text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
in one aspect , the invention relates to methods of preparing a long acting anesthetic . construction of the anesthetic will be described . experimentation to insure the anesthetic lasts over 30 hours will also be detailed . the following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds , compositions , and biomaterials and / or methods claimed herein are made and evaluated , and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention . three compounds were used including bupivacaine hydrochloride : 1 - butyl - n -( 2 , 6 - dimethylphenyl )- 2 - piperidinecarboxamide and hyaluonan : ( also called hyaluronic acid or hyaluronate ) an anionic , non - sulfated glycosaminoglycan distributed widely throughout connective , epithelial , and neural tissues , and fibrinogenor coagulation factor i , which is a soluble 340 kd plasma glycoprotein required for normal platelet function and wound healing . the composite anesthetic composition was made with powdered bupivacaine ( 40 mg ) was mixed with fibrinogen ( 40 mg ) with a magnetic stir bar . hyaluronan ( 16 mg ) was then added to the bupivacaine / fibrinogen mixture and placed in an ultrasound sonicator for final mixing followed by a vacuum to remove excess air . special testing containers were constructed with a mid polyurethane shelf to centralize the compounds within a test tube , allowing them to bathe in two ml of release medium . simulated body fluid ( sbf ) was selected as the release medium , rather than serum , which contains potential binding proteins . each specimen was initially bathed with two ml of sbf . at the end of each time period , the specimen was withdrawn and replaced with fresh sbf . release fluid was replaced at every time point and saved for bupivacaine quantification analysis . release profile experiments were conducted on four bupivacaine composites . the composite combinations were selected based on their low energy bonding characteristics that would result in the best sustained - releasing profiles . the four groups were group 1 : bupivacaine + hyaluronan , group 2 : bupivacaine + hyaluronan + fibrinogen , group 3 : bupivacaine + heparin , and group 4 : bupivacaine + heparin + fibrinogen . in each of the four composites 40 mg of powdered bupivacaine was used . other combinations were added to the bupivacaine as follows : 16 mg of hyaluronan , 40 mg of heparin , and 40 mg of fibrinogen . initially , the powdered bupivacaine was mechanically mixed with one or two of the other compounds with a magnetic stir - bar . eight ml of normal saline was added to replicate a 0 . 5 % solution that is used in the clinical setting . each composite was then placed in an ultrasound sonicator , followed by a vacuum to remove excess air . the four composites were then ready for testing . all four composites were tested in an identical manner for three different trials ( n = 3 ). a control of 0 . 5 % bupivacaine without additives was also included in each trial . there were fifteen time periods for each of the 15 specimens , totaling 225 elute samples . after all samples were collected , an ultraviolet - visible spectrophotometer was used to determine the concentration of bupivacaine in each of the elute samples . specific wavelength for absorption of bupivacaine was found in the 280 nanometers range . serial bupivacaine dilutions were created in order to generate standard curves to assist in calculating accurate bupivacaine concentrations . this required a calculation of the linear regression analysis for best fit . once all concentrations were known , data interpretation was accomplished . statistical analysis was completed by anova f - test for all combinations . a student t - test was then run on those found to be significant after anova screening . statistical significance was determined by a p value & lt ; 0 . 05 . based on the releasing data , the best combination was the hyaluronan - fibrinogen - bupivacaine combination . statistical analysis comparing all combinations demonstrated a statistically significant difference between hyaluronan / fibrinogen / bupivacaine combination and the heparin / bupivacaine composite ( p & lt ; 0 . 0415 ). a separate method to analyze the releasing profile was completed . this data examined the total amount of bupivacaine released over the entire study period . a comparison between the control and the hyaluronan / fibrinogen / bupivacaine composite was made . the total concentrations released were nearly equal after comparing the areas under the curves . a similar amount of drug is released , maintaining the same toxicity potential ; however , bupivacaine is released at a slower rate in the hyaluronan / fibrinogen / bupivacaine composite . | 0 |
in the following descriptions of the invention , terms such as “ front ,” “ back ,” “ top ,” “ bottom ,” “ side ,” and the like are used herein merely for ease of description and refer to the orientation of the components as shown in the figures . generally , the present invention may be briefly described as follows . referring first to fig1 and 2 , a preferred embodiment of an integrated pressure sense element assembly 100 of the present invention is shown . the sense element assembly 100 comprises two assemblies — a substrate assembly 102 and a diaphragm assembly 104 . the substrate assembly comprises a substrate 106 , a cp electrode 108 , a cr electrode 110 and a sealing layer 112 . in a preferred embodiment , the sealing layer 112 is a frit . however , any other material that provides a hermetic seal and provides for thermal expansion can be used . the cp electrode 108 is preferably elliptical in shape as shown more fully in fig3 and is connected to cp terminal 114 . the cr electrode 110 is also preferably elliptical in shape and is substantially an annular ring surrounding the cp electrode 108 as shown in fig1 and 3 . in a preferred embodiment , the cr electrode 110 is c - shaped . however , the cr electrode 110 may be a complete annulus surrounding the cp electrode 108 providing that there is an electrical connection possible directly with the cp electrode 108 without touching the cr electrode 110 . the cr electrode 110 is connected on one end 116 to a cr terminal 118 . the cp electrode 108 is connected to the cp terminal 114 by a conductor which extends from the cp electrode 108 and through the gap between the two ends 116 and 122 of the cr electrode 110 . in a preferred embodiment , a guard electrode 120 is provided which is connected from cr terminal 118 around cp terminal 114 to end 122 of the cr electrode 108 . the reason for this guard electrode 120 is to protect , or isolate the cp electrode that when the sensor is operational , there should be no temperature effect that affects the relative capacitance of the cp 108 and cr 110 electrodes . in an preferred embodiment in which a frit is used , the frit layer 112 will become di - electric after it is fired . thus , it will respond to outside temperature changes by a change in the dielectric constant . therefore , if the areas covered by the frit are different , as the temperature changes , the capacitances as measured at cp 108 and cr 110 electrodes will deviate from one another making the sensor less accurate . if the cr 110 and cp 108 electrodes have substantially the same area covered by the frit layer 112 then there will be very little capacitance deviation between the two electrodes . thus , in a preferred embodiment a guard electrode 120 is placed around the terminal 114 of the cp electrode 108 to act as a shield so that the only capacitance that the cp electrode 108 will be exposed to will be the capacitance created by the cr electrode 110 . in addition , if the sensor is exposed to high frequency signals , without the guard electrode 120 , terminal 118 would act like an antenna causing the sensitivity of the sensor to decrease . however , it is to be understood that the guard electrode 120 can be omitted . as shown in fig3 , in a preferred embodiment of the present invention , the cp 108 and cr 110 electrodes are fabricated by printing the cp and cr electrodes onto the substrate 106 so that they are off center on the substrate 106 . because they are elliptical in shape , by placing them off center onto the substrate 106 , the electrodes 108 and 110 can be fabricated on a larger area while still retaining sufficient space between the perimeter of the outer cr electrode 110 and the circumference of the substrate to be fused together . thus , when the diaphragm 104 and the substrate 102 assemblies layers are fused together , there is still enough space for the sealing layer 112 so that an effective seal is still possible . in a preferred embodiment , the elliptical electrodes are shaped such that the outer electrode 110 will provide essentially the same outside exposed area as the inner electrode 108 . further , in a preferred embodiment , the major diameter of the outer electrode 110 is no more than approximately twenty percent ( 20 %) larger than the minor diameter so that the increase in stress caused by the non - circular shape will remain negligible but the sensitivity to pressure will be nearly increased proportionally to the increased size of the major diameter of the outer electrode . accordingly , this configuration allows a more sensitive sensor assembly to be packaged in a smaller diameter housing . the substrate assembly preferably is fabricated by printing the cp 108 , cr 110 and guard 120 electrodes and the cr 118 and cp 114 terminals onto the substrate 106 , drying and firing them , printing the sealing layer 112 , drying the seal to drive off any volatile organic binders to leave a material that is approximately the consistency and hardness of chalk . referring again to fig1 - 3 , the diaphragm assembly 104 is shown comprising a diaphragm 120 , a ground electrode 122 having a terminal 126 connected thereto and a sealing layer 124 . a shield electrode which is on the bottom of the diaphragm assembly is not shown . in a preferred embodiment , the ground 122 and shield ( not shown ) electrodes and their terminals are fabricated by printing them onto the diaphragm 120 so that the electrodes are centered on the diaphragm 120 and correspond to the outer perimeter of the cr electrode 110 . thereafter , the electrodes are dried then fired . once the electrodes have cooled , the sealing layer 124 is printed and dried to drive off any volatile organic binders to leave a material that is approximately the consistency and hardness of chalk . the sense element 100 is completed when the substrate 102 and diaphragm 104 assemblies are fused together by aligning them along alignment notches 130 and 136 and then firing them so that the sealing layers 112 and 124 melt and fuse the assemblies 102 and 104 together . in a preferred method of the present invention , either the sealing layer 112 on the substrate assembly 102 or the sealing layer 124 on the diaphragm assembly 104 is fired prior to joining the assemblies together . the firing is done to partial completion so that the sealing layer will still have a coarse texture . after the sealing layer has cooled , the two assemblies 102 and 104 are then joined together by firing . this reduces the amount of outgassing during the joining process and it produces a stronger and less porous bond , reducing the chance of leakage in the final product . in a preferred embodiment , the sealing layer 112 is non - symmetrical due to the elliptical shapes of the electrodes 108 and 110 . since the sealing layers 112 and 124 provide support for the both the diaphragm 120 and the substrate 106 during the firing process and control the final gap between the electrodes , the sealing layers 112 and 124 must be held as constant and uniform as possible . to overcome the lack of symmetry , the sealing layers 112 and 124 are fabricated so that they have gaps 140 and 142 to balance out each sealing area so as to improve slumping when the layers of the sensor assembly 100 are fused together . this way , the centroid of each of the sealing layers 112 and 124 are kept as close as possible to the geometric center of the diaphragm 120 . another feature that is offered is the placement of an additional terminal 144 on the ground electrode . this way , it does not matter on which side of the diaphragm 120 that the ground electrode 122 is placed during fabrication so long as the shield electrode ( not shown ) is placed on the opposite side and they are connected through via holes 146 a or 146 b . the substrate 106 is manufactured so that it has 3 holes 150 a , b and c corresponding to terminals 114 , 118 , and 126 of the cp , cr and ground electrodes 108 , 110 and 122 , respectively . in addition , each of the sealing layers 112 and 124 also have holes therein which correspond to terminals 114 , 118 , and 124 of the cp , cr and ground electrodes . once the assemblies are aligned to be fused together , the holes in the substrate 106 and in the sealing layers 112 and 124 are also aligned and filled with conductive epoxy to provide the necessary conduit for the electrical connections . it will be understood that in the present invention , the sensitivity of the sense element 100 will increase without having to increase the overall size of the housing . those skilled in the art will understand that this type of sensor can be used in the automotive , airplane , heating , ventilating , and air conditioning systems ( hvac ) industries , among other applications . the embodiments described above are exemplary embodiments of the present invention . those skilled in the art may now make numerous uses of , and departures from , the above - described embodiments without departing from the inventive concepts disclosed herein . thus , the construction of the embodiments disclosed herein is not a limitation of the invention . accordingly , the present invention is to be defined solely by the scope of the following claims . | 7 |
the instant invention for electronic slip power control for a wound rotor induction motor ( wrim ) is shown in fig1 . before describing the fig1 embodiment reference will first be made to the prior art embodiment shown in fig2 . the control system shown in fig2 is for an automatically torque regulatedac adjustable speed drive . a wound rotor induction motor , indicated generally at 10 , comprises a stator 12 and a rotor 14 . the stator 12 is connected to a three - phase supply through primary protection and disconnect equipment shown symbolically at 16 . a bank of power factor correction capacitors 18 may be included if desired . the rotor is connected to slip rings shown symbolically at 20 , 22 and 24 . the slip rings 20 , 22 , 24 are connected to a three - phase full - wave rectifier , comprising a six - diode bridge section indicated generally at 26 , which is rated for the rotor output . the output of the full - wave rectifier 26 is applied to ac smoothing filter indicated generally at 28 . the filter 28 isconnected across an inverter bank comprising silicon controlled rectifiers ( scr &# 39 ; s ) indicated generally at 30 . a transformer , indicated generally at 32 , has a three - phase primary winding 34 and a three - phase secondary winding 36 . the transformer 32 is optional and is used where it is necessary to match the output of inverter 30 to the available ac power supply . the inverter bank 30 comprises six substantially identical siliconcontrolled rectifiers ( scr &# 39 ; s ) only one of which will be identified . each scr comprises an anode 38 , a cathode 40 and a gate 42 . the scr &# 39 ; s are firedby the application of a gating signal to one of the gates such as 42 . the gating of the inverter bank 30 is through feedback and trigger circuits indicated symbolically at 44 . the useful load indicated symbolically at 46is coupled to a tachometer generator 48 which develops a signal proportional to the speed of the load 46 and sends it via line 50 to the feedback and trigger circuit 44 . a torque transducer shown symbolically at52 develops a torque feedback signal which is sent by line 54 to the feedback and trigger circuit 44 . briefly , the ac voltage induced in the wrim rotor 14 is rectified in the full - wave bridge 26 to a dc level , which is fed through the filter 28 directly to the inverter 30 . the scr inverters are triggered at an inverting rate established by the frequency of the three - phase line so that the inverter output is maintained at constant frequency . the ac single phase tachometer generator 48 provides an indication of output motor speed . the tap - on resistor 52 senses the rectified current in the rotor secondary circuit , and provides a signal which is a function of the torque developed by the induction motor 10 . together the two feedback signals are summed to provide signals to the trigger circuitry 44 for controlling the inverter firing angles and therefore the inverter regenerative output voltage and power . upon energizing the system by closing the primary protection and disconnect equipment 16 , both the motor10 and the transformer 32 are energized -- the system is ready to be started . initially no current flows in the rotor 14 since the inverter 30 is not operating and hence no torque or motor rotation results . by turning on theinverter 30 at its full voltage output , the system will be operational , butthe motor 10 will not develop any torque until the voltage is reduced to a level that will permit rotor current to flow . as the voltage output of inverter 30 is reduced , current is permitted to flow in the rotor circuit since its voltage output ( which is rectified to dc by the three - phase full - wave bridge 26 ) is greater than the counter voltage being developed by the inverter 30 . the mechanical outputs of the motor -- both torque and speed -- are controlled over its entire range of operation by varying the voltage output of inverter 30 from maximum opposing voltage to a minimum or zero voltage output . since horsepower is a direct function of torque and speed ( i . e ., horsepower = kts ), when the applied torque of the load momentarily goes down thus tending to increase the speed , the feedback control circuitry 44 gates the scr &# 39 ; s of the inverter 30 so as to regenerate more ac power to the three - phase supply , thereby restoring the applied torque to the rotor 14 and maintaining the same speed and torque on the motor 10 . in the invention of fig1 the equipment which is the same as that of fig . 2 has been identified with the same numerals . the control system of fig1 is the same as that of fig2 except that the inverter now comprises two sections , indicated generally at 56 and 58 , each comprising six scr &# 39 ; s . additionally , the transformer 60 now comprises secondaries 62 and 64 connected to the outputs of the inverters 56 and 58 respectively . the primary 66 of transformer 60 is connected to the three - phase power supply . the inverter 58 is shunted by a disconnect switch shown symbolically at 68 . the inverters 56 and 58 are usually rated at half the voltage capacity of the rotor 14 , and the voltage matching transformer 60 is a three - winding unit , i . e ., one primary 66 and two secondary windings 62 , 64 . the operation of the system of fig1 is as follows . when starting , both inverter 56 and inverter 58 are at full voltage . as the motor current ( torque ) and speed are increased , the inverter 58 is reduced toward zero voltage output . during this period inverter 56 is held at maximum voltage output . when inverter 58 reaches zero voltage output , the shorting switch 68 ( connected across its output ) is closed , and inverter 58 is then shorted out and eliminated for the remainder of system operation . ( the shorting switch 68 is again opened during stopping as will be explained ). the system will then operate exactly as described in connection with fig2 control being realized by means of the single inverter 56 , that is , full voltage output from the inverter 56 will give 50 % speed , and reducingthis voltage output to zero will permit increasing the motor speed to the top rating of the motor 10 . in stopping the induction motor 10 , the output of inverter 56 is increased from its then operating value to its full or 100 % magnitude . the shorting switch 68 is then opened and inverter 58 is now back on the line at zero output voltage . once the shorting switch 68 has been opened , ( transferringrotor current to the inverter 58 ), the output of inverter 58 is increased from its zero output level to its maximum value , causing the motor 10 to be brought to a stop . thus the rotor current ( torque ) is reduced to zero by virtue of opposing voltage supplied by the inverters 56 and 58 in series , i . e ., inverter 56 at maximum voltage added to the increasing voltage output from the inverter 58 . the advantages of the fig1 arrangement over the prior art are many . by reason of the fact that two inverters are used , the voltage rating of eachinverter can be one - half that of the single inverter system of the prior art shown in fig2 . however , it should be noted at this point that this one - half rating for the inverters is not a requirement in the practice of this invention . thus , the first inverter need have only a voltage rating sufficient to satisfy the expected running range for the wound rotor motor , with the second inverter ( the one which is shorted out ) having a voltage rating of sufficient magnitude to satisfy the additional capacity requirements imposed by starting and stopping service . this results in lower inverter losses since lower voltage rated scr &# 39 ; s can be used . secondly , the matching transformer 60 can have a reduced rating -- up to as much as 43 % by proper selection of the secondary windings 62 and 64 . for example : the primary winding rating is required to match only the kva rating of inverter i , since when both secondaries are in use , in the speed range from 0 to 50 % of rated speed , only 25 % of rotor current needs to be handled . thus , the transformer rating by comparison with the normal 100 % speed range , two - winding unit , is greatly reduced . thirdly , by reducing the inverter ratings to one - half that of the rotor rating for the operating range , the kvar &# 39 ; s generated by the inverter 56 attop speed are one - half those generated by the full - range unit ( i . e ., inverter 30 of fig2 ) and the power factor correction capacitor bank 18 ( when required ) may be reduced to approximately one - half the value of the power factor correction capacitor bank 18 used with the single inverter offig2 . further , by using a reduced rating for the inverter 56 , the harmonic currents flowing into the power source will be reduced since they are proportional to rating of the inverter used . thus , the multiple inverter , multiple secondary winding transformer arrangement of fig1 provides all the advantages of the full - range ( 0 - 100 %) electronic slip power control of fig2 with lower equipment cost , higher efficiency of operation , and reduced power source disturbance . | 7 |
in one aspect of the present disclosure , there is provided a conjugated polymer containing an ethynyl crosslinking group and its use . the conjugated polymer material has a conjugated backbone structure and a functionalized ethynyl crosslinking group as side chain . the present disclosure will now be described in greater detail with reference to the accompanying drawings so that the purpose , technical solutions , and technical effects thereof are more clear and comprehensible . it is to be understood that the specific embodiments described herein are merely illustrative of , and are not intended to limit , the disclosure . the present disclosure provides a conjugated polymer containing an ethynyl crosslinking group , having the following structure : wherein , x and y are mole percentages and x + y = 1 ; ar1 and ar2 in multiple occurrences are the same or different and independently selected from an aryl or a heteroaryl group ; and , r3 is a linking group . as used herein , the term “ small molecule ” refers to a molecule that is not a polymer , oligomer , dendrimer , or blend . in particular , there is no repetitive structure in small molecules . the molecular weight of the small molecule is no greater than 3000 g / mole , more preferably no greater than 2000 g / mole , and most preferably no greater than 1500 g / mole . as used herein , the term “ polymer ” includes homopolymer , copolymer , and block copolymer . in addition , in the present disclosure , the polymer also includes dendrimer . the synthesis and application of dendrimers are described in dendrimers and dendrons , wiley - vch verlag gmbh & amp ; co . kgaa , 2002 , ed . george r . newkome , charles n . moorefield , fritz vogtle . the term “ conjugated polymer ” as defined herein is a polymer whose backbone is predominantly composed of the sp2 hybrid orbital of carbon ( c ) atom . some known non - limiting examples are : polyacetylene and poly ( phenylene vinylene ), on the backbone of which the c atom can also be optionally substituted by other non - c atoms , and which is still considered to be a conjugated polymer when the sp2 hybridization on the backbone is interrupted by some natural defects . in addition , the conjugated polymer in the present disclosure may also comprise aryl amine , aryl phosphine and other heteroarmotics , organometallic complexes , and the like . in the present disclosure , the terms such as polymerid , polymeride , and polymer have the same meaning and are interchangeable in use . in some embodiments , the polymers described in one aspect of the disclosure have a molecular weight ( mw ) of no smaller than 10000 g / mole , more preferably no smaller than 50000 g / mole , more preferably no smaller than 100000 g / mole , and most preferably no smaller than 200000 g / mol . in some preferred embodiments , the polymers described in one aspect of the disclosure are provided , wherein ar1 and ar2 are the same or different in multiple occurrences and independently selected from any one of the following structural groups : an cyclic aromatic group , including any one of benzene , biphenyl , triphenyl , benzo , fluorene , indenofuorene , and derivatives thereof ; and , a heterocyclic aromatic group , including triphenylamine , dibenzothiophene , dibenzofuran , dibenzoselenophen , furan , thiophene , benzofuran , benzothiophene , benzoselenophene , carbazole , indolocarbazole , pyridylindole , pyrrolodipyridine , pyrazole , imidazole , triazole , oxazole , thiazole , oxadiazole , oxatriazole , dioxazole , thiadiazole , pyridine , pyridazine , pyrimidine , pyrazine , triazine , oxazine , oxathiazin , oxadiazine , indole , benzimidazole , indoxazine , bisbenzoxazole , isoxazole , benzothiazole , quinoline , isoquinoline , cinnoline , quinazoline , quinoxaline , naphthalene , phthalein , pteridine , xanthene , acridine , phenazine , phenothiazine , phenoxazine , benzofuropyridine , furodipyridine , benzothienopyridine , thienodipyridine , benzoselenophenopyridine , selenophenodipyridine , and the like , or a combination thereof , or a combination thereof . in some embodiments , the ar1 , ar2 cyclic aryl groups and heterocyclic aryl groups may be further optionally substituted , wherein the substituents may be hydrogen , deuterium , alkyl , alkoxy , amino , alkenyl , alkynyl , aralkyl , heteroalkyl , aryl and heteroaryl , or a combination thereof . typically , the conjugated polymer comprises at least one backbone structural unit . the backbone structural unit is typically a π - conjugated structural unit with relatively large energy gap , also referred to as backbone unit , which may be selected from monocyclic or polycyclic aryl or heteroaryl . in the present disclosure , the conjugated polymer may comprise two or more backbone structural units . typically , the content of the backbone structural unit may be no smaller than 40 mol %, more preferably no smaller than 50 mol %, more preferably no smaller than 55 mol %, and most preferably no smaller than 60 mol %. in a preferred embodiment , the polymer according to one aspect of the disclosure is provided , wherein ar1 may be a polymer backbone structural unit that is any one selected from the group consisting of benzene , biphenyl , triphenyl , benzo , fluorene , indenofuorene , carbazole , indolocarbazole , dibenzosilole , dithienocyclopentadiene , dithienosilole , thiophene , anthracene , naphthalene , benzodithiophene , benzofuran , benzothiophene , benzene and selenophene and its derivatives , or a combination thereof . “ polymer backbone ” refers to a chain having the largest number of chain units or repeating units in a polymer chain with a branched ( side chain ) structure . in some embodiments , the polymers of the present disclosure have hole - transport properties . in a preferred embodiment , the polymer according to one aspect of the disclosure is provided , wherein ar2 may be selected from units having hole - transport properties , and a hole - transport unit may be preferably any one selected from the group consisting of aromatic amines , triphenylamine , naphthylamine , thiophene , carbazole , dibenzothiophene , dithienocyclopentadiene , dithienosilole , dibenzoselenophen , furan , thiophene , benzofuran , benzothiophene , benzoselenophene , carbazole , indolecarbazole , and their derivatives , or a combination thereof . in another preferred embodiment , ar2 may have the structure represented by chemical formula 2 : wherein ar 1 , ar 2 , ar 3 in multiple occurrences are independently the same or different : ar 1 is selected from a single - bond or mononuclear or polynuclear aryl or heteroaryl , wherein the aryl or heteroaryl may be optionally substituted with other side chains . ar 2 is selected from mononuclear or polynuclear aryl or heteroaryl , wherein the aryl or heteroaryl may be optionally substituted with other side chains . ar 3 is selected from mononuclear or polynuclear aryl or heteroaryl , wherein the aryl or heteroaryl may be optionally substituted with other side chains . ar 3 may also be linked to other parts of chemical formula 2 by a bridging group . the preferred structural unit represented by chemical formula 2 is chemical formula 3 ar 4 , ar 6 , ar 7 , ar 10 , a 11 , ar 13 , and ar 14 are defined in the same way as ar 2 in chemical formula 2 , ar 5 , ar 8 , ar 9 , and ar 12 are as defined in the same way as ar 3 in chemical formula 2 . ar 1 - ar 14 in chemical formula 2 and chemical formula 3 may be preferably selected from the group consisting of phenylene , naphthalene , anthracene , fluorene , spirobifluorene , indenofuorene , phenanthrene , thiophene , pyrrole , carbazole , binaphthalene , dehydrophenanthrene , and the like , or a combination thereof . particularly preferred alternatives of the structural units represented by chemical formula 2 and chemical formula 3 are listed in table 1 . each of these compounds may be optionally substituted with one or more substituents , and r is a substituent . wherein d 1 and d 2 may be independently the same or different in multiple occurrences and may be selected from any of the following functional groups or any combinations thereof : thiophene , selenophene , thieno [ 2 , 3b ] thiophene , thieno [ 3 , 2b ] thiophene , dithienothiophene , pyrrole , and aniline , all of which functional groups may be optionally substituted by any group below : halogen , — cn , — nc , — nco , — ncs , — ocn , scn , c (═ o ) nr 0 r 00 , — c (═ o ) x , — c (═ o ) r 0 , — nh 2 , — nr 0 r 00 , sh , sr 0 , — so 3 h , — so 2 r 0 , — oh , — no 2 , — cf 3 , — sf 5 , silyl or carbyl or hydrocarbyl having 1 to 40 c atoms , wherein r 0 and r 00 are substituent groups . ar 15 and ar 16 may be independently selected from the same or different forms in multiple occurrences and may be selected from mononuclear or polynuclear aryl or heteroaryl and may be optionally fused to their respective adjacent d 1 and d 2 . n1 - n4 may be independently selected from an integer from 0 to 4 . preferably , ar 15 and ar 16 in the materials represented by chemical formula 4 are selected from phenylene , naphthalene , anthracene , fluorene , spirobifluorene , indenofuorene , phenanthrene , thiophene , pyrrole , carbazole , binaphthalene , dehydrophenanthrene , or a combination thereof . the unit having the hole - transport property may correspond to the hole - transport material htm in oled . suitable organic htm materials may optionally comprise compounds having the following structural units : phthlocyanine , porphyrine , amine , aryl amine , triarylamine , thiophene , fused thiophene such as dithienothiophene and dibenzothiphene , pyrrole , aniline , carbazole , indolocarbazole , and their derivatives , or a combination thereof . examples of cyclic aryl amine - derived compounds that may be used as htm include , but not limited to , the general structure as follows : wherein each ar 1 to ar 9 may be independently selected from : cyclic aryl groups such as benzene , biphenyl , triphenyl , benzo , naphthalene , anthracene , phenalene , phenanthrene , fluorene , pyrene , chrysene , perylene , azulene ; and heterocyclic aryl groups such as dibenzothiophene , dibenzofuran , furan , thiophene , benzofuran , benzothiophene , benzoselenophene , carbazole , pyrazole , imidazole , triazole , isoxazole , thiazole , oxadiazole , oxatriazole , dioxazole , thiadiazole , pyridine , pyridazine , pyrimidine , pyrazine , triazine , oxazine , oxathiazin , oxadiazine , indole , benzimidazole , indoxazine , bisbenzoxazole , benzisoxazole , benzothiazole , quinoline , isoquinoline , cinnoline , quinazoline , quinoxaline , naphthalene , phthalein , pteridine , xanthene , acridine , phenazine , phenothiazine , phenoxazine , dibenzoselenophene , benzoselenophene , benzofuropyridine , indolocarbazole , pyridylindole , pyrrolodipyridine , furodipyridine , benzothienopyridine , thienodipyridine , benzoselenophenopyridine , and selenophenodipyridine ; groups comprising 2 to 10 ring structures which may be the same or different types of cyclic aryl or heterocyclic aryl and are bonded to each other directly or through at least one of the following groups , for example : oxygen atom , nitrogen atom , sulfur atom , silicon atom , phosphorus atom , boron atom , chain structure unit , and aliphatic cyclic group ; and wherein each ar may be further optionally substituted , and the substituents may optionally be hydrogen , alkyl , alkoxy , amino , alkene , alkyne , aralkyl , heteroalkyl , aryl and heteroaryl . in one aspect , ar 1 to ar 9 may be independently selected from the group consisting of : wherein n is an integer of 1 to 20 ; x 1 to x 8 are ch or n ; ar 1 is as defined above . additional non - limiting examples of cyclic aryl amine - derived compounds may be found in u . s . pat . no . 3 , 567 , 450 , u . s . pat . no . 4 , 720 , 432 , u . s . pat . no . 5 , 061 , 569 , u . s . pat . no . 3 , 615 , 404 , and u . s . pat . no . 5 , 061 , 569 . suitable non - limiting examples of htm compounds are set forth in the following table : the htm described above may be incorporated into the polymer of the present disclosure by a hole - transport structural unit . in some embodiments , the polymers of the present disclosure have electron - transport properties . in a preferred embodiment , according to one aspect of the present disclosure , wherein ar2 may be selected from units having electron - transport properties , and preferred electron - transport units may be any one selected from the group consisting of pyrazole , imidazole , triazole , oxazole , thiazole , oxadiazole , oxatriazole , dioxazole , thiadiazole , pyridine , pyridazine , pyrimidine , pyrazine , triazine , oxazine , oxathiazin , oxadiazine , indole , benzimidazole , indoxazine , bisbenzoxazole , isoxazole , benzothiazole , quinoline , isoquinoline , cinnoline , quinazoline , quinoxaline , naphthalene , phthalein , pteridine , xanthene , acridine , phenazine , phenothiazine , phenoxazine , benzofuropyridine , furodipyridine , benzothienopyridine , thienodipyridine , benzoselenophenopyridine , and selenophenodipyridine , or a combination thereof . the unit having the electron - transport characteristics may correspond to the electron - transport material etm in the oled . etm is also sometimes called n - type organic semiconductor material . in principle , examples of suitable etm materials are not particularly limited and any metal complexes or organic compounds may be used as etm as long as they have electron - transport properties . preferred organic etm materials may be selected from the group consisting of tris ( 8 - quinolinolato ) aluminum ( alq3 ), phenazine , phenanthroline , anthracene , phenanthrene , fluorene , bifluorene , spiro - bifluorene , phenylene - vinylene , triazine , triazole , imidazole , pyrene , perylene , trans - indenofluorene , cis - indenonfluorene , dibenzol - indenofluorene , indenonaphthalene , benzanthracene and their derivatives , or any combination thereof . in another aspect , compounds that may be used as etm may be molecules comprising at least one of the following groups : wherein r 1 may be selected from the group consisting of : hydrogen , alkyl , alkoxy , amino , alkene , alkyne , aralkyl , heteroalkyl , aryl and heteroaryl , wherein , when they are aryl or heteroaryl , they may have the same meaning as ar 1 in htm as described above ; ar 1 - ar 5 may have the same meaning as ar 1 in htm as described above ; n is an integer from 0 to 20 ; and x 1 - x 8 may be selected from cr 1 or n . non - limiting examples of suitable etm compounds are listed in the following table : the etm described above may be incorporated into the polymer of the present disclosure by an electron - transport structural unit . the conjugated polymer containing an ethynyl crosslinking group of structural chemical formula 1 according to one aspect of the present disclosure is provided , wherein r3 is a linking group . in a preferred embodiment , r3 may be selected from alkyl , alkoxy , amino , alkenyl , alkynyl , aralkyl , heteroalkyl , aryl and heteroaryl having from 2 to 30 carbon atoms . in some embodiments , r3 is a non - conjugated linking group , preferably any one selected from the group consisting of alkyl , alkoxy , amino , alkenyl , alkynyl , aralkyl , heteroalkyl , or a combination thereof . in some preferred embodiments , r3 is a conjugated linking group , preferably selected from c1 to c30 alkyl , c1 to c30 alkoxy , benzene , biphenyl , triphenyl , benzo , thiophene , anthracene , naphthalene , benzodithiophene , aryl amine , triphenylamine , naphthylamine , thiophene , carbazole , dibenzothiophene , dithienocyclopentadiene , dithienosilole , dibenzoselenophen , furan , thiophene , benzofuran , benzothiophene , benzoselenophene , carbazole , furan and the like , or a combination thereof . non - limiting examples of a suitable linking group r3 with a crosslinkable group are listed in the following table : in a preferred embodiment , the conjugated polymer of the present disclosure may have the general chemical formula 5 below : where x , y and z are mol % which are greater than 0 and x + y + z = 1 , and ar2 - 1 has the same meaning as ar2 described above . in a more preferred embodiment , the conjugated polymer as described above is provided , wherein at least one of ar1 , ar2 and ar2 - 1 is selected as a hole - transport unit and at least one selected as an electron - transport unit . 1 ) ar2 - 1 is selected as an electron - transport unit , ar2 is selected as a hole - transport unit ; 2 ) ar1 is selected as a backbone structural unit having electron - transport property , ar2 - 1 is selected as a hole - transport unit , and ar2 is selected as a hole - transport unit , 3 ) ar2 - 1 is selected as a light emitting unit ( including singlet emitter and triplet emitter ), and ar2 is selected as a hole - transport unit ; 4 ) ar2 - 1 is selected as a hole - transport unit , ar2 is selected as an electron - transport unit . in some preferred embodiments , the crosslinking group may be present in an amount of not greater than 50 mol %, more preferably not greater than 40 mol %, more preferably not greater than 30 mol %, and most preferably not greater than 20 mol %. a general synthetic process of a conjugated polymer containing the ethynyl crosslinking group may be : first synthesizing a monomer with a functionalized ethynyl crosslinking group , and then producing the conjugated polymer containing the ethynyl crosslinking group using polymerization processes such as transition metal catalyzed coupling ( suzuki polymerization , heck polymerization , sonogashira polymerization , still polymerization ) and the witting reaction . the reaction duration , reaction temperature , monomer ratio , reaction pressure , solubility , amount of catalyst , ligand ratio , phase transfer catalyst , and other parameters may be manipulated to control the molecular weight and dispersion coefficient of the polymer . the synthesis route may be as follows : a general synthetic process of a multi -( ternary or above ) conjugated polymer containing ethynyl crosslinking group may be : first synthesizing a monomer with a functionalized ethynyl crosslinking group , and then producing the conjugated polymer containing the ethynyl crosslinking group with multiple species f monomers ( three kinds or above ) using polymerization processes such as transition metal catalyzed coupling ( suzuki polymerization , heck polymerization , sonogashira polymerization , still polymerization ) and the witting reaction . the reaction duration , reaction temperature , monomer ratio , reaction pressure , solubility , amount of catalyst , ligand ratio , phase transfer catalyst , and other parameters may be manipulated to control the molecular weight and dispersion coefficient of the polymer . the synthesis route may be as follows : for some special polymer reaction , the ethynyl crosslinking group is sensitive to some of the specific chemical reagents , temperature and so on used in the polymer reaction process , which may initiate reaction of the ethynyl group . for example , if the temperature required for the polymerization reaction exceeds 180 ° c . or even higher than 280 ° c ., or 380 ° c ., the crosslinking groups of the conjugated polymer side chains are relatively active at high temperature and result in polymerization reaction of the ethynyl crosslinking groups to each other , generating an insoluble and infusible polymer with no solution processing characteristics . therefore , under the special polymerization conditions , the terminal hydrogen atoms on the ethynyl crosslinking group may be first protected to reduce its chemical reactivity . the most common protecting group for the terminal hydrogen atom of the ethynyl crosslinking group may be trimethylsilyl ( tms ). after formation of a trimeryl - containing polymer precursor , the polymer precursor may be treated with an alkali solution for some time to generate the targeted conjugated polymer , i . e ., the conjugated polymer containing the ethynyl crosslinking group . the optimized conjugated polymer synthesis route is shown in the following figure : the synthetic route of the conjugated organic monomer containing an ethynyl crosslinking group may be as shown below , but is not limited to the use of the following route to synthesize the target compound . the starting material a ( commercial chemical reagents or synthesized via chemical processes ) may be obtained by electrophilic optional substitution reaction ( e . g ., halogenation such as chlorination , bromination , iodination ) to obtain compound b . and the compound b can react with trimethylsilyl acetylene in a sonogashira coupling reaction catalyzed by pd — cu co - catalyst to yield compound c . the trimethylsilyl protective functional group may be removed from the compound c in an alkaline solution to produce the target compound d . in order to facilitate understanding of the conjugated polymer containing an ethynyl crosslinking group according to the present disclosure , examples of the conjugated polymers containing an ethynyl crosslinking group are given below , but are not limited thereto . the conjugated polymers containing the ethynyl crosslinking group listed herein have a distinct feature that the ethynyl group is linked to the backbone of the conjugated polymer directly or linked by a chain of conjugated aryl ring or heterocyclic aryl ring . the present disclosure also provides a mixture which may comprise a polymer according to one aspect of the disclosure , and at least another organic functional material . the organic functional material may include hole ( also referred to as electron hole ) injecting or transport material ( him / htm ), hole - blocking material ( hbm ), electron - injection or transport material ( eim / etm ), electron - blocking material ( ebm ), organic host material ( host ), singlet emitter ( fluorescent emitter ), multiplet emitter ( phosphorescent emitter ), especially light - emitting organometallic complexes . non - limiting examples of various organic functional materials are described , for example , in wo2010135519a1 , us20090134784a1 , and wo 2011110277a1 . the organic functional material may be a small - molecule polymeric material . the following is a more detailed description the organic functional material ( but not limited thereto ). htm has been described earlier and will be further discussed below . suitable organic him / htm materials for use in one aspect of the present disclosure may include any one of the compounds having the following structural units : phthalocyanines , porphyrins , amines , aryl amines , biphenyl triaryl amines , thiophenes , thiophenes such as dithiophenethiophene and thiophthene , pyrrole , aniline , carbazole , indeno - fluorene , and derivatives thereof . other suitable hims also include : fluorocarbon - containing polymers ; polymers comprising conductive dopants ; conductive polymers such as pedot / pss ; self - assembled monomers such as compounds comprising phosphonic acid and silane derivatives ; metal oxides , such as moox ; metal complex , and a crosslinking compound , or a combination thereof . other examples of metal complexes that may be used as htm or him may include , but are not limited to , the general structure as follows : m may be metal having an atomic weight greater than 40 ; ( y 1 - y 2 ) is a bidentate ligand , wherein y 1 and y 2 are independently selected from c , n , o , p , and s ; l is an auxiliary ligand ; m is an integer from 1 to the maximum coordination number of the metal ; m + n is the maximum coordination number of the metal . in one embodiment , ( y 1 - y 2 ) may be a 2 - phenylpyridine derivative . in another embodiment , ( y 1 - y 2 ) may be a carbene ligand . in another embodiment , m may be selected from ir , pt , os , and zn . in another aspect , the homo of the metal complex is greater than − 5 . 5 ev ( relative to the vacuum level ). etm has been described earlier and will be further discussed below . examples of eim / etm material used in one aspect of the present disclosure are not particularly limited , and any metal complex or organic compound may be used as eim / etm as long as they can transfer electrons . preferred organic eim / etm materials may be selected from the group consisting of tris ( 8 - quinolinolato ) aluminum ( alq3 ), phenazine , phenanthroline , anthracene , phenanthrene , fluorene , bifluorene , spiro - bifluorene , phenylene - vinylene , triazine , triazole , imidazole , pyrene , perylene , trans - indenofluorene , cis - indenonfluorene , dibenzol - indenofluorene , indenonaphthalene , benzanthracene and their derivatives , or any combination thereof . the hole - blocking layer ( hbl ) used in one aspect of the present disclosure is typically used to block holes from adjacent functional layers , particularly light - emitting layers . in contrast to a light - emitting device without a barrier layer , the presence of hbl usually leads to an increase in luminous efficiency . the hole - blocking material ( hbm ) of the hole - blocking layer ( hbl ) requires a lower homo than the adjacent functional layer , such as the light - emitting layer . in a preferred embodiment , the hbm has a greater energy level of excited state than the adjacent light - emitting layer , such as a singlet or triplet , depending on the emitter . in another preferred embodiment , the hbm has an electron - transport function . typically , eim / etm materials with deep homo levels may be used as hbm . on the other hand , examples of metal complexes that may be used as eim / etm may include , but are not limited to , the following general structure : ( o — n ) or ( n — n ) is a bidentate ligand , wherein the metal coordinates with o , n , or n , n ; l is an auxiliary ligand ; and m is an integer whose value is from 1 to the maximum coordination number of the metal . in another preferred embodiment , the organic alkali metal compound may be used as the eim . in the present disclosure , the organic alkali metal compound may be understood as a compound having at least one alkali metal , i . e ., lithium , sodium , potassium , rubidium , and cesium , and further comprising at least one organic ligand . non - limiting examples of suitable organic alkali metal compounds used in one aspect of the present disclosure may include the compounds described in u . s . pat . no . 