydrocarbon containing one or more carbon - to - carbon double bonds . examples include , but are not limited to , vinyl , allyl , and the like . as used herein the term “ alkynyl ” refers to a straight or branched chain aliphatic hydrocarbon containing one or more carbon - to - carbon triple bonds . examples include , but are not limited to , ethynyl and the like . as used herein , the term “ alkylene ” refers to a straight or branched chain divalent hydrocarbon radical , preferably having from one to ten carbon atoms . alkylene groups as defined herein may optionally be substituted . examples of “ alkylene ” as used herein include , but are not limited to , methylene , ethylene , n - propylene , n - butylene . as used herein , the term “ alkenylene ” refers to a straight or branched chain divalent hydrocarbon radical , preferably having from one to ten carbon atoms , containing one or more carbon - to - carbon double bonds that may be optionally substituted . examples include , but are not limited to , vinylene , allylene or 2 - propenylene , and the like . as used herein , the term “ alkynylene ” refers to a straight or branched chain divalent hydrocarbon radical , preferably having from one to ten carbon atoms , containing one or more carbon - to - carbon triple bonds that may be optionally substituted . examples include , but are not limited to , ethynylene and the like . as used herein , the term “ cycloalkyl ” refers to an optionally substituted non - aromatic cyclic hydrocarbon ring , which optionally includes an alkylene linker through which the cycloalkyl may be attached . exemplary “ cycloalkyl ” groups include , but are not limited to , cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , and substituted versions thereof . as used herein , the term “ cycloalkyl ” includes an optionally substituted fused polycyclic hydrocarbon saturated ring and aromatic ring system , namely polycyclic hydrocarbons with less than maximum number of non - cumulative double bonds , for example where a saturated hydrocarbon ring ( such as a cyclopentyl ring ) is fused with an aromatic ring ( herein “ aryl ,” such as a benzene ring ) to form , for example , groups such as indane . as used herein , the term “ cycloalkenyl ” refers to an optionally substituted non - aromatic cyclic hydrocarbon ring containing one or more carbon - to - carbon double bonds which optionally includes an alkylene linker through which the cycloalkenyl may be attached . exemplary “ cycloalkenyl ” groups include , but are not limited to , cyclopropenyl , cyclobutenyl , cyclopentenyl , cyclohexenyl , cycloheptenyl , and substituted versions thereof . as used herein , the term “ cycloalkylene ” refers to a divalent , optionally substituted non - aromatic cyclic hydrocarbon ring . exemplary “ cycloalkylene ” groups include , but are not limited to , cyclopropylene , cyclobutylene , cyclopentylene , cyclohexylene , cycloheptylene , and the like . as used herein , the term “ cycloalkenylene ” refers to a divalent optionally substituted non - aromatic cyclic hydrocarbon ring containing one or more carbon - to - carbon double bonds . exemplary “ cycloalkenylene ” groups include , but are not limited to , cyclopropenylene , cyclobutenylene , cyclopentenylene , cyclohexenylene , cycloheptenylene , and the like . as used herein , the term “ heterocycle ” or “ heterocyclyl ” refers to an optionally substituted mono - or polycyclic ring system containing one or more degrees of unsaturation and also containing one or more heteroatoms . preferred heteroatoms include n , o , and / or s , including n - oxides , sulfur oxides , and dioxides . preferably the ring is three to twelve - membered and is either fully saturated or has one or more degrees of unsaturation . such rings may be optionally fused to one or more of another “ heterocyclic ” ring ( s ) or cycloalkyl ring ( s ). examples of “ heterocyclic ” groups include , but are not limited to , tetrahydrofuran , pyran , 1 , 4 - dioxane , 1 , 3 - dioxane , piperidine , pyrrolidine , morpholine , tetrahydrothiopyran , and tetrahydrothiophene . as used herein , the term “ aryl ” refers to an optionally substituted benzene ring or to an optionally substituted fused benzene ring system , for example anthracene , phenanthrene , or naphthalene ring systems . examples of “ aryl ” groups include , but are not limited to , phenyl , 2 - naphthyl , 1 - naphthyl , and the like . as used herein , the term “ heteroaryl ” refers to an optionally substituted monocyclic five to seven membered aromatic ring , or to an optionally substituted fused bicyclic aromatic ring system comprising two of such aromatic rings . these heteroaryl rings contain one or more nitrogen , sulfur , and / or oxygen atoms , where n - oxides , sulfur oxides , and dioxides are permissible heteroatom substitutions . examples of “ heteroaryl ” groups used herein include , but should not be limited to , furan , thiophene , pyrrole , imidazole , pyrazole , triazole , tetrazole , thiazole , oxazole , isoxazole , oxadiazole , thiadiazole , isothiazole , pyridine , pyridazine , pyrazine , pyrimidine , quinoline , isoquinoline , benzofuran , benzothiophene , indole , indazole , benzimidizolyl , imidazopyridinyl , pyrazolopyridinyl , pyrazolopyrimidinyl , and the like . as used herein the term “ halogen ” refers to fluorine , chlorine , bromine , or iodine . as used herein the term “ haloalkyl ” refers to an alkyl group , as defined herein , that is substituted with at least one halogen . examples of branched or straight chained “ haloalkyl ” groups useful in the present invention include , but are not limited to , methyl , ethyl , propyl , isopropyl , n - butyl , and t - butyl substituted independently with one or more halogens , e . g ., fluoro , chloro , bromo , and iodo . the term “ haloalkyl ” should be interpreted to include such substituents as perfluoroalkyl groups and the like . as used herein the term “ alkoxy ” refers to the group — or a , where r a is alkyl as defined above . as used herein the term “ alkoxycarbonyl ” refers to groups such as : where the r a represents an alkyl group as herein defined . as used herein the term “ aryloxycarbonyl ” refers to groups such as : as used herein the term “ heteroaryloxycarbonyl ” refers to groups such as : as used herein the term “ nitro ” refers to the group — no 2 . as used herein the term “ azido ” refers to the group — n 3 . as used herein the term “ acyl ” refers to the group r b c ( o )—, where r b is alkyl , aryl , heteroaryl , or heterocyclyl , as each is defined herein . as used herein throughout the present specification , the phrase “ optionally substituted ” or variations thereof denote an optional substitution , including multiple degrees of substitution , with one or more substituent group . the phrase should not be interpreted so as to be imprecise or duplicative of substitution patterns herein described or depicted specifically . rather , those of ordinary skill in the art will appreciate that the phrase is included to provide for obvious modifications , which are encompassed within the scope of the appended claims . exemplary optional substituent groups include acyl ; alkyl ; alkenyl ; alkynyl ; alkylsulfonyl ; alkoxy ; alkoxycarbonyl ; cyano ; halogen ; haloalkyl ; hydroxy ; nitro ; aryl , which may be further substituted with acyl , alkoxy , alkyl , alkenyl , alkynyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro ; heteroaryl , which may be further substituted with acyl , alkoxy , alkyl , alkenyl , alkynyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro ; arylsulfonyl , which may be further substituted with acyl , alkoxy , alkyl , alkenyl , alkynyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro ; heteroarylsulfonyl , which may be further substituted with acyl , alkoxy , alkyl , alkenyl , alkynyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro ; aryloxy , which may be further substituted with acyl , alkoxy , alkyl , alkenyl , alkynyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro ; heteroaryloxy , which may be further substituted with acyl , alkoxy , alkyl , alkenyl , alkynyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro ; aryloxycarbonyl , which may be further substituted with acyl , alkoxy , alkyl , alkenyl , alkynyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro ; heteroaryloxycarbonyl , which may be further substituted with acyl , alkoxy , alkyl , alkenyl , alkynyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro ; or n ( r *) 2 ; where for each occurrence r * is independently selected from h , alkyl , alkenyl , alkynyl , cycloalkyl , heterocyclyl , aryl , aralkyl , heteroaryl , heteroaralkyl , alkylsulfonyl , arylsulfonyl , or heteroarylsulfonyl , where each occurrence of such aryl or heteroaryl may be substituted with one or more acyl , alkoxy , alkyl , alkenyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro , or the two r * s may combine to form a ring , optionally having additional heteroatoms , optionally having one or more degrees of unsaturation , and optionally being further substituted with acyl , alkoxy , alkyl , alkenyl , alkynyl , alkylsulfonyl , cyano , halogen , haloalkyl , hydroxy , or nitro . the compounds of formulas ( i ) may crystallize in more than one form , a characteristic known as polymorphism , and such polymorphic forms (“ polymorphs ”) are within the scope of formula ( i ). polymorphism generally can occur as a response to changes in temperature , pressure , or both . polymorphism can also result from variations in the crystallization process . polymorphs can be distinguished by various physical characteristics known in the art such as x - ray diffraction patterns , solubility , and melting point . certain of the compounds described herein contain one or more chiral centers , or may otherwise be capable of existing as multiple stereoisomers . the scope of the present invention includes mixtures of stereoisomers as well as purified enantiomers or enantiomerically / diastereomerically enriched mixtures . also included within the scope of the invention are the individual isomers of the compounds represented by formula ( i ), as well as any wholly or partially equilibrated mixtures thereof . the present invention also includes the individual isomers of the compounds represented by the formulas above as mixtures with isomers thereof in which one or more chiral centers are inverted . typically , but not absolutely , the salts of the present invention are pharmaceutically acceptable salts . salts encompassed within the term “ pharmaceutically acceptable salts ” refer to non - toxic salts of the compounds of this invention . salts of the compounds of the present invention may comprise acid addition salts . representative salts include acetate , benzenesulfonate , benzoate , bicarbonate , bisulfate , bitartrate , borate , calcium edetate , camsylate , carbonate , clavulanate , citrate , dihydrochloride , edisylate , estolate , esylate , fumarate , gluceptate , gluconate , glutamate , glycollylarsanilate , hexylresorcinate , hydrabamine , hydrobromide , hydrochloride , hydroxynaphthoate , iodide , isethionate , lactate , lactobionate , laurate , malate , maleate , mandelate , mesylate , methylsulfate , monopotassium maleate , mucate , napsylate , nitrate , n - methylglucamine , oxalate , pamoate ( embonate ), palmitate , pantothenate , phosphate / diphosphate , polygalacturonate , potassium , salicylate , sodium , stearate , subacetate , succinate , sulfate , tannate , tartrate , teoclate , tosylate , triethiodide , trimethylammonium , and valerate salts . other salts , which are not pharmaceutically acceptable , may be useful in the preparation of compounds of this invention and these should be considered to form a further aspect of the invention . as used herein , the term “ solvate ” refers to a complex of variable stoichiometry formed by a solute ( in this invention , a compound of formula i , or a salt or physiologically functional derivative thereof ) and a solvent . such solvents , for the purpose of the invention , should not interfere with the biological activity of the solute . non - limiting examples of suitable solvents include , but are not limited to water , methanol , ethanol , and acetic acid . preferably the solvent used is a pharmaceutically acceptable solvent . non - limiting examples of suitable pharmaceutically acceptable solvents include water , ethanol , and acetic acid . most preferably the solvent used is water . as used herein , the term “ physiologically functional derivative ” refers to any pharmaceutically acceptable derivative of a compound of the present invention that , upon administration to a mammal , is capable of providing ( directly or indirectly ) a compound of the present invention or an active metabolite thereof . such derivatives , for example , esters and amides , will be clear to those skilled in the art , without undue experimentation . reference may be made to the teaching of burger &# 39 ; s medicinal chemistry and drug discovery , 5 th edition , vol 1 : principles and practice , which is incorporated herein by reference to the extent that it teaches physiologically functional derivatives . as used herein , the term “ effective amount ” means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue , system , animal , or human that is being sought , for instance , by a researcher or clinician . the term “ therapeutically effective amount ” means any amount which , as compared to a corresponding subject who has not received such amount , results in improved treatment , healing , prevention , or amelioration of a disease , disorder , or side effect , or a decrease in the rate of advancement of a disease or disorder . the term also includes within its scope amounts effective to enhance normal physiological function . for use in therapy , therapeutically effective amounts of a compound of formula ( i ), as well as salts , solvates , and physiological functional derivatives thereof , may be administered as the raw chemical . additionally , the active ingredient may be presented as a pharmaceutical composition . accordingly , the invention further provides pharmaceutical compositions that include effective amounts of compounds of the formula ( i ) and salts , solvates , and physiological functional derivatives thereof , and one or more pharmaceutically acceptable carriers , diluents , or excipients . the compounds of formula ( i ) and salts , solvates , and physiologically functional derivatives thereof , are as herein described . the carrier ( s ), diluent ( s ) or excipient ( s ) must be acceptable , in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient of the pharmaceutical composition . in accordance with another aspect of the invention there is also provided a process for the preparation of a pharmaceutical formulation including admixing a compound of the formula ( i ) or salts , solvates , and physiological functional derivatives thereof , with one or more pharmaceutically acceptable carriers , diluents or excipients . a therapeutically effective amount of a compound of the present invention will depend upon a number of factors . for example , the species , age , and weight of the recipient , the precise condition requiring treatment and its severity , the nature of the formulation , and the route of administration are all factors to be considered . the therapeutically effective amount ultimately should be at the discretion of the attendant physician or veterinarian . regardless , an effective amount of a compound of formula ( i ) for the treatment of humans suffering from frailty , generally , should be in the range of 0 . 1 to 100 mg / kg body weight of recipient ( mammal ) per day . more usually the effective amount should be in the range of 1 to 10 mg / kg body weight - per day . thus , for a 70 kg adult mammal the actual amount per day would usually be from 70 to 700 mg . this amount may be given in a single dose per day or in a number ( such as two , three , four , five , or more ) of sub - doses per day such that the total daily dose is the same . an effective amount of a salt , solvate , or physiologically functional derivative thereof , may be determined as a proportion of the effective amount of the compound of formula ( i ) per se . similar dosages should be appropriate for treatment of the other conditions referred to herein . pharmaceutical formulations may be presented in unit dose forms containing a predetermined amount of active ingredient per unit dose . such a unit may contain , as a non - limiting example , 0 . 5 mg to 1 g of a compound of the formula ( i ), depending on the condition being treated , the route of administration , and the age , weight , and condition of the patient . preferred unit dosage formulations are those containing a daily dose or sub - dose , as herein above recited , or an appropriate fraction thereof , of an active ingredient . such pharmaceutical formulations may be prepared by any of the methods well known in the pharmacy art . pharmaceutical formulations may be adapted for administration by any appropriate route , for example by an oral ( including buccal or sublingual ), rectal , nasal , topical ( including buccal , sublingual or transdermal ), vaginal , or parenteral ( including subcutaneous , intramuscular , intravenous or intradermal ) route . such formulations may be prepared by any method known in the art of pharmacy , for example by bringing into association the active ingredient with the carrier ( s ) or excipient ( s ). by way of example , and not meant to limit the invention , with regard to certain conditions and disorders for which the compounds of the present invention are believed useful certain routes will be preferable to others . pharmaceutical formulations adapted for oral administration may be presented as discrete units such as capsules or tablets ; powders or granules ; solutions or suspensions , each with aqueous or non - aqueous liquids ; edible foams or whips ; or oil - in - water liquid emulsions or water - in - oil liquid emulsions . for instance , for oral administration in the form of a tablet or capsule , the active drug component can be combined with an oral , non - toxic pharmaceutically acceptable inert carrier such as ethanol , glycerol , water , and the like . generally , powders are prepared by comminuting the compound to a suitable fine size and mixing with an appropriate pharmaceutical carrier such as an edible carbohydrate , as , for example , starch or mannitol . flavorings , preservatives , dispersing agents , and coloring agents can also be present . capsules are made by preparing a powder , liquid , or suspension mixture and encapsulating with gelatin or some other appropriate shell material . glidants and lubricants such as colloidal silica , talc , magnesium stearate , calcium stearate , or solid polyethylene glycol can be added to the mixture before the encapsulation . a disintegrating or solubilizing agent such as agar - agar , calcium carbonate or sodium carbonate can also be added to improve the availability of the medicament when the capsule is ingested . moreover , when desired or necessary , suitable binders , lubricants , disintegrating agents , and coloring agents can also be incorporated into the mixture . examples of suitable binders include starch , gelatin , natural sugars such as glucose or beta - lactose , corn sweeteners , natural and synthetic gums such as acacia , tragacanth , or sodium alginate , carboxymethylcellulose , polyethylene glycol , waxes , and the like . lubricants useful in these dosage forms include , for example , sodium oleate , sodium stearate , magnesium stearate , sodium benzoate , sodium acetate , sodium chloride , and the like . disintegrators include , without limitation , starch , methyl cellulose , agar , bentonite , xanthan gum , and the like . tablets are formulated , for example , by preparing a powder mixture , granulating or slugging , adding a lubricant and disintegrant , and pressing into tablets . a powder mixture may be prepared by mixing the compound , suitably comminuted , with a diluent or base as described above . optional ingredients include binders such as carboxymethylcellulose , aliginates , gelatins , or polyvinyl pyrrolidone , solution retardants such as paraffin , resorption accelerators such as a quaternary salt , and / or absorption agents such as bentonite , kaolin , or dicalcium phosphate . the powder mixture can be wet - granulated with a binder such as syrup , starch paste , acadia mucilage or solutions of cellulosic or polymeric materials , and forcing through a screen . as an alternative to granulating , the powder mixture can be run through the tablet machine and the result is imperfectly formed slugs broken into granules . the granules can be lubricated to prevent sticking to the tablet - forming dies by means of the addition of stearic acid , a stearate salt , talc or mineral oil . the lubricated mixture is then compressed into tablets . the compounds of the present invention can also be combined with a free flowing inert carrier and compressed into tablets directly without going through the granulating or slugging steps . a clear or opaque protective coating consisting of a sealing coat of shellac , a coating of sugar or polymeric material , and a polish coating of wax can be provided . dyestuffs can be added to these coatings to distinguish different unit dosages . oral fluids such as solutions , syrups , and elixirs can be prepared in dosage unit form so that a given quantity contains a predetermined amount of the compound . syrups can be prepared , for example , by dissolving the compound in a suitably flavored aqueous solution , while elixirs are prepared through the use of a non - toxic alcoholic vehicle . suspensions can be formulated generally by dispersing the compound in a non - toxic vehicle . solubilizers and emulsifiers such as ethoxylated isostearyl alcohols and polyoxy ethylene sorbitol ethers , preservatives ; flavor additives such as peppermint oil , or natural sweeteners , saccharin , or other artificial sweeteners ; and the like can also be added . where appropriate , dosage unit formulations for oral administration can be microencapsulated . the formulation can also be prepared to prolong or sustain the release as for example by coating or embedding particulate material in polymers , wax or the like . the compounds of formula ( i ) and salts , solvates , and physiological functional derivatives thereof , can also be administered in the form of liposome delivery systems , such as small unilamellar vesicles , large unilamellar vesicles , and multilamellar vesicles . liposomes can be formed from a variety of phospholipids , such as cholesterol , stearylamine , or phosphatidylcholines . the compounds of formula ( i ) and salts , solvates , and physiologically functional derivatives thereof may also be delivered by the use of monoclonal antibodies as individual carriers to which the compound molecules are coupled . the compounds may also be coupled with soluble polymers as targetable drug carriers . such polymers can include polyvinylpyrrolidone ( pvp ), pyran copolymer , polyhydroxypropylmethacrylamide - phenol , polyhydroxyethyl - aspartamidephenol , or polyethyleneoxidepolylysine substituted with palmitoyl residues . furthermore , the compounds may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug ; for example , polylactic acid , polyepsilon caprolactone , polyhydroxy butyric acid , polyorthoesters , polyacetals , polydihydropyrans , polycyanoacrylates , and cross - linked or amphipathic block copolymers of hydrogels . pharmaceutical formulations adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time . for example , the active ingredient may be delivered from the patch by iontophoresis as generally described in pharmaceutical research , 3 ( 6 ), 318 ( 1986 ), incorporated herein by reference as related to such delivery systems . pharmaceutical formulations adapted for topical administration may be formulated as ointments , creams , suspensions , lotions , powders , solutions , pastes , gels , sprays , aerosols , or oils . for treatments of the eye or other external tissues , for example mouth and skin , the formulations may be applied as a topical ointment or cream . when formulated in an ointment , the active ingredient may be employed with either a paraffinic or a water - miscible ointment base . alternatively , the active ingredient may be formulated in a cream with an oil - in - water cream base or a water - in - oil base . pharmaceutical formulations adapted for topical administrations to the eye include eye drops wherein the active ingredient is dissolved or suspended in a suitable carrier , especially an aqueous solvent . pharmaceutical formulations adapted for topical administration in the mouth include lozenges , pastilles , and mouthwashes . pharmaceutical formulations adapted for nasal administration , where the carrier is a solid , include a coarse powder having a particle size for example in the range 20 to 500 microns . the powder is administered in the manner in which snuff is taken , i . e ., by rapid inhalation through the nasal passage from a container of the powder held close up to the nose . suitable formulations wherein the carrier is a liquid , for administration as a nasal spray or as nasal drops , include aqueous or oil solutions of the active ingredient . pharmaceutical formulations adapted for administration by inhalation include fine particle dusts or mists , which may be generated by means of various types of metered dose pressurized aerosols , nebulizers , or insufflators . pharmaceutical formulations adapted for rectal administration may be presented as suppositories or as enemas . pharmaceutical formulations adapted for vaginal administration may be presented as pessaries , tampons , creams , gels , pastes , foams , or spray formulations . pharmaceutical formulations adapted for parenteral administration include aqueous and non - aqueous sterile injection solutions which may contain anti - oxidants , buffers , bacteriostats , and solutes that render the formulation isotonic with the blood of the intended recipient ; and aqueous and non - aqueous sterile suspensions which may include suspending agents and thickening agents . the formulations may be presented in unit - dose or multi - dose containers , for example sealed ampules and vials , and may be stored in a freeze - dried ( lyophilized ) condition requiring only the addition of the sterile liquid carrier , for example water for injections , immediately prior to use . extemporaneous injection solutions and suspensions may be prepared from sterile powders , granules , and tablets . in addition to the ingredients particularly mentioned above , the formulations may include other agents conventional in the art having regard to the type of formulation in question . for example , formulations suitable for oral administration may include flavoring or coloring agents . the compounds of the present invention and their salts , solvates , and physiologically functional derivatives thereof , may be employed alone or in combination with other therapeutic agents . the compound ( s ) of formula ( i ) and the other pharmaceutically active agent ( s ) may be administered together or separately and , when administered separately , administration may occur simultaneously or sequentially , in any order . the amounts of the compound ( s ) of formula ( i ) and the other pharmaceutically active agent ( s ) and the relative timings of administration will be selected in order to achieve the desired combined therapeutic effect . the administration in combination of a compound of formula ( i ) salts , solvates , or physiologically functional derivatives thereof with other treatment agents may be in combination by administration concomitantly in : ( 1 ) a unitary pharmaceutical composition including both compounds ; or ( 2 ) separate pharmaceutical compositions each including one of the compounds . alternatively , the combination may be administered separately in a sequential manner wherein one treatment agent is administered first and the other second or vice versa . such sequential administration may be close in time or remote in time . the compounds of the present invention may be used in the treatment of a variety of disorders and conditions and , as such , the compounds of the present invention may be used in combination with a variety of other suitable therapeutic agents useful in the treatment or prophylaxis of those disorders or conditions . treatment will depend upon the nature and type of viral infection . the present invention may be combined with other medical therapies including a variety of cytotoxic or antiviral agents . for example , and not meant to limit the invention , the compounds of the present invention may be combined with other therapeutic agents for example immune therapies ( such as interferon ), therapeutic vaccines , antifibrotic agents , anti - inflammatory agents ( such as corticosteroids or nsaids ), bronchodilators such as beta - 2 adrenergic agonists and xanthines ( such as theophylline ), mucolytic agents , anti - muscarinics , anti - leukotrienes , inhibitors of cell adhesion ( such as icam antagonists ), anti - oxidants ( such as n - acetylcysteine ), cytokine agonists , cytokine antagonists , lung surfactants and / or antimicrobial and anti - viral agents ( such as ribavirin and amantidine ). the compositions according to the invention may also be used in combination with gene replacement therapy . the compounds of this invention may be made by a variety of methods , including well - known standard synthetic methods . illustrative general synthetic methods are set out below and then specific compounds of the invention are prepared in the working examples . in all of the examples described below , protecting groups for sensitive or reactive groups are employed where necessary in accordance with general principles of synthetic chemistry . protecting groups are manipulated according to standard methods of organic synthesis ( t . w . green and p . g . m . wuts ( 1991 ) protecting groups in organic synthesis , john wiley & amp ; sons , incorporated by reference with regard to protecting groups ). these groups are removed at a convenient stage of the compound synthesis using methods that are readily apparent to those skilled in the art . the selection of processes as well as the reaction conditions and order of their execution shall be consistent with the preparation of compounds of formula ( i ). those skilled in the art will recognize if a stereocenter exists in compounds of formula ( i ). accordingly , the present invention includes all possible stereoisomers and includes not only racemic compounds but the individual enantiomers as well . when a compound is desired as a single enantiomer , such may be obtained by stereospecific synthesis , by resolution of the final product or any convenient intermediate , or by chiral chromatographic methods as are known in the art . resolution of the final product , an intermediate , or a starting material may be effected by any suitable method known in the art . see , for example , stereochemistry of organic compounds by e . l . eliel , s . h . wilen , and l . n . mander ( wiley - interscience , 1994 ), incorporated by reference with regard to stereochemistry . as used herein the symbols and conventions used in these processes , schemes and examples are consistent with those used in the contemporary scientific literature , for example , the journal of the american chemical society or the journal of biological chemistry . specifically , the following abbreviations may be used in the examples and throughout the specification : unless otherwise indicated , all temperatures are expressed in ° c . ( degrees centigrade ). all reactions conducted at room temperature unless otherwise noted . 1 h - nmr spectra were recorded on a varian vxr - 300 , a varian unity - 300 , a varian unity - 400 instrument , or a general electric qe - 300 . chemical shifts are expressed in parts per million ( ppm , δ units ). coupling constants are in units of hertz ( hz ). splitting patterns describe apparent multiplicities and are designated as s ( singlet ), d ( doublet ), t ( triplet ), q ( quartet ), m ( multiplet ), or br ( broad ). mass spectra were obtained on micromass platform or zmd mass spectrometers from micromass ltd ., altricham , uk , using either atmospheric chemical ionization ( apci ) or electrospray ionization ( esi ). analytical thin layer chromatography was used to verify the purity of intermediate ( s ) which could not be isolated or which were too unstable for full characterization as well as to follow the progress of reaction ( s ). the absolute configuration of compounds were assigned by ab initio vibrational circular dichroism ( vcd ) spectroscopy . the experimental vcd spectrum were acquired in cdcl 3 using a bomem chirall ® vcd spectrometer operating between 2000 and 800 cm − 1 . the gaussian 98 suite of computational programs was used to calculate model vcd spectrums . the stereochemical assignments were made by comparing this experimental spectrum to the vcd spectrum calculated for a model structure with ( r )- or ( s )- configuration . incorporated by reference with regard to such spectroscopy are : j . r . chesseman , m . j . frisch , f . j . devlin and p . j . stephens , chem . phys . lett . 252 ( 1996 ) 211 ; p . j . stephens and f . j . devlin , chirality 12 ( 2000 ) 172 ; and gaussian 98 , revision a . 11 . 4 , m . j . frisch et al ., gaussian , inc ., pittsburgh pa ., 2002 . compounds of formula ( i ), wherein common terms are as defined above and lv is a leaving group such as halogen ( f , cl , br , i ), soay , so 2 ay , sor a , so 2 r a , where r a is an alkyl group , may be conveniently prepared by the process outlined in scheme 1 below : generally , the process for preparing the compounds of formula ( i ), where lv is a leaving group as defined above and x is nh ( all formulas and all other variables having been defined above ) comprises the steps of : c ) indolizing the compound of formula ( v ) to prepare a compound of formula ( vi ); d ) reductive amination of compound of formula ( vi ) to form compound of formula ( vii ); and e ) forming compounds of formula ( i ) from compound ( vii ) by nucleophilic displacement or by using palladium catlyzed coupling conditions . alternatively f ) forming compounds of formula ( i ) via reductive amination of compound ( vi ). more specifically , a compound of formula ( i ), wherein all variables are as defined above , can be prepared reacting the compound of formula ( vi ) with an amine of formula ( viii ) in the presence of a reducing agent : the reaction may be carried out as a two step process where the imine is formed under conditions that allow for removal of water followed by reduction . alternatively this reaction can be carried out in one pot by adding amine ( viii ) and the reductive agent sequentially or at the same time . for the two step process , typically a compound of formula ( vi ) is dissolved in an inert solvent such as toluene , an equivalent , or an excess of an amine of formula ( viii ) is added , followed by the optional addition of an acid catalyst such as para - toluensulfonic acid . the reaction is heated to reflux for azeotropic removal af water . optionally molecular sieves or dehydrating agents , such as trimethylorthoformate , can be used for removal of water . the imine can be isolated or used directly for the next step . the imine is dissolved in a suitable solvent and reduced by addition of a reductive agent . suitable solvents include lower alcohols such as methanol , ethanol , and the like , tetrahydrofuran , or similar solvents well known to those skilled in the art . suitable reductive agents include but are not limited to sodium cyanoborohydride , sodium triacetoxyborohydride , borane - tetrahydrofuran complex , sodium borohydride , and the like . for a one pot process , a compound of formula ( vi ) is dissolved in an inert solvent . an amine of formula ( viii ) is added to this solution , followed by the addition of a suitable reductive agent . the reaction may optionally be heated to about 50 - 150 ° c . suitable solvents include but are not limited to , dichloromethane , dichloroethane , and the like . suitable reductive agents include but are not limited to sodium cyanoborohydride , sodium triacetoxyborohydride , sodium borohydride , and the like . alternatively a compound of formula ( i ) can be formed from an amine of formula ( vii ). treatment of compound of formula ( vi ) in an inert solvent with ammonium salt and a reductive agent , optionally with heating , gives an amine of formula ( vii ). suitable solvents include but are not limited to , methanol , ethanol , dichloromethane , dichloroethane , and the like . suitable reductive agents include but are not limited to sodium cyanoborohydride , sodium triacetoxyborohydride , sodium borohydride , and the like . suitable ammonium salts include but are not limited to ammonium acetate , ammonium formate , and the like . an amine of formula ( vii ) can also be formed by treatment of compound of formula ( vi ) with hydroxylamine , followed by reduction with suitable reductive agents which include but are not limited to lithium aluminium hydride and the like . condensation of compound of formula ( vii ) with compound of formula ( ix ) gives compound of formula ( i ). this condensation can be carried out neat or in the presence of solvent , optionally with heating or in a microwave . suitable solvents include but are not limited to n , n - dimethylformamide , 1 - methyl - 2 - pyrrolidinone , dimethylsulfoxide , acetonitrile , nitromethane and the like . optionally a base can be added to the condensation reaction , examples of suitable bases include sodium carbonate , sodium bicarbonate , triethylamine , and the like . in addition , as depicted above , an amine of formula ( vii ) may be coupled with a compound of formula ( ix ) to give a compound of formula ( i ), using appropriate pd - catalized coupling as is appreciated in the art . compounds of formula ( vi ) are prepared in a similar fashion as described in the literature ( j . med . chem . 1973 , 16 , 425 and j . org . chem . 1968 , 32 , 1265 ). as will be appreciated by those skilled in the art , a compound of formula ( i ) can be converted to another compound of formula ( i ). generally the process for preparing compound of formula ( i ) where x is o consists of : 1 . reduction of compound of formula ( vi ) to give compound of formula vii - b 2 . reaction of compound of formula vii - b with compound of formula viii - b to give compound of formula i ( where all variable substituents are as herein defined ). more specifically compound of formula ( vii - b ) wherein all variables are defined as above can be prepared by reduction of compound of formula ( vi ). a suitable reducing agent include but are not limited to sodium borohydride , borane - tetrahydrofuran complex , and the like . suitable solvents include methanol , ethanol , tetrahydrofuran , and the like . compound of formula ( i ) can be formed by reaction of compound of formula ( vii - b ) with a compound of formula ( viii - b ) in presence of diethyl azodicarboxylate or diisopropyl azodicarboxylate and triphenylphosphine . suitable solvents include tetrahydrofuran and the like . a ) cyclohexane - 1 , 2 - dione ( 4 - chlorophenyl ) hydrazone . to a cold ( 0 ° c .) solution of 4 - chloroaniline ( 5 . 6 g , 44 mmol ) in concentrated hydrochloric acid ( 5 ml ) was added sodium nitrite ( 3 . 0 g , 44 mmol ) dissolved in water ( 10 ml ) portionwise over 20 minutes . the mixture was stirred at 0 ° c . for 30 minutes . in a separate flask , a cool solution of 2 -( hydroxymethylene ) cyclohexanone ( organic syntheses , collective vol 4 , 1963 , pg . 536 ) ( 5 . 0 g , 40 mmol ) in methanol ( 30 ml ) was treated with a solution of sodium acetate ( 8 . 3 g , 101 mmol ) in water ( 25 ml ). the mixture was stirred at 0 ° c . for 20 minutes and the diazonium salt slurry was added . the combined mixture was stirred for 10 - 15 minutes , collected by filtration , triturated with ethanol , and collected by filtration to give cyclohexane - 1 , 2 - dione ( 4 - chlorophenyl ) hydrazone ( 4 . 6 g , 49 % yield ) as a yellow solid . 1 h - nmr ( dmso - d 6 ): δ 9 . 93 ( s , 1h ), 7 . 29 ( m , 4h ), 2 . 55 ( m , 2h ), 2 . 40 ( m , 2h ), 1 . 84 - 1 . 75 ( m , 4h ). b ) 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one . a solution of cyclohexane - 1 , 2 - dione ( 4 - chlorophenyl ) hydrazone ( 2 . 3 g , 9 . 7 mmol ) in hydrochloric acid ( 2 ml ) and acetic acid ( 8 ml ) was heated at 120 ° c . for 20 minutes . the mixture was cooled slightly and treated with ice water . the resulting precipitate was collected by filtration to give 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 1 . 9 g , 88 % yield ) as brown solid . 1 h - nmr ( dmso - d 6 ): δ 11 . 78 ( s , 1h ), 7 . 75 ( m ; 1h ), 7 . 38 ( d , 1h ), 7 . 28 ( dd , 1h ), 2 . 92 ( t , 2h ), 2 . 55 ( t , 2h ), 2 . 13 ( q , 2h ); ms m / z 220 ( m + 1 ). to a solution of to 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 500 mg , 2 . 3 mmol ) and ammonium acetate ( 1 . 8 g , 23 mmol ) in methanol ( 9 ml ) was added sodium cyanoborohydride ( 720 mg , 11 . 5 mmol ). after heating at 60 ° c . for 15 hours , the mixture was cooled and treated with concentrated hydrochloric acid until ph 1 . the organics were removed under reduced pressure and the resulting precipitate was collected by filtration , dissolved in ethyl acetate and methanol , and washed with saturated aqueous sodium carbonate . the phases were separated and the organic phase was concentrated to yield 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 260 mg , 52 % yield ) as a light brown solid . 1 h - nmr ( dmso - d 6 ): δ10 . 90 ( s , 1h ), 7 . 34 ( m , 1h ), 7 . 27 ( d , 1h ), 6 . 97 ( dd , 1h ), 3 . 90 ( t , 1h ), 2 . 54 ( m , 2h ), 2 . 04 - 1 . 89 ( m , 2h ), 1 . 66 ( m , 1h ), 1 . 50 ( m , 1h ); ms m / z 221 ( m + 1 ). 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one was prepared from bromoaniline and 2 -( hydroxymethylene ) cyclohexanone in a similar manner as described in example 1 to give a brown solid . 1 h - nmr ( cdcl 3 ): δ 8 . 79 ( s , 1h ), 7 . 80 ( s , 1h ), 7 . 44 ( d , 1h ), 7 . 30 , ( d , 2h ), 2 . 97 ( t , 2h ), 2 . 66 ( t , 2h ), 2 . 27 ( quint , 2h ); ms m / z 265 ( m + 1 ). 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared in a similar manner as described in example 2 to give a solid . 1 h - nmr ( cdcl 3 ): δ 8 . 58 ( s , 1h ), 7 . 55 ( s , 1h ), 7 . 20 ( m , 2h ), 4 . 12 ( t , 1h ), 2 . 70 ( t , 2h ), 2 . 24 ( m , 1h ), 2 . 05 ( m , 1h ), 1 . 92 ( m , 3h ), 1 . 66 ( m , 1h ); ms m / z 266 ( m + 1 ). 6 - methyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one was prepared from p - toluidine and 2 -( hydroxymethylene ) cyclohexanone in a similar manner as described in example 1 to give a tan solid . 1 h - nmr ( cdcl 3 ): δ 8 . 65 ( s , 1h ), 7 . 43 ( s , 1h ), 7 . 30 ( d , 1h ), 7 . 20 ( d , 1h ), 2 . 98 ( t , 2h ), 2 . 65 ( t , 2h ), 2 . 45 ( s , 3h ), 2 . 26 ( quint , 2h ); ms m / z 220 ( m + 1 ). 6 - methyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared in a similar manner as described in example 2 to give a solid . 1 h - nmr ( dmso - d 6 ): δ 10 . 5 ( s , 1h ), 7 . 15 ( d , 1h ), 7 . 11 ( s , 1h ), 6 . 81 ( d , 1h ), 3 . 98 ( t , 1h ), 3 . 30 ( s , 2h ), 2 . 53 ( t , 2h ), 2 . 32 ( s , 3h ), 2 . 02 ( m , 1h ), 1 . 90 ( m , 1h ), 1 . 68 ( m , 1h ), 1 . 65 ( m , 1h ); ms m / z 201 ( m + 1 ). 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one was prepared from aniline ( 2 . 9 g , 31 mmol ) and 2 -( hydroxymethylene ) cyclohexanone ( 3 . 5 g , 28 mmol ) in a similar manner as described in example 1 to give 2 . 5 g ( 49 %) of a brown solid . 1 h - nmr ( dmso - d 6 ): δ 11 . 6 ( s , 1h ), 7 . 66 ( d , 1h ), 7 . 38 ( d , 1h ), 7 . 30 ( t , 1h ), 7 . 07 ( t , 1h ), 2 . 90 ( t , 2h ), 2 . 56 ( t , 2h ), 2 . 15 ( quint , 2h ); ms m / z 186 ( m + 1 ). to a solution of 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 1 . 5 g , 8 . 10 mmol ) in ethanol ( 20 ml ) was added a solution of hydroxylamine hydrochloride ( 1 . 13 g , 16 . 2 mmol ) in water ( 10 ml ) and a solution of sodium acetate ( 2 . 19 g , 26 . 7 mmol ) in water ( 10 ml ). the reaction mixture was heated at reflux for 2 h , cooled and concentrated . the residue was diluted with water and extracted with ethyl acetate ( 2 × 100 ml ). the organic phase was dried over sodium sulfate , filtered and concentrated to a brown solid . the oxime was dissolved in thf ( 80 ml ) and lah ( 1 . 0 m in thf , 24 . 3 ml ) was added dropwise . the reaction was heated at reflux for 7 h and cooled in an ice bath . methanol was added dropwise until bubbling ceased . the mixture was diluted with aqueous na / k tartrate , stirred vigorously for 15 min and extracted with ethyl acetate ( 2 × 100 ml ). the extracts were combined , dried over sodium sulfate , filtered and concentrated . the crude amine was purified by flash chromatography on silica ( 2 % to 5 % methanol / methylene chloride gradient ) to provide 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine as a brown oil . the oil was diluted in diethyl ether and hcl ( 1 . 0 m in diethyl ether ) was added . the resulting precipitate was collected by filtration to provide 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine hydrochloride ( 760 mg , 42 %) as a light brown solid . 1 h - nmr ( cd 3 od ): δ 7 . 54 ( d , 1h ), 7 . 42 ( d , 1h ), 7 . 22 ( t , 1h ), 7 . 09 ( t , 1h ), 4 . 66 ( t , 1h ), 2 . 95 - 2 . 73 ( m , 2h ), 2 . 39 - 2 . 28 ( m , 1h ), 2 . 18 - 2 . 03 ( m , 3h ); ms m / z ( m + 1 ) 170 . 6 - methoxy - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one was prepared from p - anisidine and 2 -( hydroxymethylene ) cyclohexanone in a similar manner as described in example 1 to give a tan solid . 1 h - nmr ( cdcl 3 ): δ 8 . 77 ( br s , 1h ), 7 . 32 ( d , 1h ), 7 . 06 ( d , 1h ), 7 . 03 ( s , 1h ), 3 . 88 ( s , 3h ), 2 . 98 ( t , 2h ), 2 . 66 ( t , 2h ), 2 . 28 ( quint , 2h ); ms m / z 216 ( m + 1 ). 6 - methoxy - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared in a similar manner as described above to give a solid . 1 h - nmr ( cdcl 3 ): δ 8 . 38 ( s , 1h ), 7 . 20 ( d , 1h ), 6 . 92 ( s , 1h ), 6 . 80 ( d , 1h ), 4 . 06 ( t , 1h ), 3 . 85 ( s , 3h ), 2 . 67 ( t , 2h ), 2 . 18 ( m , 1h ), 2 . 00 ( m , 1h ), 1 . 83 ( m , 1h ), 1 . 60 ( m , 1h ); ms m / z 217 ( m + 1 ). 6 -( trifluoromethyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one was prepared from 4 -( trifluoromethyl ) aniline ( 5 . 5 g , 34 mmol ) and 2 -( hydroxymethylene ) cyclohexanone ( 3 . 9 g , 31 mmol ) in a similar manner as described above to give 2 . 25 g ( 29 %) of a dark brown solid . 1 h - nmr ( dmso - d 6 ): δ 12 . 05 ( s , 1h ), 8 . 11 ( s , 1h ), 7 . 56 ( s , 2h ), 3 . 00 ( t , 2h ), 2 . 58 ( t , 2h ), 2 . 19 - 2 . 13 ( m , 2h ). 2 - bromo - 7 , 8 , 9 , 10 - hexahydrocyclohepta [ b ] indol - 6 ( 5h )- one was prepared from 4 - bromoaniline ( 7 . 8 g , 46 mmol ) and 2 -( hydroxymethylene ) cycloheptanone ( 5 . 8 g , 41 mmol ) in a similar manner as described in example 1 to give 3 . 5 g ( 31 %) of a dark brown solid . 1 h - nmr ( dmso - d 6 ): δ 8 . 95 ( s , 1h ), 7 . 79 ( s , 1h ), 7 . 41 ( d , 1h ), 7 . 25 ( d , 1h ), 3 . 09 ( t , 2h ), 2 . 85 ( t , 2h ), 2 . 12 - 2 . 06 ( m , 2h ), 2 . 02 - 1 . 96 ( m , 2h ); ms m / z ( m + 1 ) 278 , 280 . 2 - bromo - 5 , 6 , 7 , 8 , 9 , 10 - hexahydrocyclohepta [ b ] indol - 6 - amine hydrochloride was prepared from 2 - bromo - 7 , 8 , 9 , 10 - hexahydrocyclohepta [ b ] indol - 6 ( 5h )- one ( 1 . 5 g , 5 . 4 mmol ) in a similar manner as described above to give 0 . 98 g ( 57 %) of a light brown solid . 1 h - nmr ( cd 3 od ): δ 7 . 65 ( s , 1h ), 7 . 28 - 7 . 21 ( m , 2h ), 4 . 67 ( t , 1h ), 3 . 07 - 3 . 02 ( m , 1h ), 2 . 84 - 2 . 76 ( m , 1h ), 2 . 31 - 2 . 25 ( m , 1h ), 2 . 14 - 1 . 93 ( m , 4h ), 1 . 65 - 1 . 55 ( m , 1h ). a solution of 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 500 mg , 1 . 9 mmol ), aniline ( 350 mg , 3 . 8 mmol ) and p - toluenesulfonic acid ( catalytic ) in toluene ( 15 ml ) was heated at reflux for 16 h with a dean - stark trap in place . the reaction was cooled , concentrated , and the imine was purified by flash column chromatography on silica ( gradient of 5 % to 50 % ethyl acetate / hexanes ). the imine was dissolved in methanol ( 10 ml ) and sodium borohydride ( 140 mg , 3 . 8 mmol ) was added portionwise . the reaction was stirred for 30 min and quenched with water , concentrated , and diluted with ethyl acetate . the organic phase was separated , absorbed onto diatomaceous earth and purified by flash column chromatography on silica ( gradient of 2 % to 20 % ethyl acetate / hexanes ) to provide 6 - bromo - n - phenyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine as a brown oil . 1 h - nmr -( dmso - d 6 ): δ 8 . 04 ( s , 1h ), 7 . 61 ( s , 1h ), 7 . 25 - 7 . 21 ( m , 4h ), 6 . 80 - 6 . 72 ( m , 3h ), 4 . 84 - 4 . 78 ( m , 1h ), 3 . 86 - 3 . 82 ( m , 1h ), 2 . 27 - 2 . 21 ( m , 2h ), 2 . 08 - 2 . 00 ( m , 1h ), 1 . 89 - 1 . 78 ( m , 3h ). the oil was dissolved in diethyl ether and hcl ( 1 . 0 m in diethyl ether ) was added . the resulting precipitate was collected by filtration to provide 6 - bromo - n - phenyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine hydrochloride ( 352 mg , 51 %) as a yellow solid . 1 h - nmr ( dmso - d 6 ): δ 11 . 12 ( s , 1h ), 7 . 58 ( s , 1h ), 7 . 26 ( d , 1h ), 7 . 15 - 7 . 13 ( m , 3h ), 6 . 88 - 6 . 78 ( m , 2h ), 6 . 72 - 6 . 64 ( m , 1h ), 4 . 82 - 4 . 79 ( m , 1h ), 2 . 69 - 2 . 45 ( m , 2h ), 1 . 96 - 1 . 90 ( m , 2h ), 1 . 83 - 1 . 73 ( m , 2h ); ms m / z ( m − 1 ) 339 , 341 . 6 - chloro - n - phenyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one and aniline in a similar manner as described in example 13 to give . 200 mg ( 74 % yield ) of a yellow solid . 1 h - nmr ( cdcl 3 ): δ 8 . 04 ( s , 1h ), 7 . 46 ( d , 1h ), 7 . 27 - 7 . 20 ( m , 2h ), 7 . 17 ( dd , 1h ), 7 . 10 ( dd , 1h ), 6 . 79 ( m , 1h ), 6 . 74 ( m , 2h ), 4 . 81 ( m , 1h ), 3 . 85 ( s , 1h ), 2 . 70 ( m , 2h ), 2 . 25 ( m , 1h ), 2 . 03 ( m , 1h ), 1 . 93 - 1 . 78 ( m , 2h ); ms m / z 295 ( m − 1 ). 6 - chloro - n -( 4 - methoxyphenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one and 4 - methoxyaniline in a similar manner as described in example 13 to give 32 mg ( 21 % yield ) of a brown solid . 1 h - nmr ( cdcl 3 ): δ 8 . 13 ( s , 1h ), 7 . 50 ( d , 1h ), 7 . 23 ( dd , 1h ), 7 . 14 ( dd , 1h ), 6 . 92 - 6 . 84 ( m , 2h ), 6 . 79 - 6 . 73 ( m , 2h ), 4 . 76 ( m , 1h ), 3 . 83 ( s , 3h ), 2 . 74 ( m , 2h ), 2 . 28 ( m , 1h ), 2 . 08 ( m , 1h ), 1 . 98 - 1 . 75 ( m , 2h ); ms m / z 325 ( m − 1 ). 6 - chloro - n -( 4 - chlorophenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one and 4 - chloroaniline in a similar manner as described in example 13 to give 25 mg ( 16 % yield ) of a tan solid . 1 h - nmr ( cdcl 3 ): δ 8 . 01 ( m , 1h ), 7 . 46 ( d , 1h ), 7 . 21 - 7 . 14 ( m , 3h ), 7 . 11 ( dd , 1h ), 6 . 65 ( d , 2h ), 4 . 76 ( m , 1h ), 2 . 70 ( m , 2h ), 2 . 22 ( m , 1h ), 2 . 01 ( m , 1h ), 1 . 94 - 1 . 75 ( m , 2h ); ms m / z 329 ( m − 1 ). 6 - chloro - n -( 4 - fluorophenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one and 4 - fluoroaniline in a similar manner as described in example 13 to give 63 mg ( 43 % yield ) of a yellow solid . 1 h - nmr ( cdcl 3 ): δ 8 . 03 ( s , 1h ), 7 . 46 ( m , 1h ), 7 . 23 - 7 . 05 ( m , 2h ), 6 . 95 ( m , 2h ), 6 . 66 ( m , 2h ), 4 . 72 ( s , 1h ), 3 . 70 ( s , 1h ), 2 . 70 ( m , 2h ), 2 . 21 ( m , 1h ), 2 . 01 ( m , 1h ), 1 . 93 - 1 . 71 ( m , 2h ); ms m / z 313 ( m − 1 ). 6 - chloro - n -( 4 - methylphenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one and p - toluidine in a similar manner as described in example 13 to give 59 mg ( 41 % yield ) of a yellow solid . 1 h - nmr ( cdcl 3 ): δ 8 . 10 ( s , 1h ), 7 . 51 ( m , 1h ), 7 . 22 ( d , 1h ), 7 . 17 - 7 . 06 ( m , 3h ), 6 . 72 ( d , 2h ), 4 . 82 ( m , 1h ), 3 . 74 ( s , 1h ), 2 . 74 ( m , 2h ), 2 . 33 ( s , 3h ), 2 . 27 ( m , 1h ), 2 . 07 ( m , 1h ), 1 . 98 - 1 . 76 ( m , 2h ); ms m / z 309 ( m − 1 ). 6 - bromo - n -( 4 - methoxyphenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 100 mg , 0 . 38 mmol ) and p - anisidine ( 94 mg , 0 . 76 mmol ) in a similar manner as described in example 13 to give 41 mg ( 29 %) of a light brown solid . 1 h - nmr ( dmso - d 6 ): δ 11 . 05 ( s , 1h ), 7 . 54 ( s , 1h ), 7 . 22 ( d , 1h ), 7 . 11 ( d , 1h ), 6 . 73 - 6 . 66 ( m , 4h ), 5 . 48 ( d , 1h ), 4 . 70 - 4 . 65 ( m , 1h ), 3 . 63 ( s , 3h ), 2 . 66 - 2 . 53 ( m , 2h ), 1 . 98 - 1 . 89 ( m , 2h ), 1 . 79 - 1 . 71 ( m , 2h ); ms m / z ( m − 1 ) 369 , 371 . 6 - bromo - n -( 4 - chlorophenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 100 mg , 0 . 38 mmol ) and 4 - chloroaniline ( 97 mg , 0 . 76 mmol ) in a similar manner as described in example 13 to give 29 mg ( 20 %) of an off - white solid . 1 h - nmr ( dmso - d 6 ): δ 11 . 07 ( s , 1h ), 7 . 56 ( s , 1h ), 7 . 23 ( d , 1h ), 7 . 13 - 7 . 08 ( m , 3h ), 6 . 71 ( d , 2h ), 6 . 20 ( d , 1h ), 4 . 76 - 4 . 72 ( m , 1h ), 2 . 68 - 2 . 54 ( m , 2h ), 1 . 99 - 1 . 85 ( m , 2h ), 1 . 80 - 1 . 74 ( m , 2h ); ms m / z ( m − 1 ) 373 , 375 . 6 - bromo - n -( 4 - fluorophenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 100 mg , 0 . 38 mmol ) and 4 - fluoroaniline ( 84 mg , 0 . 76 mmol ) in a similar manner as described in example 13 to give 26 mg ( 19 %) of an off - white solid . 1 h - nmr ( dmso - d 6 ): δ 11 . 07 ( s , 1h ), 7 . 55 ( d , 1h ), 7 . 23 ( d , 1h ), 7 . 12 ( dd , 1h ), 6 . 92 ( t , 2h ), 6 . 70 - 6 . 68 ( m , 2h ), 5 . 89 ( d , 1h ), 4 . 73 - 4 . 71 ( m , 1h ), 2 . 68 - 2 . 53 ( m , 2h ), 1 . 99 - 1 . 73 ( m , 4h ); ms m / z ( m − 1 ) 357 , 359 . a solution of 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 43 mg , 0 . 16 mmol ) and 2 - chloropyrimidine ( 56 mg , 0 . 49 mmol ) in n , n - dimethylformamide ( 1 . 0 ml ) was sealed in a microwave vial and heated by a smith synthesizer microwave at 150 ° c . for 15 minutes . the mixture was diluted with ethyl acetate ( 10 ml ) and washed with water ( 2 × 10 ml ). the organic phase was concentrated and purified by flash column chromatography on silica ( 20 % to 50 % gradient of ethyl acetate / hexanes ) to provide 6 - bromo - n - pyrimidin - 2 - yl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine . the amine was diluted with diethyl ether ( 3 ml ) and hydrogen chloride ( 1 . 0 m in diethyl ether ) was added . the suspension was concentrated , diluted with acetonitrile and water , frozen and lyophilized to provide 6 - bromo - n - pyrimidin - 2 - yl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine hydrochloride ( 16 mg , 26 %) as a yellow solid . 1 h - nmr ( dmso - d 6 ): δ 10 . 94 ( s , 1h ), 8 . 44 - 8 . 39 ( m , 2h ), 8 . 03 - 7 . 96 ( m , 1h ), 7 . 55 ( s , 1h ), 7 . 23 ( d , 1h ), 7 . 12 ( d , 1h ), 6 . 72 ( t , 1h ), 5 . 37 - 5 . 32 ( m , 1h ), 2 . 63 - 2 . 59 ( m , 2h ), 2 . 09 - 1 . 95 ( m , 2h ), 1 . 87 - 1 . 75 ( m , 2h ); ms m / z ( m − 1 ) 341 , 343 . a solution of 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 50 mg , 0 . 23 mmol ) and 2 - methylsulfonylpyrimidine ( 69 mg , 0 . 44 mmol ) in n , n - dimethylformamide ( 0 . 50 ml ) was heated at 150 ° c . for 900 seconds in a smith synthesizer microwave . the mixture was diluted with ethyl acetate and extracted with 5 % aqueous lithium chloride . the organic layer was isolated and concentrated onto silica . purification by flash chromatography ( 0 - 30 % ethyl acetate - hexanes ) yielded 6 - chloro - n - pyrimidin - 2 - yl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 8 mg , 12 % yield ) as a yellow solid . alternatively , 6 - chloro - n - pyrimidin - 2 - yl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine could be prepared in a 9 % yield by heating a mixture of 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine and 2 - chlorosulfonylpyrimidine in n , n - dimethylformamide at 60 ° c . for 15 hours . 1 h - nmr ( cdcl 3 ): δ 8 . 88 ( s , 1h ), 8 . 37 ( m , 2h ), 7 . 46 ( m , 1h ), 7 . 19 ( d , 1h ), 7 . 09 ( dd , 1h ), 6 . 66 ( t , 1h ), 5 . 72 ( s , 1h ), 5 . 22 ( m , 1h ), 2 . 72 ( m , 2h ), 2 . 29 ( m , 1h ), 2 . 06 - 1 . 90 ( m , 3h ); ms m / z 297 ( m − 1 ). 6 - chloro - n -( 4 , 6 - dimethoxypyrimidin - 2 - yl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine and 4 , 6 - dimethoxy - 2 - methylsulfonylpyrimidine in a similar manner as described above to give 8 mg ( 10 % yield ) of a pale yellow solid . 1 h - nmr ( cdcl 3 ): δ 8 . 79 ( s , 1h ), 7 . 45 ( s , 1h ), 7 . 18 ( dd , 1h ), 7 . 08 ( dd , 1h ), 5 . 50 ( s , 1h ), 5 . 24 ( m , 1h ), 5 . 18 ( m , 1h ), 3 . 88 ( 2s , 6h ), 2 . 70 ( m , 2h ), 2 . 28 ( m , 1h ), 2 . 04 - 1 . 83 ( m , 3h ); ms m / z 359 ( m + 1 ). 6 - chloro - n -( 4 - methylpyrimidin - 2 - yl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine and 4 - methyl - 2 - methylsulfonylpyrimidine in a similar manner as described above to give 6 mg ( 7 % yield ) of a yellow solid . 1 h - nmr ( cdcl 3 ): δ 9 . 05 ( s , 1h ), 8 . 23 ( d , 1h ), 7 . 45 ( m , 1h ), 7 . 17 ( d , 1h ), 7 . 07 ( dd , 1h ), 6 . 52 ( d , 1h ), 5 . 36 ( m , 1h ), 5 . 20 ( m , 1h ), 2 . 70 ( m , 2h ), 2 . 38 ( s , 3h ), 2 . 29 ( m , 1h ), 2 . 02 - 1 . 85 ( m , 3h ); ms m / z 311 ( m − 1 ). 6 - chloro - n -( 4 , 6 - dimethylpyrimidin - 2 - yl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - chloro - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine and 2 - chloro - 4 , 6 - dimethylpyrimidine in a similar manner as described above to give 6 mg ( 8 % yield ) of a pale yellow oil . 1 h - nmr ( cdcl 3 ): δ9 . 23 ( s , 1h ), 7 . 45 ( s , 1h ), 7 . 16 ( d , 1h ), 7 . 07 ( d , 1h ), 6 . 42 ( s , 1h ), 5 . 25 ( m , 1h ), 5 . 20 ( m , 1h ), 2 . 70 ( m , 2h ), 2 . 35 ( s , 6h ), 2 . 29 ( m , 1h ), 2 . 03 - 1 . 83 ( m , 3h ); ms m / z 327 ( m + 1 ). 6 - bromo - n - pyridin - 2 - yl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine hydrochloride was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 150 mg , 0 . 57 mmol ) and 2 - aminopyridine ( 107 mg , 1 . 1 mmol ) in a similar manner as described above to give 10 mg of a white powder as the hydrochloride salt . 1 h - nmr ( dmso - d 8 ): δ 11 . 20 ( s , 1h ), 7 . 99 ( d , 1h ), 7 . 92 - 7 . 86 ( m , 1h ), 7 . 65 ( s , 1h ), 7 . 30 ( d , 1h ), 7 . 20 ( d , 1h ), 7 . 09 - 7 . 02 ( m , 1h ), 6 . 91 - 6 . 86 ( m , 1h ), 5 . 30 - 5 . 25 ( m , 1h ), 2 . 76 - 2 . 60 ( m , 1h ), 2 . 16 - 2 . 09 ( m , 1h ), 1 . 95 - 1 . 82 ( m , 3h ); ms m / z ( m − 1 ) 340 , 342 . 6 - bromo - n -( 5 - propylpyrimidin - 2 - yl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 75 mg , 0 . 28 mmol ) and 5 - propyl - 2 - chloropyrimidine ( 0 . 5 ml ) in a similar manner as described above to give 5 mg ( 5 %) of a yellow solid . 1 h - nmr ( dmso - d 6 ): δ 10 . 86 ( s , 1h ), 8 . 17 ( s , 2h ), 7 . 53 ( s , 1h ), 7 . 30 ( d , 1h ), 7 . 22 ( d , 1h ), 7 . 10 ( d , 1h ), 5 . 30 - 5 . 23 ( m , 1h ), 2 . 63 - 2 . 56 ( m , 2h ), 2 . 36 ( t , 2h ), 2 . 06 - 1 . 96 ( m , 2h ), 1 . 84 - 1 . 73 ( m , 2h ), 1 . 56 - 1 . 47 ( m , 2h ), 0 . 88 ( t , 3h ); ms m / z ( m − 1 ) 383 , 385 . 6 - methyl - n - pyrimidin - 2 - yl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - methyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine and 2 - chloropyrimidine in a similar manner as described above to give 5 mg ( 4 %) of a yellow solid . 1 h - nmr ( cdcl 3 ): δ 8 . 63 ( s , 1h ), 8 . 40 ( d , 1h ), 7 . 32 ( d , 2h ), 7 . 24 ( d , 1h ), 7 . 01 ( d , 1h ), 6 . 64 ( t , 1h ), 5 . 47 ( d , 1h ), 5 . 24 ( q , 1 h ), 2 . 74 ( m , 2h ), 2 . 44 ( s , 3h ), 2 . 36 ( t , 1h ), 2 . 00 ( m , 3h ); ms m / z 279 ( m + 1 ). 6 - methoxy - n -( 5 - propylpyrimidin - 2 - yl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - methoxy - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine and 2 - chloropyrimidine in a similar manner as described above to give 4 mg ( 4 %) of a yellow solid . 1 h - nmr ( cdcl 3 ): δ 8 . 72 ( s , 1h ), 8 . 40 ( d , 2h ), 7 . 25 ( d , 1h ), 7 . 00 ( s , 1h ), 6 . 84 ( d , 1h ), 6 . 64 ( t , 1h ), 5 . 47 ( d , 1h ), 5 . 24 ( q , 1h ), 3 . 85 ( s , 3h ), 2 . 74 ( m , 2h ), 2 . 36 ( t , 1h ), 2 . 00 ( m , 3h ); ms m / z295 ( m + 1 ). n -( 4 , 6 - dimethoxypyrimidin - 2 - yl )- 6 - methyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine hydrochloride was prepared from 6 - methyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine and 2 - chloro - 4 , 6 - dimethoxypyrimidine in a similar manner as described in example 22 to give 12 mg ( 8 %) of a redish solid . 1 h - nmr ( cdcl 3 ): δ 10 . 4 ( s , 1h ), 7 . 40 ( s , 1h ), 7 . 13 ( m , 2h ), 6 . 82 ( s , 1h ), 5 . 46 ( d , 1h ), 5 . 30 ( s , 1h ), 4 . 08 ( s , 6h ), 2 . 65 ( m , 2h ), 2 . 33 ( s , 3h ), 2 . 06 ( m , 2h ), 1 . 80 ( m , 2h ); ms m / z 339 ( m + 1 ). 6 - bromo - n -( 4 , 6 - dimethylpyrimidin - 2 - yl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine hydrochloride was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 50 mg , 0 . 19 mmol ) and 4 , 6 - dimethyl - 2 - chloropyrimidine ( 134 mg , 0 . 94 mmol ) in a similar manner as described in example 22 to give 12 mg ( 16 %) of a yellow solid . 1 h - nmr ( dmso - d 6 ): δ 10 . 98 ( s , 1h ), 8 . 40 ( br s , 2h ), 7 . 59 ( s , 1h ), 7 . 26 ( d , 1h ), 7 . 16 ( d , 1h ), 6 . 77 ( s , 1h ), 5 . 52 - 5 . 48 ( m , 1h ), 2 . 68 - 2 . 61 ( m , 2h ), 2 . 41 ( 2s , 6h ), 2 . 15 - 2 . 06 ( m , 1h ), 2 . 04 - 1 . 96 ( m , 1h ), 1 . 91 - 1 . 76 ( m , 2h ); ms m / z ( m + 1 ) 371 , 373 ; ( m − 1 ) 369 , 371 . 6 - bromo - n -[ 5 -( trifluoromethyl ) pyrimidin - 2 - yl ]- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 75 mg , 0 . 28 mmol ) and 2 - chloro - 5 -( trifluoromethyl )- pyrimidine ( 0 . 5 ml ) in a similar manner as described in example 22 to give 5 mg ( 4 %) of a yellow solid . 1 h - nmr ( dmso - d 6 ) taken at 80 ° c . : δ 10 . 94 - 10 . 88 ( m , 1h ), 8 . 69 - 8 . 62 ( m , 1h ), 8 . 30 - 8 . 24 ( m , 1h ), 7 . 55 ( s , 1h ), 7 . 21 ( d , 1h ), 7 . 13 - 7 . 10 ( m , 1h ), 7 . 02 ( d , 1h ), 5 . 40 - 5 . 27 ( m , 1h ), 2 . 62 - 2 . 58 ( m , 2h ), 2 . 08 - 1 . 96 ( m , 2h ), 1 . 87 - 1 . 76 ( m , 2h ); ms m / z ( m − 1 ) 409 , 411 . 6 - bromo - n -[ 5 -( trifluoromethyl ) pyridin - 2 - yl ]- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 75 mg , 0 . 28 mmol ) and 5 -( trifluoromethyl )- 2 - bromopyridine ( 192 mg , 0 . 85 mmol ) in a similar manner as described in example 22 to give 6 . 5 mg ( 6 %) of a off - white solid . 1 h - nmr ( dmso - d 6 ): δ 10 . 95 ( s , 1h ), 8 . 36 ( s , 1h ), 7 . 79 ( d , 1h ), 7 . 64 ( dd , 1h ), 7 . 57 ( s , 1h ), 7 . 23 ( d , 1h ), 7 . 13 ( dd , 1h ), 6 . 62 ( d , 1h ), 5 . 40 - 5 . 36 ( m , 1h ), 2 . 70 - 2 . 55 ( m , 2h ), 2 . 06 - 1 . 78 ( m , 4h ); ms m / z ( m − 1 ) 408 , 410 . 6 -[( 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - yl ) amino ] nicotinonitrile was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 75 mg , 0 . 28 mmol ) and 6 - chloronicotinonitrile ( 118 mg , 0 . 85 mmol ) in a similar manner as described in example 22 to give 6 . 5 mg ( 6 %) of a light brown solid . 1 h - nmr ( dmso - d 6 ): δ 10 . 95 ( s , 1h ), 8 . 36 ( s , 1h ), 7 . 79 ( d , 1h ), 7 . 64 ( dd , 1h ), 7 . 57 ( d , 1h ), 7 . 23 ( d , 1h ), 7 . 13 ( dd , 1h ), 6 . 62 ( d , 1h ), 5 . 40 - 5 . 35 ( m , 1h ), 2 . 70 - 2 . 55 ( m , 2h ), 2 . 07 - 1 . 78 ( m , 4h ); ms m / z ( m − 1 ) 365 , 367 . n -( 1 , 3 - benzothiazol - 2 - yl )- 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 75 mg , 0 . 28 mmol ) and 2 - chlorobenzothiazole ( 143 mg , 0 . 84 mmol ) in a similar manner as described in example 22 to give 11 mg ( 10 %) of a yellow solid . 1 h - nmr ( cdcl3 ): δ 9 . 31 ( s , 1h ), 7 . 70 - 7 . 62 ( m , 3h ), 7 . 39 ( t , 1h ), 7 . 29 - 7 . 17 ( m , 4h ), 5 . 38 - 5 . 32 ( m , 1h ), 2 . 77 - 2 . 75 ( m , 2h ), 2 . 45 - 2 . 38 ( m , 1h ), 2 . 10 - 1 . 99 ( m , 3h ); ms m / z ( m − 1 ) 396 , 398 . n - pyrimidin - 2 - yl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 150 mg , 0 . 81 mmol ) and 2 - chloropyrimidine ( 184 mg , 1 . 62 mmol ) in a similar manner as described in example 22 to give 16 mg ( 8 %) of a yellow solid . 1 h - nmr ( dmso - d 6 ): δ 10 . 63 ( s , 1h ), 8 . 32 ( d , 2h ), 743 ( d , 1h ), 7 . 36 ( d , 1h ), 7 . 25 ( d , 1h ), 7 . 01 - 6 . 97 ( m , 1h ), 6 . 93 - 6 . 89 ( m , 1h ), 6 . 60 ( t , 1h ), 5 . 32 - 5 . 28 ( m , 1h ), 2 . 68 - 2 . 57 ( m , 2h ), 2 . 04 - 1 . 97 ( m , 2h ), 1 . 87 - 1 . 75 ( m , 2h ). 2 - bromo - n - pyrimidin - 2 - yl - 5 , 6 , 7 , 8 , 9 , 10 - hexahydrocyclohepta [ b ] indol - 6 - amine was prepared from 2 - bromo - 5 , 6 , 7 , 8 , 9 , 10 - hexahydrocyclohepta [ b ] indol - 6 - amine ( 150 mg , 0 . 54 mmol ) and 2 - chloropyrimidine ( 123 mg , 1 . 07 mmol ) in a similar manner as described in example 22 to give 18 mg ( 9 %) of a yellow solid . 1 h - nmr ( dmso - d 6 ): δ 10 . 80 ( s , 1h ), 8 . 31 ( d , 2h ), 7 . 57 ( s , 1h ), 7 . 49 ( d , 1h ), 7 . 20 ( d , 1h ), 7 . 07 - 7 . 04 ( m , 1h ), 6 . 60 ( t , 1h ), 5 . 36 - 533 ( m , 1h ), 2 . 94 - 2 . 89 ( m , 1h ), 2 . 70 - 2 . 63 ( m , 1h ), 2 . 05 - 1 . 94 ( m , 2h ), 1 . 89 - 1 . 59 ( m , 4h ); ms m / z ( m + 1 ) 357 , 359 ; ( m − 1 ) 355 , 357 . 6 - methyl - n - pyridin - 2 - yl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine hydrochloride salt was prepared from 6 - methyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 0 . 10 g , 0 . 5 mmol ) and 2 - aminopyridine ( 0 . 51 g , 0 . 55 mmol ) in a similar manner as described above to give a brown solid ( 0 . 002 g , 1 . 0 %). 1 h - nmr ( cdcl 3 ): δ 8 . 72 ( s , 1h ), 8 . 23 ( d , 1h ), 7 . 48 ( t , 1h ), 7 . 32 ( s , 1h ), 7 . 20 ( d , 1h ), 7 . 00 ( d , 1h ) 6 . 69 ( t , 1h ), 6 . 49 ( d , 1h ), 5 . 25 ( d , 1h ), 4 . 71 ( d , 1h ) 2 . 80 - 2 . 75 ( m , 2h ), 2 . 40 - 2 . 28 ( m , 1h ), 2 . 09 - 1 . 91 ( m , 3h ); ms m / z 183 ( m − 94 ). methyl 1 - anilino - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazole - 6 - carboxylate was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 0 . 05 g , 0 . 19 mmol ), palladium acetate ( 0 . 04 g , 0 . 02 mmol ), dppf ( 1 , 1 ′- bis ( diphenylphosphino ) ferrocene ) ( 0 . 01 g , 0 . 02 mmol ) and triethylamine ( 0 . 025 ml , 0 . 19 mmol ). the reagents were added to a round bottom flask with stir bar along with a 3 : 1 mixture of dimethyl sulfoxide : methanol ( 5 . 0 ml ) and heated to 85 ° c . under atmospheric pressure of carbon monoxide for 4 hours . the solution was cooled to room temperature , water ( 5 . 0 ml ) and ethyl acetate ( 25 ml ) added , the layers separated and the organic layer washed with water ( 5 . 0 ml ). the organic layer was dried over na 2 so 4 , filtered and evaporated to yield an oil that was purified by chromatography ( 5 - 50 % ethyl acetate / hexanes gradient ) to yield a white solid ( 0 . 03 g , 65 %). 1 h - nmr ( cdcl 3 ): δ 9 . 35 ( s , 1h ), 8 . 46 ( s , 1h ), 8 . 05 ( d , 1h ), 7 . 45 ( d , 1h ), 3 . 95 ( t , 3h ), 3 . 06 ( t , 2h ), 2 . 69 ( t , 2h ) 2 . 30 ( t , 2h ); ms m / z 244 ( m + 1 ). methyl 1 - anilino - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazole - 6 - carboxylate was prepared from 6 - methyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 0 . 03 g , 0 . 11 mmol ) and aniline ( 0 . 13 ml , 0 . 13 mmol ) in a similar manner as described above . further purification by reverse phase hplc ( waters c18 symmetry column , 50 - 90 % acetonitrile / water over 8 . 5 min ., 35 ml / min .) gave a yellow solid ( 0 . 005 g , 13 %). 1 h - nmr ( cdcl 3 ): δ 8 . 27 ( s , 1h ), 8 . 25 ( s , 1h ), 7 . 86 ( d , 1h ), 7 . 27 ( t , 2h ), 7 . 23 ( d , 1h ), 6 . 79 ( t , 1h ) 6 . 75 ( d , 2h ), 4 . 83 ( t 1h ), 3 . 93 ( s , 3h ) 2 . 78 ( t , 2h ), 2 . 28 - 2 . 20 ( m , 1h ), 2 . 07 - 2 . 00 ( m , 1h ), 1 . 92 - 1 . 80 ( m , 1h ); ms m / z 228 ( m − 93 ). 6 -[( 6 - methyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - yl ) amino ] nicotinonitrile hydrochloride salt was prepared from 6 - methyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine ( 0 . 10 g , 0 . 50 mmol ) and 6 - chloronicotinonitrile ( 0 . 138 g , 0 . 1 mmol ) in a similar manner as described above to give a light brown solid ( 0 . 005 g , 3 . 0 %). 1 h - nmr ( cdcl 3 ): δ 8 . 49 ( s , 1h ), 8 . 33 ( s , 1h ), 7 . 56 ( d , 1h ), 7 . 28 ( s , 1h ), 7 . 18 ( d , 1h ), 6 . 99 ( d , 1h ), 6 . 42 ( d , 1h ), 5 . 31 ( d , 1h ), 5 . 15 ( d , 1h ) 2 . 77 - 2 . 70 ( m , 2h ), 2 . 28 - 2 . 25 ( m , 1h ), 2 . 00 - 1 . 92 ( m , 3h ); ms m / z 301 ( m − 1 ). n - phenyl - 6 -( trifluoromethyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine hydrochloride was prepared from 6 -( trifluoromethyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 150 mg , 0 . 59 mmol ) and aniline ( 110 mg , 1 . 2 mmol ) in a similar manner as described above to give 15 mg ( 7 %) of a white solid ; 1 h - nmr ( dmso - d 6 ): δ 11 . 36 ( s , 1h ), 7 . 77 ( s , 1h ), 7 . 46 - 7 . 30 ( m , 4h ), 7 . 14 - 7 . 10 ( m , 2h ), 6 . 81 - 6 . 58 ( m , 2h ), 4 . 83 - 4 . 80 ( m , 1h ), 2 . 75 - 2 . 58 ( m , 2h ), 2 . 08 - 1 . 80 ( m , 4h ); ms m / z ( m − 1 ) 329 . n - phenyl - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 150 mg , 0 . 81 mmol ) and aniline ( 1 . 0 g , 11 mmol ) in a similar manner as described above to give 24 mg ( 11 %) of a white solid ; 1 h - nmr ( dmso - d 6 ): δ 10 . 83 ( s , 1h ), 7 . 40 ( d , 1h ), 7 . 28 ( d , 1h ), 7 . 09 ( t , 2h ), 7 . 03 ( t , 1h ), 6 . 94 ( t , 1h ), 6 . 72 ( d , 2h ), 6 . 54 ( t , 1h ), 5 . 91 ( d , 1h ), 4 . 79 - 4 . 75 ( m , 1h ), 2 . 73 - 2 . 67 ( m , 1h ), 2 . 64 - 2 . 57 ( m , 1h ), 2 . 01 - 1 . 73 ( m , 4h ); ms m / z ( m − 93 ) 170 . 6 - bromo - n -( 3 - methoxyphenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 100 mg , 0 . 38 mmol ) and m - anisidine ( 94 mg , 0 . 76 mmol ) in a similar manner as described above to give 37 mg ( 26 %) of a white solid ; 1 h - nmr ( dmso - d 6 ): δ 11 . 04 ( s , 1h ), 7 . 55 ( s , 1h ), 7 . 23 ( d , 1h ), 7 . 12 ( dd , 1h ), 6 . 97 ( t , 1h ), 6 . 32 - 6 . 27 ( m , 2h ), 6 . 13 ( dd , 1h ), 5 . 96 ( d , 1h ), 4 . 76 - 4 . 72 ( m , 1h ), 3 . 65 ( s , 3h ), 2 . 68 - 2 . 52 ( m , 2h ), 2 . 00 - 1 . 87 ( m , 2h ), 1 . 82 - 1 . 74 ( m , 2h ); ms m / z ( m − 1 ) 369 , 371 . 6 - bromo - n -( 3 - fluorophenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 100 mg , 0 . 38 mmol ) and 3 - fluoroaniline ( 84 mg , 0 . 76 mmol ) in a similar manner as described above to give 17 mg ( 12 %) of a white solid ; 1 h - nmr ( dmso - d 6 ): δ 11 . 08 ( s , 1h ), 7 . 56 ( s , 1h ), 7 . 23 ( d , 1h ), 7 . 14 - 7 . 04 ( m , 2h ), 6 . 53 - 6 . 48 ( m , 2h ), 6 . 36 - 6 . 26 ( m , 2h ), 4 . 78 - 4 . 76 ( m , 1h ), 2 . 69 - 2 . 53 ( m , 2h ), 2 . 00 - 1 . 85 ( m , 2h ), 1 . 81 - 1 . 76 ( m , 2h ); ms m / z ( m + 1 ) 357 , 359 . 6 - bromo - n -( 1h - indol - 5 - yl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 100 mg , 0 . 76 mmol ) and 5 - aminoindole ( 100 mg , 0 . 76 mmol ) in a similar manner as described above to give 54 mg ( 37 %) of a white solid ; 1 h - nmr ( dmso - d 6 ): δ 11 . 08 ( s , 1h ), 10 . 61 ( s , 1h ), 7 . 55 ( d , 1h ), 7 . 23 ( d , 1h ), 7 . 14 - 7 . 11 ( m , 2h ), 7 . 10 ( d , 1h ), 6 . 84 - 6 . 83 ( m , 1h ), 6 . 65 ( dd , 1h ), 6 . 18 - 6 . 17 ( m , 1h ), 5 . 21 ( d , 1h ), 4 . 77 - 4 . 71 ( m , 1h ), 2 . 68 - 2 . 54 ( m , 2h ), 2 . 02 - 1 . 89 ( m , 2h ), 1 . 84 - 1 . 73 ( m , 2h ); ms m / z ( m + 1 ) 378 , 380 . 6 - bromo - n -( 2 - methoxyphenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 200 mg , 0 . 76 mmol ) and o - anisidine ( 187 mg , 1 . 52 mmol ) in a similar manner as described above and recrystallized from acetonitrile to give 30 mg ( 11 %) as yellow crystals ; 1 h - nmr ( dmso - d 6 ): δ 11 . 07 ( s , 1h ), 7 . 56 ( d , 1h ), 7 . 22 ( d , 1h ), 7 . 13 ( dd , 1h ), 6 . 84 - 6 . 73 ( m , 3h ), 6 . 60 - 6 . 56 ( m , 1h ), 4 . 85 - 4 . 80 ( m , 1h ), 4 . 72 ( d , 1h ), 3 . 73 ( s , 3h ), 2 . 70 - 2 . 53 ( m , 2h ), 2 . 00 - 1 . 75 ( m , 4h ); ms m / z ( m − 1 ) 369 , 371 . 6 - bromo - n -( 2 - chlorophenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 200 mg , 0 . 76 mmol ) and 2 - chloroaniline ( 193 mg , 1 . 51 mmol ) in a similar manner as described above to give 43 mg ( 15 %) of a white solid ; 1 h - nmr ( dmso - d 6 ): δ 11 . 08 ( s , 1h ), 7 . 57 ( d , 1h ), 7 . 27 - 7 . 23 ( m , 2h ), 7 . 16 - 7 . 12 ( m , 2h ), 6 . 92 ( d , 1h ), 6 . 64 - 6 . 60 ( m , 1h ), 5 . 12 ( d , 1h ), 4 . 95 - 4 . 90 ( m , 1h ), 2 . 71 - 2 . 56 ( m , 2h ), 2 . 04 - 1 . 76 ( m , 4h ); ms m / z ( m − 1 ) 373 , 375 . 6 - bromo - n -( 2 - fluorophenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 200 mg , 0 . 76 mmol ) and 2 - fluoroaniline ( 168 mg , 1 . 51 mmol ) in a similar manner as described above to give 37 mg ( 14 %) of a white solid ; 1 h - nmr ( dmso - d 6 ): δ11 . 04 ( s , 1h ), 7 . 55 ( d , 1h ), 7 . 23 ( d , 1h ), 7 . 12 ( dd , 1h ), 7 . 05 - 6 . 85 ( m , 3h ), 6 . 59 - 6 . 54 ( m , 1h ), 5 . 53 ( m , 1h ), 4 . 87 - 4 . 82 ( m , 1h ), 2 . 68 - 2 . 57 ( m , 2h ), 2 . 04 - 1 . 92 ( m , 2h ), 1 . 87 - 1 . 72 ( m , 2h ). 6 - bromo - n -( 3 , 4 - dichlorophenyl )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - amine was prepared from 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 200 mg , 0 . 76 mmol ) and 3 , 4 - dichloroaniline ( 245 mg , 1 . 51 mmol ) in a similar manner as described above to give 12 mg ( 4 %) of an off - white solid ; 1 h - nmr ( dmso - d 6 ): δ 11 . 08 ( s , 1h ), 7 . 57 ( d , 1h ), 7 . 26 ( d , 1h ), 7 . 23 ( d , 1h ), 7 . 13 ( dd , 1h ), 6 . 92 ( d , 1h ), 6 . 70 ( dd , 1h ), 6 . 52 ( d , 1h ), 4 . 79 - 4 . 77 ( m , 1h ), 2 . 68 - 2 . 52 ( m , 2h ), 1 . 99 - 1 . 72 ( m , 4h ); ms m / z ( m − 1 ) 409 . to a solution of 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - one ( 500 mg , 1 . 9 mmol ) in methanol ( 20 ml ) was added sodium borohydride ( 144 mg , 3 . 8 mmol ) portionwise . the reaction mixture was stirred for one hour and quenched with water ( 5 ml ). the reaction was concentrated , diluted with methylene chloride and washed with water . the organic phase was concentrated and the crude alcohol purified by flash chromatography on silica ( 5 % to 30 % ethyl acetate / hexanes gradient ) to provide 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - ol ( 255 mg , 50 %) as a light brown solid : 1 h - nmr ( dmso - d 6 ): δ 10 . 99 ( s , 1h ), 7 . 54 ( d , 1h ), 7 . 25 ( d , 1h ), 7 . 12 ( dd , 1h ), 5 . 18 ( d , 1h ), 4 . 75 - 4 . 70 ( m , 1h ), 2 . 64 - 2 . 53 ( m , 2h ), 2 . 02 - 1 . 91 ( m , 2h ), 1 . 77 - 1 . 66 ( m , 2h ); ms m / z ( m − 1 ) 339 , 341 . to a solution of 6 - bromo - 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazol - 1 - ol ( 50 mg , 0 . 19 mmol ) in thf ( 5 ml ) was added p - fluorophenol ( 43 mg , 0 . 38 mmol ), polymer supported triphenylphosphine ( 1 . 67 mmol / g , 228 mg , 0 . 38 mmol ) and diisopropyl azodicarboxylate ( 77 mg , 0 . 38 mmol ). the reaction was stirred at room temperature for 16 h , and additional diisopropyl azodicarboxylate ( 77 mg , 0 . 38 mmol ) was added . the reaction was stirred for 16 h , filtered and concentrated . the crude product was purified by flash chromatography on silica ( 2 % to 20 % ethyl acetate / hexanes gradient ) to provide 6 - bromo - n -( 4 - fluorophenoxy )- 2 , 3 , 4 , 9 - tetrahydro - 1h - carbazole ( 8 mg , 12 %) as a white solid : 1 h - nmr ( dmso - d 6 ): δ 11 . 20 ( s , 1h ), 7 . 61 ( d , 1h ), 7 . 26 ( d , 1h ), 7 . 16 - 7 . 06 ( m , 5h ), 5 . 53 ( t , 1h ), 2 . 75 - 2 . 69 ( m , 1h ), 2 . 57 - 2 . 50 ( m , 1h ), 2 . 02 - 1 . 76 ( m , 4h ). compounds of the current invention are believed useful in the treatment and / or prophylaxis of conditions and diseases associated with hcv infection . activity mediated through hcv was determined using an et replicon line . the materials used include a medium comprised of dmem ( 1 × liquid , high glucose ); invitrogen cat # 11965 - 092 ; 100 × penicillin / streptomycin solution ( 10 , 000 units / ml ); invitrogen cat # 15140 - 122 ; 100 × non - essential amino acid solution ( 10 mm ); invitrogen cat # 11140 - 050 ; fetal bovine serum ; jrh biosciences cat # 12107 - 500m ; geneticin ( 50 mg / ml ); invitrogen cat # 10131 - 035 the et replicon line ( see lohmann et al . ( 1999 ), replication of subgenomic hepatitis c virus rnas in a hepatoma cell line . science 285 : 110 - 113 ; krieger et al . ( 2001 ), enhancement of hepatitis c virus rna replication by cell culture - adaptive mutations . j . virol . 75 : 4614 - 4624 ; and vrolijk et al . ( 2003 ), a replicon - based bioassay for the measurement of interferons in patients with chronic hepatitis c . j . virol . meth . 110 : 201 - 209 , each herein incorporated by reference with regard to the et replicon line ), includes huh7 cells stably transfected with hcv genotype 1b strain con1 replicon . this replicon expresses the firefly luciferase , has the coding region for ubiquitin inserted upstream of the neomycin gene , and carries three cell culture - adaptive mutations that enhance rna replication cooperatively ( e1202g , t1280i , and s2197p ). the et cell line was obtained under license from : reblikon gmbh , nach dem alten schloss 22 , 55239 gau - odernheim , germany . cells are maintained at 37 ° c ., 5 % co 2 , in dmem with 10 % fcs , 1 × penicillin / streptomycin , 1 × non - essential amino acids , 0 . 5 mg / ml geneticin . for passage , cells are washed once with pbs , and incubated at 37 ° c . with sufficient trypsin ( 0 . 05 %)/ versene to cover the monolayer . once detached from the flask , cells are mixed with several mls of dmem + 10 % fbs to inactivate the trypsin , then diluted appropriately ( usually 1 in 5 or 1 in 10 ) with sufficient medium to pass to a new flask . for a t225 flask , 40 - 50 mls total volume of cells + medium is typically used . to prevent the density dependent drop in replicon rna , the et cell line is maintained at sub - confluent ( 60 - 80 %) levels . compounds are diluted in dmso across the first 10 wells of a costar v - bottom 96 - well plate using a biomek 2000 workstation ( beckman - coulter ), with 0 . 5 log 10 dilution intervals . dmso only is added to the last two columns of the plate . the top concentration of drug in this master plate is typically 2 . 5 mm . a 1 / 5 dilution of the compounds is made by adding dmem + 10 % fbs with a multichannel pipettor , giving a top concentration of 500 μm . 5 μl of diluted compounds is transferred into black costar flat bottom 96 - well daughter plates using a rapidplate workstation ( zymark ). cells are grown to approximately 80 % confluency and trypsinised as described above . cells are counted in a levy hemocytometer and diluted to 20 , 000 cells / ml in dmem containing 10 % fbs , 1 × penicillin / streptomycin , 1 × neaas . ( note : geneticin is omitted for the assay ). 245 μl cell suspension is added to the first 11 columns of the daughter plates prepared as above using a multidrop dispenser ( titertek ). thus , 5 , 000 cells are added per well , and the final top concentration of each compound is 10 μm . the twelfth column of each plate is used to generate background readings for the assay . plates are incubated at 37 ° c ., 5 % co 2 for 72 hours . steady - go reagent is prepared according to the manufacturer &# 39 ; s instructions , by mixing the steady - glo buffer and steady - glo substrate buffer at room temperature . medium is removed from the 96 - well plates containing et cells treated with compound using a multi - channel aspirator . 100 μl of steady - glo reagent is added to each well using a multichannel pipettor or multidrop dispenser . plates are incubated at room temperature for 5 minutes to ensure complete lysis , and mixed by gentle shaking . luciferase activity is read using a topcount ( pe biosystems ), with a 1 - second read - time per well . data are analyzed and ic 10 curves generated using robofit software . the compounds herein described are believed to exhibit useful hcv activity as determined by the described assay . although specific ic 50 values are given for certain of the present compounds , these values should be considered exemplary . those skilled in the art will appreciate the variability in performing and recording data using the biological activity assays that are herein described . although specific embodiments of the present invention are herein illustrated and described in detail , the invention is not limited thereto . the above detailed descriptions are provided as exemplary of the present invention and should not be construed as constituting any limitation of the invention . modifications will be obvious to those skilled in the art , and all modifications that do not depart from the spirit of the invention are intended to be included with the scope of the appended claims . | 0 |
some embodiments of the invention will now be explained below with reference to the drawings . the invention , however , is not limited to these embodiments . in these embodiments , even when using n - type semiconductors instead of p - type semiconductors while using p - type semiconductors instead of n - type semiconductors , the same effects are assured . in these embodiments , a back gate of a double - gate soi transistor is provided in parallel to the bit line . thereby , the above - mentioned problems are resolved . fig1 is a block diagram showing a memory portion of dram 100 according to the first embodiment of the invention . the memory portion includes memory cell arrays 10 , sense amplifier / plate driver portions ( herein below simply called sa / pds ) 20 , row decoders combined with wl drivers ( herein below simply called row decoders ) 30 , and a column decoder combined with csl ( column select line ) driver ( herein below simply called column decoder ) 40 . each memory cell 10 comprises memory cells having a matrix arrangement of fbcs . the plurality of memory cell arrays 10 are aligned side by side . the sa / pds 20 are provided in every other spaces between memory cell arrays 10 . one sa / pd 20 is connected to memory cell arrays 10 at both sides thereof and can detect and latch data in these memory cell arrays 10 . in addition , the sa / pd 20 can selectively control the potential of the plate lines pl shown in fig2 and can drive the selected plate line pl . each row decoder 30 is associated with each memory cell array 10 , and can select a word line in the memory cell array 10 . the column decoder 40 is associated with a group of memory cell arrays 10 in side - by - side arrangement , and can select a bit line in the memory cell arrays 10 . fig2 is a circuit diagram of one memory cell array 10 and one sa / pd 20 in dram 100 . at the right of the sa / pd 20 , another memory cell array 10 is connected , although not shown . in the memory cell array 10 , n word lines wl 0 ˜ wl n − 1 , m bit lines bl 0 ˜ bl m − 1 , and m plate lines pl 0 ˜ pl m − 1 are provided . furthermore , memory cells mc are provided in the memory cell array 10 at the crossing points of the word lines wl 0 ˜ wl n − 1 and bit lines bl 0 ˜ bl m − 1 . that is , one memory cell array 10 has n * m memory cells mc . alternatively , l sets of n * m memory cells may be aligned in the direction of the word lines to include n * m * l memory cells in one memory cell array 10 . each memory cell mc is a double - gate soi transistor formed on soi ( silicon - on - insulator ) to include a forward gate fg and a back gate bg as shown in fig3 . each of the word lines wl 0 ˜ wl n − 1 is connected to individual forward gates fg of memory cells mc of each row in the memory cell . each of the bit lines bl 0 ˜ bl m − 1 is connected to individual drains d of memory cells mc of each column in the memory cell array 10 . each of the plate lines pl 0 ˜ pl m − 1 is connected to individual back gates bg of memory cells of each column in the memory cell array 10 . individual plate lines pl 0 ˜ pl m − 1 are associated with individual bit lines bl 0 ˜ bl m − 1 . preferably , the plate lines pl 0 ˜ pl m − 1 extend in parallel with the bit lines bl 0 ˜ bl m − 1 . the word lines wl 0 ˜ wl n − 1 are connected to a row decoder 30 ( see fig1 ), respectively . the bit lines bl 0 ˜ bl m − 1 , and the plate lines pl 0 ˜ pl m − 1 are connected to the sa / pd 20 , respectively . the sa / pd 20 includes sense amplifier / plate driver circuits 21 and bl ( bit line ) / pl ( plate line ) selectors 22 . the bp / pl selectors 22 select a pair of bit line and plate line , and the pair of bit line and plate line selected by the bl / pl selectors 22 can be exclusively connected to the sense amplifier / plate driver circuits 21 . on the other hand , the wl driver in the row decoder 30 selects one of word lines wl 0 ˜ wl n − 1 and can drive the word line . thus , a memory cell mc at the crossing point of the selected pair of bit line and plate line with the selected word line can be selected . the memory cell array 10 further includes dummy memory cells dmc . forward gates fg of the dummy memory cells dmc are connected to word lines , and dummy bit lines dbl 0 or dbl 1 , are connected to the drains of the dummy memory cells dmc . back gates bg of the dummy memory cells dmc are connected to dummy plate lines dpl 0 or dpl 1 . the sa / pd 20 further includes dbl / dpl controllers 23 connected to the dummy bit lines dbl 0 , dbl 1 , and dummy plate lines dpl 0 , dpl 1 . dummy memory cells dmc are used when associated sense amplifiers sa detect data of memory cells . for example , dummy memory cells dmc connected to the dummy bit line dbl 0 store data “ 0 ”, and dummy memory cells dmc connected to the dummy bit line dbl 1 store data “ 1 ”. upon detection of the data , the sense amplifier sa adds currents of these dummy memory cells dmc and reduces the current to a half by means of a current mirror circuit ( not shown ). the sense amplifier sa compares the half current value with the current in each memory cell mc and thereby detects data “ 1 ” or data “ 0 ” of the memory cells mc . as such , the sense amplifier / plate driver circuit 21 can detect data of memory cells mc by means of the bit lines bl and the word lines wl . regarding the data detecting method , the invention is not limited to the above - explained method , but may employ any appropriate one of known methods . fig3 is a cross - sectional view of the memory portion of dram 100 taken along a bit line bl . the dram 100 includes a p - type semiconductor substrate 110 , silicon oxide film 120 , soi layer 130 , n - type drain regions 140 , n - type source regions 150 , p - type body regions 160 , word lines wl , bit lines bl , n - type plate lines pl and source lines sl . the silicon oxide film 120 is formed on the semiconductor substrate 110 . the plate lines pl are formed in the silicon oxide film 120 and isolated from the semiconductor substrate 110 and the soi layer 130 . the plate lines pl extend in parallel to the bit lines bl . the soi layer 130 overlies the silicon oxide film 120 and is isolated from the semiconductor substrate 110 and the silicon oxide film 120 . the drain regions 140 and the source regions 150 are formed in the soi layer 130 . the body regions 160 are formed between the drain regions 140 and the source regions 150 in the soi layer 130 . a gate insulating film 170 lies on the body regions 160 , and the word lines wl lie on the gate insulating film 170 . thereby , the word lines wl are insulated from the body regions 160 . the word lines wl extend in the direction vertical to the sheet plane of fig3 . the bit lines bl are electrically connected to the drain regions 140 , and extend across the word lines wl . fig4 is a cross - sectional view of the memory portion of dram 100 taken along a word line wl ( along the x - x line of fig3 ). it will be understood from fig3 and 4 that the bit lines bl and plate lines pl are associated with each other and extend in parallel . as best shown in fig4 , the bit line bl are aligned substantially in equal intervals . the plate lines pl are aligned in the same intervals as those of the bit lines bl . next referring to fig5 and 6 , operations and effects of the dram 100 will be explained . graphs shown in fig5 and 6 are results of a simulation of writing “ 0 ” or “ 1 ” in the dram 100 . the simulation was conducted under the conditions : channel length of memory cells mc : l gate = 0 . 175 μm ; thickness of the gate insulating film 170 : t oxf = 80 angstrom ; thickness of the insulating film 175 between the body regions 160 and the plate lines pl : t box = 120 angstrom , thickness of the silicon of the body regions 160 : t si = 330 angstrom . the acceptor impurity concentration in the body regions 160 is constantly 1 . 0 * 10 16 cm − 3 . both the word lines wl and the plate lines pl are made of n - type polysilicon having a sufficiently high impurity concentration . the word lines wl and the plate lines pl function as front gates fg and back gates bg , respectively . the graph of fig5 shows the potential of the body regions 160 controlled by respective potentials in the bit lines bl , word lines wl and plate lines pl . the abscissa indicates time ( in nanosecond ) and the ordinate indicates those potentials ( in volt ). potentials of the bit lines bl , word lines wl and plate lines pl are denoted “ v bl ”, “ v wl ” and “ v pl ”, respectively . potential of the body regions 160 is denoted by “ b body ”. the graph of fig6 shows relations between the potential vgs of the word line wl and the drain - to - source current ids while data is read out from a memory cell mc . first referring to fig5 , let data “ 1 ” be written in a memory cell mc . for the period from 0 nm to 42 ns , v wl is held in 1 . 5 v and the v bl is held in 2 . 0 v to bias the memory cell mc to the saturated sate . as a result , impact ionization occurs in the body region 160 , and the potential of the body region 160 gradually rises . once the potential of the body region 160 reaches approximately 0 . 7 v , the current generated by holes becomes substantially equal to the forward current flowing into the pn junction between the body region 160 and the source region 150 , and the potential of the body region 160 becomes substantially stationary . at that time , writing of data “ 1 ” in the memory cell mc is completed . next let the data “ 1 ” be maintained in the memory cell mc . after the data “ 1 ” is written in the memory cell mc , v bl is set to ov and v wl to − 1 . 5 v at the point of time , 46 ns . since v wl is a negative potential , holes in the body region 160 are maintained . therefore , the memory cell mc holds data “ 1 ”. next let v wl be raised to read out the data from the memory cell mc in order to examine whether or not the holes leak from the body region 160 . leakage of holes from the body region 160 is called “ disturbance ” herein below . for the period from about 50 ns to 70 ns , setting v bl to 0 . 2 v , and raising v wl from − 1 . 5 v to 1 . 5 v , v pl is maintained in − 2 v . in this sate , let the data in the body region 160 be monitored . thus , the potential of the body region 160 is confirmed to maintain approximately 0 . 6v unchanged . this suggests that no disturbance has occurred . in fig6 , curve i 1 shows the relation between the word line potential vgs and the drain current ids at the time of reading out the data . again referring to fig5 , let the data of the memory cell mc be read out by again holding the data “ 1 ” and thereafter raising v wl while keeping v pl in − 2v , for the purpose of confirming any disturbance to data “ 1 ”. referring to fig6 , the drain current ids of the memory cell mc then observed overlapped the curve i 1 . it has been confirmed from it that , even when the data is read out from the memory cell mc , the relation between the word line potential vgs and the drain current ids is maintained , and it has been confirmed that no disturbance occurred . next let it examined whether any disturbance occurs by raising the potential of the plate line pl and reading the data of the memory cell mc . for this purpose , for the period from about 84 ns to about 104 ns in fig5 , the potential v pl of the plate line pl is raised from − 2 v to − 5 v . v wl is maintained in − 1 . 5v . in this case , the potential of the body region 160 is maintained approximately in 0 . 6 v unchanged . this suggests that no disturbance has occurred . for the purpose of confirming that no disturbance occurs , the data of the memory cell mc is read out by raising the potential of the word line wl for the period from about 108 ns to about 110 ns . with reference to fig6 , the drain current ids of the memory cell mc observed here also overlapped the curve i 1 . it has been confirmed from it that , even when the potential of the plate line pl is raised while v wl of the word line wl is maintained in − 1 . 5 v , the relation between the word line potential vgs and the drain current ids is maintained , and disturbance did not occur . finally , for the period from about 116 ns to about 156 ns , the potential v wl and the potential v pl are raised to 1 . 5 v and − 0 . 5 v , respectively . thereby , data “ 0 ” is written in the memory cell mc . as a result , the potential of the body region 160 decreases . the duration of time for this writing was approximately 40 nm . after the data “ 0 ” is written in the memory cell mc , it is held at the point of time , 158 ns , approximately . thereafter , by reading out the data “ 0 ” from the memory cell mc in the period from about 160 ns to about 162 ns , the curve io shown in fig6 was obtained . it is appreciated from this result that the drain current ids reliably decreases , and the data “ 0 ” is certainly written in the memory cell mc . as such , if the potential of only one of the word line wl and the plate line pl is raised , the potential barrier between the body region 160 and the source region 150 does not decrease sufficiently . therefore , holes in the body region 160 are not released to the source region 150 , and the data “ 1 ” is maintained . on the other hand , if both the word line wl and the plate line pl are raised in potential , the potential barrier between the body region 160 and the source region 150 decreases sufficiently . as a result , holes in the body region 160 are released to the source region 150 , and the data “ 0 ” is written in the memory cell mc . as such , when both the word line wl and the plate line pl are raised in potential , the data “ 0 ” is written in the memory cell mc ( see the points of time 116 ns ˜ 156 ns in fig5 ). this means that the data “ 0 ” is written in the memory cell mc selected by a word line wl and a plate line pl . on the other hand , when only one of the word line wl and the plate line pl is raised in potential , the data “ 1 ” 0 stored in the memory cell mc does not change ( see the point of time 46 ns ˜ 108 ns in fig5 ). this means that no disturbance occurs against non - selected memory cells mc storing data “ 1 ”. in this manner , upon a refreshing operation , it is possible to select a memory cell mc having stored data “ 0 ” by means of a word line wl and a plate line pl and to write the data “ 0 ” only in that memory cell mc once again . in the prior art shown in fig1 , since the forward gates fg ( word lines ) and the back gates bg ( plate lines ) are parallel , it is not possible to select a particular memory cell mc alone and write the data “ 0 ” only in the memory cell mc , and it is therefore necessary to execute three steps s 1 , s 2 and s 3 for refreshing old data and writing new data . in contrast , in the instant embodiment of the invention , since the plate lines pl extend across the word lines wl and substantially in parallel to the bit lines bl . therefore , it is possible to select a memory cell mc at a crossing point of a word line wl and a plate line pl to write “ 0 ” and simultaneously select a memory cell mc at a crossing point of a word line wl and a bit line bl to write the data “ 1 ”. thus , the embodiment need only one step of writing data “ 0 ” or “ 1 ” in the memory cell mc for refreshing old data and writing new data . as a result , the instant embodiment reduces the cycle time for refreshing and writing operations than the prior art . in addition , the dram 100 according to the instant embodiment need not read data from all memory cells mc and latch them in the process of refreshing and writing operations . therefore , the sense amplifier need not be provided in one - to - one association with each bit line bl , but one sense amplifier is sufficient for one memory cell array 10 . as a result , in the semiconductor chip , the proportion of the area occupied by the sense amplifiers is reduced , the ratio of cell area increases , and the chip size is reduced . further , since this embodiment includes the word lines wl and the plate lines pl as forward gates and back gates , respectively , the problem of gidl does not occur in this embodiment . the duration of time for writing the data “ 0 ”, that is , the duration of time where potentials of the word line wl and the plate line pl are kept high , is important . as shown in fig6 , at the point of time , 156 ns , where the writing of the data “ 0 ” is completed , the potential of the body region 160 is in the course of decreasing . on the other hand , continuing the writing of data “ 0 ” until the potential of the body region 160 stabilizes results in elongating the cycle time of the refreshing operation . therefore , writing of data “ 0 ” is continued only until the potential becomes sufficiently distinctive from the potential for data “ 1 ”, but not continued beyond it up to a balanced condition . therefore , in order to prevent fluctuation of data , it is important to manage the duration of time for writing data “ 0 ”. fig7 is a block diagram showing the memory portion of dram 200 according to the second embodiment of the invention . in this embodiment , the sense amplifier portion 26 and the plate driver portion 28 are provided in separate locations . the other structural features of this embodiment are identical to those of the first embodiment . they are , therefore , not explained here . the sense amplifier portion 26 is located near one side of the memory cell array 10 . the plate driver portion 28 is located near the opposite side of the memory cell array 10 to be opposed to the sense amplifier portion 26 via the memory cell array 10 . as such , the sense amplifier portion 26 and the plate driver portion 28 are provided to appear alternately in spaces between every two adjacent memory cell arrays 10 , and they each are commonly used for two memory cell arrays 10 at both sides thereof . fig8 is a circuit diagram showing one memory cell array 10 , one sense amplifier 26 and one plate driver 28 . in harmony with the circuit arrangement including the sense amplifier portion 26 and the plate driver portion 28 as separate portions , the sense amplifier / plate driver circuit 21 shown in fig2 are separated to a sense amplifier circuit 221 and a plate driver circuit 224 in this embodiment . similarly , the bl / pl selector 22 shown in fig2 is separated to a bl selector 222 and a pl selector 225 in this embodiment . furthermore , the dbl / dpl selector 23 shown in fig2 is separated to a dbl selector 223 and a dpl selector 226 in this embodiment . the sense amplifier circuit 221 , bl selector 222 and dbl selector 223 are involved in the sense amplifier 26 whereas the plate driver circuit 224 , pl selector 225 and dpl selector 226 are involved in the plate driver 28 . the sense amplifier circuit 221 and the plate driver circuit 224 are connected by a plate drive line pdl . a plate drive signal is transferred from the sense amplifier circuit 221 to the plate driver circuit 224 via the plate drive line pdl . if data detected by the sense amplifier portion 26 is “ 0 ” in a refreshing or writing operation , the plate drive signal transfers the information to the plate driver portion 28 . thus , the plate driver portion 28 can selectively drive the plate line pl upon writing data “ 0 ”. in case of writing data “ 0 ” from outside in a writing operation , a peripheral data bus may directly transfer the information to the plate driver portion 28 . in case the sense amplifier portion 26 should process both the data “ 1 ” and data “ 0 ” in a writing operation , the sense amplifier portion 26 may transfer the information of data “ 0 ” alone to the late driver portion 28 via the plate drive line pdl . thus , the sense amplifier portion 26 can control the timing for driving the plate driver portion 28 . wiring of the plate driver line pdl can be formed from the same metal wiring layer as that of the column select line csl , which is the top layer on the memory cell array . a simulation of operation of the dram 200 results identical to the first embodiment under the same conditions . therefore , the second embodiment has the same effects as these of the first embodiment . in addition , the second embodiment makes it easier to design the sense amplifier portion 26 and the plate driver portion 28 because they are separately positioned . especially when the bit lines bl and the plate lines pl are arranged in a fine pitch , it is difficult from the standpoint of the circuit design to drive the bit lines bl and the plate lines pl independently from the same direction . therefore , the second embodiment is particularly effective for a design having a fine pitch arrangement of bit lines bl and plate lines pl . fig9 is a cross - sectional view of the memory portion of dram 300 according to the third embodiment of the invention , taken along a word line wl . when the dram 300 is cut along a bl line , it will appear identical to fig3 . the cross - sectional view of fig9 may be same as the cross - sectional view taken along the x - x line of fig3 . as shown in fig9 , each plate line pl in this embodiment is associated with four bit lines bl and four body regions 160 . a simulation of operation of the dram 300 results identical to that of the first embodiment under the same conditions . according to the instant embodiment , even when there is a difficulty in forming the plate lines pl in a fine pitch arrangement , or in forming the plate lines pl in precise alignment with the bit line bl , the plate line pl can be formed in parallel with the bit lines bl . in this embodiment , however , if data “ 0 ” is written in a memory cell in the same manner as the first and second embodiments , a plurality of memory cells connected to bit lines bl associated with a particular plate line pl are rewritten to data “ 0 ” simultaneously . therefore , this embodiment needs sense amplifiers in the same number of the bit lines bl associated with one plate line pl . then , the sense amplifiers can read and latch the data of all memory cells before writing data “ 0 ” in all memory cells and thereafter rewrite data “ 1 ” only in memory cells having stored data “ 1 ” before . as such , the third embodiment needs a reduced number of sense amplifiers equal in number to the bit lines bl associated with one plate line pl . therefore , the third embodiment increases the proportion of the cell area and reduces the chip size than conventional devices . fig1 is a diagram showing the layout and connection of sense amplifiers of the dram 300 . the dram 300 includes memory cell arrays 301 and sa / pd 302 . word lines and memory cells are omitted from illustration of fig1 . the plate lines pl 1 ˜ pl 4 are connected to sense amplifier circuit 321 ˜ 324 , respectively . four bit lines bl associated with one plate line pl 1 are connected to the sense amplifier circuits 321 ˜ 324 , respectively . similarly , four bit lines associated with another plate line pl 2 are connected to the sense amplifiers 321 ˜ 324 , four bit lines associated with still another plate line pl 3 are connected to the sense amplifier circuit 321 ˜ 324 , and four bit lines associated with yet another plate lines pl 4 are connected to the sense amplifier circuits 321 ˜ 324 . inside the dram 300 , memory cells arrays 301 each including a number of memory cells are aligned side - by - side . the sa / pd 302 involves the sense amplifiers 321 ˜ 324 and a bl selector 332 . the sense amplifier circuit 321 ˜ 324 include plate drivers . positional relation of the memory cell arrays 301 and sa / pd 302 is the same as that of the memory cell arrays 10 and sa / pd 20 shown in fig1 . that is , sa / pds circuits 302 are provided in every other spaces between adjacent memory cell arrays 301 . therefore , one sa / pd 302 is connected to two memory cell arrays 301 at both sides thereof . the bl selector 332 randomly selects four bit lines associated with the plate lines pl 1 ˜ pl 4 respectively . thereby , the sense amplifiers 321 ˜ 324 can read and latch data in all memory cells . the plate lines pl 1 ˜ pl 4 are driven by one of the sense amplifier circuits 321 ˜ 324 corresponding to the selected group of bit lines bl when data “ 0 ” is written in a memory cell . therefore , the embodiment doe not need a circuit for selecting plate lines pl ( pl selector ). fig1 is a diagram showing the layout and connection of sense amplifiers of the dram 400 according to the fourth embodiment of the invention . the dram 400 includes memory cell arrays 301 , sense amplifier portions 303 and plate driver portions 350 . this embodiment is different from the third embodiment in including the plate driver portions 350 independently from the sense amplifier portions 303 . each sense amplifier portions 303 includes sense amplifiers 325 ˜ 328 and a bl selector 332 . the sense amplifiers 325 ˜ 328 are those excluding plate drivers from the sense amplifiers 321 ˜ 325 shown in fig1 . this embodiment includes plate drivers in form of the plate driver portion 350 . positional relation of the memory cell arrays 301 , sense amplifier portions 303 and plate driver portions 350 is the same as that of the sense amplifier portions 26 and plate driver portions 28 shown in fig7 . that is , each sense amplifier portion 303 is located near one side of a particular memory cell array 301 . each plate driver portion 350 is located near the opposite side of the memory cell array 301 to be opposed to the sense amplifier portion 303 via the same memory cell array 301 . as such , the sense amplifier portions 303 and the plate driver portions 350 are provided to appear alternately in spaces between every two adjacent memory cell arrays 10 , and they each are commonly used for two memory cell arrays 301 at both sides thereof . this embodiment operates in the same manner as the third embodiment and ensures the same effects . additionally , this embodiment makes it easier to design the sense amplifier portion 303 and the plate driver portion 350 because they are separately positioned . especially when the bit lines bl and the plate lines pl are arranged in a fine pitch , it is difficult from the standpoint of the circuit design to drive the bit lines bl and the plate lines pl independently from the same direction . therefore , the second embodiment is particularly effective for a design having a fine pitch arrangement of bit lines bl and plate lines pl . | 7 |