7 , 767 , 317 b2 , ep 1941562b1 and ep 1144543b1 . the preferred organic alkali metal compound may be a compound of the following formula : wherein r 1 has the same meaning as described above , and the arc represents two or three atoms and the bond to form a 5 - or 6 - membered ring with metal m when necessary , while the atoms may be optionally substituted with one or more r 1 ; and wherein m is an alkali metal selected from lithium , sodium , potassium , rubidium , and cesium . the organic alkali metal compound may be in the form of a monomer , as described above , or in the form of an aggregate , for example , two alkali metal ions with two ligands , 4 alkali metal ions and 4 ligands , 6 alkali metal ions and 6 ligand , or in other forms . the preferred organic alkali metal compound may be a compound of the following formula : wherein , the symbols used are as defined above , and in addition : o , each time it may be the same or different , selected from 0 , 1 , 2 , 3 or 4 ; and p , each time it may be the same or different , selected from 0 , 1 , 2 or 3 . in a preferred embodiment , the alkali metal m is selected from the group consisting of lithium , sodium , potassium , more preferably lithium or sodium , and most preferably lithium . in a preferred embodiment , the organic alkali metal compound is used in the electron - injection layer , and more preferably the electron - injection layer consists of the organic alkali metal compound . in another preferred embodiment , the organic alkali metal compound is doped into other etms to form an electron - transport layer or an electron - injection layer , more preferably an electron - transport layer . non - limiting examples of a suitable organic alkali metal compound are listed in the following table : examples of a triplet host material used in one aspect of the present disclosure are not particularly limited and any metal complex or organic compound may be used as the host material as long as its triplet energy is greater than that of the light emitter , especially a triplet emitter or phosphorescent emitter . examples of metal complexes that may be used as triplet hosts may include , but are not limited to , the general structure as follows : wherein m may be a metal ; ( y 3 - y 4 ) may be a bidentate ligand , y 3 and y 4 may be independently selected from c , n , o , p , and s ; l may be an auxiliary ligand ; m may be an integer with the value from 1 to the maximum coordination number of the metal ; and , m + n is the maximum number of coordination of the metal . in a preferred embodiment , the metal complex which may be used as the triplet host has the following form : ( o — n ) may be a bidentate ligand in which the metal is coordinated to o and n atoms . in one embodiment , m may be selected from ir and pt . non - limiting examples of organic compounds that may be used as triplet host are selected from : compounds containing cyclic aryl groups , such as benzene , biphenyl , triphenyl , benzo , and fluorene ; compounds containing heterocyclic aryl groups , such as triphenylamine , dibenzothiophene , dibenzofuran , dibenzoselenophen , furan , thiophene , benzofuran , benzothiophene , benzoselenophene , carbazole , indolocarbazole , indolopyridine , pyrrolodipyridine , pyrazole , imidazole , triazole , oxazole , thiazole , oxadiazole , oxatriazole , dioxazole , thiadiazole , pyridine , pyridazine , pyrimidine , pyrazine , triazine , oxazine , oxathiazin , oxadiazine , indole , benzimidazole , indoxazine , bisbenzoxazole , isoxazole , benzothiazole , quinoline , isoquinoline , cinnoline , quinazoline , quinoxaline , naphthalene , phthalein , pteridine , xanthene , acridine , phenazine , phenothiazine , phenoxazine , benzofuropyridine , furodipyridine , benzothienopyridine , thienodipyridine , benzoselenophenopyridine , and selenophenodipyridine , or a combination thereof ; and groups containing 2 to 10 ring structures , which may be the same or different types of cyclic aryl or heterocyclic aryl and are linked to each other directly or by at least one of the following groups , such as oxygen atom , nitrogen atom , sulfur atom , silicon atom , phosphorus atom , boron atom , chain structure unit , and aliphatic ring , wherein each ar may be further optionally substituted and the substituents may be any one of hydrogen , alkyl , alkoxy , amino , alkene , alkyne , aralkyl , heteroalkyl , aryl and heteroaryl , or a combination thereof . in a preferred embodiment , the triplet host material may be selected from compounds comprising at least one of the following groups : r 1 - r 7 may be independently selected from the group consisting of hydrogen , alkyl , alkoxy , amino , alkene , alkyne , aralkyl , heteroalkyl , aryl and heteroaryl , which may have the same meaning as ar 1 and ar 1 described above when they are aryl or heteroaryl ; n may be an integer from 0 to 20 ; x 1 - x 8 may be selected from ch or n ; and x 9 may be selected from cr 1 r 2 or nr 1 . non - limiting examples of suitable triplet host material are listed in the following table : examples of singlet host material used in one aspect of the present disclosure are not particularly limited and any organic compound may be used as the host as long as its singlet state energy is greater than that of the light emitter , especially the singlet emitter or fluorescent light emitter . non - limiting examples of organic compounds used as singlet host materials may be selected from : cyclic aryl compounds , such as benzene , biphenyl , triphenyl , benzo , naphthalene , anthracene , phenalene , phenanthrene , fluorene , pyrene , chrysene , perylene , azulene ; heterocyclic aryl compounds , such as triphenylamine , dibenzothiophene , dibenzofuran , dibenzoselenophen , furan , thiophene , benzofuran , benzothiophene , benzoselenophene , carbazole , indolocarbazole , indolopyridine , pyrrolodipyridine , pyrazole , imidazole , triazole , isoxazole , thiazole , oxadiazole , oxatriazole , dioxazole , thiadiazole , pyridine , pyridazine , pyrimidine , pyrazine , triazine , oxazine , oxathiazin , oxadiazine , indole , benzimidazole , indoxazine , bisbenzoxazole , isoxazole , benzothiazole , quinoline , isoquinoline , cinnoline , quinazoline , quinoxaline , naphthalene , phthalein , pteridine , xanthene , acridine , phenazine , phenothiazine , phenoxazine , benzofuropyridine , furodipyridine , benzothienopyridine , thienodipyridine , benzoselenophenopyridine , and selenophenodipyridine ; and groups comprising 2 to 10 ring structures , which may be the same or different types of cyclic aryl or heterocyclic aryl and are linked to each other directly or by at least one of the following groups , such as oxygen atom , nitrogen atom , sulfur atom , silicon atom , phosphorus atom , boron atom , chain structure unit , and aliphatic rings . in a preferred embodiment , the monomorphic host material may be selected from compounds comprising at least one of the following groups : r 1 may be independently selected from the group consisting of hydrogen , alkyl , alkoxy , amino , alkene , alkyne , aralkyl , heteroalkyl , aryl and heteroaryl ; ar 1 is aryl or heteroaryl and has the same meaning as ar 1 defined in the htm above ; n is an integer from 0 to 20 ; x 1 - x 8 is selected from ch or n ; x 9 and x 10 are selected from cr 1 r 2 or nr 1 . non - limiting examples of a suitable singlet host material are listed in the following table : the hole - blocking layer ( hbl ) used in one aspect of the present disclosure is typically used to block holes from adjacent functional layers , particularly light - emitting layers . in contrast to a light - emitting device without a barrier layer , the presence of hbl usually leads to an increase in luminous efficiency . the hole - blocking material ( hbm ) of the hole - blocking layer ( hbl ) requires a lower homo than the adjacent functional layer , such as the light - emitting layer . in a preferred embodiment , the hbm has a greater energy level of excited state than the adjacent light - emitting layer , such as a singlet or triplet , depending on the emitter . in another preferred embodiment , the hbm has an electron - transport function . in one embodiment , the hbm used comprises the same molecules as the host material in the light - emitting layer . in another preferred embodiment , the hbm may be selected from compounds comprising at least one of the following groups : wherein n may be an integer from 0 to 20 ; l may be an auxiliary ligand ; and m may be an integer from 1 to 3 . the singlet emitter used in one aspect of the present disclosure tends to have a longer conjugate π - electron system . to date , there have been many examples , such as , but not limited to , any one of styrylamine and its derivatives or combinations thereof , and any one of indenofluorene and its derivatives or combinations thereof . in a preferred embodiment , the singlet emitter may be selected from the group consisting of monostyrylamines , distyrylamines , tristyrylamines , tetrastyrylamines , styrylphosphines , styryl ethers , and arylamines , or combinations thereof . mono styrylamine refers to a compound which comprises an unsubstituted or optionally substituted styryl group and at least one amine , most preferably an aryl amine . distyrylamine refers to a compound comprising two unsubstituted or optionally substituted styryl groups and at least one amine , most preferably an aryl amine . ternarystyrylamine refers to a compound which comprises three unsubstituted or optionally substituted styryl groups and at least one amine , most preferably an aryl amine . quaternarystyrylamine refers to a compound comprising four unsubstituted or optionally substituted styryl groups and at least one amine , most preferably an aryl amine . preferred styrene is stilbene , which may be further optionally substituted . the corresponding phosphines and ethers are defined similarly to amines . aryl amine or aromatic amine refers to a compound comprising three unsubstituted or optionally substituted cyclic or heterocyclic aryl systems directly attached to nitrogen . at least one of these cyclic or heterocyclic aryl systems is preferably selected from fused ring systems and most preferably has at least 14 aryl ring atoms . among the preferred examples are aryl anthramine , aryl anthradiamine , aryl pyrene amines , aryl pyrene diamines , aryl chrysene amines and aryl chrysene diamine . aryl anthramine refers to a compound in which a diarylamino group is directly attached to anthracene , most preferably at position 9 . aryl anthradiamine refers to a compound in which two diarylamino groups are directly attached to anthracene , most preferably at positions 9 , 10 . aryl pyrene amines , aryl pyrene diamines , aryl chrysene amines and aryl chrysene diamine are similarly defined , wherein the diarylarylamino group is most preferably attached to position 1 or 1 and 6 of pyrene . non - limiting examples of singlet emitter based on vinylamine and arylamine are also preferred examples which may be found in the following patent documents : wo 2006 / 000388 , wo 2006 / 058737 , wo 2006 / 000389 , wo 2007 / 065549 , wo 2007 / 115610 , u . s . pat . no . 7 , 250 , 532 b2 , de 102005058557 a1 , cn 1583691 a , jp 08053397 a , u . s . pat . no . 6 , 251 , 531 b1 , us 2006 / 210830 a , ep 1957606 a1 , and us 2008 / 0113101 a1 . non - limiting examples of singlet light emitters based on distyrylbenzene and its derivatives may be found in , for example , u . s . pat . no . 5 , 121 , 029 . further preferred singlet emitters may be selected from the group consisting of : indenofluorene - amine , indenofluorene - diamine , benzoindenofluorene - amine , benzoindenofluorene - diamine , dibenzoindenofluorene - amine , and dibenzoindenofluorene - diamine . other materials useful as singlet emissors include , but are not limited to , polycyclic aryl compounds , especially any one selected from the derivatives of the following compounds : anthracenes such as 9 , 10 - di - naphthylanthracene , naphthalene , tetraphenyl , phenanthrene , perylene such as 2 , 5 , 8 , 11 - tetra - t - butylatedylene , indenoperylene , phenylenes such as 4 , 4 ′-( bis ( 9 - ethyl - 3 - carbazovinylene )- 1 , 1 ′- biphenyl , periflanthene , decacyclene , coronene , fluorene , spirobifluorene , arylpyren ( e . g ., us20060222886 ), arylenevinylene ( e . g ., u . s . pat . no . 5 , 121 , 029 , u . s . pat . no . 5 , 130 , 603 ), cyclopentadiene such as tetraphenylcyclopentadiene , rubrene , coumarine , rhodamine , quinacridone , pyrane such as 4 ( dicyanoethylene )- 6 -( 4 - dimethylaminostyryl - 2 - methyl )- 4h - pyrane ( dcm ), thiapyran , bis ( azinyl ) imine - boron compounds ( us 2007 / 0092753 a1 ), bis ( azinyl ) methene compounds , carbostyryl compounds , oxazone , benzoxazole , benzothiazole , benzimidazole , and diketopyrrolopyrrole , or combinations thereof . non - limiting examples of some singlet emitter material may be found in the following patent documents : us 20070252517 a1 , u . s . pat . no . 4 , 769 , 292 , u . s . pat . no . 6 , 020 , 078 , us 2007 / 0252517 a1 , and us 2007 / 0252517 a1 . non - limiting examples of suitable singlet emitters are listed in the following table : the triplet emitter used in one aspect of the present disclosure is also called a phosphorescent emitter . in a preferred embodiment , the triplet emitter may be a metal complex of the general formula m ( l ) n , wherein m may be a metal atom ; l may be a same or different ligand each time it is present , and may be bonded or coordinated to the metal atom m at one or more positions ; n may be an integer greater than 1 , preferably 1 , 2 , 3 , 4 , 5 or 6 . alternatively , these metal complexes may be attached to a polymer by one or more positions , most preferably through an organic ligand . in a preferred embodiment , the metal atom m may be selected from the group consisting of transition metal elements or lanthanides or actinides , preferably ir , pt , pd , au , rh , ru , os , sm , eu , gd , tb , dy , re , cu or ag , and particularly preferably os , ir , ru , rh , re , pd , or pt . preferably , the triplet emitter comprises a chelating ligand , i . e ., a ligand , coordinated to the metal by at least two bonding sites , and it is particularly preferred that the triplet emitter comprises two or three identical or different bidentate or multidentate ligand . chelating ligands help to improve stability of metal complexes . non - limiting examples of organic ligands may be selected from the group consisting of phenylpyridine derivatives , 7 , 8 - benzoquinoline derivatives , 2 ( 2 - thienyl ) pyridine derivatives , 2 ( 1 - naphthyl ) pyridine derivatives , or 2 phenylquinoline derivatives . all of these organic ligands may be optionally substituted , for example , optionally substituted with fluoromethyl or trifluoromethyl . the auxiliary ligand may be preferably selected from acetylacetonate or picric acid . in a preferred embodiment , the metal complex which may be used as the triplet emitter may have the following form : wherein m is a metal selected from the group consisting of transition metal elements or lanthanides or actinides ; ar 1 may be the same or different cyclic group each time it is present , which comprises at least one donor atom , that is , an atom with a lone pair of electrons , such as nitrogen atom or phosphorus atom , which is coordinated to the metal through its ring group ; ar 2 may be the same or different cyclic group comprising at least one c atom and is coordinated to the metal through its ring group ; ar 1 and ar 2 are covalently bonded together , wherein each of them may carry one or more substituents which may also be joined together by substituents ; l may be the same or different at each occurrence and is an auxiliary ligand , preferably a bidentate chelating ligand , and most preferably a monoanionic bidentate chelating ligand ; m is 1 , 2 or 3 , preferably 2 or 3 , and particularly preferably 3 ; and , n is 0 , 1 , or 2 , preferably 0 or 1 , particularly preferably 0 . non - limiting examples of triplet emitter materials that are extremely useful may be found in the following patent documents and references : wo 200070655 , wo 200141512 , wo 200202714 , wo 200215645 , ep 1191613 , ep 1191612 , ep 1191614 , wo 2005033244 , wo 2005019373 , us 2005 / 0258742 , wo 2009146770 , wo 2010015307 , wo 2010031485 , wo 2010054731 , wo 2010054728 , wo 2010086089 , wo 2010099852 , wo 2010102709 , us 20070087219 a1 , us 20090061681 a1 , us 20010053462 a1 , baldo , thompson et al . nature 403 , ( 2000 ), 750 - 753 , us 20090061681 a1 , us 20090061681 a1 , adachi et al . appl . phys . lett . 78 ( 2001 ), 1622 - 1624 , j . kido et al . appl . phys . lett . 65 ( 1994 ), 2124 , kido et al . chem . lett . 657 , 1990 , us 2007 / 0252517 a1 , johnson et al ., jacs 105 , 1983 , 1795 , wrighton , jacs 96 , 1974 , 998 , ma et al ., synth . metals 94 , 1998 , 245 , u . s . pat . no . 6 , 824 , 895 , u . s . pat . no . 7 , 029 , 766 , u . s . pat . no . 6 , 835 , 469 , u . s . pat . no . 6 , 830 , 828 , us 20010053462 a1 , wo 2007095118 a1 , us 2012004407a1 , wo 2012007088a1 , wo2012007087a1 , wo 2012007086a1 , us 2008027220a1 , wo 2011157339a1 , cn 102282150a , wo 2009118087a1 . non - limiting examples of suitable triplet emitter are given in the following table : in some embodiments , the organic functional materials described above , including him , htm , etm , eim , host , fluorescent emitter , and phosphorescent emitters , may be in the form of polymers . in a preferred embodiment , the polymer suitable for the present disclosure is a conjugated polymer . in general , the conjugated polymer may have the general formula : wherein b , a may be independently selected as the same or different structural elements in multiple occurrences . b : a π - conjugated structural unit with relatively large energy gap , also referred to as backbone unit , which may be selected from monocyclic or polycyclic aryl or heteroaryl , preferably in the form of benzene , biphenylene , naphthalene , anthracene , phenanthrene , dihydrophenanthrene , 9 , 10 - dihydrophenanthroline , fluorene , difluorene , spirobifluorene , p - phenylenevinylene , trans - indenofluorene , cis - indenofluorene , dibenzol - indenofluorene , indenonaphthalene and derivatives thereof , or a combination thereof . a : a π - conjugated structural unit with relatively small energy gap , also referred to as a functional unit , which , according to different functional requirements , may be selected from the above - mentioned hole - injection or hole - transport material ( him / htm ), hole - blocking material ( hbm ), electron - injection or electron - transport material ( eim / etm ), electron - blocking material ( ebm ), organic host material ( host ), singlet emitter ( fluorescent emitter ), multiplet emitter ( phosphorescent emitter ), or a combination thereof . non - limiting examples of light - emitting polymers are disclosed in wo2007043495 , wo2006118345 , wo2006114364 , wo2006062226 , wo2006052457 , wo2005104264 , wo2005056633 , wo2005033174 , wo2004113412 , wo2004041901 , wo2003099901 , wo2003051092 , wo2003020790 , wo2003020790 , us2020040076853 , us2020040002576 , us2007208567 , us2005962631 , ep201345477 , ep2001344788 , and de102004020298 . in another embodiment , the polymers suitable for the present disclosure may be non - conjugated polymers . the nonconjugated polymer may be the backbone with all functional groups on the side chain . non - limiting examples of such nonconjugated polymers for use as phosphorescent host or phosphorescent emitter materials may be found in patent applications such as u . s . pat . no . 7 , 250 , 226 b2 , jp2007059939a , jp2007211243a2 and jp2007197574a2 . non - limiting examples of such nonconjugated polymers used as fluorescent light - emitting materials may be found in the patent applications jp2005108556 , jp2005285661 , and jp2003338375 . in addition , the non - conjugated polymer may also be a polymer , with the conjugated functional units on the backbone linked by non - conjugated linking units . non - limiting examples of such polymers are disclosed in de102009023154 . 4 and de102009023156 . 0 . the present disclosure also provides a formulation which may comprise a conjugated organic polymer as described in one aspect of the present disclosure and at least one organic solvent . examples of the organic solvents include , but are not limited to , methanol , ethanol , 2 - methoxyethanol , dichloromethane , trichloromethane , chlorobenzene , o - dichlorobenzene , tetrahydrofuran , anisole , morpholine , toluene , o - xylene , m - xylene , p - xylene , 1 , 4 - dioxahexane , acetone , methyl ethyl ketone , 1 , 2 - dichloroethane , 3 - phenoxytoluene , 1 , 1 , 1 - trichloroethane , 1 , 1 , 2 , 2 - tetrachloroethane , ethyl acetate , butyl acetate , dimethylformamide , dimethylacetamide , dimethyl sulfoxide , tetrahydronaphthalene , naphthane , indene and / or their formulations . in a preferred embodiment , the formulation according to one aspect of the disclosure is a solution . in another preferred embodiment , the formulation according to one aspect of the disclosure is a suspension . the formulation in the examples of the present disclosure may comprise an organic mixture from 0 . 01 to 20 wt %, more preferably from 0 . 1 to 15 wt %, more preferably from 0 . 2 to 10 wt %, and most preferably from 0 . 25 to 5 wt %. the present disclosure also provides the use of said formulation as a coating or printing ink in the preparation of organic electronic devices , and particularly preferably by means of printing or coating in a preparation process . among them , suitable printing or coating techniques may include , but are not limited to , ink - jet printing , typography , screen printing , dip coating , spin coating , blade coating , roll printing , torsion printing , lithography , flexography , rotary printing , spray coating , brush coating or pad printing , slit type extrusion coating , and so on . preferred are inkjet printing , screen printing and gravure printing . the solution or suspension may additionally comprise one or more components such as surface active compounds , lubricants , wetting agents , dispersing agents , hydrophobic agents , binders , etc ., for adjusting viscosity , film forming properties , improving adhesion , and the like . for more information about printing techniques and their requirements for solutions , such as solvent , concentration , viscosity , etc ., see handbook of print media : technologies and production methods , edited by helmut kipphan , isbn 3 - 540 - 67326 - 1 . based on the above polymers , the present disclosure also provides use of the polymers as described above , i . e . application of the polymers to an organic electronic device , which may be selected from , but not limited to , organic light emitting diodes ( oled ), organic photovoltaics ( opvs ), organic light emitting cells ( oleec ), organic field effect transistor ( ofet ), organic light emitting field effectors , organic lasers , organic spin electron devices , organic sensors , and organic plasmon emitting diodes , especially oled . in a particularly preferred embodiment , the polymer according to one aspect of the present disclosure is used in an electron - transport layer , especially a hole - transport layer , of an organic electronic device . the present disclosure further provides an organic electronic device which may comprise at least one polymer as described above . typically , such an organic electronic device may comprise at least a cathode , an anode , and a functional layer between the cathode and the anode , wherein the functional layer may comprise at least one of the polymers as described above . in a preferred embodiment , the above - described organic electronic device is an electroluminescent device , which may include a substrate , an anode , at least one light - emitting layer , and a cathode . in a particularly preferred embodiment , the organic electronic device described above may be an oled . the substrate may be opaque or transparent . transparent substrates may be used to make transparent light - emitting components . see , for example , bulovic et al ., nature 1996 , 380 , p 29 , and gu et al ., appl . phys . lett . 1996 , 68 , p 2606 . the substrate may be rigid or flexible . the substrate may be plastic , metal , semiconductor wafer or glass . most preferably the substrate has a smooth surface . substrates free of surface defects are particularly desirable . in a preferred embodiment , the substrate is flexible and may be selected from polymer films or plastic , with a glass transition temperature ( tg ) of 150 ° c . or above , more preferably above 200 ° c ., more preferably above 250 ° c ., and most preferably above 300 ° c . non - limiting examples of suitable flexible substrates are poly ( ethylene terephthalate ) ( pet ) and polyethylene glycol ( 2 , 6 - naphthalene ) ( pen ). the anode may comprise a conductive metal or a metal oxide , or a conductive polymer . the anode may easily inject holes into the hole - injection layer ( hil ) or the hole - transport layer ( htl ) or the light - emitting layer . in one embodiment , the absolute value of the difference between the work function of the anode and the homo energy level or the valence band energy level of the emitter in the light - emitting layer or of the p - type semiconductor material of the hil or htl or the electron - blocking layer ( ebl ) may be smaller than 0 . 5 ev , more preferably smaller than 0 . 3 ev , and most preferably smaller than 0 . 2 ev . non - limiting examples of anode materials may include , but are not limited to , al , cu , au , ag , mg , fe , co , ni , mn , pd , pt , ito , aluminum - doped zinc oxide ( azo ), and the like . other suitable anode materials are known and may be readily selected for use by one of ordinary skill in the art . the anode material may be deposited using any suitable technique , such as suitable physical vapor deposition , including rf magnetron sputtering , vacuum thermal evaporation , electron beam ( e - beam ), and the like . in some embodiments , the anode may be patterned . the patterned ito conductive substrate is commercially available and may be used to fabricate the device according to the disclosure . the cathode may comprise a conductive metal or a metal oxide . the cathode may easily inject electrons into the eil or etl or directly into the light - emitting layer . in one embodiment , the absolute value of the difference between the work function of the cathode and the lumo energy level or the valence band energy level of the emitter in the light - emitting layer or of the n - type semiconductor material of the electron - injection layer ( eil ) or the electron - transport layer ( etl ) or the hole - blocking layer ( hbl ) may be smaller than 0 . 5 ev , more preferably smaller than 0 . 3 ev , and most preferably smaller than 0 . 2 ev . in principle , all of the material that may be used as the cathode of an oled may serve as a cathode material for the device of the present disclosure . examples of the cathode material may include , but are not limited to , any one of al , au , ag , ca , ba , mg , lif / al , mgag alloys , baf2 / al , cu , fe , co , ni , mn , pd , pt , ito , or a combination thereof . the cathode material may be deposited using any suitable technique , such as suitable physical vapor deposition , including rf magnetron sputtering , vacuum thermal evaporation , electron beam ( e - beam ), and the like . oleds may also comprise other functional layers such as hole - injection layer ( hil ), hole - transport layer ( htl ), electron - blocking layer ( ebl ), electron - injection layer ( eil ), electron - transport layer ( etl ), and hole - blocking layer ( hbl ), or a combination thereof . materials suitable for use in these functional layers are described in detail in wo2010135519a1 , us20090134784a1 , and wo2011110277a1 . in a preferred embodiment , in the light emitting device according to one aspect of the present disclosure , the light - emitting layer thereof may be prepared by printing with the formulation of the present disclosure . the light emitting device according to one aspect of the present disclosure may have a light emission wavelength between 300 and 1000 nm , more preferably between 350 and 900 nm , and more preferably between 400 and 800 nm . the disclosure also provides the use of organic electronic devices according to one aspect of the disclosure in a variety of electronic devices including , but not limited to , display devices , lighting devices , light sources , sensors , and the like . the disclosure also provides an electronic device comprising an organic electronic device as described in an aspect of the disclosure , including , but not limited to , display devices , lighting devices , light sources , sensors , and the like . the disclosure will now be described with reference to the preferred embodiments , but the disclosure is not to be construed as being limited to the following examples . it is to be understood that the appended claims are intended to cover the scope of the disclosure . those skilled in the art will understand that modifications can be made to various embodiments of the disclosure with the teaching of the present disclosure , which will be covered by the spirit and scope of the claims of the disclosure . to a 250 ml three - necked round bottom flask , 26 . 40 g ( 0 . 1 mol ) of 2 , 5 - dibromo - p - xylene and 24 . 39 g ( 0 . 2 mmol ) of phenylboronic acid was added . 250 ml of toluene was added and stirred to dissolve , followed by 50 ml water and 21 . 2 g na 2 co 3 ( 0 . 2 mol ), stirring all solids were dissolved . 0 . 5 ml of aliquat 336 and 75 mg of tetra ( triphenylphosphine ) palladium catalyst ( 0 ) (( pph 3 ) 4 pd ) were added and flushed with protective nitrogen gas for 10 min before heated to reflux ( 92 - 100 ° c .). after refluxing for 20 min , the nitrogen gas was turned off and the system kept sealed , reflexing and reacting overnight . the reaction solution was extracted with toluene ( 50 ml × 4 ) after cooling , and the organic phase was combined and successively washed with saturated solution of nacl and water . white crystal 22 . 48 g was obtained by evaporation of the solvent and drying , with the theoretical value of 25 . 84 g and a yield rate of about 87 %. m . p . 180 - 181 ° c . ( lit . 180 ° c . ), 1 h nmr ( cdcl 3 , 400 mhz , ppm ): δ 7 . 44 - 7 . 30 ( m , 10h ), 7 . 14 ( s , 2h ), 2 . 26 ( s , 6h ). to a 250 ml three - necked round bottom flask , 12 . 92 g ( 0 . 05 mol ) of 2 , 5 - diphenyl - p - xylene and 250 ml of pyridine was added under mechanical stirring to dissolve , followed by 30 ml of water and 39 . 51 g of kmno 4 ( 0 . 25 mol ). it was heated to reflux ( about 105 - 110 ° c .) for 2 h , during which it was cooled after every 30 min of refluxing and added with 60 ml of water and 15 . 59 g of kmno 4 ( 0 . 1 mol ), repeated for four times in total . afterwards , it was cooled after every 6 h of refluxing and added with 60 ml of water , repeated for four times in total . after the reaction , filtration was done when hot . the filter cake was rinsed with boiling water ( 1000 ml × 4 ), the filtrate was combined , and the solvent was evaporated to about 100 ml , to which 50 ml of concentrated hydrochloric acid was added . after cooling , filtration , and washing with cold water , it was dried in vacuo to give 9 . 21 g of white solid , with the theoretical value of 15 . 92 and a yield rate of about 57 . 9 %. m . p . 281 - 282 ° c . ( lit . 282 ° c . ), 1 h nmr ( dmso - d 6 , 400 mhz , ppm ): δ 7 . 67 ( s , 2h ), 7 . 46 - 7 . 38 ( m , 10h ). to a 500 ml three - necked round bottom flask , 100 ml of concentrated sulfuric acid was added , followed by slow addition of 3 . 18 g of 2 , 5 - diphenylcarbodiimide ( 0 . 01 mol ) under stirring . reaction was allowed under room temperature for 0 . 5 h and followed by the addition of 5 - 10 drops of fuming sulfuric acid . after 6 h of reaction , the reaction solution was poured into ice - water mixture and stirred with a glass rod . the mixture was filtered by suction , rinsed with a large amount of water , and dried to give a dark red solid of 1 . 95 g , with the theoretical value of 2 . 82 g and a yield rate of about 69 %. m . p .& gt ; 300 ° c . ( lit .& gt ; 300 ° c . ), 1 h nmr ( cdcl 3 , 400 mhz , ppm ): δ 7 . 79 ( s , 2h ), 7 . 68 ( d , j = 7 . 36 hz , 2h ), 7 . 57 - 7 . 51 ( m , 4h ), 7 . 37 - 7 . 29 ( m , 2h ). to a 500 ml three - necked round bottom flask , 5 . 64 g of 6 , 22 - indolifluinedione ( 0 . 02 mol ) was added , and then slowly 300 ml of diethylene glycol and 4 ml of hydrazine hydrate ( 85 %) successively added with stirring , followed by 28 . 10 g of koh ( 0 . 5 mol ) ground into fine powder . after flushing with protective nitrogen gas for 10 min , it was heated to reflux ( 195 ° c .) for reaction of 48 h , before the mixture was cooled and poured into a mixed solution of crushed ice / concentrated hydrochloric acid ( v : v = 8 : 1 ), while stirring with a glass rod . the mixture was filtered by suction , washed with water , and dried to obtain a yellowish gray solid of 2 . 29 g , with the theoretical value of 5 . 09 g and a yield rate of 45 %. m . p . 300 - 301 ° c . ( lit . 300 - 302 ° c . ), 1 h nmr ( dmso - d 6 , 400 mhz , ppm ): δ 8 . 09 ( s , 2h ), 7 . 93 ( d , j = 7 . 4 hz , 2h ), 7 . 59 ( d , j = 7 . 4 hz , 2h ), 7 . 39 ( t , j = 7 . 4 hz , 2h ), 7 . 31 ( t , j = 7 . 4 hz , 2h ), 3 . 99 ( s , 4h ). to a 250 ml three - necked round bottom flask , a stir bar and 1 . 27 g of indenofuorene ( 6 ) were added , and a high vacuum piston ( paraffin seal ) was placed in the middle while rubber stoppers were place on both sides . the flask was heated with a blower while being evacuated with an oil pump . 100 ml of dry thf was added to the flask with a syringe . 6 ml of 2 . 87 m n - butyllithium ( 17 . 22 mmol ) was added dropwise to the flask using a syringe under stirring at − 78 ° c . and reacted under nitrogen protection for 1 h . the system was allowed to warm up to room temperature for 30 min of reaction and then cooled to − 78 ° c . 3 . 82 g of 1 - bromooctane ( n - c 8 h 17 br , 20 mmol ) was added with a syringe , reacted at room temperature for 1 h at − 78 ° c ., spontaneously warmed up to room temperature , and reacted overnight . the reaction was quenched by the addition of about 30 ml of water . the reaction solution was extracted with petroleum ether ( 50 ml × 4 ). the organic phase was combined and dried over anhydrous na 2 so 4 . the solvent was evaporated before purification by column chromatography ( 100 - 200 mesh silica gel / petroleum ether ). recrystallization from methanol gave 1 . 45 g of beige crystals , with the theoretical value of 3 . 52 g and a yield rate of about 47 . 7 %. 1 h nmr ( cdcl 3 , 400 mhz , ppm ): δ 7 . 72 ( d , j = 6 . 8 hz , 2h ), 7 . 58 ( s , 2h ), 7 . 33 - 7 . 24 ( m , 6h ), 1 . 99 ( t , j = 8 . 0 hz , 8h ), 1 . 12 - 0 . 98 ( m , 24h ), 0 . 76 - 0 . 59 ( m , 20h ); 13 c nmr ( cdcl 3 , 100 mhz , ppm ): δ 151 . 08 , 149 . 92 , 141 . 48 , 140 . 50 , 126 . 59 , 122 . 81 , 119 . 30 , 113 . 81 , 54 . 66 , 40 . 67 , 31 . 50 , 29 . 69 , 23 . 67 , 22 . 51 , 13 . 96 . to a 250 ml three - necked round bottom flask , a stir bar , 7 . 03 g of 6 , 6 , 12 , 12 - tetraoctylindenofuorene ( 10 mmol ), and 100 ml of ccl4 were added , dissolved by stirring . 40 g al 2 o 3 / cubr ( 0 . 25 mol ) was added for reaction under refluxing for 18 h . the reaction mixture was filtered and the filtrate was washed with water and dried over anhydrous na 2 so 4 . the solvent was evaporated and the resulting solid was recrystallized in methanol to give 3 . 73 g of white crystals with the theoretical value of 8 . 61 g and a yield rate of about 43 . 3 %. 1 h nmr ( cdcl 3 , 400 mhz , ppm ): δ 7 . 57 ( d , j = 8 . 4 hz , 2h ), 7 . 52 ( s , 2h ), 7 . 45 ( s , 2h ), 7 . 44 ( d , j = 8 . 4 hz , 2h ), 1 . 97 ( t , j = 8 . 2 hz , 8h ), 1 . 11 - 0 . 96 ( m , 24h ), 0 . 75 - 0 . 58 ( m , 20h ); 13 c nmr ( cdcl 3 , 100 mhz , ppm ): δ 153 . 12 , 149 . 68 , 140 . 12 , 139 . 72 , 129 . 69 , 125 . 97 , 120 . 73 , 120 . 63 , 113 . 84 , 55 . 13 , 40 . 60 , 31 . 58 , 29 . 71 , 23 . 76 , 22 . 62 , 14 . 11 . to a 250 ml three - necked round bottom flask , a stir bar was added , and a high vacuum piston was placed in the middle while rubber stoppers were place on both sides . the flask was heated with a blower while being evacuated with an oil pump . a solution of 4 . 31 g of 2 , 8 - dibromo - 6 , 6 , 12 , 12 - tetraoctylindenofuorene ( 5 mmol ) in 120 ml of thf was added to the flask using a syringe and stirred at − 78 ° c . for 20 min . then , 6 ml of 2 . 87 m n - butyllithium ( 17 . 22 mmol ) was added dropwise with a syringe , reacted under protective nitrogen gas for 2 h . 5 ml of 2 - isopropyl - 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborane was added dropwise with a syringe , reacted at − 78 ° c . for 2 h and then allowed to warm up to room temperature for reaction overnight . the reaction was quenched by adding 10 ml of water to the flask . the reaction was extracted with ether ( 50 ml × 4 ). the organic phase was combined and dried over anhydrous na 2 so 4 . the solvent was evaporated before purification by column chromatography ( 100 - 200 mesh silica gel / ethyl acetate v : v = 9 : 1 ) to give 1 . 18 g of white crystals , with the theoretical value of 4 . 78 g and the yield rate of about 24 . 7 %. 1 h nmr ( cdcl 3 , 400 mhz , ppm ): δ 7 . 75 ( d , j = 7 . 7 hz , 2h ), 7 . 71 ( d , j = 7 . 3 hz , 2h ), 7 . 70 ( s , 2h ), 7 . 59 ( s , 2h ) 4 . 19 ( t , j = 5 . 3 hz , 8h ), 2 . 08 ( t , j = 5 . 3 hz , 4h ), 2 . 01 ( q , j = 6 . 4 hz , 8h ), 1 . 07 - 0 . 96 ( m , 24h ), 0 . 68 ( t , j = 7 . 0 hz , 12h ), 0 . 58 ( t , j = 6 . 7 hz , 8h ); 13 c nmr ( cdcl 3 , 100 mhz , ppm ): δ 150 . 49 , 150 . 15 , 143 . 94 , 140 . 83 , 132 . 35 , 127 . 75 , 118 . 59 , 114 . 17 , 61 . 99 , 54 . 58 , 40 . 64 , 31 . 51 , 29 . 71 , 27 . 42 , 23 . 65 , 22 . 52 , 13 . 96 . to a 500 ml three - necked round bottom flask , 49 g of triphenylamine ( 0 . 2 mol ) was added , 300 ml of n , n - dimethylformamide was added slowly with stirring , and 34 . 10 g ( 0 . 2 mol ) of n - bromosuccinimide ground into fine power was added in several batches . the reaction was performed under nitrogen protection at room temperature in the dark for 48 h . after cooling , it was poured into crushed ice and extracted three times with dichloromethane . the organic phases were combined and washed three times with water . 200 - 300 mesh silica gel column was used for separation , while the eluent was for petroleum ether . the product was 58 g with a yield rate of 90 %. to a 500 ml three - necked round bottom flask , 4 - bromotriphenylamine ( 12 . 00 g , 40 . 00 mmol ), cui ( 0 . 052 g , 0 . 28 mmol ), ( ph 3 p ) 2 pdcl 2 ( 0 . 475 g , 0 . 68 mmol ), 200 ml of degassed toluene , and 60 ml of degassed diisopropylamine were added under stirring to dissolve and mix evenly . a solution of trimethylethynylsilane ( 4 . 32 g , 44 . 0 mmol ) in diisopropylamine ( 30 ml ) was added dropwise under argon at room temperature . after the dropwise addition , the temperature of the reaction solution was raised to 70 ° c . and the reaction was carried out under argon for 6 hours . the reaction progress was monitored by thin layer chromatography . after completion of the reaction , the reaction solution was cooled to room temperature , and the impurities such as solid salt were removed by filtration . the crude product was separated and purified by column chromatography ( silica gel column , with eluent as petroleum ether ), and further recrystallized from methanol to give a white solid which was filtered and dried in vacuo to give 9 . 58 g of a yield rate of 70 %. to a 500 ml three - necked round bottom flask , 6 g of 4 - trimethylsilylethynyltriphenylamine ( 0 . 02 mol ) was added , 300 ml of n , n - dimethylformamide was added slowly with stirring , and 6 . 810 g ( 0 . 04 mol ) of n - bromosuccinimide ground into fine power was added in several batches . the reaction was performed under nitrogen protection at room temperature in the dark for 48 h . after cooling , it was poured into crushed ice and extracted three times with dichloromethane . the organic phases were combined and washed three times with water . 200 - 300 mesh silica gel column was used for separation , while the eluent was for petroleum ether . the product was 5 . 6 g with a yield rate of 90 %. in a 25 ml two - necked round bottom flask , 195 mg ( 0 . 5 mmol ) of monomer 4 , 4 - dibromo - 4 ′- trimethylsilyl ethynyltriphenylamine , 418 mg ( 0 . 5 mmol ) of monomer 2 , 8 - bis ( 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborolane - diyl )- 6 , 6 , 12 , 12 - tetraoctylindenofuorene , 10 mg of pd ( pph 3 ) 4 , 10 ml of degassed toluene , 4 ml of degassed tetrahydrofuran , and 2 ml of a 20 wt % aqueous solution of tetraethylammonium hydroxide were added , homogenized , and flushed with argon for 15 minutes . the reaction was carried out under argon protection at 110 ° c . for 24 hours , followed by the successive addition of 50 μl of bromobenzene to reflux for 2 hours and 20 mg of phenylboronic acid to reflux for 2 hours . after the reaction was completed and cooled to room temperature , the reaction solution was added dropwise to methanol for precipitation . the resulting flocculent precipitate was filtered , dried in vacuo , and the resulting polymer was redissolved in about 30 ml of tetrahydrofuran . the resulting tetrahydrofuran solution was filtered through a polytetrafluoroethylene ( ptfe ) filter having a pore size of 0 . 45 m , distilled under reduced pressure , concentrated , and added dropwise to methanol for precipitation . the precipitate was dried in vacuo to give 392 mg of pale yellow solid with a yield rate of 74 %. gpc ( tetrahydrofuran , polystyrene standard sample ) mn = 21 000 g mol − 1 , pdi = 1 . 8 . to a solution of polymer p1 ( 392 mg ) in tetrahydrofuran ( 200 ml ), 15 ml of 20 wt % potassium hydroxide aqueous solution was added , followed by the addition of 20 ml of methanol to dilute the reaction solution . the reaction was stirred under argon at room temperature for 1 hour . after completion of the reaction , the reaction solution was poured into ice water and extracted with trichloromethane . the oil layers were washed with water , saturated sodium chloride aqueous solution and concentrated to obtain a crude product . the crude product was separated and purified by column chromatography ( silica gel column , with eluent as petroleum ether ) and further recrystallized in methanol to give a white solid , which was filtered and dried in vacuo to give a yield of 352 mg with a yield rate of 80 %. gpc ( tetrahydrofuran , polystyrene standard sample ) mn = 21 000 g mot − 1 , pdi = 1 . 8 . the polymer p2 prepared in example 1 was used as a hole - transport material in an organic / polymer electroluminescent device o / pleds ( ito anode / hole - transport layer / light - emitting layer / electron - transport layer / aluminum cathode ). the ito conductive glass and block resistors of about 20 ohm / cm square were pre - cut into 15 mm × 15 mm square piece , ultrasonically cleaned successively with acetone , micron - level semiconductor special detergent , deionized water , and isopropyl alcohol , flushed with nitrogen , and placed in the oven for later use . prior to use , the ito glass pieces were bombarded by plasma for 10 minutes in an oxygen plasma etch instrument . pedot : pss dispersion in water ( about 1 %) clevios ™ pedot : pss a14083 was used as a buffer layer in a high - speed spin coating ( kw - 4a ), the thickness depending on the solution concentration and rotation speed , monitored in real time by a surface profiler ( tritek alpha - tencor - 500 type ). after film formation , the residual solvent was removed in a constant - temperature vacuum oven . the thickness of the pedot : pss film on the ito substrate was 80 nm thick . the polymer p2 synthesized in example 1 was dissolved in a toluene solution at a concentration of 5 mg / ml . the polymer p2 was spin - coated on a pedot : pss film , and the thickness was 20 nm . the reaction was heated to 200 ° c . for 30 min on a hot plate , so that the substance p2 underwent a crosslinking reaction . the polymer p2 film was then rinsed with toluene and the thickness was determined to be 18 - 19 nm , indicating that the crosslinking reaction was effective and the solification of polymer p2 film was relatively complete . the fluorescent conjugated polymer p - ppv ( p - ppv is a green - emitting material ) or meh - ppv ( meh - ppv is an orange - red emitting material ) was weighed in a clean bottle , transferred to a film - specific glove box under nitrogen protection , dissolved in toluene , and filtered through a 0 . 45 micron filter . the fluorescent polymer was spin - coated on the hole - transport layer of the polymer p2 film , and the optimal thickness of the polymer light - emitting layer was 80 nm . the film thickness was measured using an alpha - tencor - 500 surface profiler . then , about 2 - 5 nm csf was applied under vacuum deposition conditions as an electron - injection / transporting layer . aluminum ( 100 nm ) was vacuum evaporated on the electron - transport layer as a cathode . the light emitting area of the device has a region masked by the ito interaction cover with an area determined to be 0 . 04 square centimeters . all preparation procedures were carried out in a glove box in a nitrogen atmosphere . the current - voltage characteristics , light intensity , and external quantum efficiency of the device were measured by the keithley236 current - voltage measurement system and a calibrated silicon photodiode . | 2 |
this invention is surgical instruments for stabilizing - the beating heart and methods for their use . the means for stabilizing the beating heart are comprised of several alternative structures which engage the surface of the heart to stabilize the beating heart during coronary surgery . the instruments provide the capability to exert and maintain a stabilizing force on the heart by contacting the heart with the stabilizing means and by fixing the position of the stabilizing means throughout the duration of a surgical procedure . the instruments and methods of the invention are preferably used for stabilization of the beating heart during a minimally invasive coronary artery bypass graft ( cabg ) operation which has been specially developed to facilitate placement of a bypass graft without cardioplegia or cardiopulmonary bypass . although the means for stabilizing the beating heart can be applied in different surgical contexts , the devices described herein are most advantageously employed in a cabg procedure wherein only one or two incisions are placed in the chest . the structure of the stabilizing means may be described by several structural embodiments which stabilize the beating heart while the minimally invasive surgical procedure is performed . the stabilizer means may also advantageously function in a multiple component system containing a retractor , an occluder , a surgical blower or suction device , an apparatus for holding the source artery , such as a lima holder , or other like devices to enable a surgeon to more efficiently complete the anastomosis . while the devices disclosed herein each use mechanical means to stabilize the beating heart , certain embodiments are designed to operate on the entire heart while others have more localized effect and may be applied to the area immediately proximate to a structure such as the target artery of the anastomosis . in each instance , the beating heart is effectively stabilized at the area where a surgical procedure is to be performed . surgical access to the beating heart may be achieved by several conventional cardiac surgical procedures which have been developed for traditional bypass surgery . the surgeon may obtain the advantages provided by the invention in any procedure where the bypass is achieved on the beating heart . when access to the beating heart is achieved by a sternotomy , the length of the sternum is separated to expose the surface of the heart . preferably , the surgeon takes additional measures to restrict the movement at the entire heart within the chest cavity . for example , an inflatable cushion with straps or laces may be inserted beneath or surrounding the heart . additionally , when the pericardium is available , the pericardium may be incised and used to position the beating heart . when the pericardium is available , the surgeon can use the pericardium to raise and rotate the beating heart within the chest cavity and maintain the position by suturing the pericardium to the periphery of the incision . in the preferred embodiment , minimally invasive access to the beating heart is achieved by a thoracotomy , which is usually created in the left side of the chest by a vertical incision between the ribs , insertion of a retractor between the ribs , followed by spreading of the ribs and securing the retractor in an open position to provide access to the source artery and the target coronary artery . the use of the pericardium to position the beating heart as described above is particularly advantageous when the less invasive thoracotomy is used to provide access to the heart . an incision is created in the pericardium which is then sutured to the periphery of the thoracotomy . in this configuration , the pericardium acts as a restraining sac to keep the beating heart in a desired orientation to achieve the anastomosis . the means for stabilizing the beating heart is introduced through the opening created by the thoracotomy and is brought into contact with the heart . the surgeon applies a stabilizing force to the heart via the stabilizing means which may then be fixed in place by attachment to a fixed support . when the rib retractor or platform is fixed in an open position to expose the heart , the retractor platform may also provide an advantageous stable support structure to which the stabilizing means may be affixed . when the position of the stabilizing means is fixed by attachment to a stable support or to the retractor platform , the stabilizing force is maintained for the duration of the procedure . although the particular source and target artery of the anastomosis are determined clinically , common minimally invasive bypass procedure on the beating heart comprises an anastomosis which forms a connection between the left internal mammary artery ( lima ) as the source artery and the left anterior descending artery ( lad ) as the target artery . the lima to lad anastomosis is used as an example herein but it is readily appreciated that the techniques and instruments described herein may be applied to other procedures depending on the clinical diagnosis . to complete the anastomosis , the surgeon must dissect a portion of the lima by separating it from the internal chest cavity . once dissection of the lima is achieved , the surgeon may attach the dissected lima to the target cardiac artery , in this example , the lad . in this example , the stabilizing means of this invention would be used to stabilize the beating heart during at least the portion of the procedure during which the surgeon completes the anastomosis to the lad . the structure of the portion of the stabilizing means which contacts the heart includes an inflatable member , a platform which may be substantially planar or which may be contoured to fit conformingly on the surface of the heart , one or more contact members which exert a stabilizing force on the heart proximate to the site of the anastomosis , a pair of contact members which may be plates or rectangular members which are placed on either side of the target coronary artery at the site of the anastomosis and which may have a friction or tissue spreading means associated therewith . the stabilizing means may also include a shaft means having several alternative embodiments to facilitate adjusting the position and orientation of the instrument . for example , the shaft means may have an adjustable length and the axis of the shaft means may have at least one ball joint disposed within its length such that the orientation of the shaft means relative to another structure such as the contact members on the retractor may be continuously varied . as is apparent from the description of the several embodiments , each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope of the invention . referring to fig1 a stabilizing means is comprised of one or more , and preferably two , contact members 1 , which are attached to a rigid , or semi - rigid connecting shaft 2 which is in turn connected to shaft means 3 . the contact members 1 may be substantially planar or may be slightly curved to conform to the shape of the heart . the contact members 1 may have any of several alternate shapes including cylindrical members formed into a u - shape or may comprise a pair of substantially parallel members spaced apart in a parallel configuration such that a target artery can be positioned between the contact members . the shape of the contact members may be varied depending on the clinical assessment by the surgeon , the design of the other features of the stabilizing means , or the design of other instruments used to complete the anastomosis . in some embodiments , as described herein , the . contact members 1 may have apertures , openings or attachments to facilitate connection with sutures or other devices to achieve the requisite stabilization . in a preferred embodiment , a pair of substantially planar rectangular contact members 1 are attached at one end to a continuous connecting shaft 2 and are oriented in a substantially parallel fashion such that a target cardiac artery is positioned therebetween and passes along the length of the contact members 1 when the stabilizing means engages the heart . see fig9 a - c . while the contact members 1 may each be connected to the connecting shaft 2 at one end , with the connecting shaft 2 operably attached to shaft means 3 , the configuration of the connecting shaft 2 relative to the contact members 1 may be altered depending on the configuration of the contact members 1 and the clinical aspects of the procedure . for example , the connecting shaft may be continuous to connect with the contact members 1 without touching the artery or may include an additional member which may be operated to contact the target artery positioned between the contact members 1 , see fig8 to occlude the passage of blood through the target artery . the contact members 1 , connecting shaft 2 and shaft means 3 may be composed of any non - toxic material such as a biocompatible plastic or stainless steel , having sufficient tensile strength to withstand a stabilizing force exerted on the heart via manipulation of the shaft means 3 to cause the contact members 1 to exert a stabilizing force on the beating heart . the shaft means 3 may be a simple rigid post or may be comprised of a multi - component system designed to be adjustable in length and orientation at least one point along its length . thus , the length of the shaft means 3 and the orientation of the contact members 1 at the distal ( lower ) end of the shaft means 3 can be altered by the surgeon . preferably , the length and orientation at the shaft means 3 relative to the contact members 1 can be adjusted by controls located at the proximate ( upper ) end of shaft means 3 . this design provides the advantage that the surgeon can introduce the stabilizing means to the beating heart by placing the contact members 1 on the surface of the heart , exerting a stabilizing force , and then locking the contact members 1 in place relative to the shaft means 3 . furthermore , the surgeon may then lock the shaft means 3 into a fixed position by attachment to a stable support such as the retractor , thereby maintaining the stabilizing force for the duration of the procedure . in one embodiment , the shaft means 3 has a housing 11 whose overall length is adjustable by a telescoping release 4 operated by an annular thumbscrew 10 which tightens about the housing 11 . the position and orientation of the contact members 1 relative to the shaft means 3 is adjustable by virtue of a locking ball joint 5 which is interposed between the connecting shaft 2 and which is located at the distal end of shaft means 3 . the locking ball joint 5 allows the position of the shaft means 3 to be positioned with three degrees of freedom relative to the contact members 1 . referring again to fig1 a locking ball joint 5 is provided by including a block 6 within the shaft means 3 which conformingly contacts the ball joint 5 and fixes the position of the ball joint 5 . block 6 is compressed against ball joint 5 when a threaded push block 7 is connected to a long allen 9 is actuated by means such as a thumbscrew 8 at the upper end of the shaft means 3 . in operation , a rotation of the top thumbscrew 8 loosens the lower ball joint 5 to allow continuous positioning of the shaft means 3 relative to the contact members 1 , and a counterrotation locks the ball joint 5 into place , fixing the position of the contact members 1 relative to shaft means 3 . the upper end of shaft means 3 may also have associated therewith an upper ball joint 13 such that the shaft means 3 can be oriented with three degrees of freedom relative to a fixed support such as a retractor . the position and orientation of the shaft means 3 may thus be fixed relative to the stable support by a locking latch 14 or other conventional mechanism which prevents movement of the upper ball joint . either the shaft means 3 or the retractor may contain the locking latch 14 surrounding the upper ball joint 13 or any like fixture to firmly attach the shaft means 3 to a stable support , e . g ., an anchor portion 15 extending from the retractor ( not shown ). referring to fig1 b , the contact members 1 preferably have friction means 4 associated with their bottom surface 5 such that the contact members 1 more securely engage the beating heart when a stabilizing force is exerted on the shaft means 3 . the friction means 4 preferably comprises a textured surface covering the bottom surface 5 of the contact member 1 , and may be comprised of several bio - compatible substances such as a textured rubber , textured or ridged aluminum , stainless steel or the like . as noted above , at the upper end of the shaft means 3 , the shaft means 3 may be attached to a fixed support , such as by anchor portion 15 , which may be any surface or structure which does not move with the beating heart . for example , the shaft means 3 may be attached to a fixture on the retractor system used to spread the ribs for access to the heart or may be attached to a fixed structure such as the surgical table or associate aperture which is not connected to the patient . in a preferred embodiment , the shaft means 3 is directly attached to a component of the retractor system which is designed to receive the shaft means 3 and to maintain the position and orientation of the shaft means 3 during the procedure . the shaft means 3 may also be attached , to or comprised of , a conformable arm which is used to position the stabilizing means against the heart and then to lock the stabilizing means in place once a stabilizing force has been exerted . the conformable arm is flexible and lockable and may have several configurations including a plurality of links , segments , or universal joints in serial configuration and having a cable fixture passed through the interior of the links which cause the entire conformable arm to become rigid by tightening the cable fixture . also , the conformable arm may be comprised of a synthetic gel or polymer contained within a conformable cylindrical housing and which becomes rigid upon exposure to light or heat , such as the commercially available dymax 183 - m . where the shaft means 3 is further comprised of the conformable arm , the conformable arm may be attached directly to the connecting shaft 2 or the contact members 1 . referring to fig2 the stabilizer - means may also be comprised of a single shaft means 3 connected to each contact member 1 . in a preferred embodiment , the shaft means 3 are interconnected at an intermediate pivot point 16 which permits the contact members 1 to be continuously positioned in parallel fashion relative to one another . the proximate ( upper ) portion of the individual shaft means 3 may have grips adapted to be grasped by the hand or may have an anchor portion 15 for attachment to a retractor or other fixed support . as with the other embodiments described herein , the length of the shaft means 3 may be adjustable by a conventional telescope configuration . in such a configuration , a first shaft 18 has a partially hollow segment 17 adapted to receive the complimentary portion of the second shaft 19 . either first 18 or second 19 shafts may be connected to the contact members 1 and may each have a conventional locking mechanism ( not shown ). the shaft means may also have a tensioning spring mechanism having an axis 21 which is displaced between a portion of the shaft means 3 affixed to the contact members 1 and the remainder of the shaft means 3 . in this configuration , the contact members 1 remain tensioned against the heart proximate to the anastomosis site when the proximal end of the shaft means 3 is affixed to a stable support . the shaft means may also comprise an interlocking mechanism 18 to fix the position of a single shaft 18 relative to the other . this embodiment also preferably has a friction means 4 as described above attached to each contact member 1 . an additional advantage of this embodiment is derived from the capability to move the contact members 1 apart from one , another in a parallel configuration . thus , the contact members 1 can first be positioned to engage the surface of the heart tissue , followed by the application of a stabilizing force in combination with spreading of the proximate ( upper ) end of the shaft means 3 . application of a stabilizing force causes the tissue on either side of the target artery to be stabilized . by coincidentally spreading the proximate portion of the shaft means 3 , the tissue engaged by the contact members 1 is stretched to provide stabilization and improved exposure of the target coronary artery . referring to fig3 the contact members 1 may be further comprised of a spring - tensioned frame 21 having a movable frame extension 22 which may have pins or an associated friction means 4 to engage the tissue proximate to the target artery . the movement of the frame extension 22 is tensioned by a spring means 23 which draws the frame extension 22 toward the contact member 1 after the frame extension 22 has been manually positioned to engage the tissue . the use of this embodiment of the invention is the same as is described for the other embodiments herein , with the frame extension 22 providing improved exposure of the target artery . as with the other embodiments of the invention disclosed herein , the contact members 1 may be attached at one end by a connecting shaft 2 which is attached to a shaft means 3 as described above . the connecting shafts 2 may also be positioned relative to one another by a conventional threaded post 24 with a positioning thumbscrew 25 . referring to fig4 this embodiment of the stabilizing means is comprised of an elongated sheath member 26 which wraps around the heart in a strap - like fashion to restrict the motion of the heart . this embodiment is particularly useful when access to the beating heart is provided by a sternotomy . the sheath member 26 is positioned to surround the heart and manipulated so that each end of the sheath member 26 extends out of the chest cavity through a the stemotomy . if desired , at least one end of each sheath member 26 is attached to the retractor to secure the position of the sheath member 26 . the sheath member 26 may have a plurality of support attachments 27 which engage the exterior of the heart to hold it in place . at the point where the support attachments 27 contact the surface of the heart , the support attachments 27 may have friction means 4 attached to the surface which is in direct contact with the heart . the support attachments 27 may have or be comprised of inflatable members 28 which cushion the heart against the sheath member 26 , and absorb the motion of the heart while it is stabilized . where the sheath member 26 has a plurality of inflatable members 28 , the sheath member 26 is preferably further comprised of at least one lumen 29 for introduction of air or a biocompatible fluid to the inflatable members 28 , which may be inflated separately or simultaneously . in the former instance , a separate lumen 29 is provided for each inflatable member 28 . the insertion of the sheath member 26 into the chest cavity should be performed while the inflatable members 28 are deflated and is achieved manually or by a conventional guide and / or guidewire . each of the support attachments 27 may be permanently attached to the sheath member 26 or may slide along the length of the sheath member 26 . alternatively , alone or in combination with at least one other inflatable member 28 , an inflatable member 28 may be positioned immediately proximate to the target coronary artery to achieve a more localized stabilization . the inflatable member 28 is positioned to lie next to , or may surround , the target coronary artery and may have openings or apertures placed in the body of the member through which surgical procedures are performed . referring to fig5 the stabilizer means may comprise at least one stabilizer plate which is attached to a stable support and which may be used with a lever member for improving exposure at the target artery while the anastomosis is completed . in this embodiment , the means for stabilizing the beating heart comprises a left and right stabilizing plate 30 , 31 which are oriented to exert a downward force on the tissue at either side of the target artery at the anastomosis site and which may be substantially planar or may be curved to conform to the surface of the heart . one or both of the stabilizing plates 30 , 31 may have an edge 27 deflected downward along its length so that the edge 27 depresses the tissue proximate to the artery to increase the exposure of the artery during the completion of anastomosis . preferably , the edge 27 of the stabilizing plates 30 , 31 has a separate lever member 33 running substantially parallel to the artery and on both sides thereof . the top portion of each lever member 33 contacts the underside of the stabilizing plates 30 , 31 . in this embodiment , the lever member 33 is substantially cylindrical , traverses the stabilizing plate along its length , and is oriented to be parallel to the edge 27 of the stabilizing plate 30 , 31 . the lever member 33 is fixed in place , and may be affixed to the heart by a suture . in such a configuration , each of the stabilizing plates 30 , 31 , which is in contact with the lever member 33 along its length , contacts the heart such that the edge 27 depresses the tissue on both sides of the target coronary to restrict the movement of the beating heart . the stabilizing plates 30 , 31 can be attached to one another or can move independently as desired . opposite the edge 32 , at a point separate from the lever member 33 , the stabilizing 30 , 31 plate is connected to a shaft means 3 which holds the stabilizing plate 30 , 31 in position and which may be manipulated relative to the lever member 33 to cause the edge 27 to engage the heart . the shaft means 3 is preferably affixed to each stabilizing plate 30 , 31 at a point opposite the edge 27 and removed from the point where the lever member 33 contacts the stabilizer plate 30 , 31 at a location to maximize leverage when the stabilizer plates 30 , - 31 are drawn upwards at the point of attachment of the shaft means 3 . the shaft means 3 may be constructed as described elsewhere herein and should be of sufficient length to facilitate manipulation of the shaft means 3 by the surgeon . as noted , the shaft means may also be attached to the retractor to fix movement of the stabilizing plates 30 , 31 during the procedure . in a preferred embodiment , the length of the shaft means 3 is adjustable relative to the retractor or other stable support . for example , the shaft means 3 may be telescopic as described above or may be comprised of a hollow post 34 which receives a rigid shaft 35 which is in turn fixed to the retractor . the rigid shaft 35 may also be substantially hollow and may have a suture or other line 36 passed therethrough and which also passes through the length of the hollow post 34 . in this configuration , one end of the suture or line 36 is attached to the stabilizing plate 30 , 31 and the other end extends through the hollow post 34 or the rigid shaft 35 to a position where it may be manipulated by the surgeon . the position of the stabilizing plate 30 , 31 may thereby be remotely actuated . by drawing tension on the suture or line 36 , the stabilizing plate 30 , 31 pivots about the lever member 33 and the edge 32 of the stabilizer plates 30 , 31 depress the tissue on either side of the target artery . referring to fig6 this embodiment of the invention is a means for stabilizing the beating heart wherein the shaft means is comprised of a flexible , lockable arm 37 having a plurality of interconnecting links 38 which allow positioning of the flexible arm 37 in every direction until the desired configuration is achieved at which point the flexible arm 37 may be locked into fixed configuration by tightening a cable fixture ( not shown ) attached to a cable 39 running axially through the interconnecting links 38 . each interconnecting link is comprised of a ball portion 38 a and a receiving portion 38 b such that the ball portion 38 fits conformingly within the receiving portion 38 b . the proximate ( uppermost ) end of the flexible , lockable arm 37 can be attached to a stable support , or to the retractor . in a preferred embodiment , the flexible , lockable arm 37 is a series of interconnecting links 38 having a cable 39 running through the center of each interconnecting link 38 such that when tension is exerted on the cable 39 , the flexible , lockable arm 37 is fixed in a rigid position . fig6 also shows an embodiment of the invention wherein the contact members 1 are comprised of a pair of substantially parallel elements 1 a , 1 b which are positioned to receive a simple snap fixture 40 which is affixed to the surface of the heart . in this embodiment , the snap fixture 40 is positioned between the two parallel elements 1 a , 1 b of the contact member 1 , in order to fix the position of the heart tissue relative to the contact members 1 . as in the above embodiment , the contact members 1 are preferably oriented in a substantially parallel fashion with the target artery of the anastomosis passing therebetween . the snap fixtures 40 are affixed to the heart by a suture , wherein the suture line 41 may then also be attached to the contact member 1 via a notch , which may form a one - way locking mechanism to secure the suture line 41 , or may be attached to a circular . post disposed in the body of the contact member 1 . the suture line 41 then may be tied through the notch or to the post in the contact member 1 to more tightly secure the heart to the contact member 1 . an additional advantage of this embodiment is that the stabilizing means is actually affixed to the cardiac tissue via the suture line 41 , such that when the heart is moving laterally or downward the artery being stabilized remains immobile . referring to fig7 a stabilizing means 60 is comprised of a substantially planar and substantially rigid surface 62 having a centrally disposed opening 61 in which the target artery of the anastomosis is positioned longitudinally through the opening . at either or both ends of the centrally disposed opening 61 , an occluder 63 extends below the surface 62 and engages the target artery to substantially reduce or eliminate the flow of blood through the artery . the occluder is a rigid member having a smooth outer surface for contacting and depressing the target artery without damaging the tissue . the planar surface 62 of the stabilizing means also has an aperture 64 comprising an opening which traverses the entire planar surface 62 so that the anastomosis can be passed through the aperture 64 when the anastomosis is completed . the planar surface 62 may also provide a mounting surface for springed tissue retractors 65 comprising a coiled spring 66 attached to the planar surface at one end and having a hook or pin 67 at the opposite end to engage and spread the tissue proximate to the anastomosis site to improve the exposure of the target artery . the planar surface 62 is attached to a post 69 which may be attached to a stable support such as the rib retractor as shown in fig9 b . the planar surface 62 may also have at least one port 70 for receiving a suture line . referring to fig8 the stabilizing means may have operably associated therewith an artery occluder 42 , which is preferably attached to the contact members 1 or to the connecting shaft 2 . the artery occluder 42 may comprise a semi - rigid member which has a blunt portion 43 , which may be positioned such that the blunt portion 43 engages the target artery 55 and compresses the target artery 55 to a point causing occlusion of the target artery 55 passing between the contact members 1 such that the blood flow through the artery is substantially reduced or eliminated . preferably , the occluder 42 has a shaft portion 44 which traverses the connection shaft 2 such that the blunt portion 43 of the occluder 43 may move from above the level of the target artery 55 to a point sufficient to occlude the blood flow . referring to fig9 a , the means for stabilizing the beating heart 54 of the invention is shown in use together with a rib retractor 50 and additional apparatus 51 , 52 which may be used during the beating heart cabg procedure . in use , the blades 53 of the retractor separate the ribs , thereby providing an access space for the introduction of surgical instruments , including the stabilizing means 54 of the invention . the stabilizing means 54 is thus brought into contact with the heart such that the contact members are proximate to the target artery 55 . once the stabilizing force has been exerted , sufficient to minimize the motion of the beating heart , the stabilizing means 54 is fixed in place , preferably by attachment to the rib retractor 50 . referring to fig9 b , the stabilizing means 54 is an embodiment substantially as described above and shown in fig1 which is comprised of a pair of rectangular , substantially planar contact members 1 which are placed proximate to a target artery 55 . the shaft means 3 is conformable such that it may be conveniently attached to the rib retractor 50 . as shown in fig9 b , the surgeon may readily adjust the orientation and positioning of the contact members 1 relative to the shaft means 3 while the stabilizing means 54 is in continuous contact with the heart by manipulating the thumbscrew 8 at the proximal end of the instrument . [ 0050 ] fig9 c shows a later stage of the procedure at a point where the anastomosis is being completed by suturing at target artery 55 . the stabilizing means 54 thus maintains a stabilizing force at the anastomosis site for the duration of the procedure . referring to fig1 , as noted above , attachment to a rib retractor is a preferred technique for fixing the position and orientation of the stabilizing means . the stabilizing means of the invention may therefore advantageously attached to a fixture attached to a rib retractor 50 or may be configured to be directly incorporated into the body of a portion of the rib retractor 50 . a surgical rib retractor 50 is generally comprised of a body 54 having blades 53 attached thereto , which engage the ribs and spread the ribs when the retractor 50 is operated to move the blades 53 apart from one another . the space created by the retracted blades 53 provides access to the heart . thus , once the retractor 50 is locked into the open position , the stabilizing means may be applied to the heart and a stabilizing force maintained at the site of the anastomosis by fixing the position and orientation of the shaft means 3 relative to the rib retractor 50 . referring to fig1 , the shaft means 3 traverses the width of the body 54 of the retractor 50 and is held in place by an upper plate 57 and a lower plate 58 having circular openings 59 therein through which the shaft means 3 passes and which maintain the position 6 f a sphere 56 positioned between the upper plate 57 and lower plate 58 . the size of the openings 59 is larger than the diameter of the shaft means 3 but smaller than the largest diameter of the sphere 56 . thus , the shaft means 3 passes through the sphere 56 and may pivot about a point approximately at the center of the sphere 56 . referring to fig1 and 12 , because the available access and working space for the surgeon may be limited , certain embodiments of the invention may be contained substantially within the chest cavity . preferably , the stabilizing means is connected to the bottom of the rib retractor 50 on each side of the opening created by spreading the ribs using the rib retractor 50 . referring to fig1 , rib retractor 50 is shown in an open position whereby blades 53 engage and spread the ribs . a pair of stabilizing bars 72 having a conventional ratchet means 73 attached at the end thereof are positioned beneath the retractor . the ratchet means 73 is comprised of a plurality of teeth 74 on the stabilizing bars 72 and a ratcheting aperture 75 permitting one - way passage of the stabilizing bars 72 unless released by a release mechanism . the stablizing bars 72 are curved downward such that as the bars are advanced through the ratchet means 73 , the lowermost portion 76 of the stablizing bars 72 engages the beating heart proximate to the anastomosis site . referring to fig1 , the orientation of the portion of the stabilizing means which engages the heart relative to the rib retractor 50 is similar to the embodiment shown in fig1 . in this embodiment , a contact member 1 is attached on opposite ends to at least two malleable supports 80 which are in turn attached to the rib retractor 50 . the malleable supports 80 are preferably made of stainless steel bands which are woven in a mesh or have a repeating serpentine configuration to allow for substantial expansion within the chest cavity . this configuration yields a malleable support 80 with sufficient tensile strength to maintain a stabilizing force at the anastomosis site while allowing the surgeon to manipulate the malleable supports within the chest cavity to achieve the desired orientation relative to the beating heart . the particular examples set forth herein are instructional and should not be interpreted as limitations on the applications to which those of ordinary skill are able to apply this invention . modifications and other uses are available to those skilled in the art which are encompassed within the spirit and scope of the following claims . | 0 |
the present invention will now be described more fully with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure is thorough and complete and fully conveys the concept of the invention to those skilled in the art . hereafter , the embodiments of the present invention shall be described in detail with the accompanying drawings . according to the embodiments of the present invention , there is provided a phase - change memory element where the first electrode used as a heating layer and the second electrode which is opposite to the first electrode are formed with layers of the same height , and a memory layer which is formed by a phase - change material placed between the side surface of the first and second electrodes which face each other . for such a phase - change memory element , the contact surface between the first electrode used as a heating layer and the memory layer is dependent on the side width of the first electrode , while , the area of the side surface of the first electrode is determined by the width and the thickness of the first electrode , which will be formed during a patterning process . accordingly , despite of the limitation of the patterning process , the contact surface of the first electrode could be formed with a very small with the aid of actually the thickness of the first electrode . the thin thickness of the first electrode can be realized during a deposition process beyond the limitation of the patterning process . therefore , the volume of a phase - change region which is dependent on the contact surface can be very small , and accordingly a phase - change memory element operation using a low current is possible . now , the phase - change memory element and a method of manufacturing the same shall be described in detail according to the preferred embodiments of the invention . fig1 a through 7b are general views of a phase - change memory element and the method of manufacturing the same according to the first embodiment of the present invention . fig1 a is a plan view showing the step of forming the first electrode pad 20 and the second electrode pad 30 on a first insulating layer 10 , and fig1 b is a cross sectional view according to a cutting - plane line 1 – 1 ′ of fig1 a . referring to fig1 a and 1b , the first insulating layer 10 is mounted on a semiconductor substrate ( not shown ) where a transistor element or diode element constituting a circuit for an addressing or memory operation . the integration of a transistor or diode on a semiconductor substrate for the operation of a phase - change memory element can be realized by a known process . a first contact hole through the first insulating layer 10 is formed on the first insulating layer 10 using a photo lithography process in order to form an electrical connection with the circuit . thereafter , a film of a conductive material , for example , a metal or other conductive material is deposited on the first insulating layer 10 and then a first interconnection contact 25 is formed to fill the first contact hole is etched back or flattened . the first connection contact 25 plays the role of an electrical connection between the first electrode and the transistor element . the first interconnection contact 25 can be formed by a semiconductor process known as a plug process , however , it also can be formed by filling the first contact hole with an electrode pad layer in the deposition process of the pad layer followed by . in a case when the first interconnection contact 25 is formed by a known plug process , the electrode pad layer is formed by the deposition of a metal or conductive film on the first connection contact 25 and the first insulating layer 10 . the electrode pad layer can be formed of a different material from or the same material as that of the first interconnecting contact 25 . afterward , by means of patterning the electrode pad layer , the first electrode pad 20 and the second electrode pad 30 , which is opposite to the first electrode pad 20 , are formed . in this way , since the first electrode pad 20 and the second electrode pad 30 are formed in one process , the first electrode pad 20 and the second electrode pad 30 substantially have the same height facing sidely each other . fig2 a is a plan view of an electrode layer 40 and fig2 b is a cross sectional view cut according to a cutting - plane line 2 – 2 ′ of fig2 a . referring to fig2 a and 2 b , an electrode layer 40 is deposited to cover the first electrode pad 20 and the second electrode pad 30 . thereafter , the electrode layer 40 is patterned so that the portion of the electrode layer 40 , which is between the first electrode pad 20 and the second electrode layer pad , has narrower width than the width of the first electrode pad 20 or the second electrode pad 30 . this electrode layer 40 can work as a diffusion barrier layer , and can also be used as a heating layer for heating the phase - change material so as to cause phase change or transformation . particularly , the portion deposited on the first electrode pad 20 works as the heating layer . the electrode layer 40 is formed of a conductive film , such as titanium aluminium nitride ( tialn ), titanium silicon nitride ( tisin ), or titanium carbon nitride ( ticn ). meanwhile , as shown in fig2 a , it is preferable that patterning is performed such that the width of the electrode layer 40 between the first electrode pad 20 and the second electrode pad 30 is narrower than the width of the first electrode pad 20 or / and the second electrode pad 30 . it is more preferable that the width sided to the first electrode pad 20 is narrower than that of the second electrode pad 30 side , since the electrode layer 40 existing above the first electrode pad 20 actually plays as a heating layer . in other words , the purpose of performing the above process is to make the volume of the phase change region small enough to confine to the contacting surface between the first electrode , which will be formed of a part of electrode layer 40 , and the phase change material by allowing more current to concentrate onto the portion of the electrode layer 40 covering the first electrode pad 20 than the contacting surface of the phase change layer , that is , the memory layer . fig3 a is a plan view explaining the step of dividing the electrode layer 40 and fig3 b is across sectional view according to the cutting plane line 3 – 3 ′ of fig3 a . referring to fig3 a and 3b , a second insulating layer 50 is formed on the electrode layer 40 , and a second contact hole 55 is formed on the electrode layer 40 using the photolithography process . the second contact hole 55 is formed to expose a portion of the first insulating layer 10 between the first electrode pad 20 and the second electrode pad 30 so as to separate the electrode layer 400 in fig2 a into the first electrode 41 located on the first electrode pad 20 and the second electrode 45 located on the second electrode pad 30 . for complete separation , the width of the second contact hole 55 is formed wider than the electrode layer 40 portion between the first electrode pad 20 and the second electrode pad 30 . here , as shown in fig3 a , a side surface of the first electrode 41 is exposed as a portion of side wall of the second contact hole 55 . the side surface of the narrow width portion 43 of the first electrode pad 20 side of the electrode layer 40 is exposed the side wall of the second contact hole 55 . while the material used for the second insulating layer 50 mentioned above , it is preferable to be formed of a silicon oxide layer ( sio 2 ), which has good coherence , for semiconductor manufacturing process , and in order to obtain a higher thermal insulating characteristic , a low thermal conductivity material such as bpsg , could be used . fig4 is a cross - sectional view showing the step of depositing of a memory layer 60 between the first electrode 41 and the second electrode 45 . referring to fig4 , a memory layer 60 is formed in the second contact hole 55 by depositing a phase - change material so as to contact the first electrode 41 and the second electrode 45 which are exposed to the second contact hole 55 . as shown in fig4 , the memory layer 60 could be deposited as a liner form without completely filling the second contact hole 55 . a chalcogenide alloy , for example , an alloy of ge — sb — te which is widely used for phase change material , could be used as a material for the memory layer 60 . fig5 a is a plan view showing the step of patterning the memory layer pattern 65 and fig5 b is a cross sectional view according to the cutting - plane line 5 – 5 ′ of fig5 a . referring to fig5 a and 5b , the deposited memory layer 60 is extended over the second insulating layer 50 according to the characteristics of deposition ; however , the patterning is performed to form a memory layer pattern 65 by a selective removal of such extended portion . for example , the memory layer 60 is etched back or cmp ( chemical mechanical polishing ) to form the memory layer pattern 65 as a ring shape on the side wall of the second contact hole 55 as shown in fig5 a . also , such patterning may be performed by a photolithography process . patterning by a combination of the cmp and photolithography processes enhances the uniformity of the shape of the memory layer pattern 65 . fig6 is a cross - sectional view showing the step of forming a third insulating layer 70 on the memory pattern 65 . as shown in fig6 , the third insulating layer 70 , which is formed of a silicon oxide layer , is formed on the second insulating layer 50 . fig7 a is a plan view showing the step of forming an upper electrical line 80 connected to the second electrode 45 , and fig7 b is a cross sectional view according to cutting - plane line 7 – 7 ′ of fig7 a . referring to fig7 a and 7b , through the third insulating layer 70 , a third contact hole 83 is formed to expose the second electrode 45 selectively , and then an electric line layer filling the third contact hole 83 is deposited . thereafter , the upper electric line 80 is connected electrically with the second electrode 45 through a second connecting contact 81 which is a portion filling the third contact hole 83 . here , the upper electric line 80 can be made of a conductive metal layer , such as aluminum ( al ) or titanium tungsten ( tiw ). as foregoing descriptions , a phase - change memory element can be formed by the process and steps according to the preferred embodiments of the present invention as suggested in fig7 a and 7b , since the first electrode 41 and the second electrode 45 are formed with the same layer . a phase - change layer , that is , a memory layer pattern 65 , which is located between the first electrode 41 and the second electrode 45 , contacts a side surface of the relatively narrow width of the first electrode which is exposing to the side wall of the second contact hole 55 . accordingly , the contacting surface between the memory layer pattern 65 and the first electrode 41 is confined to the side surface of the narrow width of the first electrode 41 . because the first electrode 41 is actually used as a heating layer , the operation volume is substantially confined to the portion of the memory layer pattern 65 adjoining the side surface of the narrow width portion 43 of the first electrode 41 . the width of the narrow width portion 43 of the first electrode 41 is dependent on the photolithography process but the thickness substantially is dependent on the thickness of the deposition of the electrode layer 40 which is for the first electrode 41 . at present time , the photolithography process has a limitation in patterning ; however , the layer thickness by deposition can be achieved far beyond the limitation of the photolithography process , and has enabled the obtaining further thinner and better in uniformity . in other words , it is possible to control the thickness of the thin film much thinner than the width of the first electrode layer , and to achieve a higher uniformity . therefore , the contacting surface of the memory layer pattern 65 with the narrow width portion 43 of the first electrode 41 can be very small and be controlled with very high uniformity . fig8 a and 8b are the general views of a phase - change memory element and manufacturing method thereof according to the second embodiment of the present invention . referring to fig8 a and 8b , as explained in fig3 a and 3b according to the first embodiment , after separation of the first electrode 41 and the second electrode 45 is performed by the installation of the second contact hole 55 , the memory layer can be formed by filling the second contact hole 55 . then , after flattening the upper surface of the memory layer using cmp process so as to expose the upper surface of the second insulating layer , a memory layer patterning 67 can be formed to completely fill the second contact hole 55 . besides above , there are various ways of forming a phase - change region , for example , patterning using the photolithography process after deposition of phase - change material , and the like . however , in all cases , the actual volume of a phase - change region is confined to the contact surface with the cross - section of the first electrode 41 . according to the embodiments of the present invention , in order to have very small volume of phase change region during operation , the phase change region can be confined to the contacting surface of the memory layer with the side surface of the first electrode which is used for heating layer . since the area of the side surface of the first electrode depends on the thickness of the layer of the first electrode , it is possible to control the volume of a phase - change region in accordance with the thickness of the first electrode . the thickness of a thin film can be controlled smaller size than the width formed by the photolithography process , and the thickness can be controlled with a higher uniformity . as a consequence , it is possible to manufacture a phase - change memory element capable of low power operation , and , especially , to manufacture a semiconductor substrate or wafer which has uniform characteristics as a whole . also , it is possible to minimize the number of masks required in the manufacturing process , thereby decreasing process costs , and it enables manufacture of a high integrated memory device . this invention may , however , be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure is thorough and complete and fully conveys the concept of the invention to those skilled in the art . | 7 |
hereinafter , a semiconductor device according to a first embodiment is described with reference to fig1 . as illustrated in fig1 , a semiconductor device 1 according to the first embodiment has a circuit board 2 . a semiconductor chip 3 is mounted on the top surface ( i . e ., a semiconductor chip mounting surface ) of the circuit board 2 . two connection pads 4 are formed on both sides of the semiconductor chip 3 . a solder ball 5 is mounted on each connection pad 4 . a molding resin layer 7 is formed on the top surface of the circuit board 2 so as to cover the semiconductor chip 3 and to upwardly expose the solder balls 5 through vias 6 , respectively . the top surfaces of the solder balls 5 are put into a clean state when a copper support plate ( to be described below ) is removed by etching . thus , there is no resin residue of the molding resin layer 7 . plural connection terminals 8 are formed on the bottom surface of the circuit hoard 2 . a solder ball 9 is mounted on each connection terminal 8 . next , a manufacturing method for the above - mentioned semiconductor device 1 is described hereinafter with reference to fig2 a to 4c . referring to fig2 a to 2i , first , a solder ball mounting portion 11 , on which the solder ball 5 is to be mounted , is formed on a copper support plate 10 ( see fig2 a ). a method for forming the solder ball mounting portion 11 is described in detail with reference to fig3 a to 3d . first , a copper thin plate k is prepared as illustrated in fig3 a , and a photoresist film 12 is formed entirely on the top surface of the copper thin plate k as illustrated in fig3 b . then , the photoresist film 12 is partially covered with a mask to open the part other than a part corresponding to each solder ball mounting portion 11 , and the exposure and development are performed as normal . consequently , as illustrated in fig3 c , only the part of the copper thin plate k , which corresponds to each solder ball mounting portion 11 , is covered with the photoresist film 12 . then , a so - called “ half etching ” is performed by immersing the copper thin plate k in copper etching solution . consequently , the non - covered parts of the copper thin plate k are etched to be thin , while the covered parts of the copper thin plate k corresponding to the solder ball mounting portions 11 are maintained . then , the resist film 12 is peeled . thus , as illustrated in fig3 d , the copper support plate 10 having the solder ball mounting portions 11 is formed from the copper thin plate k . turning back to fig2 b , after the solder ball mounting portions 11 are formed on the copper support plate 10 , a solder ball 5 is mounted on each solder ball mounting portion 11 by performing solder reflowing . then , flip chip mounting is performed on the circuit board 2 ( see fig2 c ), so that semiconductor chips 3 are mounted on the top surface of the circuit board 2 ( see fig2 d ). the copper support plate 10 is faced to the circuit board 2 so that the solder balls 5 respectively abut the connection pads 4 , and solder reflowing is performed to thereby respectively solder - connect the solder balls 5 to the connection pads 4 , as illustrated in fig2 e . then , as illustrated in fig2 f , the space between the mounting surface of the circuit board 2 and the copper support plate 10 is filled with epoxy resin by a so - called transfer molding method . thus , the molding resin layer 7 is formed . thereafter , etching is performed using , e . g ., alkali etchant ( manufactured by meltex incorporated ( trade name is “ a process ”) to selectively remove only the copper support plate 10 ( see fig2 g )). in this state , the vias 6 are formed in the molding resin layer 7 along the shapes of the solder ball mounting portions 11 formed on the copper support plate 10 . further , the top surfaces of the solder balls 5 are brought into a clean state by the etchant when the copper support plate 10 is removed by etching , and there is no resin residue of the molding resin layer 7 . solder reflowing may be additionally performed . then , a solder ball 9 is mounted on each connection terminal 8 formed on the bottom surface of the circuit board 2 , as illustrated in fig2 h . then , the circuit board 2 is cut at positions p illustrated in fig2 i via a blade into individual separated pieces , thereby manufacturing individual separated semiconductor devices 1 . in each semiconductor device 1 , the top portion of the solder hall 5 , which is exposed from each via 6 formed in the molding resin layer 7 , functions as a mounting terminal for connecting other circuit boards and the like . as illustrated in fig4 a to 4c , another package substrate 13 is stacked on the above - mentioned semiconductor device 1 , thereby forming a pop structure . hereinafter , a method for stacking another package substrate 13 on the semiconductor device 1 is described with reference to fig4 a to 4c . as illustrated in fig4 a to 4c , a solder ball 14 is mounted on each connection terminal formed on the bottom surface of the package substrate 13 . first , as illustrated in fig4 a , the solder balls 14 on the package substrate 13 are faced to the solder balls 5 on the semiconductor device 1 , respectively . and , as illustrated in fig4 b , the solder balls 14 are arranged in the vias 6 from which the solder balls 5 are exposed , respectively . thus , the package substrate 13 is pre - stacked on the semiconductor device 1 . then , the solder reflowing is performed so that the solder balls 14 on the package substrate 13 and the solder balls 5 on the semiconductor device 1 are respectively melt - connected to each other , as illustrated in fig4 c . on this occasion , the solder balls 14 on the package substrate 13 can easily be arranged in the respective vias 6 formed in the molding resin layer 7 of the semiconductor device 1 because the inverted - cone - like vias 6 expose the respective solder balls 5 . consequently , the package substrate 13 can be mounted easily and surely on the semiconductor device 1 . according to the first embodiment , when the copper support plate 10 is removed by etching , the top portion of each solder ball 5 , which is exposed from an associated one of the vias 6 formed in the molding resin layer 7 of the semiconductor device 1 , is maintained in a clean state in which no residue of the molding resin layer 7 remains . consequently , the wettability of each solder ball 5 is enhanced . thus , the solder balls 5 and the solder balls 14 are surely connected , respectively , and the electrical connection between the semiconductor device 1 and the package substrate 13 is enhanced . next , a semiconductor device according to a second embodiment is described hereinafter with reference to fig5 to 9c . as illustrated in fig5 , a semiconductor device 21 according to the second embodiment has a circuit board 22 . a semiconductor chip 23 is mounted on the top surface ( i . e ., a semiconductor chip mounting surface ) of the circuit board 22 . two connection pads 24 are formed on both sides of the semiconductor chip 23 . a solder ball 25 is mounted on each connection pad 24 . a molding resin layer 27 is formed on the top surface of the circuit board 22 so as to cover the semiconductor chip 23 and to upwardly expose the solder balls 25 through vias 26 , respectively . a metal plating film m formed by a method to be described below is formed on and covers the top surface of each solder ball 25 exposed from an associated one of the vias 26 formed in the molding resin layer 27 . plural connection terminals 28 are formed on the bottom surface of the circuit board 22 . a solder ball 29 is mounted on each connection terminal 28 . next , a manufacturing method for the above - mentioned semiconductor device 2 is described hereinafter with reference to fig6 a to 8d . referring to fig6 a to 6i , first , a solder ball mounting portion 31 , on which the solder ball 25 is to be mounted , is formed on a copper support plate 30 ( see fig6 a ). the metal plating films m are formed to cover the top surfaces of the solder ball mounting portions 31 , respectively . a method for forming such a solder ball mounting portion 31 , and a method for forming metal plating film m on the solder ball mounting portion 31 are described in detail with reference to fig7 a to 7h . first , a copper thin plate k is prepared as illustrated in fig7 a , and a photoresist film 32 is formed entirely on the top surface of the copper thin plate k as illustrated in fig7 b . then , the photoresist film 32 is partially covered with a mask to open the part other than a part corresponding to each solder ball mounting portion 31 , and the exposure and development are performed as normal . consequently , as illustrated in fig7 c , only the part of the copper thin plate k , which corresponds to each solder ball mounting portion 31 , is covered with the photoresist film 32 . then , a so - called “ half etching ” is performed by immersing the copper thin plate k in copper etching solution . consequently , the non - covered parts of the copper thin plate k are etched to be thin , while the covered parts of the copper thin plate k corresponding to the solder ball mounting portions 31 are maintained . then , the resist film 32 is peeled . thus , as illustrated in fig7 d , the copper support plate 30 having the solder ball mounting portions 31 is formed from the copper thin plate k . next , as illustrated in fig7 e , an electrodeposited resist film 33 prepared from acrylic polymer is formed on the entire surface of the copper support plate 30 . then , the top surface of the copper support plate 30 , on which the solder ball mounting portions 31 are formed , is covered with a mask , and the exposure and development are performed as normal . consequently , as illustrated in fig7 f , an opening 34 is fowled in the electrodeposited resist film 33 correspondingly with the solder ball mounting portions 31 . then , as illustrated in fig7 g , the metal plating film m is formed on each solder hall mounting portion 31 through the opening 34 . the metal plating film m have a four layer structure formed of a gold plating film m 1 , a palladium plating film m 2 . a nickel plating film m 3 . and a palladium plating film m 4 arranged in this order outwardly from the side of the solder ball mounting portion 31 ( see fig8 a to 8d ). in order to form such a metal plating film m , first , the copper support plate 30 , on which the electrodeposited resist film 33 having the opening 34 is formed , is immersed in a gold plating bath for a given time . a plating solution retained in the gold plating bath is made up of 50 grams ( g )/ liter ( l ) of potassium citrate , and 50 g / l of tripotassium citrate . consequently , a first layer formed of a gold plating film m 1 is formed on the solder ball mounting portion 31 . next , the copper support plate 30 with the gold plating film m 1 is immersed in a palladium plating bath for a given time . a plating solution retained in the palladium plating bath is made up of 150 g / l of potassium phosphate , and 15 of pd ( nh 3 ) 4 cl 2 . consequently , a second layer formed of a palladium plating film m 2 is formed on the gold plating film m 1 . next , the copper support plate 30 with the gold plating film m 1 and the palladium plating film m 2 is immersed in a nickel plating bath for a given time . a plating solution retained in the nickel plating bath is made up of 320 g / l of nickel sulphamate . consequently , a third layer formed of a nickel plating film m 3 is formed on the palladium plating film m 2 . finally , the copper support plate 30 with the first layer , i . e ., the gold plating film m 1 , the second layer , i . e ., the palladium plating film m 2 , and the third layer , i . e ., the nickel plating film m 3 is immersed in a palladium plating bath for a given time . a plating solution retained in this palladium plating bath is made up of 150 g / l of potassium phosphate , and 15 g / l of pd ( nh 3 ) 4 cl 2 . consequently , a fourth layer formed of a palladium plating film m 4 is formed on the nickel plating film m 3 . after the metal plating film m configured by the gold plating film m 1 , the palladium plating film m 2 , the nickel plating film m 3 and the palladium plating film m 4 is formed on the solder ball mounting portion 31 , the electrodeposited resist film 33 is removed by etching . thus , the copper support plate 30 in which the metal plating films m are respectively formed on the solder ball mounting portions 31 is obtained , as illustrated in fig7 h . turning back to fig6 b , after the solder ball mounting portions 31 each having the metal plating film m are formed on the copper support plate 30 , a solder ball 25 is mounted on each solder ball mounting portion 31 by performing solder reflowing . in the copper support plate 30 , as shown in fig8 a , the metal plating film m initially has the four layer structure formed of the gold plating film m 1 , the palladium plating film m 2 , the nickel plating film m 3 , and the palladium plating film m 4 arranged from the side of the solder ball mounting portion 31 . and , the solder reflowing is performed by melting the solder balls 25 at a temperature equal to or higher than the melting point , as illustrated in fig8 b . consequently , a solder alloy of the solder ball 25 and the nickel plating film m 3 is formed . the outermost palladium plating film m 4 is formed at the time of reflowing in order not only to prevent the oxidation of the nickel plating film m 3 , but also to contribute to the enhancement of wettability when being melt into the solder alloy . after the solder alloy is formed , the gold plating film m 1 and the palladium plating film m 2 maintain a two layer structure without change , and serves to prevent the oxidation of a nickel alloy . then , flip chip mounting is performed on the circuit board 22 ( see fig6 c ), so that semiconductor chips 23 are mounted on the top surface of the circuit board 22 ( see fig6 d ). the copper support portion 30 is faced to the circuit board 22 so that the solder balls 25 respectively abut the connection pads 24 , and solder reflowing is performed to thereby respectively solder - connect the solder balls 25 to the connection pads 24 , as illustrated in fig6 e . then , as illustrated in fig6 f , the space between the mounting surface of the circuit board 22 and the copper support plate 30 is filled with epoxy resin by a so - called transfer molding method . thus , the molding resin layer 27 is formed . fig8 c schematically illustrates this state . in fig8 c , illustration of the connection pad 24 is omitted . thereafter , etching is performed using , e . g ., alkali etchant ( manufactured by meltex incorporated ( trade name is “ a process ”) to selectively remove only the copper support plate 30 ( see fig6 g )). at that time , as illustrated in fig8 d , only the copper support plate 30 is removed by etching . the gold plating film m 1 and the palladium plating film m 2 that are formed on the solder ball mounting portion 31 maintain the two layer structure and remain at the side of the solder ball 25 so that the outer surfaces of the gold plating film m 1 are respectively exposed from the vias 26 formed in the molding resin layer 27 . when the copper support plate 30 is removed by etching , the surface of each gold plating film m 1 is put into a clean state by etchant . thus , there is no resin residue of the molding resin layer 27 . also in fig8 d , illustration of the connection pad 24 is omitted . solder reflowing may be additionally performed . then , a solder ball 29 may be mounted on each connection terminal 28 formed on the bottom surface of the circuit board 22 , as illustrated in fig6 h . then , the circuit board 22 is cut at positions p illustrated in fig6 i via a blade into individual separated pieces , thereby manufacturing individual separated semiconductor devices 21 . in each semiconductor device 21 , the gold plating film m 1 exposed from each via 26 formed in the molding resin layer 27 functions as a mounting terminal for connecting other circuit boards and the like . as illustrated in fig9 a to 9c , another package substrate 33 is stacked on the above - mentioned semiconductor device 21 , thereby forming a pop structure . hereinafter , a method for stacking another package substrate 33 on the semiconductor device 21 is described with reference to fig9 a to 9c . as illustrated in fig9 a to 9c , a solder ball 34 is mounted on each connection terminal formed on the bottom surface of the package substrate 33 . first , as illustrated in fig9 a , the solder balls 34 on the package substrate 33 are faced to the gold plating films m 1 on the semiconductor device 21 , respectively . and , as illustrated in fig9 b the solder balls 34 are arranged in the vias 26 from which the gold plating films m 1 formed on the top surfaces of the solder balls 25 are exposed . thus , the package substrate 33 is pre - stacked on the semiconductor device 21 . then , the solder reflowing is performed so that the solder balls 34 on the package substrate 33 and the solder balls 25 on the semiconductor device 21 are respectively melt - connected to each other with the gold plating film m 1 and the nickel plating film m 2 , as illustrated in fig9 c . on this occasion , the solder balls 34 on the package substrate 33 can easily be arranged in the respective vias 26 formed in the molding resin layer 27 of the semiconductor device 21 because the inverted - cone - like vias 26 expose the respective solder balls 25 . consequently , the package substrate 33 can be mounted easily and surely on the semiconductor device 21 . according to the second embodiment , the metal plating film m having at least three layers of the gold plating film m 1 , the nickel plating film m 2 , and the palladium plating film m 3 are formed on the solder ball mounting portions 31 . in addition , after the copper support plate 30 is removed by etching , the metal plating films m remain at the side of the solder balls 25 . the nickel plating film m 2 and the gold plating film m 1 formed on the top portion of each solder ball 25 , which is exposed from an associated one of the vias 26 formed in the molding resin layer 27 , is maintained in a clean state in which there is no residue of the molding resin layer 27 , when the copper support plate 30 is subjected to etching . consequently , the wettability of each solder ball 25 is enhanced . thus , the solder balls 25 and the solder balls 34 are surely connected , respectively , and the electrical connection between the semiconductor device 21 and the package substrate 33 is enhanced . the above - described embodiments are not limited to the above - described devices / methods as they are , and various improvements and modifications can be made without departing from the scope of the invention . for example , in the second embodiment , the metal plating films m ( each having the four layer structure formed of the gold plating film m 1 , the palladium plating film m 2 , the nickel plating film m 3 , and the palladium plating film m 4 ) are respectively formed on the solder ball mounting portions 31 of the copper support plate 30 . after the solder balls 25 are connected to the metal plating films m by solder reflowing ( see fig6 a and 6b ), the solder balls 25 are connected to the connection pads 24 on the circuit board 22 ( see fig6 e ). however , the manufacturing method according to the invention is not limited thereto . the method illustrated in fig1 a to 10i can be employed . as illustrated in fig1 a to 10i , the metal plating films m ( each having the four layer structure formed of the gold plating film m 1 , the palladium plating film m 2 , the nickel plating film m 3 , and the palladium plating film m 4 ) are respectively formed on the solder ball mounting portions 31 of the copper support plate 30 ( see fig1 a ). then . each solder ball 25 is mounted on and connected to an associated connection pad 24 formed on the circuit board 22 through solder reflowing ( see fig1 d ). thereafter , each solder ball mounting portion 31 formed on the copper support plate 30 is connected to an associated solder ball 25 by solder reflowing ( see fig1 e ). fig1 a to 11d schematically illustrate the above method . in fig1 a to 11d , illustration of the connection pad 24 is omitted . as illustrated in fig1 a , the metal plating film m formed on the copper support plate 30 initially has the four layer structure formed of the gold plating film m 1 , the palladium plating film m 2 , the nickel plating film m 3 , and the palladium plating film m 4 arranged from the side of the solder ball mounting portion 31 . after the metal plating film m formed on the solder bah mounting portion 31 of the copper support plate 30 is connected to the solder ball 25 formed on the circuit board 22 , as illustrated in fig1 b , the solder ball 25 is melted at a temperature equal to or higher than the melting point and subjected to solder reflowing . thus , a solder alloy of the solder ball 25 , the outermost palladium plating film m 4 , and the next nickel plating film m 3 is formed , while the palladium plating film m 2 and the gold plating film m 1 maintain their structure without change . in addition , according to the so - called transfer molding method , the space between the mounting surface of the circuit board 22 and the copper support plate 30 is tilled with epoxy resin . thus , the molding resin layer 27 is formed ( see fig1 c ). thereafter , etching is performed with alkali etchant to selectively remove only the copper support plate 30 ( fig1 d ). thus , only the copper support plate 30 is removed by etching . the gold plating film m 1 and the palladium plating film m 2 formed on the solder ball mounting portion 31 maintain a two layer structure and remain at the side of the solder ball 25 . a surface of the gold plating film m 1 existing on an outer side of the plating film m is exposed from each via 26 formed in the molding resin layer 27 and put into a clean state by etchant when the copper support plate 30 is removed by etching . thus , there is no residue of the molding resin layer 7 . and , the wettability of each solder ball 25 is enhanced . thus , the solder balls 25 and the solder balls 34 are surely connected , respectively , and the electrical connection between the semiconductor device 21 and the package substrate 33 is enhanced . the semiconductor device 21 and the manufacturing method therefor illustrated in fig1 a to 11d are similar to those according to the second embodiment except the above - mentioned differences . thus , the description of similar respects therebetween is omitted . in the first and second embodiments , the solder balls 9 , 29 are mounted on the connection terminals 8 , 28 formed on the bottom surface of the circuit board 2 , 22 , respectively . however , if the semiconductor devices 1 and 21 are used in a land grid array ( lga ) structure , it is unnecessary that the solder balls 9 and 29 are mounted on the connection terminals 8 and 28 , respectively . according to the first and second embodiments , the semiconductor chips 3 , 23 are mounted on the circuit boards 2 , 22 by flip chip mounting . the cases to which the first and second embodiments can be applied are not limited thereto . the first and second embodiments can be applied to the cases where the semiconductor chip is connected to the circuit hoard by wire bonding , and where the semiconductor device of the so - called chip stack type , in which two semiconductor chips are respectively stacked at upper and lower positions , is configured so that the upper semiconductor chip is mounted on the circuit board by wire bonding , and that the lower semiconductor chip is mounted thereon by flip chip mounting . according to the first and second embodiments , the metal plating film m has the four layer structure formed of the gold plating film m 1 , the palladium plating film m 2 , the nickel plating film m 3 , and the palladium plating film m 4 . the structure of the metal plating film m is not limited thereto . the metal plating film m may have a three layer structure formed of e . g ., a set of a gold plating film , a nickel plating film , and a palladium plating film , or a set of a gold plating film , a palladium plating film , and a gold plating film . according to the first and second embodiments , the metal plating film is formed by plating . however , for example , the metal film may be formed by another method such as sputtering . according to the first and second embodiments , the solder balls 5 , 25 are formed as the mounting terminals on the copper support plate 10 , 30 or on the circuit board 22 ( connection pad 24 ) by solder reflowing . however , instead of the solder balls , mounting terminals may be formed , for example , by printing solder paste on the connection pad 24 . instead of the solder balls 5 , 25 , cu - core solder balls ( solder coated cu balls ) may be used . | 7 |