as described in greater detail below , applicant has invented a method of inducing vasodilation in a mammal comprising administering to the mammal a tie2 receptor activator . in one preferred embodiment of the invention , the mammal is a human and the tie2 receptor activator is ang1 , ang1 *, or ang1 - fd - fc - fd . the invention further provides for a method wherein the tie2 receptor activator is ang1 , or a fragment or derivative thereof capable of activating the tie2 receptor . the invention also provides for a method wherein the tie - 2 receptor activator is an activating antibody , or a fragment or derivative thereof capable of activating the tie - 2 receptor , including a single chain fv ( scfv ). the invention further provides for a method wherein the tie - 2 receptor activator is a small molecule , or a fragment or derivative thereof capable of activating the tie2 receptor . by way of example , but not limitation , the method of the invention may be useful in treating clinical conditions that are characterized by hypertension , including pulmonary hypertension , and ischemic conditions including chronic ischemias such as diabetic ischemia , bueger &# 39 ; s syndrome and raynaud &# 39 ; s syndrome , and acute ischemias such as those associated with myocardial infarction and stroke . other clinical applications include treatment of penile erectile dysfunction associated with decreased blood flow . the present invention comprises tie2 ligands such as , for example , ang1 , ang1 *, and ang1 - fd - fc - fd as well as their amino acid sequence and also functionally equivalent molecules in which amino acid residues are substituted for residues within the sequence resulting in a silent change . for example , one or more amino acid residues within the sequence can be substituted by another amino acid ( s ) of a similar polarity that acts as a functional equivalent , resulting in a silent alteration . substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs . for example , the class of nonpolar ( hydrophobic ) amino acids include alanine , leucine , isoleucine , valine , proline , phenylalanine , tryptophan and methionine . the polar neutral amino acids include glycine , serine , threonine , cysteine , tyrosine , asparagine , and glutamine . the positively charged ( basic ) amino acids include arginine , lysine and histidine . the negatively charged ( acidic ) amino acids include aspartic acid and glutamic acid . also included within the scope of the invention are proteins or fragments or derivatives thereof which exhibit the same or similar biological activity and derivatives which are differentially modified during or after translation , e . g ., by glycosylation , proteolytic cleavage , linkage to an antibody molecule or other cellular ligand , etc . antibodies , including monoclonal antibodies , that activate the tie2 receptor are also contemplated by the invention . for preparation of monoclonal antibodies , any technique which provides for the production of antibody molecules by continuous cell lines in culture may be used . for example , the hybridoma technique originally developed by kohler and milstein ( 1975 , nature 256 : 495 – 497 ), as well as the trioma technique , the human b - cell hybridoma technique ( kozbor et al ., 1983 , immunology today 4 : 72 ), and the ebv - hybridoma technique to produce human monoclonal antibodies ( cole et al ., 1985 , in “ monoclonal antibodies and cancer therapy ,” alan r . liss , inc . pp . 77 – 96 ) and the like are within the scope of the present invention . the monoclonal antibodies may be human monoclonal antibodies or chimeric human - mouse ( or other species ) monoclonal antibodies . human monoclonal antibodies may be made by any of numerous techniques known in the art ( e . g ., teng et al ., 1983 , proc . natl . acad . sci . u . s . a . 80 : 7308 – 7312 ; kozbor et al ., 1983 , immunology today 4 : 72 – 79 ; olsson et al ., 1982 , meth . enzymol . 92 : 3 – 16 ). chimeric antibody molecules may be prepared containing a mouse antigen - binding domain with human constant regions ( morrison et al ., 1984 , proc . natl . acad . sci . u . s . a . 81 : 6851 , takeda et al ., 1985 , nature 314 : 452 ). various procedures known in the art may be used for the production of polyclonal antibodies . for the production of tie2 activating antibodies , various host animals , including but not limited to rabbits , mice and rats can be immunized by injection with tie2 receptor extracellular domain , or a fragment or derivative thereof . various adjuvants may be used to increase the immunological response , depending on the host species , and including but not limited to freund &# 39 ; s ( complete and incomplete ), mineral gels such as aluminum hydroxide , surface active substances such as lysolecithin , pluronic polyols , polyanions , peptides , oil emulsions , keyhole limpet hemocyanins , dinitrophenol , and potentially useful human adjuvants such as bcg ( bacille calmette - guerin ) and corynebacterium parvum . a molecular clone of an antibody to a selected epitope can be prepared by known techniques . recombinant dna methodology ( see e . g ., maniatis et al ., 1982 , molecular cloning , a laboratory manual , cold spring harbor laboratory , cold spring harbor , n . y .) may be used to construct nucleic acid sequences which encode a monoclonal antibody molecule , or antigen - binding region thereof . the present invention provides for antibody molecules as well as fragments of such antibody molecules . antibody fragments which contain the idiotype of the molecule can be generated by known techniques . for example , such fragments include but are not limited to : the f ( ab ′) 2 fragment which can be produced by pepsin digestion of the antibody molecule ; the fab ′ fragments which can be generated by reducing the disulfide bridges of the f ( ab ′) 2 fragment , and the fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent . antibody molecules may be purified by known techniques , e . g ., immunoabsorption or immunoaffinity chromatography , chromatographic methods such as hplc ( high performance liquid chromatography ), or a combination thereof . the method of the invention also contemplates the use of antibody fragments directed against tie - 2 called single chain fvs . a single chain fv ( scfv ) is a truncated fab having only the v region of an antibody heavy chain linked by a stretch of synthetic peptide to a v region of an antibody light chain . see , for example , u . s . pat . nos . 5 , 565 , 332 ; 5 , 733 , 743 ; 5 , 837 , 242 ; 5 , 858 , 657 ; and 5 , 871 , 907 assigned to cambridge antibody technology limited incorporated by reference herein . ang1 , ang1 *, or ang1 - fd - fc - fd pharmaceutical compositions can be prepared . ang1 , ang1 *, or ang1 - fd - fc - fd - containing pharmaceutical compositions typically include a therapeutically effective amount of ang1 , ang1 *, or ang1 - fd - fc - fd combined with one or more pharmaceutically and physiologically acceptable formulation components selected for suitability with the mode of administration . suitable formulation components include , but are not limited to , preservatives , diluting agents , emulsifying agents , suspending agents , solvents , fillers , bulking agents , buffers , delivery vehicles , excipients and / or pharmaceutical adjuvants . by way of non - limiting example , a suitable delivery vehicle may be water for injection or physiological saline solution . buffered saline or saline mixed with serum albumin are other examples of suitable vehicles . the vehicle solvent may be either aqueous or non - aqueous . in addition , the vehicle may contain other pharmaceutically acceptable components for maintaining the ph , osmolarity , viscosity , stability , etc . the vehicle may contain additional pharmaceutically acceptable components for affecting the rate of release of ang1 , ang1 *, or ang1 - fd - fc - fd , or for promoting the absorption or penetration of ang1 , ang1 *, or ang1 - fd - fc - fd . once the therapeutic composition has been formulated , it may be stored as a solution , suspension , gel , emulsion , solid , or dehydrated , or lyophilized powder . such formulations may be stored either in a ready to use form or in a form requiring reconstitution or other manipulation prior to administration . the optimal pharmaceutical formulations will be determined by skilled artisans . such optimal formulations will depend upon , for example , route of administration and dosage . ( see , for example , remington &# 39 ; s pharmaceutical sciences , 18th ed . ( 1990 , mack publishing co ., easton , pa . 18042 ) pages 1435 – 1712 , the disclosure of which is hereby incorporated by reference ). the pharmaceutical composition also may be formulated for slow - release or sustained circulation formulations . it is also contemplated that certain formulations may be administered orally . ang1 , ang1 *, or ang1 - fd - fc - fd , which is administered orally , may be formulated as an elixir , tablet , capsule , or gel . the capsule may be designed to release the active portion of the formulation in the gastrointestinal tract when bioavailability is maximized and degradation is minimized . additional components may be included to facilitate absorption of ang1 , ang1 *, or ang1 - fd - fc - fd . such components include , but are not limited to , diluents , vegetable oils , lubricants , suspending agents , tablet disintegrating agents , and binders . the ang1 , ang1 *, or ang1 - fd - fc - fd may be administered parenterally via a subcutaneous , intramuscular , intravenous , intraarterial , intranasal , intrapulmonary , or intraperitoneal route . alternatively , ang1 , ang1 *, or ang1 - fd - fc - fd may be administered orally , or into specific areas of the gastrointestinal tract , or via rectal , transdermal or topical routes . the frequency of dosing will depend on the pharmacokinetic parameters of the ang1 , ang1 *, or ang1 - fd - fc - fd as formulated , and the route of administration used . the specific dose may be calculated according to considerations of body weight , body surface area , or organ size . further refinement of the calculations necessary to determine the appropriate dosage for treatment involving each of the above mentioned formulations and routes of administration is routinely made by those of ordinary skill in the art . appropriate dosages may be determined through the use of established assays for determining dosages utilized in conjunction with appropriate dose - response data . the final dosage regimen involved in a method for treating the above - described conditions will be determined by the attending physician , considering various factors which modify the action of drugs , e . g ., the age , condition , body weight , sex and diet of the patient , the severity of the disorder or disease , time of administration , and other clinical factors . as studies are conducted , further information will emerge regarding the appropriate dosage levels for the treatment of the various diseases and conditions . toxicity of the compounds described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals , e . g ., by determining the ld 50 ( the dose lethal to 50 % of the population ) or the ld 100 ( the dose lethal to 100 % of the population ). the dose ratio between toxic and therapeutic effect is the therapeutic index . compounds that exhibit high therapeutic indices are preferred . the data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in humans . the dosage of the compounds described herein lies preferably within a range of circulating concentrations that include the effective dose with little or no toxicity . the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized . the exact formulation , route of administration and dosage can be chosen by the individual physician in view of the patient &# 39 ; s condition . ( see , e . g ., fingl et al ., 1975 , in : the pharmacological basis of therapeutics , ch . 1 , p . 1 ). it should be noted that the attending physician would know how to and when to terminate , interrupt , or adjust administration due to toxicity , or to organ dysfunctions . conversely , the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate ( precluding toxicity ). the magnitude of an administrated dose in the management of the clinical disorder of interest will vary with the severity of the condition to be treated and the route of administration . the severity of the condition may , for example , be evaluated , in part , by appropriate prognostic evaluation methods . further , the dose and perhaps dose frequency , will also vary according to the age , body weight , and response of the individual patient . in addition to conventional treatment modalities and routes of administration such as those described supra , numerous methods exist for genetically engineering mammalian cells . there is great interest in genetically engineering mammalian cells for several reasons including the need to produce large quantities of various polypeptides and the need to correct various genetic or other defects in the cells or in tissues and organs . the methods differ dramatically from one another with respect to such factors as efficiency , level of expression of foreign genes , and the efficiency of the entire genetic engineering process . viral vectors are presently the most frequently used means for transforming cells and introducing dna into the genome . in an indirect method , viral vectors , carrying new genetic information , are used to infect target cells removed from the body , and these cells are then reimplanted . direct in vivo gene transfer into postnatal animals has been reported for formulations of dna encapsulated in liposomes and dna entrapped in proteoliposomes containing vital envelope receptor proteins ( nicolau et al ., proc . natl . acad sci usa 80 : 1068 – 1072 ( 1983 ); kaneda et al ., science 243 : 375 – 378 ( 1989 ); mannino et al ., biotechniques 6 : 682 – 690 ( 1988 ). positive results have also been described with calcium phosphate co - precipitated dna ( benvenisty and reshef proc . natl . acad sci usa 83 : 9551 – 9555 ( 1986 )). one method of genetically engineering mammalian cells that has proven to be particularly useful is by means of retroviral vectors . retrovirus vectors and their uses are described in many publications including mann , et al ., cell 33 : 153 – 159 ( 1983 ) and cone and mulligan , proc . natl . acad . sci . usa 81 : 6349 – 6353 ( 1984 ). retroviral vectors are produced by genetically manipulating retroviruses . retroviruses are rna viruses ; that is , the viral genome is rna . this genomic rna is , however , reverse transcribed into a dna copy that is integrated stably and efficiently into the chromosomal dna of transduced cells . retroviral vectors are particularly useful for modifying mammalian cells because of the high efficiency with which the retroviral vectors “ infect ” target cells and integrate into the target cell genome . additionally , retroviral vectors are highly useful because the vectors may be based on retroviruses that are capable of infecting mammalian cells from a wide variety of species and tissues . the ability of retroviral vectors to insert into the genome of mammalian cells have made them particularly promising candidates for use in the genetic therapy of genetic diseases in humans and animals . another commonly used viral vector system in the adeno - associated virus ( aav ). the broad host range , low incidence of immune response , and longevity of gene expression observed with this vector have enabled the initiation of several clinical trials using this gene delivery system . another potential benefit of using aav vectors is their ability to integrate in a site - specific manner when introduced in the presence of rep proteins . in addition , adenoviral vectors are used in many experimental settings to mimic acute administration of a protein of interest in vivo for the purpose of studying biological effects of the protein . subjects — male wistar - kyoto rats , 250 – 300 g , were double - housed in a temperature and humidity - controlled animal housing room . animals were maintained on a 12 : 12 light : dark cycle ( lights on 06 : 00 ). food and water were available ad libitum . systemic injections — animals that received pre - treatment with ang1 - fd - fc - fd were treated with 25 mg / kg ang1 - fd - fc - fd sub - cutaneously 48 hours prior to surgery , 24 hours prior to surgery , and the morning of surgery . surgeries to invasively monitor blood pressure were conducted approximately 4 hours after the last injection of ang1 - fd - fc - fd . blood pressure measurement — anesthesia was induced with 2 . 5 % isoflurane in oxygen . animals were then transferred to a nose cone delivering 1 . 5 – 2 % isoflurane . fur was shaved from the left inner thigh and from the right clavicular region . an incision was made in the inner aspect of the thigh , exposing the femoral vein and artery . the femoral artery was isolated and a silicone medical tubing was inserted into the artery . the tubing was filled with heparinized saline and was connected to a blood pressure transducer ( iitc ). after transduction , the signal was sent to a 4 - channel chart recorder ( linseis ) for continuous monitoring of pulse and systolic blood pressure . exact blood pressure values were calculated based on a calibrated standard determined in advance of the surgery using a sphygmomanometer . after blood pressure stabilized ( same value for 1 – 2 minutes ), animals were injected intravenously via the right jugular vein with either 10 μg vascular endothelial growth factor ( vegf ), 10 μg acidic fgf ( αfgf ), 5 mg l - name , or 40 μg ang1 - fd - fc - fd . studies were conducted as follow : 1 ) ang1 - fd - fc - fd s . c . pre - treatment followed by i . v . vegf 2 ) ang1 - fd - fc - fd s . c . pre - treatment followed by i . v . vegf or αfgf 3 ) ang1 - fd - fc - fd or vegf i . v . 4 ) i . v . ang1 - fd - fc - fd or vegf followed 1 – 24 hours later by repeat injection 5 ) i . v . l - name followed 6 minutes later by i . v . ang1 - fd - fc - fd or vegf 6 ) i . v . ang1 - fd - fc - fd or vegf followed 6 minutes later by i . v . l - name for each experiment , animals were monitored for 10 minutes after the last treatment administered . some animals were monitored for up to 3 hours to track the longevity of the ang1 - fd - fc - fd - induced hypotension . data analysis — the systolic blood pressure was determined for the point immediately prior to the first i . v . injection , and for every minute thereafter . because animals can have varying initial systolic blood pressures , blood pressures were then normalized to the starting initial blood pressure , which was defined as that which occurred just prior to injection of ang1 - fd - fc - fd , vegf , or αfgf i . v . normalized blood pressures were analyzed using a mixed factorial anova ( treatment × time ). in addition , initial systolic blood pressures were analyzed either by a student &# 39 ; s independent groups t - test or an independent groups anova , depending on the number of groups in each experiment . for all analyses , alpha was set at 0 . 05 . vegf - induced hypotension is attenuated by ang1 - fd - fc - fd : the precise mechanism of vegf - induced hypotension is unknown . it is known that vegf can mediate both vasodilation and vascular leak through a nitric oxide - mediated mechanism . because ang1 - fd - fc - fd has been previously shown to interfere with vegf - mediated vascular leak , applicant hypothesized that ang1 - fd - fc - fd would interfere with vegf - induced hypotension if some or all of the hypotension was caused by vascular leak . 12 animals were injected with ang1 - fd - fc - fd and 12 animals were injected with vehicle s . c . daily for 3 days before induction of vegf - induced hypotension . pre - treatment with ang1 - fd - fc - fd significantly attenuated vegf - induced hypotension ( f ( 1 , 22 )= 11 . 045 , p & lt ; 0 . 003 , fig1 ). initial systolic blood pressures were reduced in ang1 - fd - fc - fd animals , but not significantly so ( t ( 22 )=, p & gt ; 0 . 13 ). ang1 - fd - fc - fd blocks αfgf - induced hypotension : because ang1 - fd - fc - fd significantly attenuated vegf - induced hypotension , applicant theorized that much of vegf &# 39 ; s hypotensive effect is caused by vascular leak . however , it was difficult to be certain about this conclusion in the absence of a negative control . like vegf , both acidic and basic fgf cause acute hypotension when injected in an i . v . bolus . in addition , this hypotension is thought to result from nitric oxide - mediated vasodilation , one of the mechanisms proposed to contribute to vegf - induced hypotension . unlike vegf , fgf has been shown not to induce vascular leak . therefore , applicant pre - treated animals with ang1 - fd - fc - fd or vehicle s . c . daily for 3 days before inducing hypotension with vegf or αfgf . once again , ang1 - fd - fc - fd reduced vegf &# 39 ; s hypotensive effects . contrary to applicant &# 39 ; s expectations , ang1 - fd - fc - fd dramatically interfered with fgf - induced hypotension . ang1 - fd - fc - fd &# 39 ; s effects were again statistically significant ( f ( 1 , 11 )= 5 . 094 , p & lt ; 0 . 05 , fig2 ). therefore , it seemed unlikely that ang1 - fd - fc - fd &# 39 ; s reduction of vegf - induced hypotension was entirely the result of decreased vascular leak . ang1 - fd - fc - fd induces hypotension : acute administration of vegf i . v . induces acute hypotension which recovers within 20 – 60 minutes . however , additional attempts to re - induce hypotension with vegf fail for several hours after the initial reduction , suggesting that some of the actions of either vegf or of hypotension remain in place for a period of time . these could include reduced receptor availability because of receptor turnover or the induction of compensatory mechanisms . because ang1 - fd - fc - fd interfered both with vegf and fgf - induced hypotension , applicants considered the possibility that ang1 - fd - fc - fd itself was inducing hypotension , which then rendered the system refractory to attempts to induce hypotension with vegf or fgf . when ang1 - fd - fc - fd was acutely administered in a 40 μg i . v . bolus , significant hypotension developed ( f ( 3 , 11 )= 7 . 723 , p & lt ; 0 . 005 , fig3 ). further , unlike both vegf and fgf , ang1 - fd - fc - fd was acutely longer - lasting hypotension . several animals were monitored for up to 3 hours after ang1 - fd - fc - fd administration , and it was discovered that the approximately 15 – 20 % decrease in blood pressure was maintained throughout this time . ang1 - fd - fc - fd pre - treatment interferes with ang1 - fd - fc - fd - induced hypotension : to confirm that ang1 - fd - fc - fd could induce a hypotension refractory state as vegf can , applicants administered ang1 - fd - fc - fd i . v . 4 hours and 24 hours before inducing hypotension with ang1 - fd - fc - fd . ang1 - fd - fc - fd administered 4 hours after an initial injection of ang1 - fd - fc - fd resulted in markedly decreased or no hypotension . 24 hours after ang1 - fd - fc - fd , ang1 - fd - fc - fd reliably induced hypotension , but the magnitude of the hypotension still tended to be reduced . the refractory state induced by ang1 - fd - fc - fd was statistically significant ( f ( 6 , 13 )= 5 . 985 , p & lt ; 0 . 004 , fig4 ). interestingly , ang1 - fd - fc - fd resulted in significantly decreased initial systolic blood pressure 4 hours after injection , but not 24 hours after injection when it still reduced induced hypotension ( fig5 ). therefore , ang1 - fd - fc - fd does induce a refractive state that reduced the magnitude of future inductions that occur within about a day of the initial hypotensive event . ang1 - fd - fc - fd - induced hypotension is nitric oxide - dependent : both vegf and fgf have been shown to mediate hypotension via nitric oxide - mediated mechanisms . nitric oxide has been shown to be a potent vasodilatory stimulus , and hence , at least a portion of the reason for decreased blood pressure is probably increased vascular volume . because ang1 - fd - fc - fd shows similar hypotension , and has been shown to be involved in at least chronic vascular enlargement , we decided to investigate the possibility that ang1 - fd - fc - fd acts via nitric oxide - mediated mechanisms . some animals were pre - treated i . v . with 5 mg of the nitric oxide inhibitor l - name 6 minutes before i . v . injection of ang1 - fd - fc - fd to determine if l - name could prevent ang1 - fd - fc - fd - induced hypotension . other animals were pre - treated i . v . with 5 mg of l - name 6 minutes after i . v . injection of ang1 - fd - fc - fd to determine if nitric oxide inhibition could reverse ang1 - fd - fc - fd - induced hypotension . both pre - and post - treatment with l - name significantly interfered with ang1 - fd - fc - fd - induced hypotension ( f ( 5 , 31 )= 3 . 542 , p & lt ; 0 . 02 , fig6 and fig7 ), suggesting that ang1 - fd - fc - fd causes its hypotensive effect via a nitric oxide - mediated mechanism . subjects — male wistar - kyoto control rats and male spontaneously hypertensive rats ( shr ), 250 – 350 g , were double - housed in a temperature and humidity - controlled animal housing room . animals were maintained on a 12 : 12 light : dark cycle ( lights on 06 : 00 ). food and water were available ad libitum . systemic injections — animals that received ang1 - fd - fc - fd systemically before acute blood pressure measurements were injected with either 25 mg / kg ang1 - fd - fc - fd or hfc sub - cutaneously 24 hours prior to acute intra - venous injection of vegf or ang1 - fd - fc - fd . animals that received ang1 - fd - fc - fd systemically during continuous blood pressure monitoring received a single sub - cutaneous injection of ang1 - fd - fc - fd at 5 mg / kg . acute blood pressure measurement — anesthesia was induced with 2 . 5 % isoflurane in oxygen . animals were then transferred to a nose cone delivering 1 . 5 – 2 % isoflurane . fur was shaved from the left inner thigh and from the right clavicular region . an incision was made in the inner aspect of the thigh , exposing the femoral vein and artery . the femoral artery was isolated and a silicone medical tubing was inserted into the artery . the tubing was filled with heparinized saline and was connected to a blood pressure transducer ( iitc ). after transduction , the signal was sent to a 4 - channel chart recorder ( linseis ) for continuous monitoring of pulse and systolic blood pressure . exact blood pressure values were calculated based on a calibrated standard determined in advance of the surgery using a sphygmomanometer . after blood pressure stabilized ( same value for 1 – 2 minutes ), animals were injected intravenously via the right jugular vein with either 10 μg vascular endothelial growth factor ( vegf ) or 40 μg ang1 - fd - fc - fd . studies were conducted as follow : 1 ) 15 μg ( equimolar hfc to ang1 - fd - fc - fd ) i . v . hfc in wistar - kyoto rats 2 ) 10 μg i . v . vegf in wistar - kyoto rats 3 ) 40 μg i . v . ang1 - fd - fc - fd in wistar - kyoto rats 4 ) 15 μg i . v . hfc in shrs 5 ) 10 μg i . v . vegf in shrs 6 ) 40 μg i . v . ang1 - fd - fc - fd in shrs for each experiment , animals were monitored for 10 minutes after the acute i . v . bolus . chronic blood pressure measurements — shr rats were chronically implanted with telemetry transmitters to send continuous hemodynamic data to a computer using data sciences dataquest gold acquisition software . animals were anesthetized with isoflurane ( 2 . 5 – 3 % induction and 1 . 5 – 2 % maintenance ) in 100 % oxygen , and the wound site was shaved , cleaned , and treated with povidone iodine . an incision was made along the midline in the animal &# 39 ; s abdomen , taking care not to damage any internal organs . the descending aorta was dissected out and a piece of silk suture was placed around the end of the aorta closest to the renal artery . pressure was applied to the aorta with the silk suture to prevent blood flow temporarily , and a bent bevel - tipped needle was used to introduce the blood pressure catheter portion of the radiotransmitter into the aorta . the catheter was secured to the aorta with veterinary tissue adhesive . the transmitter was secured to the inner wall of the abdomen with silk suture , and the abdomen was closed with wound clips . animals were allowed to recover from radiotransmitter implants for at least 2 weeks before measurements were taken . blood pressure recordings were taken for 24 hours prior to injection of ang1 - fd - fc - fd to establish a baseline . all animals were then injected with 5 mg / kg ang1 - fd - fc - fd s . c . the 5 mg / kg dose was used in this experiment due to a protein shortage ; however , the typical dose of 25 mg / kg would be expected to produce a larger effect . animals were then monitored for an additional week . data analysis — for the acute study , the systolic blood pressure was determined for the point immediately prior to the first i . v . injection , and for every minute thereafter . because animals can have varying initial systolic blood pressures , blood pressures were then normalized to the starting initial blood pressure , which was defined as that which occurred just prior to injection of ang1 - fd - fc - fd , vegf , or hfc i . v . normalized blood pressures were analyzed using a mixed factorial anova ( treatment × time ). for the chronic study , real blood pressures were averaged for each 10 minute time point into 3 - hour bins . analysis of the effect of ang1 - fd - fc - fd was conducted using a repeated measures factorial anova ( treatment phase × time ). for all analyses , alpha was set at 0 . 05 . acute blood pressure studies — both vegf and ang1 - fd - fc - fd significantly reduced blood pressure in both wistar - kyoto control rats and shrs . the hfc control protein did not reduce blood pressure in either strain . ang1 - fd - fc - fd produced a significant 40 % decrease in blood pressure in shrs , bringing their systolic blood pressure from a mean of 186 . 7 mmhg to 127 . 5 mmhg within 10 minutes of acute i . v . bolus ( the mean normal blood pressure of wistar - kyoto control rats was 101 . 2 mmhg ; effect of treatment f ( 2 , 15 )= 6 . 033 , p & lt ; 0 . 01 )). the decrease in blood pressure obtained with ang1 - fd - fc - fd was maintained throughout the measurements ( fig8 ). chronic blood pressure studies — fig9 illustrates systolic blood pressures in telemetered shrs for the 24 hours prior to injection with ang1 - fd - fc - fd ( pre ), the 24 hours immediately after injection with ang1 - fd - fc - fd ( tx ), and the following day ( 24 – 48 hours after injection , post ). despite the low dose used ( 5 mg / kg ), ang1 - fd - fc - fd significantly ameliorated the hypertension in the shrs within the first 3 hours after s . c . injection ( f ( 2 , 9 )= 4 . 387 , p & lt ; 0 . 05 ). this decrease in blood pressure was maintained for 3 days after injection ( first 2 shown on graph ). hence , systemic injection of ang1 - fd - fc - fd resulted in prolonged and significant decreases in blood pressure in hypertensive rats , even at a low dose . the following is a summary of the novel findings of the subject invention : 1 ) tie - 2 activators , for example ang1 - fd - fc - fd , induce drops in blood pressure in normal and hypertensive animals 2 ) tie - 2 activator - induced hypotension is long - lasting and mild to moderate 3 ) tie - 2 activator - induced hypotension is nitric oxide - mediated thus , based on these novel findings , tie2 activators , for example ang1 - fd - fc - fd , may be useful in treating diseases of the vascular system including , but not limited to , hypertension , ischemia , and vascular insufficiencies such as penile erectile dysfunction . the present invention is not to be limited in scope by the specific embodiments described herein . indeed , various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures . such modifications are intended to fall within the scope of the appended claims . | 0 |
neuropeptide y ( npy ) is a 36 - amino - acid neurotransmitter widely present in the central and peripheral nervous systems . npy has multiple actions , which control body energy balance and cardiovascular function . we have recently demonstrated that the subjects having pro7 in the signal peptide of npy have higher serum cholesterol and apolipoprotein b levels when compared to individuals having wildtype ( leu7 / leu7 ) signal peptide sequence . neuropeptide y ( npy ) plays an important role in the hypothalamic regulation of food intake and energy balance . according to recent findings in animals , npy also appears to be a potent regulator of alcohol consumption . we used recently identified leu ( 7 ) to pro ( 7 ) polymorphism in the signal peptide part of npy to investigate wheter the npy system is associated with alcohol consumption in humans . the subjects ( n = 889 ) were an ethnically homogenous , unselected population sample of middle - aged men from eastern finland . the gene variant producing pro ( 7 ) substitution was associated with a 34 % higher average alcohol consumption , even following adjustment for a number of covariates ( p = 0 . 03 ). the proportion of heavy drinkers ( over 230 grams of ethanol / week ) was also somewhat higher in this group ( 13 . 1 % vs . 8 . 2 %, p = 0 . 10 ). our study provides the first evidence that alcohol preference in humans is likely to be regulated by the npy system . the dna sequence or the mutant signal peptide or said peptide associated with any other cleavage product of prepronpy can be used for screening a subject to determine if said subject is a carrier of a mutant npy gene . the determination can be carried out either as a dna analyse according to well known methods , which include direct dna sequencing of the normal and mutated npy gene , allele specific amplification using the polymerase chain reaction ( pcr ) enabling detection of either normal or mutated npy sequence , or by indirect detection of the normal or mutated npy gene by various molecular biology methods including e . g . pcr - single stranded conformation polymorphism ( sscp )- method or denaturing gradient gel electrophoresis ( dgge ). determination of the normal or mutated npy gene can also be done by using restriction fragment length polymorphism ( rflp )- method , which is particularly suitable for genotyping large number of samples . the determination can also be carried out at the level of rna by analysing rna expressed at tissue level using various methods . allele spesific probes can be designed for hybridization . hybridization can be done e . g . using northern blot , rnase protection assay or in situ hybridization methods . rna derived from the normal or mutated npy gene can also be analysed by converting tissue rna first to cdna and thereafter amplifying cdna by an allele spefic pcr - method and carrying out the analysis as for genomic dna as mentioned above . alternatively , the determination can be carried out as an immunoassay where a sample is contacted with an antibody capable of binding the signal peptide or said peptide associated with any other cleavage product of prepronpy . antibodies can be raised against normal or mutated prepronpy or more specifically against normal or mutated signal peptide part of the npy . the production of antibodies can be done in experimental animals in vivo to obtain polyclonal antibodies or in vitro using cell lines to obtain monoclonal antibodies . a person diagnosed for having a risk for the development of alcoholism can be treated for the prevention of developing said condition by administering to said person an effective amount of an agent counteracting the influence of the mutated npy gene . this can be done by specific gene therapy aimed to repair the mutated npy sequence , or by administering pharmacotherapies , which are aimed to modulate synthesis , release or metabolism of the endogenous npy , or to interact in a specific manner at npy target sites by modulating effects of npy with specific npy receptor proteins . currently , five different subtypes of npy receptors have been cloned and characterized ( y1 - y5 receptors ) and drug molecules specifically interacting with these npy receptors have been synthesized . the pharmacotherapy described is not limited to only these named receptors or mechanisms , but also covers other npy receptors and related mechanisms to be discovered including the secretion of npy . the influence of the mutated npy gene in a patient can be counteracted by using an antisense therapy or gene switching or replacement , which includes targeted correction of disease - related mutation or site - directed inactivation of the mutant allele by homologous recombination . the antisense therapy refers to methods designed to impair translation through direct interactions with target messenger rna ( mrna ). this can be accomplished by applying a targeted oligonucleotide , which forms watson - crick base pairs with the messenger rna whose function is to be disrupted . the inhibition of gene expression by antisense oligonucleotide depends on the ability of an antisense oligonucleotide to bind a complementary mrna sequence and prevent the translation of the mrna . it is possible to correct a single mutant base in a gene by using an oligonucleotide based strategy ( giles et al ., 1995 ; schwab et al ., 1994 ; yoon et al ., 1996 ). a short , 7 or 8 bases , oligonucleotide is enough to posses an antisense activity and specificity , which depends greatly on the flanking sequences of the target rna . binding should be enough to promote stable binding and rnase h — mediated cleavage . the influence of the mutated npy gene is preferably counteracted by using a short , allele specific oligonucleotide , which includes the sequence of mutated part : . . . cga ct / cg ggg . . . . this can be accomplished by using oligonucleotides of various lengths , but all recognizing the mutated base sequence . according to the predicted secondary structure of the prepronpy mrnas ( schemes 1 and 2 ), the best target sequence is between − 9 and + 2 bases around the mutation i . e . sequence targeting to 3 ′- ac aag cga ctg g - 5 ′. this sequence contains ‘ bulbs ’ which are known to enhance the binding of oligonucleotide to the target mrna . it is possible to use unmodified oligonucleotides , but to increase their stability , nuclease resistance , and penetration to the nucleus , several modifications of oligonucleotide can be used . a relatively large number of modified pyrimidines have been synthesized , mainly c - 2 , c - 4 , c - 5 , and c - 6 sites , and incorporated into nucleotides . also purine analogs can be synthesized and incorporated into oligonucleotides . the 2 ′ position of the sugar moiety , pentofuranose ring , is substituted with methoxy , propoxy , o - alkoxy or methoxyethoxy groups . a new backbone for oligonucleotides that replace the phosphate or the sugar - phosphate unit has been made , like c - 5 propynylpyrimidine - modified phosphothioate oligonucleotides . also chimeric oligonucleotides with 5 ′- and 3 ′- ends are modified with internucleotide linkages , like methylphosphorothioate , phosphodiester , or methylphosphonate can be used . a relatively new technique is conformationally restricted lna ( locked nucleic acid ) oligonucleotides and peptide nucleic acids . bioengineered ribozymes are structurally different , but their specificity also relay on the recognition of the targeted mrna sequence . gene replacement or gene switching techniques inactivate the mutated gene sequence and introduce a corrected one . this can be accomplished by transfecting exogenous gene with normal coding sequence and blocking mutant coding sequence with antisense oligonucleotide . also a technique with only introducing a corrected normal sequence without disrupting the mutated sequence could be use . this could be used in heterozygous cells i . e . cell carrying one normal allele and one mutated allele resulting in an overexpression of normal alleles . also homozygous mutant cells could be treated resulting in a dominant positive — effect i . e . the normal allele is expressed in higher degree than the mutant allele . influence of the mutated npy sequence on the funtion of npy gene can be investigated in transgenic animals . a transgenic animal can be generated using targeted homologous recombination methodology . both normal and mutated sequence of human npy signal peptide ( or any dna sequence comprising a nucleotide sequence encoding a prepro - neuropeptide y ( prepronpy ) or part thereof encoding the amino acid sequence of the mature mouse or human mature npy peptide , where either i ) the leucine amino acid in position 7 of the signal peptide part of said prepronpy has been replaced by proline or ii ) the leucine amino acid in position 7 of the signal peptide part of said prepronpy is unchanged ) will be introduced into the sequence of npy gene to replace the endogenous signal peptide sequence . under these conditions , the endogenous npy gene functions otherwise normally , but the synthesis of the prepronpy is regulated by either normal or mutated human npy signal peptide sequence . this transgenic model can be used to investigate in a very specific manner the physiological importance of the mutated npy gene . it also will provide an ideal preclinical model to investigate and screen new drug molecules , which are designed to modify the influence of the mutated npy gene . the study population consisted of the participants of the kuopio ischemic heart disease risk factor study ( kihd ), a population - based epidemiologic study that was launched in the 1980 &# 39 ; s to investigate previously unestablished risk factors for myocardial infarction , progression of atherosclerosis , and other major health outcomes in middle - aged men [ salonen , 1988 ; lakka et al ., 1994 ]. the study protocol has been approved by the research ethics committee of the university of kuopio , and all participants gave a written informed consent to participate in kihd . the total sample of the kihd study consists of 2 , 682 men who were recruited in two cohorts . the present study is based on the second cohort , which is an age - stratified sample of 42 -, 48 , 54 -, and 60 year - old men ( n = 1 , 516 , participation rate 82 . 6 %) enrolled in the study between 1986 and 1989 . a dna sample was obtained for 1 , 137 men who were free from coronary heart disease at baseline . a self - report quantity - frequency questionnaire [ kauhanen et al ., 1997a ; kauhanen et al ., 1997b ] was used to record the level of alcohol use . the average weekly consumption of alcohol in pure ethanol ( grams / week ) was calculated based on the known alcoholic content of each beverage type and the reported doses and frequencies of drinking sessions . we further calculated the proportion of heavy users consisting of those whose average daily consumption exceeded 3 standard doses (& gt ; 230 grams of ethanol / week ). one dose is a 12 fl ounze bottle of beer , 12 cl of wine , or a 4 cl shot of hard liquor . serum gamma - glutamyltranspeptidase ( ggt ) and mean corpuscular volume ( mcv ) were determined from baseline blood samples as biomarkers of excessive alcohol use . these biochemical measures were checked to see if any of the genotype groups showed biochemical signs of actual alcohol abuse . men who told they had not been drinking at all for at least 12 months were determined as abstainers ( n = 123 , a total 12 . 1 %). since abstainers are a heterogenous group consisting of those who have quit because of health problems , they were excluded from final analyses . a number of sociodemographic , behavioral and medical characteristics were assessed according the kihd protocol as described earlier [ salonen , 1988 ; lakka et al ., 1994 ; kauhanen et al ., 1997a ]. age , place of living ( urban / rural ), marital status , educational level , current income , history of smoking in cigarette - years , and history of diagnosed chronic diseases and conditions ( ischemic heart disease , diabetes , stroke , cancer , liver disease , mental disorder ) and history of trauma were recorded by a questionnaire and double - checked in the clinical interview . the data were used to examine the possible effect of confounding in the observed relationship . prepronpy genotype was determined by restriction fragment length polymorphism ( rflp ) analysis from dna extracted from the subjects &# 39 ; peripheral blood by an investigator unaware of phenotype . briefly , the polymorphism appears as a thymidine ( 1128 ) to cytosine ( 1128 ) substitution generating a bsi ei restriction site , which was used to genotype the subjects for the leu7pro polymorphism , as described previously [ karvonen et al ., 1998 ]. the pcr products were digested by bsi el [ new england biolabs , inc . beverly , mass ., usa ] and digestions were analyzed by electrophoresis on 2 % agarose gel . the allelic frequency distribution was tested for hardy - weinberg equilibrium by the x 2 - test . statistical differences in the mean weekly alcohol consumption between the genotype groups were examined in the analysis of variance . age and other covariates were adjusted for in analysis of covariance . the proportion of heavy drinkers in the genotype groups was compared using a chi - square test . p - values less than 0 . 05 obtained from the statistical tests were interpreted as statistically significant . statistical computations were performed using the spss software for ibp rs / 6000 [ spss for unix , spss inc ., chicago , usa ]. the analysis of the leu ( 7 )- to pro ( 7 ) polymorphism in the signal peptide part of the pre - pro - npy and complete information on alcohol use was available for 889 alcohol using men . of these , 790 ( 88 . 9 %) were genotyped as leu ( 7 )/ leu ( 7 ) homozygous , a total of 95 ( 10 . 7 %) were leu ( 7 )/ pro ( 7 ) heterozygous , and 4 ( 0 . 4 %) were pro ( 7 )/ pro ( 7 ) homozygous . the allele frequencies were 94 . 2 % ( leu ) and 5 . 8 % ( pro ). all men carrying either one or two pro ( 7 ) alleles were pooled for further analyses . the study population was in hardy - weinberg equilibrium ( chi 2 = 0 . 585 , 1 d . f ., p = 0 . 44 ). table i shows sociodemographic and behavioral background characteristics , and the proportion of men with diagnosed diseases in the two npy genotype groups . there were no differences in the serum level of gamma glutamyl transpeptidase ( ggt ) or mean corpuscular volume ( mcv ) between genotypes . the means and standard deviations of ggt were 29 . 0 u / l ( sd 29 . 4 ) among leu ( 7 )/ leu ( 7 ) homozygotes and 29 . 7 u / l ( 26 . 0 ) among those with pro ( 7 ) ( p = 0 . 83 ). for mcv the means and standard deviations were 92 . 0 fl ( sd 4 . 52 ) and 92 . 0 fl ( sd 4 . 0 ), respectively ( p = 0 . 93 ). the alcohol consumption in grams of pure ethanol per week is presented in table ii . both the unadjusted mean consumption and the covariate - adjusted consumption were significantly ( 33 percent ) higher among men who were carriers of pro ( 7 ). the proportion of heavy drinkers ( men who reported drinking on average over 230 grams of ethanol / week or over 3 standard doses / day ) was also higher among men with a pro ( 7 ) substitution ( 13 . 1 % vs . 8 . 2 %) ( p = 0 . 10 ). table i means ( standard deviations ) and proportions of background variables by the npy genotype . leu ( 7 ) homozygotes pro ( 7 ) carriers ( n = 790 ) ( n = 99 ) age ( years ) 56 . 1 ( sd 6 . 7 ) 56 . 1 ( sd 6 . 9 ) living in rural area 21 . 8 % 27 . 0 % annual income 24 , 130 ( sd 15 , 918 ) 26 , 862 ( sd 14 , 771 ) ( us $) educational level 2 . 05 ( sd 1 . 75 ) 2 . 13 ( sd 1 . 92 ) ( 1 = low , 7 = high ) married 87 . 1 % 86 . 9 % cigarette smoking 141 . 3 ( sd 292 . 1 ) 147 . 4 ( sd 311 . 7 ) ( pack - years ) ischemic heart 21 . 1 % 13 . 1 % disease diabetes 5 . 6 % 5 . 1 % history of cancer 2 . 4 % 5 . 1 % history of stroke 2 . 6 % 1 . 0 % liver disease 0 . 4 % 1 . 0 % history of mental 4 . 6 % 6 . 1 % disorder history of trauma 10 . 4 % 10 . 2 % [ 0046 ] table ii mean weekly alcohol consumption in pure ethanol according to the npy genotype . leu ( 7 ) homozygotes pro ( 7 ) carriers ( n = 790 ) ( n = 99 ) p - value unadjusted mean alcohol 86 . 3 ( sd 127 . 6 ) 115 . 0 ( sd 0 . 030 consumption ( g / wk ) 173 . 9 ) mean alcohol 86 . 4 114 . 7 0 . 035 consumption ( g / wk ) adjusted for all covariates * we observed an increased alcohol consumption in a population sample of middle - aged men who were homozygous or heterozygous for the variant allele in a common polymorphism substituting leu ( 7 ) by pro ( 7 ) in the signal peptide part of neuropeptide y ( npy ). presence of pro ( 7 ) was associated with approximately one - third ( 33 %) higher average consumption of ethanol as compared to homozygous subjects with the leu ( 7 )/ leu ( 7 ) genotype . the proportion of heavy consumers who report using over 230 grams of ethanol / week was also higher among men with pro ( 7 ) mutation , although this difference did not reach statistical significance due to smaller numbers of subjects . our study is the first one to show a relationship between a common npy polymorphism and alcohol use in humans . the results are in line with the findings from a number of recent animal studies [ ehlers et al ., 1998a ; ehlers et al ., 1998b ; thiele et al ., 1998 ; cockerill , 1998 ; tecott and heberlien , 1998 ] that have shown an inverse relationship between levels of npy in central nervous system and preference for alcohol . mice with no neuropeptide y are especially fond of alcohol and less sensitive to the effects of ethanol as compared to mice that have normal or extra neuropeptide y levels [ thiele et al ., 1998 ], and alcohol - preferring rats have lower levels of npy in amygdala , hippocampus , and frontal cortex [ ehlers et al ., 1998a ]. the allele frequencies in our study were close to those seen earlier in two finnish populations [ karvonen et al ., 1998 ]. it is highly unlikely that the observed association could be due to a stratification error in sampling , or population admixture , since finns are known to be genetically a rather homogenous population . many sociodemographic factors are known determinants of alcohol use . in our study the social background among men with and without pro ( 7 ) was similar . the two groups were of the same age and had similar educational background . slightly more men with pro ( 7 ) were living in rural communities , and this group also had a little higher average income . smoking history was similar in both groups . it was somewhat unexpected to observe a higher prevalence of ischemic heart disease history among the leu ( 7 ) homozygotes , since earlier findings have shown this genotype to associate with lower serum levels of total and ldl choclesterol [ karvonen et al ., 1998 ]. adjustment for all these variables in the multivariate model did not affect the observed association between the npy polymorphism and alcohol consumption , indicating that these variables did not confound the findings . there are several physiologically plausible mechanisms that can explain the effect of npy on alcohol use . npy is an inhibitory neuromodulator that acts widely in the brain . the npy receptors couple to heterotrimeric g proteins that inhibit production of cyclicamp [ thiele et al ., 1998 ; lamme , 1995 ], so it is possible that npy inhibits camp production in response to alcohol , thus limiting alcohol intake . central administration of npy reduces anxiety , and npy - deficient mice score high on measures of anxiety [ heilig et al ., 1992 ; palmiter et al ., 1998 ]. the development of alcohol preference may in part depend on the relative lack of tension - reducing npy . chronic exposure to ethanol in rats affects npy levels in hypothalamus in a fashion similar to food restriction [ ehlers et al ., 1998a ]. npy has an important role in the hypothalamic regulation of energy balance by potently stimulating short - term food intake [ clark et al ., 1985 ; levine and morley , 1985 ; stanley and leibowitz , 1985 ]. centrally administered npy also increases the expression of lipoprotein lipase mrna and enhances the enzyme activity in white fat favoring lipid storage [ billington et al ., 1991 ; billington et al ., 1994 ]. thus , npy might unspecifically affect the consummatory behaviors regarding both food intake and alcohol drinking . however , there is a lack of npy transgene expression in the arcuate nucleus of the hypothalamus , a region thought to regulate food intake [ thiele et al ., 1998 ; palmiter et al ., 1998 ]. this indicates that the effects of npy on alcohol use are probably not mediated through similar mechanisms as with food and calorie intake . to our knowledge , there is only one earlier human study examining the possible relationship between neuropeptide y and addictions . roy and coworkers [ 1990 ] did not observe significant differences of cerebrospinal fluid ( cfs ) levels of npy between male alcoholics and normal controls . alcoholics , however , do not represent the population at large . it is also unclear , whether the cfs levels of npy reflect the activity of this peptide in the physiologically important locations of the central nervous system . plasma npy is derived from sympathetic nerve terminals and thus levels of npy in plasma reflect the level of sympathetic activity [ lundberg et al ., 1990 ]. significant positive correlations have been observed between levels of npy and corticotropin - releasing hormone , somatostatin , and growth hormone in cerebrospinal fluid [ roy et al ., 1990 ]. based on these studies and on our findings , further research on the possible sympathetic nervous system mechanisms in drinking behavior is warranted . it will be appreciated that the methods of the present invention can be incorporated in the form of a variety of embodiments , only a few of which are disclosed herein . it will be apparent for the specialist in the field that other embodiments exist and do not depart from the spirit of the invention . thus , the described embodiments are illustrative and should not be construed as restrictive . ault d t , radeff j m , werling l l . 1998 . modulation of ( 3h ) dopamine release from rat nucleus accumbens by neuropeptide y may involve a sigma 1 - like receptor . j pharmacol exp ther 284 : 553 - 560 . billington c j , briggs j e , grace m , levine a s . 1991 . effects of intracerebroventricular injection of neuropeptide y on energy metabolism . am j physiol 260 : r321 - r327 . billington c j , briggs j e , harker s , grace m , levine a s . 1994 . neuropeptide y in hypothalamic paraventricular nucleus : a center coordinating energy metabolism . am j physiol 266 : r1765 - r1770 . clark j t , kalra p s , kalra s p . 1985 . neuropeptide y stimulates feeding but inhibits sexual behavior in rats . endocrinology 117 : 2435 - 2442 . cockerill m . 1998 . low levels of brain chemicals drives mice to drink . brit med j 317 : 1544 . ehlers c l , li t k , lumeng l , hwang b h , somes c , jimenez p , mathe a a . neuropeptide y levels in ethanol - naive alcohol - preferring and nonpreferring rats and in wistar rats after ethanol exposure . 1998a . alcohol clin exp res 8 : 1778 - 1782 . ehlers c l , somes c , cloutier d . 1998b . are some of the effects of ethanol mediated through npy ? psychopharmacology 139 : 136 - 144 . gray t s , morley j e . 1986 . neuropeptide y : anatomical distribution and possible function in mammalian nervous system . nature 38 : 389 - 401 . heilig m , mcleod s , koob g k , britton k t . 1992 . anxiolytic - like effect of neuropeptide y ( npy ), but not other peptides in an operant conflict test . regul pept 41 : 61 - 69 . jewett d c , cleary j , levine a s , schaal d w , thompson t . 1992 . effects of neuropeptide y on food - reinforced behavior in satiated rats . pharmacol biochem behav 42 : 207 - 212 . karvonen m k , pesonen u , koulu m , niskanen l , laakso m , rissanen a , dekker j m , hart l m , valve r , uusitupa m i j . 1998 . association of a leucine ( 7 )- to - proline ( 7 ) polymorphism in the signal peptide of neuropeptide y with high serum cholesterold and ldl cholesterol levels . nature med 4 : 1434 - 1437 . kauhanen j , kaplan g a , goldberg d e , salonen j t . 1997a . beer binging and mortality : results from the kuopio ischaemic heart disease risk factor study , a prospective population based study . brit med j 315 : 846 - 851 . kauhanen j , kaplan g a , goldberg d , cohen r d , lakka t a , salonen j t . 1997b . frequent hangovers and carciovascular mortality in middle - aged men . epidemiology 8 : 310 - 314 . lakka t a , venäläinen j m , rauramaa r , salonen r , tuomilehto j , salonen j t . 1994 . relation of leisure - time physical activity and cardiorespiratory fitness to the risk of acute myocardial infarction in men . n engl j med 330 : 549 - 1554 . lamme v a f . 1995 . the neurophysiology of figure - ground segregation in primary visual cortex . j neurosci 15 : 1605 - 1615 . levine a s , morley j e . 1985 . neuropeptide y : a potent inducer of consummatory behavior in rats . peptides 5 : 1025 - 1029 . lundberg j m , terenius l , hokfelt t , martling c r , tatemoto k , mutt v , polak j , bloom s , goldstein m . 1982 . neuropeptide y ( npy )- like immunoreactivity in peripheral noradrenergic neurons and effects of npy on sympathetic function . acta physiol . scand 116 : 477 - 480 . lundberg j m , franco - cereceda a , hemsen a , lacroix j s , pernow j . 1990 . pharmacology of noradrenaline and neuropeptide tyrosine ( npy )- mediated sympathetic cotransmission . fundam clin pharmacol 4 : 373 - 391 . palmiter r d , erickson j c , hollopeter g , baraban s c , schwartz m w . 1998 . life without neuropeptide y . recent prog horm res 53 : 163 - 199 . roy a , berrettini w , dejong j , adinoff b , ravitz b , linnoila m . 1990 . csf neuropeptide y in alcoholics and normal controls . psychiatry res 33 : 215 - 219 . salonen j t . 1988 . is there a continuing need for longitudinal epidemiologic research ? the kuopio ischemic heart disease risk factor study . ann clin res 20 : 46 - 50 . stanley b g , leibowitz s f 1985 . neuropeptide y injected in the paraventricular hypothalamus : a powerful stimulant of feeding behavior . proc natl acad sci usa 82 : 3940 - 3943 . stewart r b , gatto g j , lumeng l , li t - k , murphy j m . 1993 . comparison of alcohol - preferring ( p ) and nonpreferring ( np ) rats on tests of anxiety and for the anxiolytic effects of alcohol . alcohol 10 : 1 - 10 . tecott l h , heberlein u . 1998 . y do we drink ? cell 95 : 733 - 735 . thiele t e , marsh d j , ste marie l , bernstein i l , palmiter r d . 1998 . ethanol consumption and resistance are inversely related to neuropeptide y levels . nature 396 : 366 - 369 . ccagccacgc ccgcgcgcca gccacc atg cta ggt aac aag cga ctg ggg ctg 113 tcc gga ctg acc ctc gcc ctg tcc ctg ctc gtg tgc ctg ggt gcg ctg 161 gcc gag gcg tac ccc tcc aag ccg gac aac ccg ggc gag gac gca cca 209 gcg gag gac atg gcc aga tac tac tcg gcg ctg cga cac tac atc aac 257 ala glu asp met ala arg tyr tyr ser ala leu arg his tyr ile asn ctc atc acc agg cag aga tat gga aaa cga tcc agc cca gag aca ctg 305 leu ile thr arg gln arg tyr gly lys arg ser ser pro glu thr leu att tca gac ctc ttg atg aga gaa agc aca gaa aat gtt ccc aga act 353 ile ser asp leu leu met arg glu ser thr glu asn val pro arg thr cgg ctt gaa gac cct gca atg tgg tgatgggaaa tgagacttgc tctctggcct 407 gly lys arg ser ser pro glu thr leu ile ser asp leu leu met arg glu ser thr glu asn val pro arg thr arg leu glu asp pro ala met | 2 |
the automatic heating assembly of the present invention includes , in a general embodiment , a heating element arranged about a planar cooktop surface where said element is provided with means to automatically actuate the element upon placement of a cooking vessel , e . g ., a pot , thereon . as will be illustrated below , the present invention though primarily described in relation to cooking applications , also has application to a variety of other applications in which automatic actuation and / or selective heating is required . fig2 - 4 illustrate a plurality of embodiments incorporating the present invention for application and incorporation into conventional cooking surfaces . fig2 illustrates a range top 16 beneath which is disposed a natural gas heating assembly 17 which includes , in a conventional embodiment , a burner 8 , a feed line 9 including a cut off valve 10 , and a generator and flame detection device 13 . integrated into heating assembly 17 is an automatic actuation means 5 which comprises a light sensor assembly 6 operatively coupled to an electrical circuit 11 and switching device 14 in the manner illustrated in fig2 . circuit 11 may be constructed in accordance with conventional teachings as a bridge , a microprocessor or the like . electrical circuit 11 controls the operation of spark generator 13 and switching device 14 , e . g ., a relay , such as to operate valve 10 , e . g ., a solenoid valve , between an &# 34 ; on &# 34 ; and an &# 34 ; off &# 34 ; position . it is also envisioned that electrical circuit 11 may also control fuel flow through feed line 9 by controlling the operation of a regulating valve ( not shown ) connected in series to feedline 9 in accordance with preset or input values . sensor assembly 6 is envisioned to operate in an environment where it receives a minimum amount of light from a given source when it is in a non - actuated mode . when this light source is removed , interrupted or reduced such as , for example , when a pot 15 is placed atop assembly 17 between assembly 6 and the light source , assembly 17 is then actuated . more specifically , assembly 17 is actuated by the placement of the cooking vessel 15 , over assembly 17 which modifies the light signal received by assembly 6 . this signal is sensed by electrical circuit 11 and compared to a preset , threshold value . as the signal passes the preset value , the electrical circuit 11 operates switching device 14 which opens solenoid valve 10 and activates spark generator and flame detection device 13 . the intensity of the heat generated by burner 8 can then be modulated by the operator in a conventional fashion . the removal of vessel 15 from assembly 17 results in an increase in the amount of light entering assembly 6 and therefore a fluctuation in the electrical output signal generated thereby . this fluctuation is again detected by circuit 11 which , after reaching the preset threshold value , causes circuit 11 to activate switching device 14 to close valve 10 . by reference to fig1 a - c , sensor assembly 6 in one aspect may be positioned below cooking surface 7 when it is constructed from transparent materials such as a glass or other transparent or translucent materials , e . g ., a glass or ceramic . alternatively , assembly 6 may be integrated into or even extend nominally above cooking surface 7 in the manner illustrated in fig1 b - 1c , in the occasion when cooking surface 17 is opaque or nominally translucent . in the example illustrated in fig1 c , assembly 6 may be disposed within a hole or aperture 51 defined in surface 7 . in the embodiment illustrated in fig1 , it may be desirable to employ a transparent top cover to avoid damage or blockage created by food particles or the like about sensor assembly 6 . in the embodiment illustrated in fig1 and more specifically in fig1 , it is desirable that sensor assembly 6 be receivable to the incidence of light generated by a given light source 200 which may constitute an overhead range light , an ultraviolet light source , or natural light . in the embodiment illustrated in fig1 , sensor assembly 6 comprises at least one light guide 2 or 3 and a light sensor 4 . light guide 2 may be formed of a hollow tube . alternatively , guide 2 may constitute a bore formed in a suitable material , e . g ., a ceramic or ceramic compound . still alternatively , light guide 2 may comprise a fiber optic carrier . if necessary in selected applications , a transparent cover or cap 1 may be added to the uppermost portion of guide 2 , where such cap may be manufactured from a polymer , glass , glass ceramic , fused silica , diamond or the like . light guide 2 ( and / or 3 ) functions to transfer incident light 200 to light sensor 4 . light sensor 4 is preferably located in a sufficiently lower temperature portion of sensor assembly 6 and may therefore comprise any type of transducer capable of transforming light signals 0 into electrical signals , e . g ., a photo resistor , photo diode , solar cell , photo transistor , photothyristor , video camera or the like . in this connection , it may be desirable to locate sensor assembly 6 remotely from the top portion of the light guide 2 ( or 3 ) in a thermally insulated area . in operation , light 0 entering sensor 6 through guide 2 or 3 is channeled to detector 4 where the light input is transformed into an electrical output signal . to ensure a good ratio of signal , e . g ., the light change related to the placing or removal of a given vessel to noise , it is desirable to include a light detector 4 having a peak spectral response at low wavelengths of 800 nm or less . for high temperature heating it may be necessary to employ a suitable light filter 5 which transmits only light of short wavelengths . it is envisioned that it may be desirable for sensor assembly 6 to integrally include a light source and a sensing element such that a given heating element can be actuated by the amount of backscattered light generated by said light source upon contact with a pot 15 and received by said assembly 6 . this embodiment may have application where a ready or adequate light source is unavailable or in instances where more precise actuation is desired . in order to prevent the unintended operation of a burner by , for example , placing miscellaneous items on a surface , it may be desirable to include within circuit 11 contactors ( not shown ) which can be set by the operator to allow interruption of the sensing of an electrical output signal of each sensor assembly 6 for each element so as to allow the heating assembly to be used as a conventional range . in order to prevent the unintended operation of an exemplary gas burner 8 by a significant decrease of the room light , i . e ., by switching off or dampening the light in the room in which the cooking surface is located , electrical circuit 11 preferably includes at least one room light detector ( not shown ) constructed in accordance with conventional teachings and located outside of the heating zone . this detector would automatically interrupt the sensing of the electrical output signal of the light sensor assembly 6 by the electrical circuit 11 and shut down all burners ( unless the burners are run in a conventional manner by the operator ) if the room light falls below a preset minimum value which should be selected correspondingly to the present threshold value . moreover , this minimum value should be selected correspondingly to the preset threshold value to which the electrical output signal of the light sensor assemblies 6 is compared by the electrical circuit 11 . fig3 and 4 illustrate another application of the invention to a range top incorporating , in the instance of fig3 a singular resistor - type heating element 24 , and in fig4 a plurality of resistor - type heating elements 25 and 26 . referring to fig3 heating element 24 may adopt , in a conventional embodiment , a spiral - type resistor and be disposed beneath a transparent or translucent cooking surface 20 via insulators 18 . as noted , surface 20 may be formed of a transparent or translucent glass , ceramic or other materials having similar properties . heating element 24 is disposed within a containment cup 19 about an insulated matrix 18a . element 24 is operatively coupled to a power source ( not shown ) via leads 21 and 22 in which a contactor 23 is operably disposed responsive to a switching device 14 . as illustrated , light sensor assembly 6 is disposed in an upright fashion through heating element 24 , cup 19 and matrix 18a to define an upper end 48 and a lower end 48a . upper end 48 of assembly 6 is embedded in cooking surface 20 so as to be receptive to a light source ( not shown ) directed to a selected receptive horizon thereabove . as noted , light source may include a range top light or another light source specifically adapted for this purpose . sensor assembly 6 is coupled at its lower end to a electrical circuit 12 , such as that previously described , which circuit 12 is coupled to switching device 14 . in operation , sensor assembly 6 monitors light in a selected optical field above element 24 . when such light falls below a selected value , as , for instance , when a pot 15 is placed atop element 24 , sensor assembly 6 through circuit 12 engages switching device 14 to actuate element 24 . again , the operator may modulate the intensity of heat generated by element 24 through conventional panel controls . moreover , it may be desirable to include within range top an optical indicator to alert the operator that a given element 24 has been actuated . fig4 illustrates a modification of the embodiment illustrated in fig3 incorporating a plurality of heating elements 25 and 26 in cooperation with a like number of sensor assemblies 6 . the electrical connection between assemblies 6 and elements 25 and 26 is essentially a modification of that previously described above with reference to fig4 except that by use of two switching devices 29 and 30 each heating element 25 , 26 may be actuated independently . in such a fashion , a large pot 15 may solely actuate a single heating element or both heating elements depending on its position relative to sensor assemblies 6 . hence , energy savings may be observed . fig5 and 6 illustrate the potential placement of light sensor assemblies 6 in relation to a resistor - type burner 18 and a halogen - type lamp heat source 34 . as illustrated , it may be desirable to incorporate a number of sensor assemblies 6 within both concentric rings 28 and 29 of the resistor - type heating element illustrated in fig5 such that if a given cooking vessel is not of sufficient diameter to block incident light from the sensor assemblies 6 placed in the outer ring 28 , only the inner ring is actuated , thereby again resulting in energy savings . as illustrated in fig6 it may be desirable to place a number of sensor assemblies 6 symmetrically around a given heat source 34 to ensure actuation only when a given pot is aligned directly atop the burner itself . fig9 illustrates another embodiment of the present invention with respect to the placement of a sensor assembly 6 vis - a - vis a given cooking surface 7 . as illustrated , it may be desirable in some applications , and especially in applications where surface 7 is opaque , to incorporate sensor assemblies 6 such that they detect are capable of lighting projected from a selected source 45 horizontally over surface 7 . sensor assemblies 6 and light projector 45 may be incorporated beneath a lip or covering 46 for purposes of protection as well as for purposes of aesthetics . fig1 a - c illustrate yet another embodiment of the present invention in which a given heatable surface , e . g ., a planar cooktop , is comprised of a plurality of densely arranged , independently heatable modules or elements 47 . as illustrated in fig1 , these modules or elements may adopt a variety of geometrical configurations , the object being to form a uniform heating field . in the illustrated embodiment , these elements 47 are tessellatingly arranged to form a gapless heating grid . in one aspect of this embodiment , each element 47 is provided with an light sensor and actuation circuitry such as that previously described in relation to the aforedescribed embodiments . in such a fashion , the field can be heated to a selected size and shape depending on the number of elements 47 covered by a given vessel , thereby allowing uniform heating of a dish or pan of an irregular or unusual configuration . alternately , it is envisioned that each element may be provided with manual , automatic or preprogrammed means of actuation . yet another application of the present invention may be seen by reference to fig7 and 8 . fig7 illustrates a container or vessel 40 , preferably a non - magnetized vessel such as a glass beaker , disposed over a heating element 24 about a surface 7 . in the illustrated embodiment , a conventional automatic stirring assembly 42 is disposed below a heating element 24 , e . g ., a resistor - type heating element , which assembly 42 being cooperable with a magnetic stirring element 41 . an automatic sensor assembly 6 is situated below vessel 40 and electrically coupled in a fashion similar to that earlier described in relation to other embodiments such that when vessel 40 is placed over heating element 24 , element 24 and stirring assembly 42 may be automatically actuated . since laboratory beakers and their contents are frequently transparent , the resulting change of incoming light received in light entrance 48 of sensor assembly 6 may be comparatively small . it may therefore be desirable to situate assembly 6 in a recessed aperture about surface 7 so as to enhance the sensitivity thereof . this light change can be increased and therefore the detectability of the beaker improved if the uppermost portion 48 of sensor assembly 6 can be aligned with the axis defined by the magnetic field generated by assembly 42 and therefore caused by the usually non - transparent stirring body 41 . fig8 illustrates yet another embodiment of the present invention wherein a sensor assembly 6 is disposed within the coil of an induction type heater 43 , e . g ., for melting inductively coupling material 44 in a ceramic vessel 50 . sensor assembly 6 detects the placement of the vessel 50 into the induction heater 43 by the fluctuation of the incoming light into its upper end 48 and actuates heater 43 in a previously described manner . therefore , energy is saved as heater 43 is automatically powered only when needed . although particular detailed embodiments of the apparatus of the present invention have been described herein , it should be understood that the invention is not restricted to the details of the preferred embodiments . many changes in design , composition , configuration and dimension are possible without departing from the spirit of the instant invention . | 5 |
in the embodiment described below , the rotor assembly is used in an electric motor in a hybrid transmission for a vehicle . however the method and structure described below is suitable for use with rotors for induction machines , permanent magnet and switch reluctance machines as well as other suitable machines . referring to fig1 , a perspective view of part of a rotor assembly 10 is illustrated . fig2 is a schematic cross sectional view of part of the rotor assembly 10 . the rotor assembly comprises a first lamination stack 20 , second lamination stack 30 and a third lamination stack 40 . the first lamination stack 20 is made up of individual first rotor laminations 22 . the first lamination stack 20 has a first end 24 and a second end 26 . the rotor assembly 10 also comprises a second lamination stack 30 , attached to the second end 26 of the first lamination stack 20 . the second lamination stack 30 is made up of individual second rotor laminations 32 . the second lamination stack 30 has a first end 34 and a second end 36 . the rotor assembly 10 also comprises a third lamination stack 40 , attached to the second end 36 of the second lamination stack 30 . the third lamination stack 40 is made up of individual third rotor laminations 42 . the third lamination stack 40 has a first end 44 and a second end 46 . the first lamination stack 20 and the third lamination stack 40 are substantially identical in size , see discussion below . the first , second and third rotor laminations 22 , 32 and 42 respectively are generally circular disks which are made of flat sheets of silicone steel . the sheets , which may be made of other suitable materials , are fitted into a punching die ( not shown ) which punches holes into the sheet resulting in a generally ring - like shape . other non - circular shapes that are suitable for use in various electric machine rotor assemblies may also be employed . as shown in fig1 , the first , second and third rotor laminations 22 , 32 and 42 have an opening with center 50 , an inner circumference 52 and an outer circumference 54 . the distance between two points on the outer circumference 54 , going through the center 50 of the opening represents the outer diameter od of each rotor lamination , as shown in fig1 . the distance between two points on the inner circumference 52 , going through the center 50 of the opening represents the inner diameter id of each rotor lamination , as shown in fig1 . each of the first , second and third rotor laminations 22 , 32 , 42 have annulus regions a 1 , a 2 and a 3 , respectively , between their respective inner and outer circumferences 52 and 54 . in the embodiment shown , the first , second and third rotor laminations 22 , 32 and 42 are stacked in an axial direction . the first lamination stack 20 has an axial length l 1 . the second lamination stack 30 has an axial length l 2 . the third lamination stack 40 has an axial length l 3 . there are approximately 25 first rotor laminations 22 in the first lamination stack 20 . there are approximately 220 second rotor laminations 32 in the second lamination stack 30 . there are approximately 25 third rotor laminations 42 in the third lamination stack 40 . thus , in the preferred embodiment , the second lamination stack 30 has an axial length l 2 greater than either of the first and third lamination stacks 20 and 40 , i . e . the second lamination stack 30 contains a greater number of individual rotor laminations than either of the first and third lamination stacks 20 and 40 or the laminations of the combined laminations of the first and third lamination stacks 20 and 40 . existing automated lamination feeding and stacking machines can be utilized for this assembly process . in terms of the sizes of the individual rotor laminations , the first , second and third rotor laminations 22 , 32 and 42 have substantially the same outer diameter od . however the first and third rotor laminations 20 and 40 have substantially smaller inner diameters id than the second rotor laminations 30 , as shown in fig1 and 2 , to allow for the placement of bolt holes 60 . thus the annulus region a 1 and a 3 is larger for the first and third rotor laminations 20 and 40 than the annulus region a 2 of the second rotor lamination 30 . as shown in fig1 , slots 62 extend along the periphery of the outer circumference 54 of the first , second and third rotor laminations 22 , 32 and 42 . the first , second and third lamination stacks 20 , 30 and 40 are cast together by first being placed in a die cast mold fixture ( not shown ). the first , second and third lamination stacks 20 , 30 and 40 are molded by applying pressure to lock the first , second and third lamination stacks 20 , 30 and 40 together . molten aluminum or other suitable material is injected into the slots 62 . the molten aluminum flows through the slots 62 from the first end 24 of the first lamination stack 20 to the second end 46 of the third lamination stack 40 . a means of pressure such as hydraulic back pressure is applied against the molten metal forcing the molten metal into the slots 62 to lock the first , second and third rotor laminations 22 , 32 and 42 together in a unitary configuration , thereby avoiding air gaps , porosity and bubbles . for example , the first , second and third lamination stacks 20 , 30 and 40 may be compressed together in a die - casting machine so as to lock the first , second and third rotor laminations 22 , 32 and 42 together . the molten aluminum solidifies to create a first end ring 64 at the first end 24 of the first lamination stack 20 and a second end ring 66 at the second end 46 of the third lamination stack 40 , see fig2 . the aluminum or other suitable material first and second end rings 64 and 66 serve to enhance the conductivity of the rotor assembly 10 . as shown in fig1 and 2 , bolt holes 60 extend along the periphery of the inner circumference 52 of the first and third rotor laminations 22 and 42 . the bolt holes 60 are configured to receive a corresponding bolt 68 . fig3 is a schematic perspective view of a bolt 68 . the head of each bolt 68 has a flat side 67 that may be used to wedge and lock the bolt 68 in the first and third lamination stacks 20 and 40 . each bolt 68 has serrations 69 that prevent the bolt 68 from rotating and interact with complementary slots on the inside of each bolt hole 60 . the flat side 67 of the head of the bolt 68 and the serrations 69 provide anti - rotation when the first and second flange 74 and 76 ( see discussion below ) is assembled and the nut 78 is tightened . there are twelve bolt holes 60 in the preferred embodiment , however any number of bolt holes may be used . a representative first bolt 70 and representative second bolt 72 is shown in fig2 , attached onto the first lamination stack 20 and the third lamination stack 40 , respectively . a first flange 74 is attached onto the first end 24 of the first lamination stack 20 , using the first bolt 70 for orientation . the first bolt 70 goes through a hole in the first flange 74 . a second flange 76 is attached onto the second end 46 of the third lamination stack 40 , using the second bolt 72 for orientation . the second bolt 72 goes through a hole in the second flange 76 . as stated above , the preferred embodiment describes a rotor assembly 10 used in an electric motor ( not shown ) in a hybrid transmission . the first and second flanges 74 and 76 are mechanical devices that provide a means of attachment for the first , second and third lamination stacks 20 , 30 and 40 to the gears and / or other parts of the electric motor in the transmission . the first and second flanges 74 and 76 help transmit power to the mechanical components of the electric motor . a set of nuts 78 are placed over the edges of the first and second bolts 70 and 72 for secure attachment of flange to rotor assembly . alternatively , a single flange with multiple holes to mate with respective first and second bolts 70 or 72 may be used . any number of multiple flanges may also be used . the flange may be constructed of steel or other suitable materials . the physical structure or configuration of the flange may be varied depending on the layout and design of the components to be attached to the rotor laminations 22 , 32 and 42 through the flange . a method for assembling the rotor assembly 10 described above is provided . the first step comprises forming a first lamination stack 20 by stacking individual first rotor laminations 22 . the first lamination stack 20 has a first end 24 and a second end 26 . the second step comprises stacking individual second rotor laminations 32 onto the second end 26 of the first lamination stack 20 thereby creating a second lamination stack 30 . the second lamination stack 30 has a first end 34 and a second end 36 . the third step comprises stacking a set of third rotor laminations 42 onto the second end 36 of the second lamination stack 30 thereby creating a third lamination stack 40 . the third lamination stack 40 has a first end 44 and a second end 46 . the first , second and third lamination stacks 20 , 30 and 40 may be cast together in a die cast mold fixture and molded to lock the first , second and third rotor laminations 22 , 32 and 42 together . a dowel pin or a guide bar ( not shown ) may be used to ensure the proper alignment of the first , second and third lamination stacks 20 , 30 and 40 . the guide bar may be used to align the stacking of the first , second and third lamination stacks in the die cast mold fixture prior to molding . the dowel pin or guide bar may be inserted into a respective one or more slots 62 of the rotor lamination 42 and extend axially through the slot to the first end 24 of the first lamination stack 20 or from the first end 24 to the second end 46 . a first bolt 70 may be attached onto the first lamination stack 20 as well as a second bolt 72 onto the third lamination stack 40 . a first flange 74 may be attached onto the first end 24 of the first lamination stack 20 , using the first bolt 70 for orientation ; and a second flange 76 may be attached onto the second end 46 of the third lamination stack 40 , using the second bolt 72 for orientation . a further step may comprise machining the outer circumference 54 of the first , second and third rotor laminations 22 , 32 and 42 . machining involves grinding the outer circumference 54 for smoothness and precision of dimensions . this process may be done at the final rotor assembly , which involves assembling both flanges . a further step may involve fine - tuning a speed sensor wheel 80 . certain rotor assemblies may contain a speed sensor wheel 80 , as shown in fig2 . the speed sensor wheel 80 may be an integral part of the flange structure or it may be mounted separately by welding , using bolts or other means . if mounted on the structure , the speed sensor wheel 80 must be attached securely so it does not vibrate . finally , a next step may be final balancing of the rotor assembly 10 , which involves removing and adding extremely small amounts of weight at either end of the rotor assembly 10 . this serves to balance the weight of the rotor assembly 10 from one end to the other , leading to reduced vibration and noise . the thickness of the hub used typically in constructing a rotor restricts the width a 2 of rotor laminations to what can be fitted within the hub . eliminating the hub allows for the cross - sectional area of the rotor laminations to be increased . this allows for a greater electromagnetic flux path and increased efficiency of the motor . furthermore , the electric motor performance and efficiency is improved as a result of the elimination of the contact pressure applied by the hub on the rotor laminations . while the best modes for carrying out the invention have been described in detail , those familiar with the art to which this invention relates will recognize various alternative designs and embodiments for practicing the invention within the scope of the appended claims . | 7 |
referring now to the figures of the drawings in detail and first , particularly , to fig1 thereof , there is seen a switching circuit of an output driver in accordance with an inverter of the cmos type . an input signal read0 is applied to gates of two switching transistors of the switching circuit . a first supply potential of a supply voltage is designated by reference symbol v1 and a second supply potential of the supply voltage is designated by reference symbol v2 . each of the two potentials is connected to a single connection of the switching circuit . an output signal line with an output signal dq is connected to a line capacitor . the second connection v2 of the supply voltage of the switching circuit of the output driver ( corresponding in this case to a driver reference voltage ) is usually led out of the chip in order to better decouple the supply voltage of the switching circuit from a supply voltage of the rest of the chip . the led - out supply voltage line contains line inductances ( that are not shown in fig1 ), which form a system capable of oscillating , together with the line capacitor of the output signal line . a principal sequence of the switching process of the switching circuit will now be explained in more detail on the basis of fig2 . in this case a state &# 34 ; log . 1 &# 34 ; corresponds to a higher potential of the supply voltage ( for example a supply potential vccq = 5v ) and a state &# 34 ; log . 0 &# 34 ; corresponds to a lower potential of the supply voltage ( for example vssq = 0v ). a starting situation is formed by the signals read0 and dq with states read0 = log . 0 and dq = log . 1 . the signal read0 = log . 1 is applied to the input signal line ( meaning &# 34 ; output the output signal dq = log . 0 &# 34 ;). this signal change causes the voltage at dq ( u dq ) to drop . as a result of an inductive voltage drop , the driver reference voltage v2 increases from its stationary value v20 ( curve 1 ). the shape of the curve , which illustrates characteristics similar to those of an oscillating circuit , is primarily determined by the line inductance of the led - out supply voltage line , by the line capacitance of the output signal line , and by the line and bulk resistance of the transistor . if the driver reference voltage is not sufficiently decoupled from the remaining supply voltage of the semiconductor chip , the function of the entire chip can be impaired . fig3 shows an output driver with voltage - dependent regulated switching characteristics . a supply voltage of the output driver has four supply potentials . the second supply potential v2 of the supply voltage of the output driver is led out and is decoupled from a third supply potential v3 on the semiconductor chip . the two potentials are equal in a stationary state . the supply potential v2 corresponds , for example , to the driver reference voltage vssq and the supply potential v3 corresponds , for example , to the chip reference voltage vss . the first supply potential v1 and a fourth supply potential v4 of the supply voltage correspond to a higher potential in comparison with the supply potentials v2 and v3 whereby , for example , it can be that v1 = vccq and v4 = v1 . the output driver as shown in fig3 is formed of a switching circuit st and in addition a regulating circuit rs for voltage - dependent regulation of the switching characteristics of the switching circuit st . the output driver includes an input signal line with an input signal read0 and an output signal line with an output signal dq . the switching circuit is formed of first and second transistors t11 and t12 , which have main current paths connected in series and which are connected to a supply voltage . the first transistor t11 and the second transistor t12 of the circuit st are of different channel types . the output signal line with the output signal dq is connected to a coupling node between the two transistors t11 and t12 of the switching circuit st . the switching circuit st is connected with the first transistor t11 at the first supply potential v1 of the supply voltage and with the second transistor t12 at the second supply potential v2 of the supply voltage . the structure of the regulating circuit rs is described in the following : the input signal read0 is connected to a gate of a first transistor t1 , which is of the p - channel type . a second transistor t2 of the n - channel type and a third transistor t3 of the n - channel type together form a current mirror s . a main current path of the transistor t2 forms an input path of the current mirror s and a main current path of the transistor t3 forms an output path of the current mirror s . a first connection of the input path of the current mirror s is connected to the third supply potential v3 of the supply voltage and a first connection of the output path of the current mirror s is connected to the second supply potential v2 of the supply voltage . a first connection of the main current path of the first transistor t1 is connected to the fourth supply potential v4 of the supply voltage and a second connection of the main current path of the first transistor t1 is connected to a second connection of the input path of the current mirror s . a gate of the third transistor t3 is additionally connected through a first resistor r1 to the third supply potential v3 of the supply voltage . a second connection of the output path of the current mirror s is connected through a second resistor r2 to the fourth supply potential v4 of the supply voltage and is connected to a gate of a fourth transistor t4 , which is of the p - channel type . a first connection of the main current path of the fourth transistor t4 is connected to the fourth supply potential v4 of the supply voltage and a second connection of the main current path of the fourth transistor t4 is connected through a third resistor r3 to the second supply potential v2 of the supply voltage . the second connection of the main current path of the fourth transistor t4 carries an output signal g of the regulating circuit rs . the switching circuit st is connected as follows : a gate of the second transistor t12 of the switching circuit st , which is of the n - channel type , is connected to the output signal g of the regulating circuit rs . a gate of the first transistor t11 of the switching circuit st , which is of the p - channel type , is connected to the signal read0 , which is a complementary signal to the input signal read0 . fig2 also shows a principle voltage progression for the signal sequence of the output signal dq = log . 1 to dq = log . 0 , for the circuit according to fig3 . in this case too , the starting point is read0 = log . 0 and dq = log . 1 . in addition , at the beginning of the switching process , for example , according to the figures following fig3 : the signal read0 = log . 1 is applied , which corresponds to an application of the input signal read0 = log . 0 at the input ( t1 ). the interaction of the regulating circuit rs and the switching circuit st during the switching process from dq = 1 to dq = 0 will now be described : read0 goes to 0v ( corresponding in this case to log . 0 ) and the transistor t1 becomes conducting . a node k1 receives the potential of the forward voltage of the transistor t2 . this potential corresponds approximately to the threshold voltage of the transistor t3 . the transistor t3 opens and the potential at a node k2 drops . the transistor t4 opens and the potential at g increases . the transistor t12 of the switching circuit st opens ( as for operation without regulation ), the voltage at the output line dq drops and the potential v2 increases as a result of the inductive voltage drop at the led - out line of the supply voltage . this potential increase causes closure of the transistor t3 which , as described above , is operated at the threshold voltage . as a result , the potential at the node k2 increases . the transistor t4 closes and the potential at g drops . the transistor t12 of the switching circuit st closes and the potential at the supply voltage v2 drops as a result . the transistor t3 is opened again . consequently , as just described , the transistor t12 is also opened again and the potential at the supply voltage v2 increases . the sequence described is repeated until the voltage at the output line dq has dropped to the potential v2 , which is back in the initial state ( fig2 curve 2 , time t 2 ). in this way a voltage fluctuation at the supply voltage arising through the switching process of the switching circuit st is counteracted . the regulating circuit rs which was explained on the basis of fig3 is effective only for voltage - dependent regulation of the switching characteristics of the switching circuit st for the transition read0 = log . 1 to read0 = log . 0 . in the case of the transition read0 = log . 0 to read0 = log . 1 a second regulating circuit with an analogous manner of working is necessary , as described in the following . fig4 illustrates an output driver with voltage - dependent regulated switching characteristics for the above transition read0 = log . 0 to read0 = log . 1 . the supply voltage of the output driver also has four supply potentials in this case . the second supply potential v2 and the third supply potential v3 of the supply voltage are higher than the first supply potential v1 and the fourth supply potential v4 of the supply voltage . the first supply potential v1 and the fourth supply potential v4 of the supply voltage are decoupled on the semiconductor chip and are equal in the stationary state ( outside a switching process ). as an example , actual values are also stated herein : in comparison with the transistors used in fig3 the transistors used in fig4 are of a different channel type : i . e ., the first transistor t1 is of the n - channel type , the second transistor t2 is of the p - channel type , the third transistor t3 is of the p - channel type , the fourth transistor t4 is of the n - channel type , the first transistor t11 of the switching circuit st is of the n - channel type and the second transistor t12 of the switching circuit st is of the p - channel type . in both variants of the output driver , the respective other inputs remain connected to the signal read0 , which is complementary to the input signal read0 . it is also possible to define a switching circuit for both switching processes ( read0 = log . 1 to read0 = log . 0 , read0 = log . 0 to read0 = log . 1 ). in this case the regulating circuit according to fig3 is used for controlling the transistor of the switching circuit st connected to the lower potential of the supply voltage . this regulates the transition read0 = log . 1 to read0 = log . 0 . instead of connecting the gate of the other transistor of the switching circuit st directly to the signal read0 , a second regulating circuit is used for controlling the transistor connected to the higher potential of the supply voltage . this regulates the transition read0 = log . 0 to read0 = log . 1 . this is illustrated in fig4 and derives directly from the statement presented above for the switching process read0 = log . 0 to read0 = log . 1 . the setting of the switching speed and the damping of the voltage fluctuations also depend on the parameters of the components used in the output driver . depending on the type of transistors or resistors used , different sequences of switching processes and voltage progressions are generated . in choosing a transistor type for the realization of this regulating circuit rs and the switching circuit st , it is of advantage to use field effect transistors since their favorable characteristics such as high switching speed and low dissipation power are advantageous for the operation of the regulating circuit rs . however , it is also possible to achieve the illustrated basic mode of operation through a circuit structure using bipolar transistors . in this case field effect transistors of the n - channel type must be replaced with bipolar transistors of the n - p - n type , and field effect transistors of the p - channel type must be replaced with bipolar transistors of the p - n - p type . | 7 |
a rotational angle detector for a vehicle steering wheel according to one embodiment of the present invention will now be described . as shown in fig1 and 2 , a rotor 12 is fixed to a rotative member , which is a steering shaft 11 in this embodiment . the rotor 12 rotates integrally with the steering shaft 11 about an axis l of the steering shaft 11 . outer slit regions a 1 to a 5 are defined along a circle having a radius r 1 about the axis l . the circle having the radius r 1 will hereafter be referred to a first track t 1 . the outer regions a 1 to a 5 are defined by evenly dividing the first track t 1 by five . each of the outer slit regions a 1 to a 5 therefore corresponds to a segment having an angle of 72 °( 360 °/ 5 ). each outer slit region a 1 to a 5 has six outer slits 13 , which are formed along the first track t 1 . the pattern of sizes of the outer slits 13 and the spaces between adjacent slits 13 are the same for each of the outer slit regions a 1 to a 5 . inner slit regions b 1 to b 14 are defined along a circle having a radius r 2 ( r 2 & lt ; r 1 ) about the axis l . the circle of the radius r 2 will hereafter be referred to a second track t 2 . the inner slit regions b 1 to b 14 are defined by evenly dividing the second track t 2 by fourteen . each of the inner slit regions b 1 to b 14 therefore corresponds to a segment having an angle of 25 . 714 °( 360 °/ 14 ). each inner slit region b 1 to b 14 has three inner slits 14 , which are formed along the second track t 2 . the pattern of sizes of the inner slits 14 and the spaces between adjacent slits 14 are the same for each of the inner slit regions b 1 to b 14 . as shown in fig1 to 3 , a light emitter 18 and a light receiver 19 are arranged to face each other with the rotor 12 in between . the light emitter 18 includes first to seventh outer luminous elements 20 a to 20 g and first to fifth inner luminous elements 21 a to 21 e . the luminous elements 20 a to 20 g and 21 a to 21 e each include a light emitting diode . the light receiver 19 includes first to seventh outer photodetectors 22 a to 22 g and first to fifth inner photodetectors 23 a to 23 e . the photodetectors 22 a to 22 g and 23 a to 23 e each include a photodiode . each outer luminous element 20 a to 20 g faces a corresponding one of the outer photodetectors 20 a to 20 g . also , each inner luminous element 21 a to 21 e faces a corresponding one of the inner photodetectors 23 a to 23 e . the outer and inner luminous elements 20 a to 20 g and 21 a to 21 e and the outer and inner photodetectors 22 a to 22 g and 23 a to 23 e are arranged on a limited arcuate region of the rotor 12 . the outer luminous elements 20 a to 20 g and the outer photodetectors 22 a to 22 g form an outer sensor . the inner luminous elements 21 a to 21 e and the inner photodetectors 23 a to 23 e form an inner sensor . the outer luminous elements 20 a to 20 g and the outer photodetectors 22 a to 22 g are located along the first track t 1 and are spaced apart by equal angular intervals . that is , as shown in fig3 the outer luminous elements 20 a to 20 g and the outer photodetectors 22 a to 22 g are spaced apart by approximately 10 . 29 °( the angle θ1 of fig3 ). the angle θ1 is obtained by dividing 72 °, which is the angular range of each outer region a 1 to a 5 , by seven ( 72 °/ 7 ). the inner luminous elements 21 a to 21 e and the inner photodetectors 23 a to 23 e are located along the second track t 2 and are spaced apart by equal angular intervals . that is , as shown in fig3 the inner luminous elements 21 a to 21 e and the inner photodetectors 23 a to 23 e are spaced apart by 5 . 14 ° ( the angle θ2 of fig3 ). the angle of θ2 is obtained by dividing 25 . 714 °, which is the angular range of each inner region b 1 to b 14 , by five ( 25 . 714 °/ 5 ). the angular interval ( 5 . 14 °) between each pair of the inner photodetectors 23 a to 23 e is half of the angular interval ( 10 . 29 °) between each pair of the outer photodetectors 22 a to 22 g . the circuit construction of the rotational angle detector will now be described . as shown in fig4 a central processing unit ( cpu ) 30 controls devices in the detector . a read only memory ( rom ) 31 stores various control programs . a random access memory ( ram ) 32 temporarily stores data obtained through performing the control programs . the cpu 30 serves as judging means , selecting means and computing means . the rom 31 serves as memory . the first to seventh outer luminous elements 20 a to 20 g , the first to fifth inner luminous elements 21 a to 21 e , the first to seventh outer photodetectors 22 a to 22 g and first to fifth inner photodetectors 23 a to 23 e are connected to the cpu 30 . when each outer photodetector 22 a to 22 g receives light from the corresponding outer luminous element 20 a to 20 g through the outer slits 13 of the rotor 12 , the photodetector 22 a to 22 b sends a signal of h level to the cpu 30 . when light from each outer luminous element 20 a to 20 g is blocked and the corresponding outer photodetector 22 a to 22 g does not receive the light , the photodetector 20 a to 22 g sends a signal of l level to the cpu 30 . the cpu 30 obtains a seven - bit reflective code ( see fig5 ) in accordance with the combination of h level signals and l level signals from the outer photodetectors 22 a to 22 g . h level is represented by one , and l level is represented by zero . reflective code is a modified binary code in which sequential numbers are represented by expressions that differ only in one bit . in the example of fig5 in an outer reflective code 35 , the fourth digit from the right is changed from zero to one , or from l level to h level . when each inner photodetector 23 a to 23 e receives light from the corresponding inner luminous element 21 a to 21 e through the inner slits 14 of the rotor 12 , the photodetector 23 a to 23 e sends a signal having an h level to the cpu 30 . when light from each inner luminous element 21 a to 21 e is blocked and the corresponding inner photodetector 23 a to 23 e does not receive the light , the photodetector 23 a to 23 e sends a signal of l level to the cpu 30 . the cpu 30 obtains a five - bit reflective code ( see fig5 ) in accordance with the combination of h level signals and l level signals from the inner photodetectors 23 a to 23 e . in the example of fig5 the third digit from the right of an inner reflective code 36 is changed from h level to l level . the seven - bit outer reflective code 35 and the five - bit inner reflective code 36 form a twelve - bit reflective code , or combined code . as described above , when the twelve - bit reflective code changes to a subsequent code , one bit , or digit , of each of the outer reflective code 35 and the inner reflective code 36 is changed . therefore , as shown in fig5 the second , subsequent twelve - bit reflective code differs by two bits . the rom 31 stores a table 37 shown in fig6 . the table 37 defines the relationship between the outer and inner reflective codes 35 , 36 and the rotational angle of the steering shaft 11 . the table 37 includes eighty - four outer reflective codes 35 . the eighty - four outer reflective codes 35 correspond to eighty - four angular subdivisions of a given outer slit region a 1 to a 5 . the table 37 also includes thirty inner reflective codes 36 . the thirty inner areflective codes 36 correspond to thirty subdivisions of a given inner slit region b 1 to b 14 . for example , in the eleventh row ( combined code no . 10 ) in the table 37 , the outer reflective code is 1001001 and the inner reflective code is 11010 . in this state , the rotational angle data is 8 . 57 °. the rotational angle data has increments of 0 . 86 °. that is , the resolution of the rotational angle detector is 0 . 86 °. the operation of the rotational angle detector will now be described . the cpu 30 performs the following operation based on control programs stored in the rom 31 . first , a case where a twelve - bit reflective code from the light receiver 19 is in the table 37 will be described . when the ignition switch is turned on , power is supplied to the rotational angle detector . then , the luminous elements 20 a to 20 g and 21 a to 21 e emit light toward the photodetectors 22 a to 22 g and 23 a to 23 e . accordingly , the photodetectors 22 a to 22 g and 23 a to 23 e output h level signals and l level signals . the combination of the signals defines the outer and inner reflective codes 35 , 36 . the cpu 30 judges whether the resulting reflective codes are in the table 37 . for example , if the outer reflective code 35 is 1001001 and the inner reflective code 36 is 11010 , the twelve - bit reflective code is 100100111010 , which is represented by the eleventh row ( code no . 10 ) of the table 36 . combination code no . 10 corresponds to an 8 . 57 ° angle of the steering wheel . a case where a twelve - bit reflective code from the light receiver 19 is not in the table 37 will now be described . if the outer reflective code 35 is 0000001 and the inner reflective code 36 is 00111 , the twelve - bit reflective code 000000100111 does not match any of the combined codes in the table 37 . in this case , the rotational angle of the steering shaft 11 is separately computed based on the outer reflective code 35 and the inner reflective code 36 . that is , the outer reflective code 35 , which is 0000001 , corresponds to the twenty - fifth row ( code no . 24 ) of fig2 , which is 20 . 57 °. since the sizes and arrangement of the outer slits 13 are common to all the outer slit regions a 1 to a 5 , the outer reflective code 35 corresponds to a certain position in one of the outer regions a 1 to a 5 . therefore , as shown in fig7 ( a ), the rotational angle computed based on the outer reflective code 35 is expressed by a formula 20 . 57 °+ 72 . 00 ° i , where i is one of the values 0 , 1 , 2 , 3 and 4 . as shown in fig7 ( a ) and 7 ( b ), the program is performed assuming that a one - bit reading error might occur in the outer reflective code 35 and the inner reflective code 36 . this is because the detecting accuracy of the outer photodetectors 22 a to 22 g and the inner photodetector 23 a to 23 e can cause errors . therefore , when the outer reflective code 35 has a value 0000001 , the cpu 30 prepares the following tentative reflective codes , which correspond to expected errors . with the value 0000001 , the tentative codes of the outer reflective code 35 are 1000001 , 01000001 , 0100001 , 0001001 , 0000101 , 0000011 and 0000000 . the cpu 30 selects pattern data , or codes , corresponding to the tentative reflective codes from the table 37 . in the case of fig7 ( a ), the cpu 30 selects code no . 11 ( 1000001 ), code no . 25 ( 0100001 ), code no . 49 ( 0000101 ) and code no . 23 ( 0000011 ). the rotational angle that corresponds to the tentative reflective code of 1000001 is 9 . 43 °+ 72 . 00 ° i . the rotational angle that corresponds to the tentative reflective code of 0100001 is 21 . 43 °+ 72 . 00 ° i . the rotational angle that corresponds to the tentative reflective code of 0000101 is 42 . 00 °+ 72 . 00 ° i . the rotational angle that corresponds to the tentative reflective code of 0000011 is 19 . 71 °+ 72 . 00 ° i . on the other hand , the rotational angle data corresponding to the inner reflective code 36 having a value “ 00111 ” is 0 . 00 ° as shown by code no . 0 of fig6 . since the sizes and arrangement of the inner slits 14 are common to all the inner slit regions b 1 to b 14 , the inner reflective code 36 corresponds to a certain position in one of the inner regions b 1 to b 14 . therefore , as shown in fig7 ( b ), a rotational angle computed based on the inner reflective code 36 is expressed by a formula 0 . 00 °+ 25 . 714 ° j , wherein j is one of the values 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 and 13 . as shown in fig7 ( b ), the program is performed assuming that a one - bit reading error might occur in the inner reflective code 36 . therefore when the inner reflective code 36 has a value 00111 , the cpu 30 prepares the following tentative reflective codes , which correspond to expected errors . with the value 00111 , the tentative codes of the inner reflective code 36 are 10111 , 01111 , 00011 , 00101 and 00110 . the cpu 30 selects codes corresponding to the tentative reflective codes from the table 37 . in the case of fig7 ( b ), the cpu 30 selects code no . 29 ( 10111 ), no . 5 ( 01111 ), no . 1 ( 00011 ), no . 15 ( 000101 ) and no . 7 ( 00110 ). a rotational angle that corresponds to the tentative reflective code of 10111 is 24 . 85 °+ 25 . 714 ° j . a rotational angle that corresponds to the tentative reflective code of 01111 is 4 . 29 °+ 25 . 714 ° j . a rotational angle that corresponds to the tentative reflective code of 00011 is 0 . 86 °+ 25 . 714 ° j . a rotational angle that corresponds to the tentative reflective code of 00101 is 12 . 86 °+ 25 . 714 ° j . a rotational angle that corresponds to the tentative reflective code of 00110 is 6 . 00 °+ 25 . 714 ° j . the resolution of the rotational angle detector is 0 . 86 °. thus , as shown in fig7 ( a ), the angles 19 . 71 °+ 72 . 00 ° i , 20 . 57 °+ 72 . 00 ° i and 21 . 43 °+ 72 . 00 ° i are consecutive angles . among these angles , the angle 20 . 57 °+ 72 . 00 ° i is the middle . as shown in fig7 ( b ), the angles 0 . 00 °+ 25 . 714 ° j , 0 . 86 °+ 25 . 714 ° j and 24 . 86 °+ 25 . 714 ° j are consecutive angles . among these angles , the angle 0 . 00 °+ 25 . 714 ° j is the middle . judging from the characteristics of reflective codes , the middle values ( 20 . 57 °+ 72 . 00 ° i and 0 . 00 °+ 25 . 714 ° j ) represent the rotational angle of the steering shaft 11 . that is , the rotational angle of the steering shaft 11 is 20 . 57 °+ 72 . 00 ° i according to outer reflective code 35 and is 0 . 00 °+ 25 . 714 ° j according to the inner reflective code 36 . then , the angle value 20 . 57 °+ 72 . 00 ° i is calculated with i replaced with 0 , 1 , 2 , 3 and 4 . also , the value 0 . 00 °+ 25 . 714 ° j is calculated with j replaced with 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 and 13 . as a result , when i is replaced with 4 and j is replaced with 12 , the values 20 . 57 °+ 72 . 00 ° i and the value 0 . 00 °+ 25 . 714 ° j are both 308 . 57 °, or equal to each other . in this manner , when the outer reflective code 35 is 0000001 and the inner reflective code 00111 , the combination of which is not on the table 37 , the cpu 30 determines that the rotational angle of the drive shaft 11 is 308 . 57 °. next , a case where the combination of the reflective codes 35 , 36 is not on the table 37 and the rotational angle of the steering shaft 11 is below the resolution will be described . for example , if the outer reflective code 35 is 0000001 and the inner reflective code 36 is 10111 , the combined twelve - bit reflective code is 000000110111 . the cpu 30 judges that the value 000000110111 is not in the table 37 . the cpu 40 therefore computes the rotational angle of the steering shaft 11 based separately on the outer reflective code 35 and the inner reflective code 36 . fig8 ( a ) shows a case in which the rotational angle of the drive shaft 11 is such that the outer reflective code 35 from the light receiver 19 is 0000001 . this is the same as the case of fig7 ( a ). therefore , the rotational angle of the outer reflective code 35 is computed as 20 . 57 °+ 72 . 00 ° i . on the other hand , the rotational angle data according to the inner reflective code 36 of 10111 is 24 . 86 ° as shown by code no . 29 of fig6 . therefore , as shown in fig8 ( b ), the rotational angle of the steering shaft 11 computed based on the inner reflective code 36 has a value 24 . 86 °+ 25 . 714 ° j , in which j is one of the values 0 to 13 . also , as shown in fig8 ( b ), assuming that the inner reflective code 36 might have a one - bit reading error , the attentive inner reflective codes 36 having values 00111 , 11111 , 10011 , 10101 and 10110 are prepared . then , the cpu 30 selects values that are in the table 37 among the expected inner reflective codes . in the case of fig8 ( b ), code no . 0 ( 00111 ), code no . 24 ( 10011 ), code no . 16 ( 10101 ) and code no . 28 ( 10110 ) are selected . when the inner reflective code is 00111 , the rotational angle is 0 . 00 °+ 25 . 714 ° j . when the inner reflective code is 10011 , the rotational angle is 20 . 57 °+ 25 . 714 ° j . when the inner reflective code is 10101 , the rotational angle is 13 . 71 °+ 25 . 714 ° j . when the inner reflective code is 10110 , the rotational angle is 24 . 00 °+ 25 . 714 ° j . the resolution of the rotational angle detector is 0 . 86 °. thus , as shown in fig8 ( b ), the angles 24 . 00 °+ 25 . 714 ° j , 24 . 86 °+ 25 . 714 ° j and 0 . 00 °+ 25 . 714 ° j are consecutive angles . among these angles , the angle of 24 . 86 °+ 25 . 714 ° i is the middle value . as described above , the middle value represents the actual rotational angle of the steering wheel 11 . thus , the rotational angle of the steering shaft 11 computed based on the inner reflective code 36 is expressed by a value 24 . 86 °+ 25 . 714 ° j . next , the value 24 . 86 °+ 25 . 714 ° j is computed by replacing j with 0 to 13 . accordingly , tentative rotational angles of the steering shaft 11 are obtained . the tentative angles are 24 . 86 °, 76 . 29 °, 102 . 00 °, 127 . 71 °, 153 . 43 °, 179 . 14 °, 204 . 86 °, 230 . 57 °, 256 . 29 °, 282 . 00 °, 307 . 71 °, 333 . 43 ° and 359 . 14 °. the rotational angle of the steering shaft 11 computed based on the outer reflective code 35 is 20 . 570 + 72 . 00 ° i . the symbol i is replaced with 0 to 4 . accordingly , tentative steering shaft angles are 20 . 57 °, 92 . 57 °, 236 . 57 ° and 308 . 57 °. thus , the angle computed based on the inner reflective code 36 and the angle computed based on the outer reflective code 35 do not match . in this case , the cpu 30 judges that there is a difference of 0 . 86 ° between the angle based on the outer reflective code 35 and the angle based on the inner reflective code 36 . therefore , the rotational angle computed based on the inner reflective code 36 is 307 . 71 ° and the rotational angle computed based on the outer reflective code 35 is 308 . 57 °. that is , the actual rotational angle of the steering shaft 11 is between 307 . 71 ° and 308 . 57 °. if the rotational angle of the steering shaft 11 cannot be computed by the above process , the cpu 30 judges that the outer and inner reflective codes 35 , 36 have erroneous values . in this case , the rotational angle of the steering shaft 11 is not computed . ( 1 ) the rom 31 stores the table 37 , which includes the pattern data of the reflective codes 35 , 36 and the corresponding rotational angle data . if a combined reflective code appears in the table 37 , the cpu 30 judges that the rotational angle of the steering shaft 11 is represented by the pattern data . when a combined reflective code is not on the table 37 , the cpu 30 computes the rotational angle of the steering shaft 11 based on the reflective codes 35 , 36 . although , the resolution of the detector is 0 . 86 °, the rom 31 does not have to store 420 ( 420 = 360 °/ 0 . 86 °) patterns of data , codes . that is , as for the outer reflective code 35 , the rom 31 stores eighty - four codes , which correspond eighty - four positions within a given outer slit region a 1 to a 5 . as for the inner reflective code 36 , the rom 31 stores thirty patterns of data , or codes , which correspond to thirty positions within a given inner slit region b 1 to b 14 . in other words , there is no need for the rom 31 to store all the pattern data corresponding to all the regions a 1 to a 5 and b 1 to b 14 , which minimizes the required memory capacity of the rom 31 . ( 2 ) the rotational angle of the steering shaft 11 , or rotative member , is separately computed based on the outer reflective code 35 and the inner reflective code 36 . even if the rotational angle computed based on the outer reflective code 35 does not match the rotational angle computed based on the inner reflective code 36 , the actual angle of the steering shaft 11 is inferred within an error of 0 . 86 °. ( 3 ) it is assumed that the outer and inner reflective codes 35 , 36 may have a one - bit reading error . the rotational angle of the steering shaft 11 is computed based on the tentative reflective codes . therefore , the rotational angle of the steering shaft 11 is computed based on the wide variety of data , which improves the detection accuracy of the rotational angle . ( 4 ) the outer luminous elements 20 a to 20 g , the inner luminous elements 21 a to 21 e , the outer photodetectors 22 a to 22 g and the inner photodetectors 23 a to 23 e are concentrated on a limited arcuate segment of the rotor 12 , which adds to the flexibility of the design and facilitates changes of the specifications and design . it should be apparent to those skilled in the art that the present invention may be embodied in many other specific forms without departing from the spirit or scope of the invention . particularly , it should be understood that the invention may be embodied in the following forms . in the illustrated embodiment , a single array of the inner slits 14 is formed radially inside the outer slits 13 . however , the inner slits 14 may be formed on circles having different radiuses . in the illustrated embodiment , the outer and inner luminous elements 20 a to 20 g and 21 a to 21 e and the outer and inner photodetectors 22 a to 22 g and 23 a to 23 e are located in a limited arcuate segment of the rotor 12 . however , the luminous elements 20 a to 20 g and 21 a to 21 e and the photodetectors 22 a to 22 g and 23 a to 23 e may be evenly arranged along the entire circumference of the rotor 12 . the present invention is used to detect the rotational angle of the steering shaft 11 in the illustrated embodiment . however , the present invention may be embodied in other devices . the rom 31 does not have to store all the rotational angle data , which reduces the required memory capacity of the rom 31 . also , the rotational angle of the steering shaft 11 is detected with an error within the resolution , which improves the detection accuracy of the rotational angle detector . the present examples and embodiments are to be considered as illustrative and not restrictive , and the invention is not to be limited to the details given herein , but may be modified within the scope and equivalence of the appended claims . | 6 |
in fig1 band pass filters 11 , 12 , 13 , 14 , and 15 have progressively higher center frequencies and are connected in parallel between input 10 and summation circuit 17 . the center frequencies of the filters are typically geometrically related , e . g . each center frequency is 1 . 7 times the next lower center frequency , and the “ q ” of the filters is typically ten . other apparatus can be included in such circuitry , depending upon application . for example , an equalizer also includes a variable gain stage coupled to the output of each filter . [ 0016 ] fig2 is a block diagram of an audio processing circuit constructed in accordance with the invention in which alternate filters are coupled through an inverting amplifier to the summation network . as illustrated in fig2 the output of filter 12 is coupled through inverting amplifier 21 to summation circuit 17 and the output of filter 14 is coupled through inverting amplifier 22 to summation circuit 17 . either filters 11 , 13 , and 15 or filters 12 and 14 could have their outputs inverted . the effect of inverting alternate outputs is illustrated in fig3 . in fig3 curve 31 represents the frequency response of filter 11 , curve 32 represents the frequency response of filter 12 , curve 33 represents the frequency response of filter 13 , curve 34 represents the frequency response of filter 14 , and curve 35 represents the frequency response of filter 15 . the frequency responses of the filters overlap , although the point at which the response curves intersect may be far down on the curve . the response curves intersect approximately half - way between the center frequencies of the filters . the sum of the outputs of filters 11 and 12 follows curve 37 in the region between the center frequencies . note that the nadir of curve 37 is distinctly higher than the point at which curves 31 and 32 intersect . the outputs of the remaining filters combine to produce similar curves . when alternate outputs are inverted in accordance with the invention , the sum of the outputs of filters 11 and 12 follows curve 38 in the region between the center frequencies . the difference , represented by double ended arrow 39 , is approximately 8 . 5 db in one embodiment of the invention . not only is this a large additional attenuation between the bands but the skirts of the response curves are also steeper below approximately − 10 db . [ 0020 ] fig4 is a schematic of a band pass filter incorporating the invention disclosed and claimed in the application cross - referenced above . specifically , a preferred band pass filter is made by subtracting the outputs from two notch filters . the particular notch filter chosen is not critical . the notch filter illustrated in fig4 is known as a twin - t filter with positive feedback ; see “ electronic filter design handbook ” by williams and taylor , third edition , mcgraw - hill , inc ., 1995 , pages 6 . 38 and 6 . 39 . this particular filter was chosen because of its simplicity , depth of notch , and because the gain can be adjusted easily , by changing the ratio of resistors r 7 and r 8 or r 13 and r 14 , to modify the frequency response of the resulting band pass filter . band pass filter 40 includes two channels , 41 and 42 , each containing a notch filter and each connected to input 43 . the outputs of the channels are subtracted in amplifier 44 . [ 0021 ] fig5 is a partial schematic of a preferred embodiment of the invention including five filters such as filter 40 ( fig4 ) each having a different center frequency . in one embodiment of the invention , the center frequencies were 316 hz , 534 hz , 900 hz , 1525 hz , 2577 hz , and the filters were one - third octave . input 50 is coupled to each of band pass filters 51 , 52 , 53 , 54 , and 55 . the outputs of filters 51 , 53 , and 55 are coupled to the non - inverting input of operational amplifier 59 , which preferably has unity gain . the outputs of filters 52 and 54 are coupled to the inverting input of amplifier 59 . this is a simpler circuit than that illustrated in fig2 but achieves the same result ; namely , subtracting alternate bands from the remaining bands . in operation , band pass filters constructed in accordance with fig4 can have the skirts of the response curve individually adjusted and , in particular made steeper than obtainable with filters of the prior art . even so , the circuit of fig5 increases the depth of the notch between filters by approximately 8 . 5 db , a significant improvement over filters of the prior art . despite the increased depth between pass bands , a signal passing through two such filters , as in a telephone for example , showed 3 db less attenuation than identical filters in which alternate pass bands were not inverted . in other words , the output signal was twice as loud with the invention as without the invention . the invention thus reduces the bandwidth of parallel filters without affecting the nominal “ q ” of the filter and provides improved separation of parallel band pass filters without changing the filters themselves . thus , the invention can be used with any band pass filter . having thus described the invention , it will be apparent to those of skill in the art that various modifications can be made within the scope of the invention . for example , the invention can be used at any frequency and can be implemented in analog or digital form ; e . g . with impedance elements as shown or as a finite impulse response ( fir ) filter or as an infinite impulse response ( iir ) filter . the inverting amplifier could precede the filter in alternate channels but this is not preferred . depending upon the application and the number of filters , one may not invert the output of every other filter . for example , if fifteen band pass filters were used , one might invert the outputs of only filters five , seven , nine , and eleven or invert the outputs of only filters one , three , five and nine . | 7 |
this invention resides in a beverage making apparatus containing a new and novel purification unit for purifying potable water . the potable water purification unit shown in fig1 . shows a perspective drawing of rectangular shaped purification unit 1 viewed along line 4 -- 4 , containing side walls 2 . generally , there are four side walls 2 , which connect with each other , forming a barrier for potable water . preferably , side walls 2 slope inwardly to facilitate the passage of water through the unit . connected to side walls 2 is bottom wall 6 which forms a support for purification agent 10 . near the top of side walls 2 is peripheral lip 8 which extends around the perimeter of side walls 2 . peripheral lip 8 mates with the top boundary of the water reservoir of a beverage making machine . it should be noted that potable water purification unit 2 can have a square configuration instead of the rectangular configuration depicted in fig1 . fig2 . shows a potable water purification unit 12 which has a circular configuration . in fig2 ., bottom wall 16 forms a support for purification agent 10 and connects to circular side wall 11 . peripheral lip 14 is located near the top of circular wall 11 and extends around the perimeter of said circular wall . fig3 . is an alternate embodiment of the water purification unit depicted in fig2 . wherein peripheral lip 18 is located near the bottom of circular wall 11 and extends around the perimeter of said circular wall . it is to be understood that the peripheral lip of the potable water purification units herein can be located near either the top or bottom of the side walls of the water purification units , in accordance with the beverage apparatus manufacturer &# 39 ; s specifications . fig4 . is a cross - section view of fig1 . in particular , potable water purification unit 1 is a cut - away view showing side wall 2 , bottom wall 6 and peripheral lip 8 located near the top of side wall 2 . bottom wall 6 has one or more openings 22 which allow purified potable water to drain therethrough . preferably , bottom wall 6 has multiple openings 22 . potable water purification agent 10 is preferably those water purification agents which effectively remove undesirable agents from potable water . representative purification agents which are suitable for use herein include activated carbon , activated silica , greensand , synthetic zeolites , polystyrene resins , alum , ferric sulfate , potassium permanganate , diatomaceous earth , bentonite clays , sodium aluminate , calcium carbonate , sodium silicate , sodium carbonate and sodium chloride and mixtures thereof . activated carbon is the preferred purifying agent 10 herein . sources for activated carbon include wood , bituminous coal , coconut shells , lignite , peat , bones , pecan shells , petroleum base residues and pulp mill black ash to name a few . the activation process consists of the source materials being carbonized under controlled conditions , the resulting carbon ( charcoal ) being treated with an oxidizing gas such as steam or air at elevated temperatures . greensand is produced from naturally occurring compositions by open pit mining said material , followed by washing , screening and treatment with caustic to remove clay . further treatment with alum , silicates and other salts produces a durable greenish - black mineral which is relatively inert except for its ion - exchange properties . synthetic zeolites are formed by mixing and reacting together solutions of sodium silicate and sodium aluminate under such conditions that precipitates do not form . the reaction mass is allowed to set into a homogenous gel , dried , crushed and activated by calcination . various metals may be added to the zeolite to enhance its water purification properties . polystyrene resins are produced by the polymerization of styrene and divinyl benzene . normally the resins form spheres of from about 0 . 45 to about 0 . 5 mm in size . preferably , the water purification agents 10 , herein , are either in solid powdered form or solid granulated form . generally , said water purification agents have a mesh size of from about 28 to about 70 . for reasons of convenience and to insure the integrity of the purification agents , it may be desirable to inclose said agent in a mesh screen or water permeable membrane . the mesh size of the screen will , of course , be smaller than the mesh size of the water purification agent . water permeable membranes by definition have very small pore openings . the use of a mesh screen or water permeable membrane will ensure the rapid addition of the water purification agent to or removal from the water purification unit . in fig5 ., potable water purification unit 1 from fig1 . ( rectangular configuration ) is supported at the top of water reservoir 25 of beverage making apparatus 24 by peripheral lip 8 . potable water is poured into water purification unit 1 , where under the influence of gravity and constrained by side walls 2 , the potable water contacts water purification agent 10 . water purification agent 10 is supported by bottom wall 6 which has multiple openings 22 . the purified water passes through the bottom wall via openings 22 into reservoir 25 of beverage making apparatus 24 . the purified water is heated using conventional beverage making apparatus heating means and transported utilizing conventional transport means to beverage apparatus opening 27 , where said heated and purified water is discharged into beverage receptacle 26 . the heated and purified water contacts beverage flavoring agent 28 and passes through bottom wall 31 via openings 32 into beverage reservoir 34 . it should be noted that beverage receptacle 26 is supported near the top portion of beverage reservoir 34 by lip 30 . suitable beverage flavoring agents include coffee or tea . it is to be understood , however , that other beverage flavoring agents which are conventional in the beverage making industry may be substituted for the above - defined coffee or tea . the flavored beverage is maintained at the desired temperature by heating pad 36 . fig6 . is an alternate embodiment of fig5 . wherein purification unit 12 ( circular configuration ) is utilized . in fig6 potable water is poured into water reservoir 25 of beverage making apparatus 24 , where it is heated using conventional heating means and transported , using conventional transportation means , to water discharge opening 27 . heated , potable water is , next , discharged into water purification unit 12 ( circular configuration ) where it contacts purification agent 10 . water purification unit 12 is supported on the top portion of beverage receptacle 26 by peripheral lip 14 . after contacting purification agent 10 , purified water drains through bottom wall 6 via multiple openings 22 and is discharged into beverage receptacle 26 . the purified water contacts beverage flavoring agent 28 and is discharged through openings 32 of bottom wall 31 into beverage reservoir 34 . the flavored beverage is maintained at the desired temperature by heating pad 36 . fig7 . is yet another embodiment of the potable water purification unit herein . particularly , fig7 . is a cut - away view of beverage making apparatus 24 in fig5 and 6 , wherein the water purification unit 38 is located below the water reservoir . potable water from the water reservoir enters water purification unit 38 via conduit 36 under the influence of gravity . potable water contacts water purification agent 10 where it is purified . water purification unit 38 can be either rectangular , square or circular in configuration , depending upon the specification of the manufacturer of the beverage making apparatus . water purification unit 38 is equipped with a bottom connecting member 41 which has screw - off and screw - on means . bottom connecting unit 38 , additionally , is equipped with sealing means , for example , an o - ring or a gasket . conventional gaskets in the beverage making technology are suitable for use herein . an example of suitable screw - on means , is mating screw threads on the bottom of purification unit 38 and on bottom connecting member 41 . the screw - on means of bottom connecting member 41 , engage , screw onto and mate with the screw threads on the bottom of purification unit 38 , forming a liquid - tight seal therewith . next , purified water is transported via conduit 42 through heat expansion conduit means 46 and conduit 48 to electric heating means 52 , where said water is heated to the desired temperature . heat expansion conduit means 46 is equipped with fastener 47 to provide a leakproof seal . conventional materials such as rubber , plastic , etc ., and fasteners are suitable for use in the construction of heat expansion conduit means 46 . heated water from electric heating means 52 is transported via conduit 50 to beverage receptacle 26 , for example , as in fig5 and 6 . from this point on , the beverage is produced in accordance with the descriptions in fig5 and 6 . obviously , many modifications and variations of the invention , as hereinbefore set forth , may be made without departing from the spirit and scope thereof , and therefore , only such limitations should be imposed as are indicated in the appended claims . | 0 |