fig1 is a cross - sectional view of the tensioner . tensioner 100 comprises a pulley 7 which engages a belt ( not shown ) to thereby provide a belt tension or load . pulley 7 is journalled to arm 6 with a bearing 11 . pulley is engaged with the bearing outer race . bearing 1 comprises a ball bearing as shown , but could also comprise a needle bearing or other suitable bearing known in the art . arm 6 is biased by torsion spring 3 thereby urging a pulley 7 into engagement with a belt which applies a tensile load to the belt . torsion spring 3 is operationally disposed between base 1 and arm 6 . arm 6 pivots about shaft 2 . pivotal movement of arm 6 allows the tensioner to compensate for any changes in belt length as the belt stretches over time and as the drive length changes from thermal expansion . arm 6 pivots about a low - friction bushing 10 about shaft 2 . shaft 2 is press fit into base 1 and extends normally from base 1 . eccentric adjuster 8 is also press fit to the end of shaft 2 opposite base 1 . eccentric adjuster 8 is used to rotate the tensioner into proper engagement with the belt during installation . eccentric refers to the center of hole 21 not being coaxial with a center of rotation of pulley 7 or of arm 6 . eccentric adjuster 8 is used to properly load the belt with a predefined tension by compensating for all component and system tolerances . a tool ( not shown ) engages the adjuster at tool receiving portion 82 . it is locked in place once the belt is installed by fully engaging a fastener inserted through a hole 21 , 81 into a mounting surface . to minimize the amount of arm oscillation or movement during operation friction damping is used . excessive arm motion induced by the engine vibration could cause the belt to jump a tooth or “ ratchet ”. tooth jump or ratcheting of the belt causes a loss of synchronization between the driven and driving shaft ( s ) of the belt . wave spring 5 is disposed between damping member 13 and arm 6 . wave spring 5 imparts a normal force upon damping member 13 . damping member 13 bears frictionally upon base 1 , thereby damping an oscillation of arm 6 . damping member 13 is generally a toroid in shape , but may also be disk shaped . torsion spring 3 is compressed between arm 6 and pad 12 . pad 12 is mechanically engaged with base 1 wherein tangs 120 engage each side of a tab 41 . being thus engaged pad 12 is constrained against rotation relative to base 1 . fig2 is an exploded view of the tensioner . damping member 13 creates friction damping between arm 6 and base 1 . damping disk 9 is also used to create friction damping between arm 6 and eccentric adjuster 8 . frictional surface engages eccentric adjuster 8 . damping member 13 and damping disk 9 are disposed on axially opposite ends of arm 6 . damping member 13 and damping disk 9 each move rotationally with arm 6 , while base 1 and eccentric adjuster 8 are fixed to the mounting surface , such as an engine ( not shown ). pulley surface 71 may be flat , multi - ribbed or toothed to accommodate a suitable belt . an end 31 of spring 3 engages tab 41 , wherein tab 41 acts as a reaction point on base 1 . the other end 32 of spring 3 engages arm 6 . rotation of arm 6 is limited by stops 63 coming into contact with a tab 41 . fig2 b is a side view of the wave spring . the wave spring comprises multiple coils 51 . each coil comprises undulations wherein each coil comes into contact with an adjacent coil at a limited number of locations approximately 120 ° apart . this description is not intended to limit the coil design of the spring . each spring may have more or fewer undulations per coil depending on design requirements . it may also comprise one or more coils . in an alternate embodiment the wave spring comprises only one coil with ends joined . fig3 is an exploded view of the tensioner . torque from arm 6 is transferred through keyway 61 to tab 130 thereby causing damping member 13 to move in locked unison with arm 6 . keyway 61 is disposed at an axial end of arm 6 . base 1 comprises tabs 41 ( three are shown ) which extend in a substantially axial direction . torque from arm 6 is transferred through keyways 62 . keyways 62 are disposed at an axial end of arm 6 opposite keyway 61 . damping disk 9 comprises a tab 91 which extends in the axial direction . tab 91 engages a keyway 62 . rotation of arm 6 causes locked rotation of damping disk 9 through interaction of keyway 62 and tab 91 . damping member 13 and damping disk 9 are loaded normally by compression of wave spring 5 thereby creating normal force friction . this arrangement compensates for wear and assembly tolerances . wave spring 5 is captured between damping member 13 and arm 6 in a receiving portion 63 . spring 5 rotates with arm 6 ensuring that relative motion only occurs between damping member 13 and base 1 , as well as only between damping disk 9 and eccentric adjuster 8 . spring 5 is shown as a wave spring which is preferred due to its spring rate characteristic and area of surface contact . fig2 b is a side view of the wave spring . in this embodiment spring 5 comprises multiple coils or volutes , each having a wave profile . this allows suitable control of the axial ( or normal ) force relative to the tolerances of the tensioner assembly . the force of the wave spring in combination with the compression of torsion spring 3 , and further in conjunction with the coefficient of friction of mating parts determines the damping level of the tensioner assembly . in alternate embodiments spring 5 may comprise a single coil wave spring . the coefficient of friction of the various mating parts is as follows : damping member 13 and damping disk 9 may comprise any known frictional material used in a tensioner damping application , including oil resistant metals and polymers . alternate embodiments may produce sufficient axial force by use of the torsion spring 3 in compression without use of the wave spring . fig6 is a chart illustrating the spring rate ( k ) as a function of spring height . total compression is indicated for each spring type , namely , spring washer , wave spring and compression or torsion spring . fig4 is a cross - sectional view of an alternate embodiment . fig5 is an exploded view of the alternate embodiment in fig4 . fig4 and 5 describe an alternate embodiment where a spring loads two damping disks , 18 , 19 , that are fixed to rotate together thereby preventing the need to fix the damping disks to the arm 20 to be dampened . damping disk 18 is in frictional contact with a static component , base 11 , and the damping disk 19 is in frictional contact with the moving member , arm 20 , to dampen the movement of the arm 20 . eccentric adjuster 15 is an eccentric that is used to move the tensioner into proper engagement with the belt during installation . eccentric refers to the center of hole 150 not being coaxial with a center of rotation of pulley 15 or of arm 12 . eccentric adjuster 15 is used to load the belt with a predetermined tension . eccentric adjuster 15 is used only during belt installation and is locked in place once the belt is installed by fully engaging a fastener ( not shown ) through a hold 150 with a mounting surface . the fastener may comprise a bold or any other suitable fastener know in the art . pulley 14 engages a belt to provide belt tension or load . pulley 14 is journalled to arm 20 about a bearing 141 , pulley 14 is engaged with the bearing outer race . bearing 141 comprises a ball bearing as shown , but could also comprise a needle bearing or other suitable bearing know in the art . arm 20 is biased by torsion spring 13 thereby urging pulley 14 into a belt ( not shown ). pivotal movement of arm allows the tensioner to compensate for any changes in belt length as the belt stretches over time and as the drive length changes from thermal expansion or as engine load and therefor belt load changes . arm 20 pivots about a low - friction bushing 16 on shaft 12 . shaft 12 is fixed to base 1 . motion of arm 20 is damped by frictional contact with damping disk 19 . damping disk 19 is pressed into arm 20 by o - ring 17 . o - ring 17 comprises an elastomeric material and is used as a compressible resilient member to apply a normal force to damping disk 19 and damping disk 18 . o - ring 17 could be replaced by a wave spring , a compression spring , a belleville spring , or other compressible resilient member having spring characteristics known in the art . damping disk 18 is pressed by o - ring 17 into base 11 . base 11 is fixed to a mounting surface such as an engine ( not shown ). frictional surface 193 engages arm 20 . frictional surface 183 engages base 11 . damping is created by the resistant torque created by the frictional force of the contact between damping disk 18 and base 11 , and damping disk 19 and arm 20 . each tab 181 on damping disk 18 fits between two cooperating lug ( s ) 191 on damping disk 19 . this arrangement fixes damping disk 18 and damping disk 19 so there is no relative rotation between the two but allows movement between these two components in the axial direction . movement in the axial direction allows o - ring 17 to apply a preload force to both damping disks 18 , 19 and to compensate for manufacturing tolerances and wear . a lip 182 on each tab 181 engages a cooperating rim 192 on damping disk 19 to limit the relative axial movement of the damping disks 18 , 19 by locking them together . the assembly of damping disk 18 and damping disk 19 “ floats ” between the arm 20 and base 11 . neither damping disk 18 nor damping disk 19 are rotationally fixed to base 11 or arm 20 . retainer 21 holds the assembly together axially . retainer 21 is fixed to eccentric adjuster 15 and engages shaft 12 to hold the assembly axially . fig7 is a detail of the retainer and adjuster . retainer 21 holds the assembly together when the tensioner is not mounted to an engine . retainer 21 is attached to adjuster 15 by engagement of posts 151 and holes 211 and prongs 212 . the two posts 151 prevent retainer 21 from rotating and prongs 212 retain retainer 21 on posts 151 . fig1 is a detail of the retainer in fig7 . fig8 is a detail of the retainer on the adjuster . the sub - assembly of retainer 21 and adjuster 15 is inserted into shaft 12 . tabs 213 are resiliently bent inward during assembly to allow retainer 21 to pass through the bore of shaft 12 . receiving portions 152 provide a space into which tabs 213 are bent . a circumferential groove 121 in shaft 12 allows tabs 213 to resiliently expand outward to lockingly engage shaft 12 . fig9 is a detail of the assembled shaft and adjuster . relative axial movement of adjuster 15 and shaft 12 is restricted by interaction between the wall of groove 121 and the radially expanded tabs 213 . fig1 is a cross sectional view of the shaft . although a form of the invention has been described herein , it will be obvious to those skilled in the art that variations may be made in the construction and relation of parts and method without departing from the spirit and scope of the invention described herein . | 5 |
the present invention is as described herein below , including detail to exemplary embodiments of the invention . examples of these exemplary embodiments are illustrated in the accompanying drawings . while the invention is described in conjunction with these embodiments , it will be understood that it is not intended to limit the invention to the described embodiments . rather , the invention is also intended to cover alternatives , modifications , and equivalents as one of ordinary skill in the art understands the invention . in the following description , specific details are set forth in order to provide a thorough understanding of the present invention . the present invention may be practiced without some or all of these specific details . in other instances , well - known aspects have not been described in detail in order not to unnecessarily obscure the present invention . in this specification and the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include plural references unless the context clearly dictates otherwise . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs . the invention is directed to cargo handling services and systems , including online trace and track features with complete shipment information , auto - notification of import cargo status , quick online payment for import service charge and storage , instant bar - coded cargo pickup authorization pass , carrier certificate in soft copy , among other features . these features are discussed below in connection with the assignee of the present patent application &# 39 ; s use of the “ epic ” engine , “ epic 1 ,” “ epic 2 ,” and “ epic 3 .” the “ epic ” engine is a single point of entry for airline related messaging including ffm , fwb , fhl and fsn . these and other acronyms herein are well understood in the industry and defined or explained further in the publication by the international air transport association (“ iata ”) “ iata freight forwarder - carrier — ground handling agent communication functional specifications ,” (“ iata functional specifications ”), dated sep . 29 , 2008 , which is available at the website : http :// www . iata . org / sitecollectiondocuments / documents / ia taffcarrierghafunctional specificationsv07 . pdf . the entire contents of the iata functional specifications publication is incorporated herein by reference . for completeness some key definitions are provided . all documents indicated may refer to electronic documents . electronic documents include documents , forms , and messages received by or directly entered into the epic system . non - electronic documents , such as an unmessaged documents , for example an awb not entered into epic , may be entered and become part of the epic system . cargo data shared among stakeholders includes : an airway bill , a piece count , discrepancy , weight , dimensions , a signed approval of freight tendered , a confirmation of a truck driver from a stored comparison photo , flight number , flight arrivals , flight departures , incoming flights , outgoing flights , a photo documenting freight condition , screening steps taken , buildup data , breakdown data , and special handling requirements and codes . an air waybill (“ awb ”) is a document made out by or on behalf of the shipper , which evidences the contract between the shipper and airline ( s ) for the carriage of cargo over the routes of the airline ( s ). a consignment is one or more pieces of goods accepted by the airline from one shipper at one time and at one address , receipted for in one lot , and moving on one air waybill or one shipment record to one consignee at one destination address . for purposes of this application , consignment is also referred to a cargo and freight . a flight manifest contains the details of consignments loaded onto a specified flight . a freight forwarder is the party arranging the carriage of goods including connected services and / or associated formalities on behalf of a shipper or consignee . a ground handling agent is the entity authorized to act for or on behalf of the carrier , for accepting , handling , loading / unloading , transiting , or dealing with cargo , passengers and baggage . a house waybill (“ hwb ”) is a document made out by an agent / consolidator specifying the contract between the shipper and the agent / consolidator for the arrangement of carriage of goods . a house manifest is a document containing the same information as a cargo manifest and additional details on freight amounts , etc . a receipt for the cargo ( also known as “ cargo receipt ”) is a document , which is provided to the shipper , upon shipper &# 39 ; s request , by the carrier creating a shipment record as a substitution for the issuance of an air waybill and which permits identification of the shipment . a shipment record is any record of the contract of carriage preserved by carrier , evidenced by means other than an awb . the shipment record is initiated by the fwb information and confirmed or modified by the subsequent fsu ( rcs ). fsu / rcs would only modify the information regarding total number of pieces (“ piece count ”), weight , and volume amount of the shipment (“ dimensions ”). an ffm message provides the details of consignments loaded onto a specified flight . an fhl message ( type i ) provides a checklist of freight forwarder hwb associated with a master awb . an fhl message ( type 2 ) provides details of one hwb consignment for the carrier to provide customs with advance information based on the hwb information provided by the origin freight forwarder . the message containing the hwb data may be sent by the origin freight forwarder and may be updated by the origin ground handler . an mb message is used to transmit a complete set of awb data in accordance with the iata cargo services conference resolutions . the message containing the awb data may be sent by the origin freight forwarder and may be updated by the origin ground handler to include data , such as weight , number of pieces , volumes . an fsu ( rcs ) message is used to notify / update interested parties with a change of status of a specified consignment as recorded in the system of a handling party . the rcs specifies that the consignment has been physically received from the shipper and is considered by the carrier as ready for carriage on this date at this location . stakeholders may include : the cargo shipper , customs broker , consignee , cargo receiver , trucker and / or trucking company , freight forwarder at origin , air carrier , air carrier &# 39 ; s offices at origin , air carrier &# 39 ; s offices at destination , ground handling operations / agent at origin , or ground handling operations / agent at destination . a carrier simply transports goods , for example : a trucker , train , airplane , etc . a ground handling agent processes inbound and outbound information regarding the physical flow of the consignments . messages entering the epic engine are interpreted and made available through the system and computer - implemented method of the present invention . epic , the customer service portal , is a web based application that is accessed via the internet for online payment and access to data . a user / stakeholder must successfully login to epic . fig1 shows the user login screen display . fig2 illustrates the initial screen display , epic payable items , following a successful user login . the user is directed to navigation tabs , buttons , and shortcuts along the top of the initial screen display . fig3 is an illustration of epic navigation tabs , buttons , and shortcuts . the displayed navigation tabs include tracking , epayment , report , myprofile , and administration . the epayment navigation tab displays all items in the payment process including : unpaid , paid but not picked up , and delivered . the user &# 39 ; s screen is filtered by clicking on the various buttons at the top of the screen . various parts of the application are accessed by clicking on the tabs . these buttons used for filtering are only accessible when the user is in the epayment tab . alternatively , the user may click on the payable items shortcut . there is a list of shortcut items on the left the left hand side of the screen . these shortcuts include payable items , which lists shipments in various stages of payment ; view cart , which contains the user &# 39 ; s shopping cart items for when the user is ready to pay ; prepaid balance , which is a view of the user &# 39 ; s balance and further containing the option to replenish the account ; and a payment history , showing all receipts . fig4 shows a navigation portion of the screen with filtering by an airport code tab . the tracking navigation tab displays all shipments paid or open and allows the user to print carrier certificates for all user consigned messaged shipments . many airlines provide freight messaging ( ffm , fwb , fhl and fsn ). freight messaging is received on flight lift off from the point of origin . after receiving messaging , a user may access to a number of features , including : click and pay , trace and track , online carrier certificates , and customs release interpretation . a user is able to pay for shipments prior to a time when messaging arrives through the input awb ( s ) manually and pay feature . while the present invention envisions 100 % industry participation , unmessaged airlines likely will be carriers . unmessaged simply means that freight messaging is not directly entered into epic . yet , a user manually entering the awb information . once entered , the user may pay for all of his shipments and perform any other task online through epic . the report navigation provides detail and summary reports of paid items . all users have access to the report paid and waiting to be picked up . this is the same information that appears in the epayment tab . but this information is conveniently combined in one report . there are several financial reports that are available as well . the user must have advanced access granted from a super admin user to access financial reports . the financial reports include both summary and detail reports . summary reports are available by airline and by user . detail reports are available by airline , by user , by payment type , and by master / house awb . all reports can be exported to excel . fig6 shows a report screen of epayment tab information consolidated in a single report . the my profile navigation tab permits the user to change a password and update the user profile . fig7 displays a my profile epayment user summary screen . the administration navigation tab is only visible to super admin level users . only online users with super admin or admin privileges can see this tab . there are three main user types . first , super admin user has full access to epic and is responsible for setting up users and users &# 39 ; rights . the super admin can change individual user &# 39 ; s rights and provide individual operators with access to certain features , including , for example : financial reports and the ability to pay isc . fig8 displays an administration super admin user &# 39 ; s setup screen . second , an accounting user of epic has full access with the exception of user management rights . finally , operator users have online payment access and operating reports only . fig9 displays an administration operator access screen . a search box is also visible on the initial navigation page . fig5 shows a search screen with searching options dropdown menu . the dropdown menu allows a user to search according to one of five criteria . first , the master awb dropdown selection is used to search a return for a particular master awb . second , the airline code dropdown selection allows the user to filter the view and show only bills for a particular airline based on the associated airline prefix . third , the house awb dropdown selection permits a search and return based on a particular house awb . fourth , return all bills for a particular flight number , regardless of the date . finally , a user may also search based on an arrival date . when the user first enters epic , a list of shipments with messaging received that have not been yet been paid for will appear . the user may click and pay for these shipments . instead , for example , if it is not a simple bill , the user may choose to pay by either master or house . fig1 shows a paying isc screen . a user can automatically calculate storage and select a storage date from the drop down . the user may also add storage to most pre - existing shipments by clicking on the ‘ more ’ button , entering pickup date , and the amount . the ‘ more ’ button can be used as needed for additional storage . fig1 shows a paying storage screen . under the epayment edit tool , a user may add house awbs and move pre - paid isc payments . if the house is paid , but not picked up , you can move the associated isc payment to any of the other houses under the same master awb . fig1 displays an epayment edit shipment screen . after selecting items , the user clicks the add to cart button . a user &# 39 ; s items will be added to the cart . if a user would like to delete the item from the cart and return it to the open items list as payable , the delete check box is clicked and then the modify cart appears . when ready to pay the view cart button is clicked . fig1 shows user cart screen . storage and isc items are listed as separate items . until fully paid , the shipment remains in the open items section . other stakeholders will be able to select the messages for payment while it is in the cart . other users will be notified the subject messages are “ in cart ” and payment options for them are not available . when a user is ready to pay the pay now button is clicked . the user have the option to select his own reference number for each awb item in the cart and then select his payment option . payment options include , but are not limited to : paying by credit card , paying by e - check , and paying by pre - paid account . the most convenient way to pay is to establish a prepaid account . this is a pool of funds available to users to make payments from . it can be used to pay for both isc and storage . to pay a balance , simply select payment option and hit verify . as long as there are enough funds in the account , the transaction will be processed . to see the balance history click on the shortcut for prepaid balance . a receipt will be emailed to the main contact . the user may receive an email by entering an additional address . as discussed above , to pay for a shipment on one of the unmessaged airlines , a user can click on the button input awb ( s ) manually and pay . fig1 shows a payment screen for an unmessaged shipment . to pay for an unmessaged shipment , a user should select based the corresponding airline prefix . an optional 2nd code may be entered as necessary . these codes include : the awb , the house awb , the flight number , and the arrival date . also as indicated above , a user has the option to search and pay for messaged shipments prior to message arrival . fig1 shows an epayment screen utilizing the search and pay for messaged shipments . a user can enter payments for master bills prior to their arrival using the input awb ( s ) manually and pay feature . once the messaging arrives the awb data is updated to your record and the user is able to use this feature for house awbs . the search and pay feature also allows a particular user to pay for shipments not consigned to that particular user . enter the whole master awb into the search field and the bill will be presented for payment . a user may also pay for partial shipments as they come in or once they all arrive . fig1 shows a pay for partial shipments screen . the user is charged isc once and storage for the whole shipment based on the portion of the whole that is selected . storage is based on the total kilos for all parts being picked up and the arrival date of the flight . isc is only charged once per master or house awb . online payment as described above , eliminates the need for physical checks and simplifies the terminal service process . access to online receipts provides the benefit of having one copy used by all the people all the time . additional features include : auto - notification , bar - code pickup pass , and trace and track . auto - notification allows a user to choose to receive pre - alerts and reminders sent via email or wireless device from the point of shipment arrival to the cargo pickup . bar - code pickup pass permits the user to receive payment receipt and pickup confirmation code generated online . bar - code pickup pass results in faster cargo recovery for all stakeholders . finally , trace and track , where a user may view complete shipment information and status , filtered according to parameters , includes : simple awb , location , payment , consolidation , partial payment , proof of delivery , inbound shipment , freight condition , piece count , weight , customs release , and discrepancy . trace and track provides access cargo information from anywhere anytime . epic 2 , the mobile warehouse management system , provides additional functionality and features , including automation of the delivery of and capture of information from the cargo handling warehouse . epic 2 reconfigures the cargo handling and optimizes the processes between the office and the warehouse , resulting in increased efficiencies . epic 2 enables tablet - aided acceptance of cargo , buildup , breakdown , and delivery . furthermore , epic 2 empowers workforce by connecting cargo and data together resulting in process efficiency , quality improvement , increased productivity , sla / c2k compliance , and enhanced employee satisfaction . epic 2 provides auto dlv messaging to meet real - time c2k compliance with accurate truck waiting time . epic 2 automatically prepares bcl to provide quicker cargo processing time and throughput . finally , epic 2 provides auto customs release to minimize the risk of customs fines and penalties . warehouse transportation vehicle ( s ), such as a forklift , are outfitted with mounting devices to a hold a smartdevice . other comparable devices with an apple ios or android os mobile device offering advanced capabilities , including personal computer - like functionality ( pc - mobile handset convergence ) or a palmtop computer may also be employed . the mounting device keeps the ipad protected , and accessible to the staff in a safe way . the staff sign into the smartdevice and application to retrieve information about incoming or outgoing freight . they also capture all information regarding the freight required for handling . warehouse staff are presented with a prioritized list of freight arriving at the warehouse for an import breakdown . fig1 shows a screen displaying a prioritized list of freight arriving at the warehouse . as the freight is broken down on to skids , the agent enters piece counts and locations for those skids . the agent also notes any discrepancies . warehouse staff are presented with a list of truckers that have checked in and are waiting to pick - up their freight for the import delivery . fig1 shows a screen displaying list of truckers that have checked in and are waiting to pick - up their freight . once a trucker is selected , they can see what freight it is and where it is located in the warehouse for retrieval . the warehouse agent uses the smartdevice and application to note cargo data . they also check the id of the driver against the id appearing digitally in the system . warehouse staff are presented with a list of truckers that have checked in and are waiting to drop - off their freight . once a trucker is selected , they can initiate the capture of critical acceptance cargo data . warehouse staff select the flight they are performing a build up for and then create skids right in the application in an export build up . a skid is a temporary storage location for cargo , for example a pallet . fig1 displays a screen showing an online freight build up and creating of a pallet . freight is added to the pallet with simple clicks . all critical build up data is captured including piece count , weights , dimensions , and special handling codes . a build up tag is printed out wirelessly by the scale to be attached to the freight . supervisors are provided with a smartdevice with an app installed that will allow them to capture condition of the freight whether it is good or bad . for example , after freight is built up it is photographed to show it is in good condition and built properly . or if freight arrives damaged it is photographed . all photos are associated with the freight and retrievable through our software . as discussed above , for airlines that do not provide message data , the information may be entered manually . epic 2 provides an import awb capture tool that allows stakeholders to quickly capture awb data electronically . fig2 shows an online tool allowing agents to capture awb data electronically for airlines that do not provide message data . once entered , the awb is now treated as messaged and is used throughout the system . all office related export awb acceptance data is captured through the epic system . fig2 illustrates a display of all captured office related export acceptance data . the capture data includes : awb and flight data , trucker identification , security checks , etc . once captured , this data then becomes available throughout the system and enables a paperless export acceptance process . the import manager is a centralized view of all import processes being captured in the warehouse or in the office . fig2 shows a real - time centralized view of all import processes captured in a warehouse or office . the manager displays status of the breakdown , discrepancies , nomination requests and notification status . similarly , the export manager is a centralized view of all export processes being captured in the warehouse or in the office . fig2 illustrates a real - time centralized view of all export processes being captured in the warehouse or in the office . the manager displays status of the outgoing flight including booking , acceptance , buildup and departure . the export flight manager also creates and sends export flight messaging to the airline handling system , such as ffm to make the build - up process faster in the office as well . the user also sees important information about freight being built that have special handling codes associated with them . fig2 shows the airline portal allowing customers access to their flight data , the epic airline portal . this portal allows airline carrier customers access to their flight data . data is presented in a user friendly way , in that data is consolidated into powerful business reports and can be easily filtered based on parameters . inbound shipments can be tracked down to the proof of delivery where the user can actually see which trucker picked up the freight and when . epic 3 provides several additional features and functions , such as dock management , a manager module , airline portal plus , and epic cloud . dock door management maximizes use of the dock doors to reduce the trucker waiting time as much as possible . the trucker engagements starts in the parking lot where the employee will be equipped with a smartdevice and application to identify the trucker and capture basic details to alert the warehouse staff of his arrival and what to prepare for . the trucker is then assigned a door based on complexity of the shipment they are dropping off or picking up and what is currently happening at each dock door . for facilities that are not busy , the freight can start to be retrieved and staged before the trucker is even walking through the traffic doors to check in . a qualifying trucker can skip the manual check - in process altogether and go straight to the dock door . for busier facilities , freight will move through faster with less unnecessary waiting by the trucker . the manager module provides warehouse managers a smartdevice application , so that the manager can set priorities for staff , complete shift reporting , fill out accident or incident reports , capture images , monitor the operations and communicate with staff and customers . airline portal plus includes an engine allowing airlines to forward all of the flight data , even for stations that are not handled in order that they can achieve reporting across their entire enterprise . epic cloud is a commerce platform for the air cargo community where partners can pay each other or transact with each other . social network features such as user profiles , online presence , and document sharing will be part of the applications . | 6 |
the examples described and drawings rendered are illustrative and are not to be read as limiting the scope of the invention as it is defined by the appended claims . below , the same reference characters are used for identical components in the different views of the figures . the illustrations in the figures are diagrammatic and not to scale . in fig1 , the system element 1 comprises a suction chamber 2 which is used for generating a suction stream and which is a generally known component , known by a person of ordinary skill in the art . the system element 1 further comprises a transport device 3 that encloses lateral walls of the suction chamber 2 . as shown in fig1 , the transport device 3 comprises a first roller 4 and a second roller 5 , where the rollers are arranged at opposite lateral surfaces of the suction chamber 2 and contact the respective lateral surface . according to the embodiment , pulleys 6 for driving the rollers 4 , 5 and thus for driving the system element 1 are arranged on the respective end regions 4 a , b and 5 a , b of the first and second rollers 4 , 5 . the pulley 6 and the rollers 4 , 5 are firmly connected to an axle 12 , as shown in fig4 , so that the running belt 7 is not subjected to unnecessary deformation as a result of torque transmission , but may instead carry out its sealing function without hindrance . as an alternative , a drive belt ( not shown ), may be used and is driven by a motor ( not shown ) and is connected to the pulley 6 , to drive the running belt 7 , such that a torque acts on the rollers 4 , 5 , and so that the system element may be moved . according to the embodiment , the suction chamber 2 is supported by the rollers 4 , 5 such that rotation of the rollers 4 , 5 may be possible and the suction chamber 2 may be safely held to the rollers 4 , 5 . according to the embodiment , the running belt 7 is made from a flexible material so that the running belt 7 may carry out its sealing function . as shown in fig1 , the embodiment comprises two running belts 7 a , 7 b that may establish contact with opposite lateral surfaces of the suction chamber 2 , where the lateral surfaces are not the same as the lateral surfaces that are contacted by the rollers 4 , 5 . as shown in fig1 , the end regions 4 a , 5 a of the rollers 4 , 5 are connected by way of the running belt 7 a , and the end regions 4 b , 5 b of the rollers 4 , 5 are connected to each other by a separate running belt 7 b . both belts are examples of a connection element . with reference to fig2 and 3 , the function of the system element 1 according to fig1 is described . fig2 shows a diagrammatic lateral view of the system element , according to fig1 , in a state in which the suction chamber 2 generates a suction stream , wherein the system element 1 is sucked to a surface 8 of a workpiece 9 . as shown in fig2 , in this suction state , the flexible running belt 7 b ( and the running belt 7 a that is not visible in this view ) conforms to the curved surface 8 of the workpiece 9 . fig2 shows guide discs 11 around where the running belt 7 b has been placed . fig3 shows a front view of the sucked in system element , according to fig2 . the diagram shows that in the sucked in state , the running belts 7 a , b may conform with the surface 8 of the workpiece 9 , and that the rollers 4 , 5 may be made from a correspondingly elastic flexible material . fig4 shows a diagrammatic partial lateral view of a detail of the system element 1 according to fig1 . as shown in fig4 , the running belt 7 is placed around a guide disc 11 . the guide disc 11 is connected to an axle 12 which extends from the roller 5 towards the outside . by way of a sliding bearing or ball bearing 13 , a connection 14 is supported by the axle 12 . the connection 14 is preferably rigid and bears or supports the suction chamber ( not shown ). according to the preferred embodiment , the rigid connection 14 comprises a first part 15 , that extends so as to be substantially parallel in relation to the axle 12 and the roller 5 , and a second part 16 and a third part 17 which extend substantially perpendicularly from the first part 15 in the direction of the axle 12 . the free ends of the first and second parts 16 , 17 are supported by the axle 12 via the sliding bearings or ball bearings 13 . the first and second parts 16 , 17 of the connection 14 are spaced apart from each other , and the pulley 6 is arranged between the first part 16 and the second part 17 , as shown in fig4 . during the transport of the suction chamber 2 over the workpiece 9 , the suction device 2 is supported by the rollers 4 , 5 . to this effect , the axle bearing 12 of the rollers 4 , 5 is rigidly connected to the suction chamber 2 as described above . expediently , attachment of the axle bearing 12 is further to the outside than the position of the running belts 7 such that the axle bearing arrangement may not be in the way of automatic sealing between the running belts 7 and the rollers 4 , 5 . the rigid connection 14 of the axle bearings 12 and the suction chamber 2 comprises an opening 18 , through which the upper part of the running belts 7 may move . in an inoperative position , e . g . while a transported tool is in operation , attachment of the suction device may also be possible by way of additional suction cups or by way of full contact of the suction device in that the rigid connection to the rollers is undone . thus , the running belts 7 a , 7 b , which may serve as connection elements , and the rollers 4 , 5 , which may serve to generate forward movement of the system element 1 , may conform to the curved surface 8 of the workpiece 9 when the suction chamber 2 generates a suction stream , so that a good negative pressure is generated between the suction chamber 2 and the surface 8 of the workpiece 9 , where negative pressure makes possible reliable adhesion of the system element 1 to the surface 8 of the workpiece 9 . in this way a tool ( not shown ) that is coupled in any desired manner to the system element may reliably be conveyed to a desired position on the surface of the workpiece 9 , where the tool may be positioned . although not shown in the figures , a transport system according to the invention may comprise a plurality of system elements 1 . for example , the shape of the suction chamber 2 is not limited to a square or rectangular shape but instead may comprise any form with any number of lateral surfaces , but it may be ensured that each lateral surface is contacted either by a roller or by a running belt so as to ensure that adequate negative pressure is generated for adhesion of the system element 1 . furthermore , the running belt 7 may also be designed as some other connection element that interconnects the end regions of the rollers and contacts a lateral surface of the suction chamber 2 . in this case , the drive of the system element 1 takes place by applying a torque to any one of the rollers 4 , 5 ( or to both ) without the need for pulleys 6 . as an alternative , the running belts 7 may be made from a suitable material and may have a suitable shape so that forward movement of the system element may by said running belts 7 alone , wherein the rollers 4 , 5 are idle rollers . the system element may be used in many sectors , for example , in aircraft construction , shipbuilding or in any other sectors where a tool has to be reliably transported over a curved surface of a workpiece and has to be positioned thereon , wherein the term “ tool ” also refers to a component , robot or a workpiece to be transported . furthermore , the system element may of course also be used on horizontal or flat surfaces . it should also be mentioned that “ comprising ” does not exclude any other elements or steps , and that “ a ” or “ an ” does not exclude a plurality . it should furthermore be noted that characteristics or steps described with reference to one of the above embodiments may also be used in combination with other characteristics or steps of other above - described embodiments . the reference symbols in the claims should not be understood in a restrictive sense . alternative combinations and variations of the examples provided will become apparent based on this disclosure . it is not possible to provide specific examples for all of the many possible combinations and variations of the embodiments described , but such combinations and variations may be claims that eventually issue . | 1 |
in the following detailed description of the invention , numerous specific details are set forth in order to provide a thorough understanding of the invention . however , the invention may be practiced without these specific details . in other instances well known methods , procedures , and / or components have not been described in detail so as not to unnecessarily obscure aspects of the invention . fig1 schematically shows a part of a data processing system , e . g . a system used in a mobile phone comprising a transmitter 10 and a receiver 20 . the transmitter 10 may be any data producing device , e . g . a baseband processor , a storage or a camera chip . the receiver 20 may be any data receiving device , e . g . a processor , or another storage . the transmitter 10 transmits data frames to the receiver 20 via data link 30 . the receiver 20 can communicate error messages to the transmitter 10 via return data link 40 . although in the embodiment shown the transmitter 10 and the receiver 20 are directly coupled , they may alternatively be coupled via one or more intermediary nodes . fig2 schematically shows an example of a data frame exchanged between the transmitter and the receiver . the data frames comprise control data as well as user data . the control information serves to control a proper transfer of the user data ( payload pl ). the control data includes at least a frame sequence number fs , and may further include for example a start of frame sof marker , an end of frame marker eof , and a traffic class indicator tc ( e . g . indicating high / low priority data traffic , isochronous traffic or best effort traffic ). furthermore redundant data crc may be present to verify correctness of the user data and / or control data . the frame sequence number fs is shown to be part of the data frame trailer , but it may also be part of the frame header . fig3 shows in more detail a transmitter according to the present invention . the transmitter includes a production module 11 for producing at least one data frame for transmission . the production module 11 may for example be an input buffer that temporarily stores data frames received from an external source 12 as shown dashed in the embodiment of this figure . alternatively the production module may for example generate the data frames itself , e . g . from signal provided by a sensor , or antenna . the at least one data frame includes a sequence number , user data and an error - detection code . the transmitter further includes a retransmission buffer 13 for temporarily storing the at least one data frame . a controller 14 configures the retransmission buffer 13 for retransmission and selects which of the production module 11 and the retransmission buffer 13 is used for supplying the data frames for transmission . the outputs of the production module 11 and of the retransmission buffer 13 are coupled to a multiplexor 15 , controlled by the controller 14 to select one of the outputs for providing a data frame for transmission to the receiver 20 . the operation of the controller 14 is shown in more detail in fig4 . at startup ( step s 4 _ 1 ) the controller initializes the following variables : therein the variables oldest_seq and newest_seq respectively indicate the sequence number of the oldest data frame and the newest data frame in the retransmission buffer . the variables rd_ptr and wr_ptr respectively indicate the retransmission buffer locations that are currently read from and written to . the variable empty indicates whether data frames are available in the retransmission buffer . frame_start [ ] is a table comprising for each data frame x the location of the first word of said data frame in the retransmission buffer 13 . in step s 4 _ 2 the controller waits for one of the following conditions to occur : a new word of a data frame becomes available for transmission ( c 4 _ 1 ). in that case the data frame is added to the retransmission buffer in action s 4 _ 3 . this action is described in more detail with reference to fig5 a and 5b . an error message ( nac ) is received ( c 4 _ 2 ) that indicates the sequence number seq of the last correctly received data frame . in that case all the data frames up to and including the reported frame sequence number seq are discarded , and the retransmission buffer read pointer is moved at the beginning of the first unacknowledged data frame in action s 4 _ 4 . this action is described in more detail with reference to fig6 . the event get_replay_word is received during a replay ( c 4 _ 3 ). this results in receiving a word from the retransmission buffer 13 . when all the data from the retransmission buffer 13 has been resent , a flag is set . this action c 4 _ 3 is described in more detail in fig7 . fig5 a and 5b are described now in more detail . in the embodiment shown data frames can comprise a variable number of words , and the production module 11 indicates the last word by a flag last_in_frame . the data frames are added word by word wr_word to the retransmission buffer 13 . first , in step s 5 _ 1 it is verified whether the retransmission buffer 13 is full . the retransmission buffer 13 is full if the value of the write pointer wr_ptr is equal to the value of the read pointer rd_ptr and the flag empty is false . if indeed the retransmission buffer 13 is full , the oldest data frame in the retransmission buffer is therefore removed in action s 5 _ 2 . this action , which is illustrated in more detail in fig5 b , includes steps s 5 _ 3 , s 5 _ 4 , s 5 _ 5 . in step s 5 _ 3 the index indicating the oldest data frame in the retransmission buffer 13 is incremented : in step s 5 _ 4 the read pointer is updated : this pointer rd_ptr addresses the first word of this new oldest data frame in the retransmission buffer 13 . after the read pointer is updated it is verified in step s 5 _ 5 whether removing the data frame resulted in an empty retransmission buffer 13 . this is the case if the read pointer equals the write pointer : the full - buffer test s 5 _ 1 may be repeated . this may for example be necessary if a new data frame is larger than the oldest data frame stored in the retransmission buffer 13 . after the full - buffer test s 5 _ 1 and the possible oldest - frame removal s 5 _ 2 , the word to be , written wr_word is inserted in the retransmission buffer at the wr_ptr position in step s 5 _ 6 , the wr_ptr pointer is incremented to the next retransmission buffer location in step s 5 _ 7 , and the empty flag is set to false in step s 5 _ 8 , because at least the current word wr_word is in the retransmission buffer 13 . in step s 5 _ 9 it is determined whether a new data frame has been completely stored in the retransmission buffer 13 , by inspecting the value of the flag last_word_in_frame provided by the production module 11 . if it is determined in step s 5 _ 9 that a new data frame has been completely stored in the retransmission buffer 13 it is also necessary to update information about the start of the next data frame . the number of data frame entries is limited . accordingly in step s 5 _ 10 it is verified whether all numbers are in use . in this particular example , the least significant bits of the sequence number are used to identify a data frame in the retransmission buffer 13 . e . g ., if there are 8 bits used for the sequence number , the least significant 4 bits can be used to maintain 16 data frame entries . the following test reveals whether a data frame entry is in use : if this is the case , in step s 5 _ 11 , worked out in fig5 b , the oldest data frame is removed from the retransmission buffer 13 to make space for the new data frame . the start of the newest data frame is calculated in step s 5 _ 12 by : subsequently the index pointing to the newest data frame is incremented in step s 5 _ 13 : when a negative acknowledge nac is received , the data transmitter 10 prepares the retransmission buffer 13 for retransmission , as shown in more detail in fig6 . first in step s 6 _ 1 it is checked if the reported sequence number seq is actually stored in the retransmission buffer . this is the case if : if so , in step s 6 _ 2 all the data frames up to and including the data frame with number seq are removed from the retransmission buffer . accordingly the variable oldest_seq is updated as : and in step s 6 _ 3 the new read pointer is updated as : in step s 6 _ 4 the currently being transmitted data frame is also removed from the retransmission buffer . removal is achieved by incrementing the write pointer wr_ptr to the start of the next data frame : in step s 6 _ 5 the replay pointer is set to the beginning of the oldest data frame : retransmission continues ( see fig7 ), until the replay pointer is equal to the write pointer . this is verified in step s 7 _ 1 . every time a word is requested , this is delivered from the replay_ptr position in the retransmission buffer ( step s 7 _ 2 ), and replay_ptr is incremented in step s 7 _ 3 . subsequently the replayed word of the frame is transmitted ( s 7 _ 4 ). if all the buffer has been replayed ( replay_ptr == wr_ptr ), a message is issued in step s 7 _ 5 that normal operation mode is assumed again ( s 4 _ 2 , fig4 ). fig8 schematically illustrates a receiver 20 of a data processing system according to the invention . the receiver 20 includes an input 21 for receiving the at least one data frame . the input 21 is coupled to a channel decoder module 22 that decodes the data from a 9 bit communication format into an 8 bit internal data format . a next module 23 converts this 8 bit internal data format into data having a further 17 bit internal format . the 17 bit data is supplied to the receive buffer 24 and to a crc - module 25 that compares the value of the crc data in the data frame with the value of the crc data calculated from the user data in the data frame . the receiver further has an error detection module 26 for detecting an error in the at least one data frame . the error detection module 26 may for example detect the following errors . an invalid symbol was received in the physical layer of the protocol . in the embodiment shown this is reported by a signal err_sym9b from the channel decoder module . a crc error occurs in the data frame ( likely caused by a bit flip ). in the embodiment shown this type of error is reported by a signal err_crc from the crc - module 25 . a sequence number error may be reported if the sequence number of a data frame does not logically follow from the sequence number of a previous data frame . an rx buffer overflow err_buf_overflow may also be a cause for an error message . the error detection module 26 here functions as the module for signaling an error message . in case an error is detected , the error detection module 26 requests via req_nac that an error indication message is sent to the transmitter 10 . the message req_nac includes information indicative for the sequence number of the last correctly received data frame . such indicative information is preferably the sequence number itself of the last correctly received data frame . alternatively it is for example the sequence number of the first data frame received with errors . this is however not always possible , as the detected errors may not necessarily be associated with a data frame . they can be associated with e . g ., a control frame , or an invalided idle symbol . the receiver 20 in the data processing system further includes a timer 27 that indicates the amount of time lapsed from the moment the error message req_nac transmission is initiated . after expiry of a predetermined amount of time it provides a signal expire to the error detection module 26 . in response to this signal the error detection module 26 initiates a new transmission of an error message . the error detection module 26 further may initiate a resynchronization of the connection to the transmitter with a signal req_link_sync . fig9 schematically illustrates a finite state machine for operation of a receiver 20 according to the invention . in this scheme the oval blocks indicate a state . the indented rectangular blocks indicate a detected condition , and the unindented rectangular blocks indicate an action state s 9 _ 1 is the initial state of the receiver 20 after reset . from that state it transfers to state s 9 _ 2 , which is maintained as long as no errors are detected . condition c 9 _ 3 implies an error is detected . in that case actions a 9 _ 4 and a 9 _ 5 are carried out . action a 9 _ 4 is the communication of a message req_nac to notify the transmitter 10 of the data frame of the sequence number of the last correctly received data frame . action a 9 _ 5 is starting the timer 27 to measure the waiting time for a response of the transmitter 10 to said message . state s 9 _ 6 is a waiting state wherein the receiver waits for a response of the receiver . during said waiting stage s 9 _ 6 the following conditions may occur : c 9 _ 7 : the receiver 20 receives a replay of data frames by the transmitter . in that case the timer may optionally be stopped to save power ( in action a 9 _ 8 ) and the receiver 20 assumes the no - error state s 9 _ 2 . the replay detection may consist of detecting a valid data and / or control frame , or detecting the link resynchronization at the physical layer . c 9 _ 9 : the timer 27 expires . in this case the actions a 9 _ 10 , a 9 _ 11 and a 9 _ 12 are performed . action a 9 _ 10 is a resynchronization of the data link 40 from the receiver 20 to the transmitter 10 . this action is followed by action a 9 _ 11 , which is the transmission of a new negative acknowledgement message which includes a flag to request the data frame transmission link to be resynchronized . as action a 9 _ 12 additionally the timer 27 is started again . following the actions a 9 _ 10 , a 9 _ 11 and a 9 _ 12 the receiver 20 assumes the waiting state s 9 _ 6 , wherein it waits again for the retransmission of data frames by the transmitter 10 . c 9 _ 14 : another error is detected . in this case , the no error indication message is further sent to the transmitter to prevent an avalanche of error messages to the transmitter when for example the link is out of sync , and with every symbol an error is likely to be detected . as a result , the receiver 20 returns directly to state s 9 _ 6 , wherein it waits for a retransmission of data frames or another response of the transmitter . as indicated by the dashed box in fig8 an error counter 28 may be used , instead of a timer 27 to initiate a second error indication message transmission . when an error indication message is transmitted by the receiver , the error counter is initialized to count the detected errors up to a predetermined value . when this value of errors is reached , the same actions as for the timer expiration are taken ( e . g ., link resynchronization a 9 _ 10 and initiating a second error indication message transmission a 9 _ 11 ), after which the error counter is reinitialized and again set to count detected errors . the error counter may stop counting errors when a response c 9 _ 7 from the transmitter is observed . fig1 shows a first example of a communication between a transmitter 10 and a receiver 20 in a data processing system according to the invention . at time t 1 the transmitter 10 transmits a data frame . this data frame is received at time t 2 by the receiver 20 . in this example the receiver detects that an error occurs in the time interval tl - t 2 . in response thereto , at time t 3 , it transmits an error message nac to notify the transmitter 10 of the data frame of the occurrence of the error . the error message includes at least information relating to the sequence number of the last correctly received data frame . the message is received at time t 4 by the transmitter 10 , and triggers a retransmission of one or more data frames at time t 5 . at time t 6 the receiver detects the retransmission and stops it the timer . fig1 shows a second example of a communication between a transmitter 10 and a receiver 20 in a data processing system according to the invention . until time t 5 the second example is equivalent to the first one . however , in the example shown , a further error occurred during the transmission of the retransmitted one or more data frames , and an error is detected at t 6 , however , no error message nac is reported back to the transmitter 10 as the timer is still running . as soon as the timer expires at t 7 , the data link 40 from the receiver 20 to the transmitter 10 is synchronized . alternatively , immediate resynchronization upon detection of the error is an option . however , the bit error rates are expected to be much higher ( e . g ., once every second ) than the synchronization error rates ( e . g ., once every hour ). the link resynchronization is only needed for synchronization errors , not for bit errors . as a result , usually the system will recover from the error without link resynchronization ( see fig1 ), and , therefore , there is no need to resynchronize the link with the first error detection . however , in the more rare cases that the system was not able to recover from error after the timer expires , it can be assumed that the link is out of sync and it may be resynchronized immediately . after synchronization of the data link 40 at time t 8 the receiver 20 transmits a new error message . this error message is received at t 9 by the transmitter 10 . in response thereto the transmitter first synchronizes the data link 30 from the transmitter 10 to the receiver 20 , and subsequently at time t 10 retransmits one or more data frames . at time t 11 the receiver 20 notices that the retransmission is started , and stops its timer 27 . it is remarked that the scope of protection of the invention is not restricted to the embodiments described herein . parts of the system may implemented in hardware , software or a combination thereof . neither is the scope of protection of the invention restricted by the reference numerals in the claims . the word ‘ comprising ’ does not exclude other parts than those mentioned in a claim . the word ‘ a ( n )’ preceding an element does not exclude a plurality of those elements . means forming part of the invention may both be implemented in the form of dedicated hardware or in the form of a programmed general purpose processor . the invention resides in each new feature or combination of features . | 7 |
referring particularly to fig1 the reference numeral 10 generally designates an array of hydraulic transmission control elements for regulating the engagement and disengagement of friction clutch 12 and band brake 14 to effect shifting between a pair of forward transmission speed ratios . in a typical application , a 1 : 1 or direct ratio ( 3rd ) is provided with engagement of the clutch 12 , and an underdrive ratio ( 2nd ) is provided with engagement of the band brake 14 . thus , a 2 - 3 upshift is achieved through concurrent disengagement of band brake 14 and engagement clutch 12 , while a 3 - 2 downshift is achieved through concurrent disengagement of clutch 12 and engagement band brake 14 . as explained below , this invention concerns the engagement of band brake 14 to effect a 3 - 2 downshift . the illustrated hydraulic elements include a positive displacement mechanically driven hydraulic pump 16 , a pressure regulator valve 18 , a force motor controlled line pressure bias valve 20 and limit valve 22 , an operator manipulated manual valve 24 , a solenoid controlled 2 - 3 shift valve 26 , a clutch apply servo 28 , a fluid restriction circuit 30 , and a band apply servo 32 . the pump 16 receives hydraulic fluid at low pressure from the fluid reservoir 40 , and supplies line pressure fluid to the transmission control elements via output line 42 . pressure regulator valve 18 is connected to the pump output line 42 and serves to regulate the line pressure and torque converter feed pressure ( cf ) by returning a controlled portion of the line pressure to reservoir 40 via the line 44 . the pressure regulator valve 18 is biased at one end by orificed line pressure in line 46 and at the other end by the combination of a spring 48 and a controlled bias pressure in line 50 . the controlled bias pressure is supplied by the line pressure bias valve 20 which develops pressure in relation to the current supplied to electric force motor 52 , the force motor 52 being hydraulically balanced by the pressure in bias chamber 54 . line pressure is supplied as an input to bias valve 20 via line 54 and the limit valve 22 . an accumulator 56 connected to the bias pressure line 50 serves to stabilize the bias pressure . with the above - described valving arrangement , it will be seen that the line pressure of the transmission is electrically regulated by force motor 52 . in the event of an interruption of electrical power to the force motor 52 , the bias pressure in line 50 assumes a maximum value , thereby forcing maximum line pressure . the friction clutch 12 and band brake 14 are activated by conventional fluid servos 28 and 32 , respectively . the servos 28 and 32 , in turn , are connected to a fluid supply system comprising the manual valve 24 , the 2 - 3 shift valve 26 , and the fluid restriction circuit 30 . the manual valve 24 develops a supply pressure d32 for the 2nd and 3rd forward speed ranges of the transmission in response to driver positioning of the transmission range selector lever 60 . the d32 pressure , in turn , is supplied via line 62 to the shift valve 26 and fluid restriction circuit 30 for application to the servos 28 and 32 . the shift valve 26 is spring - biased against a controlled bias pressure developed by the solenoid 64 , the valve 26 being illustrated in its activated state . in the illustrated state , the shift valve 26 supplies d32 supply pressure to the clutch servo 28 via line 66 and to a release chamber 68 of band brake servo 32 via line 70 . in the deactivated state , the lines 66 and 70 are exhausted via exhaust port 72 . the fluid restriction circuit 30 comprises a first orifice 80 connecting the d32 supply pressure line 62 to an apply chamber 82 of band brake servo 32 , and a solenoid operated flow control valve 84 . the flow control valve 84 is selectively controlled to connect a second orifice in parallel with the first orifice 80 , the second orifice being defined by the valve seat 86 . the flow control valve 84 includes a pintle armature 88 which is normally retracted from the seat / orifice 86 by a return spring ( not shown ) to connect the second orifice in parallel with the first orifice 80 , and a solenoid 90 which when electrically activated ( energized ) extends the pintle armature 88 into engagement with the seat / orifice 86 . thus , fluid pressure is supplied to the servo inlet chamber 82 via the parallel combination of orifices 80 and 86 when solenoid 90 is deactivated , and via the orifice 80 alone when solenoid 90 is activated . the deactivated condition thereby defines a high flow state , while the activated condition defines a low flow state . as described below , the valve 84 is controlled to its high flow state at the initiation of a 3 - 2 downshift , and is controlled to its low flow state after a determined delay time td . the servo 32 includes a post 92 fastened to a diaphragm 94 which is axially displaceable within the servo housing . a pair of springs 96 and 98 reacting against the housing of servo 32 urge the diaphragm 94 and hence the post 92 downward , as viewed in fig1 to release the band brake 14 . the spring forces may be aided by fluid pressure in release chamber 68 or opposed by fluid pressure in apply chamber 82 . reference numeral 100 designates a computer - based control unit which develops suitable electrical control signals for the force motor 52 and the solenoids 64 and 90 in response to a variety of vehicle and powertrain parameters , represented by the input lines 102 . the line pressure control of force motor 52 is essentially continuous during operation of the transmission , ensuring that the developed pressure is sufficient to prevent clutch slippage during steady state operation , and providing shift quality control during shifting . the control of solenoids 64 and 90 , on the other hand , pertain strictly to shifting and are discrete or on - off in nature . in 2nd ratio operation , the shift valve solenoid 64 is deactivated so that the clutch servo 28 and the band brake servo release chamber 68 are vented through shift valve exhaust port 72 . the servo apply chamber 82 is maintained at d32 supply pressure via fluid restriction circuit 30 , overcoming the spring bias to extend the servo post 92 and engage the band brake 14 . when a 2 - 3 upshift is required , the control unit 100 activates the shift valve solenoid 64 to connect the d32 supply pressure to clutch servo 28 and the release chamber 68 of band brake servo 32 via orifice 29 . this pressure balances the apply chamber pressure , allowing the springs 96 and 98 to stroke the diaphragm 94 , retracting the post 92 as the apply chamber fluid is displaced through the fluid restriction circuit 30 and into the pressure control line 62 . during this operation , the solenoid 90 is deactivated , and the flow control valve 84 is in its high flow state . the pressure in the clutch servo 28 builds as a function of the spring rates and orifices , engaging the clutch 12 as the band brake is released . this is a conventional band - to - clutch wash - out upshift . when a 3 - 2 downshift is required , the control unit 100 determines a delay time td for the flow control valve 84 , and deactivates the shift valve solenoid 64 to vent the fluid in clutch servo 28 and band brake servo release chamber 68 . the determination of delay time td is described below in reference to fig3 . the combination of the line pressure ( d32 ) and the effective orifice size of fluid restriction circuit 30 determines the fluid flow rate into servo apply chamber 82 , which in turn , determines the stroke time of the servo post 92 . once the shift is complete , there is no flow through the fluid restriction circuit 30 , and the solenoid 90 is deactivated . the graph of fig2 illustrates the relationship between the stroke time of band brake servo 32 and the transmission line pressure , with and without activation of the flow control valve solenoid 90 . when the solenoid 90 is activated and the supply pressure can only pass through orifice 80 , the relationship is given by the &# 34 ; 1 orifice &# 34 ; trace 110 . as one would expect , increasing line pressure increases the fluid flow , thereby decreasing the stroke time ; similarly , decreasing line pressure decreases the fluid flow , thereby increasing the stroke time . when the shuttle valve solenoid 90 is deactivated and the supply pressure can pass through the valve seat orifice 86 as well as the orifice 80 , the relationship is given by the &# 34 ; 2 orifice &# 34 ; trace 112 . the parallel combination of orifices 86 and 80 permits increased flow , resulting in reduced stroke time for a given line pressure . the graph of fig2 also shows that the range of available stroke times depends on the transmission line pressure . at pressure pl , for example , the shortest stroke time tmin is achieved by maintaining the high flow ( two orifice ) state throughout the shift , while the longest stroke time tmax is achieved by maintaining the low flow ( one orifice ) state throughout the shift . stroke times between tmin and tmax are obtained , according to this invention , by initiating the shift in the high flow state and switching to the low flow state after a determined delay time td . of course , a zero delay time would result in a stroke time of tmin , and a long delay time would result in a stroke time of tmax . as the line pressure increases above pl , both tmin and tmax decrease ; as the line pressure decreases below pl , both tmin and tmax increase since the same considerations which generally dictate an increase in stroke time dictate a decrease in line pressure , and vice versa , the range of available stroke times ( tmax - tmin ) is generally adequate to achieve optimum shift timing control . the primary control parameters for both line pressure and stroke time are vehicle speed and transmission input torque , as typically represented by engine throttle position . as the vehicle speed increases , it is generally advantageous to decrease line pressure to reduce spin losses , and to increase the downshift stroke time so that the input speed can substantially reach the 2nd ratio speed by the time the band brake 14 engages . as the input torque increases , it is generally advantageous to increase the line pressure to prevent steady state clutch slippage , and to decrease the downshift stroke time to limit the energy absorbed by the on - coming band brake . the above considerations , at least with respect to stroke time , are reflected in the 3 - d look - up table representation of fig3 . thus , for a given engine throttle position , the desired delay time td decreases with increasing vehicle speed to provide increasing servo stroke time . for a given vehicle speed , the desired delay time td increases with increasing engine throttle position to provide decreasing servo stroke time . in the above described mechanization , it is most convenient to address the effects of line pressure variations by empirically determining and storing delay time values into the look - up table of fig3 . that is , the delay time values which are empirically found to achieve the desired stroke times in various operating conditions of the powertrain are stored in a look - up table or data array as a function of the corresponding engine throttle position vs . vehicle speed test points . delay times for engine throttle position vs . vehicle speed operating points between empirically determined values are determined by interpolation . factors compensating for the effects of temperature and altitude variations may also be taken into account . in the preferred embodiment of this invention , a second look - up table or data array is provided for the storage of adaptive corrections to the table depicted in fig3 . as explained below in connection with fig4 and 6b , the performance of the transmission control in the course of normal 3 - 2 downshifts is measured and compared to a reference indicative of high quality shifting . if the measured value significantly deviates from the reference value , the control unit develops or updates a delay time adaptive correction term td ( adapt ) for the operating point in effect during the shift . in the next 3 - 2 downshift at such operating point occurs , the delay time will be determined as a combined function of the base delay time td ( base ) from the table of fig3 and the adaptive correction term td ( adapt ) from the adaptive table , so that the shift quality will be improved . a 3 - 2 downshift according to this invention is depicted in graphs a - e of fig4 on a common time base . graph a depicts the transmission speed ratio nt / no ; graph b depicts the torque capacity of the 3rd clutch 12 ; graph c depicts the stroke or displacement of servo 32 ; graph d depicts the torque capacity of the 2d band brake 14 ; and graph e depicts the energization state of the flow control valve solenoid 90 . initially , the shift valve solenoid 64 is energized to engage 3rd clutch 12 , and the flow control valve solenoid 90 is deenergized , defining a high flow state . the shift is initiated at time t0 with the deenergization of shift valve solenoid 64 and the determination by control unit 100 of a flow control valve delay time td . the deenergization of shift valve solenoid 64 quickly reduces the torque capacity of 3rd clutch 12 , as indicated in graph b . shortly thereafter at time t1 , the input speed , and therefore the ratio nt / no , increases toward the 2nd ratio , as indicated in graph a . the control unit 100 detects the change in speed ratio nt / no as indicated in graph e , and starts a delay timer for comparison with the determined delay time td . also , approximately at time t1 , the flow of fluid through orifices 80 and 86 begins to stroke the servo post 92 , as indicated in graph c . this displaces the fluid in servo release chamber 68 into the 3rd clutch exhaust circuit , slowing the release of 3rd clutch 12 , as indicated in graph b . in view of the above , it will be recognized that conditions other than a change in the speed ratio nt / no may be used to initiate the measured delay time . for example , the delay time could be initiated in response to a detected initial displacement of the servo post 92 , or the deenergization of shift valve 64 . at time t2 , the delay timer count reaches the determined delay time td , and the control unit 100 energizes the flow control valve solenoid 90 as indicated in graph e . this closes the orifice 86 , decreasing the flow to servo apply chamber 82 , and reduces the rate of displacement of servo post 92 , as indicated in graph c . at time t3 when the servo 32 is almost fully stroked , the torque capacity of 2nd band brake 14 quickly increases , as indicated in graph d . when the fully stroked position is reached at time t4 , the remaining fluid pressure in 3rd clutch servo 28 quickly exhausts through orifice 72 , fully releasing the 3rd clutch 12 , as indicated in graph b . at this point , the ratio change is completed , as indicted in graph a . shortly thereafter at time t5 , the flow control valve solenoid 90 is deenergized in preparation for the next shift . as indicated in reference to fig3 the above - described control is carried out essentially open - loop in that a predetermined delay time is used to control the operation of flow control valve 84 during the course of a shift . however , it is recognized that it may be desirable to trim the empirically determined delay times to compensate for part - to - part tolerance variations and other variations which occur over time . the control unit 100 continues to monitor specified parameters in the course of the shift to detect an aberration which indicates an inappropriate delay time td . one such indication is engine flare , as indicated by the broken line 114 in graph a of fig3 . this condition occurs if the stroke time is too long . if this condition is detected , the solenoid 90 is immediately deenergized to return the flow control valve 84 to the high flow state , and an adaptive delay term td ( adapt ) for increasing the delay time is determined and stored in the adaptive table referenced above in relation to fig3 . a further indication of a delay time aberration is the shift time . this condition occurs if the stroke time is too short , as indicated by the broken line 116 in graph a of fig3 . this condition is detected by comparing a measure of the shift time to a reference shift time stref based on vehicle speed nv . if the measured shift time is significantly shorter than the reference shift time , an adaptive delay term td ( adapt ) for decreasing the delay time is determined and stored in the adaptive table . flow diagrams representative of computer program instructions for carrying out the control of this invention with the apparatus of fig1 are depicted in fig5 and 6a - 6b . the flow diagram of fig5 represents a main or executive computer program which is periodically executed in the course of vehicle operation in carrying out the control of this invention . the block 230 designates a series of program instructions executed at the initiation of each period of vehicle operation for setting various terms and timer values to an initial condition . thereafter , the blocks 232 - 234 are executed to read the various inputs referenced in fig1 and to determine the desired speed ratio rdes . the desired ratio rdes may be determined in a conventional manner as a predefined function of engine throttle position tps and output vehicle speed nv . if the actual ratio ract -- that is , no / nt -- is equal to the desired ratio rdes , as determined at block 238 , the blocks 243 and 244 are executed to deenergize the flow control valve solenoid 90 and to determine the desired line pressure lpdes . in this case , the desired line pressure lpdes is determined as a function of throttle position and output speed , and also is adjusted based on the desired ratio rdes and an adaptive corrective term pad . the adaptive correction term pad may be generated during upshifting , based on shift time , as set forth in u . s . pat . no . 4 , 283 , 970 to vukovich et al . issued aug . 18 , 1981 , and assigned to the assignee of this invention . if an upshift is required , as determined by blocks 238 and 240 , the blocks 242 and 244 are executed to perform suitable upshift logic in addition to determining the desired line pressure lpdes as described above . if a downshift is required , as determined by blocks 238 and 240 , the blocks 246 and 248 are executed to determine the desired line pressure lpdes and to perform the downshift logic . in this case , the desired line pressure is determined as a function of throttle position , output speed , the pre - shift or old ratio rold , and the adaptive correction term pad , as indicated at block 246 . as indicated at block 248 , the downshift logic is set forth in further detail in the flow diagram of fig6 a - 6b . in any case , the block 250 is then executed to convert the desired line pressure lpdes to a solenoid duty cycle lp ( dc ), to output the duty cycle lp ( dc ) to force motor 52 , and to output discrete solenoid states to the solenoids 64 and 90 . referring now to the downshift logic flow diagram of fig6 a - 6b , the block 252 is first executed to determine the required states of the various shift valve solenoids . as indicated above , the present invention concerns the 2 - 3 shift valve solenoid 64 , which is activated to initiate a 2 - 3 upshift and deactivated to initiate a 3 - 2 downshift . if the shift is a 3 - 2 downshift , as detected at block 254 , the blocks 256 - 274 are executed to determine the required state of flow control valve solenoid 90 as a function of the vehicle speed nv and engine throttle position tps , as described above in reference to fig3 - 4 . when the transmission speed ratio nt / no first starts to increase toward 2nd , as determined by blocks 256 - 258 , the blocks 260 - 262 are executed to look up the delay time td as a function of measured vehicle speed and engine throttle position values nv , tps , to look up a reference shift time stref as a function of the vehicle speed nv , and to reset the delay timer . as indicated at block 260 , the delay time td is comprised of two components : a base delay time td ( base ) and an adaptive delay time td ( adapt ). thereafter during the shift , execution of the blocks 260 - 262 is skipped , as indicated by the flow diagram line 263 . until the delay timer reaches the determined delay time td , or unless engine flare is observed , as determined by blocks 264 and 270 , the remainder of the routine is skipped . once the delay timer reaches the determined delay time td , the block 266 is executed to energize the flow control valve solenoid 90 . the adaptive delay time functions are set forth in fig6 b , which is a continuation of the flow diagram of fig6 a . if engine flare is observed , by detecting an unexpected increase in the ratio nt / no , for example , the blocks 272 - 274 are executed to deenergize the flow control solenoid 90 and to increment or update the adaptive delay time value td ( adapt ) for the vehicle speed vs . engine throttle position operating point used at block 260 . the amount of the increase may be fixed or variable as a function of the amount or timing of the observed flare . if the ratio change is almost complete and the delay timer is significantly less than the the reference shift time value stref , as determined at blocks 276 - 278 , the block 280 is executed to decrement or update the adaptive delay time value td ( adapt ) for the vehicle speed vs . engine throttle position operating point used at block 260 . as with the adaptive increase of td ( adapt ), the amount of the adaptive decrease may be fixed or variable as a function of the deviation of the actual shift time ( delay timer ) from the reference shift time stref . while illustrated in reference to a wash - out shift arrangement , it will be appreciated that the engagement rate control of the present invention will find application in the engagement of any torque transmitting device having a member which is displaced by a servo in relation to the volume of fluid directed to an apply chamber thereof . it is expected that various other modifications to the illustrated embodiment will occur to those skilled in the art as well , and it should be understood that controls incorporating such modifications may fall within the scope of the present invention , which is defined by the appended claims . | 8 |
hereinafter reference will now be made in detail to various embodiments of the present invention , examples of which are illustrated in the accompanying drawings and described below . while the invention will be described in conjunction with exemplary embodiments , it will be understood that present description is not intended to limit the invention to those exemplary embodiments . on the contrary , the invention is intended to cover not only the exemplary embodiments , but also various alternatives , modifications , equivalents and other embodiments , which may be included within the spirit and scope of the invention as defined by the appended claims . it is understood that the term “ vehicle ” or “ vehicular ” or other similar term as used herein is inclusive of motor vehicles in general such as passenger automobiles including sports utility vehicles ( suv ), buses , trucks , various commercial vehicles , watercraft including a variety of boats and ships , aircraft , and the like , and includes hybrid vehicles , electric vehicles , plug - in hybrid electric vehicles , hydrogen - powered vehicles and other alternative fuel vehicles ( e . g ., fuels derived from resources other than petroleum ). as referred to herein , a hybrid vehicle is a vehicle that has two or more sources of power , for example both gasoline - powered and electric - powered vehicles . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ,” “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . unless specifically stated or obvious from context , as used herein , the term “ about ” is understood as within a range of normal tolerance in the art , for example within 2 standard deviations of the mean . “ about ” can be understood as within 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, 0 . 5 %, 0 . 1 %, 0 . 05 %, or 0 . 01 % of the stated value . unless otherwise clear from the context , all numerical values provided herein are modified by the term “ about ”. according to one aspect , the present invention provides a method for preparing lactide , including : ( a ) adding an ionic solvent to lactic acid oligomers , wherein the lactic acid oligomers are any synthesized through the polymerization of lactic acid monomers ; and ( b ) synthesizing lactide from the lactic acid oligomers added to the ionic solvent by regulating a temperature and / or a pressure , preferably be regulating both temperature and pressure . according to an exemplary embodiment of the present invention , the polymerization of lactic acid monomer in the step ( a ) is carried out at a temperature of about 120 to 300 ° c . under a pressure of about 1 to 500 mmhg for about 1 to 5 hours . however , the various conditions suitable for lactide synthesis ( e . g ., temperature , pressure and time ) can vary , and thus the conditions for polymerization can include all the conditions involved in the polymerization process where lactic acid monomers are converted into lactic acid oligomers . as such , while the above noted range is preferable , the temperature is not limited to the defined conditions . in an exemplary embodiment of the present invention , the synthesis of lactide in the step ( b ) is carried out at a temperature of about 100 to 1000 ° c . under a pressure of about 1 to 600 mmhg for about 1 to 5 hours . in an exemplary embodiment of the present invention , the ionic liquid is used for the purpose of ensuring stability at a high temperature condition during the step of preparing lactide . since there is no upper limit to a boiling point of the ionic liquid , and the thermal degradation thereof easily occurs at a high temperature , it is possible to ensure stability of a solvent even at a high temperature . in one example of the present invention , the ionic solvent suitable for the lactide synthesis includes 1 - butyl - 1 - methyl - azepanum bis ( trifluoromethylsulfonyl ) imide ; 1 - butyl - 1 - methyl - azepanum dicyanamide ; 6 - azonia - spiro [ 5 , 6 ] dodecan bis ( trifluoromethylsulfonyl ) imide ; 6 - azonia - spiro [ 5 , 6 ] dodecan dicyanamide ; 1 - benzyl - 3 - methylimidazolium chloride 1 - butyl - 1 , 3 - dimethylpiperidinium bis ( trifluoromethylsulfonyl ) imide ; 1 - butyl - 1 , 3 - dimethylpiperidinium dicyanamide ; 1 - butyl - 3 - methylimidazolium bis ( trifluoromethylsulfonyl ) imide ; 1 - hexyl - 3 - methylimidazolium chloride ; 1 - ethyl - 3 - methylimidazolium bis ( trifluoromethylsulfonyl ) imide ; 1 - butyl - 3 - methylimidazolium tetrafluoroborate ; 1 - ethyl - 3 - methylimidazolium acetate ; 1 - ethyl - 3 - methylimidazolium thiocyanate ; 1 - ethyl - 3 - methylimidazolium ethylsulfate ; n , n - dimethylethanolamine acetate and combinations thereof , but is not limited thereto . any known ionic solvent can be used , with preferred ionic solvents being those that have a boiling point of about 200 ° c . or greater , which is the temperature at which reaction yield increases . as such , reaction yield can be increased while ionic solvent is removed and recovered . in addition , in the case where the synthetic reaction is carried by adding lactic acid oligomers to an ionic solvent , it is possible to reduce the amount of the ionic solvent . generally , the present invention adds the ionic solvent in a low amount of about 20 parts by weight based on 100 parts by weight of the lactic acid oligomers , while still making it possible to synthesize lactide at a high yield . while the present method allows for the addition of such small amounts of ionic solvent , there is no limitation to the amount of ionic solvent added . thus , for example , it is possible to synthesize lactide by reacting lactic acid oligomers in the presence of an excessive amount of ionic solvent . in an exemplary embodiment of the present invention , when the lactic acid oligomers are used in the step ( a ), lactide can be synthesized by using the lactic acid oligomers having a molecular weight of about 600 to 9000 g / mol . in an exemplary embodiment of the present invention , a catalyst is further added to the step of lactide synthesis . any suitable catalysts can be used in the method of the present invention and preferably , the catalyst is selected from the group consisting of al ( iso - pro ) 3 ; al ( ethyl acetoacetate ) 3 ; al ( alo ( iso - pro )) 3 ; ti ( iso - pro ) 4 ; ti (( iso - pro ) 2 ( acethylacetonate )) 2 ; ti ( acethylacetonate ) 4 ; zn ( hexanoate ) 2 ; zn ( stearate ) 2 ; zn ( naphthenate ) 2 ; zncl 2 ; zno ; zr ( n - pro ) 4 ; zro ( stearate ) 2 ; zr ( acethylacetonate ) 4 ; zr ( n - buo ) 3 ( acethylacetonate ); zro ( aco ) 2 ; zro ( oh ) 2 ; zro 2 ; sn ( octoate ) 2 ; and combinations thereof . in general , any catalysts that include a metal such as ti , zn , zr , sn or al and are capable of increasing a reaction yield can be used . in an exemplary embodiment of the present invention , it is possible to continuously synthesize lactide by sequentially adding the lactic acid oligomers after the synthesis of lactide is completed . further , according to the present method , the ionic liquid does not participate in the synthetic reaction , and thus , it can be used sequentially in the following continuous reactions . because the ionic liquid exists in a liquid state at room temperature , simple washing of a reactor can be optionally carried out by using the ionic liquid as a medium . the term “ simple washing ” as used herein refers to simple rinse - out rather than a complicated washing of the whole reactor that is typically required of a reactor in which lactide is prepared . therefore , the present invention provides an eco - friendly method for preparing lactide which is characterized by minimizing unnecessary processing , such as reactor washing , and which reduces the amount of a solvent used in the reaction . the following examples illustrate the invention and are not intended to limit the same . lactic acid oligomers were prepared by using lactic acid monomer at 150 ° c ., 0 . 3 atm ( 228 mmhg ) for 2 hours , and then , based on 100 parts by weight of the lactic acid oligomers that would be converted into lactide , 50 parts by weight of 1 - butyl - 3 - methylimidazolium chloride as an ionic liquid were added thereto . after that , 0 . 05 parts by weight of zno as a catalyst was added to the resulting mixture based on 100 parts by weight of the lactic acid oligomers , followed by performing the synthetic reaction of lactide at 150 ° c ., 0 . 05 atm ( 38 mmhg ) for 2 hours . after the synthetic reaction was completed , lactide was obtained with a yield of 80 % or greater , and the reaction was progressed continuously . lactic acid oligomers were prepared by using lactic acid monomers at 150 ° c ., 0 . 3 atm ( 228 mmhg ) for 2 hours , followed by introducing the lactic acid oligomers into a reactor where lactide was synthesized by using 1 - butyl - 3 - methylimidazolium chloride . under the same conditions of lactide synthesis as described in example 1 , lactide was continuously synthesized for 2 hours . after the synthetic reaction was completed , lactide was obtained as the amount of the lactic acid oligomers added thereto ( i . e ., lactide was produced in about the same amount as the lactic acid oligomers used ). in particular , the lactide was produced with a yield of greater than about 80 % of the amount of oligomer added after the production of the first lactide . lactide was synthesized according to the same conditions as described in example 1 except that lico 3 was used as a catalyst . after the synthetic reaction was carried out 2 hours , lactide was synthesized with a yield of 85 % or greater ( wherein the yield is the amount of lactide synthesized based on the amount of lactic acid oligomers used ). lactide was synthesized according to the same conditions as described in example 1 except that 1 - butyl - 3 - methylimidazolium chloride as an ionic liquid was used in an amount of 30 pats by weight based on 100 parts by weight of the lactic acid oligomers . after the synthetic reaction was carried out 2 hours , lactide was synthesized with a yield of 80 % ( based on the amount of lactic acid oligomers added ). lactic acid oligomers were prepared by using lactic acid monomers at 150 ° c ., 0 . 3 atm ( 228 mmhg ) for 2 hours , and zno as a catalyst was added thereto in an amount of 0 . 05 wt % based on the amount of lactic acid oligomers . the resulting mixture was subjected to a lactide synthetic reaction at 150 ° c ., 0 . 05 atm . the synthetic reaction was carried out 1 hour , but there was little synthetic reaction . the yield ( lactide ) of the synthesis was about 15 % ( based on the amount of lactic acid oligomer added ), and the majority reaction product was lactic acid ( i . e . a majority of the remaining 85 % produced by the reaction ). in particular , 15 % of lactide was produced from the initial input of oligomers and most of the remainder is present in the oligomer state . after the reaction according to comparative example 1 was completed , the resulting mixture was subjected to a further reaction at 160 ° c . for 3 hours . as a result , about a 15 % yield of lactide was synthesized ( based on the amount of lactic acid oligomer added ). however , no additional synthetic reaction occurred . lactic acid oligomers were prepared by using lactic acid monomer at 150 ° c ., 0 . 3 atm ( 228 mmhg ) for 2 hours , and zno as a catalyst was added thereto in an amount of 0 . 05 wt % based on the amount of lactic acid oligomer . the resulting mixture was subjected to a lactide synthetic reaction at 205 ° c . and 0 . 05 atm or lower . after the synthetic reaction was carried out 2 hours , lactide was synthesized with a yield of 80 % ( based on the amount of lactic acid oligomers added ). as demonstrated , the preparation method of the present invention was capable of consecutively synthesizing lactide with a yield of about 85 % or greater ( based on the amount of lactic acid oligomers added ) at a reaction temperature of about 150 ° c . on the other hand , the preparation method according to comparative examples was capable of merely synthesizing lactide with a yield of about 15 % at a reaction temperature of about 160 ° c . in a non - consecutive manner , and could only non - consecutively synthesize lactide with a yield of 85 % of greater at a reaction temperature of about 205 ° c . the invention has been described in detail with reference to exemplary embodiments thereof . however , it will be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principles and spirit of the invention , the scope of which is defined in the appended claims and their equivalents . | 2 |