referring now to the drawings in which like elements are represented by like numerals throughout the several views , and in particular with reference to fig1 the electroarteriography ( eag ) apparatus 10 is depicted . eag apparatus 10 comprises an eag sensor 12 , an electronic processing circuit 14 , and a signal analyzing means such as oscilloscope 16 . eag apparatus 10 is shown connected to a test subject shown in the prone position . attached to each arm of the subject are conventional electrocardiogram ( ecg ) electrodes 18 and 20 . a conventional , air inflatable cuff 22 , such as those used for taking blood pressure , is shown placed between the location of eag sensor 12 and the patient &# 39 ; s heart . cuff 22 has a conventional , air inflating device such as a rubber bulb 24 and an indicating pressure gauge 26 . thus , when cuff 22 is inflated by repeatedly compressing and releasing bulb 24 , the amount of pressure can be read on gauge 26 . obviously , as cuff 22 is inflated to a higher and higher pressure , the amount of blood flow on the distal side of cuff 22 from the heart will decrease . at pressures above systolic , an inflation pressure of approximately 150 millimeters of mercury , a complete cut - off of the blood flow beyond cuff 22 occurs and the eag signal disappears . eag sensor 12 is depicted in fig1 as being connected for measurement of blood flowing through the dorsalis pedis artery . also shown in fig1 at 12 &# 39 ; is an alternate eag sensor site to measure the blood flowing through the radial artery . other locations for the eag sensor can include the neck for monitoring the carotid artery ; on the inside , lower side of the foot to monitor the posterior tibial artery ; on the inside of the elbow to monitor the brachial artery ; and on the anterior inner part of the thigh to monitor the femoral artery . the precise eag sensor locations are illustrative only and are not meant to be either all inclusive or to be limiting . the eag signal , described in greater detail hereinbelow , will vary in both the shape of the signal and the magnitude of the signal depending upon the particular location of eag sensor 12 . for illustrative purposes , the results of the eag signal taken from the dorsalis pedis artery will be discussed and compared for various physiological conditions in the remainder of this application . eag sensor 12 comprises an eag electrode or pad 28 , a means for attaching pad 28 to the body , such as an adjustable band 30 , and a common mode signal electrode 32 . with reference to fig3 eag pad 28 is comprised of a body 34 , two electrode pads 36 and 38 housed in cavities in body 34 , and silver wires 40 and 42 respectively adhered to the back of electrode pads 36 and 38 . body 34 is preferably flexible to conform with the shape of the subject and is non - conductive . for example , body 34 can be molded from rtv or silicone rubber and have exemplary dimensions of 230 square millimeters . electrode pads 36 and 38 are preferably molded from flexible silver filled silicone rubber and are located relatively closely to each other . electrode pads 36 and 38 have exemplary dimensions of 3 millimeters by 14 millimeters and can be spaced apart from 6 millimeters to 15 millimeters on center with a presently preferred spacing of 10 millimeters . electrode pads 36 and 38 are located in cavities in body 34 and extend below the outer surface thereof . the space above the tops of electrode pads 36 and 38 is filled with a conventional electrode jelly 50 . as clearly shown in fig5 the inside surface of eag pad 28 , that is the side to be placed on the skin of the subject , has a plurality of isolation ridges to assure electrical isolation between electrode pads 36 and 38 . annular ridges 44 and 46 ( see also fig3 ) surround electrode pads 36 and 38 , respectively , and an elongate ridge 48 extending transversely on body 34 between the inward parts of annular ridges 44 and 46 further isolates electrode pads 36 and 38 from each other . because electrode jelly tends to migrate when heated by the body , ridges 44 , 46 and 48 assure that such migration is contained and does not affect the mutual electrical isolation of electrode pads 36 and 38 . thus , eag pad 28 is completely flexible and reusable and can easily conform to the particular shape of the body portion on which it is applied . most importantly , eag pad can be firmly mounted over an artery without occluding the artery . the electrode spacing is fixed to provide consistent results and the electrode size and electrical contact area with the skin is minimal to reduce electrical artifacts . common mode signal electrode 32 can be either a conventional ecg electrode or can be used in combination with eag pad 28 , as shown in fig3 and 4 and denoted 32 &# 39 ; and 32 &# 34 ; respectively . electrode 32 &# 39 ; and 32 &# 34 ; are silver filled silicone rubber electrodes that have an &# 34 ; h &# 34 ; configuration , and an annular square configuration , respectively . electrodes 32 &# 39 ; and 32 &# 34 ; have a size and configuration so as to permit electrode pads 36 and 38 to contact the skin of the subject . other configurations , such as two parallel strips , can obviously be used . electrode 32 &# 39 ; as depicted in fig3 has a size such that it will be contained within the perimeter of body 34 , whereas the electrode 32 &# 34 ; as depicted in fig4 has a size such that its annular opening will receive body 34 . in both cases , common mode signal electrode 32 is designed to be closely spaced to electrode pads 36 and 38 . alternatively , as depicted in fig1 electrode 32 is placed on the subject at a location that is spaced from eag pad 28 . such an electrode 32 can be typically placed on a bony area ( e . g ., the patella or the fibula ) to reduce the possibility of electrode 32 sensing an eag signal . a wire 52 is mounted on electrode 32 and can be easily connected to electronic processing circuit 14 . as shown in fig1 electronic processing circuit 14 includes a front end differential amplifier 54 having at least two signal inputs and a common input . wires 40 and 42 are electrically connected to the signal inputs of differential amplifier 54 and wire 52 is electrically connected to the common input of differential amplifier 54 . although an ideal differential amplifier will not respond to the common difference between the input signals , a practical differential amplifier will in fact measure a difference between two symmetrical input signals and amplify that difference . the ability of a practical differential amplifier to reject the common signal between the two inputs is denoted the common mode rejection ratio ( cmrr ). typical cmrr are 10 6 which means that a common one volt signal will appear as a microvolt artifact . because the eag signal is of the same order of magnitude ( e . g . 1 to 2 microvolts ), this is a significant error . the common signal to both inputs is usually generated by the omnipresent 60 hertz noise as well as the ecg and emg signals from the patient . electrode 32 when placed so as not to measure an eag signal and when connected to the common connection of differential amplifier 54 greatly enhances the performance of circuit 14 . as a result , a hundred fold increase in eag signal magnitude over the noise level was obtainable . differential amplifier 54 can have a common mode rejection ratio of 100 db with a differential impedance of 10 12 ohms , a common mode impedance of 10 12 ohms , and a noise level of 5 microvolts rms in a frequency range from 10 to 500 hertz . as a result of using the common mode signal electrode 32 connected to the ground connection of differential amplifier 54 , the overall common mode rejection of differential amplifier 54 is increased to 150 db . the output from differential amplifier 54 is fed through a filter 56 and a range select conventional amplifier 58 to a conventional isolation amplifier 60 . filter 56 can be a conventional two pole butterworthy band - pass filter in the 0 . 5 to 40 hertz band . the power for isolation amplifier 60 is provided from a power supply 62 fed through an isolator 64 . in this way , a signal with no ground currents can be obtained . the output from isolation amplifier 60 is connected through an output buffer 66 to the output connection of circuit 14 . as mentioned above , the input signal levels to circuit 14 are typically in the low microvolt range whereas the output signals therefrom are typically in the low millivolt range . depending upon the setting of amplifier 58 , the overall gain of circuit 14 can be 100 , 1 , 000 , or 10 , 000 and , as mentioned above , the overall common mode rejection ratio is 150 db at 60 hertz . the outut from electronic processing circuit 14 is connected through a grounded coaxial cable 68 to the channel a input of oscilloscope 16 . for the purposes of easy comparison , the output of circuit 14 is connected to oscilloscope 16 such that forward flow causes a negative signal . although an oscilloscope 16 is disclosed in fig1 it should be obvious that the same connections can be made to an ecg recorder or other signal recording or storage devices . as shown in fig1 the performing of the method according to the present invention in the embodiment of electroarteriography comprises the placement of ecg electrodes on a subject that is prone on a bed or similar platform . two ecg type electrodes are placed on one arm and one on the other arm . depending upon the portion of the arterial tree to be screened , the artery of interest is located by either palpation or by use of a conventional sonic detector . the dorsalis pedis artery was selected for eag pad 28 and the radial artery was selected for eag pad 28 &# 39 ;. discussing only the signals from the dorsalis pedis artery , eag pad 38 is placed on the skin of the subject directly over the artery with electrode pad 36 and 38 placed so that it is upstream of the other pad 38 or 36 . eag pad 28 is held in place by an appropriate means such as an adjustable strap or band 30 that is attached so as not to occlude the artery . common mode signal electrode 32 is then attached over a bony portion of the foot of the subject and all three electrodes are connected , as discussed above , to circuit 14 . circuit 14 is then connected to the channel a input of oscilloscope 16 . fig1 a shows the waveform obtained from both the eag pad 28 , at the top of the graph , and the ecg waveform from ecg electrodes 18 and 20 shown at the bottom of the graph . reference is also made to the top two wave forms in fig2 where the top waveform is the ecg signal and the bottom waveform is an eag signal that has not been inverted . a typical ecg waveform consists of a series of complex pulses which are believed to be the result of electrical signals sent to stimulate the pumping action of the heart . a typical pumping action from the heart results in a first forward flow of flood through the arteries , a small reversal of that blood flow , and a subsequent forward flow of the blood . the particular blood flow is believed to be correlated with the ecg waveform . as shown in fig2 the ecg complex wave has a small positive segment labelled &# 34 ; p &# 34 ;, followed by a small negative part , denoted &# 34 ; q &# 34 ;, which immediately precedes a large spiked pulse denoted &# 34 ; r &# 34 ;. the end of the r portion is a small negative portion , denoted &# 34 ; s &# 34 ; which slowly rises to a medium size positive pulse portion , denoted &# 34 ; t &# 34 ;. thus , the standard ecg waveform is comprised of a complex &# 34 ; pqrst &# 34 ; pulse . because of the regular form of the ecg pulses , they cannot only be used as timing pulses , but they can also be used to trigger an oscilloscope in a known manner . in fact . the fig1 a , 1b , and 1c are reproductions of actual signals obtained from human test subjects in which the oscilloscope was triggered by the r portion of the ecg . a principal discovery underlying the present invention is that the streaming potential produces a measurable signal having a complex waveform resulting from the forward - backward - forward flow of blood through the arteries . the shape of this waveform and the relative timing of the waveform with respect to the ecg waveform can determine whether the flow through the arteries is normal , is reduced because of some lesion , disease or traumatic injury is the arterial tree between the heart and the location of the eag electrodes , or is too fast , being indicative of arteriosclerosis . with particular reference to fig2 a normal dorsalis pedis eag consists of a first , large positive peak , denoted 70 , a second , small negative peak denoted 72 , and a small positive peak denoted 74 . the time between the r peak of the ecg signal and peak 70 of the eag signal is denoted the t 2 time and is a function of the time delay between the contraction of the heart and the subsequent pulse of blood flowing past the particular eag electrode . the further the placement of the eag electrode from the heart , the greater the t 2 time . similarly , the t 2 time will be increased if the blood flow is uphill , such as with the leg raised above the heart , than with the blood flow that is downhill , such as in a standing subject . other time portions of the eag signal is the time from peak 70 to peak 72 , the t 3 time , the time from peak 72 to peak 74 , the t 4 time , and the pulse width of peak 70 , the t 5 time . the t 1 time , shown in the upper graph in fig2 is the time between heartbeats and is measured between the two r peaks of the ecg signal . other usable characteristics of the eag signal is the height of peak 70 , denoted p 1 ; the height of peak 72 , denoted p 2 ; and the height of peak 74 , denoted p 3 . more particularly , it has been found that while the absolute value of the amplitude of these peaks may vary from day to day as a result of artifacts , the ratio of the peak amplitudes apparently remains constant . in order to simulate the effects of different amounts of restrictions to the blood flow , a blood pressure cuff 22 was placed on the thigh of the subject and inflated to various pressures from 0 through systolic pressure for the individual subject to a cut - off pressure . as mentioned above , fig1 a shows the result with no pressure in cuff 22 , fig1 b shows the results of 40 millimeters ( hg ) of pressure in cuff 22 , and fig1 c shows the result with 80 millimeters ( hg ) of pressure in cuff 22 . other studies performed on a subject with a known traumatic injury to the left foot resulting in permanent inflammatory edema confirmed that there is a dramatic difference in the eag signal obtained from the normal foot than from the pathologic foot . the normal foot contained the typical eag waveform as shown in fig1 a or at the second curve from the top in fig2 whereas the pathological foot had an eag signal that was very broad , lacking well defined flow reversal , and that began late in the cycle as shown in fig2 . a study of various eag signals indicates that the signals vary with a number of factors . these factors include the location at which the signal is obtained , the heartbeat of the subject ( e . g . taken while the subject is at complete rest or after the subject has walked on a treadmill ), and the location and extent of blockage of blood flow . in addition , possibly because of inconsistent electrode placement techniques , the absolute amplitude of the eag signal may vary from test to test . reliable modifications of an eag signal from an average signal that reflect predicted hemodynamic changes include the broadening of the pulse width ( t 5 greater ), lack of flow reversal ( p 2 equals zero ), a decrease in ratios of signal amplitude ( p 2 / p 1 ), and the length of time between the peak of the ecg qrs wave and the peak of the subsequent eag wave ( t 2 time ). in addition , possibly because of inconsistent electrode pressures , the absolute amplitude of the eag wave parts may vary from test to test . a review of fig1 b , 1c and the middle waveform in fig2 shows that with increasing pressure in cuff 22 , p 1 decreases , pulses 72 and 74 become less defined , and t 2 increases . in fact , the middle wave in fig2 is so distorted that it could simply be due to background noise . the bottom two waveforms in fig2 show other effects on the eag signal from reduced blood flow . with reference now to fig6 the t 2 transit times for non - symptomatic &# 34 ; normal &# 34 ; subjects obtained from the dorsalis pedis artery are depicted as falling within a normal band of values shown by the two dashed lines . the t 2 times were found to decrease with age and this is believed to be the result of the tendency of arteries to harden with age and the tendency of blood pressure to increase with age . hardening of the arteries ( arteriosclerosis ) lowered the transit time by decreasing the ability of the arterial wall to flex , making the artery more like a rigid tube . the lowered wall compliance translates into a faster blood flow and a decreased t 2 . not shown in fig6 is the effect of the height of the person , or rather the distance from the heart to the eag sensor . it has been found that there is an increase in t 2 time on the order of 20 to 40 milliseconds for a distance of one foot . although there are numerous factors which result in the variation of the t 2 time , it has been found that whenever the t 2 time falls outside of the &# 34 ; normal &# 34 ; range , ( i . e ., is too large or too small based on the age of the subject ) there is probably an abnormality in the blood velocity and further examination is warranted . such further examination can be a detailed analysis of the eag waveform or the use of other means to confirm the presence of atherosclerosis or arteriosclerosis , or some other possible damage to the arterial tree . two clinical tests shown in table i below illustrate the utility of the t 2 time . table i______________________________________patient info . t . sub . 2 time ( msec ) age sex r . leg l . leg diagnosis______________________________________90 m 230 360 atherosclerosis present in left leg . ( confirmed by angiography .) right leg borderline normal . arteriosclerosis in excess of normal for age suspected . 68 m 780 890 severe atherosclerosis in both legs . blood flow seriously reduced . ( confirmed by angiography . ) ______________________________________ from experimental results , 86 % of the trials indicated waveforms as depicted in fig1 a , 1b , and 1c . a 10 to 20 % increase in t 2 time usually accompanied cuff pressures at or below the diastolic pressure of the subject . in fact , a 10 to 20 % increase in the t 2 time was obtained with an applied cuff pressure of 40 millimeters of mercury . although the present invention does not necessarily provide a determination of the extent of an occlusion or the exact location of the occlusion , it does provide an easily applied test with immediate results which can be used to determine whether further tests should be done . application of the present invention , obviously , can be in the preliminary screening for occlusive cardiovascular disease . other uses , in a non - medical field could be the monitoring of pulsatile flow of a conductive liquid in chemical experiments , in manufacturing processes , and in liquid transportation systems . in fact , the present invention can be used in any fluid transport system in which there is a possibility of an occlusion in the conduit of the system . as described above , the present invention provides a screening process requiring no special signal processing and having a high correlation with the actual blood velocity profile and between the transit time through the vessel and the degree of occlusion in the vessel . the present invention utilizes passive electrodes of a very simple construction . by passive electrodes it is meant an electrode that only receives an electrical signal and is not used to transmit either voltage or current to the vessel being monitored . in addition , a passive electrode does not involve a chemical reaction and is substantially unaltered by the monitoring process . although one aspect of the present invention utilizing the t 2 time as the measured signal characteristic employs the ecg signal , it is obvious that in both animal and non - animal applications of the present invention a separately generated pumping signal can be used or a second set of electrodes can be placed closer to the pump outlet to provide an initial signal to which the distally detected signal can be compared . non - animal applications require a conduit that is a poor conductor in the axial direction and conductive in the radial direction ( e . g ., porous glass ). no streaming potentials are generated in axially conductive conduits ( e . g . metal ) and none can be detected non - invasively in radially non - conductive conduits ( e . g . plastic ). with respect to the medical applications of the present invention , the present invention provides a reliable , simple and non - invasive blood velocity measurement technique that has substantial value in today &# 39 ; s clinical environment . the eag waveform is remarkably similar to the blood velocity profiles that have been obtained using ultrasound techniques and , as mentioned above , are believed to be more accurate . because blood is a conductive fluid and because the blood vessel is immersed within a bulk conductor , the streaming potentials from the blood flow through certain arteries can be detected along the skin surface above that artery . the apparatus according to the present invention provides an effective way of measuring and comparing velocity dependent voltage signals produced by streaming potentials . the use of a common mode signal electrode connected to the common input of a differential amplifier permits the low voltage streaming potentials to be detected among the much larger noise signals . the above invention has been described in detail with respect to specific embodiments thereof . however , obvious modifications should be apparent to those skilled in the art . | 0 |
referring to fig2 through 4 , there is shown a circuit diagram of the present invention , which can be utilized within the decoder 114 of fig1 . fig2 shows specifically the voltage levels corresponding to a read operation , fig3 shows the voltages corresponding to a write operation and fig4 shows the voltage levels corresponding to an erase operation . the following description of the circuit structure applies to fig2 through 4 . the circuitry of the present invention includes a multiplicity of global word line decoders 10 having vpp and vpn as power supply inputs . each global decoder selects or deselects a corresponding global word line gwlb by setting it to vpn or vpp , respectively , except in program mode , when selected gwlb are switched to vpp and deselected gwlb to vpn . a global decoder can be a row or a column decoder ; however , in the preferred embodiment , the global decoders are word line decoders . the output 14 of the global decoder constitutes one of the inputs to a corresponding control logic circuit 12 . the remaining control logic input lines include ctla , ctlb , and power supply inputs vpp and vpn . within each control logic circuit 12 there are three p - channel mos transistors p1 , p2 and t2 , and three n - channel mos transistors n1 , n2 and t1 . the ctla input is connected to the gate of the transistor t2 . the input of t2 is connected to the output 14 of a global decoder 10 , the output of t2 is connected to the output gwlb [ i ] of the i - th control logic circuit 12 and the bulk of t2 is connected to vpp . the ctlb input is connected to the gate of transistor t1 . the input of t1 is connected to an output 14 of a global decoder 10 , the output of t1 is connected to an output gwlb [ i ] of a control logic circuit 12 [ i ] and the bulk of t1 is connected to vpn . note that vpp and vpn vary depending on the mode of operation . thus t1 and t2 are capable of acting as transfer devices connecting the output 14 of a global decoder 10 to the inputs of the corresponding local decoders 20 . also within the control circuit 12 , the output 14 of a global decoder is connected to the gates of the transistors n1 and p2 . all of the transistors p1 , p2 , n1 , n2 are connected in series in an inverter type configuration and the connection between transistors p2 and n1 is further connected to the output gwlb [ i ] of a control logic circuit 12 . p1 and p2 are able to pass vpp to the output gwlb [ i ] of a control logic circuit 12 while n1 and n2 , when both are active , are able to pass vpn to the output gwlb [ i ]. the transistors p1 , p2 , n1 and n2 are capable of acting as an inverter in the programming operation . the output gwlb [ i ] of each control logic circuit 12 is connected to a multiplicity of local decoders 20 . as an example each output of the control logic circuit 12 may be connected to 8 or 16 local decoder inputs . each local decoder output 18 is a local word line and is connected to the gates of the storage cells in a row . the set of all storage cells controlled by several global decoders 10 is a memory sector . within each local decoder 20 are two p - channel mos transistors t3 and p3 , and two n - channel mos transistors n3 and n4 . in addition to gwlb [ i ], the local decoders 20 have three other inputs labeled hxt [ j ], xtb , lxtb and power supplies vpp and vpn . all hxt [ j ] signals with the same sub - label [ j ] are connected together . for example the hxt [ 0 ] lines from different sectors are connected together and the hxt [ 3 ] lines from different sectors are connected together . therefore , within a sector each sub - label [ j ] corresponds to a specific j - th row local word line . hxt [ j ] is connected to the input of transistor t3 , the source of transistor t3 is connected to a local word line 18 and the bulk of t3 is connected to vpp . transistor p3 connects between vpp and a local word line 18 and serves to pull up a word line 18 to vpp . the gate of p3 is controlled by xt . the transistor n3 connects a word line 18 to lxtb and its gate is connected to the output gwlb [ i ] of a control logic circuit 12 [ i ]. the transistor n4 connects , the word line to vpn and its gate is connected to xtb . both transistors n3 and n4 ensure that the word line is solidly grounded for deselected rows during various operations . in a first preferred embodiment the physical layout of the memory device is such that all four transistors t3 , p3 , n3 , n4 corresponding to the word line 18 , are located near one end of that word line 18 . in a second embodiment the transistors t3 and p3 are located near one end of a word line 18 while n3 and n4 are located near the opposing end of the same word line 18 . the operation of the preferred embodiment in the write , read and erase modes is now described . three types of data operations can take place in a flash type eprom device within a time period defined by an on - chip timer and a chip enable signal : data read , data write and data erase . these three types of operation will be referred to as modes . in this invention the read mode operation is carried out a byte at a time , the write mode of operation is carried out a row at a time and the erase mode of operation is carried out a sector at a time . there are also two other modes which can be considered subsets of read : program verify and erase verify . table 2 shows the voltages applied to the different control lines gwlb [ i ], hxt , xt , xtb , lxtb , ctla , ctlb and supplies vpp and vpn in the read mode of operation . table 3 shows the voltages applied to the same control lines in the write mode of operation and table 4 shows the voltages applied to the control lines in the erase mode of operation . in tables 2 through 4 the first column indicates whether a word line is selected or deselected . note that in the read mode , a word line can be selected by applying 0 v to the gwlb global word line , vcc to the hxt and xt control lines and 0 v to the xtb control line . deselecting a word line in the read mode can be done in three different manners as shown in table 2 , depending on whether that word line lies within a selected or a deselected sector . table 2__________________________________________________________________________read modeword line gwlb [ j ] hxt [ i ] xt [ i ] xtb [ i ] lxtb [ i ] ctlb ctla vpp vpn__________________________________________________________________________select 0v vcc vcc 0v 0v vcc 0v vcc 0vdeselect : vcc 0v vcc vcc 0v vcc 0v vcc 0vgwlb [ l ], l ≠ jhxt [ k ], k ≠ ideselect : 0v 0v vcc vcc 0v vcc 0v vcc 0vgwlb [ j ] hxt [ k ], k ≠ ideselect : vcc vcc vcc 0v 0v vcc 0v vcc 0vgwlb [ l ], l ≠ jhxt [ i ] __________________________________________________________________________ referring to fig2 there is shown the circuit of the present invention with arrows indicating the conducting paths through active transistors in the read mode . in the read mode a memory sector is selected by means of a global decoder 10 . the selected global decoder has an output of 0 v while all de - selected global decoders have an output of vcc . transistors t1 and t2 within the corresponding control logic 12 conduct and pass the 0 v to the local decoders 20 of the selected memory sector . a specific row is selected by taking the corresponding line hxt [ j ] to a voltage vcc . the transistor t3 conducts and passes vcc to the selected word line while de - selected word lines are held at 0 v . the transistor n4 conducts in the de - selected rows j such that the corresponding hxt [ j ] is different from the selected row corresponding to hxt [ i ], holding de - selected word lines at 0 v . the transistor n3 conducts in de - selected rows of de - selected global word lines gwlb [ j ], holding these rows at lxtb [ j ]= 0 v . in the write mode the gates of all storage transistors in a selected row are held at a negative high voltage vpn of about - 10 v , while the drain of the storage transistor is connected to the line carrying the bit to be written . in this mode writing is enabled to all storage transistors in a row . table 3__________________________________________________________________________write modeword line gwlb [ j ] hxt [ i ] xt [ i ] xtb [ i ] lxtb [ i ] ctlb ctla vpp vpn__________________________________________________________________________select vpp vpp vpp 0v -& gt ; vpp vcc 0v -& gt ; vpn vpn - 10v -& gt ; 0v - 10vdeselect : vpp vpp 0v -& gt ; vpp vcc 0v -& gt ; gwlb [ l ], l ≠ j vpn vpn vpn - 10v -& gt ; 0v - 10vhxt [ k ], k ≠ ideselect : vpp vpp vpp 0v -& gt ; vpp vcc 0v -& gt ; gwlb [ j ] vpn vpn - 10v -& gt ; 0v - 10vhxt [ k ], k ≠ ideselect : vpp vpp 0v -& gt ; vpp vcc 0v -& gt ; gwlb [ l ], l ≠ j vpn vpn vpn - 10v -& gt ; 0v - 10vhxt [ i ] __________________________________________________________________________ the bulk of the storage transistors is held at 0 v and the source floats . if the bit line is high , electrons will tunnel from the isolated gate to the drain and a positive charge will be left in the isolated gate representing a zero . if the bit line is low , no tunneling occurs and the gate remains charged ( with electrons ), representing a one . referring to fig3 there is shown the circuit of the present invention in the write mode with arrows indicating the conducting paths through transistors in a conductive state . the selection of a row for writing is achieved by first selecting a sector through the corresponding global decoder 10 and making the output of that global decoder equal to - 10 v . the selection of a global decoder is achieved by sending the level - shifted address word to that global decoder over the address bus . level shifting the addresses prior to arriving at the global decoder saves considerable physical layout compared to the prior art , which employs local level shifting requiring space - consuming level shifters for each gwlb . next , a row within the selected sector is addressed by holding the ctlb line at - 10 v within the local decoder 12 and the lxtb line at - vpn in the desired row . transistors p1 and p2 will then conduct and apply vpp to the global word line gwlb [ i ], and the transistor n3 will conduct and apply - vpn to the local word line . in program mode , the control logic acts as an inverter , since the input is - 10 v ( corresponding to logic 0 ) and the output is 0 v ( logic 1 ). at the onset of the program mode , the control logic 12 changes its mode of operation from a transfer device to an inverting device . in order to make this transition possible , the ctla signal needs to follow vpp ( i . e ., transition from vcc → 0 v in response to vpp making the same transition ) and the ctlb signal must drop to 0 v immediately at the onset of programming . this ensures that both devices t2 and t1 are off and no current path is provided through t1 and t2 between the vpp node of the control circuit 12 and the vpn node of the global decoder 10 . such a leakage path could cause the voltage pump ( not shown ) that generates the negative high voltage to malfunction . a key issue at the onset of programming is the leakage path from the vpn to vpp through the unselected global word line control circuitry . initially , in a non - program mode , the output of the global decoder 10 and the control circuit 12 is a logical 1 ( typically 3 v ) for deselected gwlb . when the program mode is entered , the deselected gwlb must go to logical 0 ( typically - 10 v ). since , during programming , logical 1 is a positive voltage and logical 0 is a negative voltage , one must first discharge the deselected gwlb to a logical 1 ( 0 v ) when program mode is entered , thereby , preventing this leakage path . this is accomplished by coupling the ctla signal to the gate of the transistor n2 , which , at the onset of programming , follows vpp from vcc ( approx . 3 v ) to 0 v . the leakage current problem is now described in greater depth with reference to fig5 . referring to fig5 there is shown a schematic of the present invention illustrating signal conditions that could cause leakage current to flow at the onset of programming but for the present invention &# 39 ; s application of the ctla signal to the gate of the transistor n2 . as shown in fig5 assuming that an unselected global word line gwlb were allowed to slowly discharge from 3 v to - 10 v at the onset of programming , at some point it would reach 1 . 5 v , where both devices a and b would be partially on . as a result , a leakage path would momentarily exist from the lxtb node , which is pumped to - 10 v through the transistors b and a , to the hxt node , which follows vpp . due to this leakage path , the negative pump ( s ) needed to generate the - 10 v signals would not operate correctly . referring to fig6 there is shown a timing diagram for the various signals ( vpp , vpn , ctla , ctlb , gwlb ) described above prior to , during and after a program mode operation . table 4__________________________________________________________________________erase modesector gwlb hxt xt xtb lxtb ctla ctlb vpp vpn__________________________________________________________________________select vpn vpp vpp vpn vpn vpn vpp 10v 0vdeselect vpp vpp vpp vpn vpn vpn vpp 10v 0v__________________________________________________________________________ referring to fig4 there is shown the circuit of the present invention with arrows indicating the conducting paths through active transistors in the erase mode . in the erase mode the control gates of all storage transistors in a sector are taken to a positive high voltage vpp of about 10 v by selecting a sector through the corresponding global decoder . the output of the selected global decoder is vpn = 0 v . transistors t1 and t2 in the control logic circuit 12 conduct and transmit the 0 v to the local decoders 20 of the selected sector . all hxt [ i ] signals are held at vpp causing the transistor t3 to pass the 10 v to all word lines within a selected sector . all of the storage transistors in the selected sector are then charged . referring to fig3 in an alternative embodiment , the p - channel transistor p1 is not present in the control circuitry 12 . in this alternative embodiment the control circuitry 12 consists of five transistors , two in parallel ( t1 , t2 ) and three in series ( p1 , n1 , n2 ). this configuration allows the control circuitry 12 to be made even smaller , providing a layout advantage over the preferred embodiment . however , this arrangement prevents this use of the ctlb signal as a control signal that can be used to determine when the vpp signal is coupled to a selected global wordline gwlb . in the preferred embodiment , this end is accomplished by using the ctlb signal to determine when the vpp signal is coupled to a selected global word line gwlb . this tradeoff may be acceptable in some operating environments . while the present invention has been described with reference to a few specific embodiments , the description is illustrative of the invention and is not to be construed as limiting the invention . various modifications may occur to those skilled in the art without departing from the true spirit and scope of the invention as defined by the appended claims . | 6 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . hereinafter , embodiments of the present invention will be described in detail with reference to the accompanying drawings . a dimension of a thickness is enlarged in the accompanying drawings to clearly represent several layers and regions . a thickness ratio of respective layers shown in the drawings is not equal to an actual thickness ratio . meanwhile , when a portion such as a layer , a film , a region and a plate is formed or disposed “ on ” the other portion , it should be understood that the portion may be formed directly on the other portion through a direct contact , or another portion may be disposed therebetween . a display device according to the present invention is characterized by using two substrates , wherein one substrate includes a display element and the other substrate includes lines . the lines serve to transfer current , driving signals and the like to the display device . fig2 a to 2d illustrate a display device according to a first embodiment of the present invention and first and second substrates thereof . the display device according to the first embodiment of the present invention is explained below with reference to fig2 a to 2d . first , fig2 a shows a display element 200 including pixels 205 . in this case , the substrate may be formed of different materials according to types of the pixels 205 formed on the substrate . further , the pixels 205 include oled , pdp and lcd pixels and the like to display text , image information and the like . that is , the display element 200 includes a plurality of pixels . as the respective pixels are operated on and off , the display element 200 can display text , a pattern or a moving picture and the like . further , as shown in the drawings , it is preferable that the pixels 205 include a plurality of pixels . further , since text or image information is displayed according to whether the respective pixels are operated on and off , it is preferable to independently apply driving signals to the respective pixels . thus , as shown in the drawings , lines 206 are formed for the respective pixels , and two lines 206 are formed for each pixel in this embodiment . if an oled is used as a display device , an anode , a hole injecting layer , a hole transporting layer , a light emitting layer , an electron transporting layer and a cathode are sequentially formed on the substrate . in this case , electrode lines are respectively connected to the anode and the cathode of the oled , independently of lines formed on the second substrate . further , fig2 b shows a transparent plate 210 with a transparent conductive material 220 formed thereon . in this case , although lines formed on the transparent plate 210 are not necessarily transparent , it is preferable that the electrode is formed of a transparent material in case of using the transparent conductive material 220 or in order to improve the aesthetic effect of the display device . further , the transparent plate 210 may be formed of glass , plastic or the like . for example , the transparent conductive material 220 may be formed of ito , izo , sio 2 , zno or the like . further , the transparent conductive material 220 is divided into four portions in fig2 b to apply driving signals to the respective pixels as will be described later . further , although the transparent conductive material 220 is formed of a transparent material , the transparent conductive material 220 is represented by oblique lines in fig2 b to distinguish the transparent conductive material 220 from the transparent plate 210 . fig2 c illustrates a display device in which the display element 200 is coupled to the transparent plate 210 . specifically , fig2 c shows a side view of the display element 200 coupled to a central portion of the transparent plate 210 . in this case , the structure of pixels and lines formed on the display element 200 is omitted , and the transparent conductive material 220 formed on the transparent plate 210 is partially contacted to the display element 200 . such contact points are connecting portions to apply driving signals to a light emitting device . further , as shown in fig2 c , a central portion of the transparent plate 210 covers the display element 200 . accordingly , if the light emitting device is an oled in this embodiment , the central portion of the transparent plate 210 may serve as a sealing layer . further , although a bottom emission type oled is shown in fig2 c , it may be a top emission type oled . fig2 d illustrates a plan view of the display device shown in fig2 c . as shown in fig2 d , the transparent conductive material 220 is formed on the transparent plate 210 . further , the display element 200 is formed on the central portion of the transparent plate 210 . in this case , a plurality of pixels is formed on the display element 200 and the respective pixels are connected to the transparent conductive material 220 through the lines . further , although not shown in the drawings , the transparent plate 210 is disposed on a body of an application product and the transparent conductive material is electrically connected to the application product such that driving signals , power and the like are supplied to the transparent conductive material . in this case , the application product means a product using a display device including the above - described display element 200 and transparent plate 210 . that is , although the above - described display device is used as an independent device , the display device may be used as a part of various types of application products , which will be described later . an effect of the display device according to the first embodiment of the present invention is explained below . in this embodiment , the pixels of the oled are formed on the substrate , and the transparent plate is in contact with the substrate to seal the pixels , thereby serving as an encapsulating plate . further , the transparent plate has a size larger than the size of the pixels of the oled . when it is applied to an electronic product or the like , the transparent plate can be formed to have a size and a shape equal or similar to those of one surface of the electronic product . accordingly , as a result , the transparent plate made of glass , plastic or the like which is coated on one surface of the electronic product serves as an encapsulating plate of the oled . thus , when a light emitting device such as an oled is applied to an electronic product , it is possible to minimize the manufacturing cost of a panel and the like by minimizing the waste of the substrate . further , since it is easy to manufacture general glass and plastic in a desired shape , it is possible to manufacture substrates having various shapes and sizes when it is applied to a product , thereby enabling various design applications . fig3 a and 3b illustrate a display device according to a second embodiment of the present invention and first and second substrates thereof . the display device according to the second embodiment of the present invention is explained below with reference to fig3 a and 3b . in fig3 a , a metal 225 is formed on the transparent plate 210 and the metal 225 is formed of thin metal . that is , this embodiment features that driving signals are applied to a light emitting device through the thin metal 225 instead of the transparent conductive material of the above embodiment . in this case , the metal 225 is formed of a conductive material . the metal 225 should have a thickness which is difficult to be cut , but if the thickness of the metal 225 is excessively large , it may ruin the beauty of the light emitting device . if the metal 225 is manufactured to have a diameter of 1 mm or less , it is possible to ensure durability without ruining the beauty . further , fig3 b illustrates a plan view of the display device in which a first substrate 310 is coupled to the second substrate 210 shown in fig3 a . in this case , the display element 200 is equal to the display element 200 shown in the first embodiment . accordingly , pixels and lines of an oled or the like are formed on the display element 200 . the lines are connected to the metal 225 formed on the transparent plate 210 to receive driving signals of the light emitting device . in the display device according to the second embodiment of the present invention , when a light emitting device of an oled is applied to a substrate , it is possible to minimize the manufacturing cost of a panel and the like by minimizing the waste of the substrate . further , it is possible to transfer driving signals through thin metal . furthermore , as described above , the pixels of the oled are formed on the substrate and the transparent plate is in contact with the substrate to seal the pixels , thereby serving as an encapsulating plate . fig4 a and 4b illustrate a display device according to a third embodiment of the present invention and first and second substrates thereof . the display device according to the third embodiment of the present invention is explained below with reference to fig4 a and 4b . this embodiment features that a groove is formed on the central portion of the transparent plate . further , an encapsulating plate of the display device is formed to have a smaller size than that of the display device . in this case , the encapsulating plate is inserted into the groove . first , fig4 a shows the transparent plate 210 with the transparent conductive material 220 formed thereon . further , a groove 212 is formed in the transparent plate 210 . although the groove 212 formed in a rectangular shape is shown in fig4 a , the groove 212 may be formed in different shapes such as a triangular shape or a circular shape . the shape of the groove 212 may be selected according to the shape of the display device . further , as described above , metal may be formed instead of the transparent conductive material 220 . next , fig4 b illustrates a display device in which the display element 200 is coupled to the transparent plate 210 . in this case , although not shown in the drawings , the pixels and lines are formed on the display element 200 . further , an encapsulating plate 215 is formed on the display element 200 to seal the display element 200 . further , the encapsulating plate 215 is inserted into the groove 212 inside of the transparent plate 210 . in fig4 b , the transparent conductive material 220 formed on the transparent plate 210 is partially contacted to the display element 200 . contact points 250 are shown in fig4 b , and driving signals of the light emitting device are transferred to the display element 200 through the contact points 250 . further , the display device shown in fig4 b is a top emission type device if a light emitting device is an oled , and may be a bottom emission type device . in the display device according to the third embodiment of the present invention , the groove is formed in the substrate . accordingly , it is possible to minimize the manufacturing cost of a panel and the like by minimizing the waste of the substrate . further , light emitted from the pixels is directly emitted to the outside without passing through the transparent plate . thus , reproducibility of color purity is further enhanced . the above - described display device according to the present invention can be used in various application products . in this case , the display device can display operation characteristics of the product and the like by driving signals applied from the lines connected to the application product . specifically , an example in which the display device is used in an air conditioner is explained . as shown in fig5 , a display device 550 disposed at an outer portion of an air conditioner 500 may display a room temperature , a setting state of the air conditioner and the like . in this case , the above - described display device makes it possible to reduce the manufacturing cost without ruining the beauty of the display . further , when a chromatic substrate is used instead of the transparent plate , it is possible to improve the beauty of the display device . although the transparent plate is formed at a portion of a front surface of a body of the air conditioner in fig5 , if the transparent plate is formed on the whole front surface of the body , it may promote the beauty . further , the body of the air conditioner may have a circular , triangular or star shape instead of a rectangular shape , and the transparent plate may be formed in the same shape as the body of the air conditioner . in this case , it is possible to obtain an aesthetic effect and an advantage in a manufacturing process since it is easy to join the transparent plate to the air conditioner . further , as shown in fig6 , a display device 650 disposed at an outer portion of a refrigerator 600 may display a cooling state , temperature setting and the like . in this case , the display device including the display element , the transparent plate and the like makes it possible to reduce the manufacturing cost without ruining the beauty of the display . further , as described above , when a chromatic substrate is used instead of the transparent plate , it is possible to improve the beauty of the display device . further , as shown in fig7 , a display device 750 disposed at an outer portion of a mobile phone 700 may display dialing and dialed numbers , text information and the like . further , the display device 750 has the same configuration as the above - described air conditioner , refrigerator or the like . further , although four oled pixels are shown in fig7 , a number of the pixels sufficient to display a text message , a moving picture and the like are provided on the entire screen . further , although respective components , a transparent conductive material and the like are shown to be distinguishable to promote the understanding , they cannot be easily distinguished with the naked eye . in the above - described display device and a temperature control unit including the same according to the present invention , when a light emitting device such as an oled is formed on a substrate , it is possible to minimize the manufacturing cost of a panel and the like by minimizing the waste of the substrate . further , since it is easy to manufacture general glass and plastic in a desired shape , it is possible to manufacture substrates having various shapes and sizes when it is applied to a product , thereby enabling various design applications . that is , the display device according to the present invention can be used in various electronic products , for example , a washing machine , a power unit such as a vacuum cleaner in addition to the above - described temperature control units such as a refrigerator and an air conditioner . further , even in application products except electronic products , when it is necessary to display information regarding a product and the like , the display device may be attached to the product and used . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the inventions . thus , it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 7 |
the present invention is described in further detail with reference to examples which are illustrative only and should not be construed to limit the scope of the invention in any manner . this example describes the preparation of the catalyst composite material , aluminosilicate ( zeolite l ). in a typical preparation , 4 . 85 g aluminium source was dissolved in a solution of 4 . 8 g sodium hydroxide , 20 . 16 g potassium hydroxide and 105 g of water to yield solution a . 37 . 32 g fumed silica was added slowly , with vigorous stirring to solution a . the gel so obtained was transferred into a stainless steel autoclave and the autoclave was capped tightly and put in an oven thermostated at the desired temperature for 4 . 5 days . then the autoclave was removed from the oven and the crystallization was terminated by quenching the autoclave reaction with cold water . after cooling , the autoclave was opened , the contents were filtered , washed thoroughly and dried at 120 ° c . for 8 hrs . the x - ray diffraction and framework ir data of the so obtained material correspond to those given in table 1 and table 2 , respectively . table 1______________________________________aluminosilicate , zeolite k - linterplanar relativedistance d . a °. intensity______________________________________15 . 93 ± . 05 1008 . 20 ± . 05 6 . 37 . 52 ± . 05 29 . 26 . 02 ± . 05 22 . 25 . 82 ± . 05 17 . 54 . 80 ± . 04 24 . 53 . 82 ± . 04 28 . 23 . 66 ± . 04 22 . 03 . 48 ± . 03 14 . 83 . 28 ± . 03 16 . 13 . 18 ± . 03 28 . 43 . 06 ± . 03 22 . 42 . 81 ± . 03 35 . 82 . 85 ± . 03 16 . 1______________________________________ table 2______________________________________inferred spectroscopic data of catalyst compositematerial alumiosilicate zeolite k - l . frequency relative ( cm . sup .- 1 ) intensity______________________________________ 1150 vs 1080 vs 1020 vs 770 m 720 m 608 m 438 sh______________________________________ the chemical composition of the catalyst material in the anhydrous state was : this example illustrates the procedure for the conversion of cumene to 2 - chlorocumene , 3 - chlorocumene , 4 - chlorocumene , α - chlorocumene and polychlorinated cumenes . the reaction was carried out in a three necked flask ( 250 ml ), one neck was fitted with a condenser , another with a thermometer and the third with a rubber septum . 60 g cumene and 2 g catalyst composite material , zeolite k - l as set out in example 1 , were taken in the flask . 0 . 652 g mono - chloroacetic acid was added thereto . the reaction mixture is stirred and heated upto 70 ° c . in the presence of nitrogen gas . then , chlorine gas was supplied at a rate of 0 . 33 mol / h for three hours to conduct the reaction while maintaining the reaction temperature at 70 ° c . after the completion of the reaction , the reaction mixture cooled to room temperature and analyzed by gas - chromatography . the results are recorded in table 3 . table 3______________________________________chlorination of cumene over catalyst composite material , aluminosilicatezeolite k - l after 3 hours . ______________________________________cumene conversion ( wt . %) 92 . 3product yields ( wt . %) 2 - chlorocumene 7 . 853 - chlorocumene 1 . 644 - chlorocumene 75 . 55α - chlorocumene 0 . 78polychlorinated cumenes 6 . 53selectivity to para - chlorocumene in chlorocumenes 88 . 8______________________________________ this example illustrates the effect of reaction time on the conversion of cumene to 2 - chlorocumene , 3 - chlorocumene , 4 - chlorocumene , α - chlorocumene and polychlorinated cumenes . the reaction was carried out in a three necked flask ( 250 ml ), one neck was fitted with a condenser , another with a thermometer and the third with a rubber septum . 60 g cumene and 2 g catalyst composite material , zeolite k - l as set out in example 1 , were taken in the flask . 0 . 652 g mono - chloroacetic acid was added thereto . the reaction mixture is stirred and heated upto 70 ° c . in the presence of nitrogen gas . then , chlorine gas was supplied at a rate of 0 . 33 mol / h for three hours to conduct the reaction while maintaining the reaction temperature at 70 ° c . after the completion of the reaction , the reaction mixture cooled to room temperature and analyzed by gas - chromatography . the results are recorded in table 4 . table 4______________________________________effect of reaction time on the conversion and selectivity in thechlorinationof cumene over catalyst composite material aluminosilicate , zeolite k - l . reaction time ( h ) 1 2 3______________________________________cumene conversion ( wt . %) 34 . 20 66 . 60 92 . 30product yields ( wt . %) 2 - chlorocumene 2 . 60 5 . 30 7 . 853 - chlorocumene 0 . 62 1 . 20 1 . 644 - chlorocumene 30 . 73 58 . 00 75 . 55α - chlorocumene 0 . 18 0 . 50 0 . 78polychorinated cumenes 0 . 07 1 . 60 6 . 53selectivity to para - chlorocumene in chlorocumenes 90 . 51 89 . 90 88 . 80 (%) ______________________________________ this example illustrates the effect of the reaction temperature on the yield and selectivity of 4 - chlorocumene . the reaction was carried out in a three necked flask ( 250 ml ), one neck was fitted with a condenser , another with a thermometer and the third with a rubber septum . 60 g cumene and 2 g catalyst composite material , zeolite k - l as set out in example 1 , were taken in the flask . 0 . 652 g mono - chloroacetic acid was added thereto . the reaction mixture is stirred and heated at different temperatures in the presence of nitrogen gas . then , chlorine gas was supplied at a rate of 0 . 33 mol / h to conduct the reaction . after the completion of the reaction , the reaction mixture cooled to room temperature and analyzed by gas - chromatography . the results are recorded in table 5 . table 5______________________________________effect of reaction temperature on the conversion and selectivity in thechlorination of cumene over catalyst composite material , aluminosilicate , zeolite k - l . ______________________________________reaction temperature (° c .) 110 139reaction time ( h ) 3 2 . 5cumene conversion ( wt . %) 92 . 3 76 . 6product yields ( wt . %) 2 - chlorocumene 7 . 85 11 . 43 - chlorocumene 1 . 64 2 . 14 - chlorocumene 75 . 55 58 . 6α - chlorocumene 0 . 78 1 . 8polychlorinated cumenes 6 . 53 2 . 7selectivity to para - chlorocumene in chlorocumenes (%) 88 . 8 81 . 3______________________________________ in this example , the influence of the solvent ( 1 , 2 - dichloroethane ) is demonstrated on the conversion of cumene to 2 - chlorocumene , 3 - chlorocumene , 4 - chlorocumene , α - chlorocumene and polychlorinated cumenes . 40 g of cumene and 150 ml of 1 , 2 - dichloroethane and 1 g of catalyst composite material , zeolite k - l , as set out in example 1 were taken for the reaction in a three necked flask . 0 . 652 g mono - chloroacetic acid was added thereto . the reaction mixture was stirred and heated upto 50 ° c . in the presence of nitrogen gas . then , chlorine gas was supplied at a rate of 0 . 33 mol / h for two hours to conduct the reaction while maintaining the reaction temperature at 50 ° c . after the completion of the reaction , the reaction mixture was cooled to the room temperature and analyzed with gas - chromatography . the results are recorded in table 6 . table 6______________________________________effect of solvent ( 1 , 2 - dichloroethane ) on the selectivity in thechlorinationof cumene over catalyst composite material , aluminosilicate , zeolite______________________________________k - l . cumene conversion ( wt . %) 68 . 8product yields ( wt . %) 2 - chlorocumene 2 . 853 - chlorocumene 0 . 814 - chlorocumene 64 . 51α - chlorocumene 0 . 00polychlorinated cumenes 0 . 58selectivity to para - chlorocumene in chlorocumenes 94 . 63______________________________________ this example illustrates the effect of the reaction time on the conversion of cumene to 2 - chlorocumene , 3 - chlorocumene , 4 - chlorocumene , α - chlorocumene and polychlorinated cumenes in the presence of solvent 1 , 2 - dichloroethane . 40 g of cumene and 150 ml of 1 , 2 - dichloroethane and 1 g of catalyst composite material , zeolite k - l , as set out in example 1 were taken for the reaction in a three necked flask . 0 . 652 g mono - chloroacetic acid was added thereto . the reaction mixture was stirred and heated upto 50 ° c . in the presence of nitrogen gas . then , chlorine gas was supplied at a rate of 0 . 33 mol / h for three hours to conduct the reaction while maintaining the reaction temperature at 50 ° c . after the completion of the reaction , the reaction mixture was cooled to the room temperature and analyzed with gas - chromatography . the results are recorded in table 7 . table 7______________________________________effect of reaction time on the conversion of cumene and product yieldsover catalyst composite material , aluminosilicate , zeolite k - l , in thepresence of 1 , 2 - dichloroethane . reaction time ( h ) 0 . 5 1 . 0 2 . 0 3 . 0______________________________________cumeneconversion ( wt . %) 5 . 70 18 . 90 68 . 80 98 . 50product yields ( wt . %) 2 - chlorocumene 0 . 17 0 . 72 2 . 85 6 . 613 - chlorocumene 0 . 00 0 . 17 0 . 81 0 . 714 - chlorocumene 5 . 55 18 . 05 64 . 51 89 . 13α - chlorocumene 0 . 00 0 . 00 0 . 00 0 . 50polychlorinated cumenes 0 . 00 0 . 00 0 . 58 1 . 56selectivity to para - chlorocumene in chloro - 97 . 00 95 . 30 94 . 63 92 . 40cumenes______________________________________ this example describes the reaction of cumene with liquid bromine to give 4 - bromocumene . 10 g of cumene , 5 g of catalyst composite material , zeolite k - l and 2 . 14 ml bromine were mixed in a batch reactor . the reaction mixture was stirred and heated up to 70 ° c . after completion of the reaction , the mixture was let to cool to room temperature and analysed by gas - chromatography . the conversion of cumene and the selectivity for 4 - bromocumene were found to be 10 . 7 wt . % and 78 . 8 %, respectiveley . this example illustrates the preparation of 4 - iodocumene . 20 g cumene , 2 g of iodine monochloride and 1 g catalyst composite material , zeolite h - beta , were taken for the reaction in a three necked flask . the reaction mixture was stirred and heated up to 70 ° c . after the completion of the reaction , the reacation mixture was cooled to the room temperature and analyzed with gas - chromatography . the conversion of cumene and the selectivity for 4 - iodocumene were found to be 7 . 6 wt . % and 79 . 6 %, respectively . ( 1 ) the resulting advantages are that a corrosion free plant can be used . ( 3 ) the expenditure on homogeneous lewis acid catalysts such as fecl 3 is no longer necessary . ( 4 ) the problem of the need to dispose off inorganic byproducts does not arise . ( 5 ) due to the shape selectivity and porous nature of zeolites , these catalysts produce higher amount of para - products at the expence of the other consecutive products . ( 6 ) the process of the present invention shows remarkably high industrial merits over proir art process for the preparation of halocumenes . the starting materials are easily available and easy to handle and that halocumenes can be produced in high yield by extremly simple operation . | 2 |
the following description of various embodiments is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . while various embodiments have been described for purposes of this specification , various changes and modifications may be made which will readily suggest themselves to those skilled in the art and which are encompassed in the spirit of the invention both disclosed herein and as defined in the appended claims . fig1 shows an embodiment of a system 100 for searching a publicly accessible network . the system 100 includes a computing device 104 which represents a local machine to a user and a remote computing device 108 which represents generally a remote computing device in communication with the local computing device 104 over the publicly accessible network . in one embodiment , a publicly accessible network is the internet . in other embodiments , networks with varying degrees of public access may be considered publicly accessible networks . for example , a free wireless network may be considered a publicly accessible network . in addition , in some instances , an intranet may be considered a publicly accessible network . as shown in fig1 , computing device 104 and computing device 108 are separate computing devices . for example , computing device 104 may be a personal computer and computing device 108 may be a business , industrial or mainframe computer . computing device 108 may be a distributed computing device as known to those with skill in the art . as represented in fig1 , computing device 108 is designated a single computing device only for the expediency of showing that search engine 110 is located on a separate computing device 108 from computing device 104 . those skilled in the art will understand that a search engine may actually be implemented in several computing devices and / or distributed over a broad range of physical machines . computing device 104 may also be physically implemented as several computing devices . computing device 104 is shown in the embodiment of fig1 as a single computing device running both an interim graphical user interface ( gui ) 126 and a browser program 124 . computing device 104 has a user input device 102 which represents user input devices such as a keyboard , a mouse , a touch pad or other means for user input of data . as shown in fig1 , user input device 102 connects to the interim gui through dotted line 106 indicating that the user input device is capable of launching the interim gui 126 . this launching process will be discussed in greater detail below . the interim gui 126 and the browser program 124 are different software routines or programs with different functions inside the computing device 104 . in one embodiment , the interim gui 126 is launched initially from the user input device 102 through a keyboard message or other signal . the interim gui 126 may receive a text string from the user input device , construct a search string from the text string , and launch the browser program 124 . unlike the browser program 124 , the interim gui does not show search results and , is not a general purpose program . for example , the interim gui allows a search to be performed whereas the browser program 124 allows navigation and access to content on the publicly accessible network . specifically , a browser program may allow a user to read a web page on the internet , download information from the internet , and view a video clip stored on the internet . by contrast , the interim gui 126 only allows the parameters of the search ( e . g ., instructions from a user ) to be entered and only performs the function of assisting and processing that search , for example , through the launching of the browser program 124 . these parameters may include , for example , a text string for a search and a type of file to be targeted by the search . the parameters may be entered through any appropriate means . for example , a text string may be entered through a text entry field of the interim gui 126 , and a type of file may be selected through an input element such as a radio button . as another example , both a text string for a search and a type of file may be entered by keystrokes from a keyboard . in an alternative embodiment , computing device 104 and computing device 108 may be interconnected or may otherwise be parts of the same computing device . for example , a single computing device ( not shown ) may operate the interim gui 126 , the browser program 124 , and the search engine 110 , and the search engine may search for files stored in that single computing device ( e . g ., a desktop search ) based on a text string received , as described further herein , by the interim gui 126 and passed , as described further herein , to the browser program 124 ( e . g ., through launching the browser program containing a search string ). in fig1 , signals between interim gui 126 , browser program 124 , and search engine 110 are noted for purposes of illustrating embodiments of interactions between those elements . the dash - plus - dots set of signals , e . g ., 112 , 114 , and 122 , illustrate one embodiment of interactions between the elements , while the dashed set of signals , e . g ., signals 120 , 118 , and 116 , illustrate another embodiment . these embodiments will be discussed in further detail below . as described above , a search engine 110 is located on a remote computing device 108 and it receives search requests ( e . g ., comprising search strings ) from various entities . the interim gui 126 may send a search string directly to the search engine as indicated with the signal 112 . the search engine may then respond with search results as indicated by signal 114 . in this embodiment , the interim gui may then launch the browser program with the search string in some or all of the search results as indicated by signal 122 . the search results may be ranked or rated , such that there is a first rated search result which has the highest ranking . types of rankings or ratings of search results are known to those with skill in the art and may contain different categories ( e . g ., sponsored sites , popular sites , recently updated sites ). in another embodiment , the interim gui 126 may launch the browser program 124 as indicated by signal 120 with a search string that the interim gui has constructed from a text string received from the user input device . thus , as indicated by signal 120 , the interim gui may launch the browser program before a search has been performed . the browser program may then launch and send the search string to the search engine as indicated by signal 118 . in this embodiment , the search engine responds to the search request with search results sent to the browser program as indicated by signal 116 . elements of the systems described herein may be implemented in hardware , software routines , firmware , any combination thereof , or in another appropriate medium . the systems described herein may implement methods described herein . in addition , the methods described herein may form systems described herein when implemented in hardware , software , firmware , any combination thereof , or in another appropriate medium . therefore , the descriptions of the methods and systems herein supplement each other and should be understood by those with skill in the art forming a cumulative disclosure . the methods described herein may be performed by any part of a system described herein . in addition , the methods described herein may be performed iteratively , repeatedly , and / or in parts . some of the methods or parts of the methods described herein may be performed simultaneously . in addition , elements of the systems described herein may be distributed geographically or functionally in any configuration . fig2 shows a flowchart of an embodiment of a method 200 for launching the browser . in the embodiment shown , a first keyboard message is received 202 . this keyboard message may be received 202 in many manners , including through intercepting low level keyboard messages or through remapping registry entries . as known by those with skill in the art , there are several methods for intercepting , interpreting and receiving keyboard messages . any of these techniques may be used in order to facilitate receiving a first keyboard message 202 . after a first keyboard message is received 202 , the first keyboard message is interpreted 204 as a request to perform a search . those with skill in the art will understand there are several ways to interpret the first keyboard message . in one embodiment , as described above , a computer registry may be remapped in order to aid in interpreting the first keyboard message . in another embodiment , a monitoring software routine may be run in order to interpret the first keyboard message as a request to perform a search . in another embodiment , the monitoring software routine may be integrated into another software routine which launches an interim gui after the request is interpreted 204 . after the first keyboard message is interpreted as a request to perform a search 204 , the embodiment 200 shown in fig2 displays an interim gui 206 . the interim gui can assist in performing a search by receiving a text string from a user through a user input device . the characteristics of an interim gui itself are described further herein . in one embodiment , when the interim gui is displayed 206 , any further input from a keyboard or other user input device is directed to a text entry field on the interim gui . for example , any text entries from a user input device which follow the display of the interim gui will be entered into the interim gui &# 39 ; s text entry field . those skilled in the art will understand that there are several ways of implementing such direction of text to a particular text field . in addition , those skilled in the art will understand that such a direction of text into a particular text entry field may be easily changed through a user input device such as a keyboard ( e . g ., through a tab key ) or through another user input device such as a mouse ( e . g ., through push button selection ) such that text is entered into a different text field or a different program . in another embodiment , the text entries from a user are not automatically directed to the interim gui . for example , a user may need to actively select the text entry field of the interim gui in order to direct the user &# 39 ; s text entries to the interim gui . the description above of directing the text from user input device into the interim gui &# 39 ; s text entry field is not meant as a limitation that the text entry from a user input device be permanently directed through the text entry of the interim gui . rather , text entry from the user input device such as a keyboard may be temporarily directed to the text entry field for the interim gui with such direction able to be changed at the will of a user through further selection by the user of another gui element . in the embodiment of the method shown , a text string is received 208 in the text entry field of the interim gui . in one embodiment , the text string may be received 208 and processed as it is typed by a user . in another embodiment , the text string may be received 208 and processed after the user has indicated the text string is complete , for example , by signaling through a conventional method that the text string is complete ( e . g ., a carriage return , the enter key , selection of a radio button ). in the embodiment shown in fig2 , after a text string is received 208 , a search string is constructed 210 . because a search string may contain instructions for a search engine , including the text string , there are many types of search strings . the search string constructed 210 may include any type of search string now known or any type later developed . in one embodiment , constructing a search string 210 is performed to produce a search string which is specially adapted for a particular search engine . in another embodiment , a search string may be constructed 204 to a generic standard . in one embodiment , constructing a search string may include information about the type of search to be performed on the text string . for example , a search may be for a particular type of file on a publicly accessible network , such as an image file , a video file , a scholarly journal article , a text file , a presentation file of a particular format , or another type of file . the type of file searched for may be based on the content or subject matter of the file ( e . g ., news , sports , entertainment ), for example , through use of descriptors , meta - data , tags or metatags , or other data related with a file or its contents . for example , a type of file may include a descriptor of the content of the file . in some embodiments , selecting a type of file which includes a descriptor of the content of the file will affect the construction of the search string 210 , including through the addition of the descriptor in the search string . the search string constructed 210 may include information about this type of file to guide a search engine to search files containing at least part of the text string which also match the type or types of files selected . in the embodiment shown , after the search string is constructed 210 , the search string is transmitted 212 over a publicly accessible network . the transmitting of the search string 212 over a publicly accessible network may be directed toward a search engine address ( e . g ., a network address which accesses a search engine ) capable of receiving the search string . in one embodiment , a search engine address may include a search string or an encoded version of the search string , and accessing the search engine from that address invokes a search by the search engine of that search string . it should be noted , as described above and as further described herein , that a search string may be transmitted 212 by the same software routine or program which is displaying the interim gui or may be transmitted 212 by another software routine , such as a browser program . the order described in fig2 of transmitting the search string over the publicly accessible network before a browser program is launched describes just one embodiment . in another embodiment ( not shown ), transmitting the search string 212 over a publicly accessible network and receiving search results 214 may be performed after issuing a launch command 216 to activate a browser program . in this embodiment , the received search results are not received by the interim gui and , instead , the interim gui issues a launch command 216 based only on instructions received from a user . in one embodiment the instructions received from the user are the text string received 208 . in another embodiment , the instructions received from the user are the text string received 208 and a file type selection received from the user . upon receiving search results 214 , as a response to the transmitted search string , those search results in the initial search string may be included in a launch command used to activate a browser program . in the embodiment shown , after receiving search results 214 , a launch command is issued 216 to activate a browser program . a browser program may be launched with an initial site to browse the search engine . in another embodiment , the browser program may be launched 216 with part of the search results received 214 . the preceding description of various embodiments is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . | 6 |
fig1 shows a patient 101 undergoing non - invasive neuromodulation therapy ( ninm ) using a neurostimulation system 100 . during a therapy session , the neurostimulation system 100 non - invasively stimulates various nerves located within the patient &# 39 ; s oral cavity , including at least one of the trigeminal and facial nerves . in combination with the ninm , the patient engages in an exercise or other activity specifically designed to assist in the neurorehabilitation of the patient . for example , the patient can perform a physical therapy routine ( e . g ., moving an affected limb , or walking on a treadmill ) engage in a mental therapy ( e . g ., meditation or breathing exercises ), or a cognitive exercise ( e . g ., computer assisted memory exercises ) during the application of ninm . the combination of ninm with an appropriately chosen exercise or activity has been shown to be useful in treating a range of maladies including , for example , traumatic brain injury , stroke ( tbi ), multiple sclerosis ( ms ), balance , gait , vestibular disorders , visual deficiencies , tremor , headache , migraines , neuropathic pain , hearing loss , speech recognition , auditory problems , speech therapy , cerebral palsy , blood pressure , relaxation , and heart rate . for example , a useful non - invasive neuromodulation ( ninm ) therapy routine has been recently developed as described in u . s . pat . no . 8 , 849 , 407 , the entirety of which is incorporated herein by reference . fig2 a and 2b show a non - invasive neurostimulation system 100 . the non - invasive neurostimulation system 100 includes a controller 120 and a mouthpiece 140 . the controller 120 includes a receptacle 126 and pushbuttons 122 . the mouthpiece 140 includes an electrode array 142 and a cable 144 . the cable 144 connects to the receptacle 126 , providing an electrical connection between the mouthpiece 140 and the controller 120 . in some embodiments , the controller 120 includes a cable . in some embodiments , the mouthpiece 140 and the controller 120 are connected wirelessly ( e . g ., without the use of a cable ). during operation , a patient activates the neurostimulation system 100 by actuating one of the pushbuttons 122 . in some embodiments , the neurostimulation system 100 periodically transmits electrical pulses to determine if the electrode array 142 is in contact with the patient &# 39 ; s tongue and automatically activates based on the determination . after activation , the patient can start an ninm treatment session , stop the ninm treatment session , or pause the ninm treatment session by pressing one of the pushbuttons 122 . in some embodiments , the neurostimulation system 100 periodically transmits electrical pulses to determine if the electrode array 142 is in contact with the patient &# 39 ; s tongue and automatically pauses the ninm treatment session based on the determination . during an ninm treatment session , the patient engages in an exercise or other activity designed to facilitate neurorehabilitation . for example , during an ninm treatment session , the patient can engage in a physical exercise , a mental exercise , or a cognitive exercise . in some embodiments , the controller 120 has pushbuttons on both arms . in some embodiments , a mobile device can be used in conjunction with the controller 120 and the mouthpiece 140 . the mobile device can include a software application that allows a user to activate the neurostimulation system 100 and start or stop an ninm treatment session by for example , pressing a button on the mobile device , or speaking a command into the mobile device . the mobile device can obtain patient information and treatment session information before , during , or after an ninm treatment session . in some embodiments , the controller 120 includes a secure cryptoprocessor that holds a secret key , to be described in more detail below in connection with fig9 a and 9b . the secure cryptoprocessor is in communication with a microcontroller . the secure cryptoprocessor can be tamper proof . for example , if outer portions of the cryptoprocessor are removed in an attempt to access the secret key , the cryptoprocessor erases all memory , preventing unauthorized access of the secret key . fig2 c shows a non - invasive neurostimulation system 100 . as shown , a mobile device 121 is in communication with a mouthpiece 140 . more specifically , the mobile device 121 includes a processor running a software application that facilitates communications with the mouthpiece 140 . the mobile device 121 can be , for example , a mobile phone , a portable digital assistant ( pda ), or a laptop . the mobile device 121 can communicate with the mouthpiece 140 by a wireless or wired connection . during operation , a patient activates the neurostimulation system 100 via the mobile device 121 . after activation , the patient can start an ninm treatment session , stop the ninm treatment session , or pause the ninm treatment session by manipulating the mobile device 121 . during an ninm treatment session , the patient engages in an exercise or activity designed to provide neurorehabilitation . for example , during an ninm treatment session , the patient can engage in a physical exercise , a mental exercise , or a cognitive exercise . fig3 a shows the internal circuitry housed within the controller 120 . the circuitry includes a microcontroller 360 , isolation circuitry 379 , a universal serial bus ( usb ) connection 380 , a battery management controller 382 , a battery 362 , a push - button interface 364 , a display 366 , a real time clock 368 , an accelerometer 370 , drive circuitry 372 , tongue sense circuitry 374 , audio feedback circuitry 376 , vibratory feedback circuitry 377 , and a non - volatile memory 378 . the drive circuitry 372 includes a multiplexor , and an array of resistors to control voltages delivered to the electrode array 142 . the microcontroller 360 is in electrical communication with each of the components shown in fig3 a . the isolation circuitry 379 provides electrical isolation between the usb connection 380 and all other components included in the controller 120 . additionally , the circuitry shown in fig3 a is in communication with the mouthpiece 140 via the external cable 144 . during operation , the microcontroller 360 receives electrical power from battery 362 and can store and retrieve information from the non - volatile memory 378 . the battery can be charged via the usb connection 380 . the battery management circuitry controls the charging of the battery 362 . a patient can interact with the controller 120 via the push - button interface 122 that converts the patient &# 39 ; s pressing of a button ( e . g . an info button , a power button , an intensity - up button , an intensity - down button , and a start / stop button ) into an electrical signal that is transmitted to the microcontroller 360 . for example , a therapy session can be started when the patient presses a start / stop button after powering on the controller 120 . during the therapy session , the drive circuitry 372 provides an electrical signal to the mouthpiece 140 via the cable 144 . the electrical signal is communicated to the patient &# 39 ; s intraoral cavity via the electrode array 142 . the accelerometer 370 can be used to provide information about the patient &# 39 ; s motion during the therapy session . information provided by the accelerometer 370 can be stored in the non - volatile memory 378 at a coarse or detailed level . for example , a therapy session aggregate motion index can be stored based on the number of instances where acceleration rises above a predefined threshold , with or without low pass filtering . alternatively , acceleration readings could be stored at a predefined sampling interval . the information provided by the accelerometer 370 can be used to determine if the patient is engaged in a physical activity . based on the information received from the accelerometer 370 , the microcontroller 360 can determine an activity level of the patient during a therapy session . for example , if the patient engages in a physical activity for 30 minutes during a therapy session , the accelerometer 370 can periodically communicate ( e . g . once every second ) to the microcontroller 360 that the sensed motion is larger than a predetermined threshold ( e . g . greater than 1 m / s 2 ). in some embodiments , the accelerometer data is stored in the non - volatile memory 378 during the therapy session and transmitted to the mobile device 121 after the therapy session has ended . after the therapy session has ended , the microcontroller 360 can record the amount of time during the therapy session in which the patient was active . in some embodiments , the recorded information can include other data about the therapy session ( e . g ., the date and time of the session start , the average intensity of electrical neurostimulation delivered to the patient during the session , the average activity level of the patient during the session , the total session time the mouthpiece has been in the patient &# 39 ; s mouth , the total session pause time , the number of session shorting events , and / or the length of the session or the type of exercise or activity performed during the therapy session ) and can be transmitted to a mobile device . a session shorting event can occur if the current transmitted from the drive circuitry to the electrode array 142 exceeds a predetermined threshold or if the charge transmitted from the drive circuitry to the electrode array exceeds a predetermined threshold over a predetermined time interval . after a session shorting event has occurred , the patient must manually press a pushbutton to resume the therapy session . the real time clock ( rtc ) 368 provides time and date information to the microcontroller 360 . in some embodiments , the controller 120 is authorized by a physician for a predetermined period of time ( e . g ., two weeks ). the rtc 368 periodically communicates date and time information to the microcontroller 360 . in some embodiments , the rtc 368 is integrated with the microcontroller . in some embodiments , the rtc 368 is powered by the battery 362 , and upon failure of the battery 362 , the rtc 368 is powered by a backup battery . after the predetermined period of time has elapsed , the controller 120 can no longer initiate the delivery of electrical signals to the mouthpiece 140 and the patient must visit the physician to reauthorize use of the controller 120 . the display 366 displays information received by the microcontroller 360 to the patient . for example , the display 366 can display the time of day , therapy information , battery information , time remaining in a therapy session , error information , and the status of the controller 120 . the audio feedback circuitry 376 and vibratory feedback circuitry 377 can give feedback to a user when the device changes state . for example , when a therapy session begins , the audio feedback circuitry 376 and the vibratory feedback circuitry 377 can provide auditory and / or vibratory cues to the patient , notifying the patient that the therapy session has been initiated . other possible state changes that may trigger audio and / or vibratory cues include pausing a therapy session , resuming a therapy session , the end of a timed session , canceling a timed session , or error messaging . in some embodiments , a clinician can turn off one or more of the auditory or vibratory cues to tailor the feedback to an individual patient &# 39 ; s needs . the tongue sense circuitry 374 measures the current passing from the drive circuitry to the electrode array 142 . upon sensing a current above a predetermined threshold , the tongue sense circuitry 374 presents a high digital signal to the microcontroller 360 , indicating that the tongue is in contact with the electrode array 142 . if the current is below the predetermined threshold , the tongue sense circuitry 374 presents a low digital signal to the microcontroller 360 , indicating that the tongue is not in contact or is in partial contact with the electrode array 142 . the indications received from the tongue sense circuitry 374 can be stored in the non - volatile memory 378 . in some embodiments , the display 366 can be an organic light emitting diode ( oled ) display . in some embodiments , the display 366 can be a liquid crystal display ( lcd ). in some embodiments , a display 366 is not included with the controller 120 . in some embodiments , neither the controller 120 nor the mouthpiece 140 includes a cable , and the controller 120 communicates wirelessly with the mouthpiece 140 . in some embodiments , neither the controller 120 nor the mouthpiece 140 includes an accelerometer . in some embodiments , the drive circuitry 372 is located within the mouthpiece . in some embodiments , a portion of the drive circuitry 372 is located within the mouthpiece 140 and a portion of the drive circuitry 372 is located within the controller 120 . in some embodiments , neither the controller 120 nor the mouthpiece 140 includes tongue sense circuitry 374 . in some embodiments , the mouthpiece 140 includes a microcontroller and a multiplexer . fig3 b shows a more detailed view of fig2 c . the mouthpiece 140 includes a battery 362 , tongue sense circuitry 374 , an accelerometer 370 , a microcontroller 360 , drive circuitry 372 , a non - volatile memory 378 , a universal serial bus controller ( usb ) 380 , and battery management circuitry 382 . during operation , the microcontroller receives electrical power from battery 362 and can store and retrieve information from the non - volatile memory 378 . the battery can be charged via the usb connection 380 . the battery management circuitry 382 controls the charging of the battery 362 . a patient can interact with the mouthpiece 140 via the mobile device 121 . the mobile device 121 includes an application ( e . g . software running on a processor ) that allows the patient to control the mouthpiece 140 . for example , the application can include an info button , a power button an intensity - up button , an intensity - down button , and a start / stop button that are presented to the user visually via the mobile device 121 . when the patient presses a button presented by the application running on the mobile device 121 , a signal is transmitted to the microcontroller 360 housed within the mouthpiece 140 . for example , a therapy session can be started when the patient presses a start / stop button on the mobile device 121 . during the therapy session , the drive circuitry 372 provides an electrical signal to an electrode array 142 located on the mouthpiece 140 . the accelerometer 370 can be used to provide information about the patient &# 39 ; s motion during the therapy session . the information provided by the accelerometer 370 can be used to determine if the patient is engaged in a physical activity . based on the information received from the accelerometer 370 , the microcontroller 360 can determine an activity level of the patient during a therapy session . for example , if the patient engages in a physical activity for 30 minutes during a therapy session , the accelerometer 370 can periodically communicate ( e . g . once every second ) to the microcontroller 360 that the sensed motion is larger than a predetermined threshold ( e . g . greater than 1 m / s 2 ). after the therapy session has ended , the microcontroller 360 can record the amount of time during the therapy session in which the patient was active . in some embodiments , the accelerometer 370 is located within the mobile device 121 and the mobile device 121 determines an activity level of a patient during the therapy session based on information received from the accelerometer 370 . the mobile device can then record the amount of time during the therapy session in which the patient was active . the mobile device 121 includes a real time clock ( rtc ) 368 that provides time and date information to the microcontroller 360 . in some embodiments , the mouthpiece 140 is authorized by a physician for a predetermined period of time ( e . g ., two weeks ). after the predetermined period of time has elapsed , the mouthpiece 140 can no longer deliver electrical signals to the patient via the electrode array 142 and the patient must visit the physician to reauthorize use of the mouthpiece 140 . in some embodiments , the mouthpiece 140 includes pushbuttons ( e . g ., an on / off button ) and a patient can manually operate the mouthpiece 140 via the pushbuttons . after a therapy session , the mouthpiece 140 can transmit information about the therapy session to a mobile device . in some embodiments , the mouthpiece 140 does not include a usb controller 380 and instead communicates only via wireless communications with the controller . fig3 c shows a more detailed view of the electrode array 142 . the electrode array 142 can be separated into 9 groups of electrodes , labelled a - i , with each group having 16 electrodes , except group b which has 15 electrodes . each electrode within the group corresponds to one of 16 electrical channels . during operation , the drive circuitry can deliver a sequence of electrical pulses to the electrode array 142 to provide neurostimulation of at least one of the patient &# 39 ; s trigeminal or facial nerve . the electrical pulse amplitude delivered to each group of electrodes can be larger near a posterior portion of the tongue and smaller at an anterior portion of the tongue . for example , the pulse amplitude of electrical signals delivered to groups a - c can be 19 volts or 100 % of a maximum value , the pulse amplitude of electrical signals delivered to groups d - f can be 14 . 25 volts or 75 % of the maximum value , the pulse amplitude of electrical signals delivered to groups g - h can be 11 . 4 volts or 60 % of the maximum value , and the pulse amplitude of electrical signals delivered to group i can be 9 . 025 volts or 47 . 5 % of the maximum value . in some embodiments , the maximum voltage is in the range of 0 to 40 volts . the pulses delivered to the patient by the electrode array 142 can be random or repeating . the location of pulses can be varied across the electrode array 142 such that different electrodes are active at different times , and the duration and / or intensity of pulses may vary from electrode . for oral tissue stimulation , currents of 0 . 5 - 50 ma and voltages of 1 - 40 volts can be used . in some embodiments , transient currents can be larger than 50 ma . the stimulus waveform may have a variety of time - dependent forms , and for cutaneous electrical stimulation , pulse trains and bursts of pulses can be used . where continuously supplied , pulses may be 1 - 500 microseconds long and repeat at rates from 1 - 1000 pulses / second . where supplied in bursts , pulses may be grouped into bursts of 1 - 100 pulses / burst , with a burst rate of 1 - 100 bursts / second . in some embodiments , pulsed waveforms are delivered to the electrode array 142 . fig3 d shows an exemplary sequence of pulses that can be delivered to the electrode array 142 by the drive circuitry 372 . a burst of three pulses , each spaced apart by 5 ms is delivered to each of the 16 channels . the pulses in neighboring channels are offset from one another by 312 . 5 μs . the burst of pulses repeats every 20 ms . the width of each pulse can be varied from 0 . 3 - 60 μs to control an intensity of neurostimulation ( e . g ., a pulse having a width of 0 . 3 μs will cause a smaller amount of neurostimulation than a pulse having a width of 60 μs ). fig4 a shows a method of operation 400 of a controller 120 as described in fig2 a , 2 b and 3 a . a patient attaches a mouthpiece 140 to a controller 120 ( step 404 ). the patient turns on the controller 120 ( step 408 ) using , for example , a power button . the patient places the controller 120 around his / her neck ( step 412 ) as shown in fig1 b . the patient places a mouthpiece 140 in his / her mouth ( step 416 ). the patient initiates a therapy session by pressing a start / stop button ( step 420 ). during the therapy session , the controller 120 delivers electrical signals to the mouthpiece 140 . the patient calibrates the intensity of the electrical signals ( step 424 ). the patient raises the intensity of the electrical signals delivered to the mouthpiece by pressing an intensity - up button until the neurostimulation is above the patient &# 39 ; s sensitivity level . the patient presses an intensity - down button until the neurostimulation is comfortable and non - painful . after the calibration step , the patient performs a prescribed exercise ( step 428 ). the exercise can be cognitive , mental , or physical . in some embodiments , physical exercise includes the patient attempting to maintain a normal posture or gait , the patient moving his / her limbs , or the patient undergoing speech exercises . cognitive exercises can include “ brain training ” exercises , typically computerized , that are designed to require the use of attention span , memory , or reading comprehension . mental exercises can include visualization exercises , meditation , relaxation techniques , and progressive exposure to “ triggers ” for compulsive behaviors . in some embodiments , the patient can rest for a period of time during the therapy session ( e . g . the patient can rest for 2 minutes during a 30 minute therapy session ). after a predetermined period of time ( for example , thirty minutes ) has elapsed , the therapy session ends ( step 432 ) and the controller 120 stops delivering electrical signals to the mouthpiece 140 . in some embodiments , the intensity of electrical signals increases from zero to the last use level selected by the patient over a time duration in the range of 1 - 5 seconds after the patient starts a therapy session by pressing the start / stop button . in some embodiments , the intensity of electrical signals is set to a fraction of the last use level selected by the patient ( e . g . ¾ of the last level selected ) after the patient starts a therapy session by pressing the start / stop button . in some embodiments , the intensity of electrical signals increases from zero to a fraction of the last use level selected by the patient ( e . g . ¾ of the last level selected ) over a time duration in the range of 1 - 5 seconds after the patient starts a therapy session by pressing the start / stop button . in some embodiments , the intensity of electrical signals increases instantaneously from zero to the last use level selected by the patient after the patient starts a therapy session by pressing the start / stop button . in some embodiments , the mouthpiece 140 is connected to the controller 120 after the controller 120 is turned on . in some embodiments , the mouthpiece 140 is connected to the controller 120 after the controller 120 is donned by the patient . in some embodiments , the patient calibrates the intensity of the electrical signals before initiating a therapy session . in some embodiments , a patient performs an initial calibration of the intensity of electrical signals in the presence of a clinician and does not calibrate the intensity of the electrical signals during subsequent treatments performed in the absence of a clinician . fig4 b shows a method of operation 449 of the non - invasive neurostimulation system 100 described in fig2 c and 3b . a patient activates a mobile device 121 ( step 450 ). the patient places a mouthpiece 140 in his / her mouth ( step 454 ). the patient initiates a therapy session by pressing a start / stop button within an application running on the mobile device 121 ( step 458 ). during the therapy session , circuitry within the mouthpiece 140 delivers electrical signals to an electrode array 142 located on the mouthpiece 140 . the patient calibrates the intensity of the electrical signals ( step 462 ). the patient first raises the intensity of the electrical signals delivered to the mouthpiece 140 by pressing an intensity - up button located within an application running on the mobile device 121 until the neurostimulation is above the patient &# 39 ; s sensitivity level . the patient presses an intensity - down button running within an application on the mobile device 121 until the neurostimulation is comfortable and non - painful . after the calibration step , the patient performs a prescribed exercise ( step 464 ). the exercise can be cognitive , mental , or physical . in some embodiments , the patient can rest for a period of time during the therapy session ( e . g . the patient can rest for 5 minutes during a 30 minute therapy session ). after a predetermined period of time ( for example , thirty minutes ) has elapsed , the therapy session ends ( step 468 ) and the circuitry located within the mouthpiece 140 stops delivering electrical signals to the electrode array 142 . in some embodiments , the calibration of the intensity of the electrical signals takes place before the patient initiates a therapy session . fig5 a shows a neurostimulation system 500 and fig5 b shows a back view of a controller 520 . the neurostimulation system 500 includes a controller 520 and a mouthpiece 540 connected via a cable 544 . the mouthpiece 540 includes an electrode array on a bottom portion thereof . the controller 520 includes an anterior portion 560 and a posterior portion 564 . the controller 520 also includes a mouthpiece port 516 , an intensity - up button 508 , an intensity - down button 512 , a power button 521 , an info button 524 , a start / stop button 504 and a display 528 . the mouthpiece 540 is in electrical communication with the controller 520 via the cable 544 . in some embodiments , the power button 521 includes a light emitting diode ( led ) indicator . in some embodiments , the port 516 is located on the mouthpiece 540 instead of the controller 520 and the cable 544 is permanently attached to the controller 520 . in some embodiments the port is a universal serial bus ( usb ) port and / or a charging port . fig5 c describes a method 200 of operating the neurostimulation system 500 shown in fig5 a and 5b . a patient activates the neurostimulation system 500 by pressing a power button 521 ( step 208 ). after activation , the neurostimulation system 500 enters an idle state ( step 212 ). while in the idle state , non - invasive neurostimulation is not delivered to the patient . if the neurostimulation system 500 remains in the idle state for a predetermined time period , the neurostimulation system 500 can shut down or enter a power - saving state ( e . g ., after idling for 10 minutes ). additionally , if the power button 521 is pressed while in the idle state , the neurostimulation system 500 shuts down . if the patient presses a start button ( step 224 ), an ninm therapy session begins and non - invasive neurostimulation generated by the controller 520 is delivered to the patient &# 39 ; s oral cavity via the mouthpiece 540 for a predetermined period of time . in some embodiments , the neurostimulation system 500 enters an intensity adjustment state when the patient presses a start button ( step 224 ). the patient then raises the intensity of the electrical signals delivered to the mouthpiece by pressing the intensity - up button 508 until the neurostimulation is above the patient &# 39 ; s sensitivity level . the patient presses the intensity - down button 512 until the neurostimulation is comfortable and non - painful . after the intensity adjustment is completed , the patient presses the start button again to begin an ninm therapy session . in one embodiment , the predetermined period of time can be in the user - selectable range of 20 - 30 minutes . additionally , the patient performs a physical , cognitive , or mental exercise during the ninm therapy session . the physical , cognitive , or mental exercise is performed simultaneously with the delivery of electrical signals from the controller 520 to the mouthpiece 540 . if the patient presses a pause button ( step 232 ) while neurostimulation is being delivered , the therapy session is paused ( step 233 ) and the neurostimulation system 500 ceases to deliver non - invasive neurostimulation to the patient &# 39 ; s oral cavity . in some embodiments , if the neurostimulation system 500 loses contact with the patient &# 39 ; s oral cavity ( e . g . determined by tongue sensing circuitry ), the therapy session is paused . if the patient presses unpause ( step 234 ), the treatment is resumed and non - invasive neurostimulation is again delivered to the patient &# 39 ; s intraoral cavity . if the patient presses the stop button while the neurostimulation system 500 is paused , or if there is no patient input for more than a predetermined time , for example , two minutes ( step 235 ) after the patient has pressed the pause button , the neurostimulation system 500 enters an idle state ( step 212 ) and a “ treatment ended due to pause timeout ” message is presented by the display 528 . if the patient presses the stop button ( step 240 ) while neurostimulation is being delivered , the neurostimulation system 500 enters an idle state ( step 212 ) and a “ treatment ended due to session stop ” message is presented by the display 528 . alternatively , if the neurostimulation system 500 delivers neurostimulation to the patient for the full predetermined period of time at step 240 , the system enters an idle state at step 212 and a “ full session completed ” message is presented by the display 528 . while the system is in the idle state at step 212 , a number of conditions can prevent the patient from initiating a therapy session . for example , if there is not enough charge remaining in the battery to complete at least one ninm therapy session , the controller 520 can block the patient from initiating the therapy session and a “ low battery ” message will be presented on the display 528 . in some embodiments , the controller can emit an audible sound to alert the patient that there is not enough charge remaining in the battery to complete at least one ninm therapy session . additionally , if the mouthpiece 540 is not attached to the controller 520 , the controller 520 can block the patient from initiating a therapy session and a “ no mouthpiece ” message is presented on the display 528 . in some embodiments , the neurostimulation system 500 delivers neurostimulation for a limited number of hours per day . for example , the neurostimulation system 500 can be configured to stop delivering neurostimulation after 200 minutes of use in a single day . in the idle state at step 212 , if the daily limit has been exceeded , the controller 520 can block the patient from initiating a therapy session and a “ daily limit reached ” message is presented by the display 528 . the patient can begin treatment the next day ( i . e ., after midnight ), when the daily limit is reset . in some embodiments , the neurostimulation system 500 delivers neurostimulation for a limited number of weeks . in the idle state at step 212 , if the calendar limit has been exceeded , the controller 520 can block the patient from initiating a therapy session and a “ calendar limit reached ” message is presented by the display 528 . for example , the neurostimulation system 500 can be configured to stop delivering neurostimulation 1 - 14 weeks after the patient receives the neurostimulation system 500 from a physician . to re - enable the neurostimulation system 500 after the calendar limit has been exceeded , the patient is required to visit a physician or a clinician . in some embodiments , a “ calendar limit approaching ” message is presented by the display 528 , warning the patient that the calendar limit will be reached soon ( e . g . in two weeks ). the “ calendar limit approaching ” message can be beneficial to patients by allowing them to schedule appointments with their clinicians prior to the calendar limit being reached . in some embodiments , the mouthpiece 540 can become damaged over time and require replacement . for example , the patient &# 39 ; s bites down on the mouthpiece 540 during each therapy session , slowly causing the surface of the mouthpiece to be damaged . this damage can cause the mouthpiece 540 to malfunction . the average time to failure can be statistically determined by testing a number of mouthpieces 540 over a number of therapy sessions and examining the mouthpieces for damage at the end of each therapy session . the average time to failure , once determined , can be programmed into the controller 520 . during the idle state at step 212 , if the average time to failure has been reached , the controller 520 can block the patient from initiating a therapy session and a “ mouthpiece expired ” message is presented by the display 528 . in some embodiments , a message is presented by the display 528 , warning the patient that the mouthpiece is set to expire soon . for example , the message presented by the display 528 can be “ mouthpiece expires in 14 days .” in some embodiments , the display 528 can present an “ authentication error ” message if a mouthpiece 540 cannot be authenticated , for example as described in fig9 a and 9b . in some embodiments , the neurostimulation system 500 tracks an activity level of a patient . for example , the neurostimulation system 500 can include an accelerometer that detects an activity level of the patient ( e . g ., at rest , walking , or running ). in some embodiments , the activity level can be recorded and stored on an external computer for analysis . for example , the recorded activity level data can be analyzed by a physician to determine an effectiveness of a prescribed treatment plan . in some embodiments , the neurostimulation system 500 sets an intensity level to 75 % of the last used intensity level when the treatment begins at step 228 . in some embodiments , data including time stamps , intensity levels , data received from the accelerometer , and data received from the tongue sense circuitry can be recorded and stored on an external computer or mobile device for analysis . in some embodiments , the port 516 can facilitate charging of the neurostimulation system 500 . for example , when the port 516 is connected to a charging source , the neurostimulation system 500 enters a charging state . in the charging state , a “ charging ” message is presented by the display 528 . additionally , in the charging state , an led can indicate a remaining battery charge . for example , the led can emit flashing red light if there is not sufficient battery charge for at least one ninm therapy session . if there is sufficient battery charge remaining to complete at least one ninm therapy session , the led can emit flashing green . when the battery charging is complete , the led can emit a solid green light ( e . g . a non - flashing green light ). while the neurostimulation system 500 is in the charging state , the patient cannot begin an ninm therapy session . when the port is disconnected in the charging state , the neurostimulation system 500 enters an idle state ( step 212 ). in some embodiments , an led included with the power button 521 can indicate a remaining battery charge . for example , the led can emit green light if there is sufficient battery charge remaining to complete two or more ninm therapy sessions . if there is sufficient battery charge remaining to complete one ninm therapy session , the led can emit yellow light . if there is not enough charge remaining for one ninm therapy session , the led can emit red light . in some embodiments , the controller 520 includes leds for providing visual indication , an audio indicator , or a vibratory indicator that can provide indications to the patient . for example , the leds , the audio indicator , and the vibratory indicator can provide an indication to the patient if electrical neurostimulation is being delivered to the mouthpiece 540 , if electrical neurostimulation delivery to the mouthpiece 540 has been disabled or cancelled , or if the ninm therapy session has ended . the indications can include a solid or flashing light emitted by the leds or a predetermined sound such as a ring , buzz , or chirp emitted by the audio indicator . the vibratory indicator can provide tactile feedback or other vibratory feedback to the patient . in some embodiments , the audio and / or vibratory indicator includes a piezoelectric element or a magnetic buzzer that vibrates and provides a mechanical indication to the patient . in some embodiments , the leds and / or the audio indicator provide an indication when an ninm therapy session is 50 % complete . in some embodiments , the leds and / or the audio indicator provide an indication when any button on the controller 520 is pressed by the patient . in some embodiments , the leds and / or the audio indicator provide an indication of the intensity level of the electrical neurostimulation . in some embodiments , the leds and / or the audio indicator provide an indication of the remaining ninm therapy session time . in some embodiments , the leds and / or the audio indicator provide an indication of the remaining stimulation minutes for the current day ( e . g ., before a daily limit is reached ). in some embodiments , the leds and / or the audio indicator provide an indication of the remaining stimulation minutes for the current calendar period ( e . g ., before a calendar limit is reached ). in some embodiments , pressing a start / stop / pause button while neurostimulation is being delivered pauses the therapy session ( step 233 ) and the neurostimulation system 500 ceases to deliver non - invasive neurostimulation to the patient &# 39 ; s oral cavity . fig6 a and 6b show a non - invasive neurostimulation system 600 . the non - invasive neurostimulation system 600 includes headband 618 , a controller 620 , pushbuttons 622 , a display 628 , a mouthpiece 640 , an electrode array 642 , and a cable 624 . the controller 620 is in electrical communication with the mouthpiece 640 and the electrode array 642 via the cable 624 . during operation , a patient rests the headband 618 along his / her ears and inserts the mouthpiece 640 into his / her mouth . operation of the non - invasive neurostimulation system 600 is similar to that described above in reference to fig5 a and 5b where similarly referenced elements have the same functionality ( e . g . controller 620 has the same functionality as controller 520 etc .). in some embodiments , the headband 618 maintains an orientation of the mouthpiece 640 within the patient &# 39 ; s mouth during an ninm therapy session . in some embodiments , the headband 618 maintains the position of the mouthpiece 640 within the patient &# 39 ; s mouth , even if the patient is in a horizontal orientation or is upside - down . fig7 a and 7b show a non - invasive neurostimulation system 700 . the non - invasive neurostimulation system 700 includes headband 718 , a controller 720 , an intensity setting wheel 722 , a mouthpiece 740 , an electrode array 742 , and a cable 724 . the controller 720 is in electrical communication with the mouthpiece 740 and the electrode array 742 via the cable 724 . during operation , a patient rests the headband 718 along an upper circumference of his / her head and inserts the mouthpiece 740 into his / her mouth . the patient can increase the intensity of the electrical signals delivered to the mouthpiece 740 by rotating the intensity setting wheel in a clockwise direction . the patient can decrease the intensity of the electrical signals delivered to the mouthpiece 740 by rotating the intensity setting wheel in a counterclockwise direction . operation of the non - invasive neurostimulation system 700 is otherwise similar to that described above in reference to fig5 a and 5b where similarly referenced elements have the same functionality ( e . g . controller 720 has the same functionality as controller 520 etc .). in some embodiments , the headband 718 is configured to allow the patient to wear his / her glasses during an ninm therapy session . fig8 a and 8b show a non - invasive neurostimulation system 800 . the non - invasive neurostimulation system 800 includes a controller 820 , a mouthpiece 840 , pushbuttons 822 , display screen 828 , and indicator light 832 . the controller 820 and the mouthpiece 840 are integrated into a monolithic package . the controller 820 is in electrical communication with the mouthpiece 840 and the electrode array 842 . during operation , a patient inserts the mouthpiece 840 into his / her mouth and the rigidly attached controller 820 rests just outside of the patient &# 39 ; s mouth . operation of the non - invasive neurostimulation system 800 is otherwise similar to that described above in reference to fig5 a and 5b where similarly referenced elements have the same functionality ( e . g . controller 820 has the same functionality as controller 520 etc .). in some embodiments , the controller 820 is in mechanical contact with the patient &# 39 ; s chin and is configured to mechanically secure the mouthpiece 840 during an ninm therapy session . in some embodiments , a display screen 828 is not included with non - invasive neurostimulation system 800 . in some embodiments , a display screen 828 is replaced with an auditory indicator that provides auditory messages to the patient . in some embodiments , the controller 820 and the mouthpiece 840 are each monolithic and connected at a connection point between the mouthpiece 840 and the controller 820 . in some embodiments , the mouthpiece 840 is removably attached to the controller 820 and can be replaced at predetermined usage intervals or upon wearing out . fig9 a shows a method of operation 900 of the non - invasive neurostimulation device illustrated in fig5 - 8 . initially a patient connects a mouthpiece to a controller or mobile device ( step 904 ). the connection can be a wired or wireless connection . a processor within the controller or mobile device generates a numeric sequence and transmits the generated sequence to the mouthpiece ( step 908 ). the numeric sequence generated at step 908 can be a sequence of random values , produced by a software pseudorandom number generator , or by a hardware random number generator . based on the received numeric sequence and a secret key shared between the mouthpiece and the controller , a processor located within the mouthpiece generates a first hash code ( step 912 ). the first hash code can be generated using an hmac ( keyed - hash message authentication code ) algorithm . in some embodiments , the first hash code is generated in accordance with an sha - 256 algorithm . the mouthpiece then transmits the first hashcode to the controller ( step 916 ). a processor located within the controller generates a second hash code based on the shared secret key and the numeric sequence ( step 920 ) and then compares the first hash code with the second hash code ( step 924 ). the numeric sequence generated at step 920 can be a sequence of random values , produced by a software pseudorandom number generator , or by a hardware random number generator . in some embodiments , the second hash code is generated in accordance with an sha - 256 algorithm . if the first hash code matches the second hash code , then electrical communications are enabled between the controller and the mouthpiece ( step 928 ). the patient then inserts the mouthpiece into his / her mouth bringing the mouthpiece into contact with the patient &# 39 ; s intraoral cavity ( step 932 ). electrical neurostimulation signals can then be delivered by the controller via the mouthpiece to the patient &# 39 ; s intraoral cavity ( step 936 ). fig9 b shows another method of operation 939 of the non - invasive neurostimulation device as shown in fig5 - 8 in accordance with an embodiment of the invention . initially , a patient connects a mouthpiece to a controller or mobile device ( step 940 ). the connection can be a wired or wireless connection . at the time of manufacture , a first hash code is generated based on a unique serial number and a secret key shared between the mouthpiece and the controller ( step 944 ). the first hash code can be generated by an hmac ( keyed - hash message authentication code ) algorithm . in some embodiments , the first hash code is generated in accordance with an sha - 256 algorithm . the first hash code and the unique serial number are stored in memory within the mouthpiece . the mouthpiece then transmits the first hash code and the unique serial number to the controller ( step 948 ). the controller generates a second hash code based on the received unique serial number and the shared secret key ( step 952 ). the second hash code can be generated by an hmac ( keyed - hash message authentication code ) algorithm . in some embodiments , the second hash code is generated in accordance with an sha - 256 algorithm . the controller then compares the second hash code and the first hash code . the controller only permits continued electrical communications with the mouthpiece if the second hash code and the first hash code match ( step 956 ). the patient then inserts the mouthpiece into his / her mouth bringing the mouthpiece into contact with the patient &# 39 ; s intraoral cavity ( step 960 ). electrical neurostimulation signals can then be delivered by the controller via the mouthpiece to the patient &# 39 ; s intraoral cavity ( step 964 ). the terminology used herein is for the purpose of describing particular embodiments and is not intended to be limiting of the inventive concepts . it will be understood that , although the terms first , second , third etc . are used herein to describe various elements , components , regions , layers and / or sections , these elements , components , regions , layers and / or sections should not be limited by these terms . these terms are only used to distinguish one element , component , region , layer or section from another element , component , region , layer or section . thus , a first element , component , region , layer or section discussed below could be termed a second element , component , region , layer or section without departing from the teachings of the present application . while the present inventive concepts have been particularly shown and described above with reference to exemplary embodiments thereof , it will be understood by those of ordinary skill in the art , that various changes in form and detail can be made without departing from the spirit and scope of the present inventive concepts described and defined by the following claims . | 0 |
referring to fig1 , a transaxle according to the present invention includes an input 10 for driveably connecting a power source , such as an internal combustion engine or electric motor , to the transmission , and an output 36 for driving a load , such as the driven wheels of a motor vehicle , through a powertrain that may include a drive shaft , differential mechanism , and axle shafts . a first friction clutch 20 , consisting of a clutch housing and a clutch disc 22 , alternately connects and disconnects a first input shaft 14 as clutch 20 is engaged and disengaged , respectively . a second friction clutch 16 , consisting of a clutch housing and a clutch disc 18 , connects and disconnects a second input shaft 12 as clutch 16 is engaged and disengaged , respectively . a first layshaft 26 supports a first output pinion 30 , which is secured to layshaft 26 in continuous meshing engagement with an output ring gear 34 , secured to output 36 . a second layshaft 24 supports a second output pinion 32 , which is secured to the layshaft 24 in continuous meshing engagement with output ring gear 34 . the first input shaft 14 supports two pinions 50 and 52 which are secured to shaft 14 . the second input shaft 12 supports one pinion 48 which is secured to shaft 12 and two pinions 44 and 46 which may rotate about shaft 12 . gear 42 is supported on layshaft 26 for rotation relative to layshaft 26 , and in continuous meshing engagement with pinion 52 . auxiliary shaft 28 is a hollow shaft supported on layshaft 26 for rotation relative to layshaft 26 . the auxiliary shaft 28 supports gears 38 and 40 which are secured to shaft 28 and in continuous meshing engagement with pinions 46 and 50 respectively . gear 54 is secured to layshaft 24 and in continuous meshing engagement with pinion 44 . gears 56 and 58 are supported on layshaft 24 for rotation relative to layshaft 24 and in continuous meshing engagement with pinion 48 and gear 42 , respectively . couplers 60 , 62 , and 64 are preferably synchronizers of the type used in automotive manual transmissions to connect a gear or pinion to a shaft , after synchronizing the speed of the shaft and that of the pinion or gear . each coupler may also disconnect the shaft and the associated pinion or gear . alternatively , each coupler may be a dog clutch having teeth that are engaged with dog teeth on a gear or pinion . this invention may use couplers in any combination of synchronizers and dog clutches . each coupler is composed of a hub secured to the shaft and a sleeve which is supported on the hub for sliding movement leftward or rightward into engagement with dog teeth on the adjacent gear or pinion . in the case where a coupler is a synchronizer , it is provided with a conical surface , which engages mutually with a corresponding conical surface located on the gear or pinion . when the synchronizer is engaging either of its adjacent gears , these conical surfaces are forced together into frictional contact , and that frictional engagement synchronizes the speed of the gear to that of the shaft before the dog teeth engage . other types of sychronizers or couplers , now know or later invented , may also be used . coupler 60 connects second input shaft 12 to pinion 44 , pinion 46 , or disconnects it from both . coupler 62 connects layshaft 26 to gear 40 , gear 42 , or disconnects it from both . coupler 64 connects layshaft 24 to gear 56 , gear 58 , or disconnects it from both . engaging coupler 60 to pinion 46 activates a power path between the first and second input shaft comprising pinion 50 , gear 40 , auxiliary shaft 28 , gear 38 , pinion 46 , and coupler 60 . to accelerate the vehicle using the first forward speed , the transmission is configured with coupler 60 engaging pinion 46 and coupler 62 engaging gear 42 . then , clutch 16 is engaged . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , coupler 60 , pinion 46 , gear 38 , auxiliary shaft 28 , gear 40 , pinion 50 , input shaft 14 , pinion 52 , gear 42 , coupler 62 , layshaft 26 , output pinion 30 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 through clutch 16 . shaft 12 is driveably connected to pinion 46 through coupler 60 . pinion 46 drives gear 38 , auxiliary shaft 28 , gear 40 , pinion 50 , shaft 14 , pinion 52 , and gear 42 . gear 42 is driveably connected to layshaft 26 through coupler 62 . pinion 30 is secured to layshaft 26 and drives ring gear 34 and output 36 . to shift from the first forward speed to the second forward speed , clutch 20 is progressively engaged while clutch 16 is progressively released . following the shift , coupler 60 may be moved to the neutral position , but in any event must be moved to the neutral position before the next odd - to - even upshift . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 52 , gear 42 , coupler 62 , layshaft 26 , output pinion 30 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 14 and pinion 52 through clutch 20 . pinion 52 drives gear 42 , which is driveably connected to shaft 26 through coupler 62 . pinion 30 is secured to shaft 26 and drives ring gear 34 and output 36 . to shift from the second forward speed to the third forward speed , the transmission is configured by displacing coupler 64 to engage gear 56 , then clutch 16 is progressively engaged while clutch 20 is progressively released . following the shift , coupler 62 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , pinion 48 , gear 56 , coupler 64 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 and pinion 48 through clutch 16 . pinion 48 drives gear 56 , which is driveably connected to shaft 24 through coupler 64 . pinion 32 is secured to shaft 24 and drives ring gear 34 and output 36 . to shift from the third forward speed to the fourth forward speed , the transmission is configured by displacing coupler 62 to engage gear 40 , then clutch 20 is progressively engaged while clutch 16 is progressively released . following the shift , coupler 64 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 50 , gear 40 , coupler 62 , layshaft 26 , output pinion 30 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 14 and pinion 50 through clutch 20 . pinion 50 drives gear 40 , which is driveably connected to shaft 26 through coupler 62 . pinion 30 is secured to shaft 26 and drives ring gear 34 and output 36 . to shift from the fourth forward speed to the fifth forward speed , the transmission is configured by displacing coupler 60 to engage pinion 44 , then clutch 16 is progressively engaged while clutch 20 is progressively released . following the shift , coupler 62 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , coupler 60 , pinion 44 , gear 54 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 through clutch 16 . shaft 12 is driveably connected to pinion 44 through coupler 60 . pinion 44 drives gear 54 , shaft 24 , pinion 30 , ring gear 34 , and output 36 . to accelerate the vehicle in reverse , the transmission is configured with coupler 60 engaging pinion 46 and coupler 64 engaging gear 58 . then , clutch 16 is engaged . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , coupler 60 , pinion 46 , gear 38 , auxiliary shaft 28 , gear 40 , pinion 50 , input shaft 14 , pinion 52 , gear 42 , gear 58 , coupler 64 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 through clutch 16 . shaft 12 is driveably connected to pinion 46 through coupler 60 . pinion 46 drives gear 38 , auxiliary shaft 28 , gear 40 , pinion 50 , shaft 14 , pinion 52 , gear 42 , and gear 58 . gear 58 is driveably connected to layshaft 24 through coupler 64 . pinion 32 is secured to layshaft 24 and drives ring gear 34 and output 36 . a shift may be accomplished in reverse by progressively engaging clutch 20 while progressively releasing clutch 16 . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 52 , gear 42 , gear 58 , coupler 64 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . following the shift , input 10 is driveably connected to shaft 14 and pinion 52 through clutch 20 . pinion 52 drives gear 42 and gear 58 , which is driveably connected to shaft 24 through coupler 64 . pinion 32 is secured to shaft 24 and drives ring gear 34 and output 36 . a chart containing a preferred number of teeth for each of the gears of the transaxle of fig1 is shown in fig2 , while fig3 is a chart containing the speed ratios between the input and output and steps between the speed ratios for each of the forward and reverse speeds of the transaxle of fig1 . referring now to fig4 , a transaxle according to the present invention includes an input 10 for driveably connecting a power source , such as an internal combustion engine or electric motor , to the transmission , and an output 36 for driving a load , such as the driven wheels of a motor vehicle , through a powertrain that may include a drive shaft , differential mechanism , and axle shafts . a first friction clutch 16 , consisting of a clutch housing and a clutch disc 18 , alternately connects and disconnects a first input shaft 12 as clutch 16 is engaged and disengaged , respectively . a second friction clutch 20 , consisting of a clutch housing and a clutch disc 22 , connects and disconnects a second input shaft 14 as clutch 20 is engaged and disengaged , respectively . a first layshaft 26 supports a first output pinion 30 , which is secured to layshaft 26 in continuous meshing engagement with an output ring gear 34 , secured to output 36 . a second layshaft 24 supports a second output pinion 32 , which is secured to the layshaft in continuous meshing engagement with output ring gear 34 . the second input shaft 14 supports two pinions 82 and 84 which are secured to shaft 14 . the first input shaft 12 supports three pinions 76 , 78 , and 80 which are secured to shaft 12 . gears 86 , 88 , 90 , and 92 are supported on layshaft 24 for rotation relative to layshaft 24 and in continuous meshing engagement with pinions 76 , 78 , 82 , and 84 respectively . gear 70 is supported on layshaft 26 for rotation relative to layshaft 26 , and in continuous meshing engagement with gear 86 . auxiliary shaft 28 is a hollow shaft supported on layshaft 26 for rotation relative to layshaft 26 . auxiliary shaft 28 supports gear 72 which is secured to shaft 28 and in continuous meshing engagement with pinion 80 . gear 74 is supported on shaft 28 for rotation relative to shaft 28 and in continuous meshing engagement with pinion 84 . coupler 94 connects layshaft 26 to gear 70 , gear 72 , or disconnects it from both . coupler 96 connects or disconnects auxiliary shaft 28 to gear 74 . coupler 98 connects layshaft 24 to gear 86 , gear 88 , or disconnects it from both . coupler 100 connects layshaft 24 to gear 90 , gear 92 , or disconnects it from both . engaging coupler 96 to gear 74 activates a power path between the first and second input shaft comprising pinion 84 , gear 74 , coupler 96 , auxiliary shaft 28 , gear 72 , and pinion 80 . to accelerate the vehicle using the first forward speed , the transmission is configured with coupler 96 engaging gear 74 and coupler 98 engaging gear 86 . then , clutch 20 is engaged . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 84 , gear 74 , coupler 96 , auxiliary shaft 28 , gear 72 , pinion 80 , input shaft 12 , pinion 76 , gear 86 , coupler 98 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 14 and pinion 84 through clutch 20 . pinion 84 drives gear 74 , which is driveably connected to auxiliary shaft 28 through coupler 96 . auxiliary shaft 28 drives gear 72 , pinion 80 , shaft 12 , pinion 76 , and gear 86 . gear 86 is driveably connected to layshaft 24 through coupler 98 . pinion 32 is secured to layshaft 24 and drives ring gear 34 and output 36 . to shift from the first forward speed to the second forward speed , clutch 16 is progressively engaged while clutch 20 is progressively released . following the shift , coupler 96 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , pinion 76 , gear 86 , coupler 98 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 and pinion 76 through clutch 16 . pinion 76 drives gear 86 , which is driveably connected to shaft 24 through coupler 98 . pinion 32 is secured to shaft 24 and drives ring gear 34 and output 36 . to shift from the second forward speed to the third forward speed , the transmission is configured by displacing coupler 100 to engage gear 92 , then clutch 20 is progressively engaged while clutch 16 is progressively released . following the shift , coupler 98 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 84 , gear 92 , coupler 100 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 14 and pinion 84 through clutch 20 . pinion 84 drives gear 92 , which is driveably connected to shaft 24 through coupler 100 . pinion 32 is secured to shaft 24 and drives ring gear 34 and output 36 . to shift from the third forward speed to the fourth forward speed , the transmission is configured by displacing coupler 94 to engage gear 72 , then clutch 16 is progressively engaged while clutch 20 is progressively released . following the shift , coupler 100 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , pinion 80 , gear 72 , coupler 94 , layshaft 26 , output pinion 30 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 and pinion 80 through clutch 16 . pinion 80 drives gear 72 , which is driveably connected to shaft 26 through coupler 94 . pinion 30 is secured to shaft 26 and drives ring gear 34 and output 36 . to shift from the fourth forward speed to the fifth forward speed , the transmission is configured by displacing coupler 100 to engage gear 90 , then clutch 20 is progressively engaged while clutch 16 is progressively released . following the shift , coupler 94 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 82 , gear 90 , coupler 100 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 14 and pinion 82 through clutch 20 . pinion 82 drives gear 90 , which is driveably connected to shaft 24 through coupler 100 . pinion 32 is secured to shaft 24 and drives ring gear 34 and output 36 . to shift from the fifth forward speed to the sixth forward speed , the transmission is configured by displacing coupler 98 to engage gear 88 , then clutch 16 is progressively engaged while clutch 20 is progressively released . following the shift , coupler 100 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , pinion 78 , gear 88 , coupler 98 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 and pinion 78 through clutch 16 . pinion 78 drives gear 88 , which is driveably connected to shaft 24 through coupler 98 . pinion 32 is secured to shaft 24 and drives ring gear 34 and output 36 . an upshift from the sixth forward speed to the seventh forward speed , unlike all other single step shifts , requires a torque break , i . e ., the torsional connection between the input 10 and output 36 is briefly interrupted by disengaging clutch 16 while the state of the couplers are changed . this is mitigated because the 6 - 7 upshift is never made at high throttle ; instead , it usually occurs as a result of the driver reducing power demand when reaching cruising speed . while both clutches are disengaged , coupler 98 is moved to the neutral position , coupler 96 is displaced to engage gear 74 , and coupler 100 is displaced to engage gear 90 . then , clutch 16 is re - engaged . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , pinion 80 , gear 72 , auxiliary shaft 28 , coupler 96 , gear 74 , pinion 84 , input shaft 14 , pinion 82 , gear 90 , coupler 100 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . when clutch 16 is re - engaged , input 10 is driveably connected to shaft 12 and pinion 80 through clutch 16 . pinion 80 drives gear 72 and auxiliary shaft 28 , which is driveably connected to gear 74 through coupler 96 . gear 74 drives pinion 84 , shaft 14 , pinion 82 , and gear 90 , which is driveably connected to shaft 24 through coupler 100 . pinion 32 is secured to shaft 24 and drives ring gear 34 and output 36 . to accelerate the vehicle in reverse , the transmission is configured with coupler 96 engaging gear 74 and coupler 94 engaging gear 70 . then , clutch 20 is engaged . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 84 , gear 74 , coupler 96 , auxiliary shaft 28 , gear 72 , pinion 80 , input shaft 12 , pinion 76 , gear 86 , gear 70 , coupler 94 , layshaft 26 , output pinion 30 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 14 and pinion 84 through clutch 20 . pinion 84 drives gear 74 , which is driveably connected to auxiliary shaft 28 through coupler 96 . auxiliary shaft 28 drives gear 72 , pinion 80 , shaft 12 , pinion 76 , gear 86 , and gear 70 . gear 70 is driveably connected to layshaft 26 through coupler 94 . pinion 30 is secured to layshaft 26 and drives ring gear 34 and output 36 . a shift may be accomplished in reverse by progressively engaging clutch 16 while progressively releasing clutch 20 . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , pinion 76 , gear 86 , gear 70 , coupler 94 , layshaft 26 , output pinion 30 , output gear 34 , and output 36 . following the shift , input 10 is driveably connected to shaft 12 and pinion 76 through clutch 16 . pinion 76 drives gear 86 and gear 70 , which is driveably connected to shaft 26 through coupler 94 . pinion 30 is secured to shaft 26 and drives ring gear 34 and output 36 . a chart containing a preferred number of teeth for each of the gears of the transaxle of fig4 is shown in fig5 , while fig6 is a chart containing the speed ratios between the input and output and steps between the speed ratios for each of the forward and reverse speeds of the transaxle of fig4 , the gears having the number of teeth shown in fig5 . referring to fig7 , a rear wheel drive transmission according to the present invention includes an input 10 for driveably connecting a power source , such as an internal combustion engine or electric motor , to the transmission , and an output 36 , which is coaxial with input 10 , for driving a load , such as the driven wheels of a motor vehicle , through a powertrain that may include a drive shaft , differential mechanism , and axle shafts . a first friction clutch 20 , consisting of a clutch housing and a clutch disc 22 , alternately connects and disconnects a first input shaft 14 as clutch 20 is engaged and disengaged , respectively . a second friction clutch 16 , consisting of a clutch housing and a clutch disc 18 , connects and disconnects a second input shaft 12 as clutch 16 is engaged and disengaged , respectively . a first layshaft 26 supports a first output pinion 30 , which is secured to layshaft 26 in continuous meshing engagement with an output gear 34 , secured to output 36 . a second layshaft 24 supports a second output pinion 32 , which is secured to the layshaft in continuous meshing engagement with output gear 34 . the first input shaft 14 supports three pinions 112 , 114 , and 116 which are secured to shaft 14 . the second input shaft 12 supports two pinions 108 and 110 which may rotate about shaft 12 . gear 106 is supported on layshaft 26 for rotation relative to layshaft 26 , and in continuous meshing engagement with pinion 116 . auxiliary shaft 28 is a hollow shaft supported on layshaft 26 for rotation relative to layshaft 26 . the auxiliary shaft 28 supports gears 102 and 104 which are secured to shaft 28 and in continuous meshing engagement with pinions 110 and 112 respectively . gear 118 is secured to layshaft 24 and in continuous meshing engagement with pinion 108 . gears 120 and 122 are supported on layshaft 24 for rotation relative to layshaft 24 and in continuous meshing engagement with pinion 114 and gear 106 , respectively . coupler 124 connects layshaft 26 to gear 104 , gear 106 , or disconnects it from both . coupler 126 connects input shaft 12 to output gear 34 , pinion 108 , or disconnects it from both . coupler 128 connects or disconnects shaft 12 to pinion 110 . coupler 130 connects layshaft 24 to gear 120 , gear 122 , or disconnects it from both . engaging coupler 128 to pinion 110 activates a power path between the first and second input shaft comprising pinion 112 , gear 104 , auxiliary shaft 28 , gear 102 , pinion 110 , and coupler 128 . to accelerate the vehicle using the first forward speed , the transmission is configured with coupler 128 engaging pinion 110 and coupler 124 engaging gear 106 . then , clutch 16 is engaged . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , coupler 128 , pinion 110 , gear 102 , gear 104 , pinion 112 , input shaft 14 , pinion 116 , gear 106 , coupler 124 , layshaft 26 , output pinion 30 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 through clutch 16 . shaft 12 is driveably connected to pinion 110 through coupler 128 . pinion 110 drives gear 102 , auxiliary shaft 28 , gear 104 , pinion 112 , shaft 14 , pinion 116 , and gear 106 . gear 106 is driveably connected to layshaft 26 through coupler 124 . pinion 30 is secured to layshaft 26 and drives output gear 34 and output 36 . to shift from the first forward speed to the second forward speed , clutch 20 is progressively engaged while clutch 16 is progressively released . following the shift , coupler 128 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 116 , gear 106 , coupler 124 , layshaft 26 , output pinion 30 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 14 and pinion 116 through clutch 20 . pinion 116 drives gear 106 , which is driveably connected to shaft 26 through coupler 124 . pinion 30 is secured to shaft 26 and drives output gear 34 and output 36 . to shift from the second forward speed to the third forward speed , the transmission is configured by displacing coupler 126 to engage gear 108 , then clutch 16 is progressively engaged while clutch 20 is progressively released . following the shift , coupler 124 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , coupler 126 , pinion 108 , gear 118 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 through clutch 16 . shaft 12 is driveably connected to pinion 108 through coupler 126 . pinion 108 drives gear 118 , shaft 24 , pinion 32 , output gear 34 , and output 36 . to shift from the third forward speed to the fourth forward speed , the transmission is configured by displacing coupler 130 to engage gear 120 , then clutch 20 is progressively engaged while clutch 16 is progressively released . following the shift , coupler 126 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 114 , gear 120 , coupler 130 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 14 and pinion 114 through clutch 20 . pinion 114 drives gear 120 , which is driveably connected to shaft 24 through coupler 130 . pinion 32 is secured to shaft 24 and drives output gear 34 and output 36 . to shift from the fourth forward speed to the fifth forward speed , the transmission is configured by displacing coupler 126 to engage output gear 34 , then clutch 16 is progressively engaged while clutch 20 is progressively released . following the shift , coupler 130 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , coupler 126 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 through clutch 16 . shaft 12 is driveably connected to output gear 34 and output 36 through coupler 126 . the fifth forward speed is direct drive . to shift from the fifth forward speed to the sixth forward speed , the transmission is configured by displacing coupler 124 to engage gear 104 , then clutch 20 is progressively engaged while clutch 16 is progressively released . following the shift , coupler 126 may be moved to the neutral position . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 112 , gear 104 , coupler 124 , layshaft 26 , output pinion 30 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 14 and pinion 112 through clutch 20 . pinion 112 drives gear 104 , which is driveably connected to shaft 26 through coupler 124 . pinion 30 is secured to shaft 26 and drives output gear 34 and output 36 . an upshift from the sixth forward speed to the seventh forward speed , unlike all other single step shifts , requires a torque break , i . e ., the torsional connection between the input 10 and output 36 is briefly interrupted by disengaging clutch 20 while the state of the couplers are changed . this is mitigated because the 6 - 7 upshift is never made at high throttle ; instead , it usually occurs as a result of the driver reducing power demand when reaching cruising speed . while both clutches are disengaged , coupler 124 is moved to the neutral position , coupler 128 is displaced to engage pinion 110 , and coupler 126 is displaced to engage output gear 34 . then clutch 20 is re - engaged . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 112 , gear 104 , auxiliary shaft 28 , gear 102 , pinion 110 , coupler 128 , input shaft 12 , coupler 126 , output gear 34 , and output 36 . when clutch 20 is re - engaged , input 10 is driveably connected to shaft 14 and pinion 112 through clutch 20 . pinion 112 drives gear 104 , auxiliary shaft 28 , gear 102 , and pinion 110 . pinion 110 is driveably connected to shaft 12 through coupler 128 . shaft 12 is driveably connected to output gear 34 and output 36 through coupler 126 . to accelerate the vehicle in reverse , the transmission is configured with coupler 128 engaging pinion 110 and coupler 130 engaging gear 122 . then , clutch 16 is engaged . the power path for this speed comprises input 10 , clutch 16 , input shaft 12 , coupler 128 , pinion 110 , gear 102 , gear 104 , pinion 112 , input shaft 14 , pinion 116 , gear 106 , gear 122 , coupler 130 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . input 10 is driveably connected to shaft 12 through clutch 16 . shaft 12 is driveably connected to pinion 110 through coupler 128 . pinion 110 drives gear 102 , auxiliary shaft 28 , gear 104 , pinion 112 , shaft 14 , pinion 116 , gear 106 , and gear 122 . gear 122 is driveably connected to layshaft 24 through coupler 130 . pinion 32 is secured to layshaft 24 and drives output gear 34 and output 36 . a shift may be accomplished in reverse by progressively engaging clutch 20 while progressively releasing clutch 16 . the power path for this speed comprises input 10 , clutch 20 , input shaft 14 , pinion 116 , gear 106 , gear 122 , coupler 130 , layshaft 24 , output pinion 32 , output gear 34 , and output 36 . following the shift , input 10 is driveably connected to shaft 14 and pinion 116 through clutch 20 . pinion 116 drives gear 106 and gear 122 , which is driveably connected to shaft 24 through coupler 130 . pinion 32 is secured to shaft 24 and drives ring gear 34 and output 36 . for purposes of this description of the invention and the claims , use of the words “ driveably connected ”, “ driving engagement ”, or derivatives of such is meant to include either a direct drive relationship between interacting components , or an indirect drive relationship between identified components that have other components therebetween , including but not limited to gears , pinions , shafts , couplers and clutches . as seen in fig1 , 4 and 7 , the layshafts 24 , 26 , and auxiliary shaft 28 , are non - coaxial with the input shafts 12 , 14 . in accordance with the provisions of the patent statutes , the principle and mode of operation of this invention have been explained and illustrated in its preferred embodiment . however , it must be understood that this invention may be practiced otherwise than as specifically explained and illustrated without departing from its spirit or scope . | 5 |
the novel photochemical reaction employed in the method of this invention is represented by the following equation : ## str3 ## in the foregoing formulas , the &# 34 ; r &# 34 ; groups may be hydrocarbon groups , which may or may not be substituted by oxygen and nitrogen . the term &# 34 ; hydrogen group &# 34 ; is therefore used herein as a generic term . r 1 and r 4 can be hydrocarbon groups containing from 1 to 18 carbons , and r 2 and r 3 can be hydrocarbon groups containing from 1 to 6 carbons . the preferred silyl diketones and the siloxy ketenes formed therefrom contain two single carbon &# 34 ; r &# 34 ; groups together with two short chain alkyl groups . for example , r 2 and r 3 can be ch 3 , while r 1 and r 4 can be alkyl groups containing from 1 to 6 carbons . si designates silicon . the silyl diketones are 1 - silyl - 1 , 2 - diones . they can be produced as starting materials by previously knowm methods . such methods are described by reich et al . ( 1982 ); reich et al . ( 1983 ); and bulman - page ( 1986 ). the method of reich et al . is described in example i . representative of the silyl diketones or 1 - silyl - 1 , 2 - diones are compounds ia and ib below : ## str4 ## the silyl diketone reactant can be used without solvent or it can be dissolved in a suitable inert solvent which also contains the ketene - reactive compound . the inert solvent should be one which does not act or degrade under conditions of the reaction , and should solubilize or be miscible with the siloxy ketene and the ketene - reactive compound . the resultant reaction mixture is then irradiated with light . daylight or artificially generated visible and / or ultraviolet light can be used . photolysis can be carried out by irradiation with light at wavelengths of from 200 to 800 nm . preferably , however , irradiation is with visible light , such as at wavelengths of about 400 to 600 nm . high energy irradiation is not required . the required light energy may be generated by conventional visible and / or ultraviolet light sources , including incandescent and fluorescent light sources . the described photolysis reaction can be carried out at ordinary ambient temperatures , such as at temperatures of 20 °- 30 ° c . more broadly , temperatures from - 20 ° to 50 ° c . are useable . as long as the reaction mixture is a liquid or is above the glass transition temperature of the mixture , heating of the mixture to higher temperatures than those indicated is not needed . further , excessive heating may promote formation of other products ; and , in the case of polymers , excessive heating can induce cross - linking . the range of molecular weights of the olefin - containing polymer is not critical as long as the reaction can be carried out above the glass transition temperature of the polymer . molecular weights of from 200 to 2 million for the resultant polymers can be achieved . in other embodiments , the ketene reactive compound may be a liquid which itself provides the liquid phase . in those embodiments , the silyl diketone and the resultant generated siloxy ketene should be soluble in the liquid ketene - reactive compound . if inert solvent is used , hydrogen solvents are preferred , such as benzene , toluene , xylene , etc . however , other inert solvents can be used such as chlorinated hydrocarbon solvents like trichloroethane , ethylene dichloride , etc . in still other embodiments , the reaction may be carried out in a viscous phase ( i . e ., above the glass transition phase ), such as in the adhesive coating after its application to a substrate . in those embodiments , the silyl diketone is premixed with the adhesive composition . for example , the adhesive composition may include one or more conjugated diene polymers . the mix is applied to the substrate and thereafter irradiated to produce in situ the siloxy - ketene intermediate , which will react with the conjugated diene linkages to form siloxy cyclobutanone groups along the polymer chains of the adhesive composition . such adhesive formulations may contain solvents which can be present on initial application of the adhesive to the substrate and during irradiation of the coating . after the in situ reaction , the coating can be dried to remove the solvent . the reaction mixture is preferably kept essentially free of oxygen . this has reference to the liquid phase itself , but it may be preferable to employ an oxygen - free atmosphere in contact with the liquid phase . if so , a nitrogen atmosphere can be used . the presence of trace amounts of oxygen in the liquid mixture can be tolerated so long as the primary reaction is between the ketene intermediate and the ketene - reactive compound . amounts of the silyl diketone employed in relation to the ketone - reactive compound can vary widely . the maximum amounts which can be reacted are determinable in relation to the number of unsaturated linkages ( electron - rich c -- c double bonds ) and / or the number of aldehyde groups , a 1 : 1 molar ratio being the maximum . to assure completion of reaction with the unsaturated linkages with the aldehyde groups , however , an excess of the silyl diketene can be employed . on the other hand , it may be desirable to react the siloxy ketene intermediate with only a portion of the unsaturated linkages , or with only a portion of the aldehyde groups . ( by electron - rich c -- c double bond is meant any alkene which bears substituents having a combined hammett sigma value of less than zero . by &# 34 ; alkene &# 34 ; 0p is meant any compound or polymer containing at least one olefinic double bond .) elastomeric diene polymers or copolymers prepared from conjugated diene monomers are an especially important class of the ketene - reactive compounds which can be used in the method of this invention . such polymers and copolymers include those prepared from 1 , 3 - butadiene , isoprene , chloroprene , 2 - phenyl - 1 , 3 - butadiene , 1 , 3 - pentadiene , 2 - vinylcyclohexene , 2 - chloro - 1 , 3 - pentadiene , and mixtures of such monomers . the resulting polybutadienes , polyisoprenes , polypentadienes , etc . include at least one and preferably a plurality of reactive unsaturated linkages ( the conjugated diene functionalities ). these are reactive with the siloxy ketene intermediates . siloxy - substituted cyclobutanone groups can be readily introduced into the conjugated diene polymers at the points of unsaturation in the polymer chains . the siloxy - containing cyclobutanone groups which result from the reaction of the siloxy ketene with diene polymers or other olefinic compounds can be represented by the following formula : ## str5 ## the values for &# 34 ; r &# 34 ; should be understood as having the same meanings as previously described for the silyl diketones and the siloxy ketenes . similarly , siloxy - substituted cyclobutanone groups can be incorporated in alkylene or cycloalkylene compounds . the alkylene compounds may be substituted , such as with oxygen or nitrogen , and should provide one or more carbon - to - carbon unsaturated linkages . for example , aliphatic alkenes containing from 2 to 20 carbon atoms can be used . similarly , cycloalkylene compounds can be employed . examples of alkenes are ethene , propene , butene , pentene , etc . examples of cycloalkylenes are cyclohexene , 2 , 3 - dihydropyran , cyclopentadiene , etc . a third class of the ketene - reactive compounds is the aldehydes . these may include one or more aldehyde groups . representative compounds are acetaldehyde , benzaldehyde , and glutaraldehyde . the aldehydes typically may contain from 2 to 20 carbons . as can be seen from the foregoing description , the siloxy ketene intermediates arre reactive with olefinic linkages , particularly with conjugated diene groups , and also with aldehyde groups . the method of this invention is therefore broadly applicable to these classes of compounds . it will also be apparent to those skilled in the art that the siloxy ketenes can be generated first and the resultant reactive intermediate can be treated with a reactant thereafter , that is , as a two - part system . the method of this invention and the novel products produced thereby are further illustrated by the following examples . the siloxy - ketenes generated reacted with substrates that are identified spectroscopically and are shown to react with substrates in a manner typical of ketenes . the 1 - silyl - 1 , 2 - diones in siloxy ketenes , as well as products from the reaction of the latter with ketene reactive substrates , were monitored by one or a combination of ir , nmr , and mass spectroscopies . the 1 - silyl - 1 , 2 - diones ia and ib were synthesized by the method of reich et al . ( 1983 ). ## str6 ## briefly , the diones were prepared as follows : the synthesis of 1 - silyl - 1 , 2 - diones was accomplished by the following procedure described by reich et al . ( 1982 ). propargyl alcohol was treated with ethyl vinyl ether in the presence of p - toluenesulfonic acid . the resulting protected alcohol was isomerized to the allenol ether by heating in the presence of catalytic amounts of potassium t - butoxide . the allenol ether was then silylated at - 90 ° in tetrahydrofuran by treatment with n - butyllithium and the corresponding chlorosilane . finally , the preparation of the 1 - silyl - 1 , 2 - dione was achieved by oxidation of the silylated allenol ether with m - chloroperoxybenzoic acid in dichloromethane solvent . the material was purified by distillation and / or gas chromatography . purification of compounds ia and ib was accomplished by preparative gas chromatography on a 6 &# 39 ;× 1 / 4 &# 34 ; 10 % ov - 101 on 60 / 80 mesh whp packed column . photolyses on a preparative scale were performed as follows : in a 13 mm od kimax ™ brand test tube was placed a solution containing 50 - 100 mg of freshly purified ia , 3 ml of a hydrocarbon solvent , and 2 ml of the alkene to be used as coreactant . the tube was sealed with a screw cap and a teflon - lined rubber septum . the sample was then deoxygenated by purging with dry nitrogen for 15 minutes in the dark . the tube and its contents were then irradiated ( at a distance of about 15 cm ., about six inches ) using a kodak carousel 5200 slide projector ( eastman kodak , rochester , ny ) with a cutoff filter ( ealing 475 nm filter , ealing corp ., south natick , ma ) inserted into the slide aperture of the projector . photolysis was stopped when no purple color could be visually detected . the solution was clear and colorless at this point and was concentrated on a rotary evaporator . the residue was purified by preparative gas chromatography using the same column as before . the following example describes the preparation of a siloxycyclobutanone from compound ia and cyclohexene . ia was photolyzed in the presence of commercial cyclohexene as described in example i . the resulting colorless liquid was isolated by gas chromatography . the following example describes the preparation of a siloxycyclobutanone from compound ia and 1 - pentene . ia was photolyzed in the presence of commercial 1 - pentene ( 98 +%) as described in example i . the resulting colorless liquid was isolated by gas chromatography the following example describes the preparation of a siloxycyclobutanone from compound ia and 2 , 3 - dihydropyran . ia was photolyzed in the presence of commercial 2 , 3 - dihydropyran as described in example i . the resulting colorless liquid was isolated by gas chromatography . the following example describes the preparation of a siloxycyclobutanone from compound ia and cyclopentadiene . ia was photolyzed in the presence of freshly distilled commercial cyclopentadiene as described in example i . the resulting colorless liquid was isolated by gas chromatography . the following example describes the preparation of 2 - oxetanones by photolysis of ia in pentane solution in the absence of coreactants . photolysis of ia as described in example i in the absence of added electron - rich alkenes resulted in the formation of complicated product mixture ( in contrast to the simple mixtures when the electron - rich alkenes were present ), which were examined by gas chromatography / mass spectroscopy ( gc / ms ), ir , and nmr . the following example describes the preparation of 2 - oxetanones by photolysis of compound ia in pentane solution in the presence of acetaldehyde and benzaldehyde respectively . ia was photolyzed in the presence of freshly distilled acetaldehyde or benzaldehyde respectively as described in example i . the product was identified by ir . the following example describes the photolysis of compound ia in the presence of oxygen ( air ). irradiation of ia in commercial cyclohexane as described in example i while purging the solution with air resulted in the clean formation of a clear colorless liquid which rapidly hydrolyzed in the laboratory environment . this material was identified as trimethylsilyl pyruvate . the following example describes the spectroscopic observation of siloxyketene ( compound iia ) during photolysis of compound ia . observation of the ketene carbonyl stretch in iia and was accomplished by preparation of mulls containing ia with nujol brand heavy mineral oil ( 5 drops / 10 ul ia ). the mull was placed between sodium chloride salt plates and the assembly was placed into the sample compartment of a perkin - elmer ( norwalk , ct ) model 983 scanning infrared spectrometer . after recording a baseline spectrum light was introduced from the kodak slide projector / filter apparatus described in example i by manually aiming the beam into the spectrometer . subsequent scanning with the light on showed an absorption band indicating the presence of a ketene . removal of the light source resulted in a rapid decline of the signal intensity . by monitoring the absorbance at 2105 cm - 1 as a function of time it was possible to determine that the decay followed first order kinetics over & gt ; 90 % of the decay , and was complete in 15 - 30 seconds . the experiment was reproduced using vaseline brand petroleum jelly and two fluorolubes ( hooker , 160 and 1200 wt ., hooker chemical co ., houston , tx ), with comparable results . the following example describes the spectroscopic observation of siloxyketene iib during photolysis of compound ib . observation of the ketene carbonyl stretch in iib was accomplished by preparation of mulls containing ib with nujol brand heavy mineral oil ( 5 drops / 10 ul ib ). the mull was placed between sodium chloride salt plates and the assembly was placed into the sample compartment of a perkin - elmer model 983 scanning infrared spectrometer . after recording a baseline spectrum light was introduced from the kodak slide projector / filter apparatus described in example i by manually aiming the beam into the spectrometer . subsequent scanning with the light on showed on absorption band consistent with a ketene . removal of the light source resulted in a slow decline of the signal intensity . greater than 300 seconds were required for complete signal decay to occur at room temperature . the following example decribes a typical preparation of siloxycyclobutanone modified polydiene polymer . polybutadiene ( 1 . 00 g , aldrich chemical co ., milwaukee , wi , # 18 , 138 - 2 , cis and trans ) was dissolved in 100 ml commercial cyclopentane . a 5 ml aliquot was removed and added to first and second pyrex test tubes , each fitted with a septum cap . the required amount of silyl diketone ia and ib was added to the first and second tubes respectively . each tube was purged with dry nitrogen for 20 minutes in the dark and then irradiated ; irradiation was accomplished using a kodak carousel 5200 slide projector using a ge fhs 300 w 82 v projection lamp . an ealing 475 nm cutoff filter was inserted into the projector to ensure irradiation of only the long way absorption band at 530 nm . the respective tube was irradiated until no pink color remained in the solution ( about 10 min ). each resultant mixture was then transferred to a respective flask and attached to high vacuum at room temperature for 6 hours to remove volatile material ; it is important and known in the art that if volatile materials remain in the polymer , erroneous measurements of peel adhesion may result . the respective material was analyzed or redissolved for coating experiments . coatings from 2 % wt / vol solutions of the modified cyclobutanone containing polymer in cyclopentane were made on to polyvinylidene chloride - primed polyethylene terephthalate film ( 3m film , 3m , st . paul , mn ) as a substrate using a number 22 wire wrapped rod and the resultant layered structure was allowed to air dry 15 minutes before being placed in a vacuum oven at 60 ° for 4 hours to dry . peel adhesion measurements were made on an instrumentors slip / peel tester model 3m90 ( cleveland , oh ) using a 2 lb weight and a 90 in / min peel rate . scotch brand ™ magic ™ tape ( 3 / 4 &# 34 ;, 3m , st . paul , mn ) was used as the adhesive substrate removed from polymer coated surfaces . experiments were performed on all samples to ensure that material transfer had not occurred during the peeling process , or that tackiness was not due to insufficient drying of the sample . results from siloxycyclobutanone - modified polydienes are described in table i . generally , an increase in the observed peel adhesion was found as compared to control polydienes . further a correlation between the extent of adhesion increase and the extent of siloxycyclobutanone formation can be seen ; the higher the amount of siloxycyclobutanone formation , the higher the peel adhesion measured . in the case of polyisoprene similar results were obtained . measurement of the peel adhesion of polyisoprene ( control ) was not possible since this material peeled off the polyvinylidene chloride substrate during testing . in contrast , once the polymer was modified to provide a siloxycyclobutanone - containing polymer of this invention , it maintained adhesion to the substrate indicating both an increase in adhesion , and that this process is useful in priming surfaces . table 1______________________________________peel adhesion values for modified polydienepolymers and reference materials . peel adhesionpolymer substrate oz / in notes______________________________________pbd . sup . a pvc . sup . b 1 . 0pbd . sup . a polyester 0 . 6 -- pyrex 23 . 1 -- polyester 18 . 2 -- pvc . sup . b 12 . 9a pvc . sup . b 28 . 5a polyester 27 . 6b pvc . sup . b 18 . 3c pvc . sup . b 28 . 3d pvc . sup . b 29 . 3e pvc . sup . b 24 . 3f pvc . sup . b -- peeled offf pvc . sup . b 32 . 8 air driedf pvc . sup . b 40 . 1 air driedg pvc . sup . b 6 . 1h pvc . sup . b 10 . 5i pvc . sup . b 16 . 6______________________________________ a = 0 . 72 g solution containing ia ( about 50 % by gc )/ 1 . 0 g pbd b = 9 mg ia / 110 mg pbd c = 36 mg ib / 110 mg pbd d = 90 mg ia / 110 mg pbd e = 45 mg ia / 110 mg pbd f = 90 mg ia / 110 mg pip . sup . c g = 5 mg ia / 100 mg cpbd . sup . d h = 10 mg ia / 100 mg cpbd . sup . d i = 20 mg ia / 100 mg cpbd . sup . d . sup . a pbd = polybutadiene ( aldrich , # 18 , 1382 , cis and trans ) . sup . b polyester film primed with polyvinylidene chloride ( pvc ) . sup . c pip = polyisoprene , ( aldrich , # 18 , 2168 , trans ) . sup . d cpbd = polybutadiene ( aldrich , # 18 , 1374 , cis ) brady , w . t . ; waters , o . h . ( 1967 ), j . org . chem . 32 , 3703 . bryce - smith , &# 34 ; photochemistry &# 34 ; ( the chemical society ), vol . 9 ( 1976 - 1977 ), pages 320 - 335 ; and vol . 10 ( 1977 - 1978 ), pages 281 - 297 . meier , h ., zeller , k .- p , ( 1975 ), angew chem . internat . ed . engl . 14 , 32 . patai , saul ( ed . ), &# 34 ; the chemistry of ketenes , allenes , and related compounds &# 34 ;, part 1 ( john wiley and sons , new york , 1980 ), chapt . 7 , pages 223 - 277 ). reich , h . j ., and kelly , m . j ., j . am . chem . soc . 1982 , 104 , 1119 . reich , h . j . , kelly , m . j ., olson , r . o ., and holtan , r . c ., tetrahedron 1983 , 39 , 949 . bulman page , p . c ., and rosenthal , s ., tetrahedron lett . 1986 , 27 , 2527 . | 2 |
the following detailed description is provided to gain a comprehensive understanding of the methods , apparatuses and / or systems described herein . various changes , modifications , and equivalents of the systems , apparatuses and / or methods described herein will suggest themselves to those of ordinary skill in the art . descriptions of well - known functions and structures are omitted to enhance clarity and conciseness . hereinafter , an exemplary embodiment will be described with reference to accompanying drawings . referring to the drawings , fig1 is a cross - sectional view of a cable 10 according to an exemplary embodiment of the invention . in this embodiment , cable 10 has the communication fibers 3 in the center of the cable . the exact core structure depends on the number of fibers being protected and may include a strength element 1 in the center . in this embodiment , the core structure includes five tubes 2 with sixteen optical fibers 3 in each tube 2 . in various embodiments of the invention , the core structure could include , but not be limited to , fiber counts ranging from 1 to 3000 . these optical fibers 3 would preferably be housed in a tube / structure 2 that is difficult to remove such as a stainless steel tube . around the core is a layer of guard fiber elements 4 that may be wrapped in a helical pattern and over that is another layer of guard fiber elements 6 that may be wrapped contra - helically . fig3 shows one possible wrapping pattern . in this figure , guard fiber elements 30 are wrapped helically and guard fiber elements 31 are wrapped contra - helically . the embodiment is not limited to two guard layers , and more could be added for improved tamper resistance . these guard fiber elements 4 , 6 would house optical fibers 5 , 7 and these would be interconnected and monitored optically by commonly known methods with the intent of looking for optical loss and / or acoustic / vibration signature . the intent is that if someone wanted to access the guard fibers 5 , 7 , they would have extreme difficulty getting through the two layers of guard elements 4 , 6 without creating either optical loss or an acoustic / vibration signal . these guard elements would preferably be housed in a tube / structure 4 , 6 that is difficult to remove such as a stainless steel tube . the outside of the cable could be covered by a jacket 8 , made of known conventional cable jacket materials , including , but not limited to , polyethylene . in another embodiment , additional layers of polymers and adhesives between the layers , such as in spaces 9 , can be added can make access to the communication fibers 3 increasingly difficult . in another embodiment , if metal tubes are used , the tubes may be spot welding together so they are not “ un - stranded ” easily . in another embodiment , if metal elements are used , an electric current can be driven through the structure and the current may be monitored . thus , if part of the metal structure is removed / cut , the signal will be disrupted , which would indicate possible tampering . also , if metal elements are used , the resistance of the structure may be measured . thus , if part of the metal structure is removed / cut , the resistance will change , which would indicate possible tampering . in another embodiment , the user may deploy decoy communication fibers in the core as well — i . e . using 432 fibers when they only need 48 fibers . they would transmit false data down the other fibers . ideally the sequence would be adjusted randomly as well to create further difficulty to the entity trying to get into the key communication fibers . in another embodiment , polymer materials could be used to create a bond with the metal elements in the core . this both makes it more difficult to separate the elements and to identify the stainless tubes versus the wires . in another embodiment , decoy guard elements of stainless steel tube and / or thin walled polybutylene terephthalate ( pbt ) may be added to complicate the attempts to enter the cable . while the embodiment shown in fig1 shows five tubes in the core , more or less tubes could be used depending on the size of the cable . similarly , while eleven inner guard elements 4 are shown , more or less elements could be used depending on the size of the cable . similarly , while seventeen outer inner guard elements 6 are shown , more or less elements could be used depending on the size of the cable . likewise , while fig1 shows that the inner guard elements 4 and outer guard elements 6 as having the same diameter , they could have different diameters , for example the diameter of the outer guard elements 6 could be larger than the diameter of the inner guard elements 4 . while the embodiment shown in fig1 shows fibers in each of the guard elements 4 , 6 , some of the guard elements can be left empty , be replaced with a filler component , rather than fibers , to reduce cost , or be made of a solid material / wire . however , to the outside , they would look just like the guard elements with fibers . in one preferred embodiment , the cable has a total of 492 fibers , which includes 72 fibers in each of six core tubes , which may be used for communications , and sixty guard fibers spread out in the inner and outer guard layers . referring to the drawings , fig2 is a cross - sectional view of a cable 20 according to another exemplary embodiment of the invention . this cable has a total of 492 fibers , which includes 72 fibers in each of six core tubes , which may be used for communications , and sixty guard fibers spread out in the inner and outer guard layers . in this embodiment , cable 20 has the communication fibers 23 in the center of the cable . the exact core structure depends on the number of fibers being protected and may include a strength element 21 in the center . in this embodiment , the core structure includes six tubes 22 with 72 optical fibers 23 in each tube 22 . however , the core structure of this embodiment is not limited to these fiber counts . these optical fibers 23 would preferably be housed in a tube / structure 22 that is difficult to remove such as a stainless steel tube . around the core is a layer of guard fiber elements 24 that may be wrapped in a helical pattern and over that is another layer of guard fiber elements 26 that may be wrapped contra - helically . see , for example . the embodiment is not limited to two guard layers , and more could be added for improved tamper resistance . these guard fiber elements 24 , 26 would house optical fibers 25 , 27 and these would be interconnected and monitored optically by commonly known methods with the intent of looking for optical loss and / or acoustic / vibration signature . the intent is that if someone wanted to access the guard fibers 25 , 27 , they would have extreme difficulty getting through the two layers of guard elements 24 , 26 without creating either optical loss or an acoustic / vibration signal . these guard elements would preferably be housed in a tube / structure 24 , 26 that is difficult to remove such as a stainless steel tube . in this embodiment , decoy guard elements of stainless steel tube and / or thin walled polybutylene terephthalate ( pbt ) or solid materials / wires 24 a , 26 a may be added to complicate the attempts to enter the cable . the outside of the cable could be covered by a jacket 28 , made of known conventional cable jacket materials , including , but not limited to , polyethylene . in another embodiment , additional layers of polymers and adhesives between the layers , such as in spaces 29 , can be added can make access to the communication fibers 23 increasingly difficult . in another embodiment , if metal tubes are used , the tubes may be spot welding together so they are not “ un - stranded ” easily . in another embodiment , if metal elements are used , an electric current can be driven through the structure and the current may be monitored . thus , if part of the metal structure is removed / cut , the signal will be disrupted , which would indicate possible tampering . also , if metal elements are used , the resistance of the structure may be measured . thus , if part of the metal structure is removed / cut , the resistance will change , which would indicate possible tampering . in another embodiment , the user may deploy decoy communication fibers in the core as well — i . e . using 432 fibers when they only need 48 fibers . they would transmit false data down the other fibers . ideally the sequence would be adjusted randomly as well to create further difficulty to the entity trying to get into the key communication fibers . in another embodiment , polymer materials could be used to create a bond with the metal elements in the core . this both makes it more difficult to separate the elements and to identify the stainless tubes versus the wires . while the embodiment shown in fig2 shows six tubes in the core , more or less tubes could be used depending on the size of the cable . similarly , while 24 inner guard elements 24 , 24 a are shown , more or less elements could be used depending on the size of the cable . similarly , while 21 outer inner guard elements 26 , 26 a are shown , more or less elements could be used depending on the size of the cable . likewise , while fig2 shows that the inner guard elements 24 , 24 a and outer guard elements 26 , 26 a as having the different diameters , they could have the same diameters . while the embodiment shown in fig2 shows fibers in only some of the guard elements 24 , 26 , all of the guard elements could have fibers . as mentioned above , although the exemplary embodiments described above are various fiber optic cables , they are merely exemplary and the general inventive concept should not be limited thereto , and it could also apply to other types of cables . | 6 |
referring to the drawings the numeral 10 generally designates a typical pickup truck having a cab 12 , and a truck bed 14 . extending upwardly from the edges of truck bed 14 are a pair of side walls 16 , 18 each of which has an elongated upper edge 20 , 22 respectively . a wheel well 24 protrudes into the space provided between the side walls 16 and 18 . the truck also includes wheels 26 . mounted within the back of the pickup truck is a tool chest 28 . tool chest 28 is formed from a chest bottom 30 and a chest top 32 . chest bottom 30 includes a front wall 34 , a rear wall 36 , opposite end walls 38 , 40 , and a bottom wall 42 . extending around the upper edges of the front , rear , and end walls 34 , 36 , 38 , 40 is a rim 44 which in cross section includes a horizontal rim flange 43 and a vertical rim flange 45 . a compartment 46 is formed within the walls 34 , 36 , 38 , 40 , 42 of the chest bottom 30 . chest top 32 includes a top frame 48 comprised of a front frame member 50 , a rear frame member 52 , and a pair of opposite end frame members 54 , 56 forming a rectangular frame opening 59 within the top frame 48 . a lid 60 is mounted to the top frame 48 by means of an elongated hinge 62 . the cross sectional configurations of the ends of the lid 60 , the chest top 32 , and the chest bottom 30 are partially shown in fig3 . within the end of lid 60 is a horizontal flange 64 , a vertical flange 66 , a second horizontal flange 68 , and a second vertical flange 60 . a sealing member 72 is attached to the horizontal flange 68 and faces downwardly . the opposite end frame members 56 , 58 of top frame 48 are shown in cross section in fig3 and include an inner horizontal flange 74 , a downwardly extending vertical flange 76 , an l leg 78 which joins another l leg 80 to form an l shape , an upper horizontal flange 82 , and an upper vertical flange 84 which engages sealing member 72 . the lower horizontal flange 74 mates with the horizontal rim flange 43 of chest bottom 30 , and the lower vertical flange 76 of top frame 48 surrounds and mates against the vertical rim flange 45 . a bolt 86 extends through the horizontal flange 74 and the horizontal rim flange 43 and is secured by a nut 88 . in this configuration the mating engagement of flanges 74 , 76 with rim flanges 43 , 45 prevents moisture , rain , or other elements from entering between the joint formed between these flanges . horizontal leg 78 forms a wing flange which extends over the top edge 20 of side wall 16 and which can be secured in place by means of a bolt 89 having a nut 91 threaded on its lower end . a hook 93 is welded to nut 91 and hooks over the lower edge of a flange 21 on the upper edge 20 of side wall 20 of truck 10 . fig4 illustrates the manner in which the lid 60 mates with the front frame member 50 and the rear frame member 52 of top frame 48 . the cross section of front frame member 50 is the same as for end frame members 54 , 56 except that an l - leg 150 is somewhat shorter than l - leg 78 of end frame members 54 , 56 . the rear frame member 52 is comprised of lower horizontal flange 74 , lower vertical flange 76 , an l - leg 152 , and a vertical l - leg 154 which is connected at its ends to upper vertical flanges 84 of end frame members 54 , 56 . referring to fig5 a modified form of the tool chest is designated by the numeral 90 . the tool chest 90 includes a tool bottom 30 which is identical to the chest bottom 30 which appears in fig1 . corresponding numerals have been used in fig5 to designate parts which correspond between the tool box 10 in fig2 and the tool box 90 in fig5 . a rectangular top frame 92 includes a first opening 94 and a second opening 96 formed by a front frame member 98 , a rear frame member 100 , end frame members 102 , 104 , and a cross frame member 106 . extending around the first opening 94 is a first rectangular flange 108 , and extending around a the second frame opening 96 is a second rectangular flange 110 . a first lid 112 is hinged by a hinge 116 ( fig6 ) to the frame member so as to move from its open position shown in fig5 to a closed position in covering relation over the first opening 94 . a second lid 114 is hinged by means of a hinge 118 to move from an open position shown in fig5 to a closed position in covering relation over second opening 96 . the cross sectional configuration of the top frame 92 when it is placed over the chest bottom 30 is the same as shown in fig3 and therefore is not repeated for the modification shown in fig5 . referring to fig7 a third modified form of the invention is shown and is designated by the numeral 120 . tool chest 120 includes a pair of downwardly extending legs 122 which straddle the wheel well 124 as shown in fig7 and 8 . tool chest 120 includes a top frame 124 having a lid 126 . the cross sectional configuration of the rear edge of top frame 124 , when mated to the chest bottom is shown in fig9 . the top lid 126 includes a vertical flange 128 , a horizontal flange 130 , and a vertical flange 132 , and a horizontal flange 134 . the sealing member 136 is fitted to the downwardly presented surface provided by horizontal flange 130 . the rear portion of rectangular frame 124 in cross section includes a vertical flange 138 the upper edge of which engages sealing member 136 . extending from upper vertical flange 138 is a horizontal flange 140 which turns downwardly to form a vertical flange 142 , then inwardly to form a horizontal flange 144 , then upwardly to form a vertical flange 146 and then horizontally to form a horizontal flange 148 . flanges 146 , 148 matingly engage the flanges 43 and 45 respectively of the bottom chest in the same manner as shown in fig3 . similarly a bolt 86 and a nut 88 secure the two together . the rear wall 36 of the chest bottom 30 is placed in facing engagement with the side wall 16 of the vehicle 10 . in this position the horizontal flange 144 engages the upper edge 20 of side wall 16 where it is secured in place by means of bolt 89 , nut 91 , and hook 93 . other suitable securing means such as screws , rivets , or other fasteners may be used in the place of bolt 89 , nut 91 , and hook 93 . because of the dimensions of the vehicle 10 , it is not possible to make a tool box capable of fitting in the pickup bed in the manner shown in fig1 or 7 and still meet the shipping requirement of most shippers . therefore the present invention makes possible the shipping of the device by making it possible to manufacture and ship the top section separately from the chest bottom . in this configuration the girth of the chest bottom plus the length of the chest bottom is less than 130 inches . by girth is meant the dimension around the perimeter of the device in its narrowest dimension . the length is then added to this girth to achieve the total number of inches . similarly the top section meets the requirement that the girth plus the length be less than 130 inches . however , when the top section and the chest bottom are assembled together the assembled tool box exceeds the 130 inches when its girth is added to its length . thus it is possible to ship the top and the bottom in separate packages and then to assemble the two at their destination . they may be assembled quickly and easily . in the drawings and specification there has been set forth a preferred embodiment of the invention , and although specific terms are employed , these are used in a generic and descriptive sense only and not for purposes of limitation . changes in the form and the proportion of parts as well as in the substitution of equivalents are contemplated as circumstances may suggest or render expedient without departing from the spirit or scope of the invention as further defined in the following claims . | 1 |
referring now to the drawings , fig1 illustrates an axial compressor flow path 1 of a gas turbine compressor 2 that includes a plurality of compressor stages . the compressor stages are sequentially numbered in the figure . the compressor flow path comprises any number of rotor stages and stator stages , such as eighteen . however , the exact number of rotor and stator stages is a choice of engineering design . any number of rotor and stator stages can be provided in the combustor , as embodied by the invention . the seventeen rotor stages are merely exemplary of one turbine design . the eighteen rotor stages are not intended to limit the invention in any manner . the compressor rotor blades impart kinetic energy to the airflow and therefore bring about a desired pressure rise across the compressor . directly following the rotor airfoils is a stage of stator airfoils . both the rotor and stator airfoils turn the airflow , slow the airflow velocity ( in the respective airfoil frame of reference ), and yield a rise in the static pressure of the airflow . the configuration of the airfoil ( along with its interaction with surrounding airfoils ), including its peripheral surface provides for stage airflow efficiency , enhanced aeromechanics , smooth laminar flow from stage to stage , reduced thermal stresses , enhanced interrelation of the stages to effectively pass the airflow from stage to stage , and reduced mechanical stresses , among other desirable aspects of the invention . typically , multiple rows of rotor / stator stages are stacked in axial flow compressors to achieve a desired discharge to inlet pressure ratio . rotor and stator airfoils can be secured to rotor wheels or stator case by an appropriate attachment configuration , often known as a “ root ”, “ base ” or “ dovetail ” ( see fig2 - 5 ). a stage of the compressor 2 is exemplarily illustrated in fig1 . the stage of the compressor 2 comprises a plurality of circumferentially spaced rotor blades 22 mounted on a rotor wheel 51 and a plurality of circumferentially spaced stator blades 23 attached to a static compressor case 59 . each of the rotor wheels is attached to aft drive shaft 58 , which is connected to the turbine section of the engine . the rotor blades and stator blades lie in the flow path 1 of the compressor . the direction of airflow through the compressor flow path 1 , as embodied by the invention , is indicated by the arrow 60 ( fig1 ). this stage of the compressor 2 is merely exemplarily of the stages of the compressor 2 within the scope of the invention . the illustrated and described stage of the compressor 2 is not intended to limit the invention in any manner . the rotor blades 22 are mounted on the rotor wheel 51 forming part of aft drive shaft 58 . each rotor blade 22 , as illustrated in fig2 - 6 , is provided with a platform 61 , and substantially or near axial entry dovetail 62 for connection with a complementary - shaped mating dovetail , not shown , on the rotor wheel 51 . an axial entry dovetail , however , may be provided with the airfoil profile , as embodied by the invention . each rotor blade 22 comprises a rotor blade airfoil 63 , as illustrated in fig2 - 6 . thus , each of the rotor blades 22 has a rotor blade airfoil profile 66 at any cross - section from the airfoil root 64 at a midpoint of platform 61 to the rotor blade tip 65 in the general shape of an airfoil ( fig6 ). to define the airfoil shape of the rotor blade airfoil , a unique set or loci of points in space are provided . this unique set or loci of points meet the stage requirements so the stage can be manufactured . this unique loci of points also meets the desired requirements for stage efficiency and reduced thermal and mechanical stresses . the loci of points are arrived at by iteration between aerodynamic and mechanical loadings enabling the compressor to run in an efficient , safe and smooth manner . the loci , as embodied by the invention , defines the rotor blade airfoil profile and can comprise a set of points relative to the axis of rotation of the engine . for example , a set of points can be provided to define a rotor blade airfoil profile . a cartesian coordinate system of x , y and z values given in the table below defines a profile of a rotor blade airfoil at various locations along its length . the airfoil , as embodied by the invention , could find an application as a 11 th stage airfoil stator vane . the coordinate values for the x , y and z coordinates are set forth in inches , although other units of dimensions may be used when the values are appropriately converted . these values exclude fillet regions of the platform . the cartesian coordinate system has orthogonally - related x , y and z axes . the x axis lies parallel to the compressor blade &# 39 ; s dovetail axis , which is at a angle to the engine &# 39 ; s centerline , as illustrated in fig7 for a rotor and fig8 for a stator . a positive x coordinate value is axial toward the aft , for example the exhaust end of the compressor . a positive y coordinate value directed normal to the dovetail axis . a positive z coordinate value is directed radially outward toward tip of the airfoil , which is towards the static casing of the compressor for rotor blades , and directed radially inward towards the engine centerline of the compressor for stator blades . for reference purposes only , there is established point - 0 passing through the intersection of the airfoil and the platform along the stacking axis , as illustrated in fig5 . in the exemplary embodiment of the airfoil hereof , the point - 0 is defined as the reference section where the z coordinate of the table above is at 0 . 000 inches , which is a set predetermined distance from the engine or rotor centerline . by defining x and y coordinate values at selected locations in a z direction normal to the x , y plane , the profile section of the rotor blade airfoil , such as , but not limited to the profile section 66 in fig6 , at each z distance along the length of the airfoil can be ascertained . by connecting the x and y values with smooth continuing arcs , each profile section 66 at each distance z can be fixed . the airfoil profiles of the various surface locations between the distances z are determined by smoothly connecting the adjacent profile sections 66 to one another , thus forming the airfoil profile . these values represent the airfoil profiles at ambient , non - operating or non - hot conditions and are for an uncoated airfoil . the table values are generated and shown to three decimal places for determining the profile of the airfoil . there are typical manufacturing tolerances as well as coatings , which should be accounted for in the actual profile of the airfoil . accordingly , the values for the profile given are for a nominal airfoil . it will therefore be appreciated that +/− typical manufacturing tolerances , such as , +/− values , including any coating thicknesses , are additive to the x and y values . therefore , a distance of about +/− 0 . 160 inches in a direction normal to any surface location along the airfoil profile defines an airfoil profile envelope for a rotor blade airfoil design and compressor . in other words , a distance of about +/− 0 . 160 inches in a direction normal to any surface location along the airfoil profile defines a range of variation between measured points on the actual airfoil surface at nominal cold or room temperature and the ideal position of those points , at the same temperature , as embodied by the invention . the rotor blade airfoil design , as embodied by the invention , is robust to this range of variation without impairment of mechanical and aerodynamic functions . the coordinate values given in table 1 below provide the nominal profile envelope for an exemplary 11 th stage airfoil stator vane . it will also be appreciated that the exemplary airfoil ( s ) disclosed in the above table 1 may be scaled up or down geometrically for use in other similar compressor designs . consequently , the coordinate values set forth in the table 1 may be scaled upwardly or downwardly such that the airfoil profile shape remains unchanged . a scaled version of the coordinates in table 1 would be represented by x , y and z coordinate values of table 1 multiplied or divided by a constant . while various embodiments are described herein , it will be appreciated from the specification that various combinations of elements , variations or improvements therein may be made by those skilled in the art , and are within the scope of the invention . | 5 |
the preferred embodiment illustrated is not intended to be exhaustive or to limit the invention to the precise form disclosed . it is chosen and described in order to best explain the principles of the invention and its application and practical use to thereby enable others skilled in the art to utilize the invention . the filter shown in fig1 and 2 where an inlet 18 &# 39 ; for the filter 10 &# 39 ; is in the filter cover 40 &# 39 ;. filter 10 &# 39 ; includes a housing 12 &# 39 ; having a side wall 14 &# 39 ; and a bottom wall 16 &# 39 ;. an outlet 20 &# 39 ; is formed in housing bottom wall 16 &# 39 ;. a circular shoulder 84 is formed in the upper edge 22 &# 39 ; of side wall 14 &# 39 ;. a filtering bag 82 is suspended within housing 12 &# 39 ; with the shape - retaining upper margin 90 of the bag resting on shoulder 84 . an o - ring 92 is seated in a groove 94 in side wall upper edge 22 &# 39 ; and provides for peripheral sealing contact between cover 40 &# 39 ; and the side wall upper edge . when cover 40 &# 39 ; is fastened to housing 12 &# 39 ;, such as by tightening holddown nuts 96 , bag upper margin 90 is compressed against shoulder 84 . it is to be understood that the manner in which bag 82 is sealed at its upper margin can vary from the manner shown . also a basket could be utilized with bag 82 as shown in u . s . pat . no . 3 , 814 , 261 . adaptation of filter 10 &# 39 ; for use as a cartridge - type filter is accomplished by removing bag 82 from housing 12 &# 39 ; and inserting filter cartridge insert 98 ( shown individually in fig3 ) into the housing . filter cartridge insert 98 includes a liquid impervious cylindrical basket 100 having a side wall 102 and a bottom wall 104 . the basket side wall 102 terminates at its upper end in an outturned flange 106 . when basket 100 is inserted into housing 12 &# 39 ;, basket flange 106 in compressive contact with cover 40 &# 39 ; is supported by housing shoulder 84 and sealed thereagainst by an o - ring 105 . basket bottom wall 104 carries reticulated tubular center posts 108 which extend upwardly from the bottom wall . each center post 108 has a central passage 110 which is aligned with an opening through basket bottom wall 104 . each center post 108 is adapted to support a filter cartridge 111 which includes a reticulated cylindrical frame 112 wrapped with fiber 114 . each cartridge frame 112 slides over a center post 108 and is topped by a cap 116 to seal the upper end of its central passage 110 . a helical spring 120 in contact with cover 40 &# 39 ; presses against each cap 116 to seal and anchor the underlying cartridge . when in use as a bag - type filter as shown in fig1 liquid , as shown by arrows 121 , enters filter 10 &# 39 ; through inlet 18 &# 39 ;, passing directly into bag 82 where it is filtered as it flows through the bag into housing 12 &# 39 ;. the fluid exits housing 12 &# 39 ; through outlet 20 &# 39 ;. conversion of filter 10 &# 39 ; from a bag - type filter to a cartridge - type filter includes removing cover 40 &# 39 ;, lifting bag 82 from housing 12 &# 39 ;, placing basket 100 in its place within the housing , and replacing the cover . liquid , as shown by arrows 123 in fig2 then enters filter 10 &# 39 ; through inlet 18 &# 39 ; passing into basket 100 where it passes through each filter cartridge 111 and openings 109 in supporting center post 108 , into center passage 110 of the post . from post center passage 110 , the liquid flows through basket bottom wall 104 and into housing 12 &# 39 ; where it exits the housing through outlet 20 &# 39 ;. it should also be understood that the invention is not to be limited by the terms of the above description and may be modified within the scope of the appended claims . | 1 |
in fig1 a burn rack 10 has a plurality of individual cells 12 , in this embodiment five cells , although the rack may have more or less cells including , in an extreme case , just a single cell . each cell 12 can accommodate a respective pc system unit 14 , which can be plugged into the cell for software download and / or system unit testing . on the front of each cell 12 there is a group 16 of four indicator lamps , each of which glows a different color when lighted , e . g . gray , green , red and blue respectively . in fig1 the circle indicated by the reference 16 refers to the group of four lamps and the legend within the circle indicates the lamp which is currently lighted within the group , e . g . gry ( gray ), grn ( green ), red or blue . bik ( black ) means that none of the four lamps is lighted . the group of lamps 16 is referred to herein as the cell status indicator ( csi ). monitoring software within or associated with each cell 12 monitors the network traffic between the cell and the server ( s ) which supplies the downloaded software , performs the tests , and lights the appropriate lamp within the csi 16 according to the instantaneous state of the cell : csi = black : the cell is free ( empty ) csi = gray : the cell is occupied with a system unit which is unable to or has not yet established connection to the server and therefore unable to commence processing ( downloading and / or testing ). this is referred to as “ out of scope ”. csi = red : the cell is occupied with a system unit whose processing has failed ( i . e . unsuccessful download and / or testing ). csi = blue : the cell is occupied with a system unit that is successfully undergoing processing . csi = green : the cell is occupied with a system unit that has finished processing and is ready to leave the rack . it will be understood that in fig1 each of the cells 12 is shown in a different state ( i . e . the csis are all different ) for the sake of explanation . obviously , in practice there will be periods when there are two or more cells simultaneously in the same state while one or more states will not occur in any of the cells . the state monitoring software also has a timer which measures the period of time for which each cell 12 has been in the state indicated by its csi 16 . this time period is preferably displayed on a clock 18 located on the front of each cell next to the csi 16 . the time periods shown on the clocks 18 in fig1 are solely by way of example and an explanation of the csi status and associated time period for each cell is given on the right hand side of the rack . it will be recognized that the provision of cell state monitoring software to drive the csis 16 and clocks 18 is well within the capabilities of those skilled in the art . [ 0016 ] fig2 is a state diagram of a single cell 12 ( the time periods shown are for illustration only ). in fig2 blocks 42 to 48 should be ignored for the moment . the cell status 20 is either free ( block 22 ) or occupied ( block 24 ). if free , the csi remains black until a system unit arrives at the cell ( block 26 ), whereupon the csi will change to gray ( block 28 ) or blue ( block 30 ) according to circumstances . if the csi is gray the monitoring software waits for client - server ( c - s ) communications ( block 32 ) and if c - s communications is established the csi changes to blue ( block 30 ). from blue the csi can change to green ( block 34 ) if the processing is successfully complete or red ( block 36 ) if the processing has failed at any point . in the latter case the system unit is revisited ( block 38 ), either to reconnect it , if it is thought that the connections may have come loose , or to remove it . the rack 10 , including the csis 16 and clocks 18 , provides a substantially enhanced of level of intersection between the rack and the rack operator , making it easy for the operator to recognize the status of a system unit on the rack and to react immediately to address any issues . however , further benefit is achieved in this embodiment by supplying the state and time period data determined by the state monitoring software to a data determined by the state monitoring software to a data analyzer ( herein referred to as a traffic performance analyzer , or tpa ) 40 , fig1 . thus , referring again to fig2 when the csi 16 of a cell 12 changes from csi = black ( block 22 ) to gray ( block 28 ) or blue ( block 30 ), the change of state and the time period for which the cell was in state csi = black ( free time ) is reported ( block 42 ) by the state monitoring software to the tpa 40 . likewise , the state change from csi = gray and the time period for which the cell was in state csi = gray ( dwell time ) is reported at block 44 , and the state change from csi = red and the time period for which the cell was in state csi = red ( fail time ) is reported at block 46 . finally , at block 48 the monitoring software also reports the total burn time for a successfully processed system unit , i . e . the total time spent in states csi = blue and csi = green . the tpa 40 uses standard statistical techniques to derive statistical data useful for management . for example , the distribution of free , dwell and fail times over a shift , or longer period , can provide useful information regarding operator efficiency and identify congested periods for network traffic . such statistical data can promote full utilization of the burn rack cells by identifying the exact utilization of the burn racks over a certain period of time , i . e . the ratio of the system units in process to all system units in the rack ( finished , failed , and those not being able to establish connection with the network ). such data can also promote a homogenous traffic flow between the build cells ( locations where the pcs are physically assembled ) and the burn rack by identifying the average time for pushing a new unit to a free cell in the burn racks . as an example of the benefit to be obtained by this disclosure , suppose that the average dwell time , over a certain period of time , is 20 minutes . if by improving the network traffic conditions we can reduce this time to 10 minutes , for example , and if we have 7 lines each running at 200 units per hour ( uph ), then we can eliminate 233 hours ( 200 × 10 × 7 ≅ 233 ) dwell time over one hour of production in one factory . as another example , reducing the average time required to load units to cells from 15 minutes ( for example ) to 5 minutes , will speed up the traffic and cut down on the processing time by 10 minutes . although illustrative embodiments have been shown and described , a wide range of modification , change and substitution is contemplated in the foregoing disclosure and in some instances , some features of the embodiment may be employed without a corresponding use of other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the embodiments disclosed herein . | 6 |
with reference to fig1 there is shown an error correction ribbon drive system of a type which may be used in typewriters or printers . although the following discussion refers to typewriters , it is expected that the subject ribbon drive system may be used in printers and other similar machines as well . while the following discussion refers to error correction ribbons , as previously noted , the ribbon drive system may also be used for printing ribbons such as carbon and fabric ribbons . an error correction ribbon 10 extends between a fixed supply spool 12 and a vertically moveable take - up spool 14 . the supply spool 12 and take - up spool 14 are shown as being vertically mounted to provide an open area between the spools to accomodate a print ribbon cartridge 16 and a removeable disc type print element 18 . the ribbon 10 is threaded from the fixed supply spool 12 through a ribbon guide 20 which is fixed with respect to the typewriter frame . thereafter , the ribbon 10 is threaded through a print point ribbon guide 22 , a vertically moveable ribbon guide 24 , and thereafter is wound on take - up spool 14 . ribbon guide 24 is mounted on vertically moveable spool bracket 26 which will be described more fully below . the typewriter print point 28 is located midway between ribbon guide 20 and ribbon guide 24 . when the typist wishes to correct an error , an error correction typewriter key at the typewriter keyboard ( not shown ) is depressed and appropriate electronic circuitry activates solenoid 30 . the activitation of solenoid 30 causes linkage 32 , 34 and thereby arm 36 of linkage 32 , 34 to rotate counter - clockwise about fixed rod 38 . counter - clockwise rotation of arm 36 activates a clutch 40 which causes cam 42 to be coupled to motor 44 for rotation therewith . rotation of the cam surface of cam 42 against roller 46 of follower arm 48 causes follower arm 48 , and roller 50 of follower arm 48 , to pivot about a fixed shaft 52 in the direction of the arrow . movement of roller 50 also carried by follower arm 48 against finger 54 of bail 56 pivots bail 56 counter - clockwise about a rod 58 . as seen most clearly in fig2 bail 56 includes an arm 60 which is pivotably connected at 62 to spool bracket 26 so that when bail 56 is pivoted counter - clockwise about rod 58 , arm 60 of bail 56 causes spool bracket 26 to move upward . after the cam 42 rotates one - third of a revolution , a spring 64 biases the arm 48 clockwise to position the roller 46 at its initial low position on the cam 42 . after bail 56 is pivoted counter - clockwise about rod 58 causing upward movement of spool bracket 26 and an error correction operation occurs , spring 66 returns bail 56 to its rest position , upon partial rotation of cam 42 . as noted in fig1 spool bracket 26 at its end proximate ribbon guide 24 is slidably mounted for vertical movement in a bracket 68 which is fixed with respect to the typewriter frame . a projection 70 on bracket 68 is located in groove 72 of spool bracket 26 and maintains the vertical alignment of spool bracket 26 with respect to bracket 68 . with reference again to fig2 a hub 74 carrying a member 76 and a metering disc 78 is journalled for rotation on spool bracket 26 . a metering disc hub 80 is integral with metering disc 78 and rotates therewith . take - up spool 14 is mounted on metering disc hub 80 and therefore take - up spool 14 and metering disc 78 rotate together . as metering disc 78 rotates clockwise , take - up spool 14 rotates clockwise and the ribbon 10 winds around the take - up spool 14 . as the ribbon winds around take - up spool 14 , new ribbon is caused to be fed from the supply spool 12 . a pawl 82 is pivotally mounted on one end of leg 84 of member 76 . a spring 86 extending from the other leg 88 of member 76 biases pawl 82 into engagement with peripheral teeth 90 of metering disc 78 . pivotal motion of bail 56 raises spool bracket 26 and member 76 . upward motion of member 76 causes pawl 82 to move upward and engage and rotate metering disc 78 in a clockwise direction , which causes ribbon 10 to be wound around take - up spool 14 . a link 92 is pivotally mounted at one end on spool bracket 26 by a pin 94 for vertical movement therewith . link 92 carries at its opposite end a stud 96 which rides in an open ended groove 98 of a lifting arm 100 . a spring 102 has one end secured to lifting arm 100 , and the other end secured to stud 96 of link 92 so that link 92 is urged to pivot in a counter - clockwise direction about pin 94 . one end of lifting arm 100 is pivotable about rod 104 , which is fixed with respect to the typewriter frame . the other end of lifting arm 100 includes a yoke 106 within which stud 108 of member 76 is located . when arm 110 of link 92 is moved upwards by vertical movement of spool bracket 26 , it causes lifting arm 100 to pivot counter - clockwise around rod 104 . the lifting arm 100 causes the stud 108 to raise and pivot the member 76 clockwise about the hub 74 which , in turn , drives the pawl 82 relative to the vertical movement of the spool bracket 26 . the pivotal movement of member 76 causes pawl 82 to incrementally rotate metering disc 78 . the increase in distance that stud 108 raises above that which stud 96 would otherwise rise as a result of vertical movement of spool bracket 26 , is due to the fact that the distance between rod 104 and the point at which yoke 106 of lifting arm 100 engages the stud 108 ( i . e . the lever arm of lifting arm 100 ) is greater than the distance between rod 104 and stud 96 of arm 110 . as previously noted , rotation of metering disc 78 causes rotation of take - up spool 14 . the amount of upward movement pawl 82 , and therefore the amount of rotation of take - up spool 14 , depends on the amount of pivotal movement of lifting arm 100 . a pawl 112 is pivotally mounted on spool bracket 26 and is biased by a spring 114 extending from spool bracket 26 into engagement with teeth 90 of metering disc 78 . the engagement of pawl 112 with teeth 90 prevents metering disc 78 ( and thereby take - up spool 14 ) from rotating in a counter - clockwise direction , and unravelling of the ribbon 10 from take - up spool 14 is thereby prevented . upon restoration of bail 56 to its rest position by spring 66 after completion of an error correction operation , spool bracket 26 is lowered by arm 60 and link 92 , lifting arm 100 and pawl 82 is thereby caused to be lowered . the pawl 82 is pivoted counter - clockwise about the hub 74 by the lowering of lifting arm 100 . since the pawl 112 prevents the metering disc 78 from rotating counter - clockwise , the pawl 82 ratchets over the teeth 90 to its lowered position . in this manner , pawl 82 is brought into engagement with teeth 90 of metering disc 78 for a subsequent error correction operation . with the ribbon guide 20 fixed relative to the typewriter frame and with the ribbon guide 24 movable relative to the frame , the ribbon 10 raises and lowers within the print point ribbon guide 22 to avoid improper ribbon feeding . the fixed ribbon guide 20 retains a portion of the ribbon 10 adjacent the ribbon guide 20 within the print point ribbon guide 22 at all times . this ribbon portion acts as a leader for the remaining portion of the ribbon 10 which extends through the print point ribbon guide 22 and is raised and lowered within the print point ribbon guide 22 . according to the ribbon feed system as described to this point , if the metering disc 78 is rotated the same distance when the diameter of ribbon 10 on take - up spool 14 is large , as it is when the diameter of ribbon 10 on take - up spool 14 is small , more ribbon will be fed when the ribbon is of larger diameter . it is , however , desirable to feed a constant amount of ribbon 10 past the print point regardless of the amount of ribbon on the take - up spool 14 . the means for feeding a constant amount of ribbon 10 past the print point include a sensing arm 116 which integrally extends from link 92 . the spring 102 biases sensing arm 116 against the roll of ribbon 10 on take - up spool 14 . as the roll of ribbon 10 on take - up spool 14 increases in diameter , sensing arm 116 and thereby link 92 rotate clockwise . as link 92 rotates clockwise , stud 96 of link 92 rides into groove 98 of lifting arm 100 . the amount of pivotal movement of lifting arm 100 , and therefore the amount of rotation of take - up spool 14 , depends on the distance between stud 96 of link 92 , and stud 108 of member 76 . the smaller the distance between the center of stud 96 of link 92 , and the center of stud 108 of member 76 , the less is the upward motion of stud 108 and pawl 82 . regardless of the distance between the stud 96 and stud 108 , the pawl 82 always travels upwardly a distance greater than the periphery of metering disc 78 so that the ribbon 10 is always advanced . therefore , as the roll of ribbon 10 on take - up spool 14 increases in diameter , and , as previously mentioned , stud 96 of link 92 rides into groove 98 of lifting arm 100 ( thereby lessening the distance between the center of stud 96 of link 92 , and the center of stud 108 of member 76 ) the amount of pivotal movement of the member 76 and pawl 82 and the amount of rotation of take - up spool 14 is lessened . in short , as the roll of ribbon 10 on take - up spool 14 increases in diameter , the amount of rotation of take - up spool 14 is lessened . in this manner , a constant amount of ribbon may be fed regardless of the diameter of the ribbon 10 on the take - up spool 14 . the invention and its attendant advantages will be understood from the foregoing description , and it will be apparent that various changes may be made in the form , construction and arrangements of the parts without departing from the spirit and scope of the invention , the form hereinbefore described being merely a preferred embodiment thereof . | 1 |
referring now to the drawings , and initially to fig1 - 3 , there is shown an apparatus 10 for providing ribbon segments in rolled form . apparatus 10 includes a mounting plate 12 carrying supports 14 for a shaft 16 . stepped collars or flanges 18 are mounted on shaft 16 , and clamp a supply roll 20 for unloading . referring briefly to fig1 a , shaft 16 is preferably driven by motor 22 and belt 24 in the direction of arrow 26 so as to assist in unrolling ribbon 30 from supply roll 20 . if desired , motor 22 can be operated so as to &# 34 ; spill &# 34 ; a loop of ribbon in cavity 32 formed in mounting plate 12 , although it is generally preferred that the ribbon be unrolled without substantial spillage in response to tension forces generated in a vacuum accumulator generally indicated at 34 . referring additionally to fig3 - 38 , the vacuum accumulator 34 includes a vertically elongated vacuum chamber 36 having a lower open end 38 with an opening 58 through which ribbons 30 emerges and an upper open end which is evacuated by vacuum source 40 . a funnel - shaped receiver 42 extends from the lower end 38 of vacuum chamber 36 . receiver 42 has a part circular opening 44 at its lower end , formed by part circular rounded end wall 46 . as can be seen in the cross - sectional view of fig3 , the vacuum chamber 36 has a generally rectangular configuration , with a first pair of opposed sidewalls 50 corresponding to the width w of ribbon 30 ( see fig3 ). the remaining pair of opposed sidewalls 52 are sized to accommodate an open loop 54 , shown for example in fig2 and 36 . as can be seen in fig3 and 37 , the ribbon blocks substantial portions of the bottom open end 56 of vacuum chamber 36 , so that the vacuum created by source 40 is applied against the flexible ribbon 30 , drawing the ribbon in an upward vertical direction within the vacuum chamber for subsequent out - feed on demand . if residence time of the ribbon loop in the vacuum chamber is substantial , then it is preferred that action be taken to control the ribbon loop . in the preferred embodiment , vacuum within the chamber is held constant . thus , as the ribbon loop experiences vacuum forces in the chamber , the loop will be drawn upward toward the vacuum source . photoelectric sensors ( not shown ) located at the top of the vacuum chamber cause motor 22 to turn on and off as required , so as to maintain a full ribbon loop within the vacuum chamber . when motor 22 is turned on , it allows ribbon from the spool to be pulled into the vacuum chamber 36 under power of the vacuum source . when sufficient ribbon is pulled in , the upper photoelectric sensor shuts the motor off , with the motor acting as a brake to prevent further ribbon from being withdrawn into the vacuum chamber . as ribbon is drawn out of the chamber during a rolling process , a second photoelectric sensor ( not shown ) disposed at a lower position operates to start motor 22 , allowing additional ribbon to be fed into the vacuum chamber to replenish the ribbon withdrawn during a rolling operation . alternatively , the vacuum source could be made variable , with the photoelectric sensors turning the vacuum on or off or reducing the magnitude of the vacuum so as to maintain the ribbon loop within desired limits within the vacuum chamber . preferably , a motor 22 provides unwinding force sufficient to overcome frictional losses in shaft 16 , so as to allow spool 20 to be essentially &# 34 ; free wheeling &# 34 ; ( or alternatively to have only a slight frictional force , which is readily overcome by the drawing force of vacuum force 40 ) as the ribbon is pulled from spool 20 into the vacuum chamber 36 . as can be seen for example in fig1 a , ribbon 30 is preferably provided on a spool 20 which is many times wider than the width w of ribbon 30 . as will be seen herein , it is important that the accumulated ribbon be provided at a constant position , for feeding along a fixed generally linear path . the funnel - shaped receiver 42 , in combination with the vacuum chamber 36 , has been found to provide an effective , reliable unspooling of ribbon 30 without requiring additional apparatus . referring to fig1 - 3 and 15a , ribbon 30 leaving vacuum accumulator 34 passes through guide rollers 60 , 62 passing cutting blade 64 , which is preferably located adjacent guide rollers 60 , 62 . the ribbon then extends past a winding spindle 68 ( shown in cross section in fig3 and in greater detail in fig3 and 31 , as will be seen herein ). the accumulated ribbon is wound about spindle 68 to form a roll , which is cut free from supply roll 20 by cutting blade 64 . referring now to fig4 - 14 , a brief overview of the fabrication steps will be described . referring first to fig4 ribbon 30 is grasped by the jaws 70 of a traveling gripper arm which moves the ribbon past cutting blade 64 , and also past spindle 68 , as shown in fig5 . referring to fig6 the jaws 72 of spindle 68 are extended in the direction of arrow 74 so as to pass around ribbon 30 . as shown in fig7 the jaws 72 are rotated in the direction of arrow 76 a slight amount so as to hold ribbon 30 captive as jaws 70 of the traveling gripper arm release their hold on the ribbon . as shown in fig8 the jaws 70 are then pulled back away from the line of travel of the ribbon , as indicated by arrow 78 , are moved back to a position adjacent the traveling guide rollers 60 , 62 ( as indicated in phantom in fig2 ), and are then moved around the path of travel of the ribbon , to the home position indicated in fig8 and 9 . in the home position , the jaws 70 are maintained spaced apart , so as to allow the ribbon to pass freely therebetween . winding of the spindle continues until a sufficient quantity of ribbon is rolled onto the spindle jaws 72 . the cutting blade 64 is then activated in the direction of arrow 84 to cut the ribbon 30 , forming two new free ends 88 , 90 ( see fig1 and 11 ). an adhesive applicator generally indicated at 94 applies a dot of adhesive to the rolled ribbon , as indicated in fig9 at a point shortly before or after cutting of the ribbon by blade 64 . as indicated in fig1 , the jaws 70 of the traveling gripper arm are preferably closed to clamp the ribbon , either concurrently or shortly before the cutting of the ribbon is completed . preferably , between fig9 and 10 , spindle jaws 72 are rotated one additional revolution , so as to bond the newly formed free end of the rolled ribbon segment to the roll to prevent unintentional unwinding of the roll . as indicated in fig1 and 11 , substantial free portions of ribbon are provided between the jaws of the traveling gripper arm and the cut end 88 , in between the wound portions of the rolled ribbon segment and cut free end 90 . at the point of time indicated in fig1 , formation of the rolled ribbon segment , generally indicated at 100 , is complete . a holder 102 is then lowered in the direction of arrow 104 onto the rolled ribbon segment 100 and engages the rolled ribbon segment with a vacuum force , as will be seen herein . as indicated in fig1 , the spindle jaws are retracted in the direction of arrow 106 and the folder 102 is lowered in the direction of arrow 108 into a recessed conveyor apparatus generally indicated at 110 . the holder 102 then disengages from the rolled ribbon segment 100 and retracts to a home position shown for example in fig1 and 11 . fig1 shows the arrangement of fig1 from a front elevational perspective . referring briefly to fig2 , the rolled ribbon segments 100 are deposited in pockets 118 of conveyor apparatus 110 , with the free end portions 90 extending toward balloons 114 . the balloons have been folded to assume a generally rectangular package , with balloon stems or necks 120 extending toward the pockets 118 . as indicated in fig2 , the free ends of the rolled ribbon segments partially overlie the necks 120 of balloons 114 . the rolled ribbon segments and balloon necks are then bonded at 121 using conventional bonding means , such as tape , heat sealing or adhesive , for example . in the preferred embodiment , adhesive tape segments are applied to connect the rolled ribbon segments to the balloons 114 . referring now to fig1 - 25 , further details of the operation of apparatus 10 will be described . referring to fig1 , the traveling gripper arm is generally indicated at 120 . the traveling gripper arm includes an actuator which moves air slide 124 in the directions of double - headed arrow 126 . actuator 122 preferably comprises actuator stock item number ia 12 ex - 35 - 200 , available from intelligent actuator located at 357 van ness way , suite 29 , torrance , calif . 90501 . actuator 122 receives instructions from a controller 130 , through conductors 128 . air slide 124 , carried by actuator 122 , receives instructions from controller 130 through conductors 132 ( shown in fig1 ), causing the air slide shaft 134 to move back and forth in the direction of arrow 136 ( see fig1 , 16 ). a gripper mechanism 138 is carried on a shaft 134 so as to be movable back and forth in the direction of arrow 136 . preferably , gripper mechanism 138 comprises a remotely actuable air gripper commercially available from compact air products located at 2424 sandifer blvd ., westminster , s . c . 29693 as part no . psg - 052x1 / 4 - lf , and air slide 124 preferably comprises stock no . ts031x1 - n - b - m , commercially available from phd company located at 9009 clubridge dr ., fort wayne , ind . 46899 . gripper mechanism 138 , which includes gripper jaws 70 , moves the gripper jaws toward and away from one another so as to clamp and unclamp ribbon 30 therebetween , in response to air signals transmitted to the gripper mechanism through an air supply ( not shown ) under control of controller 130 . under management of controller 130 , actuator 122 and air slide 124 cooperate to form the path of travel of gripper jaw 70 illustrated in fig8 . as will now be appreciated , the path of travel comprises a closed loop including the movements indicated by arrows 77 , 78 , 80 and 82 illustrated in fig8 . the arrow 77 corresponds to the movement of the gripper jaws described in fig4 and 5 from the &# 34 ; home &# 34 ; position illustrated in fig1 a to a position past the spindle 68 ( as shown in fig1 ). the gripper jaws 70 are closed ( see fig1 b ) when gripper mechanism 138 is in the position illustrated in fig1 a . the gripper jaws remain closed during movement between fig1 a and 16 as the gripper mechanism 138 is moved in the direction of ribbon travel , by actuator 122 . during this time , ribbon is drawn from the vacuum accumulator 34 , and fig1 shows the open loop of ribbon in the vacuum chamber 36 being consequently lowered . with the arrival of gripper mechanism 138 at the position illustrated in fig1 , payout of ribbon 30 is temporarily halted . as indicated in fig1 ( and as explained above in fig6 ), the spindle jaws 72 are extended in the direction of arrow 74 such that ribbon 30 is positioned between the jaws 72 in preparation for the partial winding of the ribbon about the spindle jaws , as illustrated in fig1 . this partial winding corresponds to that described above with reference to fig7 . as indicated in fig1 , the open loop of ribbon in vacuum accumulator 34 is quickly recovered with ribbon being unspooled from the supply 20 . an air signal is then sent to the gripper mechanism 138 such that jaws 70 are retracted , releasing their grip on ribbon 30 . operation of the gripper mechanism , as indicated above , is carried out via air command signals . control for operation of the gripper mechanism is preferably initiated by the electronic control means 130 , with the simple expedient of having an electrically operated solenoid opening a valve in an air pressure line , coupling the source of air pressure to the gripper mechanism . other pneumatic control signals are accommodated accordingly . as indicated in fig1 , the gripper mechanism , with jaws opened , is retracted upon operation of air slide 124 corresponding to the movement indicated by arrow 78 in fig8 . spindle 68 is again energized under commands from controller 130 to carry out a high speed winding operation , in which a desired quantity of ribbon is rolled about the spindle jaws 72 in the manner described above with reference to fig8 . with a desired amount of ribbon acquired by spindle jaws 72 , but with the ribbon still continuously extending from supply spool 20 , the adhesive applicator 94 is moved from its home position ( illustrated in fig2 ) to the position illustrated in fig2 and schematically illustrated in fig9 . the adhesive applicator 94 is coupled through a mounting arm 150 to a conventional linear actuator 152 . actuator 152 moves the adhesive applicator 94 in the direction of arrow 154 such that the tip 156 ( see fig2 ) of the applicator touches the roll of ribbon acquired on spindle jaws 172 . control signals are then sent via conductors 158 ( see fig2 ) to the adhesive applicator 94 under commands from controller 130 , to deposit a small quantity of adhesive on the outermost wound layer of ribbon . during this time , the actuator 122 moves the gripper mechanism in the manner indicated by arrow 80 ( see fig8 ) to a point adjacent the &# 34 ; home &# 34 ; position and air slide 124 is actuated so as to extend shaft 134 , placing the gripper jaws 70 at the home position illustrated in fig1 a . adhesive applicator is then retracted , as indicated in fig2 , and the spindle jaws 172 undergo a final revolution to secure an additional outer winding of ribbon to the roll of ribbon previously acquired . with reference to fig2 , solenoid 160 is actuated under control of controller 130 so as to extend cutting blade 64 in the direction of arrow 84 , as described above with reference to fig9 . the gripper jaws 70 are then closed to clamp about ribbon 30 , in the manner indicated in fig2 , and the cutting blade 64 is then actuated under control of controller 130 to sever the ribbon in the manner described above with reference to fig1 , forming cut ends 88 , 90 , thereby freeing the ribbon acquired on spindle shaft 68 from supply roll 20 . at a time just before actuation of cutter blade 64 , holder 102 is lowered in the direction of arrow 104 , as described above with reference to fig1 . holder 102 is hollow , and has an upper end 164 which is connected to a vacuum source ( not shown ) so as to create a suction force releasably holding the rolled ribbon segment 100 . with reference to fig2 , holder 102 carries a roll - receiving shoe 168 which is generally l - shaped in profile . as indicated by the arrows in fig2 , a vacuum is applied to the shoe 168 so as to draw the rolled ribbon segment 100 against the shoe . as shown in fig2 , less than half of the outer surface of the coil portion of rolled ribbon segment 100 is engaged by shoe 168 , and further , a portion of the unsecured tail ( which terminates in cut end 90 ) is also engaged by vacuum force , and is pressed against vacuum shoe 168 . thus , the tail portion of the ribbon extending beyond the vacuum shoe is held in a generally horizontal position or a position of limited downward bending such that , upon placement in pockets 118 , the tail portion will reliably overlap the balloon stems 120 , as explained above with respect to fig2 . returning again to fig2 , the holder 102 has been lowered into engagement with the rolled ribbon segment 100 which is further supported by the jaws 72 of the spindle 68 . as indicated in the figures , a washer - like wall portion 172 has a central aperture through which the spindle jaws 72 extend . with reference to fig2 , the spindle jaws 72 are retracted in the direction of arrow 106 , as described above with reference to fig1 . consequently , the rolled ribbon segment 100 is supported exclusively by holder 102 . as indicated in fig2 , the cutting blade 64 is reset for subsequent operation and solenoid 160 ( see fig2 ) is actuated under control of controller 130 to retract the cutting plate to the &# 34 ; home &# 34 ; position illustrated in fig1 a . turning now to fig2 , holder 102 is lowered in a direction of arrow 108 , in the manner described above with reference to fig1 , to place the rolled ribbon segments 100 in pockets 118 , as described above with reference to fig2 . fig2 - 28 show the conveyor apparatus 110 in greater detail . as indicated in fig2 and 29 , for example , a plurality of pocketed segments 180 are provided in a side - by - side serial array . the pockets travel along guide rails 182 under force of a conveyor belt , driven by motor 186 ( see fig2 ). turning now to fig3 - 35 , spindle 68 will be described in greater detail . spindle 68 includes an outer housing 180 having a forward end 182 and a rearward end 184 . motor coupling 186 couples a motor driven shaft 188 to a splined shaft 190 . splined shaft 190 is in turn received in a splined bushing 192 carried on a traveling shuttle 194 . shuttle 194 is supported from housing 180 by bearings 196 . shuttle 194 carries a mounting plate 198 carrying mounting shafts 200 . spindle jaws 72 are mounted on support shafts 200 for movement between the closed position illustrated in fig3 , 34 and 35 and the open position illustrated in fig3 - 33 . a sleeve 202 is mounted at the forward end 182 of housing 180 by roller bearing member 204 . the collar 202 is keyed with jaws 72 for a fixed angular position with respect to the jaws . however , the shuttle 194 , the jaws 72 and collar 202 are mounted for rotation about the central axis of body 180 . referring to fig3 and 31 , an opening 208 is formed in body 180 to allow movement of an actuator rod between the retracted position illustrated in fig3 and the extended position illustrated in fig3 . rod 212 engages the recessed rear end of shuttle 194 so as to move the shuttle back and forth along the central axis of housing 180 . as shown in fig3 and 31 , this causes the jaws 72 to extend and retract with respect to wall portion 172 carried on the forward end 182 to a body 180 . a pair of spring loaded bearing balls 220 are located at the rearward end of collar 202 . the bearing balls are spring loaded for movement toward the central axis of body 180 . as the support shafts 200 pass beyond the bearing balls 220 , as illustrated in fig3 , radially inward pressure is directed against the rearward end of the jaws in the manner indicated , thus opening the forward end of the jaws . the splined shaft 190 and splined bushing 192 engage one another to insure that the slot 230 between jaws 72 extend in a horizontal position ( as indicated in fig3 ), so as to accommodate the orientation of ribbon 30 in its defined path of travel until commanded to rotate by the controller , through action of a drive motor ( connected through coupling 186 ). the jaws 72 expand in the manner indicated in fig3 so as to define the desired inner diameter of the rolled ribbon segments 100 . as the jaws 72 are retracted in an axial direction ( i . e ., are moved from the configuration shown on fig3 to that shown on fig3 ), a frictional engagement will be maintained between the jaws and the inner winding of the rolled ribbon segment . even though the washer - like wall portion 172 is provided to constrain the rolled ribbon segment , an additional aid in unloading the rolled ribbon segments is provided , as described above . as indicated in fig3 , the jaws 72 are brought together ( i . e ., are collapsed in a radially inward direction ) automatically as the jaws are retracted in an axial direction ( i . e ., toward the configuration shown in fig3 ). frictional engagement of the jaws 72 is removed from the rolled ribbon segment by reason of their collapse , thus further facilitating the unloading of the rolled ribbon segment from the portions of apparatus directly associated with winding operations . thus , ribbon materials can be employed which are inherently more difficult to handle ( i . e ., are thinner , more flexible , or engage the spindle jaws in an unusually tenacious manner ). the drawings and the foregoing descriptions are not intended to represent the only forms of the invention in regard to the details of its construction and manner of operation . changes in form and in the proportion of parts , as well as the substitution of equivalents , are contemplated as circumstances may suggest or render expedient ; and although specific terms have been employed , they are intended in a generic and descriptive sense only and not for the purposes of limitation , the scope of the invention being delineated by the following claims . | 1 |