for the envisaged therapeutical uses , hgf from different sources can be used , for example from animal or human organs or from prokaryotic or eukaryotic cells transformed with genes coding for hgf . by the term hgf , an activated form of hgf is obviously meant , such as described in example 1 and 6 . the use of human recombinant hgf is preferred , but the invention also applies to all the possible variants of hgf , including any deletion and / or substitution mutant forms . the hepatocyte growth factors will be formulated in dosage forms suitable to the administration of protein substances . the formulations of the invention therefore will be administered preferably by the parenteral route and they can be prepared using conventional techniques and excipients , as described for example in remington &# 39 ; s pharmaceutical sciences handbook , mack pub . co ., n . y ., usa . anyhow , other administration routes already suggested for protein active principles , such as the nasal , sublingual , rectal and oral routes , cannot be excluded . for the latter , the active principle will suitably be protected from metabolic degradation making use of known techniques , for example the inclusion in liposome vesicles . the hgf dosage , according to the invention , may vary within wide ranges , for example from about 0 . 01 mg to about 10 mg of hgf , one or more times daily . the following examples further illustrate the invention . full - length hgf cdna was cloned from human liver mrna and inserted into the baculovirus transfer vector pvl1393 ( invitrogen , san diego , calif .). the recombinant vector was cotransfected with the bsul - digested bacpak6 viral dna ( clontech laboratories , palo alto , calif .) into spodoptera frugiperda insect cells ( sf9 ) by the lipofectin procedure ( gibco - brl , gaithersburg , md .). positive clones were identified and purified by dot - blot hybridization and plaque assay . the recombinant virus was used to infect sf9 cells with dilutions of 10 - 1 , 10 - 2 , 10 - 3 , 10 - 6 . after one week , the infected cell extracts were blotted on a nylon filter and probed with radiolabelled full - length human hgf cdna . the viruses containing the hgf cdna gene were subsequently purified by plaque assay . single viral clones were isolated and used for large scale infection of sf9 cells . the recombinant factor was purified by affinity chromatography on heparin ( biorad laboratories , hercules , calif . ), according to the procedure published by weidner et al ., 1990 , with some modifications . sf9 spodoptera frugiperda cells were grown at 27 ° c . in serum - free sf900 medium ( gibco ltd , scotland ). exponentially growing cultures were infected by adding the viral stock in serumfree culture medium , and the cells were grown for 3 days . the culture medium was then collected and was incubated overnight in the presence of 3 % foetal calf serum at 37 ° c ., to ensure full activation of the precursor ; it was then spun at 300 × g for 15 min , to remove cellular debris , and cleared by centrifugation at 10 , 000 × g for 1 h . the supernatant was buffered to ph = 7 . 4 with tris , supplemented with a mixture of protease inhibitors ( 1 mm pmsf , 50 μg / ml leupeptin , 10 μg / ml aprotinin , 4 μg / ml pepstatin ) and the detergent chaps to a final concentration of 0 . 2 % w / v , filtered on a 0 . 45 μm pore tuffryn membrane filter ( gelman sciences , ann arbor , mich .) by vacuum suction , cooled to 4 ° c . and applied to a 5 ml heparin - agarose column assembled in an fplc apparatus in the cold room with a loading rate of 8 ml / h . the column was sequentially washed with 0 . 15 m nacl , 50 mm tris - hcl ph = 7 . 4 , 0 . 2 % chaps and 0 . 5 m nacl , 50 mm tris - hcl ph = 7 . 4 , 0 . 2 % chaps until the eluant absorbance returned to the baseline . bound materials were eluted with a linear gradient from 0 . 5 m to 1 . 8m nacl over 8 h in 50 mm tris - hcl ph = 7 . 4 , chaps 0 . 2 %, with a flow rate of 0 . 2 ml / min , and 2 ml fractions were collected . the starting material , the column breakthrough and washings , and the eluted fractions , were scored for the content of hgf by the mdck scattering assay ( weidner et al ., 1990 ; naldini et al ., 1992 ). the fractions containing the peak of hgf activity , eluting at approximately 1m nacl , were pooled , concentrated with a diafiltration device with 30 , 000 molecular weight cut off ( amicon div ., grace industrial , switzerland ), checked for biological activity on mdck cells , and purity by sds - page and protein stains , to give pure hgf with an average yield of the procedure of 150 μg from 700 ml of culture supernatant . production of human recombinant pro - hgf in insect cells . hgf cdna was cloned from human liver mrna ( naldini et al ., 1991a ) and inserted as a bamhi - ecori fragment into the baculovirus transfer vector pvl1393 ( invitrogen ). the recombinant vector was co - transfected with the bsui - digested bacpak6 viral dna ( clontech ) into spodoptera frugiperda insect cells ( sf9 ), by the lipofectin procedure . positive viral clones isolated by dot - blot hybridization and plaque assay were used for large scale infection . hgf was obtained from culture supernatant of sf9 infected cells 72 hours post - infection , by affinity chromatography on a heparin - sepharose fplc column ( biorad ), eluted with a linear 0 . 5 - 1 . 8 m nacl gradient . the unprocessed recombinant factor ( pro . sup .• hgf ) was detected by comassie blue staining as a band of 90 kda in sdspage . protein concentration was estimated by comassie blue staining and comparison with a standard curve obtained with increasing amounts of bovine serum albumin . the effect of hgf on the growth and differentiation of hematopoietic progenitors was evaluated in colony formation assays . heparinized samples of bone marrow , fetal umbilical cord blood and adult peripheral blood , obtained from volunteers , were diluted with an equal volume of phosphate buffered saline ( pbs ), and separated by ficoll - hypaque 1077 sd ( pharmacia ) density gradient centrifugation at 550 g for 30 minutes . light - density mononuclear cells ( ld - mc ) were collected , washed twice in pbs and resuspended in iscove modified dulbecco &# 39 ; s medium ( imdm ) ( gibco ) supplemented with 5 % fetal calf serum ( fcs ). mononuclear adherent cells were then removed by a two steps incubation of 30 minutes each in plastic flasks at 37 ° c . mononuclear non - adherent cells ( mnac ) were incubated with neuraminidase - treated sheep erythrocytes for 15 minutes at 37 ° c ., centrifuged and incubated for 45 minutes at 4 ° c . t - lymphocyte - depleted mnac were separated by ficoll - hypaque 1077 sd ( pharmacia ) density gradient centrifugation . t - lymphocyte - depleted mnac were then incubated for 45 minutes at 4 ° c . with the following antibodies : anti - cd3 , anti - cd4 , anti - cd8 , anticd11 , anti - cd19 , anti - cd57 ; most of the remaining b - and t - lymphocytes , monocytes and granulocytes were thus removed by incubation for 45 min . at 4 ° c . with immunomagnetic beads coated with anti - mouse igg ( m - 450 dynabeads , dynal ), subsequently collected by a magnet ( mpc - 1 dynabeads , dynal ). a positive selection of the cd34 + cells was then performed : cells were incubated with an antibody anti - cd34 ( my - 10 ; technogenetics ) for 45 minutes at 4 ° c ., then for 45 minutes at 4 ° c . with immunomagnetic beads coated with anti - mouse igg ; a 4 : 1 beads / cell ratio was found to provide the best recovery . cd34 + cells bound to the beads were then collected by a magnet and resuspended in imdm supplemented with 10 % fcs . an overnight incubation at 37 ° c . was then performed ; to allow cd34 + cells detachment , the beads were subjected to shearing forces by repeated flushing through a pasteur pipette . further details about the negative / positive double selection procedure used have been published previously ( bagnara et al ., 1991 ). the recovered cells were morphologically unidentifiable blast elements on may - grunwald - giemsa staining , slightly contaminated by promyelocytes . flow cytometry analysis indicated that the percentage of cd34 + cells in the selected cell preparations varied between a minimum of 30 % ( when the starting material was bone marrow ) and a maximum of 50 % ( when the starting material was peripheral blood ). contamination by cd4 +, cd2 +, cd16 + or cd19 + cells was constantly below 1 %. the colony assay for erythroid burst - forming units and for multipotent colony - forming units ( cfu - gemm ) was performed according to iscove et al ., 1974 . cord blood , bone marrow or peripheral blood cd34 + cells were plated in 24 - well cell culture clusters ( costar ), at a density of 2 . 5 × 10 3 cells / well , in a medium containing imdm , 30 % fcs , 2 × 10 - 4 m hemin , 5 × 10 - 5 β - mercaptoethanol and 0 . 9 % methylcellulose . the cells were stimulated with the following growth factors alone or in combination : epo 2 ng / ml , il - 3 2 ng / ml , gh - csf 50 ng / ml , scf 20 ng / ml , pro - hgf 2 , 10 or 40 ng / ml . colonies scored positive only when dark - red and containing more than four aggregates . the assay for the 14 - day granulo - monocyte colony - forming units ( cfu - gm ) was performed as previously described ( iscove et al ., 1971 ). cord blood , bone marrow or peripheral blood cd34 + cells were plated in 24 - well cell culture clusters ( costar ), at a density of 2 . 5 × 10 3 cells / well , in a medium containing imdm , 20 % fcs , 0 . 3 % noble agar ( difco ) and the following growth factors alone or in combination : il - 3 2 ng / ml , gm - csf 50 ng / ml , scf 20 ng / ml , pro - hgf 2 , 10 or 40 ng / ml . for the megakaryocyte colony - forming unit ( cfu - meg ) assay , plasma clot assay was performed according to vainchenker et al ., 1979 . cord blood , bone marrow or peripheral blood cd34 + cells were plated in 24 - well cell culture clusters ( costar ), at a density of 2 . 5 × 10 3 cells / well , in a medium containing imdm , 20 mg / ml l - asparagine ( sigma ), 3 . 4 mg / ml cacl 2 , 10 % bovine plasma citrated ( gibco ), 1 % detoxified bovine serum albumin ( bsa , fraction v chon ) ( sigma ), 10 % of heat - inactivated human ab serum and the following growth factors alone or in combination : il - 3 2 ng / ml , gm - csf 50 ng / ml , scf 20 ng / ml , pro - hgf 2 , 10 or 40 ng / ml . after 12 days of incubation , the plasma clot was fixed in situ with methanol - acetone 1 : 3 . for 20 minutes , washed with pbs and air dried . fixed plates were stored at - 20 ° c . until immunofluorescence staining was performed ; cfu - meg colonies were scored as aggregates of 3 - 100 cells intensively fluorescent to monoclonal antibody cd41 ( immunotech ) directed against the iib / iiia glycoprotein complex . binding was shown by fluorescein - conjugated goat anti - mouse ig ( becton dickinson ). the results are schematized in fig1 and 2 , and they show that , in the presence of standard concentrations of erythropoietin ( 2 ng / ml ), hgf dramatically increased the number of colonies derived from the bfu - e precursors ( fig1 ). hgf also stimulated the growth of colonies derived from multipotent cfu - gemm progenitors . the number of colonies was comparable to that obtained by combining known hemopoietic factors such as gm - csf and interleukin - 3 ( gasson , 1991 ; miyajima et al ., 1993 ). it should be noted , however , that the hgf effect was restricted to the stimulation of cfu - gemm and bfu - e . neither granulo - monocytic nor megakaryocytic colonies were ever observed in response to hgf . the response to hgf was dose - dependent and could be observed at concentrations of hgf as low as 5 pm both in erythroid and multipotent colonies ( fig2 ). the hgf action was also studied on cd34 + foetal hematopoietic progenitors , enriched from human umbilical cords blood . it is known that this population contains a percentage of primitive stem cells higher than the population purified from adult bone marrow or peripheral blood ( broxmeyer et al ., 1992 ; lu et al ., 1993 ). as observed in the case of adult hematopoietic progenitors , hgf stimulated both bfu - e and cfu - gemm derived colonies . in the presence of both hgf and stem cell factor ( scf ), a significant increase in the number of cfu - gemm - derived colonies was observed ( fig3 ). in this case , fewer erythroid colonies could be seen compared to those developed in the cultures stimulated by hgf alone . this suggests that the combination of hgf and scf preferentially affects proliferation of multipotent progenitors . the erythroid colonies grown in the presence of both growth factors were extremely large and showed a high hemoglobin content . the size of cfu - gemm derived colonies grown in these conditions was also increased and , within each colony , the erythroid lineage was predominant . in these assays hgf did not synergize with gm - csf and interleukin - 3 , either tested individually or in combination . expression of the hgf receptor in a subpopulation of adult hematopoietic progenitors ( cd34 +). the presence of hgf receptor at the surface of hematopietic progenitors was studied by flow cytometry analysis of bone marrow and peripheral blood mononuclear cells . monoclonal antibodies directed against extracellular epitopes of the hgf receptor β chain were used . a small but clearly identifiable subpopulation of bone marrow cells stained positive for the hgf receptor ( table ). ______________________________________ phenotype positive cells % ______________________________________a . unfractionated hgf - r + 0 . 6 ± 0 . 1 bone marrow hgf - r +/ cd34 + 0 . 3 ± 0 . 05 hgf - r +/ cd34 - 0 . 3 ± 0 . 1 hgf - r +/ scf - r + 0 . 2 ± 0 . 1 hgf - r +/ scf - r - 0 . 4 ± 0 . 1 b . cfu - gemm - derived hgf - r + 15 . 3 ± 1 . 5 colonies c . bfu - e - derived hgf - r + 9 . 7 ± 1 . 2 colonies______________________________________ about half of the cells expressing the hgf receptor also co - expressed the cd34 marker and could thus be identified as hematopoietic - progenitors . as described above , hgf synergized with the scf in stimulating the growth and differentiation of cfu - gemm derived colonies . in line with this observation , a subpopulation of cells co - expressing the hgf and the scf receptors was identified using a monoclonal antibody against extracellular epitopes of the scf receptor . similar results were obtained by flow cytometry analysis of cd34 + progenitors circulating in the peripheral blood . flow cytometry analysis with anti - hgf - receptor antibodies was also performed on cells harvested from the colonies developed in vitro in response to hgf . the table shows that hgf - receptor positive cells were present . expression of hgf and its receptor during the embryonal development of hematopoietic cells . the expression of the hgf receptor was studied in embryonal hematopoietic cells by in situ hybridization of histological sections of mouse embryos . using an antisense met probe , the hgf receptor mrna could be clearly detected in megaloblastic cells located within the cavity of the developing heart and aorta from 10 - 10 . 5 days post coitum . specific mrna could be detected in the hepato / biliary primordium , which at this stage contains hemopoietic precursors . in this developing organ erythroid islands showed a higher levels of hgf receptor mrna , compared with the level of expression observed in the surrounding hepatocytes . from 11 days post coitum the hematopoietic embryonal liver also expressed hgf mrna . in order to prove the mobilization of the bone marrow hemopoietic precursors at the peripheral blood , the murine model has been used . balb / c mice were treated subcutaneously for 4 days with hgf at varied concentrations or with control preparations . at the end of the treatment , mice were killed , the circulating leukocytes were counted and hemopoietic colonies from peripheral blood were cultured . in hgf - treated mice , contrary to the untreated controls , an about 60 % increase in circulating leukocytes was observed as well as an increase in the colonies obtainable from peripheral blood . this phenomenon has an intensity comparable with that of g - csf , already described and used to mobilize bone marrow hematopoietic precursors ( janssen , w . e ., et al ., prog . clin . biol . res . 389 : 429 - 39 ). using in the colony formation assay on cd34 + cells of example 3 equimolecular amounts of activated hgf , obtained according to example 1 , instead of pro - hgf , statistically similar results have been obtained in the colonies count as shown in the enclosed fig4 . 1 . bagnara , g . p ., g . zauli , l . vitale , p . rosito , v . vecchi , g . paolucci , g . c . avanzi , u . ramenghi , f . timeus , and v . gabutti , 1991 . in vitro growth and regulation of bone marrow enriched cd34 + hematopoietic progenitors in diamond - blackfan anemia . blood . 78 ; 2203 - 2210 . 2 . boccaccio , c ., g . gaudino , g . gambarotta , f . galimi , and p . m . comoglio . 1994 . hepatocyte growth factor receptor expression is inducible and is part of the delayed - early response to hgf . j . biol . chem . in press . 3 . bottaro , d . p ., j . s . rubin , d . l . faletto , a . m . l . chan , t . e . kmiecick , g . f . vande woude , and s . a . aaronson . 1991 . identification of the hepatocyte growth factor receptor as the c - met proto - oncogene . science . 251 : 802 - 804 . 4 . broxmeyer , h . e ., hangoc , g ., cooper , s ., riberio , c ., greaves , v ., yoder , m ., wagner , j ., vadhan - raj , s ., benninger , l ., rubinstein , p ., and randolph brown e . 1992 . growth characteristics and expansion of human umbilical cord blood and estimation of its potential for transplantation in adults . proc . natl . sci . ( usa ) 89 : 4109 - 4113 . 5 . broxmeyer , e . h ., r . maze , k . miyazawa , c . carow , p . c . hendrie , s . cooper , g . hangoc , s . vadham - raj , and l . lu . 1992 . the c - kit receptor ands its ligand , steel , as regulators of hemopoiesis . cancer cells . 3 : 480 - 487 . 6 . bussolino , f ., m . f . di renzo , m . ziche , e . bocchietto , m . oliviero , l . naldini , g . gaudino , l . tamagnone , a . coffer , and p . m . comoglio . 1992 . hepatocyte growth factor is a potent angiogenic factor which stimulates endothelial cell motility and growth . j . cell . biol . 119 : 629 - 641 . 7 . clark , s . c ., and r . kamen . 1987 . the human hematopoietic colony - stimulating factors . science . 236 : 1229 - 1237 . 8 . di renzo , m . f ., r . p . narsimhan , m . olivero , s . bretti , s . giordano , e . medico , p . gaglia , p . zara , and p . m . comoglio . 1991 . expression of the met / hgf receptor in normal and neoplastic human tissues . oncogene . 6 : 1997 - 2003 . 9 . galimi , f ., brizzi , m . f ., comoglio , p . m ., 1993 . the hepatocyte growth factor and its receptor . stem cells ii suppl 2 , 22 - 30 . 10 . gasson , j . 1991 . molecular physiology of granulocyte - macrophage colony - stimulating factor . blood . 77 : 1131 - 1145 . 11 . gherardi , e ., j . gray , m . stoker , m . perryman , and a . furlong . 1989 . purification of scatter factor , a fibroblast basic protein that modulates epithelial interactions and movement . proc . natl . acad . sci . usa . 86 : 5844 - 5848 . 12 . giordano , s ., c . ponzetto , m . f . di renzo , c . s ., cooper , and p . m . comoglio . 1989a . tyrosine kinase receptor indistinguishable from the c - met protein . nature . 339 : 155 - 156 . 13 . giordano , s ., m . f . di renzo , r . narshimhan , c . s . cooper , c . rosa , and p . m . comoglio . 1989b . biosynthesis of the protein encoded by the c - met proto - oncogene . oncogene . 4 : 1383 - 1388 . 14 . giordano , s ., z . zhen , e . medico , g . gaudino , f . galimi , and p : m : comoglio . 1993 . transfer of the motogenic and invasive response to scatter factor / hepatocyte growth factor by transfection of the human c - met protooncogene . prac . natl . acad . sci . usa . 90 : 649 - 653 . 15 . grant , d . s ., h . k . kleinman , i . d . goldberg , m . bhargava , b . j . nickoloff , j . l . kinsella , p . j . polverini , and e . m . rosen . 1993 . scatter factor induces blood vessel formation in vivo . proc . natl . acad . sci . usa . 90 : 1937 - 1941 . 16 . halaban , r ., j . f . rubin , y . fusanaka , m . cobb , t . boulton , d . faletto , e . rosen , a . chan , k . yoko , w . white , c . cook , and g . moellmann . 1992 . met and hepatocyte growth factor / scatter factor signal transduction in normal melanocytes and melanoma cells . oncogene . 7 : 2195 - 2206 . 17 . iscove , n . n ., s . senn , j . e till , and e . a . mcculloch . 1971 . colony formation by normal and leukemic human marrow cells in culture : effect of conditioned medium from human leukocytes . blood . 37 : 1 - 5 . 18 . iscove , n . n ., f . sieber , and h . winteralter . 1974 . erythroid colony formation in cultures of mouse and human bone maroow : analysis of the requirement for erythropoietin by gel filtration and affinity chromatography on agarose - concanavalin a . j . cell . physiol . 83 : 309 - 320 . 19 . kan , m ., g . h . zhang , r . zarnegar , g . michalopoulos , y . myoken , w . l . mckeehan , and j . l . stevens . 1991 . hepatocyte growth factor / hepatopoietin a stimulates the growth of rad kidney proximal tubule epithelial cells ( rpte ), rat nonparenchymal liver cells , human melanoma cells , mouse keratinocytes and stimulates anchorage - independent growth of sv40 - transfomed rpte . biochem . biophys . res . commun . 174 : 331 - 331 . 20 . kmiecik , t . e ., i . r . kelleer , e . rosen , and g . f . vande woude . 1992 . hepatocyte growth factor is a synergistic factor for the growth of hematopoietic progenitor cells . blood . 16 : 2454 - 2457 . 21 . koury , m . j ., and m . c . bondurant . 1990 . erythropoietin retards dna breakdown and prevents programmed death in erythroid progenitor cells . science . 248 : 378 - 381 . 22 . lu , l ., m . xiao , r . n . shen , s . grisby , and h . e . broxmeyer . 1993 . enrichment , characterization and responsiveness of single primitive cd34 + human umbilical cord blood hematopoietic progenitors with high proliferative and replating potential . blood . 81 : 41 - 48 . 23 . matsumoto , k ., hashimoto , k . yoshikaua , and t . nakamura . 1991 . marked stimulation of growth and motility of human keratinocytes by hepatocyte growth factor . exp . cell . res . 196 : 114 - 120 . 24 . metcalf , d . 1984 . the hemopoietic colony stimulating factors . elsevier , amsterdam . 25 . metcalf , d . 1987 . the molecular control of cell division , differentiation , commitment and maturation in hemopoietic cells . nature . 339 : 27 - 30 . 26 . michalopoulos , g . k . 1990 . liver regeneration : molecular mechanisms of growth control . faseb j . 4 : 176 - 187 . 27 . miyajima , a ., a . l . mui , t . ogorochi , and k . sakamaki . 1993 . receptors for granulocyte - macrophage colony - stimulating factor , interleukin - 3 and interleukin - 5 . blood . 82 : 1960 - 1974 . 28 . miyazawa , k ., h . tsubouchi , d . naka , k . takahashi , h . okigaki , n . arakaki , h . nakayama , s . hirono , o . sakiyama , k . takahashi , e . godha , y . daikuhara , and n . kitamara . 1989 . molecular cloning and sequence analysis of cdna for human hepatocyte growth factor . biochem . biophys . res . commun . 163 : 967 - 973 . 29 . montesano , r ., k . matsumoto , t . nakamura and l . orci . 1991 . identification of a fibroblast - derived epithelial morphogen as hepatocyte growth factor . cell . 67 : 901 - 908 . 30 . nakamura , t ., t . nishizawa , m . hagiya , t . seki , m . shimonishi , a . sugimura , k . tashiro , and s . shimizu . 1989 . molecular cloning and expression of human hepatocyte growth factor . nature . 342 : 440 - 443 . 31 . naldini , l ., m . weidner , e . vigna , g . gaudino , a . bardelli , c . ponzetto , r . narshimhan , g . hartmann , r . zarnegar , g . michalopoulos , w . birchmeier , and p . m . comoglio . 1991a . scatter factor and hepatocyte growth factor are indistinguishable ligands for the met receptor . embo j . 10 : 2867 - 2878 . 32 . naldini , l ., e . vigna , r . p . narshiman , g . gaudino , r . zarnegar , g . michalopoulos , and p . m . comoglio . 1991b . hepatocyte growth factor ( hgf ) stimulates the tyrosine kinase activity of the receptor encoded by the proto - oncogene c - met . oncogene . 6 : 501 - 504 . 33 . park , m ., m . dean , k . kaul , m . j . braun , m . a . gonda , and g . f . vande woude . 1987 . sequence of met protooncogene cdna has features characteristic of the tyrosine kinase family of growth - factor receptors . proc . natl . acad . sci . usa . 84 : 6379 - 6383 . 34 . pepper , m . s ., k . matsumoto , t . nakamura , l . orci , and r . montesano . 1992 . hepatocyte growth factor increases urokinase - type plasminogen activator ( μ - pa ) and μ - pa receptor expression in madin - darby canine kidney epithelial cells . j . biol . chem . 267 : 20493 - 20496 . 35 . prat , m ., r . p . narsimhan , t . crepaldi , m . r . nicotra , p . g . natali , and p . m . comoglio . 1991a . the receptor encoded by the human c - met oncogene is expressed in hepatocytes , epithelial cells and solid tumors . int . j . cancer . 49 : 323 - 328 . 36 . rubin , j . s ., a . m . l . chan , d . p . bottaro , w . h . burgess , w . g . taylor , a . c . cech , d . w . hirschfield , j . wong , t . hiki , p . w . finch , and s . a . aaronson . 1991 . a broad - spectrum human lung fibroblast - derived mitogen is a variant of hepatocyte growth factor . proc . natl . acad . sci . usa . 88 : 415 - 419 . 37 . sonnenberg e ., d . meyer , k . m . weidner , and c . birchmeier . 1993 . scatter factor / hepatocyte growth factor and its receptor , the c - met tyrosine kinase , can mediate a signal exchange beyween mesenchyme and epithelia during mouse development . j . cell . biol . 123 : 223 - 235 . 38 . sporn , m . b ., and a . b . roberts . 1992 . transforming growth factor - β : recent progress and new challenges . j . cell . biol . 119 : 1017 - 1021 . 39 . stern , c . d ., g . w . ireland , s . e . herrick , e . gherardi , j . gray , m . perryman , and m . stoker . 1990 . epithelial scatter factor , and m . stoker . 1990 . epithelial scatter factor , and m . stoker . 1990 . epithelial scatter factor and development of the chick embryonic axis . 110 : 1271 - 1284 . 40 . stoker , m ., e . gherardi , m . perryman , and j . gray . 1987 . scatter factor is a fibroblast - derived modulator of epithelial cell mobility . nature . 327 : 239 - 242 . 41 . vainchenker , w ., j . bouquet , j . guichard , and j . breton - gorius . 1979 . megakaryocyte colony formation from human bone marrow precursors . blood 59 : 940 - 945 . 42 . weidner , k . m ., j . behrens , j . vandekerckove , and w . birchmeier . 1990 . scatter factor : molecular characteristics and effect on the invasiveness of epithelial cells . j . cell . biol . 11 : 2097 - 2108 . 43 . weidner , k . m ., n . arakaki , j . vandekerchove , s . weingart , g . hartmann , h . rieder , c . fonatsch , h . tsubouchi , t . hishida , y . daikuhara , and w . birchmeier . 1991 . evidence for the identity of human scatter factor and hepatocyte growth factor . proc . natl . acad . sci . usa . 88 : 7001 - 7005 . | 0 |
the novel features believed characteristic of the invention are set forth in the appended claims . the invention will best be understood by reference to the following detailed description of illustrated embodiments when read in conjunction with the accompanying drawings , wherein like reference numerals and symbols represent like elements . fig1 - 3 together refer to an aromatherapy face mask , hereinafter referred to as face mask 10 . the face mask 10 has a face shield 12 that is infused with aromatherapy oils 30 and has two ear loops 26 coupled at opposite ends of the face shield 12 . fig1 is a perspective view of an embodiment of the face mask 10 of the present invention . in this embodiment , the face shield 12 is rectangular and the two ear loops 26 extend from opposite ends of the rectangular face shield 12 . each ear loop 26 has a first end coupled to a top corner 16 of the rectangular face shield 12 and a second end coupled to a bottom corner 18 of the rectangular face shield 12 . it should be clearly understood , however , that substantial benefit may be derived from the ear loops 26 being coupled to other suitable portions of the face shield 12 . the face mask 10 may also have a moldable nose piece 28 coupled along a top edge 14 of the rectangular face shield 12 . referring to fig2 , the face shield 12 is shown having three layers . the first layer 20 and the third layer 24 are both fluid - resistant . the second layer 22 is absorptive and is infused with essential aromatherapy oils 30 ( see fig1 ). here , the nose piece 28 is shown being coupled between the second layer 22 and the third layer 24 . fig3 shows the face mask 10 of fig1 in use by a user 32 . in this embodiment , the user 32 is a health care provider . however , it should be clearly understood that substantial benefit may be derived from a user 32 that is not a health care provider . the absorptive second layer 22 of the face shield 12 is infused with aromatherapy oils 30 . the user 32 will wear the face mask 10 by placing the third layer 24 of the face shied 12 against his / her face and looping the ear loops 26 around the user &# 39 ; s 32 ears . the user 32 will breathe in the scent of the aromatherapy oils 30 thus affecting the mood of the user 32 . the affect that the scent of the aromatherapy oils 30 have on the user 32 depends upon the scent of the oils 30 . some scents will affect the mood of the user 32 . for example , vanilla scent will have a soothing and calming effect , sweet orange scent will promote happiness and reduce anxiety , grapefruit scent will induce euphoria and relieve performance anxiety , and chamomile will promote peace and reduce tension . lemon scent will be refreshing and uplifting to the user 32 . and a combination of lavender and vanilla scents will help combat stress and relieve tension . other scents may be useful in combating symptoms of the user 32 . for example , peppermint scent may soothe a headache or clear the user &# 39 ; s 32 sinuses . a combination of lemon , grapefruit , and geranium scents will activate and balance the mind and emotions , and may help clear the user &# 39 ; s 32 head . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details may be made therein without departing from the spirit and scope of the invention . | 0 |
for further illustrating the invention , experiments detailing a method for manufacturing a compound refractive lens for focusing x - rays in two dimensions are described below . it should be noted that the following examples are intended to describe and not to limit the invention . as shown in fig1 a - 2 b , a method for manufacturing a compound refractive lens for focusing x - rays in two dimensions , the method comprising the following steps : 1 ) preparation of a mother lens for the compound refractive lens for focusing x - rays : a ) using a glass substrate - chrome material to prepare a photolithographic mask of the mother lens by using an electron beam lithography ; the photolithographic mask of the mother lens comprising a plurality of first parabola - shaped holes and a plurality of square holes arranged coaxially at intervals ; a cross section of each of the first parabola - shaped holes being formed by connecting openings of two symmetrical parabolas ; equation of the two parabolas of the first parabola - shaped hole being represented by x 2 = 2rz , in which , r representing radius of curvature at the vertex of the parabolas ; x and z representing an x axis and a z axis in a rectangular coordinate system , respectively , as shown in fig1 ; a major axis and a minor axis of the first parabola - shaped hole being calculated by the above equation ; the number of the square holes being n , and a side length of the square hole being 1 + δ ; b ) cleaning a glass substrate ; c ) depositing a copper , aluminum , or gold film on the cleaned glass substrate as an electroforming cathode film using a sputtering method or an evaporation method ; d ) spin coating a layer of a bp212 positive photoresist on the electroforming cathode film ; baking , and curing the positive photoresist ; e ) spin coating a layer of a su - 8 photoresist having a thickness of 1 on the bp212 positive photoresist ; f ) exposing , developing , and hardening the coated su - 8 photoresist , and using the photolithographic mask of the mother lens prepared in step a ); g ) washing a first sample piece obtained from step f ), and removing an exposed bp212 positive photoresist from an upper surface ; h ) placing the first sample piece treated by step g ) in an electroforming solution for electroforming ; and the electroforming material being copper , nickel , iron , or chromium ; i ) taking the first sample piece out of the electroforming solution when a thickness of the electroforming metal is the same as the thickness of the su - 8 photoresist , that is 1 ; and washing the first sample piece to remove remaining electroforming solution ; j ) immersing the first sample piece in an acetone solution ; removing the bp212 positive photoresist and the su - 8 photoresist adhering on it to yield the mother lens of the compound refractive lens for focusing x - rays ; 2 ) preparation of a daughter lens for the compound refractive lens for focusing x - rays : k ) using a glass substrate - chrome material to prepare a photolithographic mask of the daughter lens by using the electron beam lithography ; the photolithographic mask of the daughter lens comprising a clamping arm and a plurality of square embedded lens bodies coaxially arranged on the clamping arm ; the number of the square embedded lens bodies is n , which is the same as the number of the square holes of the mother lens ; each of the square embedded lens bodies comprising a second parabola - shaped hole having a cross section formed by connecting openings of two symmetrical parabolas ; equation of the two parabolas of the second parabola - shaped hole being represented by y 2 = 2rz , in which , r representing radius of curvature at the vertex of the parabolas ; y and z representing a y axis and the z axis in a rectangular coordinate system , respectively , as shown in fig1 ; a major axis and a minor axis of the second parabola - shaped hole being calculated by the above equation ; a center of the second parabola - shaped hole and a center of the square embedded lens body coincide ; the square embedded lens body has a side length of 1 ; the square embedded lens body and the clamping arm are integrated as a whole body ; and a thickness of the clamping arm being t ; l ) cleaning a silicon substrate ; m ) spin coating a layer of bp212 photoresist on a surface of the cleaned silicon substrate ; and pre - baking to yield a second sample piece ; n ) depositing a copper , aluminum , or gold film on the second sample piece obtained from step m ) as an electroforming cathode film using the sputtering method or the evaporation method ; o ) spin coating a layer of kmp c5315 photoresist on the second sample piece from step n ); p ) spin coating a layer of su - 8 photoresist having a thickness of 1 on the second sample piece from step o ); q ) exposing , developing , and hardening the coated su - 8 photoresist , and using the photolithographic mask of the daughter lens prepared in step k ); r ) removing an exposed kmp c5315 photoresist from an upper surface using a degumming agent of kmp c5315 ; s ) placing the second sample piece treated by step r ) in an electroforming solution for electroforming ; and the electroforming material being copper , nickel , iron , or chromium but different from the material of the electroforming cathode film ; t ) taking the second sample piece out of the electroforming solution when a thickness of the electroforming metal is the same as the thickness of the su - 8 photoresist , that is 1 ; and washing the second sample piece to remove remaining electroforming solution ; u ) immersing the second sample piece in an acetone solution ; removing the kmp c5315 photoresist and the su - 8 photoresist adhering on it , and meanwhile removing the bp212 photoresist and the silicon substrate ; v ) removing the electroforming cathode film from the second sample piece after treatment of step u ) using a method of chemical etching to yield the daughter lens of the compound refractive lens for focusing x - rays ; and w ) placing the mother lens and the daughter lens beneath a microscope , finding and clamping the clamping arm of the daughter lens , aligning the square embedded lens bodies of the daughter lens with the square holes of the mother lens , respectively , for allowing the first parabola - shaped holes and the second parabola - shaped holes to form an orthogonal structure and allowing the n square embedded lens bodies of the daughter lens to fit the n square holes of the mother lens , respectively ; and inserting and pressing the square embedded lens bodies into the corresponding square holes , respectively . a distance between the center of the first parabola - shaped hole and the center of the square hole in step a ) is 1 . a distance between adjacent square embedded lens bodies in step k ) is 1 . the compound refractive lens for focusing x - rays of the example comprises : the glass substrate , the mother lens disposed on the glass substrate , and the daughter lens embedded in the mother lens ( as shown in fig1 ). the glass substrate functions a base of the compound refractive lens for focusing x - rays , and the manufacturing of the mother lens is performed on the glass substrate . the mother lens comprises a body material of the mother lens , and the first parabola - shaped cavities and the square cavities arranged in order at intervals on the body material . the square cavities are used for accommodating the daughter lens . the daughter lens comprises the clamping arm and the embedded lens bodies . the embedded lens bodies are in the square shapes ; and a second parabola - shaped cavity is disposed in a center of each of the square embedded lens bodies . the embedded lens bodies of the daughter lens are inserted into the square cavities of the mother lens from an upper of the mother lens . the first parabola - shaped cavity of the mother lens and a paraboloid of the second parabola - shaped cavity of the daughter lens achieve the refraction of the x - ray to focus the x - ray radiation along the minor axis of the parabola . the 2d focusing function of the compound refractive lens for focusing x - rays of the invention is realized by a plurality of the 2d focusing and refractive unit ( as shown in fig1 c ) which is formed by two perpendicularly arranged parabolas ( one is along a y axis , and the other is along an x axis ). an incident light of x - ray beam is radiated on the compound refractive lens for focusing x - rays along a z axis of a coordinate system , after being refracted by a plurality of the 2d focusing and refractive units , the x - ray exits from the compound refractive lens for focusing x - rays to form a 2d focal spot . a major axis of the first parabola - shaped hole and the second parabola - shaped hole is 42 μm , a minor axis is 32 μm , l is 50 μm , δ is 1 μm , n is 20 , and t is 50 μm . the material of the electroforming cathode film is copper ; and the electroforming material is nickel . as shown in fig1 a - 2 b , manufacturing steps of the compound refractive lens for focusing x - rays in two dimensions are the same as that of example 1 , except that a major axis of the first parabola - shaped hole and the second parabola - shaped hole is 242 μm , a minor axis is 222 μm , l is 250 μm , δ is 2 μm , n is 100 , and t is 100 μm . the material of the electroforming cathode film is aluminum ; and the electroforming material is nickel . as shown in fig1 a - 2 b , manufacturing steps of the compound refractive lens for focusing x - rays in two dimensions are the same as that of example 1 , except that a major axis of the first parabola - shaped hole and the second parabola - shaped hole is 200 μm , a minor axis is 180 μm , l is 210 μm , δ is 1 . 5 μm , n is 80 , and t is 80 μm . the material of the electroforming cathode film is gold ; and the electroforming material is iron . while particular embodiments of the invention have been shown and described , it will be obvious to those skilled in the art that changes and modifications may be made without departing from the invention in its broader aspects , and therefore , the aim in the appended claims is to cover all such changes and modifications as fall within the true spirit and scope of the invention . | 6 |
please refer to fig3 through fig5 . fig3 through fig5 are perspective diagrams showing the means of fabricating a transistor containing suicides according to the present invention . as shown in fig3 , a substrate 200 is first provided and a gate structure having a gate dielectric layer 202 and a gate 204 is formed over the surface of the substrate 200 , in which the gate 204 is composed of conductive materials such as doped polysilicon . next , a lightly doped ion implantation is performed to implant a light dopant ( not shown ) into two sides of the substrate 200 corresponding to the gate 204 to form a source / drain extension region 210 by utilizing the gate 204 as a mask . next , a liner 206 , such as a silicon oxide layer , is deposited around the gate structure and a spacer 208 is formed over the surface of the liner 206 , in which the spacer 208 is composed of a silicon oxide offset spacer and a silicon nitride spacer . next , a heavily doped ion implantation is performed to implant a heavy dopant ( not shown ) into the substrate 200 to form a source / drain region 212 with heavier dopant concentration by utilizing the gate 204 and the spacer 208 as a mask . next , a thermal annealing process utilizing a temperature ranging from 1000 ° c . to 1020 ° c . is performed to activate the dopants within the substrate 200 and repair the damage of the crystal lattice structure of the substrate 200 during the ion implantation process . next , a low temperature selective epitaxial growth ( seg ) is performed to form an epitaxial layer 216 over the surface of the source / drain extension region 210 and the source / drain region 212 , in which the epitaxial layer 216 is composed of silicon germanium , as shown in fig4 . next , another ion implantation process is performed to implant a retarded dopant 214 , such as fluoride ions , nitrogen , and oxygen , into the junction area between the epitaxial layer 216 and the source / drain region 212 and the gate 204 to form a retarded interface layer . alternatively , depending on the retarded property of the dopants , a surface treatment , such as an ion implantation process , a plasma treatment , or a gas or liquid treatment containing high concentration dopants with retarded property can be performed on the surface of the gate 204 , the source / drain extension region 210 , and the source / drain region 212 to form the retarded interface layer containing dopants with retarded effects before performing the low temperature selective epitaxial growth to form the epitaxial layer 216 . next , a surface cleaning process is performed to completely remove the native oxides and other impure materials remaining on the surface of the epitaxial layer 216 and a sputtering or deposition process is performed to form a metal layer ( not shown ) on the epitaxial layer 216 , in which the metal layer is composed of cobalt , titanium , nickel , platinum , palladium , and molybdenum . subsequently , as shown in fig5 , a rapid thermal process ( rtp ) is performed to react the metal layer with the epitaxial layer 216 deposited earlier to form a silicide layer 220 over the top of the gate 204 and the source / drain region 212 and the non - reacted portion of the metal layer is removed afterwards . since the dopants are implanted into the surface of the gate 204 and the source / drain region 212 via the ion implantation process performed earlier , the reaction between the metal layer and the epitaxial layer 216 will ideally stop at the retarded interface layer . in other words , the present invention is able to effectively utilize the location of the retarded interface layer and the thickness of the epitaxial layer 216 to accurately control the thickness and depth of the silicide layer 220 , thereby adjusting the contact resistance and improving conventional problems such as junction leakage , which is caused by an overly short distance between the source , drain , and substrate of the pn junction and the silicides , and nickel silicide piping effect , which is caused by the approach of suicides into the channel area during silicide reactions . additionally , since the epitaxial layer 216 will be reacted completely to form the silicide layer 220 , the present invention is able to replace the selectively epitaxial growth ( seg ) process described earlier with a low temperature selective polysilicon growth process to form a polysilicon layer over the surface of the source / drain extension region 210 and the source / drain region 212 . as shown in fig5 , after the fabrication process is completed , a transistor 222 having silicide structure is obtained , in which the transistor 222 includes a substrate 200 , a gate 204 formed on the substrate 200 , a gate dielectric layer 202 formed under the gate 204 , a spacer 208 formed over the surface of the sidewall of the gate 204 , a liner 206 formed between the sidewall of the gate 204 and the spacer 208 , and a suicide layer 220 formed on top of the gate 204 and two sides of the substrate 200 corresponding to the spacer 208 . additionally , a source / drain region 212 and a source / drain extension region 210 are formed within the substrate 200 . preferably , a retarded dopant 214 is included between the source / drain region 212 and the silicide layer 220 to form a retarded interface layer , in which the dopant is implanted by an ion implantation process and fluoride ions , nitrogen , and oxygen are utilized as the ion source . overall , the advantage of the present invention is to perform an ion implantation process before or after disposing an epitaxial layer on the top of the gate and the surface of the source / drain region . eventually , the retarded dopant injected is to be utilized as a retarded interface layer to stop the reaction of the salicide fabrication , thereby improving problems such as junction leakage , which is caused by an overly short distance between the source , drain , and substrate of the pn junction and the silicides , and nickel silicide piping effect , which is caused by the approach of suicides into the channel area during silicide reactions . additionally , a thicker epitaxial is formed over the surface of the gate and the source / drain region as the epitaxial layer will be reacted into a silicide layer in the final stage of the process , thereby reducing the sheet resistance of the source / drain region . consequently , the present invention is able to obtain a field effect transistor with much better ultra shallow junction structure and source / drain region with lower sheet resistance . those skilled in the art will readily observe that numerous modifications and alterations of the device and method may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims . | 7 |
the present invention describes an apparatus that permits the planting of salmonid and other fish eggs in stream and lake beds without the necessity of complex channels and permanent facilities such as hatchery buildings . also included is a method of planting fish eggs including salmon eggs without the use of difficult to prepare trenches and settling ponds . referring to fig1 the article of this invention is comprised of a hopper or bin 1 used as a receptacle for fertilized fish eggs . this hopper has an opening at its base 2 which permits the fertilized eggs to flow from the hopper . to regulate the flow of fertilized salmon eggs from the hopper and to prevent upflowing of water during flushing control valve 3 is utilized . the hopper 1 is connected with central chamber 4 . this chamber 4 has a pair of lateral openings 5 and 6 . lateral opening 6 is capped by cap 7 to prevent leakage of water . water is pumped from a water source , usually from upstream by means of a pump ( not shown ), into lateral opening 5 of central chamber 4 though perforations 8 . in order to regulate the flow of water , control valve 9 is employed . from the central chamber 4 the water , followed by the fertilized eggs , exits through opening 10 into a length of rigid hollow tubing 11 having a pointed base 12 for easy insertion into the stream bed substrates . during operation , valve 3 is in a closed position , while water is pumped into the hollow chamber 4 and is diverted down through the length of rigid hollow tubing 10 . the pressure of the water flushes the stream bed intragravel fines to loosen the gravel and remove life - smothering sediments . through the hydraulic pumping action , the device easily works its way into the gravel . when the apparatus is being used for desiltation and flushing alone , higher water flows are often desirable . in that case , the main valve is opened wide and the pump achieves maximum rpm . during egg deposition , however , water flows are restricted and probing is executed so as to prevent flushing out of previously deposited eggs in gravels adjacent to the planting plot . thus , once an appropriate depth is reached and proper flushing of the silt and fines from the substrate has been achieved , the control valve 9 is placed in a reduced flow or closed position . fertilized salmon eggs are introduced into the hopper 1 and permitted to flow down rigid hollow tube 11 by opening control valve 3 . once the eggs have settled to the base of tube 11 , the apparatus is gently withdrawn from the substrate permitting the eggs to mix with the gravel . a detailed view of the preferred embodiment of the present invention wherein a plurality of planters are joined to permit a multiplicity of simultaneous plantings is shown in fig2 . in this embodiment there is exhibited a plurality of interconnected hoppers 20 - 23 preferably 2 to 6 with splash baffles 24 - 26 containing , preferably , periodically placed , 3 / 16 inch perforations at the point of connection . these hoppers have an opening at their respective bases 27 - 30 . attached to each hopper opening between the hopper and the hollow chamber 35 - 38 are control valves 31 - 34 . each chamber has a pair of lateral openings 39 - 40 , 41 - 42 , 43 - 44 , 45 - 46 . lateral opening 39 is capped by cap 47 . opening 40 of chamber 35 is connected to opening 41 of chamber 36 . opening 42 of chamber 36 is connected to opening 43 of chamber 37 and opening 44 of chamber 37 is attached to opening 45 . joinder may be accomplished by any appropriate means provided it is sufficiently strong to withstand the pressure exerted by the water without leaking . water is pumped into lateral opening 46 from the water source . flow of the water is regulated by control valve 48 . these valves can be , for example , either a ball or gate valve . connected to the base of each central chamber 35 - 38 is a length of rigid hollow tubing 49 - 52 . this tubing is preferably 1 inch diameter polyvinyl chloride ( pvc ) pipe , however , other suitable materials may be employed . in order to prevent distortion of the rigid tubing during insertion , 4 - way &# 34 ; t &# 34 ; stiffness 53 - 56 may be employed . however , suitable reinforcement may be obtained from numerous other materials . during operation , after the water has been pumped through the device and has sufficiently loosened the gravel and removed sediment , the eggs in each hopper may be planted in unison or each bin may be planted in succession depending upon the operator &# 39 ; s preference . the operation of the multiple planting device is the same as the single device . fig3 is a cutaway view of a hollow chamber 36 shown in fig2 giving a detailed view of the interior with the perforations 57 . these perforations permit water to flow through the hollow tubing but prevent the fertilized eggs from becoming entrapped in the central chamber . the splash baffles 24 between hoppers 20 and 21 are also shown . the article of the present invention and the accompanying method may be used to plant in either stream beds or lake beds . in addition to salmon , this invention is useful in the planting of eggs of other salmonid species such as trout and steelhead . besides the two primary functions of the salmonid egg planting device , hydraulic flushing of sediments and deposition of fertilized salmonid eggs , this invention is instrumental in the removal of redeposited siltation on the surface of the stream bed after egg deposition and the injection of nutrients into the water and / or incubation gravel . also the invention may be used in the removal of adult predators and larvae predators either prior to deposition or during incubation . by repeating this sequence of flushing and deposition , the stream or lake bed can be seeded to any desired egg density . the density , however , is dependent upon substrate geomorphology which includes , for example , the following variables , rubble size , size / abundance ratios and the composition of the rubble , depth and degree of aqueous irrigation in the substrate , dissolved oxygen content of the irrigating waters , the species of fish involved , biological oxygen demand of the substrate , amount and form of water flow on the stream bed surface and the dynamics of upwelling intragravel water . at the present time established known figures for egg densities which result in successful fry survival exceed 7 , 000 eggs per square meter . the use of this apparatus allows for adding an additional dimension to salmonid egg planting : multiple depth planting . estimates of potential densities in excess of 25 , 000 eggs per cubic meter for ideal gravels have been suggested . thus , greater production of salmon may be obtained from physically limited spawning areas . as water intake is generally from an upstream source the flushing and planting proceeds in a downstream progression . the insertion of a venturi valve at any point in the pump &# 39 ; s exhaust stem to the main water control valve air may be introduced into the system . the resulting venturi effect gives additional lifting quality to the flushing process . in order to test for favorable water flow during sequential egg deposition , a 2 inches diameter pvc pipe is inserted into the substrate at the desired planting depth . when the probing activities are too close together , water is forced through the gravel raising the water level in the 2 inch tube . when no detectable change in the water level occurs , appropriate waterflow and separation of the egg deposition sites will have been achieved for the specific gravel composition and conditions of that portion of the stream bed . once a satisfactory determination has been achieved , egg deposition may proceed . however , it is advantageous to repeat the test should changes in resistance to probe insertion or change in gravel size be noticed . choice of the appropriate stream bed spawning environment is primarily dependent upon the natural history and physiological requirements of each species . pink salmon ( onchorynchus gorbuscha ) are capable of spawning on tidal flats where the water &# 39 ; s salinity varies with every tide . pink salmon are more resistant to the repeated salt water flushes that are associated with high tidal action wherein king salmon ( onchorynchus tshawytscha ) eggs are intolerant to salt water . the benefits attendant to the use of this invention are numerous . an important factor is that artificial fertilization avoids gamete retention , other social responses that inhibit spawning and wasting viable gametes , etc . also , a favorable planting depth may be easily achieved so that problems caused by scouring , frost , and predators may be avoided . furthermore , the invention allows for multi - level egg deposition while still permitting the upper gradient of the substrate to be utilized for natural spawning . while other methods of mechanical egg planting show successful egg to fry survival ratios none have the benefit of a highly effective flushing action to remove sediment , exactness of deposition , and the patterned deposition permitted by this invention . this invention , by permitting in - stream planting avoids the ecological and other problems incumbent in diverting stream flow , slowing or controlling water volume or the construction of expensive incubation channels . however , where an incubation channel has been constructed this invention may be used to increase yield of salmon fry . while this invention has been described by reference to the preferred embodiments thereof , it will be understood that the invention is not limited thereto , but only to the lawful scope of the appended claims . | 8 |