an example of a prior art heated breathing conduit 102 for use with a respiratory humidifier / ventilator , is shown generally in fig1 . the heated breathing conduit ordinarily comprises an inspiratory conduit 101 connected at its proximal end 102 to the gases outlet of a respiratory humidifier ( not shown ) and at its distal end 103 to a “ y ” shaped connector having three inlet / outlet ports . one port 104 of the “ y ” shaped connector directs the inspiratory gases to the patient and also receives exhaled air from the patient . the expired air is channelled by the “ y ” shaped connector to an expiratory conduit 105 via the third port 106 of the “ y ” shaped connector so that the expiratory gases may be returned to the humidifier / ventilator ( not shown ) from the end 107 of the expiratory conduit 105 . the conduits 101 , 105 are heated by a heater wire 108 located within the inspiratory conduit 101 and a second heater wire 108 a is located within the expiratory conduit 105 . in this example the two heater wires are configured in parallel such that the second heater wire 108 a shares connection 109 with the first heater wire 108 and is connected at point 123 a to the second earth return conductor 121 a which extends from point 123 a to connection 110 , although other arrangements are equally possible . power is supplied via standard domestic or industrial supply 114 . the heater wire 108 is supplied with power from the secondary side of a step down transformer 118 which is connected to the external voltage supply across the phase 115 and neutral 116 conductors . a controller 119 controls a switch 120 which , when closed , energises the heater wire . the controller can determine if there is no heater wire connected , and provides an audible alarm if this is detected . as with all electrical installations there exists fault conditions which potentially can ignite a fire . trials have indicated that two fault conditions in particular appear to be especially important in starting a fire in a heated respiratory conduit . these are : 1 . a break in the heater wire , leading to repeated sparks which cause ignition 2 . excessive current in the breathing circuit , leading to melting or ignition of the breathing circuit materials . this can be caused by incorrect breathing circuit design or assembly , or by a short circuit . the present invention may be retrofitted to existing respiratory humidifier / ventilator systems or included as part of the humidifier controller . it detects sparking and over current in the heating wire 103 as detailed in the following embodiments . according to the present invention spark detection is accomplished by detecting the rapid change in current that occurs following disconnection of the heater wire load . an inductor is used because a rapid change in current induces a voltage spike across the inductor , which can easily be detected . since sparks ( or disconnections of the heater wire ) can happen at any part of the mains cycle ( including those times when the mains voltage is near zero ) the spark detection circuitry cannot hope to pick up every single spark . in practice though disconnections which occur near the mains zero voltage do not have significant energy for ignition . it is practical to detect 75 % of all heater wire disconnections , and this provides the required degree of safety . in a first embodiment of the invention a two winding transformer is connected in series with the heater wire . as can be seen in fig2 during normal operation the current flows from the ac supply 1 through the primary 2 of the spark detection transformer then through the heater wire 3 . if a break 4 occurs in the heater wire 3 ( causing sparking ), a rapid change in current will occur in the heater wire 3 . any rapid change in current through the primary winding 2 of the transformer creates a voltage spike , due to the action of its inductance . the voltage spike is passed onto the secondary winding 5 of the transformer and is multiplied by the turns ratio . the voltage spike on the secondary winding may be either positive or negative , but the four diodes form a bridge rectifier 6 , so that the voltage spike always charges the capacitor 7 with a positive voltage . if the magnitude of the voltage spike is large enough , then the capacitor will charge above the threshold voltage 8 of the comparator 9 , which causes the output of the comparator 9 to go high , enabling the timer 10 . this comparator drives a timer 10 which turns off the power to the heater wires for a period of time ( e . g several seconds ) using a switching circuit 11 . the resistor 12 across the capacitor 7 allows the voltage to decay away to zero if no sparks are detected . in a second embodiment a two winding transformer with a center tapped primary winding is connected in series with the heater wire . in order to reject mains voltage spikes as a source of false triggering , the primary winding can be center tapped 18 as shown in fig3 and the currents from the inspiratory 13 and expiratory 14 heater wires are each passed through a different half of the primary winding . in this way , the current of any mains borne interference passes through both halves of the primary winding , and the resultant magnetic fields ( flowing through the core of the transformer ) cancel out . a spark 4 will only occur in one heater wire limb at a time ( shown here as the inspiratory 13 ), and therefore is not cancelled out . the remainder of the circuit operates in the same way as the first embodiment , with the capacitor 7 voltage compared against a threshold 8 , and the comparator 9 driving a timer 10 . in a third embodiment shown in fig4 as an alternative to using a transformer a coil 15 is connected in series with the heater wire 3 . the coil 15 is used instead of the transformer primary utilised in the fist and second embodiments . a high pass filter ( resistors 17 and capacitors 16 ) is used to reject mains e . g . : 50 - 60 hz frequencies . the remainder of the circuit operates in the same way as the first embodiment . similarly to the first embodiment this embodiment does not include specific rejection of mains borne interference e . g . : spikes . however variations in this embodiment can be envisaged which do incorporate rejection of mains borne interference . the technique used for detecting excess current is common to all three embodiments of the invention described above . the threshold for current detection is set to be the maximum current that will be drawn by the lowest foreseeable resistance heater wire , at the highest rated mains voltage + 10 %. the current detector is designed to respond to the peak current instead of the average current for two reasons : ( a ) peak current is faster responding than average , ( b ) the peak current is independent of the duty cycle that the controlling humidifier is supplying . referring to fig5 the heater wire current to be measured is passed through a low value resistor 24 . the voltage which appears across the resistor is proportional to the current flowing in the heater wire 23 . this voltage is passed through an amplifier 25 , then passes to a peak detection circuit , where a capacitor 27 is charged up by a diode 26 to the maximum peak of the ac voltage . if the peak voltage is higher than the threshold voltage 8 then the comparator 29 , operates a timer 30 , which removes power from the heater wire for a period of time . at the end of this time period the current is restored , but if the current is still too high then the peak is detected very quickly and power removed again . using this circuit , a completely short - circuited heater wire can be tolerated without blowing the heater base fuse 60 . the resistor 28 slowly discharges the capacitor . the control strategy for all faults involves disconnecting the power from the heater wire for a period and then reapplying it . this is to avoid shutting the system down in response to a non critical event . common to all embodiments of spark detection is the control strategy used for removing and reapplying power to the heater . the timing circuit ( 10 ) must operate for long enough that any heat that is generated by a spark has time to dissipate before the heater wire power is reapplied . in practice a time period of 1 second has been found to be sufficient . as a further aspect , the timing circuit could also be made to count up the number of sparks detected , and then disconnect the heater wire permanently . this is to discriminate against one of the heater wires being disconnected while the system is in use . if overcurrent is detected , then the average power being dissipated in the heater wire is determined by the time period that the device takes to detect the high current ( the “ on ” time ) and the period that the current is removed (“ off ”). with the circuit described , the maximum time it will take to detect a high peak current is one ac cycle ( i . e . 20 msec at 50 hz ). so long as the “ off ” time is many times longer than the “ on ” time then the heater wire will not dissipate excessive power and will be safe . in the preferred embodiment the heater wire is turned off for 2 secs , so power is applied for less than 1 % of the time . the ‘ off ’ time period should be more than , say , 10 mains cycles to avoid the power dissipated getting too high . also it should not be too long otherwise the operator loses the useful alarm feedback . for instance an operator removing the faulty heater wire would expect the humidifier heater wire alarm condition to cancel promptly . too long a period may confuse the operator . of importance to both spark detection and current detection is the ability to disconnect the heater wire quickly when one of these conditions is detected . conventionally a triac is used to switch off current in an ac circuit such as this , but triacs cannot be turned off instantly — turn off occurs at the ac zero crossing , which may take up to 10 msec at 50 hz mains . triacs also have a 1 - 2 v saturation voltage , which results in power loss . this is to allow the user to connect or disconnect the heater wires a limited number of times without causing a permanent disconnection or audible alarm . however , repeated sparks would cause this to occur . another prior art alternative ( shown in fig6 ) is to use an n - channel mosfet 31 with a separate substrate connection 32 . mosfets have a very fast switching time ( less than 1 microsecond ). they can also have a very low “ on ” resistance ( e . g 0 . 03 ohm ) which results in very low power dissipation . however a single mosfet configuration has two disadvantages . firstly , it requires a mosfet with a separate connection to the substrate , instead of having the substrate 32 connected to the source 35 . secondly , the substrate 32 must be connected to a bias voltage 36 which is more negative than the peak negative ac voltage ( from the source 39 ) that will be switched . this is necessary because the construction of a mosfet involves two intrinsic diodes 37 , 38 between the substrate 32 and the drain 34 and source 35 . if these diodes 37 , 38 are not kept reverse biased then they will conduct , and the switching action of the mosfet 31 will be lost . the negative voltage 36 applied to the substrate 32 keeps these diodes 37 , 38 reverse biased . in the preferred embodiment of this invention ( shown in fig7 ) the heater wire 40 is switched by two back to back n - channel mosfets 42 , 43 which have their source connections 44 , 45 connected together . the mosfets have their substrates 48 , 49 internally connected to their source leads , as is common . as previously described there are intrinsic diodes 50 , 51 connected between the source ( substrate ) and the drain of each mosfet . these diodes are connected back - to - back and do not conduct . the gates 52 , 53 of both mosfets are connected together , and a voltage 41 is applied between the gate connections 52 , 53 and the source connections 44 , 45 to turn the mosfets on and off . to turn the ac current off the gate - source voltage 41 is set to zero , and the mosfets stop conducting . to turn the current on , the gate - source voltage is increased above the threshold voltage of the mosfet , and they conduct . in the preferred embodiment of the invention the “ on ” resistance is chosen such that at the highest rated current the drain - source voltage of the mosfets never exceeds 0 . 6v , so that the intrinsic diodes are never allowed to conduct . this ac switching configuration overcomes the disadvantages of the ac switch in fig6 while still providing a rapid switching time . by using two mosfets connected in reverse the intrinsic diodes cannot conduct , without the use of an external negative bias voltage . also a separate substrate connection is not required on the mosfets . | 7 |
[ 0025 ] fig1 illustrates a closed - loop color management system 20 , consisting of a single host device 22 , here shown capable of sending color data using the cmyk color space . a predetermined lookup table 24 is then used to convert the input cmyk data to output c ′ m ′ y ′ k ′ data which is compatible with closed - loop color printer 26 . as described above , the pre - determined lookup table 24 is adequate only for a closed - loop color management system 20 . [ 0026 ] fig2 illustrates an open color management system 28 . various types of host devices may operate in the open color management system 28 , such as electronic display 30 , digital camera 32 , scanner 34 , swop ( specifications web offset publications ) cmyk host 36 , euro cmyk host 38 , and any number of custom color space hosts 40 . each of the host devices has its own color space . for example electronic display 30 may use the srgb color space , while digital camera 32 and scanner 34 may use a non - standard rgb color space . hosts 36 and 38 each use different standard forms of the cmyk color space , namely swop cmyk which is prevalent in the united states and euro cmyk which is prevalent outside the united states . it is actually desirable to allow a host to use any input color space within the open color management system 28 . other types of color spaces may be standards recognized by various organizations , or the color spaces may be a custom color space created by a graphic artist for a special application , as illustrated by custom color - space host 40 . various types of output devices may also operate in the open color management system , such as cmyk inkjet printer 42 , cmyk electrophotographic printer 44 , and cmyk lithographic printer 46 . a larger printable color gamut , and therefore possibly higher print quality may be obtained by using more than the cmyk primary colors in a printer . for example , cmyk + light cyan + light magenta printer 48 and cmyk + orange + green printer 50 may also be a part of the open color management system 28 . in fact , a printer with any combination of primary colors plus black ( k ) 52 may preferably operate in the open color management system 28 . the hosts 30 - 40 and printers 42 - 52 of the open color management system 28 are linked together at job - time by open color manager 54 . the open color manager 54 may reside on the host side , the printer side , both sides , or in a remote location . in the open color management system 28 any host may print to any printer without the need for a predetermined look - up table 24 . when linking a given host to a given printer , the open color manager 54 also is able to preserve k information to satisfy the desire of people in the graphic arts field to control k levels in the output while simultaneously offering a wide flexibility in connectivity . [ 0029 ] fig3 illustrates a host 56 and a printer 58 interfacing with the open color manager 54 in the context of the open color management system 28 . the host 56 may be any type of digital device which is capable of sending color data . the host 56 transfers 60 the input color space data 61 to the open color manager 54 . for convenience , the input color data 61 will be described as cmyk data , but any other input color space is applicable , such as , for example , srgb , rg / b , swop cmyk , euro cmyk , or a custom color space . the host 56 also transfers 62 an input color profile data structure 64 to the open color manager 54 . the input color profile data structure 64 includes a host gamut surface data set 66 and a look - up - table 68 ( lut ) to convert the input color space to a profile connection space ( pcs ) with k data . the pcs is preferably a device - independent color space such as cie l * a * b *, cie xyz , or cie cam97s jab . such device independent color spaces are well - known by those skilled in the art . the input cmyk - to - pcs + k lookup table 68 maintains the k data intact even after the cmyk data has been converted to pcs . the printer 58 may be any type of printer capable of printing color data . printer 58 receives 70 output color space data 72 from the open color manager 54 . for convenience , the output color data 72 will be described as c ′ m ′ y ′ k ′ data , but other output color spaces are applicable , such as , for example , c ′ m ′ y ′ k ′+ light cyan + light magenta , c ′ m ′ y ′ k ′+ green + orange , or any other c ′ m ′ y ′ k ′+ other primary output color space . in the embodiment of fig3 the printer 58 is also sharing 74 an output color profile data structure 76 with the open color manager 54 . the output color profile data structure 76 includes a printer gamut surface data set 78 , a look - up - table 80 ( lut ) to convert between the output color space c ′ m ′ y ′ k ′ and pcs + k ′, and an optional ink limit data set 82 . inside the open color manager 54 , the host gamut surface data set 66 and the printer gamut surface data set 78 are passed 84 to a gamut mapping and optimization step 86 . each gamut surface data set 66 , 78 defines the outer boundaries of the host 56 and printer 58 color capabilities , respectively . the gamut surface data sets 66 , 78 are provided in profile connection space ( pcs ) coordinates . a typical pcs will have three dimensions , and a device gamut surface map defines a three dimensional color space body . a two - dimensional slice of such a three - dimensional gamut map is shown in fig4 . host gamut surface curve 88 is plotted with printer gamut surface curve 90 . the area to the left of each gamut surface curve 88 , 90 defines the actual color gamut of each device . in this example , the host color gamut 92 is larger than the printer color gamut 94 . thus , in this example , the printer 58 will not be able to accurately reproduce colors to the right of the printer gamut surface curve 90 . to compensate , the open color manager 54 performs gamut mapping and optimization based on the gamut volume / data defined by surfaces 88 , 90 . in the example of fig4 the host color gamut 92 must be compressed and hue rotation must be applied so that the full printer gamut 94 will used and proper hue adjustment is performed for saturation mapping . such gamut mapping techniques are well - known to those skilled in the art . arrows 96 illustrate an example of how the host gamut 92 might be mapped to the printer gamut 94 on the surface of both curves . a similar mapping must be performed between the entire gamut volumes 92 , 94 . as part of the gamut mapping and optimization step 86 , an optional ink limit adjustment step 98 may be performed by the open color manager 54 . although certain high concentrations of ink may theoretically enable a larger printer color gamut 94 , there may be other factors , such as paper cockle ( rippling of a print media when saturated ) and ink dry - time which would make such high concentrations of ink undesirable . in such cases , an optional ink limit data set 82 is provided 84 to the gamut mapping and optimization step 86 inside of the open color manager 54 for the purpose of ink limit adjustment 98 . the ink limit data set 82 is used to shift the printer gamut surface curve 90 to an adjusted printer gamut surface curve 100 . arrows 102 illustrate an example of how the host gamut surface 88 might be mapped to the adjusted printer gamut surface 100 in light of the optional ink limit adjustment step 98 . the relationship between the host color gamut 92 and the printer color gamut 94 , determined by the open color manager 54 is referred to as a color gamut mapping function 104 . following the gamut mapping and optimization step 86 , the open color manager 54 converts 105 the input color space data 61 , here cmyk data into pcs + k data using the host - provided look - up table 68 for cmyk - to - pcs + k . this input color space data conversion to pcs + k 105 may optionally be performed prior - to or after the gamut mapping & amp ; optimization step 86 and optional ink limit adjustment step 98 . the profile connection space ( pcs ) portion of the color data is now compatible with color gamut mapping function 104 determined by the gamut mapping and optimization step 98 . the host and printer look - up tables for color space - to - pcs + k conversion 68 , 80 also contain information regarding input k and output k ′ in terms of the pcs . provided both the host 56 and the printer 58 in any given host / printer combination of the open color management system 28 are capable of managing k data separately from color data , an additional function will be calculated by the open color manager 54 . this additional function is called the k - mapping function 106 , and it quantifies the relationship between input k and output k ′. by comparing input k lightness information with output k ′ lightness information in terms of the pcs , the k - mapping function 106 can also be computed at job - time by the open color manager 54 . fig5 illustrates three examples of k - mapping functions . in some cases , the input k is boosted 108 to a higher output k ′ to give the same lightness . in other cases , the input k is reduced 110 to a lower output k ′ to give the same lightness . in rare cases , the input k to output k relationship can be one - to - one 112 . in any case , the end result is the calculation of k - mapping function 108 which quantifies the relationship between input k and output k ′. after the k - mapping function 106 has been calculated and the input color space - to - pcs + k conversion has taken place , an output k ′ determination step is performed . the input k values 114 from the pcs + k data are sent 116 to the k ′ determination step 118 along with the k - mapping function 106 . the input k values 114 are processed though the k - mapping function 106 to produce output k ′ values 120 . at this point , the input pcs color data 122 from the input color space to pcs + k conversion step 105 is used in conjunction with the output k ′ values 120 in a pcs + k ′ to output color space conversion 124 . the pcs + k ′ to output color space conversion 124 occurs in two steps . first , the color gamut mapping function 104 from the gamut mapping and optimization step 86 and the optional ink limit adjustment step 98 are used to map the input pcs color data 122 to an output - compatible pcs ′ data set 126 . second , the gamut - corrected output pcs ′ color data set 126 and their corresponding output k ′ values 120 are processed against the output color space to pcs + k look - up table 80 to determine perceptually accurate output c ′ m ′ y ′ k ′ color data 72 which is then communicated 70 by the open color manager 54 with printer 58 . [ 0037 ] fig6 illustrates a variation on the open color management process of fig3 . the process in fig6 is identical to the process of fig3 except for the source of the output color profile data structure . in the system of fig3 the output color profile data structure 76 resides in the printer 58 and is passed to the open color manager 54 at job time by the printer 58 . due to printer memory limitations , communication limitations , or service and upgrade considerations , it may be desirable to have a remote output color profile data structure 128 stored on a networked database 130 . in this alternative embodiment , the networked database 130 provides the open color manager 54 with the remote output color profile data structure 128 based on the printer 58 requested by the host 56 at job - time . the open color system embodiments of fig3 and 6 result in output c ′ m ′ y ′ k ′ data 72 which has k ′ values that accurately reflect the intended input k value . ideally , the output k ′ value will be an identical match to the intended input k value in terms of the k lightness . however , calculation errors such as rounding or interpolation errors may result in an output k ′ value which is substantially preserved , though not identical . the important feature of the black preservation is that the relative relationship between the input k and the output k ′ is not lost . the c ′ m ′ y ′ values are adjusted based on the substantially accurate k ′ value to result in perceptually the same output color . additionally , this color transformation process is performed in an open color management system 28 where the input host 56 and the output printer 58 know nothing about each other prior to job - time . instead , profile color data structures 64 and 76 are linked real - time by the open color manager 54 . up to this point , the functionality of the open color manager 54 has been detailed , but the location of the color manager 54 has not been specified . due to the open color system architecture , there is great flexibility in where the open color manager 54 may be implemented . fig7 illustrates the possible locations for the open color manager 54 . the open color management system 28 is made possible because a plurality of hosts may be flexibly connected to a plurality of printers via the internet or other network means , such as a wan , lan , ethernet , intranet , or wireless network . this internet or network 132 is illustrated in fig7 . the open color management system 28 as described in the preceding embodiments is flexible enough to handle four major classes of hosts and printers . all hosts and printers should fall into one of these four classes , and all hosts and printers are capable of connecting to the network / internet 132 per the definition of the open color management system 28 . as shown in fig7 the first class consists of smart open color hosts 134 and smart open color printers 136 . these smart open color devices 134 , 136 each contain an open color manager 54 and their respective input or output color profile data structures . the second class consists of semi - smart open color hosts 138 and semi - smart open color printers 140 . these semi - smart open color devices 138 , 140 each contain an open color manager 54 , but do not store their respective input or output color profile data structures locally . instead , the input and output color data structures may be stored in a remote database 142 which is also connected to the network / internet 132 and retrievable by any given open color manager 54 at job time . the third class consists of basic open color hosts 144 and basic open color printers 146 . these basic open color devices 144 , 146 each contain a respective input or output color profile data structure , but do not include a on - board open color manager 54 . instead , these basic open color printers rely either on a remote open color manager 148 which is connected to the network / internet 132 or the open color manager 54 resident in a smart or semi - smart printer or host being linked to at job time . the fourth class consists of dumb open color hosts 150 and dumb open color printers 152 . these dumb open color devices 150 , 152 contain neither a local color profile data structure nor a local open color manager 54 . they simply connect to the network , and at job time , they work in conjunction with the remote open color manager 148 and the remote database 142 which stores input and output color profile data structures . the dumb open color devices may also rely on the open color manager 54 of a smarter corresponding device linked - to at job - time . the open color manager 54 may be implemented using a variety of different data processing methods , but the actual location of the open color manager , whether it be on a host , on a printer , or in a remote location , will determine the preferred implementation . when the open color manager 54 is located onboard a printer , the preferred way of implementing the open color manager 54 is with an asic , via a firmware instruction set running on a microprocessor , or with a combination of an asic and firmware running on a microprocessor . when the open color manager 54 is located on a host , the preferred method of implementation is either with firmware running on a microprocessor or with software running on an operating system . the remote open color manager 148 is preferably software based , running on a server computer . thus , the method and system for open color space transformation with black preservation enables a networked / internet based approach to allow any host to print to any printer . the host and the printer do not need to know anything about each other . at job time , the host and printer pass their respective input and output color profile data structures to an open color manager . if such a color profile data structure is not native to the host or printer , it may be retrieved from a remote database which stores such structures . the open color manager may reside and run from either the host , the printer , or a remote location if neither the host nor the printer are programmed to implement an open color manager . the open color manager links the color profile data structures from both the host and the printer , performs gamut mapping and optimization , performs optional ink limit adjustment , converts the input color space data to a profile connection space ( preferably a device independent color space ), determines an output black ( k ′) value based on the input black ( k ) value in order to preserve the black level , and then uses the determined gamut mapping and optimization information in conjunction with the input pcs color data and the output black ( k ′) data to complete a conversion of the input color or space data to an output color space data where the black information has been preserved without degrading the color accuracy . the entire process performed by the open color manager is performed at job time , so the host and the printer remain separate and independent from each other . it is apparent that a variety of other modifications and substitutions may be made to implement a color space transformation with black preservation for an open color management system while still falling within the scope of the claims below . | 7 |
a preferred embodiment of the present invention will be described herein below with reference to the accompanying drawings . in the following description , in accordance with the present invention , a cellular communication system that includes femtocell base stations provides a qos ( quality - of - service ) on a desired level to active applications of users connected to the system via a femtocell base station . more specifically , the present invention relates to the qos requirements of a given application , scheduling by a scheduler residing in the femtocell base station , assignment of a radio traffic channel taking these into consideration , and transmission of data at different data rates whereby the instantaneous rates are dictated by the channel quality of the user ( s ) of the scheduled application ( s ). the scheduler in a femtocell base station constituting a tdm - based cellular communication system can perform such an invention . as such , cellular systems following the standards such as is - 2000 , wcdma , umts , cdma2000 , 1xev - do , 1xev - dv , lte , lte advanced where femtocells are deployed may use this invention . the invention is also applicable to all future cellular communication standards where data communication is tdm - based and system resources of a common radio channel are shared amongst a plurality of users having a plurality of active applications serviced by a femtocell base station . fig1 refers to a generalized network configuration of a cellular communication system where one macrocell 100 of a cellular communication system serviced by a base station 110 to which the present invention is applied is illustrated . such a cellular communication system provides a mobile user with voice as well as packet data services . the cellular communication system includes femtocells , each having a femtocell base station 120 and indoor users 130 , 140 , 150 serviced by this femtocell base station and outdoor users 160 serviced by the cellular base station 110 . the femtocell base station 120 may be closed access , open access , or hybrid . if the femtocell base station is open access , users will be serviced by the femtocell base station 120 only if the received signal strength received from this base station is the largest amongst the plurality of signals from all neighboring cellular base stations and other femtocell base stations . if the femtocell base station is closed access or hybrid , the femtocell base station may service the users in the subscriber list even when the received signal strength from this base station is not the largest . if the femtocell is closed access , users that are not in the subscriber group will always be serviced by either the cellular base station or a neighbouring open access or hybrid femtocell even if the received signal strength from the closed access femtocell base station is the largest . in such a cellular communication system , users that are serviced by the femtocell base station 120 are potentially geographically distributed inside the femtocell . this is illustrated in fig2 . here , femtocell 200 is serviced by the femtocell base station 210 and users 220 and 230 actively request service . the channel 240 between femtocell base station 210 and user 220 as well as the channel 250 between the femtocell base station 210 and user 230 are wireless , and therefore undergo typical wireless channel impairments , such as path loss , wall penetration loss , multipath fading , shadow fading as well as doppler spread . furthermore , these channels are time - varying . fig3 illustrates typical time - variations of the channels 240 and 250 of femtocell users 220 and 230 , respectively from fig2 . as observed , channels 240 and 250 experience variations in the channel strengths with time and these variations are , to a large extent , independent . however , the users 220 and 230 may have multiple active applications at a given time . it should be noted here that , all of the active applications of a given user experience exactly the same channel conditions . fig4 illustrates how data for an active application of a femtocell user 310 is carried from the cellular core network to the user . the femtocell base station 320 is directly connected to the internet 330 via a link 380 such as an adsl connection , cable , broadband connection , optical fibre or a wireless last - mile solution . the cellular core network has an internet gateway with link 390 to the internet . the cellular network has cellular base stations 350 , 360 that may be covering a geographical area that includes the femtocell 300 . the femtocell 320 has both a control - plane as well as a data - plane connection to the cellular core network via the internet 300 . the control - plane connection enables system specific messaging between the femtocell base station 320 and the core network , such as those during a call setup , handoff etc . the data - plane connection allows for the data transfer to / from the mobile user 310 from / to the cellular core network via the femtocell base station 320 . fig5 illustrates the sub - unit 421 of the femtocell base station where buffers are stored for each active application of each active user . the incoming traffic to the femtocell base station consists of data packets for all active applications of all active users . the illustration displays two of such possible users , 401 and 402 , 401 having an active e - mail application 411 , active messaging application 412 , active video application 413 and an active voice over ip application 414 . similarly , in the illustration , user 402 has an active web application 415 , an active download application 416 , and an active voice over ip application 417 . upon arrival , the femtocell base station differentiates each packet based on its destination address ( mobile user ) as well as application ( or application type ). the femtocell base station may be explicitly notified regarding the application type ( or application class ). if this is not available , the femtocell base station may use one or more of the many available techniques to enable this differentiation . such techniques include , but not limited to , use of source address , deep packet inspection , and estimation based on traffic pattern , average inter - packet arrival time difference and average packet size . once user and application based data differentiation is accomplished , the femtocell base station may divide the data packets into physical layer packets whose sizes are dictated by the cellular communication system in use . these packets are subsequently queued in the appropriate buffers . the head - of - line packets of the scheduled applications are transmitted over the common transmission channel at the next time interval . fig6 illustrates the block diagram of the scheduler system in the femtocell base station for the present invention . the scheduler is composed of 4 logical units , a user and application fairness logic , 501 , a downlink channel quality ( or achievable data rate ) collection logic , 502 , the buffers for the active applications , 503 , as well as the intelligence unit , 504 , which decides which services to serve and how to divide the system resources amongst these applications at each scheduling interval . the downlink channel quality collector logic 502 in the femtocell base station receives instantaneous channel quality indicators ( which may be in the form of achievable data rates ) from every active user prior to each scheduling interval . the downlink channel quality collector logic 502 in the femtocell base station also keeps track of the average channel quality ( which may be in the form of average observed data rates ) for each active user , where averaging is handled using a sliding window over a pre - defined duration of time . the user and application fairness logic 501 keeps a record of the current qos requirements of all active applications , the current user ( or cellular operator ) set priority levels of all active users and applications , as well as the current satisfaction and / or dissatisfaction levels for all of the applications . one of the goals of the disclosed invention is to satisfy a fair service to all active applications where fairness is measured in terms of the relative satisfaction and / or dissatisfaction levels with user and application level priorities and qos levels set as constraints . the application buffers 503 provide a queue for the application data packets . each queue is a first - in - first - out ( fifo ) queue where the head - of - line packets leave the queue for over the air transmission whenever the corresponding application is scheduler by the intelligence logic , 504 . one preferred embodiment of the disclosed invention has an intelligence unit 504 that decides which application ( s ) to serve and how to divide the system resources amongst them so that the goals of satisfaction of qos requirements of each active application , user and application priority level scaled fairness of service , and the femtocell base station sum throughput are jointly maximized using multiple objective optimization . here , 504 decides on the scheduled application ( s ) and if necessary , the corresponding division of system resources amongst the scheduled applications , so that a best compromise solution that has the smallest euclidean distance from the utopia point is met . in another preferred embodiment , the intelligence unit 504 sub - optimally schedules which applications to serve and the division of resources amongst the scheduled applications according to an application rank , which is calculated at each scheduling interval according to a nonlinear function of one or more of the qos requirements ( maximum instantaneous and average data rates , minimum instantaneous and average data rates , average and maximum packet delays , estimated ( or exact if the system allows for a feedback ) buffer fullness levels at the user end ), current qos satisfaction or dissatisfaction levels ( which could be measured using a token counter , a satisfaction / dissatisfaction metric , or any other metric that measures the deviation from the desired level ), observed channel qualities ( or the achievable data rate ) for each user , and average channel qualities ( or average observed data rate ) for each application . fig7 illustrates how scheduling allocates system resources amongst active applications over a number of scheduling intervals . fig7 ( a ) illustrates a system where the intelligence unit 504 of the previous figure allocates all system resources to one application at a given scheduling interval . the system resources are multi - dimensional and may consist of one or more of the following : femtocell base station transmit power , transmission code space ( if a cdma based system is used ), antennas ( if the base station is furnished with multiple antennas ), and the available bandwidth ( if an fdma , multi - carrier or ofdma based system is used ). if each of the available system resources are divided into unit size chunks , a multi - dimensional unit of system resources can be illustrated as 601 . in that case , in fig7 ( a ), the entire multi - dimensional system resources space is allocated to one application at a given scheduling interval . this application is selected by the intelligence unit 504 of the previous figure . similarly , fig7 ( b ) illustrates a system where it is possible to schedule multiple applications for service at a given scheduling interval . in this case , the intelligence unit 504 of the previous figure schedules which applications to serve at a given scheduling interval based on the current application ranks . furthermore , the intelligence unit 504 also decides which application to allocate each multi - dimensional unit of system resources 601 . in other words , all possible multi - dimensional units of system resources 601 are divided amongst all active applications so that the overall desired system goals are satisfied at every scheduling interval . while the invention has been shown and described with reference to certain preferred and / or illustrative embodiments , it will be understood by those skilled in the art that various changes in the form and details may be made therein without departing from the spirit and scope of the invention as defined as the appended claims . | 7 |
referring first to fig1 the guiding device shown has nine exits 2 which are defined by vanes 4 , the exits being relatively closely spaced and arranged to have coins emerge from them substantially parallel and in a downward direction . a coin guide , which is of changeable configuration , comprises a first , upper , portion 6 and a second , lower , portion 12 . first portion 6 comprises two swinging links 8 which are pivoted at their upper ends , the gap between them at their upper ends constituting an entry opening for coins arriving at the device , such coins being indicated at 10 . the inner surfaces of swinging links 8 guide entering coins . the second guide portion 12 is constituted by two sides 14 which are not fixed together but are pivotally supported at the lower ends of the respective swinging links 8 . a guide control means is provided ( which may be of the type to be described in more detail below ) which is capable of selectively moving the lower end of the second guide portion 12 into register with any one of the coin exits 2 , and the guide control means is so arranged that as this traversing of the exits occurs , the swinging links 8 and sides 14 are constrained to move in a particular way , and in coordination with each other , in a manner which can be interpreted from the two particular positions shown in fig1 . the movement of the first guide portion formed by swinging links 8 is relatively easy to envisage . they always diverge from each other and turn from side to side in unison . the movement of the second guide portion 12 is more complex and involves both rotation and also bodily translation . the second guide portion 12 translates bodily between the extreme right - hand position shown in fig1 a and an extreme left - hand position which is the mirror - image of that shown in fig1 a . hence its coin outlet moves across the substantial distance covered by the relatively large number of coin exits 2 , even though the guide portion 12 is of modest size . because of the translation , the upper end of guide portion 12 moves from side to side and , when in its extreme positions especially , is not perfectly placed to reliably receive the incoming coin 10 . however , the inner surfaces of swinging links 8 ensure that the coins do nevertheless enter the lower guide portion 12 the two sides 14 of the guide portion 12 diverge from each other in the direction away from the exits 2 , i . e . upwards , so there is plenty of space in which the coin can make the movements necessary to transfer through the inlet and then from the first guide portion into the second guide portion . however , although the upper end of the second guide portion 12 is relatively broad owing to its divergence , there is no need for the overall width of the device to be increased to accommodate this extra breadth when the second guide portion 12 is translated from one to the other of its two extreme positions . this is because , at the same time as the translational movement , the second guide portion 12 rotates . in fig1 a it has rotated anti - clockwise relative to its central position , such that the right - hand side 14 is approximately vertical . as it translates to the left as shown in fig1 b it rotates clockwise and when it reaches the extreme left - hand position the left - hand side 14 will be substantially vertical . hence , because when the coin outlet from lower guide portion 12 is in each of the two extreme lateral positions , the laterally extreme sides 14 occupy substantially parallel positions adjacent to the respective extreme outlets , the width of the device need be little or no greater than the width required to accommodate the exits 2 , despite the divergent shape of the second guide portion 12 . the effect is that the lower guide portion 12 is rotated as though about a centre located substantially above the top of the device as viewed in fig1 . this is achieved by pivoting the sides 14 of the second guide portion 12 independently at the lower ends of the swinging links 8 , and hence without any part of the mechanism needing to extend outside the rectangular outline indicated in fig1 . a coin 10 &# 39 ; is shown in fig1 ( a ) sliding down the left - hand side 14 towards the extreme right - hand exit 2 . it is desired that the coin 10 &# 39 ; emerge through and from the exit 2 edgewise and substantially vertically as illustrated by the coin 10 &# 39 ;&# 39 ; and for this to happen the coin must rotate substantially clockwise when its leading edge is entering the exit . the right - hand side 14 directs the leading edge towards the exit and , because the right - hand side 14 is substantially vertical it leaves plenty of free space ( between itself and the coin 10 &# 39 ; in fig1 ( a )) to allow the coin to turn clockwise under gravity and enter the extreme right - hand exit 2 with minimal hindrance . it will be appreciated that this turning space for the coin , in conjunction with the steeply inclined left - hand side 14 for speedily guiding the coin towards its exit , could not be made available by pivoting the second guide portion 12 at a point within the confines of the device , for example in the vicinity of the coin entry , and arises because the second guide portion 12 is effectively swung about a centre quite substantially outside the device . still referring to fig1 ( a ), it can be seen that the first guide portion 6 , and in particular the left - hand swinging link 8 , is already starting to guide the arriving coin 10 in the general direction of the extreme right - hand exit ( indeed , this could be occurring even before the lower end of the second guide portion 12 has arrived fully in register with that exit ) and the upper end of the second guide portion 12 is , because of the geometry , always in a position to receive the partially guided coin from the upper guide 6 and then route it accurately to the desired exit . in general terms , the complete guide consisting of the first and second guide portions 6 and 12 together , is constrained by control means which will be described in more detail below to change its shape according to which of the exits the lower end of the chute is in register with , such that unhindered delivery of the coin to the selected exit is facilitated , as has been explained . there is substantial overlap between the volumes occupied by the guide in adjacent exit positions , and this enables the volume represented by the rectangular outline of the device as seen in fig1 ( a ) to be of relatively small overall dimensions , both in height and width , and to be substantially fully utilised . turning now to fig2 to 5 and 6 to 8 , the device shown is identical in all these figures except that ten exits 2 are shown in fig2 to 5 and seven are shown in fig6 to 8 , as compared with the nine exits of the fig1 device . the device shown in these figures has a second guide portion 12 with independent but coordinated sides 14 but , instead of the solid swinging links 8 which provide guide surfaces in fig1 it has swinging links 16 and 18 in the form of open frames . although these do not serve a direct guiding function , they are pivoted at their upper ends and the sides 14 are pivoted to them at their lower ends , and therefore they do control the movement of the second guide portion 12 , in exactly the same way as did the swinging links 8 in fig1 . the operative parts of the device are housed and supported by a casing which has a front wall 20 , two side walls 22 and 24 having openings in them , a rear wall 26 having a hollow box - like structure ( best seen in fig3 ) in which part of the drive mechanism is housed , and , extending from the rear wall a bracket portion having main walls 28 and 30 . the vanes 4 extend between the front and rear walls 20 and 26 , with the two laterally extreme vanes being actually formed by the lower parts of the side walls 24 . the swinging links 16 and 18 are pivoted at their upper edges by means of pivot pins ( not shown ) engaging in respective recesses in the front and rear walls 20 and 26 . the lower edges of the sides 14 are formed with pegs 32 which extend forwardly to ride in and be guided by a quadrant - shaped slot 34 in the front wall 20 ( see fig2 ), and at their rear ends are formed with pegs 36 which extend through a quadrant - shaped aperture 39 into the hollow interior of the rear wall 26 . in place of the internal surfaces of the swinging links 8 which formed the first guide portion in the fig1 embodiment , the fig2 embodiment has a first guide portion in the form of two movable elements 38 and 40 which are pivoted at their upper ends on pivot pins ( not shown ) which extend between the front and rear walls 20 and 26 , these being the same pivot pins on which the swinging links 16 and 18 are mounted . by means of a guide control mechanism which will be described , the two elements 38 and 40 forming the first guide portion turn from side to side in coordination with the movement of the sides 14 of the second guide portion 12 but , because the first guide portion is narrower it guides the arriving coin more precisely towards the selected exit as the coin is entering the second guide portion 12 . the guide control means includes a unitary structure which includes an arcuate rack gear 42 , a pair of arms 44 extending downwardly from the ends of the rack gear 42 to support at their lower ends a double trunnion 46 into which engage the pegs 36 , and a pair of rod - like curved horns 48 and 50 which extend upwardly from the ends of the rack gear 42 . the unitary structure just described is located by means of a curved bearing projection 52 of which one portion can be seen in fig2 and another portion in fig3 though the entire projection 52 is in practice a continuous arc ; the projection 52 is fixed on the rear surface of the inner part of the box - like rear wall 26 of the casing . the curved bearing projection 52 matches , and serves as a sliding bearing for , the inner arcuate surface of the arcuate rack gear 42 and these two surfaces have the same central axis of curvature ( a , in fig6 ), which is also the central axis of the quadrant slot 34 , the quadrant aperture 39 , and the rack teeth . the teeth on the outside of the arcuate rack gear 42 engage with the output gear 54 of a stepper motor 56 which is mounted on the forward - facing surface of the bracket wall 30 . the elements 38 and 40 of the first guide portion are provided with respective angled arms 58 which project back through apertures 60 ( only one visible , in fig2 but see fig7 ) to the interior of the box - like rear wall 26 where the arms 58 are each formed with a trunnion 62 which slidably rides on a respective one of the horns 48 and 50 . when the stepper motor 56 is actuated , the unitary structure 42 , 44 , 46 , 48 , 50 is turned or rocked about the axis of curvature a of the arcuate rack gear 42 so that the trunnion 46 acting through pegs 36 positively drives the lower edges of the lower coin guide portion 12 to traverse across the exits 2 . the stepper motor 56 can be driven by signals which are derived by standard techniques from a coin validator of any type , which applies one or more tests to a coin , processes the test results to determine whether it is a coin that should be accepted and , if it is , produces a signal indicative of the denomination of the coin which in turn is used to derive a drive signal for the stepper motor such as to cause it to position the lower end of second guide portion 12 in register with that exit 2 which leads to a storage location for that particular denomination of coin . if the horns 40 and 48 had the same central axis of curvature a as the rack 42 , then they would simply slide through the trunnions 62 as the unitary body turns or rocks . however , the horns 48 and 50 are given a lower central axis of curvature ( b , see fig6 ) than the rack 42 , that is to say , relative to a circular continuation of the rack the horns curve further inwardly towards each other . the result of this is that the horns have a sliding camming action within the trunnions 62 as the unitary structure rocks . referring to fig7 as the unitary structure rocks from y to y &# 39 ;, the trunnions 62 move from z to z &# 39 ;. this pushes the arms 58 both in the same direction and these in turn cause the movable elements 38 and 40 to be pivoted in the same direction about their pivot pins . the relative dimensioning is such that the first guide portion formed by elements 38 , 40 pivots across only part of the angular range of the exits 2 , that is to say it turns through an angle substantially less than the angle through which the lower end of the second guide portion moves as viewed from the entry . hence the coin does not have to turn sharply when entering the first guide portion . the device guides incoming coins to the appropriate exit 2 basically in the same way as the device explained in relation to fig1 except for the different manner of operation of the first guide portion ( elements 38 , 40 ) which has already been explained . however , the device includes extra features which enable it not only to guide acceptable coins to the appropriate one of the exits 2 , but also enable it to route non - acceptable coins to a reject path in response to the associated coin validator determining that a coin is not acceptable . for this purpose , an accept / reject gate in the form of a small plate 64 is provided which in its normal position , as shown in fig2 and 8 and in full lines in fig7 blocks off the bottom or lower end of the first guide portion formed by the elements 38 and 40 . the accept / reject gate 64 slopes downwardly toward the rear wall 26 , which has a central cut - out 66 in it where indicated generally by the arrow in fig2 and 3 so that when a coin arrives and the gate 64 is closed , as shown in fig4 the coin rolls rearwards on the gate 64 through the gap 66 and onto a steep ramp 68 formed by the outer surface of wall 28 of the rear bracket . the sequence of positions occupied by a coin being rejected in this fashion is illustrated in fig4 . the accept gate plate 64 is the lower part of an l - shaped member of which the upper part is a plate 70 which is pivotally mounted at its upper edge to the outside of element 40 by means of a pin 71 in lugs 73 . unitary with the l - shaped member 64 , 70 is an arcuate lever 72 ( see also fig7 and 8 ). the arcuate lever 72 is shaped such that its centre of curvature lies on the axis about which element 40 pivots . the accept / reject gate is operated by means of a solenoid 74 mounted behind bracket wall 28 and having an actuator arm 76 ( see fig3 and 8 ) which extends through an aperture in the rear wall 26 of the casing ( which at this position is single , rather than box - like ) so as to lie behind the lever 72 . actuator arm 76 includes ( see fig7 and 8 ) a lug 77 having an aperture therein through which lever 72 extends , and by means of which the actuator arm 76 pushes lever 72 inwardly when the solenoid 74 is activated , this being done when the solenoid 74 receives from the associated coin validator a signal indicating arrival of a coin which is acceptable and is to be permitted to be directed to one of the exits 2 . it is to be noted that because the centre of curvature of lever 72 coincides with the axis about which it moves , its point of contact with lever 76 remains constant as the outside of the lever slides across the surface of the arm 76 , and this point of contact always lies above the axis 71 on which the l - shaped member is pivoted . consequently , irrespective of the instantaneous angular position of the mechanism , whenever lever 72 is pushed towards the first guide portion 38 , 40 , by the actuator arm 76 , it causes the entire l - shaped member 64 , 70 to pivot outwardly to the position shown in fig5 and in broken lines in fig7 so that the plate 64 no longer obstructs the bottom of the first guide portion and the coin can leave the bottom thereof freely . fig5 shows the sequence of positions occupied by a coin which is acceptable and is therefore to be allowed to pass the accept / reject gate and be routed to one of the more right - hand exits 2 . the device just described enables a reduction in the dimensions of a complete coin validation and routing system because it can be appreciated that the location of the accept / reject gate 64 within the guide requires virtually no additional space for the additional function of acceptance / rejection , beyond that needed for guidance . furthermore , because the accept / reject gate 64 is located below the upper guide portion 38 , 40 , the process of guiding the coin to its eventual exit can already have been started before the accept / reject gate 64 is opened which enables the functions of acceptance and guidance to an exit to be accomplished within a shorter time . it should be appreciated that the exits 2 and vanes 4 which define them might alternatively be provided as a separate unit from the movable parts of the guidance system or as a part of a separate unit therefrom . it should be noted that , in the present invention the guide for the coin to its final destination is always formed by the same elements , whereas in prior art active sorter devices typically the coin is guided by a different selection of the various movable elements , the selection depending upon which exit the coin has to be guided to . | 6 |
fig1 shows a coded modulation system 100 employing one or more embodiments of the present invention . coded modulation system 100 is characterized by transmitter 200 applying space - time coding with bit - interleaved coded modulation that is combined with a multi - carrier ofdm modulation ; and receiver 300 applying ofdm demodulation with iterative demapping and decoding . such coded modulation systems in accordance with the present invention may be advantageously employed in wireless local / wide area network ( lan / wan ) applications . fig1 shows an example of a system with 3 transmit antennas and 2 receive antennas , and a system model may be defined for the general case of n t transmit antennas ( n t an integer and n t ≧ 2 ) and n r receive antennas ( n r an integer and n r ≧ 1 ). each of the n r receive antennas receives signals from the n t transmit antennas . while the exemplary embodiment is described for space - time coding with bit - interleaved coded modulation , other types of coded modulation for space - time coding may be employed . in addition , the exemplary embodiments are described for a mapping of the bit - interleaved coded data into symbols using a modem constellation . such modem constellation may be m - ary psk or m - ary qam with m constellation points , though the present invention is not limited to these constellations and may employ any multi - level signal point modulation . system 100 employs ofdm for wideband channels using f subcarriers rather than single carrier modems . the spectral efficiency of system 100 is r c n t log 2 m bits / s / hz , where r c is the rate of the convolutional code used . the output y k , l j at the kth subcarrier and at the lth time slot from the jth receive antenna matched filter after the discrete fourier transform ( dft , or its fast version , the fft ) is given by equation ( 1 ): y k , l j = e s ∑ i n i h k , l i , j x k , l i + n k , l i for j = 1 , 2 , … n r ( 1 ) where x k , j l is the transmitted symbol ( of a multi - level symbol constellation ) at the ith transmit antenna at the kth subcarrier and at the lth time slot . the value e s is defined as the symbol energy and h k , j l , j is defined as the equivalent channel frequency response of the link between the ith transmit antenna and jth receive antenna at the kth subcarrier and at the lth time slot . the quantity n k , j j represents the additive noise contribution , which is represented as a sequence of i . i . d . complex , zero - mean , gaussian variables with variance n o / 2 per dimension . the time domain channel impulse response between the ith transmit and jth receive antenna may be a frequency selective channel that may be modeled as defined in equation ( 2 ): h i , j ( t , τ ) = ∑ n = 1 k h _ i , j ( n , t ) δ ( τ - τ n ) ( 2 ) where the channel coefficients { overscore ( h )} l , j ( n , t ) are complex gaussian variables with zero mean ( rayleigh fading ). the term δ (•) is defined as the dirac delta function , and k denotes the number of channel ( filter ) taps . the channel impulse responses of each of the antenna links are independent of one another . both fast fading ( i . e ., uncorrelated fading coefficients in time ) and block fading ( i . e . static fading coefficients over a block of transmitted symbols , independent over blocks ) may be present . for the described embodiments , the model is described using block fading typical of wireless lans with slow movements . consequently , the variables with respect to time indices l and t may be considered constant and these indices are omitted from the following description for clarity . the channel frequency response in equation ( 1 ) may be expressed as given in equation ( 3 ): h k i , j = ∑ n = 1 k h _ i , j ( n ) ⅇ - j2π kτ n / f t ( 3 ) where t denotes the sampling period . the absolute magnitude of the channel frequency response , | h k l , j |, is rayleigh distributed . the symbol constellation is normalized such that equation ( 4 ) holds true : e {| x k l | 2 }= 1 for i = 1 , 2 , . . . n t ( 4 ) with vector notations , equation ( 2 ) may be expressed as in equation ( 5 ): y k = [ y k 1 ⋮ y k nτ ] = e s [ h k 1 , 1 ⋯ h k n i , 1 ⋮ ⋰ ⋮ h k 1 , n τ ⋯ h k n i , n τ ] [ x k 1 ⋮ x k n i ] + [ n k 1 ⋮ n k nτ ] ( 5 ) y k =√{ square root over ( e s )} h k x k + n k for k = 1 , 2 , . . . f ( 5 ′) generally , receiver 300 includes circuitry that estimates the values for the elements in channel response matrix h k , and such estimates may be generated using periodic test signals transmitted by transmitter 200 to receiver 300 . such a priori information of the channel impulse response may also be generated via simulations . fig2 shows transmitter 200 for space - time coding with bit - interleaved coded modulation ( bicm ) with ofdm modulation for the case of wideband frequency selective channels . transmitter 200 comprises convolutional encoder 201 , bit interleaver 202 , processing module 203 , mapper modems 207 ( 1 )– 207 ( n t ), inverse fast fourier transform ( ifft ) modules 208 ( 1 )– 208 ( n t ), and transmit antennas 209 ( 1 )– 209 ( n t ). applying bicm encoding to the data is as follows . convolutional coder 201 applies a binary convolutional code with rate r c to the input bits ( input data ). bit interleaver 202 then interleaves the encoded bits from convolutional coder 201 to generate bicm encoded data . bit interleaving by interleaver 202 de - correlates the fading channel , maximizes diversity , removes correlation in the sequence of convolutionally encoded bits from convolutional coder 201 , and conditions the data for increased performance of iterative decoding . convolutional coder 201 and bit interleaver 202 may typically operate on distinct blocks of input data , such as data packets . applying ofdm to the bicm encoded data is as follows . processing module 203 includes serial - to - parallel converter 204 , and optional framing module 206 . serial - to - parallel converter 204 receives the serial bicm encoded bitstream from bit interleaver 202 , which bitstream may have framing information inserted in the bitstream by framing module 206 . optional framing information allows a receiver to synchronize its decoding on distinct blocks of information . serial - to - parallel converter 204 generates a word of length n t long , with each element of the word provided to a corresponding one of mapper modems 207 ( 1 )– 207 ( n t ). elements of the word may be single bit values , or may be b bit values where b is the number of bits represented by each modem constellation symbol . mapper modems 207 ( 1 )– 207 ( n t ) each convert b bits to corresponding symbols ( of the m - ary symbol space ) in the sequence x k l of equations ( 5 ), and ( 5 ′). the output of the j th modem mapper 207 ( j ) is a symbol . ifft modules 208 ( 1 )– 208 ( n t ) each collect up to f symbols , and then apply the ifft operation of length f to the block of f symbols . thus , ifft modules 208 ( 1 )– 208 ( n t ) each generate f parallel subchannels that may be transmitted over corresponding antennas 209 ( 1 )– 209 ( n t ). each subchannel is a modulated subcarrier that is transmitted to the channel . fig3 shows receiver 300 an iterative decoder for the space - time code for the ofdm system . receiver 300 comprises receive antennas 301 ( 1 )– 301 ( n r ), fast fourier transform ( fft ) modules 302 ( 1 )– 302 ( n r ), demodulator / detector 303 , parallel - to - serial converter 307 , bit deinterleaver 308 , maximum a posteriori ( map ) decoder 309 , bit interleaver 310 , and serial - to - parallel converter 311 . for a wideband system , receiver 300 performs ofdm demodulation for each of receive antennas 301 ( 1 )– 301 ( n r ), and the demodulation and demapping is performed over f parallel subchannels . the ith receive antenna 301 ( i ) senses a signal made up of various contributions of the signals transmitted from the n t transmit antennas ( i . e ., contributions of the multiple f parallel , narrowband , flat fading subchannels transmitted over corresponding antennas 209 ( 1 )– 209 ( n t ) of fig2 ). fft modules 302 ( 1 )– 302 ( n r ) each apply an f - point fft to the corresponding signals of receive antennas 301 ( 1 )– 301 ( n r ), generating n r parallel sets of f subchannels . in accordance with embodiments of the present invention , demodulator / detector 303 estimates bits in each of the f subchannels ( slowly varying with flat fading ) rather than in only one subchannel as in the narrowband , flat fading systems of the prior art . demodulator 304 demodulates f subchannel carriers to baseband for each of the n r parallel sets of f subchannels . multi - input multi - output ( mimo ) demapper 305 , based on the n r parallel sets of f subchannels from fft modules 302 ( 1 )– 302 ( n r ) produces map estimates of the demapped bits ( i . e , bits mapped from the constellation symbol ) in each of the f subchannels from the n t antennas in the transmitter . mimo demapper 305 produces the map estimates of the demapped bits using reliability information generated by map decoding of the map estimates for the bicm values by map decoder 309 . estimation of bit values by mimo demapper 305 is now described . mimo demapper 305 computes soft values for bits transmitted on the overlapping f subchannels , along with an a posteriori probability of the soft value being correct . the a posteriori probability of the soft value being correct is defined as an a posteriori log - likelihood ratio ( llr ) for the soft value ( bit ). defining d k l , m as the bit that is mapped at the kth subcarrier into the mth bit position ( m = 1 , 2 . . . m , where m is the integer number of bits per symbol ) of the constellation symbol of the ith transmit antenna , i1 , 2 , . . . n t , then the a posteriori llr l ( d k l , m ) for the soft value corresponding to bit d k l , m is given as in equation ( 6 ): the set s d l , m , d =+ 1 or − 1 , is defined as the set of all symbol vectors with a + 1 or − 1 value for bit d k i , m , respectively . the number of elements in such a set is 2 n l m . the llr in equation ( 6 ) conditioned on the channel state information h k is given in equation ( 7 ): a mimo demapper considers all 2 n l m combinations of overlapping bits in a subchannel and then evaluates the llr for each combination . soft values are assigned as the combinations that exhibit the highest probability of occurrence with respect to the llr values . for system 100 , the complexity ( number of combinations evaluated ) is approximately 2 n l m . thus , assuming a transmitted vector of symbol bits x k a vector of observations at the receiver y k , and the known estimated channel function h k , the soft output values for bits may be generated by calculating the llr of equation ( 7 ) for all combinations and selecting the combination having the highest llr values . mimo demapper 305 in fig3 is shown in fig4 . each signal of the n r receive antennas 302 ( 1 )– 302 ( n r ) is divided into f subchannels ( via demodulator 304 , not shown in fig4 ) by applying the fft and sent to corresponding subchannel mimo demappers 401 ( 1 )– 401 ( f ). the signal outputs of the kth subchannel for all n r receive antennas are provided to the kth subchannel mimo demapper 401 ( k ), which computes the log likelihood ratio of equation ( 7 ) using extrinsic information ( a likelihood ratio vector l k e ) generated from the output of map decoder 309 of the previous iteration . instead of the parallel structure shown in fig5 , it is possible to process the signals output from each of fft modules 302 ( 1 )– 302 ( n r ) sequentially by buffering the output and processing them one by one with only one mimo demapper . in order to generate a value for the llr of equation ( 7 ), the joint probability density p ( x k , y k , h k ) of equation ( 7 ) is evaluated . the joint probability density p ( x k , y k , h k ) of equation ( 7 ) is proportional to (∝) the quantity of equation ( 8 ): p ( x k , y k , h k ) ∝ exp ( - 1 n 0 y k - h k x k 2 + 1 2 d k t l k e ) ( 8 ) where d k is a column vector comprising elements d k l , m and l k e is the extrinsic information column vector representing a priori log likelihood ratio ( llr ) values for the bits from map decoder 309 . the extrinsic information ( the a priori llr vector l k e ) is exchanged between mimo demapper 305 and map decoder 309 to improve the bit error rate performance for each iteration . the elements of the a priori llr vector l k e may be independent variables in the interleaved bit stream . for the first iteration ( i . e ., the first pass through the iterative detection and decoding process ) the elements of the a priori llr vector l k e are set to zero . for each subsequent iteration , the elements of the a priori llr vector l k e are derived from the map decoding process of map decoder 309 . returning to fig3 , the estimates of bits in f parallel streams from mimo demapper 305 are provided to parallel - to - serial converter 307 which reconstitutes receiver 300 &# 39 ; s estimate of the bicm encoded bitstream generated by the transmitter . the estimated bicm encoded bitstream is then deinterleaved by bit deinterleaver 308 and applied to map decoder 309 to reverse the convolutional encoding applied by the transmitter . the map decoding process generates soft output values for transmitted information bits . the map decoding process employs input a priori llr values for decoding . the input a priori llr values to map decoder 309 are extrinsic information from mimo demapper 305 , which is the difference between 1 ) the input llr values l k e to mimo demapper 305 for the encoded information bits and 2 ) the output llr values l k having elements l ( d k l , m ) calculated from equation ( 7 ) for the estimates for encoded information bits . for map decoding , the a posteriori log - likelihood ratio ( llr ) value l ( u t ) for a user &# 39 ; s bit u l at time i ( for either a decoded or a new / improved encoded information bit ) given an observation ( channel output sample ) y l may be calculated as given in equation ( 9 ): the a priori llr vector l k e applied to the kth subchannel mimo demapper 401 ( k ) is formed from extrinsic information of map decoding . extrinsic information for a bit is defined as the difference between 1 ) the input a priori llr value to map decoder 309 for the encoded information bit ( extrinsic information from the mimo demapper ) and 2 ) the output a posteriori llr value for the encoded information bit ( e . g ., generated through equation ( 9 )). however , after forming the difference , the extrinsic information from map decoder 309 is first applied to bit interleaver 310 . bit interleaving aligns elements of the extrinsic information with the interleaved estimated bicm encoded bitstream from mimo demapper 305 . in addition , the interleaved extrinsic information is applied to serial - to - parallel converter 311 , which forms n t parallel streams of extrinsic information corresponding to the parallel bit streams formed at the transmitter . vector channel module 306 then forms the a priori llr column vector l k e for each of the f subchannels from the n t parallel streams of extrinsic information . the extrinsic information is exchanged between mimo demapper 305 and map decoder 309 to improve the bit error rate performance for each iteration . the elements of the a priori llr vector l k e may be considered as independent variables in the interleaved bit stream . however , for calculation of the llr value of equation ( 7 ), the cardinality of the set s d l , m is 2 n l m . thus , 2 n l m sequence evaluations are made , which number of evaluations grows exponentially with the product of the number of transmit antennas n t and the number of bits per constellation symbol ( signal point ) m . to improve speed of decoding and decrease both circuit size and power consumption of an implementation , it is desirable to reduce the number of calculations during the evaluations . for a first level of complexity reduction without significant loss of performance , a max - log approximation for calculation of llrs may be used in both a mimo demapper and in a map decoder for the convolutional code . the max - log approximation for calculation of a posteriori llr values may employ the max * term relationship of equation ( 10 ): max *( x , y )= log ( e − x + e − y )= max ( x , y )+ log ( 1 + e −| x − y | ) ( 10 ) when calculating updated forward recursive , reverse recursive , and branch metrics sequences to calculate the value of equation ( 6 ). each constituent mimo demapper or map decoder thus calculates the max * term by separate calculation of a max term ( max ( x , y )) and a logarithmic correction term ( log ( 1 + e −| x − y | )). for a second level of complexity reduction , the number of evaluations is reduced . one method by which the number of evaluations is reduced employs llr values of a previous iteration to identify a number p of bit soft output values that may be fixed as hard decisions . fixing hard decisions reduces the number of sequence vectors ( possible symbol sequence combinations ) that are evaluated during either demapping or decoding . however , since the a priori llr values as described previously are set to zero , embodiments of the present invention employ a separate method to estimate llr values for the first iteration . in a first iteration of demapping and decoding , a minimized cost function error estimation , such as the minimum mean square error estimation , is used to determine the p soft output values that are to be fixed . the techniques described herein for a low complexity receiver need not be limited to a system employing ofdm modulation . fig5 shows a receiver 500 for a system employing any one of a number of modulation schemes known in the art . as shown in fig5 , receiver 500 includes demodulator 501 , minimum mean square error ( mmse ) estimator 504 , and mimo demapper 502 receiving at least n r signals , n r an integer greater than 1 , from corresponding receive antennas 503 ( 1 )– 503 ( n r ). parallel - to - serial converter 507 , bit interleaver 508 , map decoder 509 , bit interleaver 510 , and serial - to - parallel converter 511 operate in a similar manner to like components of fig3 . mmse estimator 504 , mimo demapper 502 , map decoder 509 implement a method of reduced - complexity iterative demapping / decoding for llr calculation as described below . for the receiver of fig5 , the system model employs the following definitions for demapper operations that compute the llr for the information bit . the bit b k n is the bit that is mapped to the nth bit position ( n = 1 , 2 , . . . , n t m ) in the input symbol vector x k . for example , the ith input symbol x k l is mapped by the input bits b k ( l − 1 ) m + 1 , b k ( l − 1 ) m + 2 , . . . , b k lm . the llr value l ( b k n ) represents the llr value for the bit b k n . to distinguish the llr values of mimo demapper 502 from the llr values of map decoder 509 , the notation l m ( b k n ) and l c ( b k n ) are used , respectively . the extrinsic information provided to the demapper is defined as l c e ( b k n ) for the bit b k n . the set s d n , d =± 1 , is the set of all symbol vectors with a + 1 or a − 1 value of bit b k n . column vector b k has elements representing bits b k n , and column vector l k e has elements corresponding to the extrinsic information l c e ( b k n ) ( difference of a priori and a posteriori llr values ) from the map decoder 509 . during the first iteration , the present method identifies “ reliable ” bit decisions for computation of demapper a posteriori llr values , and those reliable bit positions are subsequently fixed as hard decisions . since the demapping process of the first iteration does not have any a priori information available , an mmse estimation filter w k is applied to the received signal ( observations or samples ) y k to get an mmse estimate vector { circumflex over ( x )} k of the transmitted vector x k ( a vector of the transmitted symbols x k l at time k ). thus , mmse estimation minimizes estimation error defined as in equation ( 11 ): where w k , l is a column vector of length n r for estimating x k l . defining e k as a column vector of length n t comprised of the estimation error e k l , the combination of column vectors w k into a n r by n t matrix may generate an optimum estimation matrix w k that minimizes the mean square error e ∥ e k ∥ 2 . the optimum estimation matrix w k may be defined as in equation ( 12 ): using a well - known matrix inversion rule , equation ( 12 ) may be expressed as in equation ( 14 ): w k = h k ( h * k h k + αi ) − 1 . ( 14 ) therefore , the mmse estimate vector { circumflex over ( x )} k for symbols x k is obtained through evaluation of equation ( 15 ): { circumflex over ( x )} k = w * k y k =( h * k h k + αi ) − 1 h * k y k . ( 15 ) the covariance matrix r e of the estimation error e k = x k −{ circumflex over ( x )} k is expressed as in equation ( 16 ): r e = e ( e k e * k )= n 0 ( h * k h k + αi ) − 1 . ( 16 ) once the quantity ( h * k h k + αi ) − 1 is obtained , both the mmse estimation filter w k and the covariance matrix r e are easily computed . next , tentative decisions for the transmitted bits are generated based on the mmse estimates . denoting { circumflex over ( l )}( b k n ) as the soft output value based on the mmse estimation { circumflex over ( x )} k , the soft output value { circumflex over ( l )}( b k n ) for each bit b k n may be computed using equation ( 17 ): equation ( 17 ) for the general receiver structure may be related to equation ( 6 ) of the ofdm system since the index n is equivalent to im + m . at high signal - to - noise ratios ( snr ), the mmse estimation approaches a zero forcing ( zf ) solution , and may be approximated by a variable having complex gaussian distribution . thus , by applying the gaussian probability density function approximation and normalizing , the joint probability p ({ circumflex over ( x )} k | x k ) is defined as in equation ( 18 ): if the mmse estimates { circumflex over ( x )} k l are uncorrelated with each other , the correlation matrix r e becomes a diagonal matrix with σ l 2 being the ith diagonal element of the matrix . denoting σ l 2 as the variance of the ith mmse estimate { circumflex over ( x )} k l , then the joint probability p ({ circumflex over ( x )} k | x k ) of equation ( 18 ) may be expressed as in equation ( 19 ): with equation ( 19 ), the llr computation may be performed with a single scalar symbol instead of a vector . for n =( i − 1 ) m + 2 , ( i − 1 ) m + 2 , . . . , im , the notation b k n | l to indicate that the nth bit position falls into ith symbol . after canceling out symbols unrelated to b k n | l , the llr computation of equation ( 17 ) may be expressed as in equation ( 20 ): l m ( b k n i ) = log ∑ x k j ∈ m + 1 n i exp ( - 1 2 σ i 2 x ^ k i - x k i 2 ) ∑ x k j ∈ m - 1 n i exp ( - 1 2 σ i 2 x ^ k i - x k i 2 ) ( 20 ) where the set m d n | l is defined as in equation ( 21 ): with equations ( 20 ) and ( 21 ), the number of evaluations ( candidates to search ) is reduced to 2 m . by applying the max - log approximation to equation ( 20 ), the computation of llr is further reduced . given the mmse estimate { circumflex over ( x )} k , the simplified scheme transforms the m - dimensional search over likelihood values for all sequences into simple m boundary problems . even though the llr values for all the transmitted bits may be obtained by a method employing equations ( 20 ) and ( 21 ), this llr computation is employed to determine those bits whose decisions may be considered “ reliable ” to further reduce the number of evaluations . if a number p of bit positions , n 1 , n 2 , . . . n p are identified as having llr values computed in equation ( 20 ) that are reliable , the corresponding llr values l ( b k n 1 ), l ( b k n 2 ), . . . l ( b k n p ) meet or exceed a threshold . defining { circumflex over ( b )} k n 1 , { circumflex over ( b )} k n 2 , . . . { circumflex over ( b )} k n p as the hard decisions for the bits made by slicing soft output values corresponding to these llr values , then the set l p is defined as a set of all symbol vectors with bits in those positions equal to the hard decisions . the set l p is defined as in equation ( 22 ): l p ={ x k | b k n 1 ={ circumflex over ( b )} k n 1 , b k n 2 ={ circumflex over ( b )} k n 2 , . . . b k n p ={ circumflex over ( b )} k n p }. ( 22 ) as a result , a candidate search for combinations of equation ( 7 ) is carried out over a smaller set l p ∩ s d n . the size of the set that the demapper needs to search over is reduced 2 n t m − p . identification of the p most reliable bit positions is now described . if incorrect hard decisions are employed within a candidate set l p , overall performance degrades due to error propagation in the mimo demapper . thus , the bit positions included in the candidate set l p are selected so as to minimize the probability of error by choosing the bit positions with the largest llr values . considering that hard decisions { circumflex over ( b )} k n are obtained by slicing the estimate { circumflex over ( x )} k l , the probability of error p e in { circumflex over ( b )} k n is dependent on the probability of estimation error of { circumflex over ( x )} k l . therefore , the probability p c that the hard decision { circumflex over ( b )} k n is correct may be expressed as in equation ( 23 ): p c =( 1 − p e ) p { b k l ={ circumflex over ( b )} k l } ( 23 ) where p e is the probability that the mmse estimate { circumflex over ( x )} k l results in an incorrect decision . denoting q (•) as the complementary error function , p c may be computed via equation ( 24 ): p c ≈ n c q ( d min 2 σ i ) , ( 24 ) where n c represents the average number of nearest neighbors , and d min is the minimum euclidean distance for a constellation . both n c and d min may be determined a priori from the given constellation . for example , n c = 3 and d min = 2 for 16 - qam with symbol energy e s = 10 . therefore , using the relationship between l ( b k n ) and p { b k n ={ circumflex over ( b )} k n }, the overall probability p c of correct decision is given by equation ( 25 ): further simplification can be made by using an approximation of q (•) as given in equation ( 26 ): to determine the p most reliable bit positions , we compute the probability of correct decision for each bit position using the relation of equation ( 25 ), and choose the p bit positions with the largest p c . after identifying the p bit positions , equations ( 6 ) and ( 7 ) are modified to compute the llr values over the set l p ∩ s d n . once the mimo demapper generates the llr values using the technique described above for the first iteration , the map decoder may produce soft output values for the transmitted bits for the first iteration and subsequent iterations . therefore , the same principle of fixing hard decisions in the mimo demapper in the subsequent iterations is employed to reduce the size of a set of candidates to search . fig6 shows an exemplary method of reduced complexity iterative demapping / decoding for llr calculation . at step 601 , the mimo demapper begins the first iteration of demapping / decoding . for each i , the mmse estimate { circumflex over ( x )} k l is obtained using equation ( 15 ), and the corresponding mse variance σ l 2 is obtained using equation ( 16 ). at step 602 , the mimo demapper employs the mmse estimates { circumflex over ( x )} k l and the corresponding mse variances σ l 2 to compute mmse llr values l m ( b k n ) are computed using equations ( 20 ) and ( 21 ). at step 603 , the probabilities of correct decisions are then computed using equation ( 25 ). at step 604 , the p positions with the largest p c as calculated from equation ( 25 ) are selected , and those bit positions are fixed with the corresponding hard decision . at step 605 , the llr values for every bit position ( except the fixed positions ) are computed in equations ( 6 ) and ( 7 ) over a set with a reduced size 2 n l m − p . after the mimo demapper computes the llr values in step 605 , at step 606 the extrinsic information is transferred to the map decoder ( after deinterleaving ). at step 607 , the map decoder performs an iteration of map decoding . then , at step 608 , the map decoder updates its a posteriori llr values l e ( b k n ) for the transmitted bits b k n , unless the last iteration is reached in which the method terminates . at step 609 , the extrinsic information llr values l e ( b k n ) ( by subtracting the input a priori llr values from the a posteriori llr values ) are applied to the mimo demapper ( after interleaving ). even though the extrinsic information l e ( b k n ) is employed by the mimo demapper , the overall llr value l e ( b k n ) for the bit from map decoding is preferably used to determine the p most reliable bit positions . therefore , in the second iteration ( and the subsequent iterations ), at step 610 , the mimo demapper chooses those p bit positions with the largest magnitude map decoder llr values | l e ( b k n )|, and then at step 611 , a set l p is determined based on those p fixed bit positions . at step 612 , the llr values of the mimo demapper for bit positions except for those p fixed positions are computed via equation ( 27 ): l m ( b k n ) = log ∑ x k ∈ l p ⋂ s + 1 n exp ( - 1 n 0 y k - h k x k 2 + 1 2 b k t l k e ) ∑ x k ∈ l p ⋂ s - 1 n exp ( - 1 n 0 y k - h k x k 2 + 1 2 b k t l k e ) . ( 27 ) after step 612 , the method returns to step 606 . as is known in the art , the logarithm of a summation of exponential terms may be approximated by taking only the maximum value of the exponent . therefore , the probability of a bit decision may be determined through equation ( 28 ): a system operating in accordance with an embodiment of the present invention may provide the following advantages . space time bit - interleaved coded modulation ( st - bicm ) in wireless lan applications is flexible in various system configurations . unlike other space - time coded systems of the prior art in which coding and modulation design was specified for each system setup , a single coder in a st - bicm system operating in accordance with an exemplary embodiment of the present invention may support many different data rates . support of multiple , varying data rates may be advantageous for wireless lan system design where , for example , eight different data rate modes are defined in the 802 . 11a standard . the present invention can be embodied in the form of methods and apparatuses for practicing those methods . the present invention can also be embodied in the form of program code embodied in tangible media , such as floppy diskettes , cd - roms , hard drives , or any other machine - readable storage medium , wherein , when the program code is loaded into and executed by a machine , such as a computer , the machine becomes an apparatus for practicing the invention . the present invention can also be embodied in the form of program code , for example , whether stored in a storage medium , loaded into and / or executed by a machine , or transmitted over some transmission medium or carrier , such as over electrical wiring or cabling , through fiber optics , or via electromagnetic radiation , wherein , when the program code is loaded into and executed by a machine , such as a computer , the machine becomes an apparatus for practicing the invention . when implemented on a general - purpose processor , the program code segments combine with the processor to provide a unique device that operates analogously to specific logic circuits . it will be further understood that various changes in the details , materials , and arrangements of the parts which have been described and illustrated in order to explain the nature of this invention may be made by those skilled in the art without departing from the scope of the invention as expressed in the following claims . | 7 |
an intended advantage of the embodiments disclosed herein is to provide a network of virtual communities based on discussion groups that are self moderated . in the following description , numerous specific details are set forth such as examples of news protocols and networks in order to provide a thorough understanding of the present invention . it will be obvious , however , to one skilled in the art that these specific details need not be employed to practice the present invention . in other instances , well known software or hardware configurations have not been described in detail in order to avoid unnecessarily obscuring the present invention . fig1 illustrates a client server network having virtual servers in accordance with one embodiment of the present invention . client ( i . e ., user ) computers 10 - 19 communicate with a net news reading protocol ( nnrp ) server 50 having a nnrp agent 55 . the nnrp server 50 is a proxy caching server connected to a network 70 . the network 70 may be an intranet , an internet , a wide area network , a local area network , or other network configuration . the network 70 is connected to a news server 90 containing articles on various topics . one embodiment of an nnrp server for receiving news from a news server is disclosed in co - pending u . s . patent application entitled , “ hybrid news server ,” application ser . no . 09 / 263 , 587 filed on mar . 5 , 1999 which is incorporated herein by reference . the nnrp agent 55 is a software plug - in for the nnrp server 50 that supports distribution and caching of client 10 - 19 information . it should be noted that ten clients are only shown for illustrative purposes . in other embodiments , the nnrp server can accommodate more clients . the nnrp agent 55 can be configured to support multiple connection profiles for different users . individual user information is maintain in a database system on the nnrp server 50 that appears to each individual client as virtual servers 210 - 219 as illustrated in fig2 . a virtual server is a collection of information that forms a logical view of a set of discussion groups . the virtual server provides facilities to clients of that view to rate or filter discussion groups based on the collective client &# 39 ; s preferences . the client &# 39 ; s preferences may include information such as a client &# 39 ; s directory structure , log files , permissions lists , and authentication identification . in one embodiment , virtual server space is stored on multiple servers . when a client 210 accesses a virtual server 261 , the nnrp server 250 dynamically switches to the client &# 39 ; s set of access parameters . a virtual server is transparent to the client so that information access and transfers are performed automatically by the nnrp server 250 without the client &# 39 ; s knowledge . the client accessing a virtual server is not aware that the virtual server is not a dedicated server such that there other clients 211 - 219 accessing information stored on the same nnrp server 250 . the nnrp agent 255 allows the nnrp server 250 to manage each client &# 39 ; s connection to their respective virtual server . in addition to authenticating the client , the nnrp agent 255 can return profile information allowing extended features and services on an individual client or client group basis . use of virtual servers with the nnrp agent 255 allows the establishment of virtual communities . clients can be grouped into self selected virtual communities . individual clients assigned to a virtual community may set their own group filtering and rating preferences . referring again to fig1 the virtual communities are not necessarily determined by the geographic location of the clients . virtual community 30 , for example , consists of a client in new york 10 , a client in los angeles 11 , a client in washington d . c . 12 , and a client in san jose 13 . although geographically separated , the clients form a community in regards to information that is shared among the community clients . in another embodiment , however , virtual communities are established based on geographic location of the clients . clients in these virtual communities can self select policies , as well as their own filtering options for the articles distributed within their virtual community . in one embodiment , only clients of within a virtual community are allowed to post new articles to the community , thereby providing an efficient means of monitoring abusive users . such a scheme gives server administrators , such as internet service providers ( isp ), corporations , or affinity groups , an opportunity to provide valuable content to users while enabling undesired material to be excluded based on a community and client profiles rather than the standards imposed by a server administrator . fig3 illustrates a virtual community process according to one embodiment of the present invention . a client accesses the nnrp server which allocates space appearing as a virtual server to the client , 310 . the client then enters parameters that the nnrp agent will use to establish a profile for the client , 320 . the nnrp agent assigns the client to virtual communities on the nnrp server based on the client &# 39 ; s profile , 330 . the clients of a virtual community determine ratings and filtering procedures for articles to be distributed within their own virtual community , 340 . each virtual communities is its own groups such that filter is performed at the group level rather than the article level . as such , articles may be removed by a community group if that group deems it to be offensive . the nnrp agent links articles and sets of article groups from news servers with the virtual community clients based on the self selected community &# 39 ; s policies , 350 . any new articles or article group obtained from news servers or posted by community member clients are evaluated by the nnrp agent to determine if they comply with the a virtual communities &# 39 ; standards , 360 . in one embodiment , if the article group conforms with a virtual community &# 39 ; s standards , the nnrp agent will make the article group available to the virtual community &# 39 ; s clients , 380 . if the article group does not conform with a particular virtual community &# 39 ; s standard , then the nnrp agent prevents the community &# 39 ; s clients from accessing those articles , 390 . the process is repeated beginning with step 360 as new articles or article groups become available . in one embodiment , a client assigned to a particular virtual community ( e . g ., by an isp or a corporation ) can modify his own profile in order to access additional virtual community groups . in another embodiment , clients can additionally filter articles within their assigned virtual communities . for example , if an employer develops an intranet virtual community allowing access to a set of article groups , employees within that virtual community can alter their own client profiles to be able to additionally filter articles within the set of article groups that only pertains to their area of interest . in addition , the set of article groups for the virtual community cannot be overwritten by the clients within the virtual community . in another embodiment , clients can define sub profiles allowing for multiple access to the nnrp server , for example , to enable a parent to access a particular discussion group while preventing a child &# 39 ; s access to that discussion group . in yet another embodiment , separate virtual communities can be aggregated together to appear as a single virtual community to users based on their area of interest defined in their user profiles . for example , if a client &# 39 ; s profile correlates with a first virtual community with a first rating and a second virtual community with a second rating , the nnrp agent can combine the two virtual communities with the appropriate ratings to appear as a single virtual community to the client . in the virtual communities , because the discussion groups are self moderated the responsibility of determining what is obscene is transferred to a moderation process within the virtual communities . the nnrp agent together with the nnrp server provides the ability to have the virtual communities assign ratings to the discussion groups and allows individual users to select particularly rated discussions based on their own client profiles . with clients possibly spread out across the country and the world , this scheme may eliminate a service provider &# 39 ; s policing of , in effect , a nationwide standard by enabling clients to establish virtual communities with self defined community standards of obscenity . fig4 illustrates a structure of a nnrp server enabling virtual communities according to one embodiment of the present invention . a client 410 establishes a connection to nnrp server 450 having a server table 415 . the server table 415 contains entries including locations from where to retrieve articles , locations to which articles should be posted , identification information , formats of how articles are displayed to clients , and client profiles . the server table 415 has links 417 to database tables : group table 420 , group to article table 425 , and article table 430 . in one embodiment , a virtual community is established by defining an identification for the virtual community and a group identification for clients ( e . g ., client 410 ) within the virtual community . as such every group will have a row 421 in the group table 420 that establishes which groups are available for a given virtual community . the community identification together with the group identification form a unique set that establishes what articles will be available to users in that community . the group to article table 425 provides a link between the groups and the articles to be provided for that group . the article table 430 provides a listing of the actual articles on nnrp server 450 . fig5 illustrates software components for a nnrp server 505 according to another embodiment of the present invention . the software components include three databases : a network news transfer protocol ( nntp ) database ( db ) 510 , a configuration database 520 , and a local object manager ( lom ) database 530 . the nntp database 510 stores , the links between the groups and articles , the list of articles available to the communities , and the virtual server information similar to that discussed above for server table 415 of fig4 . a news database class library 515 provides the software routines through which new database 510 may be accessed . in one embodiment , the news database class library 515 is an open api that allows server administrators to develop custom news agent program modules to access the underlying news database 515 . the configuration database 520 stores configuration information that determines how the nntp database information will be interpreted by the agents ( e . g ., the nnrp agent ). the configuration database 520 also includes a configuration database class library 525 which acts as an interface to the underlying configuration database 520 information . the lom database 530 stores the group articles , tracks the multiple caches used to store articles , and stores data that enables client access to the nnrp server . access to lom 530 is provided by local object class library 537 . in one embodiment , the databases are modular such that new applications can be inserted on nnrp server to access the underlying databases . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the invention as set forth in the appended claims . the specification and drawings are , accordingly , to be regarded in an illustrative rather than a restrictive sense . | 7 |
before the description of the present invention proceeds , it is to be noted that like parts are designated by like reference numerals throughout the accompanying drawings . referring now to the drawings , there is shown in fig1 ( a ) the main portion of an image forming apparatus or electrophotographic copying machine to which a developing apparatus according to the present invention may be applied . in fig1 ( a ), generally at the central portion of the copying machine , there is rotatably provided a photosensitive drum or photoreceptor drum 100 so as to be driven for rotation counterclockwise as indicated by an arrow f . around said drum 100 , there are sequentially disposed various components or processing stations such as a charging unit or corona charger 102 , a developing unit 103 directly related to the present invention , a transfer unit 104 , a separating unit 105 , a cleaner 106 and an eraser lamp 107 . these components referred to above are in a specified arrangement , and sequentially controlled by a micro - computer ( hereinafter referred to as &# 34 ; cpu &# 34 ;) 201 to be described later ( fig7 ). the photosensitive drum 1 is drivingly rotated counterclockwise at a system speed of s mm / s . when the cpu 201 starts up a high - voltage unit hv1 , a high voltage charging output vo is applied to a wire electrode 102a of the charging unit 102 , which in turn uniformly charges the photosensitive surface 100a of the drum 100 . the surface 100a of the drum 100 is exposed to light m having image data through an optical system 101 , whereby an electrostatic latent image is formed on said surface 100a of the drum 100 . the latent image is then converted to a toner image by the developing unit 103 . the toner image is transferred by the transfer unit 104 onto paper p which is transported at the system speed s mm / s by being forwarded by a timing roller 110 driven in timed relation with the exposure of the drum 100 . more specifically , the cpu 201 causes a high - voltage unit hv2 to apply a high voltage v1 to a wire electrode 104a of the transfer unit 104 , which produces static electricity for attracting the toner image onto the paper p . the paper p bearing the transferred toner image thereon is separated from the drum 100 by the separating unit 105 , and thereafter is conveyed to a fixing device 111 where the toner is fixed to the paper p . on the other hand , the toner remaining on the surface 100a of the drum 100 is scraped off by the cleaner 106 . the residual charges are erased by being illuminated by the eraser lamp 107 . the image forming cycle as described above is repeated . in fig1 ( b ) and 2 , there is shown on an enlarged scale , the improved developing apparatus 103 according to one preferred embodiment of the present invention , which generally includes essential portions as follows contained in a casing 1 thereof . the developing apparatus 103 is so arranged that , while circulating and transporting a two or dual - component developing material composed of toner and carrier by the developing material circulation / transport section 3 ( referred to merely as transport section 3 hereinafter ), it supplies part of the developing material to the developing section 2 for the development , and replenishes toner corresponding in amount to the consumed toner , to the transport section 3 from the toner accommodating section 6 through the toner replenishing section 7 . the developing section 2 includes a developing sleeve 21 made of a non - magnetic electrically conductive material ( e . g . aluminum ) in a cylindrical shape in which a magnet roller 22 is incorporated , and formed , on its outer peripheral face , with very small convex and concave portions or undulation , for example , by blasting finish , and is rotatably disposed to confront the photosensitive surface 100a of the photoreceptor drum 100 for rotation in a direction indicated by an arrow e as shown . the transport section 3 includes a developing material mixing and stirring transport passage 31 and a developing material supply transport passage 32 which are formed by curving the bottom portion of the casing 1 and communicated with each other through paths 33a and 33b formed at opposite ends of a partition plate 33 rising from the bottom portion of the casing 1 ( fig2 ). the transport passage 32 is directed in a parallel relation to the developing sleeve 21 , and accommodates a bucket roller 4 therein . the bucket roller 4 includes a pair of spaced support plates 41 in a hexagonal shape ( only one support plate 41 is shown ), a plurality of beams or bucket plates 42 bridging respective corresponding sides of the support plates 41 , a large number of blades or vanes 43 provided inside the buckets 42 , and a support shaft 44 extending through the interior of the roller 4 for rotation of said bucket roller 4 in a direction indicated by an arrow b . the other transport passage 31 is adapted to be slightly inclined so as to be lower than the transport passage 32 at the left side , but higher than said passage 32 at the right side in fig2 . generally , at the central bottom portion of the transport passage 31 , there is mounted a toner concentration detecting sensor 9 which is a magnetic sensor as also shown in fig3 and the upper surface 91 of said sensor 9 is arranged to lie on generally the same plane as inner surface of the transport passage 31 so as not to obstruct a smooth flow of the developing material transported through the transport passage 31 . it is to be noted here that the toner concentration detecting sensor 9 is intended to detect the concentration of the toner contained in the developing material transported through the transport passage 31 , as a variation of permeability , and the sensor output thereof is arranged to be applied to a control device to be described later . incidentally , the sensor characteristic of the toner concentration detecting sensor 9 , i . e . toner concentration ( wt %) vs . sensor output voltage ( v ) characteristic is set in a relation as shown in fig4 and in the present embodiment , the reference concentration as a judging standard is set to be 7 . 0 wt %, with the corresponding sensor output voltage being set at 2 . 5 v . moreover , in the transport passage 31 , there is rotatably mounted a developing material transport roller 5 ( referred to merely as a transport roller 5 hereinafter ) for rotation at a constant period ( 300 m sec .) in a direction indicated by an arrow a . as is most clearly seen in fig3 the transport roller 5 includes a support shaft 50 and a blade member 51 fixedly mounted thereon , and said blade member 51 is fitted with a large number of transport vanes 52 except for its portion corresponding to a toner concentration detecting area so at which the upper sensor surface 91 of the toner concentration detecting sensor 9 is located . at the above portion corresponding to the detecting area so , a developing material exchanging means 53 is provided instead of the transport vanes 52 . the developing material exchanging means 53 referred to above includes a scrape - up member 54 integrally attached to the blade member 51 in the axial direction , and a cleaning member 55 , for example , of polyester film of 0 . 05 mm in thickness fixed to said scrape - up member 54 . as shown in fig5 dimensions at respective portions are set in such relation as r1 & gt ; l & gt ; r2 , where l represents a distance between the center of the support shaft 50 and the upper sensor surface 91 , r1 denotes a distance between the center of the shaft 50 and the forward end of the cleaning member 55 , and r2 shows a distance between the center of the shaft 50 and a forward end of the scrape - up member 54 . by the above setting , as the transport roller 5 rotates , the cleaning member 55 rubs against the upper sensor surface 91 , thereby preventing toner from adhering to the sensor surface 91 . the toner accommodating section 6 includes a replenishing toner hopper 61 formed by partitioning the casing 1 at the rear portion of the transport passage 31 , a stirring device 62 provided in the toner hopper 61 , and a tone cartridge 63 preliminarily filled with replenishing toner and detachably mounted on the toner hopper 61 for supplying the replenishing toner into the hopper 61 . the toner replenishing section 7 is provided between the transport passage 31 and the toner accommodating section 6 , and is separated from said passage 31 by a partition wall 35 . in the toner replenishing section 7 , there is provided a replenishing roller 71 , which includes a support shaft 72 and a transport blade 73 spirally wound around said shaft 72 , and is rotatably provided in a replenishing passage 74 located at the bottom portion of the hopper 61 for rotation in the direction of an arrow d . as shown in fig2 the replenishing passage 74 is communicated , at its left side , with said transport passage 31 through a toner replenishing inclined surface 75 , which has an angle equal to or larger than an angle of repose for toner so as to facilitate flow of the toner . hereinbelow , movement of the developing material in the developing apparatus of the present invention having the construction as described so far will be explained . the toner replenished into the toner hopper 61 of the toner accommodating section 6 is transported through the replenishing passage 74 in the direction of the arrow d based on the rotation of the replenishing roller 71 in the direction of the arrow d , while being agitated by the stirring device 62 , and is fed to an upstream side of the transport passage 31 as it is guided by the inclined face 75 shown at the left side in fig2 . the toner thus fed to the transport passage 31 is transported through said passage 31 in the direction of the arrow a by the transport vanes 52 based on the rotation of the transport roller 5 , together with the developing material fed from the neighboring passage 32 via the path 33b , and passes through the toner concentration detecting region so located approximately at the central portion so as to be transported to the inner side end portion ( fig3 ). the developing material transported to the toner concentration detecting region so is raised in the direction of the arrow a based on the rotation of the pick - up member 54 and the cleaning member 55 of the developing material exchanging means , and upon arrival at a predetermined level , spontaneously falls onto the sensor surface 91 , and thus , smoothly passes through the region so without staying thereat , owing to depression by the developing material successively fed , and also based on the scraping function of the transport vanes 52 located at the downstream side of the region so . the developing material which has reached the inner side end portion of the transport passage 31 through the toner concentration detecting region so , is displaced into the transport passage 32 from the path 33a as it is guided by the inclined surface 34 . the developing material thus fed into the transport passage 32 is transported by the vanes 43 in the direction of the arrow b , based on the rotation of the bucket roller 4 in the direction of the arrow b , and upon arrival at the forward side end portion , is again fed into the passage 31 by a scoop - up plate 45 ( fig2 ) so as to be transported in the direction of the arrow a within the transport passage 31 . it is to be noted here that , during transportation through the transport passage 32 , part of the developing material is scooped up by the buckets 42 so as to be supplied onto the outer surface of the developing sleeve 21 . the developing material thus supplied onto the outer peripheral surface of the developing sleeve 21 is held thereon along the magnetic lines of force of the magnet roller 22 in a state of a magnetic brush , while it is transported in the same direction based on the rotation of the developing sleeve 21 in the direction of the arrow e , and rubs against an electrostatic latent image formed on the photosensitive surface 100a of the photoreceptor drum 100 at a developing region x ( fig1 ( b )) for developing the latent image into a visible toner image . meanwhile , the developing material which has passed through the developing region x is further transported over the developing sleeve 21 in the direction of the arrow e , and upon arrival at the portion confronting the bucket roller 4 where the neighboring magnetic poles of the same polarity ( s pole ) form a repelling magnetic field , is disengaged from the surface of the magnetic sleeve 21 and taken into the developing material in the transport passage 32 so as to be again transported in the direction of the arrow b . incidentally , in the toner concentration detecting sensor 9 , the sensor surface 91 is periodically cleaned by the cleaning member 55 , and in that case , since the developing material is increased in its density as it is depressed onto the sensor surface 91 by the cleaning member 55 , noises n in the peak form periodically appear in the sensor output waveforms as shown in fig6 . however , owing to the fact that , since the toner is accumulated on the sensor surface 91 in a natural state , between the noises n , the output waveforms form a comparatively flat stable region f . therefore , in order to detect the toner concentration of the developing material , it is necessary to sample the sensor output in said stable region f , and for this purpose , a toner concentration detecting mechanism as described hereinbelow is provided . hereinbelow , the toner concentration control mechanism and its functioning will be described together with the general operation of the copying apparatus provided with the developing apparatus according to the present invention . in fig7 showing part of the circuit construction of a control circuit for the copying apparatus provided with the developing apparatus according to the present invention , there is provided the cpu ( central processing unit ) 201 coupled with the toner concentration detecting sensor 9 through a terminal a9 , and having output terminals a1 , a2 , a3 , a4 , a5 , a6 and a7 which are respectively connected to driving switch transistors ( not shown ) of a main motor m1 for driving the photoreceptor drum , a developing motor m2 for driving the developing sleeve , a timing roller clutch cl1 , a paper feeding clutch cl2 , a corona charger hv1 , a transfer charger hv2 , and a toner replenishing motor m3 , and another output terminal a8 connected to a power source circuit ( not shown ). a ram 202 backed up by a battery is connected to the cpu 201 through a data bus . the toner concentration detecting sensor 9 is intended to detect magnetic permeability in the developing material based on a signal outputted from an oscillator 93 , and arranged to replace variation of the magnetic permeability by inductance variation of a coil so as to output the signal thereof to a phase comparator 94 , which applies said signal to an a / d port of the cpu 201 in the form of an analog signal shown in fig6 via a capacitor 95 through the terminal a9 . the inputted sensor output signal is converted into a digital signal by an a / d converter ( not shown ) so as to be stored in said ram 202 and properly taken out therefrom for being subjected to data processing . in a flow - chart of fig8 for a main routine showing the processing procedures of the copying apparatus on the whole , upon turning on the power source , the control device is initialized at step s1 , and 1 - routine timer is started at step s2 , thereby to execute the processing of the main routine at each set time ( per 10 m sec . in the present embodiment ). the atdc input routine is the process for detecting the toner concentration of the developing material based on the sampling data in the stable region f of the output waveform shown in fig6 according to the signal applied from the toner concentration detecting sensor 9 to the cpu 201 , and details of said process will be described later . in the subsequent step s5 , a copying function control routine is executed . this routine relates to a process in which the copying function is executed by driving the main motor m1 , etc . according to a time - chart shown in fig1 , while toner is supplied to the developing apparatus based on the result of detection of the toner concentration obtained by said atdc routine . at step s6 , it is judged whether or not the 1 - routine timer set at step s2 is completed , and if it is completed , the procedure returns to step s2 again so as to start the 1 - routine timer once more . this routine is intended to detect the toner concentration at the stable region f on the basis of five continuous sensor output sampling data applied from the toner concentration detecting sensor 9 to the cpu 201 and further converted into the digital signal per each 1 - routine timer ( 10 m sec .). in the first place , at step s31 , it is checked whether or not a flag for sampling the data from the sensor output is set . more specifically , in the series of the copying functions shown in fig1 , it is judged whether or not the flag is set at the data sampling time . if the flag has been set , the step proceeds to step s32 , while on the contrary , if the flag has not been set , the procedure jumps to step s38 without effecting subsequent steps for returning to the main routine . as shown in fig1 , at step s32 , sampling data di1 ˜ di5 ( fig1 ) stored in the addresses are of the ram 202 are successively called out , and sampling data di2 ˜ di5 stored in the addresses b , c , d and e are respectively moved into the addresses a , b , c and d . then , at step s33 , as shown in fig1 , a fresh sampling data di6 inputted to the cpu 201 from the sensor 9 after 1 - routine timer ( 10 m sec .) and further subjected to a / d conversion is memorized in the address e . subsequently , at step s34 ( first calculating means ), maximum value max . and minimum value min . are detected from the five sampling data di2 to di6 stored in the addresses a to e to judge whether or not a difference therebetween represented by | max - min | is within a reference value δ at step s35 second calculating means . it is to be noted that , in the present embodiment , the reference value δ is set at 0 . 05 v . in the case where the relation is | max - min |& lt ; δ , it is judged that the sampling data di2 to di6 are those derived from the stable region f . on the contrary , if the relation is | max - min |& gt ; δ , the data di2 to di6 are found to be those derived from the noise n portion . thus , if the relation is | max - min |& lt ; reference value δ , i . e . if the sampling data are those from the stable region f , the procedure proceeds to step s36 , while on the contrary , if the sampling data are those from the noise n portion , the procedure jumps to step s38 without effecting the subsequent steps s36 and s37 for returning to the main routine . at step s36 , the average value dav of the five sampling data di2 to di6 for the addresses a to e is calculated , and at subsequent step s37 , a fresh average value dav is stored in the ram 202 to replace the old value , so as to return to the main routine at step s38 . this routine shown in fig1 is the process which controls the copying function , and also executes the toner replenishing function . the timing - chart in fig1 represents the state of functioning at essential portions of the copying apparatus . at block 1 in fig1 , upon turning on of a print sw , the main motor m1 for driving the photoreceptor drum 100 , developing motor m2 for driving the developing device , corona charger hv1 , transfer charger hv2 , paper feeding clutch cl2 are respectively caused to function , while copy flag indicating that the copying function is under way is set to &# 34 ; 1 &# 34 ;, with the timers ta and tb for the control being started . at block 2 , completion of said timer ta is judged so as to turn off the paper feeding clutch . at block 3 , the timer tb is checked for completion , thereby to turn on the scan clutch cl3 of the scan motor for driving the scanning optical system for starting the scanning function . at block 4 , the timing roller clutch cl1 is turned on upon output of a timing signal owing to actuation of the timing switch during the scanning operation , and also , processing to set the timer tc is effected , while the copy paper sheet is transported in synchronization with the image formed on the surface of the photoreceptor drum 100 . meanwhile , block 5 represents a process for executing the toner replenishing function . in the first place , at step s50 , data sampling flag and a timer te for the data sampling are set . it is to be noted here that in the present embodiment , the timer te is set at 300 m sec ., which value is in agreement with the period in which the screw roller 5 is rotated , and also that , since 1 - routine timer is set at 10 m sec . as described earlier , 30 pieces of data are to be sampled during the time . at step s51 , it is checked whether or not the data sampling flag is set , and if it is set , the procedure proceeds to the next step s52 , while if it is not set , the step jumps to step s54 . thus , at step s52 , judgement is made as to whether or not the sensor output average value dav for the stable region f as calculated by atdc input routine is above 2 . 5 v . if it is judged that the relation is sensor output average value ( dav )& gt ; 2 . 5 v , i . e . the toner concentration is below the reference concentration , the toner is insufficient , and therefore , the procedure proceeds to the next step s53 to effect toner replenishment . on the other hand , if the relation is not found to be sensor output average value ( dav )& gt ; 2 . 5 v , i . e . the toner concentration is above the reference concentration , sufficient amount of the toner is present , without necessity for toner replenishment , and the procedure proceeds to step s54 . at step s53 , the toner replenishing motor m3 is started to supply the toner within the toner hopper 61 into the transport passage 31 , and simultaneously , the timer td for the driving time of the toner replenishing motor m3 is started . subsequently , at step s54 , judgement is made as to whether or not the timer td is completed , and if it is completed , the toner replenishing motor m3 is stopped at step s55 , while if it is not completed , the procedure proceeds to step s56 . at step s56 , it is checked whether or not the data sampling timer te is completed , and if said timer is completed , data sampling flag is reset at step s57 , while if it is not completed , the procedure proceeds to the next block 6 in the state as it is . in block 6 , the timer tc is checked for completion , and if it is , the corona charger hv1 , scanning clutch cl3 and timing roller clutch cl1 are respectively turned off . it is to be noted here that the timer tc may be set as variable according to sizes of the copy paper sheets , etc . in block 7 , when a fixed position switch ( not shown ) is turned on upon restoration of the optical system back to the fixed position following the returning function , the developing motor m2 , and transfer charger hv2 are respectively turned off , and with the copy flag set to &# 34 ; 0 &# 34 ;, the processing to set the timer tf is effected . in block 8 , the timer tf is checked for completion , and if it is , the main motor is turned off to return to the main routine . as is clear from the foregoing description , according to the developing apparatus of the present invention , there are provided the developing material exchanging means for periodically exchanging the developing material on the surface of said detecting sensor , and the toner concentration detecting mechanism or discriminator for reading the output data of the toner concentration detecting sensor only when the output of the detecting sensor is stabilized . accordingly , although the output signal of the toner concentration detecting sensor is periodically varied as it is affected by the developing material exchanging means , the signal waveform thereof is stabilized as a whole . moreover , since the output at the stable region of the output waveform accurately reflects the actual toner concentration , and the toner concentration is detected from the output value at this portion by the discriminator , it is possible to correctly measure the toner concentration of the developing material . accordingly , the toner concentration of the developing material can be maintained at a proper value to obtain images at a high quality under a stable state . furthermore , soiling within the apparatus due to excessive toner can be prevented for maintaining favorable circumstances . although the present invention has been fully described by way of example with reference to the accompanying drawings , it is to be noted here that various changes and modifications will be apparent to those skilled in the art . therefore , unless otherwise such changes and modifications depart from the scope of the present invention , they should be construed as included therein . | 6 |
fig1 shows a filter 20 for filtering a fluid as shown at incoming arrow 22 , e . g . air or other fluids . in the case of air , the filter is an air cleaner including a cylindrical housing 24 extending axially along an axis 26 and having a tangential inlet 28 and having an outlet 30 , fig2 for discharging clean filtered air as shown at arrow 32 , and for example as shown in u . s . pat . no . 6 , 958 , 083 , incorporated herein by reference . an annular filter element 34 in the housing receives dirty air from inlet 28 and delivers clean filtered air to outlet 30 . air entering housing 24 through tangential inlet 28 as shown at arrow 22 flows along an interior surface 36 of housing 24 in a helical spiral pattern and then flows through filter element 34 including first and second subelements 38 and 40 , to be described , into hollow interior 42 and then flows axially leftwardly in fig2 through outlet 30 as shown at arrow 32 . housing 24 is typically a two - piece plastic assembly provided by an upper housing section 44 and a lower housing section 46 , as in the noted incorporated &# 39 ; 083 patent , and joined by a twist and lock structure 48 , for example as shown in u . s . pat . no . 6 , 402 , 798 , incorporated herein by reference . lower section 46 may have a dust ejection purge valve 50 for periodically discharging collected particulate due to the precleaning provided by the centrifugal separation afforded by the noted helical pattern , as is known , for example in the noted incorporated &# 39 ; 083 patent . a pressure tap 52 may be provided at outlet 30 for monitoring the pressure thereat , for in turn monitoring pressure drop across the filter , as is known . filter element 34 , fig2 , extends axially along axis 26 between distally opposite first and second axial ends 54 and 56 . the filter element includes a first subelement 38 having a first flow path 58 therethrough from a first upstream face 60 to a first downstream face 62 , and a second subelement 40 having a second flow path 64 therethrough from a second upstream face 66 to a second downstream face 68 . each subelement is preferably an annular member , and subelement 38 may taper slightly radially inwardly as it extends axially rightwardly in fig2 , and subelement 40 may be a frusto - conical member tapering radially inwardly as it extends axially leftwardly in fig2 . flow paths 58 and 64 are in parallel with each other from inlet 28 to outlet 30 . second flow path 64 has an upstream portion 70 , fig2 - 4 , flowing axially rightwardly at 72 along the noted first upstream face 60 then radially inwardly at 74 along the noted first axial end 54 of the filter element then axially leftwardly at 76 along the noted second upstream face 66 . the flow at 72 is between the filter element and an annular flange 78 extending axially leftwardly from the axial end 80 of housing section or cover 46 . the flow at 74 is between the axial end 54 of the filter element at endcap 82 and axial end 80 of housing cover section 46 , with guide structure provided along path 74 , to be described . the flow at 76 is into hollow interior 84 of subelement 40 . first and second downstream faces 62 and 68 face each other . first and second upstream faces 60 and 66 face away from each other . first flow path 58 through first subelement 38 is along a first direction , namely radially inwardly . second flow path 64 through second subelement 40 is along a second direction , namely radially outwardly . the noted second direction is opposite to the noted first direction . first and second downstream faces 62 and 68 face each other across a common gap 88 preferably along a rectilinear line therebetween . first and second flow paths 58 and 64 merge with each other in gap 88 . upstream portion 70 of second flow path 64 defines a u - shape around common gap 88 . the u - shape has first and second legs 72 and 76 and a bight 74 therebetween . first leg 74 is radially spaced from common gap 88 by first subelement 38 therebetween . bight 74 is axially spaced from common gap 88 by axial end 54 of the filter element therebetween . second leg 76 is radially spaced from common gap 88 by second subelement 40 therebetween . in the construction of fig2 - 4 , endcap assembly 82 at first axial end 54 has radial guide channels therealong providing radial flow passages at 74 from first upstream face 60 to second upstream face 66 . first and second subelements 38 and 40 are attached to each other with a common endcap 82 , e . g . urethane or the like , providing the noted endcap assembly . the endcap assembly includes a plurality of axially extending standoffs 92 providing a respective plurality of radial flow passages 90 therebetween . the endcap assembly may also include a plurality of radially extending standoffs 94 providing a respective plurality of axial flow passages 96 therebetween from first upstream face 60 to the plurality of radial guide channels 90 . the endcap assembly may further include a plurality of grooves 98 along axial flow passages 96 for additional axial flow . fig5 - 6 show another embodiment and use like reference numerals from above where appropriate to facilitate understanding . the noted endcap assembly includes a perforated cage 100 extending from the noted first axial end 54 . the perforated cage includes a sidewall 102 extending axially and radially along a taper from first axial end 54 . the flow path at 74 passes through the perforations or openings or louvers or slots 104 of the cage as shown at 106 . in one embodiment , each of subelements 38 and 40 includes pleated filter media having a plurality of pleats in a closed loop having an outer perimeter defined by a plurality of outer pleat tips , and an inner perimeter defined by a plurality of inner pleat tips , for example as shown by the following incorporated u . s . pat . nos . 6 , 261 , 334 ; 6 , 383 , 244 ; 6 , 391 , 076 ; 6 , 416 , 561 ; 6 , 511 , 599 ; 6 , 641 , 637 . in one embodiment , common endcap 82 spans radially across the entire axial end of each subelement and covers the inner and outer pleat tips of each , fig4 , 6 . in another embodiment , fig7 , which uses like reference numerals from above to facilitate understanding , common endcap 82 a covers the inner pleat tips 110 of first subelement 38 and the outer pleat tips 112 of second subelement 40 , but not the outer pleat tips 114 of first subelement 38 nor the inner pleat tips 116 of second subelement 40 . common endcap 82 a has an outer perimeter 118 less than the outer perimeter of outer pleat tips 114 of first subelement 38 . common endcap 82 a has an inner perimeter 120 greater than the inner perimeter of inner pleat tips 116 of second subelement 40 . this embodiment enables use of alternate pleat sealing as in the above noted incorporated patents , including u . s . pat . no . 6 , 391 , 076 , allowing the ends of the filter to have open pleat tips , including the end of the outer subelement 38 , to reduce restriction to flow around the axial end of the filter element at 74 , which in turn reduces overall restriction and increases the utilization of subelement 40 . the other axial end of second subelement 40 at 118 is closed by endcap 120 which may likewise only extend partially along the axial ends of the pleats to again take advantage of the noted alternate pleat sealing technology of the noted incorporated patents , though endcap 120 may extend radially across the entire span between the inner and outer pleat tips of subelement 40 . in the foregoing description , certain terms have been used for brevity , clearness , and understanding . no unnecessary limitations are to be implied therefrom beyond the requirement of the prior art because such terms are used for descriptive purposes and are intended to be broadly construed . the different configurations , systems , and method steps described herein may be used alone or in combination with other configurations , systems and method steps . it is to be expected that various equivalents , alternatives and modifications are possible within the scope of the appended claims . | 1 |
[ 0028 ] fig1 shows an example of how the invention can be implemented in a mobile telephone 1 , which can be e . g . a umts phone or a gsm phone having a high data rate due to e . g . edge ( enhanced datarates for gsm evolution ). it could also be a damps phone , or it could be a short range radio link device , such as a bluetooth device . many of the components shown in fig1 are well known standard components of a mobile telephone . a radio connection to a base station ( not shown ) is established through an antenna 2 connected to the radio transmitter / receiver circuit 3 . the radio circuit 3 is connected to a digital signal processor ( dsp ) 4 , which may include , or may be integrated with , a micro controller controlling all the functions of the mobile telephone 1 . the dsp also includes an audio coder / decoder circuit 5 . when the telephone 1 is used for a normal telephone conversation with a remote party , the radio signals received by the radio circuit 3 are processed by the dsp 4 , and audio signals are decoded by the audio codec 5 and converted into analog audio signals in the digital - to - analog converter 6 . these audio signals are then sent to the loudspeaker 7 so that the user of the telephone can listen to the voice of the other party . alternatively , the audio signals are sent through an interface connector 8 to an external loudspeaker ( not shown ) in e . g . a headset connected to the telephone . the other way round , the voice of the user is picked up by the microphone 9 , and the analog audio signals therefrom are converted into digital signals in the analog - to - digital converter 10 . these digital audio signals are then coded according to the protocol used by the phone in the audio codec circuit 5 and transmitted through the radio circuit 3 and the antenna 2 to the base station and eventually to the remote party . instead of the built - in microphone 9 an external microphone in e . g . a headset connected to the interface connector 8 can be used . in another embodiment the digital - to - analog and analog - to - digital converters may be integrated together with the dsp . a keyboard 11 , which can be used for entering telephone numbers , messages , etc , is also connected to the processor 4 . this is also the case for a display 12 provided for the presentation of information to the user of the telephone . this information could be numbers or messages entered by means of the keyboard 11 , or it could be information received by the telephone through the antenna 2 . a memory 13 is provided for the storage of data , including messages picked up by the microphone 9 or received through the antenna 2 . stored messages can be replayed through the loudspeaker 7 or transmitted to a remote party through the antenna 2 . the stored messages could also be audio files in the form of e . g . music , or they could be video clips . as will be seen in fig1 the dsp 4 also includes a video coder / decoder circuit 14 . the video circuit could also be located in a separate dsp . if the radio signals received by the radio circuit 3 comprise digital coded video signals , they will be decoded in the video codec 14 similar to the decoding of audio signals in the audio codec 5 . the decoded video signals may be sent as digital video signals ( according to one of the many existing protocols for digital video signals ) to a digital video out terminal on the interface connector 8 , from where they may be connected to a digital video display unit which , however , must be prepared for digital video signals according to the same protocol . the digital video signals may also be used as input signals to the display 12 . according to the invention the decoded video signals from the video codec 14 are connected to a digital - to - analog converter 15 in which they are converted into analog video signals . these analog video signals are then modulated in the modulator 16 to form a standard video signal , such as a pal , secam or ntsc signal , all of which are well - known television standards . each of these standards covers large areas of the world , and within a certain area all television receivers are arranged to accept one of the standards . as an example any colour television receiver in the united states of america can receive an ntsc signal . therefore , the provision of a standard analog video signal on the interface connector of a mobile telephone means that any normal television receiver can be used as a display unit for the video signals received by the phone . in the situation described above the video signals , which were converted into analog video signals and provided on the analog video out terminal , were received through the antenna 2 and the radio circuit 3 . however , also digital video signals stored in the memory 13 may be converted and provided on the analog video out terminal . similarly , analog video signals in a standard television format may be received on an analog video in terminal on the interface connector 8 from a normal video camera or recorder . these analog input signals are demodulated in the demodulator 17 and converted into digital video signals in the analog - to - digital converter 18 . the digital video signals can then be coded in the video codec 14 and transmitted through the radio circuit 3 and the antenna 2 to a remote location , or they can be stored in the memory 13 . above , the mobile telephone is described as being prepared for digital video input signals as well as digital video output signals on the interface connector , but it should be noted that it could also be arranged to have only digital video input signals or only digital video output signals . as an alternative to the standard television signals ( e . g . pal , secam or ntsc ) described above a different embodiment is shown in fig2 . here an rgb modulator 21 is used instead of the modulator 16 in fig1 . the rgb modulator 21 provides three separate signals for the colours red , green and blue , respectively , and this type of signal is accepted as an input signal by most computer monitors , and virtually any computer monitor can be used as a display unit for the mobile telephone . similarly , rgb input signals can be accepted by the rgb demodulator 22 , thus allowing any camera having an rgb output to be used as an input device for the phone . [ 0038 ] fig3 shows an example of how an analog video output signal according to the invention can be used . the mobile telephone 1 is connected to a television receiver 25 through a cable 26 and the analog video out terminal of the interface connector 8 . through the antenna 2 the telephone 1 is in radio contact with a base station 27 , and the telephone may thus be connected via a gsm network 28 ( prepared for edge ) to the internet 29 and a server 30 connected thereto . a video sequence stored in the server 30 may now be transmitted to the telephone 1 in which it is treated as described in relation to fig1 and analog video signals in e . g . pal , secam or ntsc format are sent from the analog video out terminal of the interface connector 8 to the television receiver 25 . thus the video sequence from the server 30 is received by the phone 1 and shown directly on the normal standard television receiver 25 . the television receiver 25 can of course be replaced by a standard video recorder so that the video sequence can be recorded for later presentation . if the analog video output of the phone is an rgb output as shown in fig2 a standard computer monitor could be used instead of the television receiver 25 . instead of the video sequence stored in the server 30 , the telephone 1 could also be connected through the gsm network 28 to another mobile telephone connected to a video camera so that video signals from this camera are transmitted directly to the phone 1 and shown on the television receiver 25 . as mentioned earlier , the analog video output signal may also be generated from data stored in the memory 13 of the mobile telephone 1 instead of data received through the antenna 2 . thus , as an example , a video sequence can be downloaded to the memory 13 of the phone and then viewed on the television receiver connected to the phone at a later time . during normal use of the mobile phone 1 the display 12 is often used , e . g . for displaying messages , wap ( wireless applications protocol ) browsing , e - mail reading or the use of pim ( personal information management ) . with the analog video output signal according to the invention these uses can be enhanced , because the information showed on the display 12 of the phone can now also be presented on a standard television receiver for better viewing . [ 0042 ] fig4 shows an example of the use of an analog video input signal according to the invention . a standard video camera 31 having a normal analog video output terminal is connected through a cable 32 to the analog video in terminal of the interface connector 8 . in the mobile telephone 1 the analog video signals ( in e . g . pal , secam or ntsc format ) received from the camera 31 are converted into digital video signals and transmitted through the antenna as described earlier . in the example shown the signals are transmitted via the base station 27 , a gsm network 28 and the internet 29 to a server 30 connected to the internet 29 , but the destination could also be e . g . another mobile phone connected to the gsm network 28 . instead of transmitting the signals from the mobile telephone 1 , they could also be stored in the memory 13 for later transmission or presentation on a television receiver connected to the analog video out terminal as described above . the camera 31 can of course be replaced by any other device generating a standardized video signal , such as a video recorder replaying a recorded video sequence . again the analog video signals could also be in an rgb format . finally , fig5 shows an example in which the analog video input signal and the analog video output signal of the mobile telephone 1 are both used at the same time . a standard television receiver 25 and a standard video camera 31 are both connected to the interface connector 8 via cables 26 and 32 . through the gsm network 28 the phone 1 is connected to another mobile telephone 33 , which is also connected to a television receiver 34 and a camera 35 . in this way it is possible to perform a video - conference between the two locations using standard video cameras and standard television receivers together with the two mobile telephones . although a preferred embodiment of the present invention has been described and shown , the invention is not restricted to it , but may also be embodied in other ways within the scope of the subject - matter defined in the following claims . | 7 |
referring now to fig1 - 5 , pictorially and schematically illustrating the method transferring a visual and textural design to an uncured concrete surface of a concrete mixture utilizing a decorative finishing tool . the preferred method utilizes a decorative finishing tool to implement a pattern on the exposed surface of the concrete . as a result , the concrete is given an aesthetically pleasing appearance having various depths , sizes , diameters , and length within the contours of the texture thereby resembling natural patterns such as wood grain , or lightly finished cut or honed stone . additionally , such contours and designs conceal imperfections and irregularities from the concrete surface . the preferred method commences by preparing the concrete surface . in this regard , the initial step comprises preparing the subgrade 10 to a desired elevation and grade . the subgrade 10 layer of a pavement is , essentially , the native material underneath the pavement . it is also known as the “ formation level ”, which can be defined as the level at which excavation ceases and construction starts , therefore it is the lowest point of the pavement structure . generally , a subgrade 10 requires some basic preparation for adaptation for construction purposes , this process is known as ‘ subgrade formation ’ or ‘ reducing to level ’. such preparation preferably comprises compacting the subgrade 10 to approximately 90 % compaction . subsequent to being compacted , the subgrade 10 is preferably covered with a layer of clean , moist fill sand 12 which is preferably maintained at a minimum four inch thickness . although the fill sand 12 is not absolutely necessary for the method of producing the decorative concrete surface of the present invention , it is highly desirable to control the hydration process of the concrete . in order to increase the resultant strength of the concrete and reduce subsequent cracking of the same , reinforcement members 14 such as wire mesh or rebar is / are positioned upon the layer of fill sand 12 . with the reinforcement members 14 in place , a concrete mix or mixture 16 is poured over the layer of fill sand 12 and the reinforcement members 14 such that the reinforcement members 14 are encapsulated therewithin . the concrete mixture 16 is poured to approximately a three and one - half to four inch thickness . although variations in the concrete mixture 16 are clearly contemplated , a preferred concrete mixture 16 comprises 70 % sand and 30 % three - eighth inch mean diameter aggregate combined with six sack cement ( two thousand pounds per square inch ) or seven sack cement ( three thousand pounds per square inch ). dependent upon individual desires , various color mixtures can be added to the concrete mixture 16 . the color of the concrete mixture 16 may be specifically selected to complement the overall design being implemented in the decorative pattern . it is contemplated that a variety of colors to enhance the effects of the decorative pattern 24 may be employed by the present invention . in the present embodiment of the invention , the decorative pattern 24 implemented on the concrete structure is similar to wood grain . therefore , the color of the cement mixture 16 may be reflective of wood , taking the color of brown or dark brown or a mixture of colors complementing the desired aesthetic appeal of the decorative pattern 24 . it is further contemplated that numerous colors may be employed at various stages of concrete preparation process to obtain varying shades of color if so desired . after the concrete mixture 16 has been poured , the same is preferably screeded to a desired level plane or grade . screeding is leveling and smoothing the top layer of the concrete mixture 16 , so the mixture 16 is the same height as the forms , or guides , that surround it . the screeding of the concrete mixture 16 results in the same defining a generally level or planar upper exposed surface 18 . therefore in order to facilitate the implementation of the decorative pattern , subsequent to screeding , the exposed surface 18 of the concrete mixture 16 is surfaced or finished with a conventional finishing tool to dispose a quantity of cement / fines paste derived from the concrete mixture 16 at the exposed surface 18 thereof . in the preferred embodiment , a vibrating metal bull float is utilized as the finishing tool . such vibrating metal bull floats are known in the art and are characterized by possessing an extremely smooth or polished surface which , in addition to bringing up the appropriate amount of cement / fines paste for the subsequent manipulative steps of the present invention , also tends to seal the exposed surface 18 of the concrete mixture 16 . it is contemplated that this initial finishing step may be completed through the use of a conventional bull float . a bull float consists of a trowel blade produced from a specially designed hollow section alloy extrusion with a convex profiled sole . typically , the blade angle is easily controlled to facilitate forward and backward movement by a blade pitch control . a bull float generally provides very accurate levels without the need for guiding rails . in the present embodiment , it is preferred that either a vibrating magnesium bull float or a vibrating aluminum bull float is utilized . a preferred metal bull float is sold under the trademark hal 200 by the lievers holland company . according to one aspect of the present invention , when the exposed surface is in the plastic state , fine sand 20 may be broadcast over the exposed surface 18 . the fine sand 20 may be of any given color or texture , as required by the decorative pattern 24 . further , it is contemplated that various combinations of color , texture , or other characteristics of the fine sand 20 may be selected in order to complement the decorative pattern 24 . it is contemplated that the present invention may be implemented upon a variety of concrete surfaces , including surface seeded exposed aggregate . therefore , in an exemplary embodiment of the present invention , a quantity of aggregate 22 may also be broadcast upon the exposed surface 18 of the concrete mixture 16 . when the exposed surface 18 of the concrete mixture 16 is still plastic , small size exposed aggregate 22 is broadcast over the exposed surface 18 . it is preferred that aggregates 22 be clean , hard , strong particles free of absorbed chemicals or coatings of clay and other fine materials that could cause the deterioration of concrete . the selection of aggregates 22 may impact the aesthetic appearance of the decorative pattern . in this regard , the aggregates 22 are selected to complement the overall visual and textural characteristics of the design pattern . as a result , a variety of techniques may be employed such that the aggregates 22 carry the desired visual and textural characteristics as required by the decorative pattern 24 . in an exemplary embodiment of the present invention , a benefaction process such as jigging or heavy media separation can be used to upgrade the quality of the aggregates 22 . in this regard , once processed , the aggregates 22 are handled and stored in a way that minimizes segregation and degradation and prevents contamination . aggregates 22 not only impact the aesthetic characteristics of concrete but also influence freshly mixed and hardened properties , mixture proportions , and economy of the concrete . it is preferred that the aggregate 22 comprise silica sand , glass bead , coarse sand ( e . g ., monterey aquarium coarse sand ), organic materials ( e . g ., sea shells ), metals , or composite materials . additionally , it is preferred that any aggregate 22 employed in the present invention be characterized by having a mean average diameter size of approximately one - eighth inch diameter , and further be characterized by possessing a generally rounded external surface configuration . such small size aggregate 22 is a substantial departure over prior art surface seeded exposed aggregates which typically comprise rock or gravel aggregate having average mean diameters of three - eighths of an inch or greater and are characterized by rough , jagged exterior surfaces . typically , the aggregate 22 is broadcast over the exposed surface 18 of the concrete mixture 16 by use of square point shovels and is applied at a preferred rate of approximately one pound per square foot of the exposed surface 18 of the concrete mixture 16 . it is preferred that the aggregate 22 should not initially depress below the exposed surface 18 of the concrete mixture 16 , but rather should be broadcast solely to cover the same . after being broadcast upon the exposed surface 18 of the concrete mixture 16 , the aggregate 22 is mixed or worked into the exposed surface 18 of the concrete mixture 16 , and more particularly is mixed into the quantity of cement / fines paste at the exposed surface 18 through the use of the above - described vibrating metal bull float . as indicated above , this vibrating metal bull float may comprise either a vibrating magnesium bull float or a vibrating aluminum bull float . this mixing of the aggregate 22 with the cement / fines paste at the exposed surface 18 derived during the previous vibrating metal bull float step is critical to the process of the present invention and insures that the aggregate 22 is fully embedded into the cement / fines paste , and thus thoroughly adhered or bonded to the exposed surface 18 of the concrete mixture 16 upon resultant curing . in order to maintain the design pattern , it is critical that the aggregate 22 is thoroughly bonded to the exposed surface 18 so that individual pieces of aggregate 22 are not dislodged and impacting the visual and textural effect of the decorative pattern . subsequent to the mixing of the aggregate 22 into the cement / fines paste at the exposed surface 18 of the concrete mixture 16 , the exposed surface 18 is finished with a decorative finishing tool 26 to implement the decorative pattern 24 upon the exposed surface 18 . a decorative finishing tool 26 is a concrete finishing tool that imprints a visual and textural decorative pattern 24 upon the exposed surface 18 of the concrete mixture 16 . it is contemplated that the decorative finishing tool 26 may be utilized upon any concrete surface . the decorative finishing tool 26 includes a blade 28 having first and second opposing sides 28 a , 28 b . the first opposing side 28 a is adapted to have a handle 30 or the like so that a user may easily navigate the decorative finishing tool 26 about the exposed surface 18 . it is contemplated that the first opposing side 28 a may carry an insert for employing conventional attachments known in the art such as broom handles and the like . it is further contemplated that the decorative finishing tool 26 may be adapted to work with existing trowels , floats , vibrating floats , and the like . the second opposing side 28 b is smoothed or troweled over the exposed surface 18 and imprints the design pattern 24 thereupon . the second opposing side 28 b is adapted in accordance with the parameters of the design pattern 24 so that the when the decorative finishing tool 26 is troweled over the exposed surface 18 , the blade 28 creates the visual and textural design impressions upon the exposed surface 18 . it is contemplated that a predetermined template of the design pattern 24 may be formed upon the second opposing side 28 b . in a preferred embodiment , the second opposing side 28 b includes a plurality of rods 32 disposed about the second opposing side . the rods 32 are positioned in accordance to the decorative pattern 24 and configured to create the pattern 24 in the exposed surface 18 . in the present embodiment , the decorative pattern 24 is that of wood grain . generally , natural wood grain finishes include the alignment , texture and appearance of wood fibers . the appearance of natural wood grain varies depending on the sought after look . for example , one wood finish may include grains which runs in a single direction along the cut wood , a product of a straight growing tree . in a second example , a spiral wood grain where grain which develops as the trunk of the tree twists in development may be the sought after look . in order to capture these varying looks , the rods 32 may be constructed so that each rod 32 is varying in linearity , depth , length , and diameter to provide a naturally looking finish . as further illustrated by fig3 and 4 , the rods 32 may be positioned so that there are varying spaces 32 between them which further creates natural finishes found in wood grains . it is contemplated that the rods 32 are rigidly affixed to the second opposing side 28 b so that the construction of the decorative finishing tool 26 can withstand the rigor of imprinting the decorative pattern 24 upon the exposed surface 18 . in this regard , the rods 32 may be affixed to the second opposing side 32 through conventional welding techniques or through the use of adhesives such as epoxy or the like . it is preferred that the second side 28 b is configured with grooves 34 that are adapted to rigidly clasp the rods 32 , as illustrated in fig2 , 2 a , and 4 . therefore , as with the rods 32 , each groove 34 may be configured to have a varying length , size , depth , or width to capture the intended design . it is contemplated that conventional concrete - finishing tools such as floats or trowels may be adapted so that a decorative pattern 24 is formed upon conventional blades and configured to implement the decorative pattern 24 upon the exposed surface 18 . prior art finishing tools do not provide such a capability and such a pattern would require utilizing numerous tools to create variations in depth , diameter , size and texture within the concrete . as such , the decorative finishing tool 26 provides the appearance of a multi troweled finish . additionally , the decorative finishing tool 24 advantageously provides a consistent pattern 24 throughout its application over the entire exposed surface 18 . once the decorative pattern 24 has been troweled on the exposed surface 18 the concrete may be cured or finished . in certain concrete surfaces a variety of finishing techniques are employed to enhance the stability and durability of the surface . it is contemplated , that the implemented design retains its appearance during the employment of a finishing technique . a common finishing technique utilized with exposed aggregate concrete is the application of a chemical surface retarder . a chemical surface retarder is sprayed upon the exposed surface 18 to uniformly cover the same . the chemical retarder slows down the hydration process of the concrete mixture 16 . the chemical retarder does not affect the visual or textural appeal of the decorative pattern 24 . the application of the surface retarder to the exposed surface 18 is followed by the step of finishing the exposed surface 18 of the concrete mixture 16 with a conventional finishing tool or a spray to massage the surface retarder into the cement / fines paste having the aggregate 22 mixed therein . this finishing step preferably results in the penetration of the surface retarder into the cement / fines paste a distance of at least approximately three - eighths of an inch which , due to the relatively small size the aggregate 22 therein , is below the maximum depth of the aggregate 22 . the chemical retarder slows down the hydration process of the concrete mixture 16 . advantageously , this particular finishing step conducted subsequent to the application of the surface retarder to the exposed surface 18 of the concrete mixture 16 eliminates hard spots in the resultant concrete by facilitating a full mix of the retarder and cement / fines paste . subsequent to the surface retarder being massaged into the cement / fines paste , a vapor barrier is preferably formed on the exposed surface 18 of the concrete mixture 16 . in the preferred embodiment , the formation of the vapor barrier is facilitated by the application of a liquid chemical evaporation reducer to the exposed surface 18 of the concrete mixture 16 . a preferred evaporation reducer is sold under the trademark confilm by the concrete tie company of compton , calif . an alternative vapor barrier may be formed by covering the exposed surface 18 with four or six mill visqueen . the vapor barrier is maintained upon the exposed surface 18 of the concrete mixture 16 for a prescribed period of time , which may range from approximately two to twenty - four hours . the vapor barrier does not affect the visual or textural characteristics of the decorative pattern 24 upon the exposed surface 18 . after the vapor barrier has remained upon the exposed surface 18 for a prescribed period of time , the exposed surface 18 of the concrete mixture 16 is washed with water to remove any surface films therefrom . in this washing procedure , it is additionally preferable to lightly bristle brush the exposed surface 18 wherein preferably no more than about 5 % of the aggregate 22 is dislodged and removed therefrom . the extremely low percentage ( i . e ., less than 5 %) removal of the aggregate 22 from the exposed surface 18 evidences the extremely strong adherence of the aggregate 22 to the exposed surface 18 of the concrete mixture 16 . it is preferred that brushing the exposed surface 18 is done in a manner to minimize any deviation from the intended visual appeal of the decorative pattern 24 . as a result of the washing step , the full mixture of the retarder and cement / fines paste accomplished through the use of a conventional finishing tool known in the art , such as a trowel or float , subsequent to the application of the surface retarder to the exposed surface 18 of the concrete mixture 16 significantly aides in the elimination of perimeter wear - down and excessive dislodgement and loss of the aggregate 22 during this initial washing step . which resultantly facilitates the preservation of the decorative pattern 24 upon the exposed surface 18 . additionally , the application of the liquid evaporation reducer to the exposed surface 18 which prevents hydration of the concrete mixture 16 and reduces the rate of evaporation of moisture therefrom increases the ease at which excess cement / fines paste and residual surface retarder are washed from the exposed surface 18 during this initial washing step . in this regard , the aggregate 22 embedded within the decorative pattern 24 is minimally affected . subsequent to washing , the concrete mixture 16 is cured with water only as opposed to chemical curing agents to avoid any staining of the same or interference with the visual or textural aesthetics of the design pattern , with such water curing typically being facilitated through the use of a conventional fogger or soaker hose . after a prescribed period of time ( e . g ., 30 days after initiating the curing process ) any surface residue present on the exposed surface 18 is removed by conventional power washing with a 90 % steam and 10 % muriatic acid mixture which is applied by a power washer via a high pressure nozzle . it is contemplated that conventional power washing of the concrete does not detract from the decorative pattern 24 formed upon the exposed surface 18 . the resultant concrete exhibits an aesthetically appealing surface that conceals imperfections upon the surface and is advantageously suitable for high pedestrian traffic flooring applications . additionally , the surface color and texture may be such that it approximates conventional flooring surfaces such as stone or wood . this resemblance can further be accentuated by saw cutting the concrete surface into rectangular grids to give the appearance that the individual rectangular squares of the grid were laid in a manner analogous to stone or wood flooring . thus , the present invention comprises a significant improvement in the art by providing a surface seeded exposed aggregate concrete having a decorative pattern formed thereupon and possesses a surface texture and color having improved aesthetics over the prior art . additional modifications and improvements of the present invention may also be apparent to those of ordinary skill in the art . thus , the particular combination of parts and steps described and illustrated herein is intended to represent only one embodiment of the present invention , and is not intended to serve as limitations of alternative devices and methods within the spirit and scope of the invention . | 4 |
referring now to fig3 , 4 , 5 , 6 ( a ) and 6 ( b ), there are shown various views , respectively , of one embodiment of a transbronchial needle aspiration ( tbna ) device constructed according to the teachings of the present invention , said tbna device being represented generally by reference numeral 101 . device 101 comprises a handle assembly 103 , a wire 105 , a flexible catheter 107 , a sampling needle 109 , a hub 111 , a jacket 113 and a spring 115 . handle assembly 103 , in turn , comprises a body 117 , a cover 119 , a button slide 121 , a syringe connector 123 and a strain relief member 125 . referring now to fig7 ( a ) through 7 ( f ), body 117 is a unitary , generally c - shaped member , preferably made of a durable molded plastic or another similarly suitable material , comprising a top portion 131 , a distal end portion 133 and a bottom portion 135 , the sides and proximal end of body 117 being open . top portion 131 , distal end portion 133 and bottom portion 135 collectively define a longitudinally - extending cavity 139 , which , as will be described below , is shaped to accommodate a syringe or similar aspirating device . top portion 131 is shaped to include a pair of rails 141 - 1 and 141 - 2 , rails 141 - 1 and 141 - 2 being separated by a slot 142 whose purpose will become apparent below . a first pair of detents 143 - 1 and 143 - 2 are formed on the outer side surface of rail 141 - 1 , and a second pair of detents 145 - 1 and 145 - 2 are formed on the outer side surface of rail 141 - 2 , second detents 145 - 1 and 145 - 2 being staggered relative to first detents 143 - 1 and 143 - 2 . as will be described below , detents 143 - 1 , 143 - 2 , 145 - 1 and 145 - 2 are used in the coupling together of body 117 and cover 119 to form a handle . distal end portion 133 includes a proximal surface 147 , proximal surface 147 being shaped to receive syringe connector 123 . distal end portion 133 also includes a distally extending post 149 . a bore 151 ( which is seen best in fig7 ( f )) extends longitudinally through post 149 and continues through the remainder of distal end portion 133 to cavity 139 . bore 151 includes a distal portion 151 - 1 of comparatively greater cross - sectional diameter and a proximal portion 151 - 2 of comparatively lesser cross - sectional diameter , distal portion 151 - 1 extending for most of the length of bore 151 . as will be described further below , distal portion 151 - 1 is sized to securely receive the proximal end of catheter 107 , with the proximal end of wire 105 passing through proximal portion 151 - 2 . a transverse opening 153 is also provided in distal end portion 133 , transverse opening 153 intersecting distal portion 151 - 1 of bore 151 at an intermediate location thereof . bottom portion 135 has a top surface 155 and a bottom surface 157 . top surface 155 is contoured to receive a syringe or similar aspirating device thereon . bottom surface 157 is contoured to fit ergonomically within the hand of an operator . referring now to fig8 ( a ) through 8 ( e ), cover 119 is a unitary , generally trough - shaped member , preferably made of a durable molded plastic or another similarly suitable material , comprising a top portion 161 , a pair of side portions 163 - 1 and 163 - 2 , and a proximal end portion 165 , the bottom and the distal end of cover 119 being open . top portion 161 is shaped to include an elongated , longitudinally - extending slot 167 , through which , as will be further described below , the button portion of button slide 121 is adapted to extend . top portion 161 is also shaped to include a proximal pair of notches 169 - 1 and 169 - 2 and a distal pair of notches 171 - 1 and 171 - 2 , notches 169 - 1 and 169 - 2 being disposed on opposite sides of slot 167 near the proximal end thereof , notches 171 - 1 and 171 - 2 being disposed on opposite sides of slot 167 near the distal end thereof . as will be described further below , proximal notches 169 - 1 and 169 - 2 and distal notches 171 - 1 and 171 - 2 are alternately adapted to receive , in a releasably locking fashion , a pair of pawls formed on button slide 121 , notches 169 - 1 and 169 - 2 being adapted to receive said pawls in such a manner as to retain button slide 121 at a proximal position ( as in fig3 , 4 and 6 ( a )), notches 171 - 1 and 171 - 2 being adapted to receive said pawls in such a manner as to retain button slide 121 at a distal position ( as in fig6 ( b )). a first pair of recesses 175 - 1 and 175 - 2 are formed on the inside surface of side portion 163 - 1 , and a second pair of recesses 177 - 1 and 177 - 2 are formed on the inside surface of side portion 163 - 2 . recesses 175 - 1 and 175 - 2 are adapted to securely receive detents 143 - 1 and 143 - 2 , respectively , of rail 141 - 1 , and recesses 177 - 1 and 177 - 2 are adapted to securely receive detents 145 - 1 and 145 - 2 , respectively , of rail 141 - 2 . in this manner , body 117 and cover 119 may be secured to one another to form a handle . with body 117 and cover 119 thus coupled together , proximal end portion 165 of cover 119 is situated within the open proximal end of body 117 , the open distal end of cover 119 terminates just proximally of post 149 , and top portion 161 of cover 119 is spaced , for reasons to become apparent below , from the top surfaces of rails 141 - 1 and 141 - 2 . referring now to fig9 ( a ) through 9 ( e ), button slide 121 is a unitary , generally rectangular member , preferably made of a durable molded plastic or other similarly suitable material , comprising an outer frame portion 181 and an inner tab portion 183 . frame portion 181 , which is generally planar , is shaped to include a proximal end 185 , a distal end 187 , and a pair of sides 189 - 1 and 189 - 2 , all of which collectively define an interior cavity 190 . for reasons to become apparent below , frame portion 181 is appropriately dimensioned so that sides 189 - 1 and 189 - 2 are adapted to ride along the top surfaces of rails 141 - 1 and 141 - 2 , respectively , and below a pair of ribs 188 - 1 and 188 - 2 , respectively , formed on cover 119 ( see fig8 ( c ) through 8 ( e )). proximal end 185 of frame 181 is shaped to include a downwardly extending central portion 191 , central portion 191 being dimensioned to extend downwardly a short distance through slot 142 of body 117 . a slot 193 is provided in central portion 191 , slot 193 extending upwardly a short distance from the bottom surface of portion 191 . slot 193 is shaped to include a pair of substantially orthogonal arms 193 - 1 and 193 - 2 , which , as will be described further below , are adapted to matingly receive the proximal end of wire 105 . distal end 187 is shaped to include a generally rectangular central portion 195 , central portion 195 being dimensioned to extend downwardly a short distance through slot 142 . a bore 197 is provided in central portion 195 , bore 197 being aligned with arm 193 - 1 of slot 193 to receive an intermediate length of wire 105 . inner tab portion 183 is generally trapezoidal in shape and includes a proximal end 201 , a distal end 203 and a pair of sides 205 - 1 and 205 - 2 . proximal end 201 is hingedly connected to proximal end 185 of frame 181 , with distal end 203 being free and upwardly biased . a pair of pawls 207 - 1 and 207 - 2 extend upwardly from sides 205 - 1 and 205 - 2 , respectively , of tab portion 183 . pawls 207 - 1 and 207 - 2 are adapted to be received either within proximal notches 169 - 1 and 169 - 2 , respectively , or distal notches 171 - 1 and 171 - 2 , respectively , of cover 119 . a button 209 is provided on the top surface of tab portion 183 proximate to distal end 203 , button 209 being adapted to extend upwardly through slot 167 of cover 119 . with button 209 thus accessible through slot 167 , an operator may use button 209 to exert downward pressure on tab portion 183 to disengage pawls 207 - 1 and 207 - 2 from either notches 169 - 1 and 169 - 2 or notches 171 - 1 and 171 - 2 , as well as to slide button slide 121 proximally or distally along rails 141 - 1 and 141 - 2 . gripping elements 211 extend outwardly from the top of button 209 to facilitate manipulation of button 209 . referring now to fig1 ( a ) through 10 ( e ), syringe connector 123 is a generally teardrop - shaped unitary member , preferably made of a durable molded plastic or another similarly suitable material , comprising a proximal end 221 , a distal end 223 and a side 225 . a port 227 extends proximally a short distance from proximal end 221 , port 227 defining a tapered cavity 229 adapted to receive the medical luer of a syringe . the proximal end of port 227 is shaped to include a pair of radially outwardly extending tabs 229 - 1 and 229 - 2 , tabs 229 - 1 and 229 - 2 being adapted for threaded engagement with the internally threaded sleeve of a syringe . port 227 is oriented so that , with a syringe connected thereto and with connector 123 mounted on body 117 , said syringe extends longitudinally through cavity 139 and on top of bottom portion 155 of body 117 . an oval - shaped ridge 231 extends distally a short distance from distal end 223 , ridge 231 being receivable within a correspondingly shaped groove 235 provided in distal end portion 133 of body 117 ( see fig7 ( d )). an adhesive ( not shown ) may be used , if desired , to more securely retain ridge 231 within groove 235 . ridge 231 defines an oval - shaped cavity 237 that is adapted to bounded proximally by distal end 223 of syringe connector 123 and distally by distal end portion 133 of body 117 . cavity 237 is adapted to be aligned with distal portion 151 - 1 of bore 151 of body 117 for reasons to become apparent below . a first transverse bore 241 extending between proximal end 221 and distal end 223 is provided in syringe connector 123 , bore 241 being in fluid communication with each of cavity 229 and cavity 237 . accordingly , by connecting a syringe to connector 121 , one can apply negative or positive suction force through cavity 229 , bore 241 , and cavity 237 and into bore 151 . a second transverse bore 245 extending between proximal end 221 and distal end 223 is provided in syringe connector 123 , bore 245 being alignable with bore 151 for an intermediate portion of wire 105 to pass therethrough . referring now to fig1 ( a ) through 11 ( d ), strain relief member 125 is a unitary member , preferably made of a durable molded plastic or another similarly suitable material , comprising a generally cylindrical proximal portion 251 and a frustoconical distal portion 253 . a longitudinal bore 255 extends the length of member 125 , the proximal portion 256 of bore 255 being shaped to receive , among other things , post 149 of body 117 , the distal portion 257 of bore 255 being shaped to receive , and thereby provide strain relief to , a length of catheter 107 proximate to the proximal end of catheter 107 . referring now to fig1 ( a ) and 12 ( b ), hub 111 is a unitary tubular member , preferably made of stainless steel or another similarly suitable material , comprising a proximal portion 261 and a distal portion 263 . proximal portion 261 is straight and has a uniform diameter over its entire length . distal portion 263 flares outwardly from proximal portion 261 to a distal end 265 for reasons to become apparent below . ( it should be understood that the proximal end could also be outwardly flared , if desired .) referring back to fig3 , 4 , 5 , 6 ( a ) and 6 ( b ), catheter 107 is a unitary flexible tubular member , preferably made of nylon or another similarly suitable material , having a length of about 160 cm and comprising a proximal end 271 and a distal end 273 . proximal end 271 of catheter 107 is coaxially received and fixedly secured within distal portion 151 - 1 of bore 151 . as seen best in fig6 ( a ) and 6 ( b ), catheter 107 is dimensioned relative to hub 111 so that hub 111 may be press - fit into catheter 107 through distal end 273 , with distal end 273 of catheter 107 being inverted over distal end 265 of hub 111 and shaped to define an opening 275 . although not shown herein , the shaping of distal end 273 of catheter 107 around distal end 265 of hub 111 to define opening 275 may be performed by inserting a mandrel through hub 111 and catheter 107 and then using heat to shape distal end 273 to said mandrel . preferably , opening 275 of catheter 107 is dimensioned to conform closely to the outer diameter of a shaft 277 of needle 109 to promote an air - tight seal between shaft 277 and catheter 107 when needle 109 is extended through opening 275 ( as in fig6 ( b )). alternatively , one could position an annular seal ( not shown ) coaxially within catheter 107 between distal end 273 of catheter 107 and distal end 265 of hub 111 , said annular seal being appropriately dimensioned and made of a suitable material to promote an air - tight interface with the outer surface of needle 109 inserted therethrough . referring now to fig1 , wire 105 is a solid flexible unitary member , preferably made of stainless steel or another similarly suitable material , comprising a proximal portion 281 and a distal portion 283 . proximal portion 281 , which has a length of about 52 inches and a thickness of about 0 . 022 inch , includes a proximal end 285 . proximal end 285 is bent into an l - shape and is adapted to be securely received within slot 193 of button slide 121 . the remainder of proximal portion 281 is adapted to be inserted through bore 197 of button slide 121 , through an annular seal 291 ( see fig4 and 5 ) positioned between button slide 121 and syringe connector 123 , through bore 245 of syringe connector 123 , through bore 151 of body 103 and into catheter 107 , terminating a few inches proximally of hub 111 . distal portion 283 , which has a length of about 2 inches , is shaped to include a proximal segment 287 - 1 and a distal segment 287 - 2 . proximal segment 287 - 1 has a length of about 0 . 2 inch and decreases uniformly in thickness from about 0 . 022 inch at its proximal end to about 0 . 01 inch at its distal end . distal segment 287 - 2 , which extends distally from segment 287 - 1 , has a length of about 1 . 8 inch and a uniform thickness of about 0 . 01 inch over its entire length . as will be described further below , the reason for providing a reduced thickness over much of the length of distal portion 283 of wire 105 is to endow distal portion 283 with additional flexibility , which may be advantageous in enabling distal portion 283 to be delivered to certain remote sampling sites accessible only through contorted paths . endowing distal portion 283 of wire 105 with additional flexibility may also be advantageous in allowing passage through aggressive scope channels . notwithstanding the above , distal portion 283 may be varied in size and / or shape depending upon the characteristics desired therefor . referring now to fig1 ( a ) and 14 ( b ), jacket 113 is a unitary tubular member , preferably made of arnitel , polypropylene or another similarly suitable material . jacket 113 is shaped to include a proximal end 301 , a distal end 303 , a central bore 305 , and a plurality of external ribs 307 - 1 through 307 - 4 . bore 305 is appropriately dimensioned to securely receive wire 105 by a friction - fit , with proximal end 301 of jacket 113 being aligned with that portion of wire 105 that is disposed within distal portion 151 - 1 of bore 151 when button slide 121 is in its retracted position and with distal end 303 of jacket 113 being aligned with that portion of wire 105 that is positioned just proximally of distal portion 283 . an alternative to the aforementioned friction - fit between wire 105 and jacket 113 is a sliding - fit between wire 105 and jacket 113 . such a sliding - fit allows wire 105 to move with respect to jacket 113 in situations where jacket 113 encounters resistance when sliding within catheter 107 . this allows for movement of wire 105 to occur in the manner of least resistance . ribs 307 - 1 through 307 - 4 , which extend longitudinally along the entire length of jacket 113 , are evenly spaced about the circumference of jacket 113 . each of ribs 307 - 1 through 307 - 4 extends in a direction radially outwardly from bore 305 and is generally triangular in shape , as viewed from an end of jacket 113 . ribs 307 - 1 through 307 - 4 are appropriately sized so that at least one of their respective vertices 309 - 1 through 309 - 4 is adapted to be in contact with the inside surface of catheter 107 . in this manner , ribs 307 - 1 through 307 - 4 serve to keep wire 105 substantially centered within catheter 107 throughout its length ( even when a load force is applied to needle 109 ) while , at the same time , providing ample space ( i . e ., between adjacent ribs 307 ) for fluid flow within catheter 107 . as can readily be appreciated , there are a myriad number of ways in which ribs 307 - 1 through 307 - 4 may be changed in size , shape and number while still satisfying the foregoing objectives of keeping wire 105 centered within catheter 107 and providing an ample volume within catheter 107 for fluid flow . ( for examples of these and other modifications , see commonly - assigned u . s . pat . no . 6 , 454 , 702 and commonly - assigned u . s . patent application ser . no . 09 / 716 , 710 , both of which are incorporated herein by reference .) in another embodiment ( not shown ), one could replace jacket 113 with a plurality of beads or similarly suitable elements over - molded around wire 105 at spaced intervals thereof , said beads being sized to engage the inside surface of catheter 107 and , thus , to keep wire 105 centered within catheter 107 . if desired , said beads could have longitudinal grooves or channels oriented along the longitudinal axis of catheter 107 to allow maximum fluid flow from the proximal to the distal portions of catheter 107 and vice versa . the dimensions of said beads may also be chosen so as to regulate fluid flow by controlling the gap between the bead surface and catheter 107 . in still another embodiment ( not shown ), one could replace both jacket 113 and wire 105 with a wire that is shaped ( e . g ., by machining , stamping , etc .) to include one or more elements adapted to keep said wire centered within catheter 107 . referring now to fig1 ( a ) and 15 ( b ), spring 115 is a unitary member , preferably made of stainless steel or another similarly suitable material , comprising a plurality of closely spaced or compressed coils 311 terminating at a proximal end 313 and a distal end 315 . ( although coils 311 are shown in the present embodiment having a rectangular transverse cross - sectional shape , it is to be understood that coils 311 are not limited to a rectangular transverse cross - sectional shape and could have , for example , a circular transverse cross - sectional shape or the like .) as seen best in fig1 ( a ) through 16 ( c ), spring 115 coaxially surrounds distal portion 283 of wire 105 , with proximal end 313 of spring 115 being secured , preferably by a weld 314 - 1 ( see fig1 ( c )) or like means , to wire 105 just proximally of segment 287 - 1 and with distal end 315 of spring 115 being secured , preferably by a weld 314 - 2 ( see fig1 ( d )) or like means , to the distal end of segment 287 - 2 . spring 115 has a uniform inner diameter of about 0 . 026 inch , which is slightly greater than the thickness of wire 105 , and a uniform outer diameter of about 0 . 034 inch . the purpose of spring 115 is to provide greater column strength to distal portion 283 of wire 105 , i . e ., to make distal portion 283 less likely to buckle when a compressive force is applied thereto . such increased column strength is desirable since , as noted above , distal portion 283 has a decreased thickness as compared to the remainder of wire 105 . one advantageous feature of spring 115 is that , whereas spring 115 cannot be compressed and , therefore , provides the aforementioned column strength to distal portion 283 , spring 115 can be bent and , therefore , does not substantially diminish the flexibility of distal portion 283 . referring now to fig1 ( a ) through 17 ( d ), needle 109 is a unitary member , preferably made of stainless steel or another similarly suitable material , comprising a proximal base portion 321 and a distal stem portion 323 . base portion 321 , which is generally cylindrical in shape , is about 0 . 2 inch in length and includes a proximal end 325 , a rounded distal end 327 , a longitudinal bore 329 and an upwardly - facing slot 331 , slot 331 extending distally from proximal end 325 to a point just prior to distal end 327 . slot 331 is bounded by a flat edge 332 onto which wire 105 may be secured , preferably by welding or like means . stem portion 323 , which is generally cylindrical in shape and coaxial with base portion 321 , is about 0 . 8 inch in length and includes a proximal end 333 , a distal end 335 and a longitudinal bore 337 . distal end 335 is shaped to define an upwardly - facing , open - ended tip , said tip being appropriately shaped and dimensioned to acquire a tissue sample for biopsy . as in the embodiment shown , slot 331 and the tip of needle 109 both face in the same direction ; in this manner , wire 105 may be ( but is not necessarily ) welded to needle 109 on the same side as the tip . this permits force applied to the tip to be transmitted along the axis of wire 105 . when joining wire 105 to needle 109 , a small space is left between the distal end of wire 105 and the distal end of slot 331 , said space being appropriately sized to permit fluid flow between catheter 107 and longitudinal bores 337 and 329 of needle 109 while , at the same time , preventing passage of the sample from needle 109 into catheter 107 . this gap may be varied in size and / or length to regulate fluid flow for a given purpose . rounded distal end 327 of base portion 321 and proximal end 333 of stem portion 323 together define a shoulder that is shaped to abut directly the proximal end of hub 111 in such a way as to form an air - tight seal therewith when needle 109 is placed in its advanced position . as discussed above , the outer diameter of stem portion 323 is appropriately dimensioned to form a tight seal with distal end 273 of catheter 107 when needle 109 is moved to its extended position ( see fig6 ( b )). in addition , as noted above , the shoulder formed by rounded distal end 327 of base portion 321 and proximal end 333 of stem portion 323 is appropriately dimensioned to engage proximal end 261 of hub 111 so as to form a seal therewith , as well as to delimit distal movement of needle 109 ( and , in so doing , prevent needle 109 from being lost distally from the remainder of device 101 and , perhaps , becoming lost in a patient ). although not shown , one could , if desired , enhance the seal formed between the shoulder of needle 109 and proximal end 261 of hub 111 by heat - shrinking an elastomeric sleeve over the shoulder of needle 109 , said sleeve conforming to the shape of the shoulder and forming a sealing interface with the proximal end 261 of hub 111 . ( it should be noted that the use of such an elastomeric sleeve in device 101 would make considerably more difficult any reprocessing of device 101 .) referring now to fig1 ( a ) through 18 ( c ), there are shown various views of a first alternate needle usable instead of needle 109 in device 101 , said first alternate needle being constructed according to the teachings of the present invention and being represented generally by reference numeral 359 . needle 359 is a unitary structure shaped to include a stem portion 361 and a base portion 363 . stem portion 361 , which is substantially identical to stem portion 323 of needle 109 , is a generally tubular element shaped to include a proximal end 365 and a distal end 367 , distal end 367 being an upwardly - facing , open - ended tip . base portion 361 includes a distal portion 369 and a proximal portion . distal portion 369 , which is generally tubular in shape , forms a shoulder with proximal end 365 of stem portion 361 . the proximal portion of base portion 361 is bifurcated into a left side member 373 and a right side member 375 , left side member 373 and right side member 375 being centered relative to the top and bottom surfaces of distal portion 369 of base portion 361 . wire 105 may be mounted along the top or bottom surfaces of left and right side members 373 and 375 , respectively . referring now to fig1 ( a ) through 19 ( c ), there are shown various views of a second alternate needle usable instead of needle 109 in device 101 , said second alternate needle being constructed according to the teachings of the present invention and being represented generally by reference numeral 379 . needle 379 is a unitary structure shaped to include a stem portion 381 and a base portion 383 . stem portion 381 , which is substantially identical to stem portion 323 of needle 109 , is a generally tubular element shaped to include a proximal end 385 and a distal end 387 , distal end 387 being an upwardly - facing , open - ended tip . base portion 383 is a generally tubular element shaped to include a transverse slot 389 extending distally a short distance from the proximal end of base portion 383 . slot 389 , which is appropriately sized for wire 105 to be mounted therewithin , extends from the left side of base portion 383 to the right side of base portion 383 and is centered relative to the top and bottom surfaces of base portion 383 . one desirable attribute of needle 379 is that slot 389 permits wire 105 to be coupled to needle 379 in such a way that wire 105 and needle 379 share a common axis . in use , prior to inserting device 101 into a bronchoscope , an operator typically tests device 101 by using button slide 121 to alternately position needle 109 in its advanced position and its retracted position . once the operability of said needle positioning mechanism has been confirmed , needle 109 is then locked in its retracted position by positioning slide 121 so that pawls 207 - 1 and 207 - 2 are positioned within notches 169 - 1 and 169 - 2 , respectively . the distal end of device 101 is then loaded into a bronchoscope ( which has previously been inserted into the patient to a neutral location ), and a syringe is attached to port 227 of connector 123 . once confirmation is received that distal end 273 of device 101 has passed entirely through the bronchoscope ( such confirmation typically being provided using a video channel of the same bronchoscope ), the bronchoscope and device 101 are advanced together to the target site , and needle 109 is advanced to its extended position by positioning slide 121 so that pawls 207 - 1 and 207 - 2 are positioned within notches 171 - 1 and 171 - 2 , respectively . distal end 335 of needle 109 is then inserted through the bronchial wall of the patient and into a nearby lymph node . at this time , the syringe is used to apply suction . in the unfortunate event that needle 109 has errantly penetrated a blood vessel , instead of a lymph node , the application of suction causes blood to be aspirated through bore 337 of needle 109 and into catheter 107 and the syringe , where such blood is detected . in such a case , the application of suction is discontinued and the soiled device 101 is removed from the bronchoscope and the patient . a fresh tbna device 101 is then loaded into the bronchoscope and the patient in the manner described above , and another attempt is made to penetrate the lymph node . if , while suction is applied , it appears that needle 109 has penetrated a lymph node , as is desired , catheter 107 is agitated to help shear tissue from the penetrated lymph node into bore 337 of needle 109 . with a tissue sample thus disposed within bore 337 of needle 109 , needle 109 is moved back to its retracted position within catheter 107 by positioning slide 121 so that pawls 207 - 1 and 207 - 2 are positioned within notches 169 - 1 and 169 - 2 , respectively . device 101 is then removed from the bronchoscope and the patient . needle 109 is then placed in its advanced position by positioning slide 121 so that pawls 207 - 1 and 207 - 2 are positioned within notches 171 - 1 and 171 - 2 , respectively , and negative suction is then used to expel the tissue from needle 109 onto a slide or the like for histological examination . device 101 is intended to be a single - use device . however , it is envisioned that , if device 101 is constructed from materials capable of withstanding reprocessing conditions , e . g ., flushing with suction , followed by ( or preceded by ) washing in an ultrasonic bath , flushing again with suction , and then autoclaving , device 101 may be reprocessed for additional use . the embodiments of the present invention described above are intended to be merely exemplary and those skilled in the art shall be able to make numerous variations and modifications to it without departing from the spirit of the present invention . all such variations and modifications are intended to be within the scope of the present invention as defined in the appended claims . | 0 |
fig1 a is a longitudinal section view of an undersea flow pipe 1 . there is a fluid flow 2 into the undersea flow pipe 1 , in the direction indicated by the arrow a — a . a foam pig 4 is urged by an upstream portion 2 b of the flow 2 , located upstream from the foam pig 4 . a hollow device 3 is urged by the foam pig 4 , and both , in conjunction , urge a downstream portion 2 a of the flow 2 . therefore , the downstream portion 2 a is being urged by the upstream portion 2 b , which in turn urges the foam pig 4 , which urges the hollow device 3 . in the present embodiment , for exemplification only , the hollow device 3 is provided with such an internal geometry that its opening is venturi shaped . the foam pig 4 and the hollow device 3 are inserted into the undersea flow pipe 1 at the end located upstream of the point where the hollow device 3 should operate , by means of a device known in the art . the downstream and upstream flow portions 2 a and 2 b may comprise varying kinds of fluids . they may comprise a single component or more than one component . they may comprise one phase or more than one phase ; they may comprise varying combinations of phases and components , in each of the fluid portions 2 a and 2 b or in both ; and they can vary along the time . in the embodiment illustrated , the undersea flow pipe 1 is shown in a horizontal position , for exemplification only , but when in operation , it may be in any orientation . the undersea flow pipe 1 may have different internal diameters and may be formed by different materials . further , the undersea flow pipe 1 may be subjected to high or low temperatures and pressures . in the situation shown in fig1 b , the hollow device 3 has just reached a stop means 5 , which prevents the hollow device 3 from further movement along the undersea flow pipe 1 . therefore , in a first moment the foam pig 4 is also arrested there . the retention of the foam pig 4 provokes waves of pressure downstream and upstream from the foam pig 4 . the upstream pressure from the foam pig 4 tends to increase , as the sources originating the flow have not stopped operation . as a consequence , the upstream flow from the foam pig 4 tends to apply more pressure against the back portion of the pig . in the situation depicted in fig1 c , the back pressure acting on the foam pig 4 reaches a value which forces the foam pig 4 to pass into the opening of the hollow device 3 . this is possible because the foam pig used is preferably highly compressible . in the situation depicted in fig1 d the foam pig 4 has already passed through the opening of the hollow device 3 , and continues traveling along the undersea flow pipe 1 for being retrieved in the opposite end to which it was inserted into the undersea flow pipe 1 . it is not necessary that the foam pig 4 keeps its physical integrity after having passed throughout the opening of the hollow device 3 , and it can be destroyed during the process of passing through the opening . the procedure herein described for setting a hollow device into a undersea flow pipe may also be cumulatively used , that is , hollow devices can be set in a sequence , either in the same region or in discrete regions . in the present embodiment the stop means 5 is shown schematically . such stop means 5 can be inserted at its operational position in the undersea flow pipe 1 before the latter be laid on the seabed , or it can be set in position afterwards . it can be a permanent or a temporary stop . it can have a fixed or variable insertion distance into the pipe . fig3 depicts a first embodiment of a stop means to stop the traveling of the hollow device 3 and to keep it in its operational position . an orifice 9 , preferably circular , is drilled in the external wall of the undersea flow pipe 1 at a position where the stop means should operate to stop the traveling of the hollow device 3 . next a lower flange 13 b of a flanged spool 13 is welded in the region of the undersea flow pipe 1 where the orifice 9 has been drilled , the internal passage of the spool 13 being substantially in registration with the orifice 9 . a bonnet 7 of a gate valve is connected to the upper flange 13 a of the flanged spool 13 , as shown in the fig3 . the bonnet 7 is provided with a stem 15 , and a gate 14 connected to the lower end of the stem 15 . a handwheel 6 is connected to the upper end of the stem 15 , to drive it . a packing set 8 seals the stem 15 . the above assembly allows the gate 14 to be inserted into the undersea flow pipe 1 , and the distance of the projection of the gate 14 is controlled by driving the handwheel 6 in such a way that the stem 15 provokes a downward movement of the gate 14 , causing the insertion of the gate 14 into the undersea flow pipe 1 to the desired length . the gate 14 must be structurally reinforced and must be provided with a support at the flanged spool 13 to resist the impact of the hollow device 3 against it at the moment which the hollow device 3 , driven at a relatively high speed by the foam pig 4 , contacts the gate 14 . the embodiment of fig3 requires that the flow in the undersea flow pipe 1 is interrupted when the orifice 9 is to be drilled , and the flow may only be restarted after the assembly operation has finished . modifications and improvements can be made in the embodiment depicted in the fig3 without departing from the general scheme which is shown . fig4 depicts a further embodiment of a stop means to stop the displacement of the hollow device 3 into the undersea flow pipe 1 and to keep it into its operational position . this embodiment does not require that the flow is interrupted in order for the stop means to be installed . as can be seen in fig4 , the lower flange 24 a of a flanged spool 24 is welded to the external wall of the undersea flow pipe 1 at a position where the stop means for stopping the displacement of the hollow device 3 is supposed to operate . the lower flange 25 a of a gate valve 25 is connected ( in this case bolted ) to the upper flange 24 b of the flanged spool 24 . the gate valve 25 is in the closed configuration during this part of the assembly operation . a drilling device ( not shown in fig4 ) may then be connected to the upper flange 25 b of the gate valve 25 to prepare for drilling an orifice in the wall of the undersea flow pipe 1 as will be described in the following . drilling devices as the one mentioned above are widely known in the art and it will not be described herein , as its construction does not form part of the invention . next , the gate valve 25 is open and the drilling element of the drilling device passes through the open interior passage of the gate valve 25 and it drills an orifice 23 in the outer wall of the undersea flow pipe 1 . after the orifice 23 has been drilled , the drilling element of the drilling device is retrieved and then the gate valve 25 is closed . the drilling device may then be retrieved , and next the lower flange 26 a of a flanged spool 26 is connected to the upper flange 25 b of the gate valve 25 . next a bonnet 27 of a gate valve is connected to the upper flange 26 b of the flanged spool 26 . the bonnet 27 is provided with a stem 28 , and a gate 22 which is connected to the lower end of the stem 28 as illustrated in fig4 , for example , the gate has a transverse dimension in a direction transverse to the axis thereof that is substantially less than the diameter of the flow passage . thus , full insertion of the gate into the flow pipe will not cease flow through the flow passage . a handwheel 29 is connected to the upper end of the stem 28 , to drive it . a packing set 30 seals the stem 28 . the above assembly allows the gate 22 to be inserted into the undersea flow pipe 1 to act as stop means for a hollow device 3 of the type shown in fig1 and 2 . for this purpose the gate valve 25 is open and the handwheel 29 is driven so as to displace the gate 22 downwardly , allowing the gate to pass through the gate valve 25 and the orifice 23 , for being inserted into the undersea flow pipe 1 . the distance by which the gate 22 projects into the pipe 1 is controlled by driving the handwheel 29 in such a way that the stem 28 causes the insertion of the gate 22 into the undersea flow pipe 1 to the desired length . the packing set 30 prevents the fluids from the flow 2 flowing in the undersea flow pipe 1 from escaping to the external environment . the gate 22 must be structurally reinforced and must be provided with a support at the flanged spool 24 to resist the impact of the hollow device 3 against it at the moment which the hollow device 3 , driven at a relatively high speed by the foam pig 4 , contacts the gate 22 . the embodiment of fig4 does not require interruption of the flow in the undersea flow pipe 1 when the orifice 23 is to be drilled . modifications and improvements can be made in the embodiment depicted in the fig4 without departing from the general scheme which is shown . the stop means depicted in fig3 and 4 may be manually or mechanically driven , they may be remotely or locally controlled , and they can be provided with or without a mechanism to regulate the insertion of the gate . when it is necessary to halt the displacement of the hollow device 3 along the undersea flow pipe 1 , to set it in the desired position , the stop means previously installed would be operated , and the gate would be transversely inserted into the undersea flow pipe 1 , forming in the internal wall of the pipe an indentation of a size adequate to arrest the hollow device 3 . one or more stop means can be used along the undersea flow pipe 1 . should more than one stop means be used at the same position in the undersea flow pipe to arrest one and the same hollow device , they should preferably be placed along the same transverse section of the undersea flow pipe 1 in an annular array . although use has been made of handwheels 6 and 29 to actuate the gates 14 and 22 of the embodiments of the stop means of the fig3 and 4 , respectively , it should be mentioned that any other type of actuating means can be used . for example , the gates 14 and 22 can be remotely actuated by means of a hydraulic actuating means . when it is necessary to retrieve the hollow device from the interior of the undersea flow pipe , it suffices to fully retract the stop means , the gate 14 , in the case of the embodiment of the fig3 , or the gate 22 , in the case of the fig4 , thereby releasing the hollow device 3 . fig2 a to 2 d depict the retrieval sequence of the hollow device 3 by means of a pig . fig2 a depicts a cross section of the undersea flow pipe 1 with a hollow device 3 kept into position by stop means 5 . there is a flow in the undersea flow pipe 1 , in the direction indicated by the arrow a — a . first the stop means 5 are removed from the interior of the undersea flow pipe 1 , thereby releasing the hollow device 3 to travel along the undersea flow pipe 1 , urged by the flow 2 . while any stop means can be used here , in the present embodiment the stop means 5 used is preferably either of those depicted in fig3 and 4 . in the case of the stop means of fig4 , the gate valve 25 can be closed after the gate 22 has been retrieved , so as to avoid fluid leakage to the interior of the bonnet 27 . if the hollow device 3 remains at its operating position , even if the stop means 5 have been retracted as depicted in fig2 , a pig 34 can be inserted into the undersea flow pipe 1 upstream to the hollow device 3 . the pig 34 is then urged by the flow towards the hollow device 3 . it should be mentioned here that it is not necessary that the pig used for removing the hollow device 3 from the interior of the undersea flow pipe 1 be a foam pig , as any kind of pig suited for this operation can be used . fig2 c depicts a situation in which the pig 34 has reached the hollow device 3 . as the stop means 5 no longer retain the hollow device 3 in its operational position it is then urged by the pig 34 towards the other end of the undersea flow pipe 1 , as shown in fig2 d . the hollow device 3 and the pig 34 can then be retrieved at an adequate place of the undersea flow pipe 1 , by means of any retrieval device well known in the art . the hollow device 3 must be provided with an external sealing system for hindering the flow of fluids along any fortuitous space formed between the external wall of the hollow device 3 and the internal wall of the undersea flow pipe 1 . fig5 a schematically depicts an embodiment of such a sealing system . sealing rings 40 are circumferentially arranged along certain portions of the external surface 35 of the hollow device 3 . the sealing rings 40 may have any cross sectional shape , some of them being depicted in the details “ a ”,“ b ” and “ c ” of fig5 b , 5 c and 5 d . other sealing elements such as gaskets and the like may be used instead or in conjunction with the sealing rings 40 . while a foam pig has been proposed herewith to be used for setting a hollow device into its operating position , any other kind of pig , or even other kind of device , can be used , providing that it is able to pass throughout the opening of the hollow device after the device has been set in position . those skilled in the art will immediately notice that modifications can be introduced in the methods and in the devices herewith disclosed without departing of the scope an of the spirit of the present invention . having described the present invention with respect to its preferred embodiments , it should be mentioned that the above description should not be taken to limit the present invention , which is limited by the scope of the appendant claims . | 8 |
proceeding therefore to describe the invention in detail , reference should be made to fig1 and 2a which show prior art devices and in which reference characters 17 and 10 represent the concentrator and column respectively . the column is self - supported in a half - hazard vertical alignment on top of the concentrator , by the teflon - butt connection 24 . the teflon tubing is permanently heat sealed to the hypodermic needle component 25 and is an individual permanent assembly , making direct hypodermic needle replacement for flow control adjustment or damaged , difficult in the field . the concentrator 17 is normally held in a support ( not illustrated ) and is operatively connected to a source of metered helium via the inlet 19 , said helium acting as an evaporating gas for the solvent such as hexane contained within the eluant . however , such apparatus is fully described in analytical chemistry volume 51 , page 1861 , september 1979 and it is therefore not believed necessary to describe same further . the new design consists of concentrator 17 shown in fig2 and a column similar to that shown in fig2 a . the column includes a cylindrical tube 11 with a reservoir portion 12 at the upper end thereof , a fibre filter 13 adjacent the lower end thereof , and a luer taper connection on the lower end thereof which may be engaged within a stopcock component 16 . the stopcock component 16 is provided with a luer fitting 15 on the upper end thereof and a luer taper 22 on the lower end thereof ( obtainable commercially as a separate item ). the column 10 is self - supported on the concentrator 17 in perfect vertical alignment by the luer taper engaging within the upper end 25 of a hypodermic needle assembly situated in the upper end of the cylindrical tube 17 . a cylindrical or tubular fitting 18 is engaged around the upper end of the tube 17 and a hypodermic needle component receptacle 18a is of the push - in / pull - out construction in a teflon molded construction inner sleeve for direct simple hypodermic needle replacement . a shaped aperture is formed in this receptacle corresponding to the shaped or square body portion 26a of the conventional hypodermic needle . this cylindrical sleeve 18 also includes the inlet tube 19 operatively connectable to a source of metered helium as hereinbefore described relative to the prior art . the push - in engagement of a standard hypodermic needle component such as that shown in fig1 , makes replacement or exchange simple , fast and inexpensive in the field . the design also makes it possible for more rigid self - support of the column . a relatively simple column mounting is essential as it has to be removed every 15 or 20 minutes to empty and replace the column packing in preparation for the next sample run . the hypodermic needle 26 engages within a feed tube 20 also held by adhesive or the like within the cylindrical fitting 18 . the lower end 27 of the feed tube 20 is restricted due to the inwardly tapering cross sectional configuration thereof and of course the distal end of the feed tube is open . the elongated filament 28 is formed from glass or stainless steel and is approximately one millimeter in diameter and means are provided at the upper end thereof to freely suspend the filament within the restricted lower end 27 so that it extends through the open end of the feed tube and is freely suspended within the cylindrical jacket 25 . the lower or distal end 29 of the filament 28 is stabilized by restricted means provided at the lower end of the jacket . in the present invention , the lower end of the jacket is in the form of a drip tip 30 inasmuch as the lower end tapers inwardly and terminates with the discharge tip exit 31 and the lower end 29 of the filament ( see fig7 ) is in concentric relationship with the inner wall 32 of the tip but is spaced slightly therefrom . this means that slight vibration can occur but this vibration is removed due to the restriction between the outer surface 33 of the filament and the inner wall 32 of the tip . various means are provided to suspend the filament within the restricted lower end 27 of the feed tube and reference should be made to fig3 to 6 . fig3 and 4 show a flattened ball 34 formed or otherwise secured to the upper end 35 of the filament . this ball rests upon the inner wall 36 of the restricted lower end 27 and suspends the filament through the lower open discharge 37 of the feed tube . the flattened sides 38 of the ball provide a liquid passage between the interior of the feed tube and the external surface 39 of the filament so that liquid can flow from the feed tube and down the outer surface of the filament . fig5 shows a cylindrical collar 40 frictionally engaged around the upper end of the filament and freely engaging and being supported by the inner walls 36 of the restricted lower end , once again concentrically supporting the filament through the discharge lower end 37 of the feed tube . in this embodiment , a vertical slit 41 is formed through the collar acting as a fluid passage between the interior of the feed tube and the outer wall 39 of the filament . if desired , a ball 42 can be provided or secured to the upper end of the filament above the collar 40 . fig6 shows a still further embodiment in which the collar 40 relies on the frictional engagement with the filament 28 to prevent downward movement of the filament relative to the collar . in this embodiment , a relatively short slit 43 is provided within the wall of the collar to act as a fluid passageway as hereinbefore described . in operation , the eluant is fed to the reservoir 12 of the chromatographic column and flows through the filter 13 and through a relatively fine feed tube 13a extending from the lower end of the filter through the luer taper and into the connector 15 . with the shut - off valve 16 in the open position , this eluant passes to the interior of the hypodermic needle assembly 25 and drips from the distal end of the needle 26 , the rate being controlled by the diameter of the bore thereof . the eluant then flows slowly along the glass filament 28 to the discharge tip exit 31 . metered helium enters through the inlet tube 19 and evaporates the solvent from the element to a desired concentration . helium and solvent vapors escape through vent holes 44 formed in the jacket adjacent the lower end thereof and the sample concentrate collects in receiving tubes ( not illustrated ) situated below the drip tip . reference to fig7 will show one of the advantages of the present construction as compared to the prior art construction . in the prior art construction , occasional ( additive ) concentrate which are lost on the joint , are unrecovered , and will drastically lower the end result . however , in the present device , all drops will engage the inner surface 32 of the drip tip and are all collected in the receiver indicated by reference character 45 in fig7 . therefore , it runs down the surface of the drip tip into the receiving tube . since various modifications can be made in my invention as hereinabove described , and many apparently widely different embodiments of same made within the spirit and scope of the claims without departing from such spirit and scope , it is intended that all matter contained in the accompanying specification shall be interpreted as illustrative only and not in a limiting sense . | 6 |
the present invention will be described in detail with reference to a preferred embodiment thereof , that is , the creation and installation of an autogeneous pumping chamber for ventricular replacement or ventricular assistance . the autogeneous pumping chamber , as it is herein called , is created from the patient &# 39 ; s own muscle . the autogeneous chamber created in accordance herewith , can thereafter be paced to rhythmically contract and thus function as a heart ventricle replacement or as a pumping assist mechanism . the coaction of the silicone implant with the formation of scar tissue by the muscle creates a pumping chamber having an inner lining which is quite smooth so as to limit and substantially preclude the formation of clots on the wall thereof , a major factor in the overall consideration of the procedure . referring now to the drawing , in which fig1 - 4 illustrate one embodiment of the present invention and fig5 illustrates a human heart having the implant - induced autogeneous pumping chamber operatively associated therewith , the use of the implant to create the muscular chamber pursuant hereto and the surgical procedures required to place the autogeneous chamber in operative relationship to the human cardiovascular system will now be described . the autogeneous pumping chamber embodying the present invention is herein identified by the general numeral 10 . chamber 10 is created around an implant or pouch 11 which preferably is formed of silicone sheeting or like non - toxic suitable material . pouch 11 , as shown in fig2 and 3 , comprises a generally almond shaped body portion 12 which converges to a neck 13 which in turn is connected to and enclosed by suture tab formed of rigid silicone or other pharmacologically acceptable silastic or plastic material . a fill port 15 is constructed in and defined by suture tab to receive and retain a fill tube 16 , the function of which will be hereafter described in detail . body portion 12 and suture tab coact to define an enclosed chamber 18 therewithin having , in the usual case , a height of about 8 - 10 cm and a transverse dimension of about 12 cm . at rest , chamber 18 has a volume of 100 - 150 cc and it expands to about 200 cc for a male adult . the capacity of chamber 18 will be provided with slightly less capacity for female adults and children . referring to fig1 and 4 , neck 13 has an internal length of about 10 cm and an internal width of about 4 cm . a centrally convergent groove 20 essentially divides the neck area into a first compartment 21 and a second compartment 22 , each of which has a depth of from about 1 . 0 cm to about 1 . 5 cm . fill tube 16 , as shown in fig3 comprises a first end portion 23 extending downwardly through fill into port 15 communication with chamber 18 , and it is covered by an appropriate domed cover 24 . at the distal end 25 of fill tube 16 a second domed fitting 26 is mounted into which , as will appear , saline solution is injected to fill chamber 18 . in one practice of the present invention , the abdomen of the host is opened with a midline incision and the rectus muscle or like major muscle or muscle group is located . the rectus muscle will be made visible by using a right paramedian or a low transverse incision to elevate the overlying skin and fat . a fascia is opened in the muscle just below the umbilicus and it is raised until the neuro - vascular bundle coming off of the superior epigastric artery is located . the rectus muscle is wrapped around the pouch 11 perferably twice , to completely cover the implant with muscle and the muscle is then stitched to itself to create a closed system . the rectus fascia will be sutured around the elevated neck 13 of the implant with the fill tube 16 disposed in a subcutaneous pocket and sutured in a triangular fashion for ease of palpitation . once emplaced , the pouch 11 is filled with bacteriostatic isotonic saline to provide volume ( see dotted line in fig2 ) and the muscle permitted over time to develop a scar at the interface with the silastic implant . when the autogeneous chamber 10 is fully formed , the volume of the pouch is reduced by withdrawing the saline fluid through the fill tube 16 having placed an incision just above the neck , the neck having been wrapped with the muscle fascia . the silastic pouch is then withdrawn from the muscle chamber through the fill port 15 leaving an integral chamber of muscle which has grown together to create a fluid - tight entity herein designated autogeneous pumping chamber 10 . the exact relocation of this muscular pouch is determined by the function it will be called upon to perform by the surgeon . thus as an assist , it will be disposed in the abdomen while as a replacement , it will be disposed adjacent the heart and connected by grafts or tubes . suitable grafts include cadaver , human autografts and acceptable synthetic vascular graft material such as , gortex and the like . to install the autogeneous chamber 10 at the heart , the chest cavity is opened and chamber 10 is rotated to the heart while leaving it connected to the superior epigastric artery in the manner of an island pedicle flap . then , the neck is sutured to an appropriate inflow / outflow such as the left atrium and the aorta as shown in fig5 . once secured , a pacemaker is attached to the main nerve of the muscle with a conductive probe to pulse the atrium in the conventional fashion . in one precise practice of the surgical procedure employed in the present invention , the abdominal exposure will be created from the pubis to the costal margin . the anterior rectus fascia will be opened in its midline . the inferior edge of the rectus muscle will be incised and elevated from the posterior fascia . the muscle will be raised approximately 2 / 3rds around the implant 11 in a spiral fashion . after two complete thicknesses of the muscle have been wrapped about the pouch 11 , three to four vertical openings in the superior edge of the muscle will be made and three to four strips or flaps of the interior portion of the muscle will be made to place through the openings and sutured on the muscle to maintain the wrapping in place . the incisions will be closed after the integrity of the expanding prosthesis is checked , that is , when the unimpeded flow of injectable saline through the fill dome 24 into the body portion 12 of pouch 18 is visually verified . the implant 18 will be filled at the time of surgery with between 50 to 150 mls . of saline , depending upon the patient &# 39 ; s size ( child , female , adult male , etc .). over a period of four to six weeks at weekly intervals , additional sterile saline solution will be added by percutaneous injection through fill dome 24 and fill tube 16 while the muscle is trained . by &# 34 ; training the muscle &# 34 ;, as that term is used herein , i refer to the electrical connection of a nerve stimulator ( neuromod ®, medrionic ) to the main nerve of the muscle to cause the muscle to quiver and prepare it to respond later with rhythmic contraction and expansion when a pacemaker is associated therewith in a similar fashion , that is , with an electrically conductive probe . when body portion 12 of implant 11 achieves a filled volume of approximately two times its initial volume , the entire assemblage is left in place within the body of an additional one to two months . thereafter , a second operation is performed during which the implant 11 is removed from within the autogeneous pumping chamber , the nerve stimulator is removed by withdrawing the connective probe from the main nerve of the muscle , and a pacemaker is connected into the main nerve supply entering superiorly into the muscle chamber 10 which has been skeletonized . while maintaining the patient on bypass , the newly constructed autogeneous pumping chamber , if to be used for ventricular replacement , is attached to the left atrium and aorta of the patient for which it assumes the function of the diseased ventricle or provides an assist pumping chamber . from the foregoing it can be seen that a method of forming an autogeneous pumping chamber for use as a replacement ventricle or ventricle assist has been described which can be paced to rhythmically contract and expand like an original heart ventricle or heart . the procedure can be characterized as comprising three parts , namely : the first surgery ; the in vivo muscular chamber formation and muscle training ; and the second surgery . the first surgical procedure comprises placing implant 10 ( herein called the &# 34 ; gibney ventricular stimulating implant &# 34 ; or &# 34 ; gvsi &# 34 ;) within a rectus ( adominis ) muscle and wrapping the muscle around the implant , sewing the muscle upon itself to achieve a closed system ; and filling the interior of body portion 12 of implant 11 , after wrapping with muscle , via fill tube 16 through fill port 15 . thereafter , the in vivo formation of the autogeneous pumping chamber is achieved by adding additional fluid ( sterile isotonic saline ) into the body portion 12 by percutaneous injection through fill tube 16 and fill port 15 over a period of four to six weeks at weekly intervals ; and maintaining the rectus wrapped implant in vivo for one to two months during which time the nerve stimulation is perfected and the muscle merges into an integral chamber . thereafter , the second surgical procedure is performed which comprises removing the implant 11 , and fill tube 16 from within the pumping chamber 10 , inserting a pacemaker into the main nerve supply , and substituting the resulting autogeneous pumping chamber 10 for the deceased ventricle or connecting it as an assist while sustaining the patient on a conventional bypass during the procedure . while the rectus muscle has been herein indentified as used in the practice of the present invention , other major muscle and muscle groups such as the latissimus dorsi , the pectoralis major , the quadricep and the diaphragm are also prime candidates for the procedure hereof . furthermore , when the device hereof is to be used as an auxiliary pumping station , pumping chamber 10 and implant 11 may use a silicone fill tube 116 having a self - sealing silicone gum disposed therein and attached by a tab 32 ( see fig7 ) at the distal end thereof to an adjacent surface . in grafting chamber 10 , conventional or y - grafts , formed of a suitable silicone material or gortex ® and the like may be employed . referring now to fig6 an alternative embodiment of the present invention is shown which is especially adapted for use as a cardiac assist which includes a closed member 28 formed upon suture tab and extending upwardly therefrom about 2 - 3 cm . closed member 28 comprises a cylindrical body portion 29 enclosed at its upper end with circular portion 30 into which an alternate fill port 31 is formed for receiving fill tube 16 therewithin in the manner previously described . the saline solution can be introduced into fill tube 16 by injection into fill dome 24 ( see fig6 ) or by inserting an appropriate needle directly into the self sealing fill tube 116 ( see fig7 ). a further embodiment of the present invention is shown in fig8 and 9 and is especially adapted for use when prior nerve damage or other exigencies do not allow a conventional pacemaker hook up to the main nerve of the muscle selected to create chamber 10 . specifically this embodiment involves a muscular pumping chamber 10 formed about a pouch 11 in exactly the same general manner as is described above . however in this practice , pouch 11 is first wrapped in a polyurethane shell 33 having a thickness of about 1 to 2 mil and having a pair of non - corrosive electrically conductive strips or wires 34 , 35 disposed therein starting adjacent the bottom 36 thereof and coiling up about body portion 12 in spaced relationship to each other toward the top thereof . during the development of the autogeneous chamber 10 , the muscle literally grows into the polyurethane and conductive wires 34 , 35 are scarred in place on the inner wall of muscle chamber 10 and remain so positioned when pouch 11 is subsequently removed through fill port 15 in accordance with the earlier description . when this chamber 10 is placed with use , the pacemaker will be connected to conductors 34 , 35 at the exposed ends 38 , 39 , thereof , respectively . from the foregoing , it is apparent that means and methods have been herein described and illustrated which fulfill all of the aforestated objectives in a remarkably unexpected fashion . it is of course understood that such modifications , alterations and adaptations as may readily occur to the artisan confronted with this disclosure are intended within the spirit of this disclosure which is limited only by the scope of the claims appended hereto . | 0 |