exemplary embodiments of an electromagnetic shield structure according to an embodiment of the present invention are explained next with reference to the accompanying drawings . although the invention has been described with respect to specific embodiments for a complete and clear disclosure , the appended claims are not to be thus limited but are to be construed as embodying all modifications and alternative constructions that may occur to one skilled in the art which fairly fall within the basic teaching herein set forth . fig1 is a cross - section of an electromagnetic shield structure according to an embodiment of the present invention . an electromagnetic shield - requiring substrate 2 in fig1 is the circuit board substrate that is shielded by the electromagnetic shield structure . various kinds of circuit elements such as transistors , integrated circuits ( ics ), large - scale integrations ( lsis ), etc . are mounted on the electromagnetic shield - requiring substrate 2 . when these circuit elements are powered up , they produce an electromagnetic noise . if the electromagnetic noise is ignored and no appropriate action is taken to check it , it may lead to malfunctioning of the electromagnetic shield - requiring substrate 2 and the electronic gadget of which the electromagnetic shield - requiring substrate 2 is a part , and in addition , may cause other electronic gadgets to malfunction as well . the present embodiment aims to block the electromagnetic noise . a metal frame 1 encloses a top surface 2 a and sides of the electromagnetic shield - requiring substrate 2 . as shown in fig2 and fig3 , the metal frame 1 is a one - side - open , rectangular , metal case . fig2 is a perspective view of the metal frame 1 viewed from above and fig3 is a perspective view of the metal frame 1 viewed from below . the metal frame 1 may be made of any material as long as it effectively blocks the electromagnetic noise . further , although it is mentioned above that the metal frame 1 is one - side - open , rectangular , metal case , it may have any other shapes . for instance , the metal frame 1 may be of a shape that is same as that of the electromagnetic shield - requiring substrate 2 , or of a shape that is same as that of the electronic gadget in which the electromagnetic shield - requiring substrate 2 is mounted . the metal frame 1 may be of any shape as long as it effectively encloses the top surface and the sides of the electromagnetic shield - requiring substrate 2 . the metal frame 1 may also be of any size , such as to suit the size of the electromagnetic shield - requiring substrate 2 or the space inside the electronic gadget in which the electromagnetic shield - requiring substrate 2 is mounted , etc . as long as the metal frame 1 effectively encloses the top surface and the sides of the electromagnetic shield - requiring substrate 2 . the metal frame 1 is electrically connected to the electromagnetic shield - requiring substrate 2 via connecting members 1 a provided inside the metal frame 1 . to be more specific , the metal frame 1 is connected to a connector pad 5 ( see fig4 ) provided on the surface ( the top surface 2 a in fig1 ), in other words , the side that is opposite to a base substrate 11 , of the electromagnetic shield - requiring substrate 2 which is facing the metal frame 1 . the connector pad 5 is connected to an embedded ground ( gnd ) plane 2 c provided within the electromagnetic shield - requiring substrate 2 . fig4 is a magnified view of the region a shown in fig1 , which is the point of connection between the metal frame 1 and the electromagnetic shield - requiring substrate 2 . the connector pad 5 and the embedded gnd plane 2 c are electrically connected by a through hole 2 d that traverses widthwise from the top surface 2 a of the electromagnetic shield - requiring substrate 2 to the embedded gnd plane 2 c . this connector pad 5 may be etched to match the surface pattern that is pre - etched on the top surface 2 a of the electromagnetic shield - requiring substrate 2 . if the electromagnetic shield - requiring substrate 2 is a printed circuit board and the like , the connector pad 5 can be etched together with the wiring print , thus making the etching process simple . the through hole 2 d may have any shape or size as long as it enables the embedded gnd plane 2 c and the top surface 2 a of the electromagnetic shield - requiring substrate 2 to be effectively electrically connected . further , there are no limitations on the number of through holes 2 d , and any number of through holes 2 d may be provided . further , the connector pad 5 used in the electromagnetic shield according to the present invention may be of any material as long as it enables the metal frame 1 and the electromagnetic shield - requiring substrate 2 to be effectively electrically connected . the connector pad 5 again may be of any shape as long as it enables the metal frame 1 and the electromagnetic shield - requiring substrate 2 to be effectively electrically connected , and may have a shape that matches the shape of the connecting member 1 a , and the like . the connector pad 5 may be of any size as long as it enables the metal frame 1 and the electromagnetic shield - requiring substrate 2 to be effectively electrically connected , and may be of a size that matches the size of the connecting member 1 a , and the like . the other surface ( the bottom surface 2 b ) of the electromagnetic shield - requiring substrate 2 is covered by the base substrate 11 provided on the side of the bottom surface 2 b of the electromagnetic shield - requiring substrate 2 . the base substrate 11 functions as a foundation for the electromagnetic shield - requiring substrate 2 . the base substrate 11 is disposed substantially parallel to and at a predetermined distance from the electromagnetic shield - requiring substrate 2 . an embedded gnd plane 4 is disposed in the base substrate 11 running roughly parallel to the main surfaces ( a top surface 11 a and a bottom surface 1 b ) of the base substrate 11 . the width of the embedded gnd plane 4 is broader than the width of the electromagnetic shield - requiring substrate 2 in all directions . consequently , the bottom surface 2 b of the electromagnetic shield - requiring substrate 2 is covered by the embedded gnd plane 4 provided within the base substrate 11 . the base substrate 11 having such a structure is connected to the electromagnetic shield - requiring substrate 2 via connectors 3 provided on the top surface 11 a of the base substrate 11 . an input / output 9 of power and signals from the base substrate 11 to the electromagnetic shield - requiring substrate 2 takes place via the connectors 3 . consequently , no opening is required in the metal frame 1 for connection to the outside . the base substrate 11 is electrically connected to the metal frame 1 via a connector pad 10 provided on the surface ( the top surface 11 a in fig1 , fig5 , and fig6 ) of the base substrate 11 that faces the electromagnetic shield - requiring substrate 2 . to be more specific , as shown in fig5 , the base substrate 11 is connected via the connector pad 10 to a mounting member 1 c provided at an end of a side surface 1 b of the metal frame 1 . the connector pad 10 and the mounting member 1 c may for instance be connected by a solder 12 . the connector pad 10 is connected to the embedded gnd plane 4 provided within the base substrate 11 . fig5 is a magnified view of the region b shown in fig1 , which is the point of connection between the metal frame 1 and the base substrate 11 . fig6 is a view of the region b shown in fig5 cut along the line c - c . the connector pad 10 and the embedded gnd plane 4 are electrically connected by a through hole 6 that traverses widthwise from the top surface 11 a of the base substrate 11 to the embedded gnd plane 4 . the through hole 6 may have any shape or size as long as it enables the embedded gnd plane 4 and the connector pad 10 to be effectively electrically connected . further , there are no limitations on the number of through holes 6 , and any number of through holes 6 may be provided . further , the connector pad 10 used in the electromagnetic shield may be of any material as long as it enables the metal frame 1 and the embedded gnd plane 4 to be effectively electrically connected , and effectively blocks the electromagnetic noise issuing from the electromagnetic shield - requiring substrate 2 . the connector pad 10 again may be of any shape as long as it enables the metal frame 1 and the embedded gnd plane 4 to be effectively electrically connected , and effectively blocks the electromagnetic noise issuing from the electromagnetic shield - requiring substrate 2 . the connector pad 10 may have a shape that matches the shape of the through hole 6 and that of the mounting member 1 c . the connector pad 10 may be of any size as long as it enables the metal frame 1 and the electromagnetic shield - requiring substrate 2 to be effectively electrically connected , and effectively blocks the electromagnetic noise issuing from the electromagnetic shield - requiring substrate 2 . the connector pad 10 may be of a size that matches the size of the through hole 6 or that of the mounting member 1 c . in this manner , according to the present invention , the electromagnetic shield - requiring substrate 2 is covered by a metal frame 1 and the embedded gnd plane 4 of the base substrate 11 . in other words , in this structure , the electromagnetic shield - requiring substrate 2 is electromagnetically sealed by the metal frame 1 and the embedded gnd plane 4 of the base substrate 11 . this structure effectively blocks the electromagnetic noise that is issued when the circuit elements such as the transistor , ic , lsi , etc . mounted on the electromagnetic shield - requiring substrate 2 are powered up . thus , the electromagnetic shield - requiring substrate is effectively shielded by the metal frame 1 and the embedded gnd plane 4 of the base substrate 11 . as a result , malfunctioning of the electromagnetic shield - requiring substrate 2 or the electronic gadget in which the electromagnetic shield - requiring substrate 2 is mounted , and other electronic gadgets caused by the electromagnetic noise issuing from the electromagnetic shield - requiring substrate 2 can be prevented . in this electromagnetic shield structure , the top surface 2 a and the sides of the electromagnetic shield - requiring substrate 2 are covered by the metal frame 1 , and the bottom surface 2 a of the electromagnetic shield - requiring substrate 2 is covered by the embedded gnd plane 4 of the base substrate 11 disposed facing the bottom surface 2 b of the electromagnetic shield - requiring substrate 2 . in a conventional electromagnetic shield structure , as shown in fig7 , an electromagnetic shield - requiring substrate 102 is fixed to a base substrate 111 by connectors 103 . the base substrate 111 functions as a foundation for the electromagnetic shield - requiring substrate 102 . both surfaces ( a top surface 102 a and a bottom surface 102 b ) of the electromagnetic shield - requiring substrate 102 are sealed by covering them with metal frames 101 and 107 . thus , this structure enables blockade of the electromagnetic noise . however , in this structure , more area is required for accommodating the two metal frames 101 and 107 . besides , this structure leads to higher components cost since two metal frames 101 and 107 are required . however , in the electromagnetic shield structure according to the present invention , the need to enclose all the surfaces of the electromagnetic shield - requiring substrate 2 with a metal frame is obviated . in other words , as against two metal frames 101 and 107 required in the conventional electromagnetic shield structure , only one metal frame 1 is required in the present invention . consequently , the area required for accommodating the metal frame can be drastically reduced . thus , the electromagnetic shield structure 20 of the electromagnetic shield - requiring substrate 2 is space - efficient . as a result , the electronic gadget using this space - efficient electromagnetic shield - requiring substrate 2 can be made really compact . in the electromagnetic shield structure of the present invention , the need to enclose all the surfaces of the electromagnetic shield - requiring substrate 2 with a metal frame is obviated . in other words , as against two metal frames 101 and 107 required in the conventional electromagnetic shield structure , only one metal frame 1 is required in the present invention . consequently , the weight of the metal frame can be drastically reduced . thus , a light electromagnetic shield structure 20 is realized . as a result , the electronic gadget using this light electromagnetic shield - requiring substrate 2 can be made lightweight . in the electromagnetic shield structure of the present invention , the need to enclose all the surfaces of the electromagnetic shield - requiring substrate 2 with a metal frame is obviated . in other words , as against two metal frames 101 and 107 required in the conventional electromagnetic shield structure , only one metal frame 1 is required in the present invention . consequently , the cost of the metal frame can be drastically reduced . thus , a cost - effective electromagnetic shield structure 20 is realized . as a result , the cost of the electronic gadget using this cost - effective electromagnetic shield - requiring substrate 2 can be effectively reduced . thus , according to the present invention , a space - efficient and cost - effective electromagnetic shield structure is realized that enables electromagnetic shielding of the electromagnetic shield - requiring substrate 2 . in the above description , a structure is explained in which the metal frame 1 and the electromagnetic shield - requiring substrate 2 are uniquely connected through the connection between the connecting members 1 a of the metal frame 1 and the connector pads 5 of the electromagnetic shield - requiring substrate 2 . however , in the present invention , a structure can be obtained in which the connection can be selected . in other words , as shown in fig8 , a connector pad 13 is provided on the top surface 2 a of the electromagnetic shield - requiring substrate 2 corresponding to the connecting member 1 a of the metal frame 1 . a chip part 14 that connects with the embedded gnd plane 2 c of the electromagnetic shield - requiring substrate 2 is provided on the top surface 2 a of the electromagnetic shield - requiring substrate 2 . thus a structure is obtained in which the metal frame 1 and the electromagnetic shield - requiring substrate 2 can be electrically connected by connecting the connector pad 13 and the chip part 14 by a solder 15 , as shown in fig9 . this structure enables the selection of whether or not the metal frame 1 and the embedded gnd plane 2 of the electromagnetic shield - requiring substrate 2 are to be connected , at the step in which electromagnetic noise radiation is evaluated . the chip part may be a condenser , resistor , inductor , ferrite beats , and the like . the electromagnetic shielding effect of the electromagnetic shield structure according to the present invention can be controlled in according to the selection of the chip part . it is preferable to mount faster circuits on the electromagnetic shield - requiring substrate 2 and slower circuits on the base substrate 11 . in this way , more circuits can be mounted , and in spite of more circuits , the electromagnetic waves issuing from the electromagnetic shield - requiring substrate 2 and the base substrate 11 can be effectively blocked . the electromagnetic shield structure according the present invention can be adapted as an electromagnetic shield of any circuit board substrate that issues electromagnetic noise , though it is most suitable for electronic gadgets in which very low electromagnetic radiation , if at all , from the circuit board substrate is desirable . the electromagnetic shield structure according to the present invention may be used in electronic gadgets in which space - efficiency is desirable . the usefulness of the electromagnetic shield structure can be more effectively demonstrated by using it in electronic gadgets in which very low electromagnetic radiation from the circuit board substrate as well as space efficiency is desirable . although the invention has been described with respect to a specific embodiment for a complete and clear disclosure , the appended claims are not to be thus limited but are to be construed as embodying all modifications and alternative constructions that may occur to one skilled in the art which fairly fall within the basic teaching herein set forth . | 7 |
referring to the drawings generally , wherein like reference numerals designate the same or functionally similar elements throughout the several drawings , and to fig1 in particular , there is shown a schematic sectional side view of a first embodiment of the present invention , drawn to a radiant synthesis gas cooler , generally designated 10 . the synthesis gas cooler 10 is typically a cylindrical vessel having its longitudinal axis oriented vertically . in this embodiment , the cooler 10 is provided with hot synthesis gas 12 from a gasifier ( not shown ) at an inlet 14 provided at the top of the cooler 10 . the gas 12 enters an inner flue or enclosure region 16 provided within the cooler 10 . the inner flue is defined by inner enclosure wall 18 , preferably cylindrical in shape , and comprised typically of fluid - cooled tubes . the working fluid within the tubes may be water , steam or a mixture thereof . in addition to the fluid - cooled tubes forming the inner enclosure wall 18 , the inner flue 16 is also provided with a plurality of fluid - cooled , wing wall surfaces 20 which are internally suspended within the cooler 10 so that a significant portion of the wing walls 20 are exposed to the incoming synthesis gas 12 , thereby heating the working fluid ( again water , steam or a mixture thereof ) conveyed through the wing walls 20 . the wing walls 20 are generally constructed as a planar bank of tubes provided adjacent to one another , and are provided with inlet and outlet manifolds or headers 22 which distribute or collect the working fluid conveyed through the wing walls 20 . the number and arrangement of the wing walls 20 provided would be determined by heat transfer and other requirements . thus , while fig2 illustrates an arrangement of six ( 6 ) wing walls 20 arranged around the vertical longitudinal axis of the cooler 10 , a greater or fewer number of wing walls 20 may be provided to suit particular heat transfer and cooling requirements . as the hot synthesis gas 12 flows down through the inner flue 16 , it is cooled by the inner enclosure wall 18 and the wing walls 20 , and at a bottom region 24 of the inner flue 16 the synthesis gas 12 turns upwardly substantially 180 degrees through one or more openings 26 provided in the inner enclosure wall 18 and then into an outer flue or enclosure region 28 defined by the inner enclosure wall 18 and a similarly constructed outer enclosure wall 30 . the outer flue 28 thus has a substantially annular shape . manifolds or headers 32 may be provided to facilitate formation of these openings 26 , if necessary . the synthesis gas 12 is then conveyed upwardly through the outer flue 28 , through one or more openings 34 , and then out of the cooler 10 via synthesis gas outlet 36 . the distance between the inner enclosure wall 18 and the outer enclosure wall 30 , as well as the distance between the outer enclosure wall 30 and a shell 38 forming the cooler 10 will be of a size sufficient to provide access and inspection when the cooler 10 is out of service . the enclosure walls 18 , 30 forming the inner and outer flues 16 , 28 , respectively , will preferably be provided as independent fluid circuits to provide for individual lifting , removal and inspection . all water / steam generating surface will be arranged to provide for natural circulation , avoiding the need for a forced circulating system with circulation pumps . solids entrained in the hot synthesis gas 12 flowing downwardly through the inner flue 16 will tend to fall out of the synthesis gas 12 at the bottom region 24 where the synthesis gas 12 makes an approximately 180 degree turn upwardly into the outer flue 28 . the solids fall into a water bath 38 provided at a lower portion of the cooler 10 , thereby permitting the solids to be cooled and removed via solids outlet 40 . sootblowers 42 may be provided at the openings 26 provided at the bottom region 24 where the synthesis gas 12 makes the 180 degree turn into the outer flue 30 , if required to prevent pluggage from accumulated solids . the combination of the inner and outer flues 16 , 28 , with the wing walls 20 located within the inner flue 16 , results in an overall height of the cooler 10 that is substantially less than with either construction individually . providing independent inner and outer flues 16 , 28 with space for lifting and removal while accommodating the wing wall headers 22 and connections thereto ( not shown ) inside the inner flue 16 will require a novel inner flue 16 design , particularly at the bottom of the inner flue 16 . depending upon the amount of heat in the synthesis gas 12 provided to the cooler 10 , additional heating surface may be required , and a second embodiment of the present invention to accomplish this task is illustrated in fig3 . as those skilled in the art will appreciate , the second embodiment shares several design features with the first embodiment of fig1 , and in particular also provides an arrangement of convection heating surface 50 arranged within the outer flue 28 as shown . this convection heating surface 50 can be water or steam cooled , and comprised of one or more banks of tubes arranged so that the synthesis gas 12 flows over the outside of the tubes . the banks of convection heating surface 50 may be provided within the outer flue 28 anywhere around the perimeter of the cooler 10 . in one specific feature of this embodiment , the convection heating surface 50 may employ the same fluidic circuitry ( an integrated cooling approach ) as is employed in the steam generating surface comprising the inner and outer enclosure walls 18 , 30 , respectively , thus eliminating the need for a separate cooling system . alternatively , a separate fluidic circuit may be employed for the convection heating surface 50 . synthesis gas 12 , after flowing over the convection heating surface 50 , exits the outer flue 28 via openings 34 , and exits the cooler via gas outlet 36 . sootblowers 52 can be provided to clean the convection heating surface 50 to prevent pluggage . the convection heating surface 50 eliminates the need for a convection cooler component separate and detached from the radiant cooler 10 , as well as the otherwise attendant connecting flues with turns , pressure vessel containment for same and , in the case of the aforementioned integrated cooling approach , a separate cooling system . the synthesis gas 12 flowing from the radiant cooling section ( the inner flue 16 ) upwardly over the convection heating surface 50 located within the outer flue 28 travels substantially in a straight line , minimizing gas turbulence at the inlet to the outer flue 28 . this minimizes the potential for uncontrollable ash pluggage , and permits the ability to provide sootblowers 52 adjacent the convection heating surface 50 to clean same . this design is especially advantageous as compared to the turbulence and attendant uncontrollable pluggage problems typically encountered at the abrupt entrance to tubes at the inlet tubesheet of a fire tube cooler design . if desired , a further simplification of the structures and equipment employed in a gasification system can be accomplished by means of a third embodiment of the present invention , as illustrated in fig4 . as shown therein , this arrangement extends the tubes comprising the enclosure wall 18 , and which defines the inner flue 16 , upwardly to form an integral , fluid - cooled gasifier enclosure region 60 in an upper region of the cooler 10 . the integral gasifier 60 is thus positioned within the cooler 10 to provide the synthesis gas 12 to the inner flue 16 . the tubes forming the enclosure wall 62 of the gasifier enclosure region 60 would have a refractory coating 64 to protect the surface of the tubes from molten slag and to maintain the gasifier enclosure region 60 environment at temperatures sufficient for the proper gasification reactions to occur . this gasifier enclosure region 60 according to the present invention overcomes the problems associated with uncooled , refractory gasifiers , as well as the prior art for cooled gasifiers . the present invention improves on prior cooled gasifier designs by integrating the cooling circuitry for the gasifier enclosure region 60 into the same fluid - cooled circuitry as that provided for the radiant cooler 10 , eliminating the need for a separate cooling system . this design also recovers the heat rejected from the gasifier enclosure region 60 and transfers it into the gasification plant &# 39 ; s steam / water system , thereby improving efficiency and providing modest fuel cost savings over the life of the unit . the above discussion of each of the three design embodiments list the technical advantages of each over the prior art . from a commercial perspective , the combined inner / outer flue with wing wall design concept substantially reduces cost by significantly reducing the overall height of the radiant synthesis gas cooler . these cost reductions are obtained not just from the reduced cost of the outer vessel , but also from transportation costs , fuel piping costs , steel structure costs , and costs to construct the component on site . providing separable inner and outer flues minimizes maintenance costs . this is important with a gasification process cooler , which experiences a more aggressive corrosion environment and requires more maintenance over time than combustion gas coolers used in a conventional pulverized coal plant . the incorporation of the convection heating surface integrally within the radiant cooler enclosures eliminates the cost of a separate component . the cost savings are substantial here as well , because in addition to saving on an extra pressure vessel there are also savings in reduced gas flue and steam / water piping costs , steel structure costs and construction costs . the savings from higher availability on solid fuel , due to reduced or eliminated convective cooler plugging , can be more than the entire capital cost of a convective cooler over the life of the unit . the incorporation of an integral , cooled gasifier provides modest cost savings over separate cooled gasifiers by eliminating the need for separate pressure vessels and some of the cooling circuitry . while it may be somewhat more expensive in capital cost as compared to an uncooled gasifier , it is believed that the higher availability using solid fuels will be substantial , greatly exceeding any capital cost difference . the cost savings from combining some or all of the three design concepts to allow elimination of a spare component train are significant . again , these savings expand beyond just the extra components to include all the supporting equipment and steel structures surrounding the components and the construction costs associated with building it . it will thus be appreciated that an important , fundamental improvement provided by the present invention involves consolidating individual components into one integrated component to make it compact , low cost , more reliable , and more maintainable . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the principles of the invention , those skilled in the art will appreciate that changes may be made in the form of the invention covered by the following claims without departing from such principles . in some embodiments of the invention , certain features of the invention may sometimes be used to advantage without a corresponding use of the other features . accordingly , all such changes and embodiments properly fall within the scope of the following claims . | 2 |
please refer to fig3 . a typical computer 10 has a screen 15 , a keyboard device 31 , some function keys 33 , a motherboard ( not shown ), a memory ( not shown ), etc . please refer to fig4 . fig4 shows a first embodiment of a signal noise reduction system 20 in the computer 10 . the signal noise reduction system 20 comprises a signal generating element 30 and a digital chip 40 . the signal generating element 30 , such as the keyboard device 31 or the function keys 33 , is electrically connected to the at least one digital chip 40 ( such as a keyboard control chip 41 , which is basically pins of a gpio ). please refer to fig5 . fig5 is a flowchart of a method of signal noise reduction according to the present invention . this flowchart describes the signal processing performed by the signal generating element 30 and a connection line 21 of the digital chip 40 . samples shown in fig1 indicate the signals generated by the signal generating element 30 ; “ sample 1 ” indicates the first signal , “ sample 2 ” indicates the second signal , and so on . debouncehigh , debouncelow and stablesignal are variables of the logical operations , wherein stablesignal indicates signals confirmed by the digital chip 40 . please refer to fig6 and fig7 for further description of the signal processing . an and logical operation is performed on the received recent signal and “ n ” previous signals ; in this embodiment , n = 2 , so 3 samples are selected ; the corresponding formula is : please refer to fig6 . in the logical operation for sample 1 , sample 2 and sample 3 , since each of sample 1 , sample 2 and sample 3 are “ 1 ”, debouncehigh ( 3 )= 1 . in the logical operation for sample 2 , sample 3 and sample 4 , since sample 4 = 0 , debouncehigh ( 4 )= 0 . step 301 indicates that only when all samples are “ 1 ”, then debouncehigh is “ 1 ”; under any other condition debouncehigh is “ 0 ”. the above - mentioned “ n ” can be other values , but is preferably between 1 and 5 . for example , when n = 1 , the corresponding formula is : an or logical operation is performed on the received recent signal and “ n ” previous signals ; the corresponding formula is : please refer to fig6 . in the operation for sample 1 , sample 2 and sample 3 , since all of sample 1 , sample 2 and sample 3 are “ 1 ”, debouncehigh ( 3 )= 1 . in the operation for sample 4 , sample 5 and sample 6 , since sample 4 , sample 5 and sample 6 are all “ 0 ”, debouncelow ( 6 )= 0 . step 302 indicates that only when all samples are “ 0 ”, then debouncelow is “ 0 ”, and under any other condition debouncelow is “ 1 ”. an or logical operation is performed with the previous confirmed signal and result from step 301 , and then an and logical operation is performed on the result from logical operation 302 and the result from step 302 ; the corresponding formula is please refer to fig6 . for example , in order to calculate stablesignal ( 3 ), assuming stablesignal ( 2 )= 1 ( which means the previous confirmed signal was “ 1 ”), stablesignal ( 3 )=( 1 or 1 ) and ( 1 )= 1 , so the new confirmed signal is 1 . by way of further example , stablesignal ( 6 )=( 1 or 0 ) and ( 0 )= 0 , which indicates that the previous confirmed signal was “ 1 ”, and the new confirmed signal is 0 . the formulas in the above - mentioned description may be explained as follows . step 301 and step 302 may be explained as : checking whether received recent signals and “ n ” previous signals are all consistent digital logical operations . debouncehigh is used for checking whether all samples are 1 , and debouncelow is used for checking whether all samples are 0 . when all samples are 1 ( the signals are consistent ), debouncehigh = 1 and debouncelow = 1 ; when all samples are 0 ( the signals are consistent ), debouncehigh = 0 and debouncelow = 0 . when the signals are not consistent ( some samples are “ 1 ”, some samples are “ 0 ”), debouncehigh = 0 and debouncelow = 1 . step 303 may be described as determining a new confirmed signal with digital logical operations based upon the previous confirmed signal and the results from step 301 and step 302 , using the following two conditions : condition 1 : if step 301 and step 302 find consistent signals , then the new confirmed signal is set to the recent signals and the previous confirmed signal is ignored . and regardless of whether stablesignal ( the previous confirmed signal ) is “ 1 ” or “ 0 ”, the new confirmed signal is “ 1 ”. and regardless of whether stablesignal ( the previous confirmed signal ) is “ 1 ” or “ 0 ”, the new confirmed signal is “ 0 ”. condition 2 : if step 301 and step 302 find non - consistent signals , the new confirmed signal is set to the previous confirmed signal . that is , it is noted that , since the signals are not consistent , debouncehigh = 0 and debouncelow = 1 may be assumed . please refer to fig6 . when the signals are not consistent , such as when sample 2 = 1 , sample 3 = 1 and sample 4 = 0 : please refer to fig7 . when the signals are not consistent , such as when sample 2 = 0 , sample 3 = 0 and sample 4 = 1 : please refer to fig8 . fig8 shows a second embodiment of a signal noise reduction system in a computer according to the present invention . a difference between this embodiment and the first embodiment is that there is more than one signal generating element ; for example , three signal generating elements 30 a , 30 b , 30 c are all connected to the same digital chip 40 . please refer to fig9 . fig9 shows a third embodiment of a signal noise reduction system in a computer according to the present invention . a difference between this embodiment and the first embodiment is that the signal generating element 30 may be a south bridge chip 32 ( or a north bridge chip ), which means that non - gpio pins can be used in the technology of the present invention . please refer to fig1 . fig1 shows a signal noise reduction system performing logical operations to a plurality of pins . for example , when processing eight pins p 1 ˜ p 8 , stablesignal for each pin can be calculated simultaneously . for example , an 8 bit system can calculate 8 pins simultaneously , and a 16 bit system can calculate 16 pins simultaneously , which is an advantage of the present invention . the above - mentioned logical operations can be executed by the digital chip 40 . although the present invention has been explained in relation to its preferred embodiment , it is to be understood that many other possible modifications and variations can be made without departing from the spirit and scope of the invention as hereinafter claimed . for example , when debouncehigh = 1 , there is no need to calculate debouncelow , and stablesignal may simply be set to “ 1 ”; and when debouncelow = 0 , stablesignal may be directly set to “ 0 ”. of course , utilizing a logical “ if ” operation may reduce efficiencies , therefore , the embodiment of the present invention do not use the logical “ if ” operation . | 7 |
in accordance with one embodiment , there is provided a wound healing composition and the method of use of the composition on a patient &# 39 ; s skin or wound . this product accelerate healing and restoration of a wound . in accordance with another embodiment , there is provided a method of use of the composition that is a photodynamic technique whereby the composition is activated by light providing a beneficial effect on the skin or wound and promoting healing . the composition and method may be used to treat injuries to the different layers of the skin , including incisions , lacerations , abrasions , puncture wounds , penetrations wounds , gunshot wounds , contusions , hematomas and crushing injuries . lesions to muccosae may also be treated with the composition of the present invention , which may be used for example , to treat pathological lesions of the oral mucosa , such as periodontitis , ulcers , and cold sores ( orafacial herpes ). the composition comprises a number of active principles selected from groups of possible components . these various active principles each have their mechanism of action . the composition comprises oxidants as a source of oxygen radicals . peroxide compounds are oxidants that contain the peroxy group ( r — o — o — r ) which is a chainlike structure containing two oxygen atoms , each of which is bonded to the other and a radical or some element . suitable oxidants for preparation of the active medium include , but are not limited to : hydrogen peroxide ( h 2 o 2 ) is the starting material to prepare organic peroxides . h 2 o 2 is a powerful oxidizing agent , and the unique property of hydrogen peroxide is that it breaks down into water and oxygen and does not form any persistent , toxic residual compound . hydrogen peroxide for use in this composition can be used in a gel , for example with 6 % hydrogen peroxide a suitable range of concentration over which hydrogen peroxide can be used in the present composition is from about 3 . 5 % to about 6 %. urea hydrogen peroxide ( also known as urea peroxide carbamide peroxide or percarbamide ) is soluble in water and contains approximately 35 % hydrogen peroxide . carbamide peroxide for use in this composition can be used as a gel , for example with 16 % carbamide peroxide that represents 5 . 6 % hydrogen peroxide . a suitable range of concentration over which urea peroxide can be used in the present composition is from about 10 % to about 16 %. urea peroxide brakes down to urea and hydrogen peroxide in a slow - release fashion that can be accelerated with heat or photochemical reactions . the released urea [ carbamide , ( nh 2 )], is highly soluble in water and is a powerful protein denaturant . it increases solubility of some proteins and enhances rehydration of the skin and / or mucosa . benzoyl peroxide consists of two benzoyl groups ( benzoic acid with the h of the carboxylic acid removed ) joined by a peroxide group . it is found in treatments for acne , in concentrations varying from 2 . 5 % to 10 %. the released peroxide groups are effective at killing bacteria . benzoyl peroxide also promotes skin turnover and clearing of pores , which further contributes to decreasing bacterial counts and reduce acne . benzoyl peroxide breaks down to benzoic acid and oxygen upon contact with skin , neither of which are toxic . a suitable range of concentration over which benzoyl peroxide can be used in the present composition is from about 2 . 5 % to about 5 %. inclusion of other forms of peroxides ( e . g . organic or inorganic peroxides ) should be avoided due to their increased toxicity and their unpredictable reaction with the photodynamic energy transfer . the photoactivators transfer light energy to the oxidants . suitable photoactivators can be fluorescent dyes ( or stains ), although other dye groups or dyes ( biological and histological dyes , food colorings , carotenoids ) can also be used . combining photoactivators may increase photo - absorbtion by the combined dye molecules and enhance absorption and photo - biomodulation selectivity . this creates multiple possibilities of generating new photosensitive , and / or selective photoactivator mixtures . a advantageous characteristic of a photoactivator is increased fluorescence . in the present invention , re - emission of light in the green to yellow spectrum would be advantageous , since it is a deep penetrating wavelength range , with deep absorption by the blood . this confers a strong increase on the blood flow , vasodilation and angiokinetic phenomena . suitable photoactivators include , but are not limited to : the xanthene derivative dyes have been used and tested for a long time worldwide . they display low toxicity and increased fluorescence . the xanthene group consists of 3 sub - groups that are : a ) the fluorenes ; b ) fluorones ; and c ) the rhodoles . the fluorenes group comprises the pyronines ( e . g . pyronine y and b ) and the rhodamines ( e . g . rhodamine b , g and wt ). depending on the concentration used , both pyronines and rhodamines may be toxic and their interaction with light may lead to increased toxicity . similar effects are known to occur for the rhodole dye group . fluorescein is a fluorophore commonly used in microscopy with an absorption max of 494 nm and an emission max . of 521 nm . the disodium salt of fluorescein is known as d & amp ; c yellow 8 . it has very high fluorescence but photodegrades quickly . in the present composition , mixtures of fluorescein with other photoactivators such as indocyanin green and / or saffron red powder will confer increased photoabsorption to these other compounds . eosins group comprises eosin y ( tetrabromofluorescein , acid red 87 , d & amp ; c red 22 ) with an abs max 514 - 518 nm , stains cytoplasm of cells , collagen , muscle fibers and red blood cells intensely red ; and eosin b ( acid red 91 , eosin scarlet , dibromo - dinitrofluorescein ), with the same staining characteristics as eosin y . eosin y , eosin b , or a mixture of both can be used because of their sensitivity to the light spectra used : broad spectrum blue light , blue to green light and green light . their tissue and biofilm staining properties and their low toxicity are also advantageous . both eosin y and eosin b stain red blood cells and thus confer to the composition of the present invention haemostatic ( controls the flow or stops the flow of blood ) properties as well as increase the selective targeting of light to the soft tissues of the lesion or wound during the application of the composition . phloxine b ( 2 , 4 , 5 , 7 tetrabromo 4 , 5 , 6 , 7 , tetrachlorofluorescein , d & amp ; c red 28 , acid red 92 ) is a red dye derivative of fluorescein which is used for disinfection and detoxification of waste water through photooxidation . it has an abs . max . of 535 - 548 nm . it is also used as an intermediate for making photosensitive dyes and drugs . erythrosine b ( acid red 51 , tetralodofluorescein ) is a cherry - pink coal - based fluorine food dye used as a biological stain , and a biofilm and dental plaque disclosing agent , with max . abs . 524 - 530 nm in aqueous solution . it is subject to photodegradation . erythrosine is also used in some embodiments due to its photosensitivity to the light spectra used and its ability to stain biofilms . inclusion of erythrosine should be favored when using the composition in deep pockets of infected or contaminated tissue , such as periodontal pockets in periodontal therapy . rose bengal ( 4 , 5 , 6 , 7 tetrachloro 2 , 4 , 5 , 7tetraiodofluorescein , acid red 94 ) is a bright bluish - pink biological dye with an absorption max of 544 - 549 nm , that has been used as a dye , biological stain and diagnostic aid . also used in synthetic chemistry to generate singlet from triplet oxygen . merbromine ( mercurochrome ) is an organo - mercuric disodium salt of fluorescein with an abs . max . of 508 nm . it is used as an antiseptic . the azo ( or diazo -) dyes share the n - n group , called azo the group . they are used mainly in analytical chemistry or as food colorings and are not fluorescent . suitable azo dyes include : methyl violet , neutral red , para red ( pigment red 1 ), amaranth ( azorubine s ), carmoisine ( azorubine , food red 3 , acid red 14 ), allura red ac ( fd & amp ; c 40 ), tartrazine ( fd & amp ; c yellow 5 ), orange g ( acid orange 10 ), ponceau 4r ( food red 7 ), methyl red ( acid red 2 ), murexide - ammonium purpurate . dye molecules commonly used in staining protocols for biological materials can also be used as photoactivators . suitable biological stains include : saffranin ( saffranin o , basic red 2 ) is also an azo - dye and is used in histology and cytology . it is a classic counter stain in a gram stain protocol . fuchsin ( basic or acid ) rosaniline hydrochloride ) is a magenta biological dye that can stain bacteria and has been used as an antiseptic . it has an abs . max . 540 - 555 nm . 3 , 3 ′ dihexylocarbocyanine iodide ( dioc6 ) is a fluorescent dye used for staining cell &# 39 ; s endoplasmic reticulum . vesicle membranes and mitochondria . it shows photodynamic toxicity ; when exposed to blue light , has a green fluorescence . carminic acid ( acid red 4 , natural red 4 ) is a red glucosidal hydroxyanthrapurin naturally obtained from cochineal insects . indocyanin green ( icg ) is used as a diagnostic aid for blood volume determination , cardiac output , or hepatic function . icg binds strongly to red blood cells and when used in mixture with fluorescein , it increases the absorption of blue to green light . saffron red powder is a natural carotenoid - containing compound . saffron is a spice derived from crocus sativus . it is characterized by a bitter taste and iodoform or hay - like fragrance ; these are caused by the compounds picrocrocin and saffranal . it also contains the carotenoid dye crocin that gives its characteristic yellow - red color . saffron contains more that 150 different compounds many of them are carotenoids : mangicrocin , reaxanthine ; lycopene , and various α - and β - carotenes , that show good absorption of light and beneficial biological activity . also saffron can act as both a photo - transfer agent and a healing factor . saffron color is primarily the result of α - crocin ( 8 , 8 diapo - 8 , 8 - carotenoid acid ). dry saffron red powder is highly sensitive to fluctuating ph levels and rapidly breaks down chemically in the presence of light and oxidizing agents . it is more resistant to heat . data show that saffron has anticarcinogenic , immunomodulating and antioxidant properties . for absorbance , it is determined for the crocin specific photon wavelength of 440 nm ( blue light ). it has a deep red colour and forms crystals with a melting point of 186 ° c . when dissolved in water it forms an orange solution . crocetin is another compound of saffron that was found to express an antilipidermic action and promote oxygen penetration in different tissues . more specifically it was observed an increased oxygenation of the endothelial cells of the capillaries . an increase of the oxygenation of muscles and cerebral cortex was observed and led to an increased survival rate in laboratory animals with induced hemorrhagic shock or emphysema . anatto a spice contains as main constituent ( 70 - 80 %) the carotenoid bixin which displayed relevant antioxidative properties . fucoxanthine is a constituent of brown algae with a pronounced ability for photosensitization of red - ox reactions . healing factors comprise compounds that promote or enhance the healing or regenerative process of the tissues on the application site of the composition . during the photoactivation of the composition , there is an increase of the absorption of molecules at the treatment site by the skin or the mucosa . an augmentation in the blood flow at the site of treatment is observed for an extent period of time . an increase in the lymphatic drainage and a possible change in the osmotic equilibrium due to the dynamic interaction of the free radical cascades can be enhanced or even fortified with the inclusion of healing factors . suitable healing factors include , but are not limited to : hyaluronic acid ( hyaluronan , hyaluronate ): is a non - sulfated glycosaminoglycan , distributed widely throughout connective , epithelial and neural tissues . it is one of the primary components of the extracellular matrix , and contributes significantly to cell proliferation and migration . hyaluronan is a major component of the skin , where it is involved in tissue repair . while it is abundant in extracellular matrices , it contributes to tissues hydrodynamics , movement and proliferation of cells and participates in a wide number of cell surface receptor interactions , notably those including primary receptor cd44 . the hyaluronidases enzymes degrade hyaluronan . there are at least seven types of hyaluronidase - like enzymes in humans , several of which are tumor suppressors . the degradation products of hyaluronic acid , the oligosaccharides and the very - low molecular weight hyaluronic acid , exhibit pro - angiogenic properties . in addition , recent studies show that hyaluronan fragments , but not the native high molecular mass of hyaluronan , can induce inflammatory responses in macrophages and dendritic cells in tissue injury . hyaluronic acid is well suited to biological applications targeting the skin . due to its high biocompatibility , it is used to stimulate tissue regeneration . current studies evidenced hyaluronic acid appearing in the early stages of healing to physically create room for white blood cells that mediate the immune response . it is used in the synthesis of biological scaffolds for wound healing applications and in wrinkle treatment . glucosamine : is one of the most abundant monosaccharides in human tissues and a precursor in the biological synthesis of glycosilated proteins and lipids . it is commonly used in the treatment of osteoarthritis . the common form of glucosamine used is its sulfate salt . glucosamine shows a number of effects including an anti - inflammatory activity , stimulation of the synthesis of proteoglycans and the synthesis of proteolytic enzymes . a suitable range of concentration over which glucosamine can be used in the present composition is from about 1 % to about 3 %. allantoin : is a diureide of glyosilic acid . it has keratolytic effect , increases the water content of the extracellular matrix , enhances the desquamation of the upper layers of dead ( apoptotic ) skin cells , and promotes skin proliferation and wound healing . also , saffron can act as both a photo - transfer agent and a healing factor . chelating agents can be included to promote smear layer removal in closed infected pockets and difficult to reach lesions ; act as a metal ion quencher and as a buffer . suitable chelating agents include , but are not limited to : ethylenediaminotetraacetic acid ( edta ): it is an aminoacid , used to sequester di - and trivalent metal ions . edta binds to metals via 4 carboxylate and 2 amine groups . edta forms especially strong complexes with mn ( iii ), fe ( iii ), cu ( iii ), co ( iii ). prevents collection of the platelets and blood clots formation . it is used in the endodontic therapy as a smear layer removal agent during instrumentation . it is used to buffer solutions . ethylene glycol tetraacetic acid ( egta ) is related to edta , but with a much higher affinity for calcium than for magnesium ions . it is useful for making buffer solutions that resemble the environment inside living cells and is often employed in dentistry , more specifically endodontics , in the removal of smear layer . lipolysis stimulating factors can be included for use of the composition in cosmetic applications , such as wrinkle treatment . caffeine , and the metabolic derivative of caffeine paraxanthine can increase in the lipolysis process to releases glycerol and fatty acids into the blood stream . the wound healing composition may also contain one or more hydrophilic gelling agent . the hydrophilic gelling agent enhances the consistency of the composition and contributes to facilitating the application of the composition to the skin or wounded area . also , when used with hydrogen peroxide ( h 2 o 2 ), it may contribute to the slow the release of the h 2 o 2 , and provide a more immediate reaction because pure h 2 o 2 can be used directly . suitable hydrophilic gelling agent include , but are not limited to glucose , modified starch , methyl cellulose , carboxymethyl cellulose , propyl cellulose , hydroxypropyl cellulose , carbopol ® polymers , alginic acid , sodium alginate , potassium alginate , ammonium alginate , calcium alginate , agar , carrageenan , locust bean gum , pectin , and gelatin . the inclusion of suitable photosensitive compounds and activation with a light source of a proper wavelength , leads to the acceleration in the breakdown process of the source of peroxide ( the oxidant ) and the other reactions that take place , via a photodynamic phenomenon . the included dyes are illuminated by photons of a certain wavelength and excited to a higher energy state . when the photoactivators &# 39 ; excited electrons return to a lower energy state , they emit photons with a lower energy level , thus causing the emission of light of a longer wavelength ( stokes shift ). in the proper environment , much of this energy transfer is transferred to oxygen or the reactive hydrogen peroxide and causes the formation of oxygen radicals , such as singlet oxygen . the singlet oxygen and other reactive oxygen species generated by the activation of the composition are thought to operate in a hormetic fashion . that is , a health beneficial effect is brought about by the low exposure to a normally toxic stimuli ( e . g . reactive oxygen ), by stimulating and modulating stress response pathways in cells of the targeted tissues . endogenous response to exogenous generated free radicals ( reactive oxygen species ) is modulated in increased defense capacity against the exogenous free radicals and induces acceleration of healing and regenerative processes . furthermore , activation of the composition will also produce an antibacterial effect . the extreme sensitivity of bacteria to exposure to free radicals makes the composition of the present invention a de facto bactericidal composition . possible mechanism of action should be a fortified redox signalling phenomenon resulting in accentuated signal transduction process in which cells convert one kind of signal into another ; activated “ second messengers ” induce a “ signal cascade ” beginning with a relatively small stimulus that elicits a large response via biologically monitored amplification of such signals . these complex mechanisms act possibly involving angiogenic phenomena via growth factor activation . this method could be described as a form of photodynamic therapy . however , unlike other photodynamic techniques , where the photoactoactivators are incorporated in the tissue structure . in the present method , the photoactive material is in simple contact with the tissue and acts when activated by light , as a “ photodynamic device ” that chemically interacts with the tissue . additionally , the actinic light penetrates the tissue , and the light that is emitted by the photoactivator ( light of a longer wavelength ) is also absorbed by the tissue . any source of actinic light can be used . any type of halogen , led or plasma arc lamp , or laser may be suitable . the primary characteristic of suitable sources of actinic light will be that they emit light in a wavelength ( or wavelengths ) appropriate for activating the one or more photoactivators present in the composition . in one embodiment , an argon laser is used . in another embodiment , a potassium - titanyl phosphate ( ktp ) laser ( e . g . a greenlight ™ laser ) is used . in yet another embodiment , a led photocuring device is the source of the actinic light . in yet another embodiment , the source of the actinic light is a source of visible light having a wavelength between 400 and 600 nm . furthermore , the source of actinic light should have a suitable power density . suitable power density for non - collimated light sources ( led , halogen or plasma lamps ) are in the range from about 900 mw / cm 2 to about 2000 mw / cm 2 . suitable power density for laser light sources are in the range from about 0 . 5 mw / cm 2 to about 0 . 8 mw / cm 2 . the duration of the exposure to actinic light will be dependent on the surface of the treated area , and on the type of lesion , trauma or injury that is being treated . the photoactivation of the composition may take place within seconds or even fragment of seconds , but a prolonged exposure period is beneficial to exploit the synergistic effects of the absorbed , reflected and reemitted light on the composition of the present invention and its interaction with the tissue being treated . in one embodiment , the time of exposure to actinic light of the tissue , skin or wound on which the wound healing composition has been applied is a period between 60 second and 5 minutes . in another embodiment , the time of exposure to actinic light of the tissue , skin or wound on which the wound healing composition has been applied is a period between 60 seconds and 5 minutes per cm 2 of the area to be treated , so that the total time of exposure of a 10 cm 2 are would be between 10 minutes and 50 minutes . in yet another embodiment , the source of actinic light is in continuous motion over the treated area for the appropriate time of exposure . in yet another embodiment , multiple applications of the wound healing composition and actinic light are performed . in some embodiments , the tissue , skin or wound is exposed to actinic light at least two , three , four , five or six times . in some embodiments , a fresh application of the wound healing composition is applied before exposure to actinic light . an exemplary wound healing composition was prepared by mixing the following components : the oxidant ( 4 ml ) and healing factors ( 1 . 5 ml ) were mixed and the combined with the photoactivators ( 1 ml ). the resulting composition was applied to the skin of a wounded patient , and activated with actinic light provided by a led photocuring device ( blue light ). the composition was removed following treatment . an second exemplary wound healing composition was prepared by mixing the following components : the oxidant ( 4 ml ) and healing factors ( 1 . 5 ml ) were mixed and the combined with the photoactivators ( 1 ml ). the resulting composition was applied to the skin of a wounded patient , and activated with actinic light provided by a led photocuring device ( blue light ). the composition was removed following treatment . this second exemplary composition is using the fluorescein dye as a photoactivator to other dyes ( indocyanine green and saffron red powder ) present in the composition . the addition of a small amount of fluorescein to the indocyanine green and saffron red powder solution caused reemission of light at wavelengths that activated the other dye compounds and improved the treatment by increasing the established clinical absorption / reemission criteria . indocyanine green binds well to hemoglobin and helps the selective energy absorption by the tissues and also helps targeting these tissues with the generated free radical cascades . also , this photoactivators mixture is able to render saffron red fluorescent , which again improves both the photodynamic and biostimulating phenomena . the toxicity of the photoactivators eosin y and erythrosine b was evaluated by measuring the cytotoxicity of these compounds on human cells . hep g2 human hepatocellular carcinoma cells with an epithelial morphology were treated for 24 hours with increasing concentrations ( 0 . 001 to 100 μm ) of eosin y or erythrosine b , and the cellular survival was evaluated . increasing concentrations of either eosin y ( fig1 ) or erythrosine b ( fig2 ) did not affect cellular viability when compared to untreated cells . straurosporine ( sts ) was used as a positive control for inducing cellular mortality and caused a dose - dependent effect ( fig1 and 2 ). similar results were obtained by measuring cell death by release of lactate dehydrogenase ( ldh ). therefore , neither eosin y or erythrosine b caused increased cellular mortality . random skin flaps in rat were used to study the wound healing procedures , for evaluating the benefits of ischemic and pharmacologic preconditioning methods on skin flap survival , applying blood flow assessment technologies on flaps , demonstrating the effects of vascular shunts and the studies on skin flap viability . the random skin flap model was used to study the effect of the comosition of the present invention on skin flap survival and associated modulations contributing to healing process . excision wound of 1 cm in width by 2 cm in length were cut dorsally on the midline of the back , 2 cm below the interior angle of the scapulae . the skin was cut with a surgical blade , the panniculus carnosus and a 0 . 5 cm layer subcutaneous to the panniculus camosus was excised from the wound edges . the wound was next photographed with an 8 mm by 8 mm size marker . one gram of the wound healing composition was applied to the wound ( 0 . 5 g / cm 2 ) and irradiated with a blue led light during 3 minutes . excisions were performed on rats ( n = 2 per group ) as described above in example iv , and the excisions were treated or not with a single application of 1 gram of a wound healing composition comprising the oxidant ( carbamide peroxide ) and a photoactivator mixture containing eosin y , erythrosine b and saffron red powder . the excisions were irradiated with a led light ( blue light ) for 3 minutes . the percentage of wound closure was evaluated ( fig3 ) over a ten - day period following treatment . animals treated with the composition showed a more rapid wound closure over the initial first three - day period following treatment . excision were performed on rats ( n = 2 per group ) as described above in example iv , and the excisions were treated or not with a single application of 1 gram of a wound healing compositions comprising : ( a ) the oxidant ( carbamide peroxide ) and a photoactivator mixture containing eosin y , and erythrosine b ; ( b ) the oxidant ( carbamide peroxide ) and a photoactivator mixture containing eosin y , erythrosine b and saffron red powder , or ( c ) the oxidant ( carbamide peroxide ) and a photoactivator mixture containing eosin y . erythrosine b , saffron red powder and indocyanine green . the excisions were irradiated with a led light ( blue light ) for 3 minutes . the percentage of wound closure was evaluated daily for four days ( fig4 ). animals treated with compositions ( a ) and ( b ) showed improved wound closure over the four - day period following treatment . the addition of indocyanine green in composition ( c ) repressed the wound healing effect observed for compositions ( a ) and ( b ). excision were performed on rats ( n = 2 per group ) as described above in example iv , and the excisions were treated or not with a single application of 1 gram of a wound healing composition comprising the oxidant ( carbamide peroxide ) and a photoactivator mixture containing eosin y and erythrosine b . the excisions were irradiated with a led light ( blue light ) for 3 minutes . the percentage of wound closure was evaluated ( fig5 ) over a twelve - day period . animals treated with the composition showed a more rapid wound closure over the first seven - day period following treatment . using a template of 3 cm by 9 cm ( 3 × 9 ) in plexiglas , a flap was traced on the dorsal skin with a surgical marker , taking as limits the inferior angles of the scapulae and the superior bones of pelvis . a pure random pattern flap with cranial base was cut using sterile techniques and elevated through deep fascia , including superficial fascia , panniculus carnosus , the subcutaneous tissue and skin . to minimize wound contraction and simulating the human condition , a 0 . 5 cm subcutaneous layer of panniculus carnosus from the wound edges was removed . during one hour , an impermeable barrier ( e . g . a silicone sheeting ) was placed between the flap and its donor site to eliminate the possibility of wound bed support . the sheet was then removed , the flap returned to its original position and the flap edges were surgically closed using 4 / 0 nylon suture in an interrupted fashion . immediately following flap closure , flap pedicle were coated with 13 . 5 g of gel formulation ( 0 . 5 g / cm 2 ) and irradiated . the controls did not receive any treatment . care was taken to distribute ointment evenly along the entire flap . gel formulation was prepared the same day of the experiment . for gel + light group the animals were treated with gel formulation , the flap was irradiated for 3 minutes with a led lamp . excision were performed on rats ( n = 2 per group ) as described above , and the excisions were treated or not with the gel formulation , and irradiated with a led light ( blue light ) as described in example viii . the results demonstrate a direct correlation of necrosis from fluorescein injection and direct visualization . biopsies were evaluated for changes in histology . data from the treated group demonstrate a clinically significant 1 . 5 times reduction in necrosis , ( percent necrosis , mean , sd of 45 . 7 (± 17 . 36 ) vs . 30 . 42 (± 20 . 18 ), in the control and treatment groups respectively ). now referring to fig7 a , the clinical evaluation of necrosis following flap surgery , in the control and treatment group shows that higher necrosis is observed on the control group versus the treatment group . hematoxylin and eosin staining of biopsies from the control and treatment group ( fig7 b ) reveal that greater vascular recruitment occurs in the treated group ( see black arrows therein ). masson trichrome staining for the assessment of collagen fibril deposition ( fig7 c ) at a 40 × magnification shows that new collagen deposition is occurring in the treatment group vs the control group . the photodynamic treatment using photoactivators and wavelength specific light aimed at increasing the viability of the skin flap by stimulating the vascular recruitment of collaterals in flaps to improve the loco - regional state of the new wound , including the formation of new collagen therein . the embodiments and examples presented herein are illustrative of the general nature of the subject matter claimed and are not limiting . it will be understood by those skilled in the art how these embodiments can be readily modified and / or adapted for various applications and in various ways without departing from the spirit and scope of the subject matter disclosed claimed . the claims herof are to be understood to include without limitation all alternative embodiments and equivalents of the subject matter hereof . phrases , words and terms employed herein are illustrative and are not limiting . where permissible by law , all references cited herein are incorporated by reference in their entirety . it will be appreciated that any aspects of the different embodiments disclosed herein may be combined in a range of possible alternative embodiments , and alternative combinations of features , all of which varied combinations of features are to be understood to form a part of the subject matter claimed . | 0 |