the copolymers of the present invention preferably have a t g of at least 180 ° c . when such copolymers contain more than one comonomer copolymerized with pdd , the value of s is less than 1 . the especially preferred copolymers of the present invention have a t g of at least 220 ° c . when those copolymers contain more than one comonomer copolymerized with pdd , the value of s is significantly less than 1 , for example , 0 . 8 or less . all the principal monomers used in this invention are known to the art . the perfluoro ( alkyl vinyl ethers ) ( f ) include perfluoro ( methyl vinyl ether ), perfluoro ( ethyl vinyl ether ), and perfluoro ( npropyl vinyl ether ). the ethers ( g ) include , i . a ., methyl perfluoro ( 3 , 6 - dioxa - 4 - methyl - 8 - nonenoate ) ( further referred to as eve ) represented by the following formula ## str2 ## and perfluoro ( 4 - methyl - 3 , 6 - dioxa - 7 - octenyl ) sulfonyl fluoride ( further referred to as psepve ) represented by the following formula ## str3 ## tfe is made in large quantities by e . i . du pont de nemours and company ; other suitable representative monomers are available from the following sources : vf 2 , chlorotrifluoroethylene ( ctfe ), hexafluoropropylene ( hfp ), vinyl fluoride , and trifluoroethylene from scm specialty chemicals , gainesville , fla . ; perfluoro ( methyl vinyl ether ) ( pmve ), and perfluoro ( propyl vinyl ether ) ( ppve ) are made as described in u . s . pat . no . 3 , 180 , 895 ; ( eve ) is made as described in u . s . pat . no . 4 , 138 , 740 ; and psepve is made as described in u . s . pat . no . 3 , 282 , 875 . pdd is described in the above - mentioned u . s . pat . no . 3 , 978 , 030 . it has now been discovered that pdd can be copolymerized with any one or more of the above - named monomers to amorphous copolymers . the amorphous copolymers of the present invention , are soluble at room temperature in perfluoro ( 2 - butyltetrahydrofuran ), which is a commercial solvent available from 3m company under the tradename fc - 75 . in addition , they have the following outstanding combination of properties : the first four characteristic properties of the copolymers of the present invention are particularly advantageous in applications where the polymer must bear a load at an elevated temperature . because of their chemical inertness and excellent dielectric properties , they also are suitable for a number of specialized electrical applications . also , because of their chemical inertness , good optical properties , and good physical properties , they are suitable for the manufacture of optical lenses . the polymers of this invention can also be filled or reinforced with solid substances to make composite materials . the additives include , i . a ., graphite , graphite fibers , aramid fibers , mica , wollastonite , glass fibers , etc . fibrous material may be in the form of loose fibers , fabrics , or mats . such composite materials show enhancement of desirable properties such as modulus , for example . films of the amorphous copolymers of this invention are useful when thermally laminated to other polymeric films or metal foils . a laminate of the amorphous copolymers of this invention with copper foil is a superior substrate for flexible circuit production because the copolymer bonds directly with the copper without the necessity for an intervening adhesive . conventional copper / adhesive / polyimide / adhesive / copper structures for electronic circuit substrates have the deficiency of high dielectric constant material next to copper . this limits the ultimate speed of the electronic circuit . a laminate of copper / amorphous copolymer / copper permits very high circuit speeds because the amorphous copolymer film has a low dielectric constant ( 2 . 1 ) and can be thermally bonded directly to circuit copper . a thermal laminate of amorphous copolymer / polyimide / amorphous copolymer is useful as an electronic circuit substrate . compared to polyimide film itself , this laminate is a superior circuit substrate because ( a ) it may be thermally bonded to copper foil without adhesive ; ( b ) the low water absorption of the amorphous copolymer gives the substrate greater dimensional stability in humid environments ; and ( c ) the low dielectric constant of the amorphous copolymer allows the fabrication of a high speed circuit . a thermal laminate of amorphous copolymer / polyimide is useful as a vacuum bag for the curing of parts such as helicopter blades made from carbon fiber reinforced thermoset . the high glass transition temperature , thermal stability and low surface energy of the amorphous copolymer give the laminate excellent release properties when this side is placed against the thermoset part to be cured . the polyimide layer of the laminate provides strength to prevent pinholing when the bag enclosing the thermoset part is evacuated and raised to curing temperature . after curing and cooling the laminate is easily separated from the part . a thermal laminate containing film of amorphous copolymer as its outer faces and a film of oriented polypropylene as the core is useful as a low - cost film structure with outstanding chemical resistance and stain resistance combined with excellent mechanical properties . such laminates can be used to protect sensitive instruments from environmental damage . pipe , tubing and fittings which are made from or lined with the amorphous copolymer of this invention prevent the contamination of the process liquid with metal ions , plasticizer , or degradation products from the fluid handling system . such fluid handling components are of very high purity , are inert to most common chemicals , and are easily fabricated by injection molding , extrusion , machining from stock . alternatively , fluid handling system components may be fabricated from metal , glass , or other plastic and subsequently lined with amorphous copolymer of this invention by solution coating , dispersion coating , or electrostatic powder coating . in addition to pipe , tubing and fittings , other useful fluid handling articles made from the amorphous copolymers of this invention are pump housings , pump impellers , valve bodies , valve stems , valve seals , diaphragms , tanks , trays , pipettes , laboratory vessels . such articles are especially useful in semiconductor processing fluid handling systems where parts - per - billion purity is required in process water and chemicals . also , in molecular biology research laboratories where extreme purity is required , and microgram quantities must be completely released from the vessels in which they are handled , the fluid handling articles made from the amorphous copolymer of this invention are particularly useful . the amorphous copolymers of this invention are particularly useful when fabricated into articles to transport materials and components through chemical treatment processes . for example in the manufacturing process for semiconductor chips the silicon wafers must be transported through a series of chemical treatment steps ; the containers in which the silicon wafers are carried must be chemically inert to prevent contamination of the chips , and they must be rigid and dimensionally stable to permit precise automatic positioning at each stage of the process . compared to the conventional fluoroplastics used for such wafer carriers , e . g ., the copolymer of tetrafluoroethylene and perfluoro ( propyl vinyl ether ), the amorphous copolymers of the present invention have greater rigidity and greater dimensional stability . this advantage makes possible the fabrication of larger wafer carriers , e . g , baskets to hold silicon wafers of 30 cm in diameter ; wafer carriers made from conventional fluoroplastics are too low in flexural modulus to be useful for wafers larger than about 15 cm in diameter . other conveying system components for which articles made from the amorphous copolymers of the present invention are especially well suited are guide rails , conveyor belt links , bearings and rollers , clamps , racks , hooks , positioning pins , robot arm jaws and fingers , gears , cams and similar mechanical parts which must be precisely engineered , have good high temperature mechanical properties , retain dimensions , be chemically pure and chemically inert . conveying system components made from the amorphous copolymers of this invention exposed to corrosive chemicals or ultrapure water are superior to all conventional fluoroplastics because of the superior high temperature mechanical properties and dimensional stability of the polymers of this invention . the low dielectric constant ( 2 . 1 ) and low coefficient of thermal expansion of the amorphous copolymers of this invention make them especially useful as dielectrics in electrical and electronic applications . for example , the dielectric used between the separate circuit layers in high speed digital multi - layer circuit boards must be very low in dielectric constant and be very dimensionally stable from - 20 ° c . up to soldering temperature of approximately 225 ° c . polyimide is dimensionally stable but has a high dielectric constant (& gt ; 3 ); in addition it is susceptible to atmospheric moisture ; the amorphous copolymers of this invention do not have these deficiencies , and multi - layered circuits which have this polymer as a dielectric between circuit layers are capable of greater speed and greater circuit density . the low moisture absorption , outstanding chemical resistance , purity , thermal stability , and dimensional stability of the amorphous copolymers of this invention make them especially suited for the protection of sensitive electronic circuits and components . unlike conventional fluoroplastics the polymers of the present invention can be dissolved to form coating and encapsulating solutions . for example , a so - called &# 34 ; smart connector &# 34 ; may be encapsulated by dipping it , pins up , in a solution of the amorphous copolymer of example 1 and evaporating the fc - 75 solvent to leave a protective film of polymer to exclude environmental water and corrosive chemicals . in another embodiment the polymers of this invention may be used instead of a thin layer of gold , so - called &# 34 ; gold flash &# 34 ;, to protect electronic connectors from corrosion from atmospheric chemicals . whole electronic or electro - optic circuits may be encapsulated by the amorphous copolymers of this invention by a solution coating process , which is not possible with conventional fluoropolymers because of their insolubility in practical solvents . it is well known that aqueous dispersions of conventional fluoropolymers may be used to impregnate and encapsulate articles such as glass fabric and metal parts ; however , the application of such dispersions is limited to substrates which can tolerate the high baking temperatures (& gt ; 200 ° c .) required to fuse the fluoroplastic into a pinhole - free coating . in contrast to aqueous dispersions of conventional fluoroplastics , solutions of the amorphous copolymers of the present invention may be applied to temperature sensitive substrates such as electronic circuits or electronic components made from thermoplastics , and the solvent evaporated at moderate temperature ( 100 ° c . or less ) to leave a protective polymer film without the necessity of high temperature baking to fuse the polymer . as the amount of pdd in the copolymers of the present invention increases , the tg also increases , although not necessarily in a linear fashion . tg is determined by differential scanning calorimetry ( dsc ) according to astm method d - 3418 . examination of the dsc curve shows only a second order transition and no first order transition , indicating the absence of crystallinity . the relative proportions of the comonomers in the copolymer can be determined by fluorine - 19 nuclear magnetic resonance spectroscopy ( 19 f nmr ). the proportion of hydrogen - containing monomers can be determined by proton nmr together with 19 f nmr . the proportions of comonomers in some copolymers also can be determined by x - ray fluorescence ( xrf ), e . g . using a philips electronic instruments 1404 xrf spectrometer . calibration of x - ray fluoroescence intensity as a function of weight % oxygen and fluorine can be accomplished using three polymer samples of known composition which bracket the anticipated fluorine and oxygen content of the unknown pdd copolymers . the copolymers of pdd with the fluoromonomers of this invention are readily melt - processible , so that they can be fabricated into articles by such techniques as , e . g ., injection molding and extrusion . furthermore , they have low refractive indices , which is a particularly desirable feature for optical fiber cladding . since they are soluble in fc - 75 , they can be conveniently applied to substrates , such as optical fibers or flexible or rigid circuit boards , from solution to give thin polymer layers . furthermore , films of these copolymers are clear and transparent , compared with hazy or translucent films of crystalline polymers . for this reason , the amorphous copolymers of the present invention are suitable for such applications as , for example , windows for chemical reactors , especially for processes using or manufacturing hydrogen fluoride . it is to be noted that , while pdd homopolymers also are amorphous and have good chemical properties , they are not readily melt - fabricable because of some degradation occurring at the high processing temperatures required . copolymerization is carried out in the presence of a free radical generator at a temperature suitable for the initiator chosen . well agitated pressure equipment and a nontelogenic solvent or diluent should be used , preferably one that has sufficient volatility to permit easy removal from the polymer . this invention is now illustrated by the following examples of certain preferred embodiments thereof , where all parts , proportions , and percentages are by weight , unless otherwise indicated . most tg &# 39 ; s were determined using du pont differential thermal analyzer model 1090 with 910 or 912 dsc modules . all units have been converted to si units . a mixture of 5 . 0 g of pdd , 0 . 100 g of 4 , 4 &# 39 ;- bis ( t - butylcyclohexyl ) peroxydicarbonate , and 40 . 0 g of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane was placed in a pressure tube . the mixture was thoroughly degassed , sealed , and placed in a constant temperature bath at 30 ° c . for 20 hours . the polymerization mixture appeared as a thick , translucent slurry of polymer particles dispersed in 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane . the volatile material was removed by distillation , and the polymer residue was dried at 150 ° c . for 20 hours to give 4 . 7 g of pdd homopolymer . the products of four identical runs were combined . the polymer had two glass transition temperatures , at 333 ° and 350 ° c . the pdd homopolymer could not be melt - fabricated by compression molding without some degradation ( evidenced by gas evolution ). moldings could be obtained within the temperature range 355 °- 370 ° c . above 370 ° c ., the degradation was quite noticeable ; below 350 ° c ., the polymer flow was insufficient for producing moldings , and coalescence to a homogeneous test slab was not achieved . pdd homopolymer could be cast from perfluoro ( 2 - butyltetrahydrofuran ) solution . that material had good physical properties ( e . g ., high modulus ) but this technique is impractical for thick parts . a 2 - liter vertical reactor equipped with a four - bladed impeller type agitator was charged with 1500 ml of deoxygenated , deionized water , 3 . 75 g of ammonium perfluorononanoate surfactant , and 4 . 70 g of ammonium sulfite . the reactor was pressurized with chlorotrifluoroethylene ( ctfe ), then vented . with the agitator running at 600 rpm , 25 ml of a 7 % ammonium persulfate ( aps ) solution in water was introduced into the reactor heated to 60 ° c . ; next , an initial charge of 2 . 63 g of ctfe and 16 g of pdd was added . after the mixture had been stirred for 30 minutes , continuous feed of 5 . 25 g / hr of ctfe , 32 g / hr of pdd ( ctfe / pdd mole ratio of 0 . 344 ) and 10 ml / hr of aps solution was begun and continued for 4 . 5 hours . the reactor was cooled to 30 ° c ., and a dispersion containing 9 . 4 % of solids was recovered . concentrated nitric acid ( 15 ml ) was added to the dispersion in a blender and agitated . the dispersion separated into a water phase and a copolymer phase . the copolymer was filtered off , dried in an oven at 110 ° c . for 24 hours , and further dried in a vacuum oven at 100 ° c . to remove any traces of water . the copolymer was next fluorinated for 6 hours at 100 ° c . with a 25 : 75 fluorine / nitrogen mixture in a reactor which had been evacuated and purged with nitrogen . the total gas flow amounted to 0 . 132 part of fluorine per part of copolymer . the reactor was then purged with nitrogen and cooled . the granulated amorphous copolymer , which was recovered , had a single glass transition temperature of 174 ° c . its composition was 19 . 7 mole % ctfe and 80 . 3 mole % pdd . a copolymer of pdd and ctfe was prepared in the same manner as described in example 1 , except that the initial charge consisted of 2 . 66 g of ctfe and 16 g of pdd ( ctfe / pdd mole ratio of 0 . 348 ). the dispersion recovered from the polymerization reactor contained 9 . 03 % solids . the resulting copolymer was fluorinated as described in example 1 . it was amorphous , with a single tg of 184 ° c . and had a monomer composition of ctfe / pdd of 23 : 77 mole %. a cold 200 ml hastelloy ( tm ) c shaker tube was charged with 30 g of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane , 6 g ( 0 . 0246 mole ) of pdd , 0 . 02 g of 4 , 4 &# 39 ;- bis ( t - butylcyclohexyl ) peroxydicarbonate , and 1 g ( 0 . 00237 mole ) of eve . the tube was evacuated while cold and flushed several times with nitrogen , then agitated 12 hours at 40 ° c . the resulting dipolymer was collected and dried 24 hours at 100 ° c . in a vacuum oven at 20 . 3 kpa pressure . the yield of dipolymer was 4 . 5 g ( 64 % conversion ). the dipolymer was amorphous , had a tg of 186 . 7 ° c ., and contained 90 . 8 mole % of pdd , as determined by 19 f nmr spectroscopy . its inherent viscosity was 0 . 0735 m 3 / kg , as measured at 27 ° c . in a 3 . 33 kg / m 3 solution in fc - 75 ®. a cold 240 ml hasteloy ( tm ) c shaker tube was charged with 50 g of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane and 10 g ( 0 . 041 mole ) of pdd , 0 . 1 g of 4 , 4 &# 39 ;- bis ( t - butylcyclohexyl ) peroxydicarbonate . the tube was evacuated cold and was charged with 2 g ( 0 . 0133 mole ) of hexafluoropropene . the tube was agitated at 60 ° c . for 2 hours and at 70 ° c . for 2 hours . the resulting dipolymer was collected and dried at 130 ° c . in a vacuum oven for 10 hours . a white dipolymer powder , 7 . 4 g ( 62 % conversion ) was obtained . the dipolymer was amorphous , had a tg of 265 °- 270 ° c ., and contained 94 . 6 mole % pdd . the inherent viscosity of the dipolymer was 0 . 0293 m 3 / kg , as measured at 23 ° c . in a 3 . 33 kg / m 3 solution in fc - 75 ®. a 500 ml creased , jacketed flask equipped with a mechanical stirrer , nitrogen sparger , and syringe inlet was charged with 200 ml of water and 1 . 02 g of ammonium perfluorononanoate . the flask was warmed up to dissolve ammonium perfluorononanoate and then cooled to room temperature . concentrated ammonium hydroxide ( 3 ml ), sodium sulfite ( 0 . 85 g , 0 . 0067 mole ), pdd ( 25 g , 0 . 1025 mole ), and perfluoro ( n - propyl vinyl ether ) ( 11 . 7 g , 0 . 044 mole ) were charged into the flask in that order . the contents of the flask were stirred at 500 rpm . potassium persulfate ( 0 . 90 g , 0 . 0033 mole ) was injected into the flask . the reaction mixture was stirred overnight ( total reaction time 21 . 5 hours ). the resulting coagulum was filtered off , and the remaining latex was diluted with methanol , then coagulated with 20 g of magnesium sulfate in 100 ml of water . the resulting dipolymer was collected , washed three times with a methanol / water mixture , and dried overnight . the dry dipolymer weighed 12 . 6 g . the inherent viscosity of this amorphous copolymer was 0 . 0904 m 3 / kg , as measured at 30 ° c . in a 3 . 33 kg / m 3 solution in fc - 75 ®, and its tg was 228 ° c . the approximate mole fraction of pdd in this dipolymer is 92 %. a cold 240 ml hastelloy ( tm ) c shaker tube was charged with 80 g of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane , 15 g ( 0 . 0615 mole ) of pdd , 2 g ( 0 . 00474 mole ) of eve and 0 . 05g of 4 , 4 &# 39 ;- bis ( t - butylcyclohexyl ) peroxydicarbonate . the tube was sealed , evacuated while cold , and was charged with 0 . 8 g (± 0 . 2 g ) ( 0 . 008 mole ) of tfe . the tube was agitated at 40 ° c . for 12 hours . the resulting terpolymer was collected and dried 20 hours in a vacuum oven at 120 ° c . a white resin 10 . 5 g ( 59 % conversion ) was obtained . this terpolymer was amorphous and had a t g of 162 ° c . the inherent viscosity of the terpolymer was 0 . 0734 m 3 / kg , as measured at 25 ° c . in a 3 . 33 kg / m 3 solution in fc - 75 ®. the terpolymer had a composition of pdd / tfe / eve = 79 . 5 / 16 . 5 / 4 . 0 ( mole %) as determined by f - 19 nmr spectroscopy . a 2 - liter horizontal reactor equipped with a paddle stirrer was charged with 1150 ml of deionized water , 4 g of ammonium perfluorononanoate , and 1 . 25 g of ammonium sulfite . with the stirrer turning at 70 rpm , an initial charge of 14 g of perfluoro ( methyl vinyl ether ) ( pmve ) and 32 g of pdd ( pmve / pdd mole ratio of 0 . 643 ) was introduced into the reactor heated to 65 ° c . then , 30 ml of a 1 % ammonium persulfate solution ( aps ) in water was added . the mixture was stirred at 65 ° c . for 10 minutes , after which a continuous feed of 20 g / hr of pmve , 48 g / hr of pdd , and 30 ml of the aps solution was begun and continued for 6 hours . the reactor was cooled to 30 ° c . a dispersion containing 11 . 5 % of solids was recovered . the dispersion was coagulated by addition of 10 ml of concentrated nitric acid in a blender , separating into a water phase and a copolymer phase . the copolymer was dried 24 hours at 105 ° c . in an oven at normal pressure and then at 100 ° c . in a vacuum oven to remove any traces of water . the copolymer was then fluorinated at 100 ° c . for 6 hours in a previously evacuated and nitrogen - purged reactor with a 25 : 75 fluorine / nitrogen mixture , which was passed at the total rate of 0 . 085 part of fluorine per part of copolymer . the resulting amorphous copolymer had a single tg of 173 ° c . and had a monomer composition of pmve / pdd of 13 : 87 mole %. a 2 liter horizontal polymerization kettle equipped with a paddle type agitator was charged with a solution of 1100 g of demineralized water containing 2 . 0 g of ammonium sulfite and heated to 60 ° c . the polymerization kettle was evacuated to 68 kpa . to the evacuated polymerization kettle were added 50 ml of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane and 8 . 0 g of asahi glass &# 34 ; surfion &# 34 ; s111s fluorosurfactant ( which is essentially ammonium perfluorononanoate ). with the agitator still off , 26 . 7 ml ( 42 . 7 g , 0 . 175 mole ) of pdd was pressured into the polymerization kettle to give a pressure of 90 kpa . then 13 . 5 g ( 0 . 116 mole ) of ctfe was added , raising the pressure to 207 kpa . the mole fraction of ctfe in the monomer charge thus was 39 . 9 %. after both monomers were added , agitation was begun at a rate of 200 rpm and a 1 % aqueous solution of ammonium persulfate initiator was added at a rate of 150 ml / hr . after 36 minutes of feeding the initiator at this rate , reactor pressure had dropped to 179 kpa , indicating that polymerization had begun . at this point , ammonium persulfate addition was reduced to a feed rate of 60 ml / hr . pdd was now fed at a continuous rate of 51 . 7 ml / hr ( 82 . 7 g / hr , 0 . 34 mole / hr ), and ctfe monomer was fed at a continuous rate of 26 . 7 g / hr ( 0 . 23 mole / hr ) until a total of 155 ml ( 248 g , 1 . 02 mole ) of pdd and 80 . 1 g ( 0 . 69 mole ) of ctfe had been added after the initial pressure drop . the mole fraction of ctfe in the continuously fed monomer thus was 40 . 4 %. addition of both monomers and initiator was stopped at this time . after a further pressure drop to 158 kpa , the polymerization kettle was vented and the contents were recovered . the resulting cooled latex weighed 1 , 732 g and had a solids content of 19 . 8 %. an additional 554 ml of deionized water was added to dilute the latex to 15 % solids . the diluted latex was transferred to a 5 l jacketed flask equipped with a mechanical paddle stirrer . the stirrer was turned at 350 rpm while 25 ml of concentrated ( 16m ) nitric acid was added rapidly . the dispersion gradually thickened to a gel . stirring was stopped for 15 minutes . when stirring was resumed at 350 rpm , 86 ml of 1 , 1 , 2 - trichloro - 1 , 2 , 2 - trifluoroethane was poured into the flask at a rate of 300 ml / min . the gel immediately separated into copolymer and water phases . stirring was continued for 15 minutes , after which the temperature was raised at a rate of 2 . 5 ° c ./ min to 45 ° c . by circulating hot water through the jacket of the flask . a nitrogen purge was begun in the flask to aid in solvent removal . stirring at 45 ° c . was continued for 1 hour to remove the bulk of the solvent , and then the temperature was raised to 75 ° c . at a rate of 2 . 5 ° c ./ minute . a dip tube with filter cloth at the bottom was placed into the flask , and water was pumped out of the flask with a peristaltic pump at the rate of 45 ml / minute . fresh water was added to the flask at the same rate in order to keep the volume approximately constant . this washing was continued for about 2 hours , or until the ph of the effluent water was 7 as determined with an indicator paper . at this point , water addition was stopped and all but about 50 ml of water was removed from the flask . twenty - five ml of triethylamine was added to the flask , and the contents were allowed to stir at 77 ° c . under reflux for 12 hours . the solid copolymer was then recovered by vacuum filtration , washed twice with 100 ml aliquots of demineralized water , then dried in a vacuum oven for 12 hours at 100 ° c . the yield was 230 g of light brown polymer with a glass transition temperature of 149 ° c ., corresponding to a ctfe content of 35 mole percent . the ctfe content was determined from a calibration curve of tg vs . ctfe content , where ctfe content had been obtained by chlorine analysis . | 7 |
the following description with reference to the drawings provides illustrative examples of devices and methods according to embodiments of the invention . such description is for illustrative purposes only and not for purposes of limiting the same . in the context of the current application , the term “ semiconductor substrate ” or “ semiconductive substrate ” or “ semiconductive wafer fragment ” or “ wafer fragment ” or “ wafer ” will be understood to mean any construction comprising semiconductor material , including but not limited to bulk semiconductive materials such as a semiconductor wafer ( either alone or in assemblies comprising other materials thereon ), and semiconductive material layers ( either alone or in assemblies comprising other materials ). the term “ substrate ” refers to any supporting structure including , but not limited to , the semiconductive substrates , wafer fragments or wafers described above . “ l o ” as used herein is the inherent periodicity or pitch value ( bulk period or repeat unit ) of structures that self assemble upon annealing from a self - assembling ( sa ) block copolymer . “ l b ” as used herein is the periodicity or pitch value of a blend of a block copolymer with one or more of its constituent homopolymers . “ l ” is used herein to indicate the center - to - center cylinder pitch or spacing of cylinders of the block copolymer or blend , and is equivalent to “ l o ” for a pure block copolymer and “ l b ” for a copolymer blend . in embodiments of the invention , a polymer material ( e . g ., film , layer ) is prepared by guided self - assembly of block copolymers , with both polymer domains at the air interface . the block copolymer material spontaneously assembles into periodic structures by microphase separation of the constituent polymer blocks after annealing , forming ordered domains of perpendicular - oriented cylinders at nanometer - scale dimensions within a trench . a method for fabricating a self - assembled block copolymer material that defines a one - dimensional ( 1 - d ) array of nanometer - scale , perpendicular - oriented cylinders according to an embodiment of the invention is illustrated with reference to fig1 - 8 . the described embodiment involves a thermal anneal of a cylindrical - phase block copolymer under a solvent atmosphere . the anneal is conducted in combination with a graphoepitaxy technique that utilizes a lithographically defined trench as a guide with a floor composed of a material that is neutral wetting to both polymer blocks , and sidewalls and ends that are preferential wetting to one polymer block and function as constraints to induce the block copolymer to self - assemble into an ordered 1 - d array of a single row of cylinders in a polymer matrix oriented perpendicular to the trench floor and registered to the trench sidewalls . in some embodiments , two or more rows of perpendicular - oriented cylinders can be formed in each trench . as depicted in fig1 - 1b , a substrate 10 is provided , which can be silicon , silicon oxide , silicon nitride , silicon oxynitride , silicon oxycarbide , among other materials . as further depicted , conductive lines 12 ( or other active area , e . g ., semiconducting regions ) are situated within the substrate 10 . in any of the described embodiments , a single trench or multiple trenches can be formed in the substrate , and can span the entire width of an array of lines ( or other active area ). in embodiments of the invention , the substrate 10 is provided with an array of conductive lines 12 ( or other active areas ) at a pitch of l . the trench or trenches are formed over the active areas 12 ( e . g ., lines ) such that when the block copolymer material is annealed , each cylinder will be situated above a single active area 12 ( e . g ., conductive line ). in some embodiments , multiple trenches are formed with the ends ( 24 ) of each adjacent trench 18 aligned or slightly offset from each other at less than 5 % of l such that cylinders in adjacent trenches are aligned and situated above the same line 12 . in the illustrated embodiment , a neutral wetting material 14 ( e . g ., random copolymer ) has been formed over the substrate 10 . a material layer 16 ( or one or more material layers ) can then be formed over the neutral wetting material and etched to form trenches 18 that are oriented perpendicular to the array of conductive lines 12 , as shown in fig2 - 2b . portions of the material layer 16 form a spacer 20 outside and between the trenches . the trenches 18 are structured with opposing sidewalls 22 , opposing ends 24 , a floor 26 , a width ( w t ), a length ( l t ) and a depth ( d t ). in another embodiment , the material layer 16 ′ can be formed on the substrate 10 ′, etched to form the trenches 18 ′ as depicted in fig3 , and a neutral wetting material 14 ′ can then be formed on the trench floors 26 ′ as shown in fig4 . for example , a random copolymer material can be deposited into the trenches 18 ′ and crosslinked to form a neutral wetting material layer . material on surfaces outside the trenches such as on the spacers 20 ′ ( e . g ., non - crosslinked random copolymer ) can be subsequently removed . single or multiple trenches 18 ( as shown ) can be formed using a lithographic tool having an exposure system capable of patterning at the scale of l ( 10 - 100 nm ). such exposure systems include , for example , extreme ultraviolet ( euv ) lithography , proximity x - rays and electron beam ( e - beam ) lithography , as known and used in the art . conventional photolithography can attain ( at smallest ) about 58 nm features . a method called “ pitch doubling ” or “ pitch multiplication ” can also be used for extending the capabilities of photolithographic techniques beyond their minimum pitch , as described , for example , in u . s . pat . no . 5 , 328 , 810 ( lowrey et al . ), u . s . pat . no . 7 , 115 , 525 ( abatchev , et al . ), us 2006 / 0281266 ( wells ) and us 2007 / 0023805 ( wells ). briefly , a pattern of lines is photolithographically formed in a photoresist material overlying a layer of an expendable material , which in turn overlies a substrate , the expendable material layer is etched to form placeholders or mandrels , the photoresist is stripped , spacers are formed on the sides of the mandrels , and the mandrels are then removed leaving behind the spacers as a mask for patterning the substrate . thus , where the initial photolithography formed a pattern defining one feature and one space , the same width now defines two features and two spaces , with the spaces defined by the spacers . as a result , the smallest feature size possible with a photolithographic technique is effectively decreased down to about 30 nm or less . factors in forming a single ( 1 - d ) array or layer of perpendicular - oriented nanocylinders within the trenches include the width ( w t ) and depth ( d t ) of the trench , the formulation of the block copolymer or blend to achieve the desired pitch ( l ), and the thickness ( t ) of the block copolymer material within the trench . there is a shift from two rows to one row of the perpendicular cylinders within the center of the trench as the width ( w t ) of the trench is decreased and / or the periodicity ( l value ) of the block copolymer is increased , for example , by forming a ternary blend by the addition of both constituent homopolymers . the boundary conditions of the trench sidewalls 22 in both the x - and y - axis impose a structure wherein each trench contains “ n ” number of features ( e . g ., cylinders ). for example , a block copolymer or blend having a pitch or l value of 35 - nm deposited into a 75 - nm wide trench having a neutral wetting floor will , upon annealing , result in a zigzag pattern of 17 . 5 - nm diameter (˜ 0 . 5 * l ) perpendicular cylinders that are offset by about one - half the pitch distance ( about 0 . 5 * l ) for the length ( l t ) of the trench , rather than a single line row of perpendicular cylinders aligned with the sidewalls down the center of the trench . in the illustrated embodiment , the trenches 18 are constructed with a width ( w t ) of about 1 . 5 − 2 * l ( or 1 . 5 − 2 × the pitch value ) of the block copolymer such that a cast block copolymer material ( or blend ) of about l will self assemble upon annealing into a single row of perpendicular cylinders ( diameter ˜ 0 . 5 * l ) with a center - to - center pitch distance ( p ) of adjacent cylinders at or about l . for example , in using a cylindrical phase block copolymer with an about 50 nm pitch value or l , the width ( w t ) of the trenches 18 can be about 1 . 5 − 2 * 50 nm or about 75 - 100 nm . the length ( l t ) of the trenches is at or about n * l or an integer multiple of l , typically within a range of about n * 10 to about n * 100 nm ( with n being the number of features or structures , e . g ., cylinders ). the depth ( d t ) of the trenches 18 is greater than or equal to l ( d t & gt ; l ). the width of the spacers 20 between adjacent trenches can vary and is generally about l to about n * l . in some embodiments , the trench dimension is about 20 - 100 nm wide ( w t ) and about 100 - 25 , 000 nm in length ( l t ), with a depth ( d t ) of about 10 - 100 nm . a self - assembling , cylindrical - phase block copolymer material 28 having an inherent pitch at or about l o ( or a ternary blend of block copolymer and homopolymers blended to have a pitch at or about l b ) is deposited into the trenches 18 , typically as a film ( as in fig5 - 5b ). the block copolymer ( or blend ) is constructed such that all of the polymer blocks will have equal preference for a neutral wetting material on the trench floor . the block copolymer material can be constructed to provide desired properties such as defect tolerance and ease of development and / or removal of one of the blocks . in some embodiments of the invention , the block copolymer or blend is constructed such that the minor domain can be selectively removed . examples of diblock copolymers include , for example , poly ( styrene )- b - poly ( vinylpyridine ) ( ps - b - pvp ), poly ( styrene )- b - poly ( methylmethacrylate ) ( ps - b - pmma ) or other ps - b - poly ( acrylate ) or ps - b - poly ( methacrylate ), poly ( styrene )- b - poly ( lactide ) ( ps - b - pla ), poly ( styrene )- b - poly ( tert - butyl acrylate ) ( ps - b - ptba ), and poly ( styrene )- b - poly ( ethylene - co - butylene ( ps - b -( ps - co - pb )), poly ( styrene )- b - poly ( ethylene oxide ) ( ps - b - peo ), poly ( isoprene )- b - poly ( ethyleneoxide ) ( pi - b - peo ), poly ( isoprene )- b - poly ( methylmethacrylate ) ( pi - b - pmma ), poly ( butadiene )- b - poly ( ethyleneoxide ) ( pbd - b - peo ), a ps - b - peo block copolymer having a cleavable junction such as a triphenylmethyl ( trityl ) ether linkage between ps and peo blocks ( optionally complexed with a dilute concentration ( e . g ., about 1 wt -%) of a salt such as kcl , ki , licl , lii , cscl or csi ( zhang et al ., adv . mater . 2007 , 19 , 1571 - 1576 ), ps - b - pmma block copolymer doped with peo - coated gold nanoparticles of a size less than the diameter of the self - assembled cylinders ( park et al , macromolecules , 2007 , 40 ( 11 ), 8119 - 8124 ), and a poly ( styrene )- b - poly ( 2 - vinylpyridine ) ( ps - b - p2vp ) block copolymer having a cleavable junction such as a dithiol group , among others , with ps - b - pvp used in the illustrated embodiment . other types of block copolymers ( i . e ., triblock or multiblock copolymers ) can be used . examples of triblock copolymers include abc copolymers such as poly ( styrene - b - methyl methacrylate - b - ethylene oxide ) ( ps - b - pmma - b - peo ), and aba copolymers such as ps - pmma - ps , pmma - ps - pmma , and ps - b - pi - b - ps , among others . the film morphology , including the domain sizes and periods ( l o ) of the microphase - separated domains , can be controlled by chain length of a block copolymer ( molecular weight , mw ) and volume fraction of the ab blocks of a diblock copolymer to produce cylindrical morphologies ( among others ). for example , for volume fractions at ratios of the two blocks generally between about 60 : 40 and 80 : 20 ( a : b ), the diblock copolymer will microphase separate and self - assemble into periodic cylindrical domains of polymer b within a matrix of polymer a . an example of a cylinder - forming ps - b - pvp copolymer material ( l o ˜ 28 nm ) to form about 14 nm diameter cylindrical pvp domains in a matrix of ps is composed of about 70 wt -% ps and 30 wt -% pvp with a total molecular weight ( m n ) of 44 . 5 kg / mol . an example of a cylinder - forming ps - b - pmma copolymer material ( l o = 35 nm ) to form about 20 nm diameter cylindrical pmma domains in a matrix of ps is composed of about 70 wt -% ps and 30 wt -% pmma with a total molecular weight ( mn ) of 67 kg / mol . as another example , a ps - b - pla copolymer material ( l = 49 nm ) can be composed of about 71 wt -% ps and 29 wt -% pla with a total molecular weight ( mn ) of about 60 . 5 kg / mol to form about 27 nm diameter cylindrical pla domains in a matrix of ps . the l value of the block copolymer can be modified , for example , by adjusting the molecular weight of the block copolymer . the block copolymer material can also be formulated as a binary or ternary blend comprising a block copolymer and one or more homopolymers ( hps ) of the same type of polymers as the polymer blocks in the block copolymer , to produce a blend that will swell the size of the polymer domains and increase the l value . the concentration of homopolymers in the blend can range from 0 to about 60 wt -%. an example of a ternary diblock copolymer blend is a ps - b - p2vp / ps / p2vp blend , for example , 60 wt -% of 32 . 5 k / 12 k ps - b - p2vp , 20 wt -% of 10 k ps , and 20 wt -% of 10 k p2vp . another example of a ternary diblock copolymer blend is a ps - b - pmma / ps / pmma blend , for example , 60 wt -% of 46k / 21k ps - b - pmma , 20 wt -% of 20k polystyrene and 20 wt -% of 20k poly ( methyl methacrylate ). yet another example is a blend of 60 : 20 : 20 ( wt -%) of ps - b - peo / ps / peo , or a blend of about 85 - 90 wt -% ps - b - peo and up to 10 - 15 wt -% peo ; it is believed that the added peo homopolymer may function , at least in part , to lower the surface energy of the peo domains to that of ps . in the present embodiment , the trench floors 26 are structured to be neutral wetting ( equal affinity for both blocks of the copolymer ) to induce formation of cylindrical polymer domains that are oriented perpendicular to the trench floors , and the trench sidewalls 22 and ends 24 are structured to be preferential wetting by one block of the block copolymer to induce registration of the cylinders to the sidewalls as the polymer blocks self - assemble . in response to the wetting properties of the trench surfaces , upon annealing , the preferred or minority block of the cylindrical - phase block copolymer will self - assemble to form a single row of cylindrical domains in the center of a polymer matrix for the length of the trench and segregate to the sidewalls and edges of the trench to form a thin interface brush or wetting layer ( e . g ., as in fig6 - 6b ). entropic forces drive the wetting of a neutral wetting surface by both blocks , and enthalpic forces drive the wetting of a preferential - wetting surface by the preferred block ( e . g ., the minority block ). to provide preferential wetting surfaces , for example , in the use of a ps - b - pvp ( or ps - b - pmma , etc .) block copolymer , the material layer 16 can be composed of silicon ( with native oxide ), oxide ( e . g ., silicon oxide , sio x ), silicon nitride , silicon oxycarbide , indium tin oxide ( ito ), silicon oxynitride , and resist materials such as methacrylate - based resists and polydimethyl glutarimide resists , among other materials , which exhibit preferential wetting toward the pvp ( or pmma , etc .) block . in the use of a ps - b - pvp cylinder - phase block copolymer material , for example , the block copolymer material will self assemble to form a thin interface layer and cylinders of pvp in a ps matrix . in other embodiments , a preferential wetting material such as a polymethylmethacrylate ( pmma ) polymer modified with an — oh containing moiety ( e . g ., hydroxyethylmethacrylate ) can be applied onto the surfaces of the trenches , for example , by spin coating and then heating ( e . g ., to about 170 ° c .) to allow the terminal oh groups to end - graft to oxide sidewalls 22 and ends 24 of the trenches . non - grafted material can be removed by rinsing with an appropriate solvent ( e . g ., toluene ). see , for example , mansky et al ., science , 1997 , 275 , 1458 - 1460 , and in et al ., langmuir , 2006 , 22 , 7855 - 7860 . a neutral wetting trench floor 26 allows both blocks of the copolymer material to wet the floor of the trench . a neutral wetting material 14 can be provided by applying a neutral wetting polymer ( e . g ., a neutral wetting random copolymer ) onto the substrate 10 , forming the material layer 16 and then etching the trenches to expose the underlying neutral wetting material , as illustrated in fig2 - 2b . in another embodiment illustrated in fig3 - 4 , a neutral wetting random copolymer material can be applied after forming the trenches 18 ′, for example , as a blanket coat by casting or spin - coating into the trenches , as depicted in fig4 . the random copolymer material can then be thermally processed to flow the material into the bottom of the trenches by capillary action , which results in a layer ( mat ) 14 ′ composed of the crosslinked , neutral wetting random copolymer . in another embodiment , the random copolymer material within the trenches can be photo - exposed ( e . g ., through a mask or reticle ) to crosslink the random copolymer within the trenches to form the neutral wetting material 14 ′. non - crosslinked random copolymer material outside the trenches ( e . g ., on the spacers 20 ′) can be subsequently removed . neutral wetting surfaces can be specifically prepared by the application of random copolymers composed of monomers identical to those in the block copolymer and tailored such that the mole fraction of each monomer is appropriate to form a neutral wetting surface . for example , in the use of a ps - b - pvp block copolymer , a neutral wetting material 14 can be formed from a thin film of a photo - crosslinkable random ps - r - pvp that exhibits non - preferential or neutral wetting toward ps and pvp , which can be cast onto the substrate 10 ( e . g ., by spin coating ). the random copolymer material can be fixed in place by chemical grafting ( on an oxide substrate ) or by thermally or photolytically crosslinking ( any surface ) to form a mat that is neutral wetting to ps and pvp and insoluble when the block copolymer material is cast onto it , due to the crosslinking . in another example , in the use of ps - b - pmma , a photo - crosslinkable ps - r - pmma random copolymer ( e . g ., containing an about 0 . 6 mole fraction of styrene ) can be used . in embodiments in which the substrate 10 is silicon ( with native oxide ), another neutral wetting surface for ps - b - pmma can be provided by hydrogen - terminated silicon . the floors 26 of the trenches 18 can be etched , for example , with a hydrogen plasma , to remove the oxide material and form hydrogen - terminated silicon , which is neutral wetting with equal affinity for both blocks of a block copolymer material . h - terminated silicon can be prepared by a conventional process , for example , by a fluoride ion etch of a silicon substrate ( with native oxide present , about 12 - 15 å ) by exposure to an aqueous solution of hydrogen fluoride ( hf ) and buffered hf or ammonium fluoride ( nh 4 f ), by hf vapor treatment , or by a hydrogen plasma treatment ( e . g ., atomic hydrogen ). an h - terminated silicon substrate can be further processed by grafting a random copolymer such as ps - r - pvp , ps - r - pmma , etc . selectively onto the substrate resulting in a neutral wetting surface for the corresponding block copolymer ( e . g , ps - b - pvp , ps - b - pmma , etc .). for example , a neutral wetting layer of a ps - r - pmma random copolymer can be provided by an in situ free radical polymerization of styrene and methyl methacrylate using a di - olefinic linker such as divinyl benzene which links the polymer to the surface to produce about a 10 - 15 nm thick film . referring again to fig3 - 4 , in another embodiment , a neutral wetting random copolymer material 14 ′ can be applied after formation of the material layer 16 ′ and trenches 18 ′, which reacts selectively with the trench floor 26 ′ ( composed of the substrate 10 ′ material ) and not the trench sidewalls 22 ′ or ends 24 ′ ( composed of the material layer 16 ′). for example , a random copolymer ( or appropriate blend of homopolymers with block copolymer surfactant ) containing epoxide groups will react selectively to terminal amine functional groups ( e . g . — nh — and — nh 2 ) on silicon nitride and silicon oxynitride surfaces relative to silicon oxide or silicon . in another example in which the trench floor 26 ′ is silicon or polysilicon and the sidewalls 22 ′ are a material such as an oxide ( e . g ., sio x ), the floor can be treated to form h - terminated silicon and a random copolymer material 14 ′ ( e . g ., ps - r - pvp , ps - r - pmma , etc .) can be formed in situ only at the floor surface . in another embodiment , a neutral wetting surface ( e . g ., for ps - b - pmma and ps - b - peo ) can be provided by grafting a self - assembled monolayer ( sam ) of a trichlorosilane - base sam such as 3 -( para - methoxyphenyl ) propyltrichorosilane grafted to oxide ( e . g ., sio 2 ) as described for example , by d . h . park , nanotechnology 18 ( 2007 ), p . 355304 . in a further embodiment , a neutral wetting random copolymer of polystyrene ( ps ), polymethacrylate ( pmma ) with hydroxyl group ( s ) ( e . g ., 2 - hydroxyethyl methacrylate ( p ( s - r - mma - r - hema )) ( e . g ., about 58 wt -% ps ) can be can be selectively grafted to a substrate 10 ( e . g ., an oxide ) as a neutral wetting layer 14 about 5 - 10 nm thick by heating at about 160 ° c . for about 48 hours . see , for example , in et al ., langmuir , 2006 , 22 , 7855 - 7860 . in yet another embodiment , a blend of hydroxyl - terminated homopolymers and a corresponding low molecular weight block copolymer can be grafted ( covalently bonded ) to the substrate to form a neutral wetting interface layer ( e . g ., about 4 - 5 nm ) for ps - b - pmma and ps - b - p2vp , among other block copolymers . the block copolymer can function to emulsify the homopolymer blend before grafting . for example , an about 1 wt -% solution ( e . g ., in toluene ) of a blend of about 20 - 50 wt -% ( or about 30 - 40 wt -%) oh - terminated homopolymers ( e . g ., m n = 6k ) and about 80 - 50 wt -% ( or about 70 - 60 wt -%) of a low molecular weight block copolymer ( e . g ., 5k - 5k ) can be spin coated onto a substrate 10 ( e . g ., sio 2 ), heated ( baked ) ( e . g ., at 160 ° c . ), and non - grafted ( unbonded ) polymer material removed , for example by a solvent rinse ( e . g ., toluene ). for example , the neutral wetting material can be prepared from a blend of about 30 wt -% ps - oh ( m n = 6k ) and pmma - oh ( m n = 6k ) ( weight ratio of 4 : 6 ) and about 70 wt -% ps - b - pmma ( 5k - 5k ), or a ternary blend of ps - oh ( 6k ), p2vp - oh ( 6k ) and ps - b - 2pvp ( 8k - 8k ), etc . a surface that is neutral wetting to ps - b - pmma can also be prepared by spin coating a blanket layer of a photo - or thermally cross - linkable random copolymer such as a benzocyclobutene - or azidomethylstyrene - functionalized random copolymer of styrene and methyl methacrylate ( e . g ., poly ( styrene - r - benzocyclobutene - r - methyl methacrylate ( ps - r - pmma - r - bcb )). for example , such a random copolymer can comprise about 42 wt -% pmma , about ( 58 - x ) wt -% ps and x wt -% ( e . g ., about 2 - 3 wt -%) of either polybenzocyclobutene or poly ( para - azidomethylstyrene )). an azidomethylstyrene - functionalized random copolymer can be uv photo - crosslinked ( e . g ., 1 - 5 mw / cm ̂ 2 exposure for about 15 seconds to about 30 minutes ) or thermally crosslinked ( e . g ., at about 170 ° c . for about 4 hours ) to form a crosslinked polymer mat as a neutral wetting layer 14 . a benzocyclobutene - functionalized random copolymer can be thermally cross - linked ( e . g ., at about 200 ° c . for about 4 hours or at about 250 ° c . for about 10 minutes ). as illustrated in fig5 - 5b , a self - assembling , cylindrical - phase block copolymer material 28 having an inherent pitch at or about l o ( or a ternary blend of block copolymer and homopolymers blended to have a pitch at or about l b ) can be cast or deposited into the trenches 18 to a thickness ( t 1 ) at or about the l value of the block copolymer material ( e . g ., about ± 20 % of l ) such that after annealing ( e . g ., fig6 a ), the thickness ( t 2 ) will be at or about the l value and the block copolymer material will self assemble to form a single layer of cylinders having a diameter of about 0 . 5 * l ( e . g ., 5 - 50 nm , or about 20 nm , for example ) within a polymer matrix in a single row within each trench 18 . the thickness of the block copolymer material 28 can be measured , for example , by ellipsometry techniques . the block copolymer material can be deposited by spin casting ( spin - coating ) from a dilute solution ( e . g ., about 0 . 25 - 2 wt % solution ) of the copolymer in an organic solvent such as dichloroethane ( ch 2 cl 2 ) or toluene , for example . capillary forces pull excess block copolymer material 28 ( e . g ., greater than a monolayer ) into the trenches 18 . as shown , a thin layer or film 28 a of the block copolymer material can be deposited onto the material layer 16 outside the trenches , e . g ., on the spacers 20 . upon annealing , the thin film 28 a will flow into the trenches leaving a structureless brush layer on the material layer 16 from a top - down perspective . the block copolymer ( bcp ) material 28 is then heated above its glass transition temperature under a vapor phase containing a partly - saturated concentration of an organic solvent to cause the polymer blocks to phase separate and self assemble according to the preferential and neutral wetting of the trench surfaces to form a self - assembled polymer material 30 , as illustrated in fig6 - 6b . the appropriate partial pressure of solvent vapor to achieve a neutral wetting vapor interface at a particular temperature depends , at least in part , on the block copolymer that is used and can be determined empirically . the block copolymer is heated at a thermal anneal temperature that is above its glass transition temperature ( t g ) but below the decomposition or degradation temperature ( t d ) of the block copolymer material . for example , a ps - b - pvp block copolymer material can be annealed at a temperature of about 150 - 275 ° c . in a solvent vapor atmosphere for about 1 - 24 hours to achieve a self - assembled morphology . a ps - b - pmma block copolymer material can be annealed at a temperature of about 150 - 275 ° c . in a solvent vapor atmosphere for about 1 - 24 hours to achieve a self - assembled morphology . in most applications of a thermal anneal in a vacuum , the air interface is preferentially wetting to one of the polymer domains and the bcp material does not orient into perpendicular structures . in embodiments of the invention , during heating , the bcp material 28 is exposed to solvent vapors of a “ good ” solvent for both blocks , that is , a neutral organic solvent that solvates both the constituent blocks well . in general , solvent annealing consists of two phases . in a first phase , the bcp material is exposed to a solvent vapor that acts to plasticize the film and increase chain mobility causing the domains to intermingle and the loss of order inherent from casting the polymer material . the organic solvent that is utilized is based at least in part on its solubility in the block copolymer material such that sufficient solvent molecules enter the block copolymer material to promote the order - disorder transition of the polymer domains and enable the required molecular rearrangement . examples of solvents include aromatic solvents such as benzene , toluene , xylene , dimethoxyethane , ethyl acetate , cyclohexanone , etc ., and chlorinated solvents such as chloroform , methylene chloride , a chloroform / octane mixture , etc ., among others . in a second phase , the substrate is removed from the solvent vapor and the solvent and solvent vapors are allowed to diffuse out of the polymer material and evaporate . the block copolymer material begins to “ dry ” as the solvent evaporates from the material . the evaporation of the solvent is highly directional and forms a solvent gradient from the “ top ” ( surface ) of the bcp material to the “ bottom ” of the bcp material at the trench floor that induces orientation and self - assembly of structures starting at the air - surface interface , which is neutral wetting due to the partial pressure of solvent at the interface , and driven downward to the floor of the trench , with formation of perpendicular - oriented cylindrical domains ( 34 ) guided by the trench sidewalls and extending completely from the air interface ( 46 ) to the substrate surface ( trench floor ). in embodiments of the invention , the substrate 10 and bcp material 28 are heated above the boiling point of the solvent such that swelling of the bcp material by the solvent is disallowed . the use of a partly - saturated solvent vapor phase above the block copolymer material provides a neutral wetting interface , similar to the second phase of solvent annealing . the concentration of solvent in the air immediate at the vapor interface with the bcp material is maintained at or under saturation to maintain a neutral wetting interface such that both ( or all ) polymer blocks will equally wet the vapor interface . as both the air and trench floor are neutral wetting , the domains will orient perpendicular throughout the film layer , with the preferential wetting sidewalls inducing lateral order . the resulting morphology of the annealed copolymer material 30 ( e . g ., perpendicular orientation of cylinders ) can be examined , for example , using atomic force microscopy ( afm ), transmission electron microscopy ( tem ), scanning electron microscopy ( sem ), among others . in embodiments of the invention , the anneal is performed by globally heating the block copolymer within the trenches in a solvent atmosphere . in other embodiments , a zone annealing is conducted to anneal portions or sections of the block copolymer material 28 in trenches on the substrate 10 by a localized application of thermal energy ( e . g ., heat ). zone annealing can provide rapid self - assembly of the block copolymer material ( e . g ., on the order of minutes ). for example , as depicted sequentially in fig6 - 8 , the substrate 10 ( in a vapor atmosphere ) and a thermal or heat source 32 ( or combined heating and cooling source ) can be moved relative to each other ( e . g ., arrow ←) such that heat is applied above ( or underneath ) the substrate 10 . only a portion of the bcp material is initially heated above the glass transition temperature and the heated zone is then “ pulled ” across the substrate ( or vice versa ). for example , a thermal source 32 can be moved across the substrate 10 at a translational set speed ( e . g ., about 0 . 05 - 10 μm / second using a mechanism such as a motorized translation stage ( not shown ). pulling the heated zone across the substrate ( or vice versa ) can result in faster processing and better ordered structures relative to a global thermal anneal . in some embodiments , a hot - to - cold temperature gradient can be provided over ( or under ) the substrate such that a certain portion of the substrate is heated and then cooled , which can be at a controlled rate . in other embodiments , the substrate can be exposed to a cold - to - hot temperature gradient to anneal the bcp material , followed by cooling . in other embodiments , the bcp material can be heated above and then cooled below the order - disorder temperature ( but above the glass transition temperature ), for example , to remove ( melt out ) defects and allow the material to recrystalize provided that the order - disorder temperature ( t o - d ) is less than the decomposition temperature ( t d ) of the block copolymer material . the order - disorder temperature is defined by the temperature dependence of the block copolymer , chi value , the total number of monomers per chain , and the monomer composition . only those portions of the block copolymer material that are heated above the glass transition temperature ( t g ) of the component polymer blocks will self - assemble , and areas of the material that were not sufficiently heated remain disordered and unassembled . for example , as illustrated in fig6 - 6b , initially , the block copolymer material within trench 18 a can be heated and annealed to form a self - assembled material 30 while the unannealed block copolymer material 28 within trenches 18 b , 18 c remains disordered . only those portions of the block copolymer material 28 that are heated above the glass transition temperature ( t g ) will self - assemble . a next portion of the substrate can then be selectively heated , as shown in fig7 - 7a , resulting in the self assembly of the block copolymer material within trench 18 b . a subsequent heating of the remaining areas of the substrate can then be conducted , e . g ., as depicted in fig8 - 8a . upon annealing , the cylindrical - phase block copolymer material 28 will self - assemble into a polymer material 30 ( e . g . film ) in response to the character of the block copolymer composition ( e . g ., ps - b - pvp having an inherent pitch at or about l ) and the boundary conditions , including the constraints provided by the width ( w t ) of the trench 18 and the wetting properties of the trench surfaces including a trench floor 26 that exhibits neutral or non - preferential wetting toward both polymer blocks ( e . g ., a random graft copolymer ), sidewalls 22 that are preferential wetting by the minority ( preferred ) block of the block copolymer ( e . g ., the pvp block ), and the presence of a neutral or non - preferential solvent ( or in some embodiments , a film or material that is neutral or non - preferential wetting ) in contact with the surface of the block copolymer material 26 in the trenches . the anneal results in a row ( or rows ) of perpendicularly - oriented cylinders 34 of the minority polymer ( preferred ) block ( e . g ., pvp ) within a matrix 36 of the majority polymer block ( e . g ., ps ), with the cylinders registered and parallel to the sidewalls 22 of the trench . the diameter of the cylinders 34 will generally be at or about 0 . 5 * l ( e . g ., about one - half of the center - to - center distance between cylinders ). in addition , the minority ( preferred ) block ( e . g ., pvp ) will segregate to and wet the preferential wetting sidewalls 22 and ends 24 of the trenches 18 to form a thin interface or wetting brush layer 34 a having a thickness generally about one - fourth of the center - to - center distance between adjacent cylinders 34 . for example , a layer of the pvp block will wet oxide interfaces with attached ps domains directed outward from the oxide material . in some embodiments , the self - assembled block copolymer material 30 is defined by a single layer of an array of cylindrical domains ( cylinders ) 34 , each with a diameter at or about 0 . 5 * l ( e . g ., about one - half of the center - to - center distance between cylinders ), with the number ( n ) of cylinders in the row according to the length ( l t ) of the trench , and the center - to - center distance ( pitch distance , p ) between each cylinder at or about l . optionally , after the block copolymer material is annealed and ordered , the copolymer material can be treated to crosslink the polymer segments ( e . g ., the ps segments ) to fix and enhance the strength of the self - assembled polymer blocks . the polymers can be structured to inherently crosslink ( e . g ., upon exposure to ultraviolet ( uv ) radiation , including deep ultraviolet ( duv ) radiation ), or one of the polymer blocks of the copolymer material can be formulated to contain a crosslinking agent . generally , the film 28 a outside the trenches ( e . g ., on spacers 18 ) will not be thick enough to result in self - assembly . optionally , the unstructured thin film 28 a can be removed , as illustrated in fig8 - 8a , for example , by an etch technique or a planarization process to provide an about uniformly flat surface . for example , the trench regions can be selectively exposed through a reticle ( not shown ) to crosslink only the annealed and self - assembled polymer material 30 within the trenches 18 , and a wash can then be applied with an appropriate solvent ( e . g ., toluene ) to remove the non - crosslinked portions of the block copolymer material 28 a ( e . g ., on the spacers 20 ), leaving the registered self - assembled polymer material within the trench and exposing the surface of the material layer 16 above / outside the trenches . in another embodiment , the annealed polymer material 30 can be crosslinked globally , a photoresist material can be applied to pattern and expose the areas of the polymer material 28 a outside the trench regions , and the exposed portions of the polymer material 28 a can be removed , for example by an oxygen ( o 2 ) plasma treatment . referring to fig9 , in another embodiment of a method of the invention , a thermal anneal is conducted while applying a non - preferentially wetting material 37 ′ to the surface of the block copolymer ( bcp ) material 28 ′ in the trenches . in some embodiments , the non - preferential wetting material 37 ′ is composed of a solid material , which can be physically placed onto the bcp material 28 ′, for example , a soft , flexible or rubbery solid material such as a cross - linked , poly ( dimethylsiloxane ) ( pdms ) elastomer ( e . g ., sylgard - 184 by dow - corning ) or other elastomeric polymer material ( e . g ., silicones , polyurethanes , etc . ), which provides an external surface that is neutral wetting . the solid material can be derivatized ( e . g ., by grafting a random copolymer ) such that it presents a neutral wetting surface . with the non - preferential wetting material 37 ′ in contact with the surface of the block copolymer material 38 ′, a thermal annealing process is conducted ( arrows ↓, fig9 a - 9b ) to cause the polymer blocks to phase separate in response to the preferential and neutral wetting of the trench surfaces and the non - preferential ( neutral ) wetting of the overlying material 37 ′, and form a self - assembled polymer material 30 ′ as illustrated in fig1 a - 10b . after annealing , the non - preferential wetting material 37 ′ can be removed from contact with the annealed polymer material 30 ′ ( arrow ↑) as depicted in fig1 a . a pdms or other elastomeric material layer 37 ′ can be removed , for example , by lifting or peeling the material from the surface of the annealed polymer material . additionally , a solvent such as water , alcohols , and the like , which is compatible with and does not dissolve the block copolymer material 30 ′, can be applied ( e . g ., by soaking ) to permeate and swell the elastomeric material ( e . g ., pdms ) to enhance physical removal . a dilute fluoride solution ( e . g ., nh 4 f , hf , naf , etc .) can also be applied to etch and dissolve a pdms material to remove it from the annealed polymer material . following self assembly , the pattern of perpendicular - oriented cylinders that is formed on the substrate can then be further processed as desired , for example , to form an etch mask for patterning nanosized features into the underlying substrate 10 through selective removal of one block of the self - assembled block copolymer . since the domain sizes and periods ( l ) involved in this method are determined by the chain length of a block copolymer ( mw ), resolution can exceed other techniques such as conventional photolithography . processing costs using the technique is significantly less than extreme ultraviolet ( euv ) photolithography , which has comparable resolution . for example , as illustrated in fig1 - 11b , in one embodiment , an etch mask 38 can be formed by selectively removing the cylindrical polymer domains 34 of the self - assembled polymer material 30 to produce openings 40 in the polymer matrix 36 ( e . g ., ps ) to expose the underlying substrate 10 at the trench floors 26 . for example , the cylindrical domains 34 can be removed by a selective wet etch ( e . g ., pmma and pla by uv exposure / acetic acid development , pla by aqueous methanol mixture containing sodium hydroxide , peo by aqueous hydroiodic acid or water , etc .) or by a selective reactive ion etch ( rie ) process . in embodiments in which the block copolymer includes a cleavable linker group , the film can be exposed to a solvent selective to the minor domain , for example , an alcohol for pvp , water for peo or pla , and acetic acid for pmma , that contains a cleaving agent to remove ( e . g ., wash out ) the minor domain . as depicted in fig1 - 12b , the remaining porous polymer ( e . g . ps ) matrix 36 can then be used as a lithographic template or mask to etch ( arrows ↓↓) a series of cylindrical - shaped openings or contact holes 42 in the nanometer size range ( e . g ., about 10 - 100 nm ) to the conductive lines 12 or other active area ( e . g ., semiconducting region , etc .) in the underlying substrate 10 ( or an underlayer ). the openings 42 can be formed , for example , using a selective reactive ion etching ( rie ) process . further processing can then be performed as desired . for example , as depicted in fig1 - 13b , the residual polymer matrix 36 can be removed ( e . g ., ps by an oxidation process such as a plasma o 2 etch ) and the substrate openings 42 can be filled with a material 44 such as a metal or metal alloy such as cu , al , w , si , and ti 3 n 4 , among others , to form arrays of cylindrical contacts to the conductive lines 12 . the cylindrical openings 42 in the substrate can also be filled with a metal - insulator - metal stack to form capacitors with an insulating material such as sio 2 , al 2 o 3 , hfo 2 , zro 2 , srtio 3 , and the like . embodiments of the invention utilize a thermal anneal process in combination with solvent annealing , which can provide faster processing than with a solvent anneal alone and expands the types of block copolymers ( bcps ) that can be processed to substantially all bcps . in embodiments using a zone annealing in combination with an organic solvent atmosphere , a wide range of block copolymers can be processed to form perpendicular - oriented nanostructures ( e . g ., cylinders ) and at a rapid rate . in addition , methods of the disclosure provide a means of generating self - assembled diblock copolymer films composed of perpendicular - oriented cylinders in a polymer matrix . the methods provide ordered and registered elements on a nanometer scale that can be prepared more inexpensively than by electron beam lithography , euv photolithography or conventional photolithography . the feature sizes produced and accessible by this invention cannot be easily prepared by conventional photolithography . the described methods and systems can be readily employed and incorporated into existing semiconductor manufacturing process flows and provide a low cost , high - throughput technique for fabricating small structures . although specific embodiments have been illustrated and described herein , it will be appreciated by those of ordinary skill in the art that any arrangement which is calculated to achieve the same purpose may be substituted for the specific embodiments shown . this application is intended to cover any adaptations or variations that operate according to the principles of the invention as described . therefore , it is intended that this invention be limited only by the claims and the equivalents thereof . the disclosures of patents , references and publications cited in the application are incorporated by reference herein . | 7 |
fig1 shows an integrated circuit arrangement 10 during production . in a semiconductor substrate ( not illustrated ) of the integrated circuit arrangement 10 , a multiplicity of electrical components such as transistors have already been fabricated , e . g . in accordance with cmos technology , in accordance with bicmos technology or in accordance with a technology for power switching elements ( power devices ). the production was then continued until the application of a metal layer 12 . the metal layer 12 contains a connecting section 14 made of an aluminium - copper alloy containing e . g . 0 . 5 % copper . an antireflection layer 16 comprising titanium nitride , for example , or containing at least one titanium nitride layer was sputtered onto the metal layer 12 . the antireflection layer 16 was required for patterning the metal layer 12 in a photolithographic process during which the connecting section 14 was also patterned . after the deposition of the antireflection layer 16 , a dielectric layer 18 was deposited with a thickness of 600 nm , for example , e . g . with the aid of a cvd method ( chemical vapour deposition ). the dielectric layer comprises silicon dioxide , for example , and serves for electrical insulation between the metal layer 12 and a metal layer that is still to be arranged in the dielectric layer 18 . fig2 shows the circuit arrangement 10 after the etching of a contact hole 20 , which extends through the dielectric layer 18 and the antireflection layer 16 right into the connecting section 14 . between a lower surface 22 and a contact hole bottom 24 of the contact hole 20 there is a distance a 1 of 10 nm , for example . the diameter of the contact hole is 0 . 5 . mu . m , for example . the etching process for etching the contact hole 20 is conducted such that , for a large part of contact holes of the circuit arrangement 10 , the bottom 26 of the contact hole lies in the centre of the antireflection layer 16 . between the bottom 26 of the contact hole and the lower surface 22 of the antireflection layer 16 there is then a distance a 2 of a few nanometres . in this process implementation , there are no contact holes in which the bottom 28 of the contact hole lies above the antireflection layer 16 . between the bottom 28 of the contact hole and the lower surface 22 there would then be a distance a 3 which is greater than the distance a 2 and also greater than the thickness of the antireflection layer 16 . the contact hole 20 has a central region 30 , which is shown in enlarged illustration in fig3 and 4 . after the etching of the contact hole 20 , an adhesion promoting layer 32 is deposited , the construction of which is explained in more detail below with reference to fig4 . fig3 shows a titanium nitride layer 40 which could be deposited in the contact hole 20 as adhesion promoting layer . if this were done under a reactive nitrogen atmosphere , then an aluminium nitride layer 42 would form between the titanium nitride layer 40 and the connecting section 14 , which aluminium nitride layer considerably increases the contact resistance . by contrast , fig4 shows the construction of the adhesion promoting layer 32 actually deposited in the contact hole 20 , the said adhesion promoting layer containing a base layer 50 made of titanium nitride , an intermediate layer 52 and a covering layer 54 made of titanium nitride . the base layer 50 , the intermediate layer 52 and the covering layer 54 were sputtered in the order mentioned by a method which is explained in more detail below with reference to fig6 . the intermediate layer 52 comprises a mixture of titanium nitride and titanium in lower regions b 1 and b 2 , the proportion of titanium increasing in the regions b 1 and b 2 , starting from the base layer 50 , and reaching 100 % in a region b 3 adjoining the region b 2 . equally , the proportion of titanium nitride decreases from 100 % to 0 %. the proportion of titanium in the centre of the region b 1 and of the region b 2 is , for example , 60 % and 90 %, respectively . the proportion of titanium is also 100 % in a region b 4 lying above the region b 3 . the regions b 1 to b 2 have identical thicknesses d 1 of 0 . 5 nm , for example , so that a total thickness d 2 of the intermediate layer 52 is 2 nm . a thickness d 3 of the base layer 50 is 3 nm in the exemplary embodiment . a thickness d 4 of the covering layer is 10 nm . the thicknesses d 1 to d 4 relate to the extent of the layers in a stack direction r , in which the layers 50 to 54 are stacked one above the other and which lies at right angles to the surface of the semiconductor substrate . fig5 shows a sputtering chamber 100 used for introducing the adhesion promoting layer 32 . a receptacle 102 has a gas inlet 104 and a gas outlet 106 . the receptacle additionally contains a sputtering target 108 made of titanium , which serves as cathode 107 and a wafer holder 11 0 , which serves as anode 109 . the wafer holder 110 carries a wafer 112 , e . g . an 8 inch wafer ( 1 inch = 25 . 4 mm ). the sputtering target 108 has e . g . the same diameter as the wafer . the sputtering chamber 100 is suitable for directional sputtering because a distance a between sputter target 108 and wafer 112 has been considerably increased in comparison with a sputtering chamber for non - directional sputtering , for example by a factor of four to five . thus , the distance a is about 25 cm in the exemplary embodiment . between the connecting line from a point p in the centre of the wafer 112 toward the edge of the sputtering target 108 and the normal n to the main surface of the wafer 112 there is an angle w , which is less than 45 . degree ., in particular less than 30 . degree ., in the case of directional sputtering . however , directional sputtering can also be achieved or enhanced by measures other than a large distance a , e . g . by reducing the pressure within the sputtering chamber 100 , e . g . to only 1 to 2 millitorr , or by suitable bias voltages during sputtering . other methods also lead to directional sputtering , e . g . : [ 0039 ] the use of an imp method ( ionized metal plasma ) from the company applied materials , [ 0040 ] the use of an sip method ( self ionized plasma ) from the company applied materials , [ 0041 ] the use of the advanced high fill method from the company trikon , [ 0042 ] the use of the ultra high fill method from the company trikon , [ 0043 ] or the use of older sputtering with a collimator . thus , directional sputtering can be differentiated from non - directional sputtering by an angle w of less than 45 . degree . or less than 30 . degree . or else by other measures which lead to the same effect as a small angle w with regard to the ratio of the layer thicknesses inside and outside a contact hole 20 . fig6 shows method steps carried out during the production of the adhesion promoting layer 32 . the method begins in a method step 150 . in a method step 152 , the sputtering target 108 is inserted into the sputtering chamber 100 in order to utilize it for a multiplicity of sputtering processes . the sputtering target 108 contains a titanium layer 153 made of pure titanium . in a subsequent method step 154 , nitrogen gas is introduced into the sputtering chamber 100 . the nitrogen brings about a nitriding of the reactive titanium layer 153 . a thin titanium nitride layer 157 is therefore produced at the surface of the titanium layer 153 . after the nitriding , in a method step 158 , the supply of nitrogen is interrupted and the nitrogen contained in the sputtering chamber 100 is extracted by suction . in a next method step 106 , the wafer 112 is fixed on the wafer holder 110 in the sputtering chamber . in a method step 162 , a protective gas , for example argon , is introduced into the sputtering chamber 100 . under the argon atmosphere that forms , sputtering is begun in a method step 164 , the base layer 50 being deposited on the wafer 112 . if the last parts of the titanium nitride layer 157 and then parts of the titanium layer 153 are sputtered away , then the intermediate layer 52 is likewise formed under the argon atmosphere . after the deposition of the intermediate layer 52 , in a method step 166 , nitrogen is introduced into the sputtering chamber 100 in addition to the protective gas or instead of the protective gas . the sputtering can be interrupted in this case in order to produce reproducible layers . in a method step 168 , the sputtering is continued by reigniting the plasma , the covering layer 54 being formed . in a method step 170 , the method is ended if the covering layer 54 and thus also the adhesion promoting layer 32 have reached their predetermined thickness . without changing the sputtering target 108 , the method explained is carried out a number of times in succession . later , in a different chamber , tungsten is introduced into the contact hole that has already been lined with the adhesion promoting layer 32 . afterwards , still further metal layers of the integrated circuit arrangement 10 are produced . | 7 |
in fig1 the reference numeral 1 denotes a machine controller connected to an upper shaft drive motor 3 via an upper shaft drive circuit 2 . the drive motor 3 is mechanically connected to an upper shaft of the sewing machine which has a sensor 4 and a potentiometer 5 mounted thereon for rotation therewith . the sensor 4 produces a pulse signal each time when the upper shaft comes to a predetermined angular position , and the potentiometer 5 produces signals indicating the angular positions of the upper shaft . the sensor 4 gives a pulse signal to an upper shaft stop ordering device 6 and a counter 7 in each rotation of the upper shaft . the drive motor 3 is subject to a speed control by operation of the controller 1 as known , and also receives a stop order from the upper shaft stop ordering device 6 to stop the rotation of the upper shaft at a predetermined angular position thereof . the drive motor 3 also stops the rotation of the upper shaft after the counter 7 has counted a predetermined number of rotations of the upper shaft , namely a predetermined number of stitches . the reference numeral 8 denotes a servo motor for swingably driving a fabric feeding shaft . the servo motor 8 is mechanically connected to a sensor 9 and a potentiometer 10 . the sensor 9 produces a pulse signal each time when the feeding shaft swingably comes to a predetermined angular position . the potentiometer 10 produces pulse signals indicating the predetermined angular positions of the feeding shaft . the sensor 9 gives a pulse signal to a counter 12 and a feed shaft stop ordering device 11 each time when the feeding shaft makes one complete reciprocation . the servo motor 8 stops the feeding shaft at a predetermined angular position thereof by way of the stop ordering device 11 . the servo motor also stops the feeding shaft after the counter 12 counts a predetermined number of feeding movements of the feeding shaft . the potentiometers 5 , 10 are connected to a feed shaft drive circuit 13 which compares the signals from these potemtiometers to drive the feeding shaft control servo motor 8 in connection to the rotational angular positions of the upper shaft drive motor 3 . the upper shaft stop ordering device 6 receives signals from the counter 12 to stop the upper shaft until the fabric feeding device feeds the fabric for a predetermined amount . on the other hand , the feeding shaft stop ordering device 11 receives the signals from the counter 7 . the reference numeral 14 is a manually operated ordering device which gives an output to the feeding shaft stop ordering device 11 . fig2 shows an output voltage v b of the potentiometer 10 generated at the rotation angles θ thereof which is called potentiometer b in this case and is mounted on the servo motor 8 for driving the feeding shaft . the output voltage v b shows one period of symmetrical sine curve per rotation of the servo motor 8 . fig3 shows an output voltage v a of the potentiometer 5 at the rotation angles θ thereof which is called potentiometer a and is mounted on the upper shaft driven by the machine drive motor 3 . the sine curve of the output voltage v a is , as shown , asymmetrical in the plus and minus ranges and is relatively larger in the minus range and smaller in the plus range . however , these voltages of the potentiometers 5 , 10 are same in the maximum and minimum values . namely the upper shaft and the feeding shaft are rotated from the rest point 0 with the same angular speed ω a , the output voltages v a , v b take minus values respectively and the voltage v b is faster than the voltage v a to reach the next potential 0 . now the purpose of the invention is to set the voltage v b to be always in accord with the voltage v a by controlling the speed of the feeding shaft control servo motor 8 . in other words , the purpose of the invention is to set the voltage v b to reach the next potential 0 together with the voltage v a by driving the feeding shaft with the angular speed ω a slower than that ω a of the upper shaft . fig4 shows a motion diagram of the sewing machine parts . it is desirable to feed the sewn fabric in the horizontal direction immediately after the thread fastening has been made at the point a by the thread take up lever and to finish the horizontal feeding at the point b just before the needle penetrates the fabric . however , actually the horizontal feeding has been initiated at the point d due to the reason as stated in the preamble hereinbefore . in case the sewn fabric is thicker , it is desirable to shift the point b toward the point c in proportion to the thickness of the fabric . namely by setting the feeding curve connecting the points a and c , the feeding device becomes ideal for feeding the thick or thin fabrics . it has been impossible to obtain such an inclination . but by driving the feeding shaft by a separate drive source independently of the upper main shaft and the lower loop taker drive shaft , and by properly adjusting the angular speed of the feeding shaft , a suitable feeding device can be attained for any kind of fabrics to be sewn . thus the defects and disadvantages of the prior art can be eliminate . in fig3 θ 1 is a range which corresponds to the range a - b or a - c in fig4 in which the horizontal feeding should be applied with an increased angular speed of the feeding shaft . namely the voltage v a in the plus side is designed to control the feeding shaft drive servo motor to be driven with an angular speed faster than that ω a of the upper main shaft , so that , for example , the horizontal feeding may be finished in the range a - c in fig4 . in this invention , the counters 7 , 12 and the stop ordering devices 6 , 11 may be replaced by a micro computer . in order to set the rotation of the feeding shaft drive servo motor substantially in accordance with a desired wave form such as shown in fig3 it is possible to properly divide the wave form with respect to the axis θ and to store the voltages v a into a memory and then to read out these voltages one by one . fig5 shows another embodiment of the invention in which a micro computer is used as a main control device for controlling the operation of the feeding shaft , and a pulse motor is used for driving the feeding shaft . rom 15 is a read only electronic memory storing stitch control signals and program control signals . cpu 16 is a central programming unit for ordering a signal read - out , making program control and procesing a signal operation . ram 17 is an electronic memory which is operated by the order of the cpu to store the data of the memory 15 , the data necessary for various operation processes and the results of the operation processes . these memories 15 , 17 and the cpu 16 constitute a micro computer . a pulse generator 18 and a sensor 4 on the upper shaft generate pulses respectively per rotation of the upper shaft . as shown in fig6 the sensor 4 generates a pulse signal of high ( h ) and low ( l ) level with the same width per rotation 2π of the upper shaft . on the other hand the pulse generator 18 generates a plurality of pulses dividing the pulse of the sensor 4 with an equal width . in this case , the pulse generator 18 has angular positions to generate pulses each corresponding to the changeover of the h and l level of the pulse of the sensor 4 . the changeover point 0 or 2π from the l level to the h level and the changeover point π from the h level to the l level correspond respectively to the upper dead point of the needle bar ( rotation angle 0 ° of the upper shaft ) and the lower dead point of the needle bar rotation angle 180 ° of the up upper shaft as shown in fig4 . a pattern selecting device 19 is provided on the front face of the sewing machine and is manually operated by way of switches to produce a specific code signal to the selected pattern . a pulse motor drive circuit 20 receives a control signal processed by the cpu 16 in dependence upon the signals from the pattern selecting device 19 and the manually operated ordering device 14 , to control the operation of the feeding shaft driving pulse motor 21 in a specific angular phase of the upper shaft . the rom 15 stores the data which are read out by the pattern selecting device 19 and the manually operated ordering device 14 to set the initial horizontal feeding point a and the feed ending point b . the angular phase of the upper shaft for drivingly controlling the pulse motor 21 is determined by the central programming unit ( cpu 16 ) which discriminates the h and l levels of the pulse of the sensor 4 and also counts the pulses of the pulse generator 18 from the changeover point from l level to h level or from h level to l level . the drive speed and the drive amount of the feeding shaft can be determined by the total number of pulse motor driving pulses derived from the pulse motor drive circuit 20 and applied to the appointed individual pulses of the pulse generator 18 . such a number of pulse motor driving pulses is sought by the result of the operation processing made by the cpu 16 in dependence upon the inclination of the straight line connecting the points a and b and the horizontal feeding amount as shown in fig6 . fig5 does not include the upper shaft stop ordering device 6 , the upper shaft counter 7 , the feeding shaft stop ordering device 11 and the feeding shaft counter 12 which are all provided in fig1 . instead , fig5 includes a micro computer such as the central programming unit ( cpu 16 ) housing all functions of these mentioned elements and is capable of control operation in the same way as the embodiment in fig1 . fig7 shows a feeding mechanism operated by the feeding shaft driving device of the invention . the reference numeral 22 is a feed dog fixedly mounted on an up and down moving base 23 by means of a fastening screw 24 . the reference numeral 25 is a u - shaped horizontal feeding member receiving the up and down moving base 23 and provided with a rack 26 at the bottom bace thereof . the rack 26 is engaged by a pinion 28 mounted on the swingable horizontal feeding shaft 27 so that the horizontal feeding member 25 may be moved in the right and left directions in fig7 when the shaft 27 is swingably moved . the base 23 is received in the horizontal feeding member 25 and movable up and down . an auxiliary plate 29 is arranged in the horizontal feeding member 25 and supports the base 23 . a triangular cam 31 is arranged between the base 23 and the auxiliary plate 29 . the triangular cam 31 is mounted on an up and down feeding shaft 30 which is rotated by the upper main shaft in synchronism therewith . the base 23 is , therefore , moved up and down as the triangular cam 31 is rotated together with the shaft 30 . the horizontal feeding shaft 27 is swingably driven by the servo motor 8 in fig1 or by the pulse motor 21 in fig5 . the reference numeral 32 is a needle bar with a needle , and the reference numeral 33 is a presser bar with a presser foot which cooperates the feed dog 22 . fig8 shows another embodiment to operate the feed dog 23 directly by using pulse motors . in this embodiment , the feed dog 22 is secured to a horizontal feeding base 34 by means of a screw 24 . the reference numeral 36 is an l - shaped member received in a u - shaped guide 38 and movable up and down therein . the horizontal feeding base 34 is provided with a rack 35 at the bottom thereof which is engaged by a pinion 40 driven by a pulse motor ( not shown ) by way of belt wheels 41 , 42 and a timing belt 43 , thereby to move the feeding base in the right and left directions as the pinion 40 is driven . on the other hand , the l - shaped member 36 is provided with a rack on one side thereof which is engaged by a pinion 39 driven by another pulse motor ( not shown ), thereby to move the member 36 up and down in the guide 38 as the pinion 39 is driven . therefore with a controlled and combined turning movements of the pinions 39 , 40 , the feed dog 22 can be variously set to feed the sewn fabric . fig9 is an outlined view of a sewing machine of the invention which is to be considered in connection with the embodiment in fig7 . the reference numeral 44 is a machine housing . 45 is the upper main shaft and 4 is the sensor cooperating with the upper shaft to generate a pulse per rotation of the upper shaft as mentioned herein - before . the pulse generator 18 in fig5 is to be mounted on the upper shaft 45 . the servo motor 8 or the pulse motor 21 swingably drives the horizontal feeding shaft 27 by way of a swingable linkage 46 as shown . the horizontal feeding shaft 27 reciprocates the feed dog 22 in a horizontal plane . in this case , the feed dog 22 is moved up and down in timed relation with the rotation of the upper shaft 27 by the cam 31 as shown in fig7 . a pulse motor 48 is connected to a transmission rod 49 at one end thereof which is connected at the other end to swingable from supporting the needle bar 32 for vertical reciprocation . the pulse motor 48 laterally reciprocates the transmission rod 49 , thereby to reciprocate the swingable frame laterally of the fabric feeding path . according to the embodiment in fig8 it will be apparent that the upper shaft can be stopped with the needle bar held in the upper dead point while the feed dog 22 is operated to feed the sewn fabric for the purpose of forming ornamental or basting stitches , since the feed dog 22 is operated by a drive source completely separate from the drive source of the upper shaft of the sewing machine . moreover according to the invention , since the horizontal feeding shaft for moving the feed dog 22 in a horizontal plane is driven by a drive source separate from the drive source of the upper shaft , it is possible that the feed dog 22 can be rapidly and positively operated to feed the sewn fabric at a proper time during one rotation of the upper shaft . further in the embroidery stithching operation , the horizontal feeding shaft and the up and down shaft can be stopped at a predetermined angular position thereof so as to hold the feed dog 22 inoperative below the needle plate ( not shown ). the embodiments of the invention are all simple and compact , and require no conventionnally used transmission elements . therefore there will be no accumulated errors which may be caused due to such conventional transmission elements and the abrasion thereof . | 3 |
the present invention relates to implementations of digital watermarks that are optimally suited to particular transmission , distribution and storage mediums given the nature of digitally sampled audio , video , and other multimedia works . the present invention also relates to adapting watermark application parameters to the individual characteristics of a given digital sample stream . the present invention additionally relates to the implementation of digital watermarks that are feature - based . that is , a system where watermark information is not carried in individual samples , but is carried in the relationships between multiple samples , such as in a waveform shape . for example , in a manner similar to the way a us $ 100 bill has copy protection features including ink type , paper stock , fiber , angles of artwork that distort in photocopier machines , inserted magnetic strips , and composite art , the present invention envisions natural extensions for digital watermarks that may also separate frequencies ( color or audio ), channels in 3d while utilizing discreteness in feature - based encoding only known to those with pseudo - random keys ( i . e ., cryptographic keys ) or possibly tools to access such information , which may one day exist on a quantum level . there are a number of hardware and software approaches in the prior art that attempt to provide protection of multimedia content , including encryption , cryptographic containers , cryptographic envelopes or “ cryptblopes ,” and trusted systems in general . none of these systems places control of copy protection in the hands of the content creator as the content is created , nor provides an economically feasible model for exchanging the content to be exchanged with identification data embedded within the content . yet , given the existence of over 100 million personal computers and many more non - copy - protected consumer electronic goods , copy protection seems to belong within the signals . after all , the playing ( i . e ., using ) of the content establishes its commercial value . generally , encryption and cryptographic containers serve copyright holders as a means to protect data in transit between a publisher or distributor and the purchaser of the data ( i . e ., a means of securing the delivery of copyrighted material from one location to another by using variations of public key cryptography or other more centralized cryptosystems ). cryptolopes are suited specifically for copyrighted text that is time - sensitive , such as newspapers , where intellectual property rights and origin data are made a permanent part of the file . for information on public - key cryptosystems see u . s . pat . no . 4 , 200 , 770 to hellman et al ., u . s . pat . no . 4 , 218 , 582 to hellman et al ., u . s . pat . no . 4 , 405 , 829 to rivest et al ., and u . s . pat . no . 4 , 424 , 414 to hellman et al ., which patents are incorporated herein by reference . systems are proposed by ibm and electronic publishing resources to accomplish cryptographic container security . digitally - sampled copyrighted material , that is binary data on a fundamental level , is a special case because of its long term value coupled with the ease and perfection of copying and transmission by general purpose computing and telecommunications devices . in particular , in digitally - sampled material , there is no loss of quality in copies and no identifiable differences between one copy and any other subsequent copy . for creators of content , distribution costs may be minimized with electronic transmission of copyrighted works . unfortunately , seeking some form of informational or commercial return via electronic exchange is ill - advised absent the use of digital watermarks to establish responsibility for specific copies and unauthorized copying . absent digital watermarks , the unlikely instance of a market of trusted parties who report any distribution or exchange of unauthorized copies of the protected work must be relied upon for enforcement . simply , content creators still cannot independently verify watermarks should they choose to do so . for a discussion of systems that are oriented around content - based addresses and directories , see u . s . pat . no . 5 , 428 , 606 to moskowitz , which patent is incorporated herein by reference . in combining steganographic methods for insertion of information identifying the title , copyright holder , pricing , distribution path , licensed owner of a particular copy , or a myriad of other related information , with pseudo - random keys ( which map insertion location of the information ) similar to those used in cryptographic applications , randomly placed signals ( digital watermarks ) can be encoded as random noise in a content signal . optimal planning of digital watermark insertion can be based on the inversion of optimal digital filters to establish or map areas comprising a given content signal insertion envelope . taken further , planning operations will vary for different digitized content : audio , video , multimedia , virtual reality , etc . optimization techniques for processes are described in related patents , including u . s . pat . no . 5 , 613 , 004 , entitled “ steganographic method and device ” and u . s . pat . no . 5 , 822 , 432 , entitled “ method for human assisted random key generation and application for digital watermark system ,” which patents are incorporated herein by reference . optimization processes must take into consideration the general art of digitization systems where sampling and quantizing are fundamental physical parameters . for instance , discrete time sampling has a natural limit if packets of time are used , estimated at 1 . times . 10 . sup .− 42 second . this provides a natural limit to the sampling operation . also , since noise is preferable to distortion , quantizing will vary given different storage mediums ( magnetic , optical , etc .) or transmission mediums ( copper , fiber optic , satellite , etc .) for given digitized samples ( audio , video , etc .). reducing random bit error , quantization error , burst error , and the like is done for the singular goal of preserving quality in a given digitized sample . theoretical perfect error correction is not efficient , given the requirement of a huge allocation of redundant data to detect and correct errors . in the absence of such overhead , all error correction is still based on data redundancy and requires the following operations : error detection to check data validity , error correction to replace erroneous data , and error concealment to hide large errors or substitute data for insufficient data correction . even with perfect error correction , the goal of a workable digital watermark system for the protection of copyrights would be to distribute copies that are less than perfect but not perceivably different from the original . ironically , in the present distribution of multimedia , this is the approach taken by content creators when faced with such distribution mechanisms as the internet . as an example , for audio clips commercially exchanged on the world wide web ( www ), a part of the internet , 8 bit sampled audio or audio downsampled from 44 . 1 khz ( cd - quality ), to 22 khz and lower . digital filters , however , are not ideal because of trade - offs between attenuation and time - domain response , but provide the engineer or similarly - trained individual with a set of decisions to make about maximizing content quality with minimum data overhead and consideration of the ultimate delivery mechanism for the content ( cds , cable television , satellite , audio tape , stereo amplifier , etc .). for audio signals , and , more generally , for other frequency - based content , such as video , one method of using digital filters is to include the use of an input filter to prevent frequency aliasing higher than the so - called nyquist frequencies . the nyquist theorem specifies that the sampling frequency must be at least twice the highest signal frequency of the sampled information ( e . g ., for the case of audio , human perception of audio frequencies is in a range between 20 hz and 20 khz , such signals should be sampled at a frequency of at least 40 khz ). without an input filter , aliases can still occur leaving an aliased signal in the original bandwidth that cannot be removed . even with anti - aliasing filters , quantization error can still cause low level aliasing which may be removed with a dither technique . dither is a method of adding random noise to the signal , and is used to de - correlate quantization error from the signal while reducing the audibility of the remaining noise . distortion may be removed , but at the cost of adding more noise to the filtered output signal . an important effect is the subsequent randomization of the quantization error while still leaving an envelope of an unremovable signaling band of noise . thus , dither is done at low signal levels , affecting only the least significant bits of the samples . conversely , digital watermarks , which may take the form of essentially randomly - mapped noise , are intended to be inserted into samples of digitized content in a manner such as to maximize encoding levels while minimizing any perceivable artifacts that would indicate their presence or allow for removal by filters , and without destroying the content signal . further , digital watermarks should be inserted with processes that necessitate random searching in the content signal for watermarks if an attacker lacks the keys . attempts to over - encode noise into known watermarked signal locations to eliminate the information signal can be made difficult or impossible without damaging the content signal by relying on temporal encoding and randomization in the generation of keys during digital watermark insertion . as a result , although the watermark occupies only a small percentage of the signal , an attacker is forced to over - encode the entire signal at the highest encoding level , which creates audible artifacts . the present invention relates to methods for obtaining more optimal models to design watermark systems that are tamper - resistant given the number and breadth of existent digitized sample options with differing frequency and time components ( audio , video , pictures , multimedia , virtual reality , etc .). to accomplish these goals , the present invention maintains the highest quality of a given content signal as it was mastered , with its watermarks suitably hidden , taking into account usage of digital filters and error correction presently concerned solely with the quality of content signals . additionally , where a watermark location is determined in a random or pseudo - random operation dependent on the creation of a pseudo - random key , as described in u . s . pat . no . 5 , 613 , 004 , and unlike other forms of manipulating digitized sample streams to improve quality or encode known frequency ranges , an engineer seeking to provide high levels of protection of copyrights , ownership , etc . is concerned with the size of a given key , the size of the watermark message and the most suitable area and method of insertion . robustness is improved through highly redundant error correction codes and interleaving , including codes known generally as q - ary bose - chaudhuri - hocquenghem ( bch ) codes , a subset of hamming coding operations , and codes combining error correction and interleaving , such as the cross - interleave reed - solomon code . using such codes to store watermark information in the signal increases the number of changes required to obliterate a given watermark . preprocessing the watermark by considering error correction and the introduction of random data to make watermark discovery more difficult , prior to watermarking , will help determine sufficient key size . more generally , absolute key size can be determined through preprocessing the message and the actual digital watermark ( a file including information regarding the copyright owner , publisher , or some other party in the chain of exchange of the content ) to compute the absolute encoded bit stream and limiting or adjusting the key size parameter to optimize the usage of key bits . the number of bits in the primary key should match or exceed the number of bits in the watermark message , to prevent redundant usage of key bits . optimally , the number of bits in the primary key should exactly match the watermark size , since any extra bits are wasted computation . insertion of informational signals into content signals have been contemplated . more detailed discussions are included in related patents entitled “ steganographic method and device ” and “ method for human assisted random key generation and application for digital watermark system .” the following discussion illustrates some previously disclosed systems and their weaknesses . typically , previously disclosed systems lack emphasis or implementation of any pseudo - random operations to determine the insertion location , or map , of information signals relating to the watermarks . instead , previous implementations provide “ copy protect ” flags in obvious , apparent and easily removable locations . further , previous implementations do not emphasize the alteration of the content signal upon removal of the copy protection . standards for digital audio tape ( dat ) prescribe insertion of data , such as isrc ( industry standard recording codes ) codes , title , and time in sub - code according to the serial copy management system ( scms ) to prevent multiple copying of the content . one time copying is permitted , however , and systems with aes3 connectors , which essentially override copy protection in the sub - code as implemented by scms , actually have no copy limitations . the present invention provides improvement over this implementation with regard to the ability of unscrupulous users to load digital data into unprotected systems , such as general computing devices , that may store the audio clip in a generalized file format to be distributed over an on - line system for further duplication . the security of scms ( serial copy management system ) can only exist as far as the support of similarly oriented hardware and the lack of attempts by those skilled in the art to simply remove the subcode data in question . previous methods seek to protect content , but the shortcomings are apparent . u . s . pat . no . 5 , 319 , 735 to preuss et al . discusses a spread spectrum method that would allow for over - encoding of the described , thus known , frequency range , and is severely limited in the amount of data that can be encoded — 4 . 3 8 - bit symbols per second . however , with the preuss et al . method , randomization attacks will not result in audible artifacts in the carrier signal , or degradation of the content as the information signal is in the subaudible range . it is important to note the difference in application between spread spectrum in military field use for protection of real - time radio signals , and encoding information into static audio files . in the protection of real - time communications , spread spectrum has anti - jam features , since information is sent over several channels at once . therefore , in order to jam the signal , one has to jam all channels , including their own . in a static audio file , however , an attacker has practically unlimited time and processing power to randomize each sub - channel in the signaling band without penalty to themselves , so the anti - jam advantages of spread spectrum do not extend to this domain . in a completely different implementation , u . s . pat . no . 5 , 379 , 345 to greenberg seeks enforcement of broadcast contracts using a spread spectrum modulator to insert signals that are then confirmed by a spread spectrum - capable receiver to establish the timing and length that a given , marked advertisement is played . this information is measured against a specific master of the underlying broadcast material . the greenberg patent does not ensure that real - time downloads of copyrighted content can be marked with identification information unless all download access points ( pcs , modems , etc . ), and upload points for that matter , have spread spectrum devices for monitoring . other methods include techniques similar to those disclosed in related patents and patent applications cited above , but lack the pseudo - random dimension of those patent applications for securing the location of the signals inserted into the content . one implementation conducted by michael gerzon and peter craven , and described by ken pohlmann in the third edition of principles of digital audio , illustrates a technology called “ buried data technique ,” but does not address the importance of randomness in establishing the insertion locations of the informational signals in a given content signal , as no pseudo - random methods are used as a basis for insertion . the overriding concern of the “ buried data techniques ” appears to be to provide for a “ known channel ” to be inserted in such a manner as to leave little or no perceivable artifacts in the content signal while prescribing the exact location of the information ( i . e ., replacing the least significant bits ( lsb ) in a given information signal ). in gerzon and craven &# 39 ; s example , a 20 - bit signal gives way to 4 - bits of lsbs for adding about 27 db of noise to the music . per channel data insertion reached 176 . 4 kilobits per second per channel , or 352 . 8 kbps with stereo channels . similarly attempted data insertion by the present inventors using random data insertion yielded similar rates . the described techniques may be invaluable to manufacturers seeking to support improvements in audio , video and multimedia quality improvements . these include multiple audio channel support , surround sound , compressed information on dynamic range , or any combination of these and similar data to improve quality . unfortunately , this does little or nothing to protect the interests of copyright holders from unscrupulous pirates , as they attempt to create unmarked , perfect copies of copyrighted works . the present invention also relates to the “ steganographic method and device ” patent and the “ method for human - assisted random key generation and application for digital watermark system ” patent , as well as u . s . pat . no . 5 , 745 , 569 entitled “ method for stega - cipher protection of computer code ” as mentioned above , specifically addressing the weakness of inserting informational signals or digital watermarks into known locations or known frequency ranges , which are sub - audible . the present invention seeks to improve on the methods disclosed in these patent applications and other methods by describing specific optimization techniques at the disposal of those skilled in the art . these techniques provide an a la carte method for rethinking error correction , interleaving , digital and analog filters , noise shaping , nonlinear random location mapping in digitized samples , hashing , or making unique individual watermarks , localized noise signal mimic encoding to defeat noise filtering over the entire sample stream , super audible spread spectrum techniques , watermark inversion , preanalyzing watermark key noise signatures , and derivative analysis of suspect samples against original masters to evaluate the existence of watermarks with statistical techniques . the goal of a digital watermark system is to insert a given information signal or signals in such a manner as to leave few or no artifacts in the underlying content signal , while maximizing its encoding level and location sensitivity in the signal to force damage to the content signal when removal is attempted . the present invention establishes methods for estimating and utilizing parameters , given principles of the digitization of multimedia content ( audio , video , virtual reality , etc . ), to create an optimized “ envelope ” for insertion of watermarks , and thus establish secured responsibility for digitally sampled content . the pseudo - random key that is generated is the only map to access the information signal while not compromising the quality of the content . a digital watermark naturally resists attempts at removal because it exists as purely random or pseudo - random noise in a given digitized sample . at the same time , inversion techniques and mimicking operations , as well as encoding signal features instead of given samples , can make the removal of each and every unique encoded watermark in a given content signal economically infeasible ( given the potential commercial returns of the life of a given copyright ) or impossible without significantly degrading the quality of the underlying , “ protected ” signal . lacking this aesthetic quality , the marketability or commercial value of the copy is correspondingly reduced . the present invention preserves quality of underlying content signals , while using methods for quantifying this quality to identify and highlight advantageous locations for the insertion of digital watermarks . the present invention integrates the watermark , an information signal , as closely as possible to the content signal , at a maximal level , to force degradation of the content signal when attempts are made to remove the watermarks . general methods for watermarking digitized content , as well as computer code , are described in related patents entitled “ steganographic method and device ” and entitled “ method for stega - cipher protection of computer code .” recognizing the importance of perceptual encoding of watermarks by the authors and engineers who actually create content is addressed in patent “ method for human assisted random key generation and application for digital watermark system .” the present invention describes methods of random noise creation given the necessary consequence of improving signal quality with digitization techniques . additionally , methods are described for optimizing projections of data redundancy and overhead in error correction methods to better define and generate parameters by which a watermarking system can successfully create random keys and watermark messages that subsequently cannot be located and erased without possession of the key that acts as the map for finding each encoded watermark . this description will provide the backdrop for establishing truly optimized watermark insertion including : use of nonlinear ( chaotic ) generators ; error correction and data redundancy analysis to establish a system for optimizing key and watermark message length ; and more general issues regarding desired quality relating to the importance of subjecting watermarked content to different models when the content may be distributed or sold in a number of prerecorded media formats or transmitted via different electronic transmission systems ; this includes the use of perceptual coding ; particularized methods such as noise shaping ; evaluating watermark noise signatures for predictability ; localized noise function mimic encoding ; encoding signal features ; randomizing time to sample encoding of watermarks ; and , finally , a statistical method for analyzing composite watermarked content against a master sample content to allow watermark recovery . all of these features can be incorporated into specialized digital signal processing microprocessors to apply watermarks to nongeneralized computing devices , such as set - top boxes , video recorders that require time stamping or authentication , digital versatile disc ( dvd ) machines and a multitude of other mechanisms that play or record copyrighted content . as discussed above , the nyquist theorem proves that bandlimited signals can be sampled , stored , processed , transmitted , reconstructed , desampled or processed as discrete values . in order for the theorem to hold true , the sampling must be done at a frequency that is at least twice the frequency of the highest signal frequency to be captured and reproduced . aliasing will occur as a form of signal fold over , if the signal contains components above the nyquist frequency . to establish the highest possible quality in a digital signal , aliasing is prevented by low - pass filtering the input signal to a given digitization system by a low - pass or anti - aliasing filter . any residue aliasing which may result in signal distortion , relates to another area of signal quality control , namely , quantization error removal . quantization is required in a digitization system . because of the continuous nature of an analog signal ( amplitude vs . time ), a quantized sample of the signal is an imperfect estimate of the signal sample used to encode it as a series of discrete integers . these numbers are merely estimates of the true value of the signal amplitude . the difference between the true analog value at a discrete time and the quantization value is the quantization error . the more bits allowed per sample , the greater the accuracy of estimation ; however , errors still always will occur . it is the recurrent nature of quantization errors that provides an analogy with the location of digital watermarks . thus , methods for removal of quantization errors have relevance in methods for determining the most secure locations for placement of watermarks to prevent the removal of such watermarks . the highest fidelity in digital reproduction of a signal occurs at points where the analog signal converges with a given quantization interval . where there is no such convergence , in varying degrees , the quantization error will be represented by the following range : + q / 2 and − q / 2 , where q is the quantization interval . indeed , describing maximization of the quantization error and its ratio with the maximum signal amplitude , as measured , will yield a signal - to - error ratio ( s / e ) which is closely related to the analog signal - to - noise ratio ( s / n ). to establish more precise boundaries for determining the s / e , with root mean square ( rms ) quantization error e . sub . rms , and assuming a uniform probability density function 1 / q ( amplitude ), the following describes the error : this explains the s / e ratio of 98 db for 16 - bit and 92 db for 15 - bit quantization . the 1 . 76 factor is established statistically as a result of peak - to - rms ratio of a sinusoidal waveform , but the factor will differ if the signal waveform differs . in complex audio signals , any distortion will exist as white noise across the audible range . low amplitude signals may alternatively suffer from distortion . quantization distortion is directly related with the original signal and is thus contained in the output signal . this being the case , implementation of so - called quality control of the signal may use dither . as discussed above , dither is a method of adding random noise to the signal to de - correlate quantization error from the signal while reducing the audibility of the remaining noise . distortion may be removed at the cost of adding more noise to the filtered output signal . an important effect is the subsequent randomization of the quantization error while still leaving an envelope of an unremovable signaling band of noise . dither , done at low signal levels , typically affects only the least significant bits of the samples . use of linear and nonlinear quantization can affect the output signal , and this trade - off must be considered for a system of watermarks designed to determine acceptable quantization distortion to contain the digital watermark . for audio systems , block linear quantization implementations may be chosen . however , block floating point and floating point systems , non - uniform companding , adaptive delta modulation , adaptive differential pulse - code modulation , and perceptual coding schemes ( which are oriented around the design of filters that closely match the actual perception of humans ) appear to provide alternative method implementations that would cause higher perceptible noise artifacts if filtering for watermarks was undertaken by pirates . the choice of method is related to the information overhead desired . according to one aspect of the present invention , the envelope described in the quantization equations above is suitable for preanalysis of a digitized sample to evaluate optimal locations for watermarks . the present example is for audio , but corresponding applications for digitization of video may be implemented using the quantization of color and luminance . the matter of dither complicates preanalysis of a sample evaluated for digital watermarks . therefore , the present invention also defines the optimal envelope more closely given three types of dither ( this example is for audio , others exist for video ): triangular probability density function ( pdf ), gaussian pdf , and rectangular pdf . again , the purpose is to establish better boundaries for the random or pseudo - random insertion of a watermark in a region of a content signal that would represent an area for hiding watermarks in a manner most likely to cause damage to the content signal if unauthorized searches or removal are undertaken . dither makes removal of quantization error more economical through lower data overhead in a system by shifting the signal to decorrelate errors from the underlying signal . when dither is used , the dither noise and signal are quantized together to randomize the error . dither which is subtractive requires removing the dither signal after requantization and creates total error statistical independence . subtractive dither also provides further parameters for digital watermark insertion given the ultimate removal of the dither signal before finalizing the production of the content signal . with nonsubtractive dither , the dither signal is permanently left in the content signal . errors would not be independent between samples . for this reason , further analysis with the three types of dither should reveal an acceptable dither signal without materially affecting the signal quality . some proposed systems for implementing copyright protection into digitally - sampled content predicate the natural occurrence of artifacts that cannot be removed . methods for creating a digital signature in the minimized error that is evident , as demonstrated by explanations of dither , point out another significant improvement over the art in the system described in the present invention and its antecedents . every attempt is made to raise the error level of error from lsbs to a level at which erasure necessarily leads to the degradation of the “ protected ” content signal . furthermore , with such a system , pirates are forced to make guesses , and then changes , at a high enough encoding level over a maximum amount of the content signal so as to cause signal degradation , because guessing naturally introduces error . thus , dither affects the present invention &# 39 ; s envelope by establishing a minimum encoding level . any encoding done below the dither level might be erased by the dither . one embodiment of the present invention may be viewed as the provision of a random - super - level non - subtractive dither which contains information ( the digital watermark ). to facilitate understanding how this does not cause audible artifacts , consider the meaning of such encoding in terms of the s / e ratio . in a normal 16 - bit signal , there is a 98 db s / e according to the equation s / e = 6 . 02n + 1 . 76 . consider that the encoding of watermark information looks like any other error , except it moves beyond the quantization level , out of the lsbs . if the error is of a magnitude expressed in bits , for example , 8 bits , then at that moment , the signal effectively drops to 8 bits ( 16 − 8 ). this corresponds to a momentary drop in s / e , referred to herein as the momentary s / e . yet , these errors are relatively few and far between and therefore , since the signal is otherwise comprised of higher - bit samples , a “ perceived s / e ” may be derived which is simply the weighted average of the samples using the “ pure s / e ” ( the samples without watermark information ) and those with the momentary s / e . as a direct consequence , it may be observed that as the watermark map becomes more sparse , the number of errors introduced in a given range is reduced , and the higher the perceived s / e . it also helps that the error is random , and so over time , appears as white noise , which is relatively unobtrusive . in general , it is observed that as long as introduced errors leave resulting samples within an envelope in the sample window described by minimum and maximum values , before error introduction , and the map is sufficiently sparse , the effects are not perceived . in addition , it is possible to obtain an even higher perceived s / e by allowing the range of introduced errors to vary between a minimum and maximum amount . this makes the weighted average s / e higher by reducing the average introduced error level . yet , someone trying to erase a watermark , assuming they knew the maximum level , would have to erase at that level throughout the data , since they would not know how the introduced level varies randomly , and would want to erase all watermarks . a watermarking cipher could perform this operation and may also introduce the further step of local dither ( or other noise ) significantly above the quantization amplitude on a window by window basis , randomly , to restrict total correlation between the watermark signal and the probability that it remains independent between samples , similar to the use of subtractive dither implementations that are mostly concerned with the ultimate removal of the dither signal with requantization . this ability could be used to accomplish signal doping , which adds a degree of random errors that do not contain watermark information so as to prevent differential analysis of multiple watermarked copies . alternatively , it could be used to mimic a specific noise function in a segment of the signal in order to defeat attempts to filter a particular type of noise over the entire signal . by varying this function between watermarks , it may help ensure that any particular filter is of little use over the whole signal . by applying several filters in series , it seems intuitive that the net results would be significantly different from the original signal . the discussion may be more appropriately introduced with perceptual coding techniques , but a watermarking system could also defeat some detection and correction with dither by inserting watermarks into signal features , instead of signal samples . this would be equivalent to looking for signal characteristics , independent of the overall sample as it exists as a composite of a number of signals . basically , instead of encoding on a bit per sample basis , one might spread bits over several samples . the point of doing this is that filtering and convolution operations , like “ flanging ,” which definitely change individual samples on a large scale , might leave intact enough of a recognizable overall signal structure ( the relationship between multiple samples ) to preserve the watermark information . this may be done by measuring , generalizing , and altering features determined by the relationships between samples or frequency bands . because quantization is strictly an art of approximation , signal - to - error ratios , and thus the dynamic range of a given system are determined . the choice of eliminating quantization distortion at the expense of leaving artifacts ( not perceptible ) is a permanent trade - off evident in all digitization systems which are necessarily based on approximation ( the design goal of the present invention in preanalyzing a signal to mask the digital watermarks make imperceptibility possible ). the high fidelity of duplication and thus subsequent ability to digitally or electronically transmit the finished content ( signal ) is favored by consumers and artists alike . moreover , where there continues to be a question of approximating in quantization — digital watermark systems will have a natural partner in seeking optimized envelopes in the multitude and variety of created digitized content . another aspect of optimizing the insertion of digital watermarks regards error correction . highly redundant error codes and interleaving might create a buffer against burst errors introduced into digital watermarks through randomization attacks . a detailed description follows from the nature of a digitization system — binary data can be corrected or concealed when errors exist . random bit errors and burst errors differ in their occurrence : random bit errors are error bits occurring in a random manner , whereas burst errors may exist over large sequences of the binary data comprising a digitized signal . outside the scope of the present invention are errors caused by physical objects , such as dust and fingerprints , that contribute to the creation of dropouts are different from the errors addressed herein . measuring error with bit - error ratio ( ber ), block error ratio ( bler ) and burst - error length ( berl ), however , provides the basis of error correction . redundancy of data is a focus of the present invention . this data necessarily relies on existing data , the underlying content . to efficiently describe optimal parameters for generating a cryptographic key and the digital watermark message discussion of error correction and error concealment techniques is important . forms of error detection include one - bit parity , relying on the mathematical ability to cast out numbers , for binary systems including digitization systems , such as 2 . remainders given odd or even results ( parity ) that are probabilistically determined to be errors in the data . for more appropriate error detection algorithms , such as cyclic redundancy check code ( crcc ), which are suited for the detection of commonly occurring burst error . pohlmann ( principles of digital audio ) notes the high accuracy of crcc ( 99 . 99 %) and the truth of the following statements given a k - bit data word with m bits of crcc , a code word of n bits is formed ( m = n − k ): burst errors less than or equal to m bits are always predictable . random errors up to 3 consecutive bits long can be detected . the medium of content delivery , however , provides the ultimate floor for crcc design and the remainder of the error correction system . error correction techniques can be broken into three categories : methods for algebraic block codes , probabilistic methods for convolutional codes , and cross - interleave code where block codes are used in a convolution structure . as previously discussed , the general class of codes that assist in pointing out the location of error are known generally as hamming codes , versus crcc which is a linear block code . what is important for establishing parameters for determining optimized error coding in systems such as digital audio are more specifically known as reed - solomon codes which are effective methods for correcting burst errors . certain embodiments of the present invention presuppose the necessity of highly redundant error codes and interleaving , such as that done in cross interleave reed - solomon code , to counter burst errors typically resulting from randomization attacks . more generally , certain embodiments of the present invention include the use of hamming codes of ( n , n ) to provide n − 1 bit error detection and n − 2 bit error correction . further , a hamming distance of n ( or greater than n ) is significant because of the nature of randomization attacks . such an attack seeks to randomize the bits of the watermark message . a bit can be either 0 or 1 , so any random change has a 50 % chance of actually changing a bit from what it was ( 50 % is indicative of perfect randomness ). therefore , one must assume that a good attack will change approximately half the bits ( 50 %). a hamming distance of n or greater , affords redundancy on a close par with such randomization . in other words , even if half the bits are changed , it would still be possible to recover the message . because interleaving and parity make data robust for error avoidance , certain embodiments of the present invention seek to perform time interleaving to randomly boost momentary s / e ratio and help prevent removing keys and watermarks that may be subsequently determined not to be “ errors .” given a particular digital content signal , parity , interleaving , delay , and cross - interleaving , used for error correction , should be taken into account when preprocessing information to compute absolute size requirements of the encoded bit stream and limiting or adjusting key size parameters to optimize and perhaps further randomize usage of key bits . in addition , these techniques minimize the impact of errors and are thus valuable in creating robust watermarks . uncorrected errors can be concealed in digital systems . concealment offers a different dynamic to establish insertion parameters for the present invention . error concealment techniques exist because it is generally more economical to hide some errors instead of requiring overly expensive encoders and decoders and huge information overheads in digitization systems . muting , interpolation , and methods for signal restoration ( removal of noise ) relate to methods suggested by the present invention to invert some percentage or number of watermarks so as to ensure that at least some or as many as half of the watermarks must still remain in the content signal to effectively eliminate the other half . to invert a watermark relative to another watermark is to inverse the mathematical or logical relationships between the two watermarks ( for example , without limitation , by bit flipping , by inverting the phase relationships , or by using an inverse filter relationship ). given that a recording contains noise , whether due to watermarks or not , a restoration which “ removes ” such noise is likely to result in the changing of some bit of the watermark message . therefore , by inverting every other watermark , it is possible to insure that the very act of such corrections inverts enough watermark bits to create an inverse watermark . this inversion presupposes that the optimized watermark insertion is not truly optimal , given the will of a determined pirate to remove watermarks from particularly valuable content . ultimately , the inability to resell or openly trade unwatermarked content will help enforce , as well as dictate , the necessity of watermarked content for legal transactions . the mechanisms discussed above reach physical limits as the intent of signal filtering and error correction are ultimately determined to be effective by humans — decidedly analog creatures . all output devices are thus also analog for playback . the present invention allows for a preprocessed and preanalyzed signal stream and watermark data to be computed to describe an optimized envelope for the insertion of digital watermarks and creation of a pseudorandom key , for a given digitized sample stream . randomizing the time variable in evaluating discrete sample frames of the content signal to introduce another aspect of randomization could further the successful insertion of a watermark . more importantly , aspects of perceptual coding are suitable for methods of digital watermarks or super - audible spread spectrum techniques that improve on the art described by the preuss et al . patent described above . the basis for a perceptual coding system , for audio , is psychoacoustics — the analysis of what the human ear is able to perceive . similar analysis is conducted for video systems , and some may argue abused , with such approaches as “ subliminal seduction ” in advertising campaigns . using the human for design goals is vastly different than describing mathematical or theoretical parameters for watermarks . on some level of digital watermark technology , the two approaches may actually complement each other and provide for a truly optimized model . the following example applies to audio applications . however , this example and other examples provided herein are relevant to video systems as well as audio systems . where a human ear can discern between energy inside and outside the “ critical band ,” ( described by harvey fletcher ) masking can be achieved . this is particularly important as quantization noise can be made imperceptible with perceptual coders given the maintenance of a sampling frequency , and decreased word length ( data ) based on signaling conditions . this contrasts with the necessary decrease of 6 db / bit with decreases in the sampling frequency as described above in the explanation of the nyquist theorem . indeed , data quantity can be reduced by 75 %. this is an extremely important variable to feed into the preprocessor that evaluates the signal in advance of “ imprinting ” the digital watermark . in multichannel systems , such as mpeg - 1 , ac - 3 and other compression schemes , the data requirement ( bits ) is proportional to the square root of the number of channels . what is accomplished is masking that is nonexistent perceptually , only acoustically . the phrase “ nonexistent perceptually ” means merely that the masking is not perceived as being present . taken to another level for digital watermarking , which is necessary for content that may be compressed and decompressed , forward adaptive allocation of bits and backward adaptive allocation provide for encoding signals into content signals in such a manner that information can be conveyed in the transmission of a given content signal that is subsequently decoded to convey the relatively same audible signal to a signal that carries all of its bits — e . g ., no perceptual differences between two signals that differ in bit size . this coding technique must also be preanalyzed to determine the most likely sample bits , or signal components , that will exist in the smaller sized signal . this is also clearly a means to remove digital watermarks placed into lsbs , especially when they do not contribute significant perceptible value to the analyzed signal . further methods for data reduction coding are similarly important for preanalyzing a given content signal prior to watermarking . frequency domain coders , such as sub - band and transform bands , can achieve data reduction of ratios between 4 : 1 and 12 : 1 . the coders adaptively quantize samples in each sub - band based on the masking threshold in that sub - band ( see pohlmann , principles of digital audio ). transform coders , however , convert time domain samples into the frequency domain for accomplishing lossless compression . hybrid coders combine both sub - band and transform coding , again with the ultimate goal of reducing the overall amount of data in a given content signal without loss of perceptible quality . with digital watermarks , descriptive analysis of an information signal is important to preanalyze a given watermark &# 39 ; s noise signature . analysis of this signature versus the preanalysis of the target content signal for optimized insertion location and key / message length , are potentially important components to the overall implementation of a secure watermark . it is important that the noise signature of a digital watermark be unpredictable without the pseudo - random key used to encode it . noise shaping , thus , has important applications in the implementation of the present invention . in fact , adaptive dither signals can be designed to correlate with a signal so as to mask the additional noise — in this case a digital watermark . this relates to the above discussion of buried data techniques and becomes independently important for digital watermark systems . each instance of a watermark , where many are added to a given content signal given the size of the content and the size of the watermark message , can be “ noise shaped ” and the binary description of the watermark signature may be made unique by “ hashing ” the data that comprises the watermark . generally , hashing the watermark prior to insertion is recommended to establish differences between the data in each and every watermark “ file .” additionally , the present invention provides a framework in which to analyze a composite content signal that is suspected to contain a watermarked sample of a copyrighted work , against an unwatermarked original master of the same sample to determine if the composite content actually contains a copy of a previously watermarked content signal . such an analysis may be accomplished in the following scenario : assume the provision of the suspect composite signal c . sub . w ( t ) ( w subscript denotes a possible watermark ) and the unwatermarked original sample s . sub . uw ( t ). these are the only two recordings the analyzer is likely to have access to . the methods of digital signal processing allow for the computation of an optimal estimate of a signal . the signal to be estimated is the composite minus the watermarked sample , or c ″. sub . w ( t )= c . sub . w ( t )− s . sub . w −( t ). the analyzer , however , cannot determine a value of s . sub . w ( t ), since it does not know which of the many possible s . sub . w ( t ) signals was used in the composite . however , a close estimate may be obtained by using s . sub . uw ( t ), since watermarking makes relatively minor changes to a signal . so , c ″. sub . w ( t ) ( an estimate of c ′. sub . w ( t ) given c ″. sub . w ( t ) and s ′. sub . w ( t )) may be obtained . once c ″. sub . w ( t ) is calculated , it is simply subtracted from c . sub . w ( t ). this yields s ′. sub . w ( t ) c . sub . w ( t )− c ″. sub . w ( t ). if the watermark is robust enough , and the estimate good enough , then s ′. sub . w ( t ), which is approximately equal to s . sub . w ( t ), can be processed to extract the watermark . it is simply a matter of attempting watermark decoding against a set of likely encoding key candidates . note that although a watermark is initially suspected to be present in the composite , and the process as if it is , the specifics of the watermark are not known , and a watermark is never introduced into the calculations , so a watermark is extracted , it is valid , since it was not introduced by the signal processing operations . the usefulness of this type of operation is demonstrated in the following scenario : people are interested in simply proving that their copyrighted sample was dubbed into another recording , not the specifics of ownership of the sample used in the dubbing . so , this implies that only a single , or limited number of watermark keys would be used to mark samples , and hence , the decode key candidates are limited , since the same key would be used to encode simple copyright information which never varies from copy to copy . there are some problems to solve to accomplish this sort of processing . the sample in question is generally of shorter duration than the composite , and its amplitude may be different from the original . analysis techniques could use a combination of human - assisted alignment in the time domain , where graphical frequency analysis can indicate the temporal location of a signal which closely matches that of the original sample . in addition , automatic time warping algorithms which time align separate signals , on the assumption they are similar could also be used to solve temporal problems . finally , once temporal alignment is accomplished , automatic amplitude adjustment could be performed on the original sample to provide an optimal match between the composite section containing the sample and the original sample . it may be desirable to dynamically vary the encoding / decoding algorithm during the course of encoding / decoding a signal stream with a given watermark . there are two reasons for dynamically varying the encoding / decoding algorithm . the first reason for dynamically varying the encoding / decoding algorithm is that the characteristics of the signal stream may change between one locality in the stream and another locality in the stream in a way that significantly changes the effects that a given encoding algorithm may have on the perception of that section of the stream on playback . in other words , one may want the encoding algorithm , and by implication , the decoding algorithm , to adapt to changes in the signal stream characteristics that cause relative changes in the effects of the encoding algorithm , so that the encoding process as a whole causes fewer artifacts , while maintaining a certain level of security or encoding a given amount of information . the second reason for dynamically varying the encoding / decoding algorithm is simply to make more difficult attempts at decoding watermarks without keys . it is obviously a more difficult job to attempt such attacks if the encoding algorithm has been varied . this would require the attacker to guess the correct order in which to use various decoding algorithms . in addition , other reasons for varying the encoding / decoding algorithms may arise in the future . two methods for varying of the encoding / decoding algorithms according to embodiments of the present invention are described herein . the first method corresponded to adaptation to changing signal characteristics . this method requires a continuous analysis of the sample windows comprising the signal stream as passed to the framework . based on these characteristics , which are mathematically well - defined functions of the sample stream ( such as rms energy , rms / peak ratio , rms difference between samples — which could reflect a measure of distortion ), a new codec ( encoder / decoder ) module , from among a list of pre - defined codecs , and the algorithms implemented in them , can be applied to the window in question . for the purpose of this discussion , windows are assumed to be equivalent to frames . and , in a frame - based system , this is a straightforward application of the architecture to provide automated variance of algorithms to encode and decode a single watermark . the signal features ( or signal characteristics ) can also be identified from relationships between multiple sample windows in the digital content signal . for example , an implementation using a sample window size of 15 seconds can be compared to an implementation using a sample window size of 45 seconds . the comparison will reveal differences in robustness of the encoding and decoding operations — which differences will be useful in identifying signal features that are desirable to target . the second method for varying of the encoding / decoding algorithms corresponds to increased security . this method is easier , since it does not require the relatively computationally - expensive process of further analyzing the samples in a frame passed to the framework . in this method , the framework selects a new codec , from among a list of predefined codecs , to which to pass the sample frame as a function of the pseudo - random key employed to encode / decode the watermark . again , this is a straightforward application of framework architecture which provides automated variance of algorithms to encode and decode a single watermark versus limitations evident in the analysis of a single random noise signal inserted over the entire content signal as proposed by digimarc , nec , thorn emi and ibm under the general guise of spread spectrum , embedded signaling schemes . it is important to note that the modular framework architecture , in which various modules including codecs are linked to keys , provides a basic method by which the user can manually accomplish such algorithmic variations for independent watermarks . the main difference detailed above is that an automated method to accomplish this can be used within single watermarks . automated analysis of composited copyrighted material offers obvious advantages over subjective “ human listening ” and “ human viewing ” methods currently used in copyright infringement cases pursued in the courts . in addition to the embodiments discussed above , in the same manner that the signal to be watermarked , or scrambled , may be separated in time ( from the beginning to the end of the signal ) into streams , as disclosed in the copending u . s . patent application ser . no . 09 / 594 , 719 , entitled “ utilizing data reduction in steganographic and cryptographic systems ,” additional processing may occur prior to the actual embedding of the watermark (“ preprocessing ”) as well as after each instance of watermark embedding (“ postprocessing ”). the pre - and post - processing may be used to optimize the actual embedding process . in cases where the intent is to watermark a compressed file , for a given signal , the coefficients that are to be manipulated may first be identified . that is , for a particular signal , such as a song , a video , etc ., to be embedded in such a manner as to authorize a plurality of unique descendant copies of that signal , a preprocessing step may first complete the necessary psychoacoustic or psychovisual modeling inherent in the embedding process for that signal . in one embodiment , the watermark message may change for each descendant copy . in another embodiment , the key may change for each descendant copy to reflect the uniqueness of a given message . in either case , both the message and the key may be processed so as to reflect any intended differences among the descendant copies . of particular interest are those cases in which the psychoacoustic or psychovisual model may be roughly correct for any number of proprietary compression techniques ( e . g ., mp3 , aac , epac , etc . for audio , mpeg for video ) and a given signal may need to be prepared so as to enable the watermarking encoder to handle multiple requests for the same signal , but for different compression schemes . the preprocessing step of the present invention provides a “ skeleton ” of the candidate bits , and eliminates the need to process all of the signal data each time an encoding is performed . each time a descendant copy is created , the appropriate model ( e . g ., psychovisual , psychoacoustic , etc .) may be generated for that signal , or a previously saved version of the appropriate model is referenced , and then any concatenation between the model and the particular compression scheme may be matched . any uniquely - generated descendant copy may differ from other copies in that the keys or messages may change to reflect the difference after watermark ( s ) have been embedded . one signal may have a plurality of watermarks , which may be a combination of different messages , different encoding keys , and different decoding keys , or key pairs , for each embedded message . the psychoacoustic model itself may be saved for later handling in the watermark encoding process so as to decrease the requisite time to make every instance of a descendant copy unique for any number of characteristics . these characteristics may include , inter alia , a geographical territory , a transaction identification , an individual identification , a use limitation , a domain , a logical constraint , etc . the preprocessing of the signal may prepare a key for additional postprocessing in making the key or watermarked signal unique . other embodiments and uses of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . the specification and examples should be considered exemplary only with the true scope and spirit of the invention indicated by the following claims . as will be easily understood by those of ordinary skill in the art , variations and modifications of each of the disclosed embodiments can be easily made within the scope of this invention as defined by the following claims . | 6 |
test materials were prepared by varying the iron content in the base metal and in the brazing material as shown in table 1 , and heat exchangers of the plate - fin structure shown in fig1 were constructed by the combination of base metals and the test members shown in table 2 by means of flux brazing and fluxless brazing as shown , in order to carry out testing by applying an internal pressure thereto . said brazing is affected using standard prior art techniques and conventional process parameters in general , which do not constitute an aspect of this invention , per se . in fig1 and 2 , reference numeral 1 denotes brazing sheets , 2 denotes fins , 3 denotes a brazing material , 4 denotes spacer bars , 5 denotes test paths , and 6 denotes dummy paths . table 1__________________________________________________________________________chemical components of test materialstest chemicalmaterialcomponents si fe cu mn mg cr zn ti al__________________________________________________________________________corres . alloy a 0 . 21 0 . 60 0 . 12 1 . 10 0 . 02 0 . 02 0 . 04 0 . 01 balanceto 3003alloy b 0 . 26 0 . 11 0 . 16 0 . 13 0 . 03 0 . 02 0 . 03 0 . 01 &# 34 ; corres . alloy c 0 . 27 0 . 63 0 . 18 1 . 23 1 . 07 0 . 01 0 . 04 0 . 01 &# 34 ; to 3004alloy d 0 . 25 0 . 15 0 . 19 1 . 21 1 . 22 0 . 02 0 . 05 0 . 01 &# 34 ; corres . alloy a 11 . 7 0 . 65 0 . 01 0 . 01 0 . 01 0 . 02 0 . 01 0 . 01 &# 34 ; to alloy b 11 . 3 0 . 15 0 . 02 0 . 01 0 . 01 0 . 02 0 . 01 0 . 01 &# 34 ; 4047 alloy c 11 . 3 0 . 04 0 . 01 0 . 01 0 . 01 0 . 03 0 . 01 0 . 01 &# 34 ; corres . alloy d 10 . 1 0 . 70 0 . 01 0 . 01 1 . 45 0 . 03 0 . 01 0 . 01 &# 34 ; to alloy e 9 . 8 0 . 14 0 . 03 0 . 01 1 . 56 0 . 02 0 . 01 0 . 01 &# 34 ; 4004 alloy f 10 . 2 0 . 02 0 . 02 0 . 01 1 . 49 0 . 03 0 . 01 0 . 01 &# 34 ; __________________________________________________________________________ table 2__________________________________________________________________________test results pressurebrazing brazing base metals for burst brokenmethods materials no . ( fin metals ) test samples portion remarks__________________________________________________________________________flux a ( corres . 1 a ( corres . 303 kg / cm . sup . 2 ( g ) jointsbrazing to 4047 ) to 3003 ) 2 b ( corres . 315 &# 34 ; to 3003 ) b ( corres . 3 a ( corres . 401 fins ( joint strength to 4047 ) to 3003 ) not confirmed ) 4 b ( corres . 408 &# 34 ; ( joint strength to 3003 ) not confirmed ) c ( corres . 5 a ( corres . 410 &# 34 ; ( joint strength to 4047 ) to 3003 ) not confirmed ) 6 b ( corres . 417 &# 34 ; ( joint strength to 3003 ) not confirmed ) a ( corres . 7 c ( corres . 351 joints to 4047 ) to 3004 ) 8 d ( corres . 344 &# 34 ; to 3004 ) b ( corres . 9 c ( corres . 486 fins ( joint strength to 4047 ) to 3004 ) not confirmed ) 10 d ( corres . 480 &# 34 ; ( joint strength to 3004 ) not confirmed ) c ( corres . 11 c ( corres . 492 &# 34 ; ( joint strength to 4047 ) to 3004 ) not confirmed ) 12 d ( corres . 501 &# 34 ; ( joint strength to 3004 ) not confirmed ) fluxless d ( corres . 13 a ( corres . 289 jointsbrazing to 4044 ) to 3003 ) 14 b ( corres . 277 &# 34 ; to 3003 ) e ( corres . 15 a ( corres . 395 fins ( joint strength to 4044 ) to 3003 ) not confirmed ) 16 b ( corres . 406 &# 34 ; ( joint strength to 3003 ) not confirmed ) f ( corres . 17 a ( corres . 403 &# 34 ; ( joint strength to 4044 ) to 3003 ) not confirmed ) 18 b ( corres . 403 &# 34 ; ( joint strength to 3003 ) not confirmed ) d ( corres . 19 c ( corres . 339 joints to 4044 ) to 3004 ) 20 d ( corres . 348 &# 34 ; to 3004 ) e ( corres . 21 c ( corres . 492 fins ( joint strength to 4044 ) to 3004 ) not confirmed ) 22 d ( corres . 490 &# 34 ; ( joint strength to 3004 ) not confirmed ) f ( corres . 23 c ( corres . 505 &# 34 ; ( joint strength to 4044 ) to 3004 ) not confirmed ) 24 d ( corres . 494 &# 34 ; ( joint strength to 3004 ) not confirmed ) __________________________________________________________________________ the test results are shown in table 2 . when the iron content in the brazing material is reduced to 0 . 15 % by weight or less , the ultimate strength of brazed joints of fins increases by 30 % to 49 % compared with examples when iron is contained in an amount close to the upper limit of the standarized value . therefore , the iron content in the brazing material is specified to be 0 . 15 % by weight or less . according to test nos . 2 , 8 , 14 and 20 of table 2 , joints are broken though the iron contents are small in the base metal , since the iron contents in the brazing materials are outside the range specified by the present invention . according to test nos . 3 , 5 , 9 , 11 , 15 , 17 , 21 and 23 , on the other hand , the strength at the brazed joints is so improved as to become greater than the ultimate strength of fins though iron is contained in large amounts in the base metal , since the iron content in the brazing materials lies within the range defined by the present invention . in other words , the ultimate strength is affected little by the iron content in the base metals . the strength of bazed joints is improved if the iron content in the brazing material is selected to be 0 . 15 % by weight or less ; i . e ., joints having strength greater than the ultimate strength of fins can be obtained in this way . the above - mentioned effects are obtained even when a material of the al - si type corresponding to jis 4047 is used , or even when a material of the al - si - mg type corresponding to jis 4004 is used , and even when magnesium is contained in the base metal ( fin metal ) that is to be joined . iron present on the broken surface of tested joints was analyzed using a sample that offered joints having a strength greater than the ultimate strength of fins . it was observed that iron was present not in the form of a compound but in the form of a solid solution in the α - phase . it can be easily presumed that the above change helps increase the toughness of joints and increase the strength of the joints as a whole . the present invention makes it possible to increase the strength of a joint structure to meet the purposes in manufacturing large equipment in which brazing is effected under sever conditions and limitation is imposed on the size of the brazed joints . though it has generally been believed that the materials containing magnesium could not be sufficiently jointed with brazing , the use of the alloy of the present invention serves to increase the strength of the structure to thereby meet this objective . using the al - si - mg type brazing material , furthermore , the joints become brittle since magnesium is left in the brazed joints . by suppressing the iron content in the brazing material to 0 . 15 % by weight or less in accordance with the present invention , however , the strength of the structure can be increased to overcome this obstacle . | 8 |
referring now to fig1 there is shown a schematic diagram of a purification system for providing pure cadmium and tellurium in stoichiometric quantities to form crystalline cadmium telluride which is pure and of the proper stoichiometry . the system includes a reactor tube 1 which is preferably formed of vitreous quartz and which has a pair of fittings 3 and 5 at opposite ends thereof . the fittings 3 and 5 seal off the ends of the reactor tube 1 except for tubes 7 , 9 and 23 passing therethrough which will now be explained . the fitting 3 includes a pair of tubes 7 and 9 passing therethrough , the tube 9 passing to a first chamber 11 in which is disposed a vitreous quartz boat 13 having impure cadmium therein . the chamber 11 has an outlet 15 having a constriction 16 as shown in fig2 . a tapered ceramic tube 17 is disposed within tube 1 , abuts the constriction 16 at its wide end and is adjacent the outlets of chambers 11 and 19 for reasons as will be explained hereinbelow . the inlet tube 7 passes to the chamber 19 within the reactor tube 1 , the chamber 19 including a ceramic quartz boat 21 in which is disposed impure tellurium . the outlet of the chamber 19 passes to the inlet of the tapered tube 17 at which point the output gasses from the chambers 11 and 19 will mix . the tapered ceramic tube 17 passes for an extended distance within the reactor tube 1 as will be explained in more detail hereinbelow and then the reactor tube alone continues to the fitting 5 through which is disposed the outlet tube 23 to an exhaust system and scrubbers and other desirable output devices . as can be seen , five furnace elements 25 , 27 , 29 , 31 and 33 are disposed along the reactor tube 1 , the first furnace element 25 being disposed around the chamber 11 containing the cadmium in the boat 13 , the second element 27 being disposed about the chamber 19 and tellurium containing boat 19 , the third element 29 being disposed for a small region along the inlet to the tapered tube 17 at the outlet of the chambers 11 and 19 , the fourth element 31 being disposed about a major portion of the tapered tube 17 and a fifth element 33 being disposed about the downstream end portion of the tapered tube 17 and beyond and along the reactor tube 1 . the purpose of the five furnace elements is , in the case of the element 25 over the cadmium containing boat 13 and the element 27 over the tellurium containing boat 21 , to provide the proper vapor pressure in each chamber so that the same amounts of cadmium and tellurium will evaporate on a time basis for reaction externally to these chambers at the inlet to tapered tube 17 . preferable temperatures for these elements are 450 degrees c . for element 25 and 500 degrees c . for element 27 , it being understood that these temperatures can be altered to provide proper stoichiometric amounts of the volatilized elements so long as the temperature is high enough to provide rapid volatilization . the element 29 is positioned at the outlet of the chambers 11 and 19 and is at a temperature designed to cause rapid reaction between the cadmium and tellurium to form cadmium telluride and also to maintain the cadmium telluride thus formed in the vapor state . a preferred temperature of 1000 degrees c . is utilized for the element 29 . the heating element 31 is designed to provide a temperature within the tapered tube which is sufficiently low to cause condensation of the cadmium telluride within the tapered tube . accordingly , the reacted cadmium telluride will condense in the tapered tube 17 in the region within the heating element 31 . the heating element 33 is designed to be at a temperature so that cadmium telluride will not condense in that zone . in actual operation , a mixture of water and a reducing agent such as hydrogen , forming gas ( 10 % h 2 , 90 % n 2 ) or the like is passed through the tube 7 and 9 into the chambers 11 and 19 . at the temperatures within the chambers 11 and 19 , the cadmium and tellurium will volatilize and any gasses formed in these chambers , by existence themselves or by reaction of impurities with the water , which have a vapor pressure higher than the cadmium or tellurium , will also volatilize and pass out of these chambers . in this manner , compounds will be formed with hydrocarbons that may be present with carbon itself , with sulphur , and the like , as is readily apparent . these compounds , if volatilized , will enter the region of the tapered tube 17 along with the cadmium and tellurium beneath the heating element 29 where reaction between the cadmium and tellurium will take place to form cadmium telluride in vapor phase . these gasses will continue within the tapered tube until they reach the region within the heating element 31 at which point the cadmium telluride will condense on the tapered tube 17 and the remaining gasses as well as any unreacted cadmium and / or tellurium will continue through the system and pass out through the tube 23 and the fitting 5 . at periodic points during the operation , the system is shut down , the tapered tube 17 is removed and the cadmium telluride thereon or therein is removed therefrom , this cadmium telluride being pure and therefore not sticking to the quartz tapered tube 17 . impurities havig a vapor pressure lower than the cadmium or tellurium will remain in the boats . the system is then set up for operation again and the cycle is repeated . the following are examples of the quantities usable in the foregoing method with the presumptions of a reactor tube 1 diameter of 50 mm and 250 grams of impure cadmium in boat 13 and 250 grams of impure tellurium in boat 21 : ( 1 ) bubble forming gas at a flow of 25 cubic centimeters per minute through water at 30 degrees c . ( so the wet forming gas is about 4 % water ) and direct the wet forming gas through tubes 7 and 9 into chambers 11 and 19 . ( 2 ) bubble forming gas at a flow of 150 cubic centimeters per minute through water at 50 degrees c . ( so the wet forming gas is about 12 % water ) and direct the wet forming gas through tubes 7 and 9 into chambers 11 and 19 . although very simple in construction and operation , as discussed above , the reactor performs a multitude of functions , these being the fact that the furnace elements heat the cadmium and tellurium to temperatures at which vaporization occurs at a desired rate , thereby providing purification thereof within the chambers 11 and 19 . in addition , during vaporization of cadmium and tellurium , impurities with low vapor pressures are left in the boats 13 and 21 . furthermore , certain impurities such as hydrocarbons and sulphur are also volatilized with the cadmium and tellurium but they react with the water in the flowing gas to produce harmless gases which pass out of the system . furthermore , the cadmium and tellurium flow to the tapered tube 17 where they are mixed for the first time in a zone at 1000 degrees c . where they react to form cadmium telluride which has a vapor pressure substantially lower than cadmium or tellurium at the same temperature , however , at 1000 degrees c . the cadmium telluride has little tendency to deposit , thus the initial end of the tapered tube remains clean . the cadmium telluride vapors move to the 800 degree zone which is low enough in temperature for condensation to occur . the condensation process consists of the growth of cadmium telluride crystals possessing nearly perfect stoichiometry . the 800 degrees c . temperature is too high for cadmium , tellurium or volatile impurities to condense and therefore they move down the tube . accordingly , the cadmium telluride which grows in the tapered tube posseses exceptional purity and stoichiometry . the excess cadmium and / or tellurium and the impurities exit from the tube into the scrubber system which removes them from the carrier gas if desired . by proper control of zone temperatures , gas velocities and zone lengths , a high yield process can be obtained . furthermore , after the cadmium telluride has been formed , the tapered tube can be removed from the reactor and the cadmium telluride released into a storage chamber . while the system described is a relatively simple version , many modifications can obviously be made which will still use the principals described hereinabove . for example , the cadmium and tellurium can be placed in separate chambers connected with the reactor tube in a y or t configuration . the process described also lends itself to automation where , by using appropriate interlock chambers , the cadmium and tellurium are maintained at desired levels in their boats . therefore , when the systems would be opened only to remove the cadmium telluride but not to refill the cadmium and telluride boats , operation can continue on a continuous basis . thus , it is apparent that the invention is not restricted to the design described . ( 1 ) impurity elements possessing low vapor pressure at the preferred temperatures for the cd and te zones ( e . g ., fe , mn , cu etc .) will remain behind during the sublimation of the contents of that zone . these impurity elements might form an oxide coating due to reaction with the h 2 o vapor but would still would remain in the boat . ( 2 ) other elements possessing higher vapor pressures ( such as al , sb etc .) would react with the h 2 o to either form an oxide coating , or to convert completely to an oxide and thus remain behind in the boat . ( 3 ) other impurity elements such as s , and c would react with the h 2 o to form a stable gaseous species ( e . g . co , co 2 , so 2 ) and would pass through the system . ( 4 ) almost all impurity elements with moderate vapor pressures ( e . g . pb , sn etc .) would possess volatilization and / or segregation properties such that the final cdte product would be much purer than the starting material . thus all four mechanisms together would assure a much purer final product than could be obtained by a simple direct chemical reaction between the starting ingredients . depending upon the impurities present , one or more of the four mechanisms may not be invoked . if desired , a third zone containing zn could be attached to the system to permit the compounding of ( cd , zn ) te which is a popular substrate material . the zinc furnace element would be set to 550 degrees c . ; the impure cadmium would be heated to about 450 degrees c . ; the impure tellurium would be heated to about 500 degrees c . ; the cadmium zinc telluride would form at about 1000 degrees c . and be solidified at about 800 degrees c . the same four mechanisms of impurity control would again apply . also , if doping is desired ( e . g . with as ), a separate zone could be attached to the system for this purpose . of course , each zone attached to the system would have to be maintained at its proper temperature to create the desired concentration of the specie in the vapor phase , and consequently the proper composition of the final product . though the invention has been described with respect to a specific preferred embodiment thereof , many variations and modifications will immediately become apparent to those skilled in the art . it is therefore the intention that the appended claims be interpreted as broadly as possible in view of the prior art to include all such variations and modifications . | 2 |
turning attention now to fig1 , there is shown a mobile asset such as a trailer 10 and associated electronics in which the present invention may be implemented . the electronics includes a controller 12 , power control logic 14 , motion filter 16 , in_transit logic 18 , a battery 20 , hook - up sensor 22 , reefer sensor 24 , motion sensor 26 , global positioning system ( gps ) receiver 28 , cellular data modem 30 , and other electronics 32 . the controller 12 is generally responsible for collecting location , status and other information from sensors located on the trailer 10 . it also uses the cellular modem 30 for reporting such information to a central asset manager system ( not shown in fig1 ). for example , the gps 28 may receive information concerning the location of trailer 10 . the controller 12 reads gps location data and periodically sends messages via the cellular modem 30 to an asset management tracking system that is operated by the owner and / or other entity responsible for the trailer 10 . the controller 12 may also receive inputs from other sensors such as door sensors , wheel sensors , temperature sensors and the like indicating the status of other aspects of the trailer 10 . only a few exemplary sensors are shown in fig1 , and the exact configuration of all of the status sensors is not critical to the operation of the present invention . as will be understood shortly , the controller 12 should receive at least position information such as a gps 28 , and an input from a motion sensor 26 , such as a vibration sensor . the controller 12 has other functions such as entering a low power mode when the trailer 10 enters a certain state , such as when the trailer 10 is not moving . the low power mode is intended to allow the controller 12 to continue to operate off the power provided only by local battery 20 . this mode is needed at certain times , such as when the trailer 10 is parked in a storage yard or otherwise not tethered to a tractor . in this instance , the controller 12 uses stored software or firmware procedures for logic circuits such as power logic 14 , motion filter 16 , and in_transit logic 18 to control whether it will continue to operate in a high power mode or enter a low power mode . while it was mentioned that gps 28 could be used to determine location , it should be understood that other navigation systems can be used in lieu of a gps 28 . for example , loran or other radio navigation sensors , or wireless systems such as third generation cellular systems that provide location information can be used . similarly , although the data communication system was described as using a cellular modem 30 , it should be understood that other wireless data communication systems that are satellite or terrestrial based may also be used . turning attention to fig2 , it will now be described how the controller 12 executes a motion filtering algorithm in order to avoid entering a high power mode ( e . g . continuing to activate a gps 28 to take position fixes ) even when the motion sensor is only being triggered by a local vibration source such as a refrigeration unit . beginning in a first state 40 , the unit is placed in a low power mode with the motion sensor 26 enabled . the unit may then be caused to leave the low power mode upon any one of a number of events . the first such event occurring could be event 44 when a tractor is hooked up to the trailer 10 . such an event may be detected by a hook - up sensor 22 shown in fig1 . in this instance , a state 45 will be entered in which the controller 12 and other electronics 32 will be permitted to operate in a high power mode , since tractor power is now available . however another event can cause the system to enter an in_motion state 46 . such an event can be caused by receiving a trigger from a motion sensor 26 or in other ways . in the case of being trigger by the motion sensor 26 , the raw motion sensor outputs will be first subjected to filtering 16 . a preferred embodiment of motion filtering 16 is shown in more detail in fig3 . for example , the direct motion sensor output may be provided by a motion interrupt signal 60 , used as an interrupt driven input to the controller 12 . the interrupt then awakens the controller 12 from a low power mode 40 for further processing . a blanking interval 62 may be applied to raw motion interrupt outputs , that may , for example , mask the output for a predetermined period of time such as three seconds which will limit the update rate for a motion trigger counter . once the three seconds has passed the motion interrupt is reenabled . if further motion interrupts occur , a counter is incremented and the process is repeated . if a predetermined period of time , such as 30 seconds , passes without further motion interrupt then the motion count is reset to zero . if the motion count reaches a predetermined number such as 5 ( which would require a minimum of 15 seconds of motion because of the blanking interval 62 ) then the in_motion logic signal 64 is set to a true state . this indicates that the unit is experiencing sufficient “ motion ” to warrant a further check for distance movement . in this case , the unit then enters a state 48 called the in_transit mode . in this state , shown in fig4 , assertion of the in_motion signal 68 causes the gps unit to take a position fix . the gps position fix is taken to determine if the in_motion signal 68 being in the true state is actually due to distance movement of the trailer 10 , or instead due to a false trigger for some other reason , such as vibration . a last known stationary location of the unit is also maintained in memory be controller 12 . this last known stationary location is compared to a new location as determined by the gps receiver at time t 1 when in_motion was asserted true . if this difference in location exceeds a system defined threshold ( typically ½ a mile ), then the system determines that the trailer 10 has actually moved to a new location , and that the in_transit state 68 was asserted true due to actual motion . however , if a gps position fix cannot be obtained at time t 1 , or if the gps location is obtained but less than the transit distant threshold , ( i . e ., less than ½ mile of movement has been detected ), then the gps is turned off and the system assumes that the in_transit trigger was false , and remains in the in_motion state . the system can then retest for in_transit at various predetermined retry intervals as long as the in_motion state remains asserted . once the in_motion state transitions to false ( for example , when the motion sensor has not generated any motion triggers for 10 minutes ), then the gps unit is operated again to obtain a new stationary location . if the gps fix attempt is unsuccessful , no retries are performed since the probability of success following a failure is low unless there is movement . so if an in_transit state is determined , such as by gps validation of at least ½ of a mile travel , then a full power mode will be entered in state 45 , however if gps validation fails , then another state 50 will be entered . returning attention to fig2 , state 50 next attempts to determine if further information about the presence of a reefer unit can be determined in a number of different ways . first , a reefer unit itself may provide a logic status signal to the controller 12 indicating that it is operating . if this is the case , processing can then proceed to state 52 in which the motion sensor will be disabled and power logic 14 will switch to low power mode . this is because an assumption is made that the triggering of the motion sensor or vibration sensor was due to the reefer unit operating . thus with the motion sensor disabled in state 52 , processing proceeds to state 42 , in which low power mode will be maintained until such time as either a timer times out or tractor power is introduced , i . e . in state 44 . returning attention to state 50 , if a reefer status output signal is not available , a configuration data bit may instead indicate that a reefer is attached to the trailer . if this is the case , an assumption is made that it was the reefer unit that was triggering the motion sensor . in this case state 52 will also be entered . if however , neither a reefer status signal nor configuration data bit are available , further processing can take place to derive whether the reefer caused the in_transit failure . for example , a state 54 is entered , in which consecutive failures to enter in_transit are evaluated . as one example , if there have been fewer than , for example , three consecutive failures , processing returns to state 40 where low power mode is entered with the motion sensor still enabled . however , if three or more consecutive failures of an in_transit detection have occurred , processing continues to state 52 where low power mode is entered with the motion sensor disabled . at this point , it is assumed that some other external event ( which is not the reefer ) is causing repeated triggering of the motion sensor without an actual distance movement of the trailer . therefore , the motion sensor should be disabled to prevent entering full power mode and / or further triggering of the gps unit to take position fixes . thus once state 52 is entered ( low power mode and motion sensor disabled ) processing will stop until a future event occurs such as the expiration of a predetermined amount of time or the application of tractor power . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims . | 6 |
the invention provides a method of storing produce or comestibles such as fruit , vegetables , meat and fish . the principles of the invention are preferably applied to transport containers and , more particularly , to transport containers of the iso type , so that the beneficial storage conditions can be applied to the produce while being transported from their source to their desired place of distribution and / or marketing . in accordance with the invention the levels of oxygen and carbon dioxide within the storage container are positively maintained at desired predetermined levels . the actual predetermined levels of carbon dioxide and oxygen selected will vary according to the nature of the produce . these levels are generally well known or can be established by simple experimentation . referring now to the figures a container 5 is shown having a roof 6 , a base 7 , an internal load support floor 8 , side walls 9 and rear doors 10 . a first bulkhead 11 defines the front boundary of the load space 12 . a second bulkhead 13 is provided which defines , in part , the front plane 14 of the container 5 . the bulkhead 13 further defines an enclosed space 15 in combination with the bulkhead 11 , and a recess 16 which is open to the front of the container . the load support surface 8 is of a type known in the art in that it is configured to provide gas delivery channels 17 beneath the support surface , the channels 17 being fed from a supply duct 18 defined between the bulkhead 13 and the bulkhead 11 . gases delivered through the duct 18 pass along the channels 17 and thus into contact with the load occupying the load space 12 . the direction of circulation of the gases is shown simplistically by the arrows in fig1 . located within the enclosed space 15 at the front of the container is an air blower or fan 20 . this fan draws air from the load space 12 through a port 21 in the bulkhead 11 , directs the air flow over evaporator coil 22 and then directs the cooled air stream down into the delivery duct 18 for return to the load space 12 . the evaporator coil 22 forms part of a refrigeration system which further includes compressor 23 and refrigeration compressor coil 24 which are located in recess 16 , externally of the container so as to be in contact with ambient air . the parameters of the refrigeration system are set at , and may be displayed on , control panel 25 . also located within the recess 16 are an oxygen level monitor 30 and a carbon dioxide level monitor 31 . both of these instruments communicate through bulkhead 11 with gases flowing through supply duct 18 to sense the oxygen and carbon dioxide levels in the gas being returned to the load space 12 . co 2 level monitor 31 communicates with the supply duct 18 by conduit 32 shown in fig1 for example . the oxygen monitor and carbon dioxide monitor may comprise tai model 335 - x and tai model 731 - x respectively manufactured by teledyne analytical instruments of california , united states of america . in accordance with the invention these analyzers or monitors 30 and 31 are operatively connected to supplies of nitrogen - rich gas and carbon dioxide so that the levels of oxygen and carbon dioxide within the load space 12 can be monitored constantly and adjusted on an &# 34 ; on demand &# 34 ; basis . the oxygen level within the container is adjusted by directing a nitrogen - rich gas into the container . the nitrogen - rich gas , itself , includes a small , but adjustable , percentage of oxygen . the nitrogen rich gas is generated from ambient air surrounding the container by an air splitter 35 which , as can be seen , is located in recess 16 at the front of the container 5 . the particular form of air splitter described herein is a device which employs selective permeation to separate nitrogen and oxygen from ambient air . ambient air is forced , under pressure , through bundles of semi - permeable membranes formed into tiny hollow fiber . because of the different rates of permeation , the oxygen flows through the fiber walls and can be exhausted through slow as outlet 42 , for example , while the nitrogen passes longitudinally of the hollow fibers . we have found that an air splitter manufactured by permea inc . of st louis , mo ., united states of america is particularly suitable for the purposes of this invention . in the form shown the air splitter 35 is supplied with ambient air under pressure by compressor 37 . the compressor 37 is of the oiless type and , in the form shown , is located within enclosed space 15 . the compressor 37 is operated from the oxygen level monitor 30 and draws ambient air from outside the container through inlet pipe 38 and delivers compressed air to the splitter 35 through delivery pipe 39 . both pipes 38 and 39 pass through the bulkhead 13 . as can be seen from fig2 a flow meter 36 is provided on the delivery side of the air splitter 35 . an adjustable valve 41 , which is typically a needle valve , is provided in conjunction with the flow meter to alter the flow characteristics through the air splitter 35 . a consequence of this is that the rate of permeation , and thus the oxygen content of the nitrogen - rich gas stream , may be varied . typically the oxygen content of the nitrogen - rich gas may be varied between substantially 0 % and 21 %. this range covers the oxygen requirements for most produce applications . the compressor 37 may also be operatively connected to the carbon dioxide level monitor 31 in a manner such that if the carbon dioxide level rises above a predetermined maximum , nitrogen - rich gas is directed into the container to dilute the carbon dixoide content . the compressor 37 is preferably located within refrigerated space 15 for a number of reasons . firstly , the cool air within the space 15 helps to cool the compressor . further , by locating the compressor within the container it is protected from corrosive elements often present in the ambient air . the carbon dioxide sensor or monitor 31 is operatively connected to a source of carbon dioxide which , according to the invention , is supplied in the form of dry ice . the dry ice is contained within an insulated box 40 which , in the form shown , is mounted within recess 16 at the front of the container . however , the insulated box 40 could also be mounted within the refrigerated space to further enhance the insulative properties of the box . the box 40 , wherever mounted , includes thick insulated walls so as to insulate the dry ice . we have found that using suitable insulation a 50 pound block of dry ice ( 1 cubic foot ) provides a source of carbon dioxide gas for approximately 12 days . in order to achieve this a two inch layer of polystyrene insulation ( not shown ) is provided about the dry ice within the box 40 . it will be appreciated that the box 40 might include its own refrigerating system to control the rate of decay of dry - ice into gaseous carbon dioxide . this refrigerating system could be part of the main refrigeration system powered by compressor 23 . while cooling the box 40 , or its contents , would obviously reduce the rate of decay of dry - ice , it is also preferred that when the carbon - dioxide level within the load space 12 falls below the predetermined minimum , the desired level is re - established in the shortest possible time . to this end , some form of heating device could be incorporated into the box 40 to allow the decay process to be temporarily speeded up . it will also be appreciated that more than one dry - ice storage box could be provided for applications where carbon dioxide supply was required over a greater period of time . in this event it is almost certain that at least one of these boxes would be refrigerated to prevent decay of the dry - ice contents until required . multi - position valve means 43 are preferably provide to control the flow of carbon dioxide derived from the decomposing dry ice . as can be seen the valve 43 is operatively connected to the carbon dioxide level monitor 31 and is arranged , so that , in a first position , carbon dioxide is directed into the container space upon the monitor 31 sensing a carbon dioxide level below the predetermined minimum . in a further position the valve allows carbon dioxide to bleed off into the ambient air surrounding the container . as an alternative to the multi - position valve the supply to the container space could be of the ` on / off ` type and a pressure relief valve provided on , or in communication with , the insulated box to avoid the build - up of excess pressure within the box 40 through the decomposition of the dry ice into carbon dioxide gas . it will be appreciated that transport containers of the iso type are not completely sealable . further , as the containers are used , they develop leaks . experience has shown that the greatest leakage occurs through the doors 10 defining the rear of the container . as with other forms of controlled atmosphere storage containers the present invention seeks to reduce this leakage through the rear doors by the provision of a sealing curtain 50 mounted between the load within the load space 12 and the inside of the doors 10 . in use produce is placed within the storage area 12 and the sealing curtain 50 located in position . the doors 10 are then closed . in order to establish the atmosphere within the storage area level the predetermined oxygen and carbon dioxide control levels are set by operation of external controllers on display panel 25 . the compressor 37 then operates to direct ambient air through the air splitter 35 whereupon the nitrogen - rich gas stream is directed into the container to fill the load space with a nitrogen - rich gas containing the exact predetermined quantity of oxygen . the oxygen rich gas stream is directed back to atmosphere . at the same time the carbon dioxide monitor 31 operates and , in turn , brings the carbon dioxide level within the storage area 12 up to the predetermined level by directing carbon dioxide obtained from the degradation of the dry ice block within box 40 into the interior of the container . the gases within the container space are circulated by blower 20 and may be subjected to heating or cooling by use of the refrigeration system . owing to leakage within the container and also to respiratory activity of the produce the environment within space 12 will continually change . this is continuously monitored and , brought back to the predetermined levels by appropriate operation of the splitter 35 , and of the control valve 43 . if necessary the container as herein described can include further means to monitor and , if necessary , modify ethylene and carbon monoxide levels within the container space 12 . it will thus be appreciated that the present invention provides a relatively simple yet effective means of positively controlling the atmosphere within a storage container and re - establishing the atmosphere on an &# 34 ; on demand &# 34 ; basis . | 1 |
embodiments of the present invention will now be described in detail with reference to the accompanying drawings . [ 0046 ] fig1 is a block diagram showing a construction of a first embodiment of the magneto - optical recording / reproduction apparatus according to the present invention . in fig1 each portion that is the same as that of the conventional apparatus shown in fig6 is given the same reference numeral and the description thereof will be omitted . that is , a magneto - optical disk 1 of domain wall displacement detection type , a substrate 2 , a magneto - optical recording film 3 , and an optical head 5 are each the same as that shown in fig6 . the optical head 5 includes a semiconductor laser for recording / reproduction , a condensing lens for condensing a laser light flux of the semiconductor laser , an actuator for driving the condensing lens , a beam splitter , and a polarizing beam splitter , a photosensor for detecting reflection light from the magneto - optical disk 1 , and the like . the wavelength of the semiconductor laser in the optical head λ is set to , for example , 650 nm and the na of the condensing lens is set to , for example , 0 . 60 . also , a controller 6 for controlling each portion in the apparatus , an ld driver 7 for driving the semiconductor laser in the optical head 5 , a magnetic head 9 for applying a recording magnetic field to the magneto - optical disk 1 , a magnetic head driver 8 for driving the magnetic head 9 , a pr equalizing circuit 11 for performing waveform equalization of a reproduction signal , and a viterbi decoding circuit 12 for performing viterbi decoding are , respectively , the same as those shown in fig6 . at the time of recording of information , the optical head 5 irradiates the magneto - optical disk 1 with a light beam for recording in a pulse manner and the magnetic head 9 applies recording magnetic fields having different polarities in accordance with a recording signal . also , at the time of reproduction of the information , the optical head 5 irradiates the magneto - optical disk 1 with a light beam for reproduction . [ 0050 ] fig1 differs from fig6 in that a limiter circuit 10 is provided at the previous stage of the pr equalizing circuit 11 and other constructions are the same as those shown in fig6 . the limiter circuit 10 is an amplitude limiting circuit including an operational amplifier , a diode and the like , and is a circuit that corrects the amplitude of a reproduction signal to a predetermined upper limit value or a predetermined lower limit value . [ 0051 ] fig2 a shows a fundamental construction of the limiter circuit 10 , while fig2 b shows operation characteristics of the limiter circuit 10 . as shown in fig2 a , the limiter circuit 10 includes an operational amplifier amp , resistors r 1 and r 2 , and diodes d 1 and d 2 . also , as shown in fig2 b , the limiter circuit 10 is constructed so that its output value becomes saturated when receiving an input signal higher than or lower than a predetermined input level . this limiter circuit 10 sets the upper limit value and the lower limit value for the reproduction signal . also , the pr equalizing circuit 11 is a circuit that performs waveform equalization of the reproduction signal , that is , performs equalization to a pr ( 1 , − 1 ) characteristic . to do so , the pr equalizing circuit 11 mainly includes a low - pass filter , a differentiating circuit , and a transversal filter . those construction elements of the pr equalizing circuit 11 are well known , so that the detailed description thereof will be omitted . the fundamental recording operation according to this embodiment is the same as that shown in fig7 a to 7 e . in brief , at the time of recording of the recording signal of in fig7 a , a light beam set at the predetermined recording power as shown in fig7 b and modulated in a pulse manner is applied to the magneto - optical disk 1 from the optical head 5 , and simultaneously the modulation magnetic field as shown in fig7 c based on the recording signal of fig7 a is applied to a light beam irradiation region from the magnetic head 9 . in this embodiment , the bottom power of the modulation laser light is set to “ 0 ”, although the present invention is not limited to this and the bottom power may be set to a value other than “ 0 ”. also , laser light modulation is described as the clock frequency of a modulation code , although the present invention is not limited to this and an integer multiple of the clock frequency may be used . further , the pulse irradiation has a duty of 50 %, although the present invention is not limited to this and the pulse irradiation may have any other duty . as a result of those recording operations , the recording mark string as shown in fig7 a to 7 e is formed in the course of cooling of the magneto - optical recording film 3 and so - called pulse - assisted magnetic field modulation recording is executed . adopting such magnetic field modulation recording enables magnetic domains smaller than a spot size to be formed . also , an operation principle of reproduction of domain wall displacement detection type according to this embodiment is the same as that shown in fig8 a to 8 d . when briefly described , at the time of information reproduction , first , as shown in fig8 a to 8 d , the magneto - optical recording film 3 is heated to the ts temperature condition , at which a domain wall of the reproduction layer of the magneto - optical recording film 3 is displaced , by irradiation with a light beam for reproduction . in the temperature range lower than ts , the switching layer is placed under a state where it is connected with the recording layer and the reproduction layer through an exchange coupling . when the magneto - optical recording film 3 is heated to the ts temperature or higher by the irradiation with the light beam for reproduction , the temperature of the switching layer reaches a curie point and the layer is placed under a state where the exchange coupling with the reproduction layer and the recording layer is disconnected . as a result , concurrently with the reaching of the domain wall of a recording mark to this ts temperature range , the domain wall of the reproduction layer is instantly displaced to a position , at which the domain wall exists with stability in terms of energy with respect to a temperature gradient of the reproduction layer , that is , to the maximum temperature point in the linear density direction of a temperature rise due to the irradiation with the light beam , while going across a land . as a result , the magnetization state of the great majority of a region covered with the light beam for reproduction becomes the same , so that a reproduction signal having a shape close to the rectangular shape as shown in fig8 a to 8 d is obtained even from a minute recording mark that cannot be reproduced according to an ordinary light beam reproduction principle . in this embodiment , the magneto - optical recording film 3 has a three - layer structure as shown in fig8 b where a reproduction layer , a recording layer , and a switching layer are combined with each other , although the present invention is not limited to this . next , a reproduction signal processing method according to this embodiment will be described with reference to fig3 a to 3 g . a case where a ( 1 , 7 ) rll code is used as a modulation code will be described as an example . fig3 a shows a recording information string , fig3 b shows a recording signal string , fig3 c shows a recording mark string in the case where the recording signal string of fig3 b is recorded in the magneto - optical disk 1 , fig3 d shows a domain wall displacement detection magneto - optical reproduction signal in the case where the recording mark string of fig3 c is reproduced from the magneto - optical disk 1 , fig3 e shows an output of the limiter circuit 10 , and fig3 f shows a signal obtained by performing pr ( 1 , − 1 ) equalizing processing on the signal of fig3 e . [ 0059 ] fig3 g also shows a histogram of the signal level ( fig3 f ), that is , so - called level jitter . the magneto - optical reproduction signal of fig3 d reproduced from the magneto - optical disk 1 passes through a not - shown amplifier and high - pass filter and the like , and dc components are removed by this high - pass filter . the signal , from which the dc components have been removed , is inputted into the limiter circuit 10 , which then limits the reproduction signal using the upper limit value or the lower limit value . the reproduction signal level is corrected to the predetermined upper limit value or the predetermined lower limit value to obtain a signal as shown in fig3 e . that is , subjecting the magneto - optical reproduction signal of fig3 d to the limiter processing by the limiter circuit 10 results in the reproduction signal waveform as shown in fig3 e in which no high - frequency noise component and the like exist . the upper limit value or lower limit value of the output of the limiter circuit 10 become a value in which only noise components determined by electric circuits are superimposed on each other . it is sufficient that the upper limit value or lower limit value of the limiter may be optimized with reference to an evaluation index such as an error rate . this signal is subjected to the pr equalizing processing by the pr equalizing circuit 11 to obtain the reproduction signal as shown in fig3 f . the solid circles of fig3 f indicate sampling points . this signal is based on a signal restricted to the upper limit value or the lower limit value by the limiter circuit 10 , so that this signal becomes a signal in which level jitter has been reduced to an extremely small level . accordingly , the histogram of this signal level becomes the histogram where the levels of three values are separated from one another very well as shown in fig3 g . as a result , level errors at the time of pr level detection are drastically reduced , which makes it possible to reduce misjudgments . in addition , sampling level differences clearly appear also at the time of maximum likelihood decoding and viterbi decoding , so that decoding with higher accuracy becomes possible . [ 0063 ] fig4 is a block diagram showing a second embodiment of the present invention . fig4 differs from fig1 in that a reproduction signal processing circuit 13 is provided in place of the limiter circuit 10 and the pr equalizing circuit 11 , and other constructions are the same as those shown in fig1 . the reproduction signal processing circuit 13 is a digital signal processing circuit that performs the reproduction signal sampling , limiter limitation , and pr equalization as digital processing . the fundamental recording operation and the fundamental reproduction operation principle according to this embodiment are the same as those in the first embodiment . next , a reproduction signal processing method according to this embodiment will be described with reference to fig5 a to 5 h . a case where a ( 1 , 7 ) rll code is used as a modulation code will be described as an example . fig5 a shows a recording information string , fig5 b shows a recording signal string , fig5 c shows a recording mark string in the case where the recording signal string of fig5 b is recorded in the magneto - optical disk 1 , and fig5 d shows a domain wall displacement detection magneto - optical reproduction signal in the case where the recording mark string of fig5 c is reproduced . [ 0065 ] fig5 e also shows a sampling value string { v ( i )} obtained by sampling the magneto - optical signal at sampling times i by pll clocks , and fig5 f shows a signal string [ v 1 ( i )] obtained by defining an upper limit value ( vmax ) or a lower limit value ( vmin ) for the sampling values of fig5 e and performing a conversion processing where a result of “ v ( i )= vmax ” is obtained when “ v ( i )& gt ; vmax ” and a result of “ v ( i )= vmin ” is obtained when “ v ( i )& lt ; vmin ”, that is the limiter processing . fig5 g further shows a signal string obtained by performing calculation processing of “[ vpr 1 ( i )]=[ v 1 ( i )]−[ v 1 ( l − 1 )]” on the signal string [ v 1 ( i )]. the magneto - optical reproduction signal of domain wall displacement detection type has no inter - code interference , so that this processing becomes a processing equivalent to pr ( 1 , − 1 ) equalization processing . when it is necessary to perform additional equalization depending on the signal bandwidth of a transmission system , it is sufficient that the equalizing processing be further performed . fig5 h also shows a histogram of the signal level of fig5 g , that is , so - called level jitter . the level distribution of the signal string [ vpr 1 ( i )] as shown in fig5 g becomes a distribution of differential values from vmax or vmin except for level fluctuations at sampling points due to edge shift . therefore , it becomes possible to substantially alleviate the influence of noises or waveform distortions at a reproduction signal saturation level , to separate the levels of three values very well , and to obtain a pr ( 1 , − 1 ) equalized output . as a result , it becomes possible to drastically reduce level errors at the time of pr level detection and to suppress misjudgments . in addition , sampling level differences clearly appear also at the time of maximum likelihood decoding and viterbi decoding , so that it becomes possible to perform decoding with higher accuracy . the experiment conducted by the inventor of the present invention could reduce that a characteristic of “ error rate ≈ 1e - 4 ” in a conventional signal processing system to “ error rate ≈ 5e - 5 ” by using the technique of the present invention , which means that it is possible to reduce reproduction errors by half . | 6 |
“ treat ” or “ treating ” means any treatment , including , but not limited to , alleviating symptoms of a disease , disorder , or condition . “ preventing ” refers to inhibiting the initial onset of a pathologic process . “ therapeutically effective amount ” means an amount of a compound that is effective in treating or preventing a particular disorder or condition . “ pharmaceutically acceptable carrier ” is a non - toxic solvent , dispersant , excipient , or other material used in formation of a pharmaceutical composition , i . e ., a dosage form capable of administration to a subject or patient . “ immune disorder ” means any disease or pathology that is associated with non - normal function of the immune system such that the immune system is auto reactive , excessively active or otherwise causes a pathological effect on its host that may have an inflammatory component . examples include rheumatoid arthritis , multiple sclerosis , inflammatory bowel disease , graft rejection , myocarditis , atherosclerosis , asthma , chronic bronchitis and psoriasis . a “ selective inhibitor of the adenosine 2 b receptor ” is a substance that has a ki for the receptor of 10 μm or lower and for which the ki on a2b is at least 10 - fold lower than for a1 , a2a and a3 . an “ adenosine 2 b receptor antagonist ” is an inhibitor of the a2b receptor . in various aspects , methods for treating and preventing inflammatory diseases are described . such methods include those for inhibiting the initiation of inflammation , inhibiting inflammatory diseases related to mast cells , inhibiting inflammatory diseases involving activated macrophage , and inhibiting inflammatory diseases involving osteoclasts . the methods include administering adenosine 2b receptor antagonists at a dosage sufficient to selectively inhibit the a2b receptor , thereby modulating the downstream signalling effects of the receptors , causing a beneficial therapeutic affect on a subject / patient . adenosine 2b receptor antagonists include inhibitors described in the following publications : bormann et al ., j . med . chem . 2009 , 52 , 3994 - 4006 , yan et al ., j . med . chem . 2006 , 49 , 4384 4391 , yan and müller j . med . chem . 2004 , 47 , 1031 1043 hayella et al ., j . med . chem . 2002 , 45 , 1500 1510 along with other analogs of similar activity , all of which are hereby incorporated by reference . adenosine 2b receptor antagonists of utility include structures related to the 8 - aryl - xanthines substituted with piperidyl - sulfonamides as indicated in the following generic structure . where r1 and r2 are independently selected from h , alkyl , branched alkyl , 1 - propin - 3 - yl , amino alkyl r3 and r4 are independently selected from h , halogen ( f , cl , br , i ), trifluoromethyl , hydroxyl or alkoxy , methylendioxy . in a preferred embodiment , r2 is h and r1 is an alkyl group and n is 0 , 1 or 2 . in a more preferred embodiment , r2 is h and r1 is propyl , and n is 0 additional adenosine 2b receptor antagonists of utility include structures related to the 8 - aryl - xanthines substituted with piperidyl - sulfonamides as indicated in the following generic structure . where r1 and r2 are independently selected from h , alkyl , branched alkyl , 1 - propin - 3 - yl , amino alkyl further adenosine 2b receptor antagonists of utility include structures related to the 8 - aryl - xanthines substituted with piperidyl - sulfonamides as indicated in the following generic structure . where r1 and r2 are independently selected from h , alkyl , branched alkyl , 1 - propin - 3 - yl , amino alkyl r3 and r4 are independently selected from h , alkylphenyl , alkyl , branched alkyl , hydroxyalkly , carboxyalkyl and alkylarylether , halo aryl , pyridinyl in a preferred embodiment , r2 is h and r1 is an alkyl group and n is 0 , 1 or 2 . in a more preferred embodiment , r2 is h and r1 is propyl , the selectivity of these substances at various adenosine receptors is illustrated as follows : the methods for synthesising the foregoing compounds are recorded in bormann et al ., j . med . chem . 2009 , 52 , 3994 - 4006 . in studies described herein , it is shown that adenosine 2b receptor antagonists prevent and treat inflammatory diseases by selectively inhibiting a spectrum of signal transduction pathways central to the pathogenesis of the inflammatory disease . using collagen - induced arthritis ( cia ) in mice as a model of an exemplary inflammatory disease , rheumatoid arthritis ( ra ), i . p . administration of adenosine 2b receptor antagonists to mice was shown to be effective in treating the progression of cia ( e . g ., example 1 and fig3 ) in mice with established clinical arthritis . after the end of treatment , the inhibitory effect was maintained for a period of 2 - 3 days after which signs began to re - emerge . these data suggest that the activity of the a2b receptor is required for the maintenance of inflammation . perhaps more importantly , these data suggest that it is possible to rapidly suppress established arthritis in the course of the peak inflammatory potential , a period of cia that resembles the conditions of an acute arthritic flair . in further experiments performed in support of the present compositions and methods , the ability of adenosine 2b receptor antagonists to treat and / or prevent another exemplary inflammatory condition , experimental autoimmune encephalomyelitis ( eae ), was evaluated . eae is a widely used animal model for multiple sclerosis ( ms ). mice in which eae had been induced were treated with adenosine 2b receptor antagonists once daily i . p . and the severity of the disease was determined using a standard scoring system , described in example 2 . animals treated with adenosine 2b receptor antagonist compound 1 once daily at 15 mg / kg i . p . demonstrated delayed onset such that there were no signs of eae compared to control mice . adenosine 2b receptor antagonists likely provided a beneficial therapeutic effect by inhibiting the signalling required to initiate inflammation . while the eae model is not necessarily able to replicate all aspects of human forms or multiple sclerosis , these data suggest that the adenosine 2b receptor antagonists are able to exert a general anti - inflammatory action irrespective of the inflamed organ . the inhibitors described herein are suitable for once daily injection , however , they are relatively quickly eliminated and thus they are suitable for use in depot and modified release forms as a means to extend their duration of action . in certain applications , rapid elimination is an advantage in that it provides a reduction in toxicological risk . in this respect , in a preferred embodiment , the inhibitor has a plasma half - life following subcutaneous injection of 8 hours or less in human subjects . administration less than every day is also contemplated , for example administration every other day or several times per week or once per week or once every 14 days using formulations designed to have some depot effect . additionally , intermittent courses of therapy with adenosine 2b receptor antagonists or are contemplated , for example , treatment for one week then off drug for one week , or treatment for one week then off drug for three weeks , or treatment only during periods of disease flare . in a preferred embodiment , the adenosine 2b receptor antagonists is administered parenterally . in one embodiment , substance is provided in a simple propylene glycol suspension for subcutaneous administration . in a further embodiment , the suspension may be incorporated in a matrix such as a poly - lactide or similar biocompatible polymers . for treatment of disease of the digestive system and the liver , oral administration is contemplated . in inflammatory bowel disease , oral formulations including enterically coated materials are suitable . solid dosage forms for oral administration include capsules , tablets , pills , powders , and granules . in such solid dosage forms , the active compound is mixed with at least one inert , pharmaceutically - acceptable excipient or carrier , such as sodium citrate or dicalcium phosphate and / or ( a ) fillers or extenders such as starches , lactose , sucrose , glucose , mannitol , and silicic acid , ( b ) binders such as , for example , carboxymethylcellulose , alginates , gelatin , polyvinylpyrrolidone , sucrose , and acacia , ( c ) humectants such as glycerol , ( d ) disintegrating agents such as agar - agar , calcium carbonate , potato or tapioca starch , alginic acid , certain silicates , and sodium carbonate , ( e ) solution retarding agents such as paraffin , ( f ) absorption accelerators such as quaternary ammonium compounds , ( g ) wetting agents such as , for example , cetyl alcohol and glycerol monostearate , ( h ) absorbents such as kaolin and bentonite clay , and ( i ) lubricants such as talc , calcium stearate , magnesium stearate , solid polyethylene glycols , sodium lauryl sulfate , and mixtures thereof . in the case of capsules , tablets and pills , the dosage form may also comprise buffering agents . solid compositions of a similar type may also be employed as fillers in soft and hard - filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like . the solid dosage forms of tablets , dragees , capsules , pills , and granules may be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art . they may optionally contain opacifying agents and can also be of a composition that they release the active ingredient ( s ) only , or preferentially , in a certain part of the intestinal tract , optionally , in a delayed manner . examples of embedding compositions which can be used include polymeric substances and waxes . the active compound can also be in micro - encapsulated form , if appropriate , with one or more of the above - mentioned excipients . liquid dosage forms for oral administration include pharmaceutically - acceptable emulsions , solutions , suspensions , syrups and elixirs . in addition to the active compounds , the liquid dosage forms may contain inert diluents commonly used in the art such as , for example , water or other solvents , solubilizing agents and emulsifiers such as ethyl alcohol , isopropyl alcohol , ethyl carbonate , ethyl acetate , benzyl alcohol , benzyl benzoate , propylene glycol , 1 , 3 - butylene glycol , dimethyl formamide , oils ( in particular , cottonseed , groundnut , corn , germ , olive , castor , and sesame oils ), glycerol , tetrahydrofurfuryl alcohol , polyethylene glycols and fatty acid esters of sorbitan , and mixtures thereof . besides inert diluents , the oral compositions can also include adjuvants such as wetting agents , emulsifying and suspending agents , sweetening , flavoring , and perfuming agents . suspensions may contain , in addition to the active compounds , suspending agents as , for example , ethoxylated isostearyl alcohols , polyoxyethylene sorbitol and sorbitan esters , microcrystalline cellulose , aluminum metahydroxide , bentonite , agar - agar , and tragacanth , and mixtures thereof . from the foregoing , various additional aspects and embodiments of the present compositions and methods will become apparent . the following examples are provided to illustrate the compositions and methods but are not intended as limiting . the following examples are illustrative in nature and are in no way intended to be limiting . treatment of rheumatoid arthritis using collagen induced arthritis as a model collagen - induced arthritis studies . cia in dba / 1 mice was induced by injecting dba / 1 mice with bovine type il collagen ( cii ) emulsified in cfa1 followed by boosting 21 days later with cii emulsified in incomplete freund &# 39 ; s adjuvant ( ifa ). technical adenosine 2b receptor antagonist ( compound 1 ) was suspended in warm peg 400 at a concentration of 60 mg / ml and diluted 1 in 10 in saline to form an injectable suspension . 30 mg / kg was delivered by i . p . injection once daily , starting following the development of clinical arthritis in treatment experiments . animals were monitored daily following boost of arthritis , following the emergence of clear signs of disease observed on two consecutive days , animals were allocated randomly to treatment groups . signs monitored included weight loss , paw thickness , and observed clinical score . scoring is according to the presence of inflamed joints : 1 point for an inflamed digit , 1 point for a inflamed metatarsus , and 1 point for an inflamed joint above the metatarsus . mice treated with adenosine 2b receptor antagonists displayed significant reductions in the severity of cia based on reduced paw swelling , erythema and joint rigidity as assessed by the mean visual arthritis score , as shown in fig3 . of particular clinical importance in these data is the fact that the adenosine 2b receptor antagonist was able to reduce an existing inflammation to a normal state . this is in contrast to substances such as methotrexate that function only in prophylaxis . method of treating multiple sclerosis , the effect of adenosine 2b receptor antagonists in eae adenosine 2b receptor antagonist compound 1 was tested for its ability to prevent and treat experimental autoimmune encephalomyelitis ( eae ), a mouse model of multiple sclerosis ( ms ). eae was induced in c57b / 6 mice by subcutaneous immunization with 100 ug / mouse myelin oligodendrocyte glycoprotein ( mog ) peptide 35 - 55 emulsified in compete freund &# 39 ; s adjuvant ( cfa ) containing 2 mg / ml heat - killed mycobacterium tuberculosis h37ra ( hooke laboratories ). as part of the induction protocol , mice were also injected intraperitoneally on the day of immunization and 48 hours later with 0 . 1 ml of 4 [ mu ] g / ml bordetella pertusis toxin . severity of eae was determined daily based on a standard scoring system : 1 , tail weakness or paralysis ; 2 , hind leg weakness ; 3 , hind limb paralysis ; 4 , forelimb weakness ; and 5 , moribund animals or death . mice treated with 15 mg / kg adenosine 2b receptor antagonists once daily demonstrated a delay in the onset of eae compared to the vehicle control mice . these data demonstrate that the adenosine 2b receptor antagonists are also efficacious in treating a rodent model of multiple sclerosis . adenosine 2b receptor antagonist compound 1 ( 30 mg ) was suspended in 1 ml of warm ( 50 c ) propylene glycol and vigourously ground using either a mortar ( prewarmed ) or a bead mill the resulting homogenate was further mixed with 1 ml of saline containing 1 w / v tween 80 and vigorously mixed . the resulting suspension was then diluted to 10 ml in saline . polylactide co - glycolide was dissolved in n - methyl pyrollidone triacetin to a concentration of 15 % w / v according to madhu et al , 2009 . adenosine 2b receptor antagonist compound 1 ( 100 mg ) was suspended in 1 ml of warm ( 60 c ) polylactideglycolide and homogenised using a bead mill the preparation is tested for its ability to prevent and treat disease as in the earlier examples . adenosine 2b receptor antagonist compound 1 was prepared in either the 1 % methyl cellulose in water , 0 . 2 % tween 80 at 5 mg / ml , or in mouse serum 0 . 8 mg / ml . the cellulose formulation was administered to c57blk6 mice orally . the serum suspension / solution was administered intravenously . at various times after administration , small samples of blood ca . 20 μl were taken and analysed for compound 1 . the results are recorded in fig5 . these data show that compound 1 is not orally available , but is has a terminal half life in the range of 1 to 2 h after i . v . application . while a number of exemplary aspects and embodiments have been discussed above , those of skill in the art will recognize certain modifications , permutations , additions and sub - combinations thereof . it is therefore intended that the following appended claims and claims hereafter introduced are interpreted to include all such modifications , permutations , additions and sub - combinations as are within their true spirit and scope . madhu et al ., international journal of pharmacy and pharmaceutical sciences , vol . 1 supp . 1 , november - december 2009 | 0 |
the present invention generally relates to network communications and , more particularly , to a mechanism for managing access session keys in a public wireless local area network ( wlan ) environment that supports third party virtual operators . such virtual operators may include internet service providers ( isps ), cellular operators , or pre - paid card providers . to maximize revenue sources , a public wireless local area network ( wlan ) may maintain business relationship with multiple virtual operators . it is to be understood that the present invention is described in terms of a wlan systems , such as those that comply with ieee 802 . 11 , hiperlan 2 , and / or ultrawide band standards ; however , the present invention is much broader and may be applicable to other system management schemes for other communications systems . in addition , the present invention may be applicable to any network system including telephone , cable , computer ( internet ), satellite , etc . referring now in specific detail to the drawings in which like reference numerals identify similar or identical elements throughout the several views , and initially to fig1 , a wireless local area network ( wlan ) 14 includes an access point 30 for a wlan hot spot 31 . wlan 14 may employ , for example , ieee 802 . 11 and hiperlan2 standards . wlan 14 may include a firewall 22 between external networks , such as , for example , the internet 7 . end users or mobile units 40 may access virtual operators 62 from wlan 14 through the internet 7 using , for example , https tunnels or other secured channels 64 , as will be described herein . dispersed between or within cells of a cellular network are wireless local area networks 14 . in accordance with the present invention , a session key 60 is sent from a virtual operator 62 to a user 40 . virtual operators 62 may include internet service providers ( isps ), cellular operators , or pre - paid card providers or other entities , which provide services over a communications network . to maximize revenue sources , a public wireless local area network ( wlan ) may maintain business relationship with multiple virtual operators . however , maintaining a plurality of virtual operators is difficult while maintaining adequate system security . because the virtual operator 62 and the user ( ms 40 ) share a secret , such as a secured channel or using a shared piece of information or code , the key 60 can be transmitted through a secure channel 64 between them . however , instead of having the virtual operator 62 determining and maintaining the session key 60 , the keys are chosen by wlan access points 30 and then hinted to the virtual operator . keys may be chosen by a plurality of methods , including , for example , random number generation , selecting from a pre - stored number of keys , etc . referring to fig2 , an embodiment for implementing the present invention is illustratively described as follows . in block 102 , a user ( mobile terminal ( mt )) requests wireless lan access at an access point ( ap ) 30 and specifies a virtual operator ( vo ) 62 . in block 104 , the ap 30 establishes a secure channel sc 1 with the virtual operator 62 . all subsequent communication between the ap 30 and the virtual operator 62 will be through sc 1 . in block 106 , the user establishes a secure channel sc 2 with the virtual operator 62 and authenticates herself with the virtual operator through sc 2 . this may include putting the session key on hold until successful user authentication . in block 108 , the virtual operator , upon successful user authentication , notifies the ap 30 about the result and asks the ap 30 for a session key 60 through sc 1 . if the session key is on hold , it may be removed from on hold if the authentication is unsuccessful . in block 110 , the ap 30 chooses a session key 60 and sends it to the virtual operator 62 through sc 1 . in block 112 , the virtual operator sends this session key to the user through sc 2 . in block 114 , the user and the ap 30 start using the session key for the subsequent communication between them ( secure channel sc 3 ). referring to fig3 , the method as shown in fig2 may be further improved for speed and efficiency as illustrated . instead of having the virtual operator ask for the session key after successful authentication , the ap 30 provides a suggested session key right after sc 1 is established and puts this key “ on hold ” in memory 24 at access point 30 . upon successful user authentication , the ap 30 is notified by the virtual operator and starts using this key for sc 3 . in case of an unsuccessful authentication ( e . g ., after a certain number of unsuccessful tries by the user ), the ap 30 is also notified and removes the key from the “ on hold ” list 24 . this prevents a denial - of - service attack in which an attacker continuously makes unsuccessful authentication attempts . if the ap is not notified about unsuccessful authentication , the suggested keys would pile up in the ap &# 39 ; s memory storage . the authentication steps may include the following . in step 202 , a user requests wireless lan access at an ap 30 and specifies virtual operator 62 . in step 204 , ap 30 establishes a secure channel sc 1 with the virtual operator 62 . all subsequent communication between the ap and the virtual operator will be through sc 1 . in step 206 , the ap 30 sends a suggested session key to the virtual operator 62 and puts this key “ on hold ”. in step 208 , the user establishes a secure channel sc 2 with the virtual operator 62 and authenticates herself with the virtual operator 62 through sc 2 in block 209 . in step 210 , the virtual operator 62 notifies the ap 30 about the authentication result , and the ap 30 removes the suggested key from the “ on hold ” list . in block 212 , in case of successful authentication , the virtual operator 62 sends the session key to the user . in block 214 , the user and the ap 30 start using the session key for the subsequent communication between them ( secure channel sc 3 ). the reason that the method of fig3 is more efficient is because it saves one round trip of communication time from the method of fig2 , e . g ., the virtual operator does not have to wait until the end of the authentication , to ask the ap for the session key , then notify the user about the key . although in step 206 , the ap needs to send to the virtual operator the suggested key , it can be done in parallel with step 208 . thus overall , a round trip delay is avoided . in other embodiments step 206 , may be performed sequentially with step 208 . it is to be understood that the present invention may be implemented in various forms of hardware , software , firmware , special purpose processors , or a combination thereof , for example , within a mobile terminal , access point , and / or a cellular network . preferably , the present invention is implemented as a combination of hardware and software . moreover , the software is preferably implemented as an application program tangibly embodied on a program storage device . the application program may be uploaded to , and executed by , a machine comprising any suitable architecture . preferably , the machine is implemented on a computer platform having hardware such as one or more central processing units ( cpu ), a random access memory ( ram ), and input / output ( i / o ) interface ( s ). the computer platform also includes an operating system and microinstruction code . the various processes and functions described herein may either be part of the microinstruction code or part of the application program ( or a combination thereof ), which is executed via the operating system . in addition , various other peripheral devices may be connected to the computer platform such as an additional data storage device and a printing device . it is to be further understood that , because some of the constituent system components and method steps depicted in the accompanying figures may be implemented in software , the actual connections between the system components ( or the process steps ) may differ depending upon the manner in which the present invention is programmed . given the teachings herein , one of ordinary skill in the related art will be able to contemplate these and similar implementations or configurations of the present invention . having described preferred embodiments for session key management for public wireless lan supporting multiple virtual operators ( which are intended to be illustrative and not limiting ), it is noted that modifications and variations can be made by persons skilled in the art in light of the above teachings . it is therefore to be understood that changes may be made in the particular embodiments of the invention disclosed which are within the scope and spirit of the invention as outlined by the appended claims . having thus described the invention with the details and particularity required by the patent laws , what is claimed and desired protected by letters patent is set forth in the appended claims . | 7 |
6 , 26 , 31 , 32 , 38 , 39 , 40 , 42 , 44 , 45 , 47 , 49 , 52 , and 53 are various types of transmitting antennas ; 10 and 11 are forward v f and reflected v r voltages , respectively ; 12 , 14 , 13 , and 15 are the rc high pass filters ( hpf ); 17 and 18 are the extracted variable signals from the basic v f and v r voltages ; 20 is an o / p signal v e from the equation processor block ; 60 and 61 are rf form forward v f and reflected v r voltages , respectively ; 68 , 73 , 74 , and 77 are rf suppression chokes ; the device structure according to the invention , for all the applications aforementioned , has generally the same configuration . the slight difference in specification between each individual application is due to the difference in the requirements from one application to another . these differences will be explained in the related sections . referring to the drawings , and more particularly to fig1 the first part of the device is the generator of the em - waves . this is an rf transmitter 1 with a power level from a fraction of one watt to a few watts . the power has to be minimized for more safety in case of applications related to the human body , such as in cardiographs ( fig3 ) and for newborn babies ( fig4 ). this is also applicable in cases where there is a need for the use of nonstandard frequencies , which are not permitted . the frequency of the rf transmitter 1 should be tuned to match as near as possible the resonance frequency of the targeted objects 9 , 35 . in general , utilization of the standard permitted frequencies ; e . g ., 27 . 12 mhz , in such applications is adequate and satisfies the requirements . the generated rf energy passes through a bidirectional coupler 2 , which detects and identifies the actual values for the v f 10 and v r 11 signals . then the rf energy is directed to the matching network or , more precisely , to what is the so - called antenna tuner 3 . the function of the antenna tuner is to convert the complex parasitic impedance of the load ( media ) structures ( i . e ., human body 29 , 36 , tree trunk 8 , etc .) into a real impedance value and to match , as closely as possible , the output impedance of the rf transmitter 1 . in certain applications , the need of high - speed automatic - type antenna tuners is essential in comparison with manual or semi - automated tuners . the applications that require the use of a high - speed antenna tuner with tuning time of a few seconds or less are those in which the time is limited . for example , in heart monitoring ( fig3 ), it is necessary to minimize the device preset time as the full process of cardiograph monitoring is executed within the time frame occurring between breath cycles . this is to isolate the heart activity from lung motion so as to obtain a few full cycles of the heart &# 39 ; s activity in between the volitional breath pauses . additionally , the device can be tuned to identify the heart movement in isolation to the lung activity by narrowing the time response bandwidth . this is because lung activity is much slower than heart movement , where a patient can voluntarily slow down or even can stop his breathing process for a few seconds . using an antenna tuner of the so - called unbalanced - output type enables the use of a single transmitting cable . this cable is connected to a single conductive rigid or flexible metal plate , which can have any geometric form or size . a metallic grille , grid , rod , or even just a wire may be used in place of the metal plates to function as a transmitting antenna . in a few applications , the transmitting antenna , wherever possible , should encircle the load media , for example , a tree trunk 8 when the device is intended to detect the infestation by pests 9 . when a balanced - output type antenna tuner 3 is used or when an unbalanced - type antenna tuner is connected to the input of the unbalanced - to - balanced transformer 5 ( fig3 ), it will enable the use of dual transmitting cables 4 together with dual ( balanced ) transmitting antenna 6 , 31 , 32 , etc ., so as to narrow the detecting and monitoring area . each of the antennas could have the same aforementioned configuration described . then , using adjacent , opposite , or encircling dual - transmitting antenna 6 , 31 , 32 , etc ., on the targeted load 8 , 29 , 36 , sensitivity will be increased . this will result in the narrowing and direction of the em - field 34 fig3 ) to cover mainly the targeted area . the output v f 10 and v r 11 signals produced by the bi - directional coupler 2 pass through a so - called a high pass filter ( hpf ) consisting of , in its simplest form , an ac coupling ( dc blocking ) capacitor 12 , 13 in series , with a resistor 14 , 15 in parallel . this will pass only the required variable v f 17 and v r 18 signals ( fig1 and 9 ), which have the indication for any movement in the load ( media ). variable v f 17 and v r 18 signals then pass to the analog equation processor unit 19 , which then uses the preferred arithmetic equation ( formula ) to combine the v f 17 and v r 18 signals . this then produces a signal v e 20 , where v e = f ( v f , v r ). as an example and not by way of limitation , equations such as vswr or the reflection coefficient , etc ., can be achieved by the use of analog circuits . the analog equation for the vswr , v e = vswr =( v f + v r )/( v f − v r ), can be achieved by using an analog summing amplifier to function as its nominator ( v f + v r ), and an analog difference amplifier to function as its denominator ( v f − v r ). then the value of vswr is achieved by dividing the resultant values for the nominator by the denominator . the division can be carried out by the use of analog logarithmic and anti - logarithmic circuits , or by using ready made analog dividing integrated circuits ( ic ). for example , the analog divider ic “ ad538 ” made by analog device , inc ., or similar ics made by others , are suitable . in similar ways , it is easy to utilize the analog circuits to realize the equation for the reflection coefficient : v e ρ =( v r / v f ), or its opposite value 1 / ρ =( v f / v r ) ( 2 ) selection of any one from the given equations is dependent upon the final design requirements . utilizing the vswr equation gives more stability over a wide range of noise and drifts , etc ., which are produced in the rf transmitter 1 . where such noise effects will modulate the rf em - waves , such modulation theoretically will not result in any change in the vswr value . normally , due to the use of a large number of components to achieve the vswr equation circuit , the resulting internal components &# 39 ; noise is added to the requested useful signal . therefore the use of vswr formula is preferable in applications such as the access controls ( fig7 ) and cardiography ( fig3 ), wherein size of the targeted object 35 is relatively large and high stability and low gain ( few thousands ) is desired . when the vswr equation is used , v f 10 and v r 11 signals should pass directly to the equation processor unit 19 . this eliminates the need for the hpf 12 , 13 , 14 , 15 in the input circuit , and the hpf should be located at the output of the equation processor . this configuration can be applied also to any dividing equation . other equations like ( v f / v r ) or ( v r / v f ) dramatically improve the device performance , because it uses fewer components in comparison to the vswr equation , so it gives improved results and stability over a wider range of conditions . analog circuits also can achieve the non - standard and useful equations , such as ( v f − v r ) or ( v r − v f ). these subtractive equations enhance the performance over a wide range of conditions . this is due to the use of so - called difference type or instrumentation amplifier ( ia ). where ia has a very high common mode rejection ratio ( cmrr ), this enables operation in a noisy environments . various ia ics , which have ultra low internal noise of about 1 nv are available and are produced widely by many manufacturers , such as ia ic “ ina103 ” made by burr broun , inc . satisfactory results can be achieved by using only one of v f 17 or v r 18 signals , especially where an application does not require a very high gain or if high quality and less noisy components are utilized in a perfect design , and if the system is used in an area of low interference and ambient noise . practical observation has shown that the variable components 17 , 18 of the v f 10 and v r 11 voltages , which are generated by the moving objects within the scrutinized media , have an approximately symmetric nonproportional relationship . this is especially achieved when a good degree of match is reached . this means that when the v f 17 signal increases , the v r 18 signal decreases and vice versa , a combined differential signal occurs . this conclusion represents the variable components of the v f 10 and v r 11 as a source of differential signal . this highly improves the use of subtracting equations ( v f − v r ) or ( v r − v f ). where ia can perfectly achieve such equations , this type of amplifier is specially designed to work with the differential - type signal to provide a higher performance over a wide range of unstable ambient conditions . normally , when a good degree of match is reached , the final v f 10 signal becomes greatly larger than the v r 11 signal . this reduces the symmetry between the variable v f 17 and v r 18 signals . this happens due to the different working ( saturation ) points at the nonlinear ( exponential ) volt - ampere characteristic ( vac ) of the rectifying diodes . normally , these diodes contained in the bidirectional coupler 2 , which is used to detect the v f 10 and v r 11 , signals in the rf tank 56 ( fig9 ). the use of a so - called active diode , where a silicon passive diode is fixed in the feedback circuit of an operational amplifier , will help , but it is still not enough , as such high frequency operational amplifiers generally produce a relatively high level of internal noise . still , there is a need to find other effective ways to deal with this problem . an excellent alternative way ( fig9 ) can be achieved by shifting down the positive voltage level of the rf signal 61 before it reaches the rectifying diode 65 of the v f detection circuit . in this way , both diodes 64 , 65 will work in the same working ( saturation ) point at the vac . this can be achieved by applying a negative dc voltage 56 at the v f diode anode 65 . this equalizes the rectified dc voltages 66 , 67 at the cathode of both diodes 64 , 65 . this way will not affect the requested variable signal 17 , 18 , as these signals are so small , and in the worst case they are greatly smaller than the rf form v f 61 and v r 60 signal , so by this way symmetry is achieved . the v e 20 signal generated in the equation processor unit 19 as a function of v f 17 and v r 18 , in accordance with the required and used equation , is then ready for the following processing steps . the v e 20 signal needs to be amplified to that level where the analyzing and monitoring can be executed . in addition to the amplification , filtration will be required . the v e 20 signal then passes to the amplifier circuits 21 , 23 , which contain multi - amplifier stages . in the preamplifier first stage circuit 21 , the signal should have an acceptable gain level ( few hundreds time ). then the main gain can be obtained by manual adjustment or by an auto gain ranging amplifier 23 . the total gain range for the amplifiers should cover all the possible signal amplitude variations . this occurs due to the different sizes , positions , and structures of the inspected media or objects . signal filtration is a major part of the amplifier circuits 21 , 23 , which generally helps in minimizing the noise and interference that may reach the device circuits . the signal filtration is achieved by the introduction of passive and active , high - and low - pass , wideband , and notch filters wherever possible in the various stages of the device . the filters &# 39 ; bandwidths are defined according to the expected motion speed of the tracked targeted object 9 , 35 etc . the final stage 25 will be the provision of audio or visual indications of the monitored subject . this can include a hard copy of the observation results if required . additionally as an example , visual indications can be complemented by the use of a buzzer with different tones or light emitting diode ( led ) to show the level of infestation by red palm weevil 9 . this can be achieved by averaging the signal peaks for one insect in a defined period of time , then by counting the number of peaks within the same time interval . the combinations of manner of indicating the presence of the pest are manifold . additionally , the resulted ( indication ) signal 24 can be used for analytical purposes in applications that require such analysis . device sensitivity can be changed by adjusting the amplifier 23 gain or by shifting the response level threshold . this detection circuit for the response threshold may be located in or before the final stage 25 where it is used to drive a variety of types of indicators , such as for triggering the alarm circuits . finally special care should be taken in fabrication and operation of the device in the real world . the device should be well screened and shielded — this is to minimize the external em - interference or noise effects . these noise effects could originate from the air currents flowing inside the device . the assembly design should include a metallic separation partition in between the linear and the rf circuits . additionally the rf ground 7 and the linear circuit &# 39 ; s ground 16 should be well rf - isolated . this can be achieved by joining both grounds through a suitable rf inductive suppression choke 68 , 73 , 74 , 77 at a value range of a few milli - henry . extra care should be taken to ensure that the operator is sufficiently remote from the detection area to be sure that there is no possibility of undue interference . this can be achieved by separating the device into two individual parts . one can include the circuits up to the preamplifier 21 , the other to include all remaining circuits that will be directly used by the operator . this is to allow the operator to do the necessary tuning and adjustments . the link 22 between the two units should be sufficiently long and should utilize good shielded cable . when the device is used in the open field , e . g ., to detect the tree infestation ( fig2 ) by borer pests 9 hidden inside the tree trunk 8 or the upper roots , the total surface area of the transmitting antenna 26 should be minimized so as to eliminate the wind effect which could vibrate the antennas . any vibration could generate an interference signal . to solve this , rubber 27 or velcro ®- type bindings 59 can be used to tighten the transmitting parallel wires 26 or springs onto the tree trunk 8 . wherever it is considered necessary to have an extended transmitting cable and where the use of dual ( balanced ) transmitting antennas is preferable , this can be achieved by utilizing the unbalanced - type antenna tuner through connecting to unbalanced - to - balanced transformer 5 ( fig2 - 7 ). this will enable the length of the transmitting cable to be extended by the use of high quality rf coaxial cable 28 . the surface areas of the transmitting cables or the antennas have to be electrically well insulated by the use of proper insulation 33 ( fig3 ), such as rubber , pvc , etc ., especially when the working media contains a high volume of moisture or in the case of applications related to human bodies . in security applications ( fig5 and 6 ), as an example , the transmitted rf energy can be modulated with a medium range frequency ( few khz ) to disable the possibility of any interference caused by intruders . such modulation will require narrowband pass filters of the same modulating frequency in the device inputs &# 39 ; discriminating circuits . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention . | 6 |
in the pfbc power plant shown in fig1 designates a pressure vessel enclosing a space 3 . through a conduit 2 , the space 3 is fed with combustion air from a compressor ( not shown ). the pressure vessel 1 encloses a combustion chamber 4 and a cyclone dust separator 5 . in reality a plurality of parallel groups of series - connected cyclones would almost certainly be used , but just one unit 5 has been shown for convenience . in the lower part of the combustion chamber 4 there is located a fluidized bed 6 of a particulate material and a tube bundle 7 for cooling of the bed 6 and for operation of steam for a steam turbine ( not shown ). particulate fuel is supplied to the bed 6 through a conduit 8 from a fuel storage hopper ( not shown ). the plenum space 10 above the bed 6 is connected to the cyclone by means of a conduit 11 . in the cyclone 5 ahses from the combustion chamber 4 are separated from the combustion gases before the gases are passed to a gas turbine ( not shown ) through a conduit 12 . the ashes are collected in the conical bottom part 13 of the cyclone 5 and are removed through a pressure - reducing stage 14 . a discharge nozzle 15 is provided in the cyclone 5 and ashes and transport gas are drawn into the nozzle 15 and flow , via a conduit 16 , to the pressure - reducing stage 14 . the pressure - reducing stage 14 is constituted by a conduit 17 , in which successive reductions in pressure are obtained by repeatedly diverting the gas / ash flow in a series of overflow connection chambers 18 before it is transported through a conduit 19 to a collecting container 20 . ashes 21 are separated from the gas and collect in the lower part of the container 20 . the transport gas is cleaned in a filter 22 and removed through a conduit 23 . the ashes 21 are removed from the container 20 via a sluice valve 24 . fig2 is a perspective sketch of one of the overflow connection chambers 18 . this consists of a first end wall 30 , a second end wall 31 and a side wall 32 surrounding a chamber space 33 of the connection chamber . the space 33 has such an axial extension that a cushion 38 of material is formed against the end wall 31 , which cushion 38 prevents particulate material entering the space 33 from an upstream tube 34 from contacting the end wall 31 and causing erosion damage . the upstream tube 34 and a downstream tube 35 are connected to the end wall 30 at a distance a from each other . the optimum value for the distance a can be determined by means of tests and typicallky will be greater than one and smaller than two internal tube diameters . on the side facing towards the space 33 , the end wall 30 is saddle - shaped and may be formed from a saddle - shaped plate or half a rotary - symmetrical body which is divided in its symmestry plane . the radius of curvature of the surface 36 ( in the plane a of fig2 ) is , as shown at r 1 in fig3 equal to half a ( i . e . half the distance between the inner surfaces of the tubes 34 , 35 in the plane a ). the radius of curvature of the surface 36 is also equal to half the distance between the inner surfaces of the tubes 34 , 35 in all other planes parallel to the plane a . an embodiment of this kind is very favorable from the point of view of ease of manufacture . other curve shapes may , of course , also occur in these planes ; for example , the curve may be parabolas or half ellipses . the important point is that for any given shape of the surface 36 the flow at the outlet of the connection chamber should be such that the particles do not strike the wall of either of the tubes in such a way as to cause any significant erosion . fig4 shows a section through the chamber 18 of fig2 in a plane b mid - way between the tubes 34 , 35 and parallel thereto . the radius of curvature r 2 of the surface 36 in plane b is the same as the inner radius of the tubes 34 , 35 . the saddle - shaped end wall 30 may have a varying radius of curvature in the plane a . from the point of view of good flow conditions , it is convenient for the tangent of the surface to be parallel to the inner surfaces of the tubes 34 , 35 at the point of connection . fig5 shows the component parts of an overflow connection chamber of the kind shown in fig2 and indicates one convenient method of putting those parts together . half of the walls of the rubes 34 , 35 are removed over end regions thereof . the remaining parts 34a , 35a are connected together with a pair of parallel plates 37a , 37b . the parts 34a , 35a , 37a and 37b then form the side wall 32 . the end walls 30 and 31 may be connected to the tubes 34 , 35 and the sheets 37a , 37b and to the parts 34a , 35a , 37a , 37b , respectively . in fig5 the end wall 30 is shown as half of a rotary - symmetrical body divided along its symmetry plane . the axis of the tubes 34 , 35 are parallel in fig2 but they can converge ( preferably at an angle less than 30 °). suitably the distance between the end walls 30 , 31 is between three and six times greater than the internal diameter of the tubes 34 , 35 ( or the internal diameter of the smaller of the two tubes if these are different ). since various modifications are clearly possible to the details of the design shown in the drawings it should be appreciated that the invention is defined by the following claims and is not limited to the embodiments specifically described . | 5 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.