in order to provide a clearer and consistent understanding of the specification and claims , including the scope to be given such terms , the following definitions are provided . &# 34 ; actin - binding compound &# 34 ; is meant to include any compound , and especially any protein ( or peptide ), which is capable of binding actin so as to modify any of actin &# 39 ; s many functions , including suppressing the ability of actin monomers to polymerize into filaments . when administered to a subject in need of treatment , the actin - binding compounds of the invention are substantially free of natural contaminants which associate with such compound either in vivo ( in a prokaryotic or eukaryotic ) host , or in vitro ( as a result of a chemical synthesis ). such compounds include , but are not limited to extracellular actin - binding proteins such as gelsolin and dbp , and intracellular actin - binding proteins such as those most abundant in cells ( for example , myosins , tropomyosins , profilin and cofilin ) and those most abundant in non - muscle cells . actin - binding compounds within the scope of the methods of the invention also include but are not limited to a ) actin - binding compounds that predominantly sequester actin monomers , that is , bind monomers in a complex which is resistant to polymerization ( for example , dbp , profilin , depactin , cofilin , and dnaase i ); b ) actin - binding compounds which sequester monomers and possess filament severing activity ( for example , gelsolin , villin , fragmin and severin ; c ) actin - binding compounds that predominantly block the ends of actin filaments and prevent the exchange of monomers with that end ( for example , capping protein , β - actinin , and acumentin ); and d ) actin - binding nonproteinaceous molecules that have such effects on actin ( for example , cytochalasin or biologically - active derivatives thereof , that block the ends of actin filaments ). if desired , such compounds may be administered in the form of a pharmaceutically acceptable salt to the animal . by the term &# 34 ; thrombotic event &# 34 ; is meant any vascular condition in which vascular occlusion , thrombosis , infarction or other biological perturbation results in fibrinolysis . the term &# 34 ; animal &# 34 ; is meant to include all animals in which the accumulation of free actin or actin filaments in the bloodstream or extracellular space would be detrimental to the physiology of the animal . foremost among such animals are humans ; however , the invention is not intended to be so limiting , it being within the contemplation of the present invention to treat any and all animals which may experience the beneficial effect of the invention . an &# 34 ; efficacious amount &# 34 ; of an actin - binding compound is one which is sufficient to reduce or eliminate toxic effects of actin in an animal . a material is said to be &# 34 ; substantially free of natural contaminants if it has been substantially purified from materials with which it is normally and naturally found before such purification . examples of natural contaminants with which actin - binding compounds might be associated are : non - actin - binding peptides , carbohydrates , glycosylated peptides , lipids , membranes , etc . a material is said to be substantially free of natural contaminants if those contaminants normally and naturally found with the substance in vivo or in vitro are substantially absent from a sample of the material . by &# 34 ; substantially absent &# 34 ; is meant that such contaminants are either completely absent or are present at such low concentrations that their presence ( 1 ) does not interfere with the desired therapeutic effect of the active agent ( herein the actin - binding compound ) in the preparation when such preparation is administered to an animal and ( 2 ) does not harm the animal as the result of the administration of such preparation . the term &# 34 ; administration &# 34 ; is meant to include introduction of actin - binding compounds to an animal by any appropriate means known to the medical art , including , but not limited to , enteral and parenteral ( e . g ., intravenous ) administration . the term &# 34 ; pharmaceutically acceptable salt &# 34 ; is intended to include salts of the actin - binding compounds of the invention . such salts can be formed from pharmaceutically acceptable acids or bases , such as , for example , acids such as sulfuric , hydrochloric , nitric , phosphoric , etc ., or bases such as alkali or alkaline earth metal hydroxides , ammonium hydroxides , alkyl ammonium hydroxides , etc . the term &# 34 ; pharmaceutically acceptable vehicle &# 34 ; is intended to include solvents , carriers , diluents , and the like , which are utilized as additives to preparations of the actin - binding compounds of the invention so as to provide a carrier or adjuvant for the administration of such compounds . the term &# 34 ; treatment &# 34 ; or &# 34 ; treating &# 34 ; is intended to include the administration of actin - binding compounds to a subject for purposes which may include prophylaxis , amelioration , prevention or cure of actin related disorders . the term &# 34 ; fragment &# 34 ; is meant to include any portion of a molecule which provides a segment of an actin - binding compound which is capable of binding actin monomers ; the term is meant to include actin - binding fragments which are made from any source , such as , for example , from naturally - occurring peptide sequences , synthetic or chemically - synthesized peptide sequences , and genetically engineered peptide sequences . further , if such fragment is a peptide , a fragment of a peptide of such actin - binding protein is meant to include to any variant of the actin - binding protein . a &# 34 ; variant &# 34 ; of a compound such an actin - binding compound is meant to refer to a compound substantially similar in structure and biological activity to either the native compound , or to a fragment thereof . the biological activity of the compounds of the invention is their ability to bind actin and modify it into a form which is less toxic to an animal than unmodified actin . such modification may be the result of the binding of the compounds per se or the result of a chemical or enzymatic reaction which results from such binding . a &# 34 ; functional derivative &# 34 ; of an actin binding compound is a derivative which possesses a biological activity that is substantially similar to the biological activity of the actin - binding compound . by &# 34 ; substantially similar &# 34 ; is meant activity which is quantitatively different but qualitatively the same . for example , a functional derivative of an actin - binding protein of the invention would contain the same amino acid backbone as an actin - binding protein but also contains other modifications such as post - translational modifications such as , for example , bound phospholipids , or covalently linked carbohydrate , depending on the necessity of such modifications for the performance of the diagnostic assay or therapeutic treatment . as used herein , the term is also meant to include a chemical derivative of an actin binding compound . such derivatives may improve the compound &# 39 ; s solubility , absorption , biological half life , etc . the derivatives may also decrease the toxicity of the molecule , or eliminate or attenuate any undesirable side effect of the molecule , etc . derivatives and specifically , chemical moieties capable of mediating such effects are disclosed in remington &# 39 ; s pharmaceutical sciences ( 1980 ). procedures for coupling such moieties to a molecule are well known in the art . the term &# 34 ; functional derivative &# 34 ; is intended to include the &# 34 ; fragments ,&# 34 ; &# 34 ; variants ,&# 34 ; &# 34 ; analogues ,&# 34 ; or &# 34 ; chemical derivatives &# 34 ; of a molecule . an &# 34 ; analog &# 34 ; of the actin - binding compounds of the invention is meant to refer to a compounds substantially similar in function to either the native actin - binding compound or to a fragment thereof . for example , an analog of an actin - binding protein is a protein which does not have the same amino acid sequence as an actin - binding protein but which is sufficiently homologous to an actin - binding protein so as to retain the biological activity of such actin - binding protein . the methods of the invention are based , in part , upon the observation that secondary injury of the lung and / or kidney often results when , in response to inflammation or injury elsewhere in the body , complexes of actin with the actin - binding proteins gelsolin and dbp appear in the blood and the levels of free gelsolin and dbp in the plasma are significantly depressed . knowing that infusions of free , extracellular actin are toxic to the lung and kidneys , and inhibit fibrinolysis , the inventor made the observation that it is the uncomplexed actin in the blood which is responsible for the secondary tissue injury to the lungs and kidney . the inventor made the further unique observation that tissue injury and inflammation may saturate the host &# 39 ; s ability to complex and remove such toxic , free extracellular actin . the inventor then drew the conclusion that amelioration of the toxic effects of extracellular actin , and especially , cytoprotective effects to the lung and / or kidney may be provided by administering sufficient amounts of an actin - binding compound to the subject to complex or otherwise modify the extracellular actin into a non - toxic monomeric form . the particular actin - binding molecules that are the subject of the methods of the invention are purified native and recombinant actin - binding proteins , and other non - proteinaceous actin - binding molecules , and biologically - active fragments thereof , which are characterized by the presence of unique actin binding domains which possess the biological activity of being able to sequester actin in a monomeric form or rapidly to disaggregate or depolymerize actin filaments or to cover sites on free actin that are toxic to host cells . individual actin - binding domains possessing this biological activity may also be produced by synthetic , enzymatic , proteolytic , chemical or recombinant dna methods . in a preferred embodiment , gelsolin , dbp , or actin - binding fragments thereof , or , a combination of gelsolin and dbp and / or actin - binding fragments thereof , are provided to the subject in need of treatment . plasma gelsolin , ( also called brevin , or actin depolymerizing factor ) and dbp , ( also called gc globulin ) are the two high affinity actin - binding proteins that exist in plasma . high affinity actin - binding proteins bind actin with a k d of less than 10 - 8 . both gelsolin and dbp bind to actin in serum and have actin depolymerizing activity . dbp preferentially binds monomeric actin while gelsolin preferentially binds actin filaments . gelsolin is a multifunctional actin - binding protein obtained from mammalian cytoplasm and extracellular fluids . plasma gelsolin differs from cellular gelsolin only by the addition of 25 amino acids at the amino terminus of the molecule and both gelsolins are the product of a single gene . plasma gelsolin has three actin - binding sites and binds with high affinity to either g - actin or f - actin . plasma gelsolin binds a second actin molecule with a higher affinity than it binds a first actin molecule , and thus preferentially forms 2 : 1 complexes over 1 : 1 complexes and binds filaments in preference to monomers . when added to f - actin , plasma gelsolin severs the filament in a nonproteolytic manner and remains bound to one end of the newly formed filament . if free gelsolin molecules are present , they will sever the actin filament successively until only 2 : 1 actin - gelsolin complexes are present , thereby rapidly depolymerizing the filament . free and complexed ( to actin ) gelsolin molecules differ in their functional properties . although free gelsolin can sever actin filaments , actin - gelsolin complexes cannot . gelsolin &# 39 ; s primary function in the plasma is to sever actin filaments . if gelsolin is present in excess of actin , only gelsolin - actin complexes result ; if actin is in excess , there are free actin oligomers and gelsolin - actin complexes . the actin severing occurs by way of a nonproteolytic cleavage of the noncovalent bond between adjacent actin molecules . gelsolin &# 39 ; s severing activity is activated by micromolar ca 2 ++ and has been shown to be inhibited by phosphatidyl inositol , bisphosphate ( pip2 ) and phosphatidyl inositol monophosphate ( pip ). since extracellular ca 2 ++ concentrations are at millimolar levels and extracellular fluids do not normally contain pip or pip 2 in a form that inhibits gelsolin , plasma gelsolin is constitutively active in extracellular fluids . dbp has a single actin binding site and binds constitutively to monomeric but not f - actin . in one embodiment , efficacious levels of actin - binding compounds are administered so as to provide therapeutic benefits against the secondary toxic effects of excessive extracellular actin . by &# 34 ; efficacious levels &# 34 ; of actin - binding compounds is meant levels in which the toxic effects of free extracellular actin are , at a minimum , ameliorated . by &# 34 ; excessive &# 34 ; extracellular actin is meant an amount of extracellular actin which exceeds the ability of the plasma proteins to bind and clear the actin from extracellular fluids without secondary tissue damage or toxic effects . by &# 34 ; secondary &# 34 ; tissue damage or toxic effects is meant the tissue damage or toxic effects which occur to otherwise healthy tissues , organs , and the cells therein , due to the presence of excessive extracellular actin in the plasma , usually as a result of a &# 34 ; primary &# 34 ; tissue injury elsewhere in the body . in the methods of the invention , infusion of actin - binding compounds , such as , for example , gelsolin , dbp , or actin - binding fragments thereof results in a ) binding to actin monomers so as to prevent their condensation into actin filaments , and / or b ) cleavage of actin filaments to the monomeric state , and / or c ) enhanced clearance of such actin complexed to actin - binding protein or fragments thereof from the circulation or extracellular tissue environment . actin - binding compounds may be conjugated , either chemically or by genetic engineering , to fragments of other agents which provide a targeting of such actin - binding compound to a desired site of action . actin - binding compounds or active fragments thereof which possess the ability to transport across the renal glomerulus filter may be used to reduce actin toxicity to the kidney . actin - binding compounds which have a molecular weight less than 65 kd may be expected to cross the renal glomerulus filter and thus be capable of neutralizing toxic effects of filtered actin ; such compounds may also more easily penetrate plugs of actin lodged in capillaries of any organ or in the extracellular space . alternatively , other compounds may be conjugated , either chemically or by genetic engineering , to the actin - binding compound or active fragment thereof , so as to enhance or provide additional properties to such actin binding compound , especially properties which enhance the compound &# 39 ; s ability to promote relief of actin &# 39 ; s toxic effects . for example , because actin promotes intravascular blood coagulation and inhibits fibrinolysis , by conjugating tissue plasminogen activator and / or an antithrombin such as hirudin or active fragments thereof to the actin - binding compound one can target a fibrinolytic agent to the sites where tissue injury released actin which promoted intravascular blood coagulation . amounts and regimens for the administration of actin - binding compounds can be determined readily by those with ordinary skill in the clinical art of treating actin - related disorders , tissue injury and inflammation . generally , the dosage of actin - binding compound treatment will vary depending upon considerations such as : type of actin - binding compound employed ; age ; health ; conditions being treated ; kind of concurrent treatment , if any , frequency of treatment and the nature of the effect desired ; extent of tissue damage ; gender ; duration of the symptoms ; and , counterindications , if any , and other variables to be adjusted by the individual physician . dosage can be administered in one or more applications to obtain the desired results . the dosage can be calculated in the following manner . the normal blood gelsolin concentration is 2 . 4 μm ( 2 . 4 μmol / l ), and the normal blood dbp concentration is 5 μm ( 5 μmol / l ). thus , the total blood actin - binding capacity ( abc ) is approximately 7 . 5 μmol / l . the blood volume is 6 % of the body weight , hence a 70 kg person has 4 . 2 liters of blood and thus ( 4 . 2 l × 7 . 5 μmol / l ) 31 . 5 μmols abc . since dbp and gelsolin are distributed throughout the extracellular space ( which is 10 % of the body weight , the body contains ( 7 . 5 × 7 ) 52 . 5 μmols abc . it may be desired to administer between 32 and 53 μmols of an actin binding compound ( or 0 . 46 μmol / kg body weight ) to cover total complexing or depletion of endogenous abc . since 0 . 425 mg of actin is equal to 1 μmol , and since there is 4 . 86 mg actin per gram of skeletal muscle , each gram of muscle contains 11 . 3 μmol actin , or 4 . 6 grams of muscle destruction could neutralize total body abc . however , because the toxic effects of actin are presumably local ( e . g ., inhibition of clot lysis ), sequestered or kinetically determined ( e . g ., actin permeates an organ faster than binding proteins neutralize it ), it is likely that a theoretically minimum dose will have to be adjusted upward in order to achieve kinetically favorable therapeutic effects . the kinetic effect can be important , for example , since hemolysis of about half of erythron , which should liberate only 4 . 2 μmol of actin , reduces the plasmia gelsolin concentration by half acutely ( smith et al . blood 72 : 214 - 2181 ( 1988 )), suggesting slow equilibration between extravascular and blood compartments . conversely , a therapeutically effective state , capable of breaking up local deposits of actin , may be achievable only by a transient pulse of a high concentration of actin - binding molecules . the compounds of the invention can be administered in any appropriate pharmacological carrier for administration . they can be administered in any form that effects prophylactic , palliative , preventative or curing conditions of tissue injury in humans and animals . preparations of the actin - binding proteins of the invention for parenteral administration includes sterile aqueous or non - aqueous solvents , suspensions and emulsions . examples of non - aqueous solvents are propylene glycol , polyethylene glycol , vegetable oil , fish oil , and injectable organic esters . aqueous carriers include water , water - alcohol solutions , emulsions or suspensions , including saline and buffered medical parenteral vehicles including sodium chloride solution , ringer &# 39 ; s dextrose solution , dextrose plus sodium chloride solution , ringer &# 39 ; s solution containing lactose , or fixed oils . intravenous vehicles include fluid and nutrient replenishers , electrolyte replenishers , such as those based upon ringer &# 39 ; s dextrose and the like . the actin - binding proteins of the invention may also be administered by means of pumps , or in sustained - release form , especially , when the primary injury is prolonged or delayed rather an acute . an example in which the primary injury is often prolonged or delayed rather than acute is a myocardial infarction wherein the damage to the heart muscle is not revealed ( or persists ) until days after the primary heart attack . the actin binding molecules of the invention may also be delivered to specific organs in high concentration by means of suitably inserted catheters , or by providing such molecules as a part of a chimeric molecule ( or complex ) which is designed to target specific organs . administration in a sustained - release form is more convenient for the patient when repeated injections for prolonged periods of time are indicated . for example , it is desirable to administer the actin - binding proteins of the invention in a sustained - release form when the methods of the invention are being used to treat a genetic or chronic disease based upon an actin - related disorder so as to maximize the comfort of the patient . the actin - binding proteins of the invention can be employed in dosage forms such as tablets , capsules , powder packets , or liquid solutions for oral administration if the biological activity of the protein is not destroyed by the digestive process and if the characteristics of the compound allow it to be absorbed across the intestinal tissue . the pharmaceutical compositions of the present invention are manufactured in a manner which is in itself know , for example , by means of conventional mixing , granulating , dragee - making , dissolving , lyophilizing or similar processes . the compositions of the present invention , in and of themselves , find utility in the control of actin - induced physiological damage , be it chronic or acute . the compositions of the invention direct the body &# 39 ; s own mechanisms for dealing with excess actin in the bloodstream or extracellular tissues to its maximum potential . in intravenous dosage form , the compositions of the present invention have a sufficiently rapid onset of action to be useful in the acute management of potential tissue damage . additionally , a low potency version is useful in the management of mild or chronic actin - related disorders . in addition , the compositions of the present invention provide requisite reagents for the laboratory assay of actin levels in an animal &# 39 ; s bloodstream or extracellular tissues . actin - binding proteins which are substantially free of natural contaminants can be isolated and purified from their natural or recombinant sources in accordance with conventional conditions and techniques in the art previously used to isolate such proteins , such as extraction , precipitation , chromatography , affinity chromatography , electrophoresis , or the like . one of skill in the art can identify the actin - binding domain ( s ) of an actin - binding compound using techniques known in the art , without undue experimentation , and such domains are preferred in the methods of the invention . for example , derivatives of the native actin - binding proteins , or , derivatives of recombinantly produced actin - binding proteins , can be made by proteolytic cleavage of the full - length actin - binding protein with common proteases , such as , for example , trypsin , chymotrypsin , and subtilisin . affinity chromatography with actin - derivatized resins may be used to assay such fragments for their actin - binding ability . when identification of compounds or fragments thereof which possess actin - severing activity is desired , such compounds or fragments can also be identified using techniques known in the art , for example , by following the rate of depolymerization of pyrene - labeled f - actin . further , such fragments may be identified by their homology to other known actin - binding or actin - severing domains wherein it may be predicted that function will follow homology . for example , it is known that severin , gelsolin and villin , and especially amino acid residues 40 - 351 in severin and amino acid residues 63 - 383 in gelsolin , show extensive homology in the domain responsible for f - actin severing activity . the n - terminal half of gelsolin , for example , an n - terminal tryptic fragment known as ct45 , is capable of severing f - actin and contains two actin binding sites . one of these sites resides in a chymotryptic fragment , ct15n ( human gelsolin residues 24 - 150 ), which binds the ends of actin monomers and filaments with high affinity ; the other site is contained in the adjacent fragment ct28n ( residues 151 - 406 ), which binds to the side of f - actin in a polyphosphoinositide - regulated manner . neither of the fragments sever actin filaments by themselves . the smallest gelsolin polypeptide which is capable of severing f - actin encompasses residues 25 - 165 of plasma gelsolin . efficacious amounts of ct45 which are substantially free of natural contaminants can be administered to a patient who has had a severe myocardial infarction or other thrombotic event for a time and period throughout which damage to the heart or tissue is revealed . the amount of the peptide to be administered may be determined after assaying the ratio of total to bound gelsolin in the patient &# 39 ; s plasma to determine the fraction of the total gelsolin which has already been saturated with actin released by the dying heart cells and calculating the amount needed to , at a minimum , supply enough actin - binding capability to return this ratio to levels found in healthy individuals . further , indicators of renal damage such as the patient &# 39 ; s bun and creatinine levels may be closely monitored and the dose of the actin - binding molecule adjusted higher , if necessary , if such indicators reveal that renal damage may be occurring . thus , the present invention may be used to administer actin - binding compounds to animals in levels sufficient to either a ) prevent actin filament formation and / or b ) process actin filaments to a &# 34 ; stable &# 34 ; monomeric state , in amounts sufficient to treat and / or prevent undesirable physiological effects of free actin accumulation or release in the bloodstream . further , compounds such as actin - binding proteins are highly conserved among species and can be easily isolated in large quantities from nonhuman ( bovine , porcine ) plasma and / or muscle tissues and fragments of these proteins can be chemically or enzymatically prepared by techniques well - known in the art . thus such actin - binding compounds can be administered to a subject in need of the therapeutic methods of the invention without provoking a severe immune response . all references cited in this application are incorporated herein by reference . having now generally described the invention , the following examples further describe the materials and methods used in carrying out the invention . the examples are not intended to limit the invention in any manner . an efficacious amount of an actin - binding compound , for example ct45 , or a peptide containing residues 25 - 165 of plasmia gelsolin , which binds g - and f - actin with high affinity , and which is capable of actin - filament severing and is substantially free of natural contaminants , in a pharmaceutically acceptable vehicle , is administered to a subject that has recently undergone massive trauma , acute hemolysis or rhabdomyloysis due to any cause . the amount of the actin - binding molecule to be given , and the duration of therapy , may be determined by monitoring depletion of extracellular actin - binding capacity through measurements of total plasma gelsolin concentrations or of actin gelsolin complexed in the plasma . if necessary , endogenous gelsolin can easily be differentiated from a therapeutic fragment of gelsolin by monoclonal antibodies directed to epitopes in different domains of the native gelsolin molecule , such antibodies are known in the art . ( chaponnier et al . j . cell biol . 103 : 1473 - 1481 ( 1986 )). in addition , by monitoring pulmonary functions , for example , by measurement of arterial blood oxygenation , and / or renal function , for example , by measurement of serum bun and creatinine concentrations , the dosage of actin - binding compound is adjusted to therapeutic levels . an efficacious amount of an actin - binding molecule is given to patients who have sustained an acute myocardial infarction due to coronary artery thrombosis , prior to or simultaneous with administration of a thrombolytic agent . this is done because plasma gelsolin levels have been known to decrease , progressively following acute myocardial infarction and because actin has been shown to inhibit plasmin , the enzyme activated by all thrombolytic treatments . it is also done because all fibrinolytic therapies currently in existence have had a finite failure rate , that is , arterial patency is not achieved or else reocclusion occurs . to the extent that this failure is caused by inhibition of plasmin generated endogenously or as a result of thrombolytic therapy by free actin emerging from necrotic atheromatous plaques or from infarcted myocardial tissue , actin - binding molecule therapy is directed against this mechanisms of failure . now having fully described this invention , it will be understood by those with skill in the art that the scope may be performed within a wide and equivalent range of condition , parameters , and the like , without affecting the spirit or scope of the invention or of any embodiment thereof . | 6 |
fig1 is a block diagram of a program and system information protocol ( psip ) data generator according to the invention in the context of system 100 that can produce an advanced television standards committee ( atsc ), standard a / 65 , compliant digital television ( dtv ) signal . the system 100 of fig1 includes : a psip generator 102 according to the invention ; sources of data upon which the psip generator operates , such as a source 108 of listing service data , a source 110 of traffic system data and a source 112 of other data ; a multiplexer 114 to incorporate the psip data from the psip generator 102 into an a / 65 - compliant dtv signal ; and a source 116 of audio data , video data , etc . in fig1 , the psip generator 102 includes an interface unit 104 and a non - uniform interval calculation unit 106 . the psip generator 102 according to the invention can be implemented by adapting a well known psip generator according to the discussion herein . an example of a known psip generator is the psip builder pro brand of psip generator manufactured and sold by triveni digital inc . the psip builder pro itself is based upon a programmed pc having a pentium type of processor using the microsoft windows nt4 . 0 operating system . the software can be written in the java language . the other blocks of fig1 correspond to known technology . in fig1 , the invention has been depicted in the context of a digital television broadcast such as a terrestrial broadcast , and more particularly one that is compliant with the advanced television standards committee ( atsc ), where each event is a program , and the schedule data is psip data . however , the invention is readily applicable to any television format , e . g ., analog terrestrial , analog cable , digital cable , satellite , etc ., for which an electronic schedule is maintained and corresponding data is sent to a receiver for the purpose of presenting an electronic program guide ( epg ) to a viewer . the units 104 and 106 within the psip generator 102 do not necessarily correspond to discrete hardware units . rather , the units 102 and 104 can represent functional units corresponding to program segments of the software that can embody the invention . the interface unit 104 can generate a graphical user interface ( gui ) that operates to receive at least one , issuance parameter for like psip tables ( e . g ., etts or eits ) that do not all have an issue interval assigned by the a / 65 standard . such an interface will be described in more detail below with regard to fig2 . the non - uniform interval calculation unit 106 is operable to determine non - uniform issuance intervals for ones of the like psip tables that do not have an assigned interval , based upon the issuance parameter ( s ) received via the interface unit 104 . fig2 is an example image of a dialog window 200 ( a gui ) that can be generated by the interface unit 104 according to the invention . in fig2 , the dialog window 200 can include : a cycle time settings tab 202 ; a miscellaneous settings tab 204 ; a ftp periodic update controls tab 206 ; an “ apply settings ” button 226 ; a “ defaults ” button 228 ; a “ refresh ” button 230 ; and a “ close ” button 232 . the position of the cursor can be indicated via the reverse highlighting 234 . the cycle time settings tab 202 can include a “ cycle times ( in seconds ) for eits :” region 208 , a “ cycle times ( in seconds ) for psip tables :” region 210 , a “ cycle times ( in seconds ) for psi tables :” region 212 and a “ cycle times ( in seconds ) for etts .” region 214 . it is well known that eits carry program schedule information including program title information and program start information . each eit covers a three - hour time span . etts carry text messages associated with the eits , e . g ., program description information for an eit . in fig2 . the “ cycle times ( in seconds ) for eits :” region 208 of the dialog window 200 can include : a box 216 in which a user can enter a fixed interval for the eit 0 table ; a box 218 in which a user can enter an increment for the eit k table ; and a box 220 in which a user can enter a maximum number of eit tables that are to be sent . usually , the number entered in box 220 will be far smaller than the maximum number of eit tables permitted by the a / 65 standard . also , in fig2 . the “ cycle times ( in seconds ) for etts :” region 214 can include : a box 222 in which a user can enter a fixed interval for the ett 0 table ; and a box 224 in which a user can enter an increment for the ett k table . the non - uniform interval calculation unit 106 can receive the values in the boxes 216 , 218 , 220 , 222 and 224 from the regions 208 and 214 , respectively , and use them to determine the non - uniform issuance intervals of , e . g ., the eit and ett tables . further discussion of the operation of the unit 106 is couched in a particular non - limiting example , for simplicity . the a / 65 standard recommends a time interval for outputting the zeroith event information table ( eit ), i . e ., eit 0 , but provides no guidelines regarding eit 1 through eit 128 . for the rating region table ( rrt ), the a / 65 standard recommends a value only for the output frequency of rrt 1 . and no recommendation is made regarding the output frequencies of any of the extended text tables ( etts ). under the a / 65 standard , it is left to the discretion of the operator of a psip data generation system to select the frequency of table output for the unmentioned tables . the operator could specify an entry for each group of tables , but that would be burdensome because it would require a total of over 500 entries . a simple solution to the problem of unspecified output frequencies would be to set each type of table to the same output frequency , but that creates a problem in that the guidelines for bandwidth specified by the a / 65 standard would be exceeded . a further consideration to solve the problem , namely of how to insert the least amount possible of meta data into the dtv signal and yet still achieve an a / 65 compliant dtv signal , is : how closely in time to the present moment does each table relate ? that is , table types such as the eit describe event information up to two weeks into the future . a user of an electronic program guide that receives such table types will typically want to view event information concerning only the next 24 - 48 hours . users typically do not look farther into the future than this because ( at least in part ) the event schedule information two weeks into the future is much more likely to change than is event schedule information concerning the next 24 - 48 hours , i . e ., the farther into the future . the less reliable the event information becomes . care must be exercised so as not to set the intervals to be too infrequent . this is because the dtv receiver can become stalled waiting for a table to arrive . if the dtv receiver is stalled for 0 . 5 seconds , a user might not notice or object if she did . but such a delay of , e . g ., 4 - 5 seconds probably would be noticed by , and probably would annoy , the user . this reinforces the need to set short intervals for near term events because users are likely to want to display epg information about them . again , the invention , in part , provides an interface unit 104 that defines parameters that the non - uniform interval calculation unit 106 then can use to generate the time intervals between tables of the same type . typically ( but not necessarily ) the function performed by the unit 106 will be linear , e . g ., with a defined start interval ( the root_time ) and an increment interval ( increment_time ). for example , if the user desires eit 0 to be output every half second ( root time ) with each succeeding eit 0 to be output 0 . 25 seconds less frequently than the preceding eit , namely eit i the user would enter 0 . 5 seconds as the root_time in box 216 and 0 . 25 seconds as the increment_time in box 218 . the function for each table eit - i interval would then be : for example , eit 12 can be output every 0 . 5 sec +( 0 . 25 sec * 12 )= 3 . 5 seconds , which is less frequent than eit 0 . obviously , other examples are possible , e . g ., the increment_time for each of different groups of like tables can be set . a similar calculation for etts can be performed by the unit 106 . the invention has at least the following advantages : 1 ) it provides an easy way of entering the interval times for the tables : 2 ). it defines the interval times for like tables that are not all fixed to a constant interval ; and 3 ) it provides an interval function that increases the interval for tables that represent information further out in time . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims . | 7 |
fig1 shows an exploded view of the inventive socket assembly 11 comprising a base 12 and a cover 14 both of which are formed or molded of a suitable relatively rigid insulative material such as plastic . the socket 11 includes a central passage 15 for mounting onto the terminal pin portion of the neck of a television picture tube , not shown . the terminal pins generally labeled 16 extend downwardly for purposes of connecting the socket assembly 11 to suitable electrical and electronic circuitry , as is known . a conductor plate or ring 30 , in substantially a semi - circle shape , conforms to the shape of a horizontal planar surface 22 on base 12 and is securely embedded as by molding , as is well - known , slightly beneath the surface 22 . conductor plate 30 includes a terminal tab 31 for connecting through an electrical lead 32 to ground reference . openings 33 are formed in surface 22 to selectively expose sections of the ring 30 to provide one part of an arc gap as will be explained . the pins 16 extend upwardly through suitable apertures 18 in base 12 and are bent over to have a portion 21 which extends horizontally over respective spark gap openings 33 formed on surface 22 . pin portions 21 each include a dimple protrusion 23 which extends downwardly toward , but spaced from , ring 30 . this provides the gap across which the low voltage arcing occurs ; as is well - known in the art . the base plate 12 is generally in an irregular circular form , in plan view , as is the entire assembly 11 . the base 12 includes an upwardly extending peripheral wall 29 which is irregular in height . the cover 14 includes a peripheral wall 24 which mates with and encircles wall 29 . the top 25 of cover 14 comprises two stepped planar surfaces which conform to and provide a cover for base 12 . the periphery of opening 15 in base 12 includes one or more positioning notches 28 on its circumference for properly indexing the socket assembly 11 on the neck of the associated tube . the wall 24 of cover 14 includes vertically extending flexible latches 26 which mate with , or are received by respective positioning catches or shoulders 27 formed on the periphery of the base 12 . the ends 33 of the pins 16a which extend to the periphery of opening 15 provide electrical contact with the picture tube pins . pin contact ends 33 are bifurcated and are in the form of a spring - biased and centrally cantilevered structure similar to that described in u . s . pat . no . 3 , 733 , 522 assigned to the same assignee as the present invention . a portion of base 12 extends vertically to form a housing 40 which is substantially rectangular in plan view , on one side of base 12 . housing 40 contains or encloses the high voltage spark gap devices , see also fig2 . housing 40 is divided into two similar but separate chambers or compartments 41 and 42 for housing or containing two distinct but similar set of spark gap electrodes . fig2 shows a cross - sectional view of the housing 40 and one set of the spark gap ball electrodes 43 and 44 in chamber 41 . each ball electrode is substantially hemi - spherical and includes a central nipple 60 which extends toward the other electrode ; this provides a reliable spark gap initiating point . as seen in fig1 the housing 40 includes a central air space 45 formed by dielectric walls or barrier 46 and 47 . the combination of the foregoing dielectric barrier walls and the air spaces therebetween provide improved thermal and dielectric characteristics for the socket assembly 11 substantially according to the concepts described in u . s . pat . no . 3 , 771 , 024 and assigned to the same assignee as the present invention . the chamber 41 tends to maintain the atmosphere therein constant and stable such that the spark gap formed between the two opposed electrodes 43 and 44 maintain a more constant arcing level . it has been found that in certain multipotential applications , it is necessary that the spacing between pairs of ball electrodes be adjusted to arc at different high voltage ranges . thus , in the embodiment shown , ball electrodes 43 and 44 are spaced at a greater distance than the electrodes in compartment 42 to accommodate a larger operating or arcing voltage . as shown in fig2 the ball electrode 43 is embedded or formed in a plastic plug 51 which conforms to the periphery of the chamber 41 , and is received in chamber 41 . the electrode 43 is connected as by lead 62 to the pin 16a and to the high voltage conductor 59 . chamber 41 includes an interior peripheral ledge 63 in which a hollow cup shaped ring spacer 64 is positioned . spacer 64 includes an inwardly extending rim 65 for purposes to be described . the plug 51 including ball electrode 43 rests on the top of spacer 64 . the lower electrode 44 is embedded in the bottom of chamber 41 and its lower surface is open to the surroundings . a vent hole 66 vents the interior of chamber 41 to the surroundings . electrode 44 is connected through lead 67 to ground reference . an important feature of the invention are the structures shown in fig2 which provides a corona disruption capability . since corona precedes dielectric breakdown , a corona discharge adversely affects and changes the selected and pre - established voltage breakdown or arcing potential , between the electrodes . it has been found that with ball electrodes positioned in chamber 41 having smooth sides , a corona discharge path initiated at one electrode extends or moves along the walls of the chamber and thence tends to reduce the arcing potential between the two electrodes . as shown by the dashed lines 69 in fig2 the rim or shoulder 65 on spacer 64 provides an effective barrier which interrupts the corona ionizing path track to thereby inhibit corona discharge . in effect the rim 65 provides a shadow area , indicated as x , from electrodes 43 or 44 to the wall of the chamber 41 , which tends to inhibit establishing a corona discharge along the wall of the chamber . while the invention has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art , that various changes in form and details may be made therein without departing from the spirit and scope of the invention . | 7 |
in both of the semiconductor devices shown in fig1 and 2 , multiple semiconductor materials are integrated to form the device on a si substrate 10 and 20 respectively . it should be noted that both fig1 and fig2 are diagrammatic and are not drawn to scale , the dimensions of the thicknesses of the various layers of semiconductor materials being exaggerated for greater clarity . corresponding parts in both figures are given the same hatching and generally have the same references numerals but separated by ten , for example the si substrate in fig1 has the reference numeral 10 whereas in fig2 the si substrate has the reference numeral 20 . in both fig1 and fig2 , the semiconductor device comprises a cmos device wherein both an n - mosfet device n and a p = mosfet device p are formed on the same si substrate 10 , 20 . in the first embodiment shown in fig1 , the substrate also comprises a layer 11 of gap provided over a base si layer 10 to provide insulation and to reduce thermal problems caused by self - heating and the n and p devices are formed on the layer 11 . each of the n and p devices comprises a channel of appropriate type conductivity semiconductor material 12 , 13 respectively formed on the layer 11 and separated by an isolation region 14 . in fig1 , the first , n - type conductivity semiconductor material used for the channel 12 of the n device also comprises silicon and the second p - type conductivity semiconductor material used for the channel 13 of the p device comprises a silicon - germanium alloy . the manner in which this cmos device is manufactured will now be described with reference to fig3 . after provision of the si substrate 10 , the gap layer 11 is first grown on the si layer 10 . over this , a second thin si layer 12 is then grown to form part of the first channel material for the n - mosfet device n . the second thin si layer 12 can be p - type doped in - situ during an epitaxy growth step . the thickness of this second si layer 12 may be between 10 nm and 20 nm . since a high crystalline quality undoped gap layer , 11 and the second si layer 12 can be directly grown in a single growth step on a si substrate 10 using either molecular beam epitaxy or vapor phase epitaxy or a metalorganic chemical vapour deposition ( mocvd ) technique , a reduction in the fabrication time and cost of a wafer as compared to the conventional but tedious simox or wafer bonding processes used in soi type devices can be achieved . the thickness of the gap layer 11 may be between 50 nm and 150 nm . essentially , therefore , a complete base structure comprising the layers 10 , 11 , and 12 with an excellent interface quality in the si / gap interface can be epitaxially grown initially in a single epitaxy growth step ( step 1 ). the second si layer 12 is then dry etched at a place where the p - mosfet device p is to be defined ( step 2 ). in order to form the p - mosfet device p , a si0 . 75ge0 . 25 layer 13 is then epitaxially grown , which may be between 10 nm and 30 nm thick and n - type doped in - situ during epitaxy growth step ( step 3 ). the composition of ge in this layer may be tuned ( x = 0 . 2 − 0 . 3 ) to match the lattice constant exactly with that of the gap layer 11 beneath it . an isolation region 14 is then defined first by anisotropically etching the si layer 12 and the si0 . 75ge0 . 25 layer 13 to separate these layers and then by depositing silicon nitride ( si3n4 ) or sio2 by a conventional cvd technique ( step 4 ). gate oxide layers 15 are then formed over the layers 12 and 13 ( step 5 ). these layers 15 may be thermally grown and may typically comprise sio2 or another high - k material such as tantalum oxide ( tao5 ), hafnium oxide ( hf02 ) or other suitable gate dielectric material . gate electrode layers 16 are then deposited ( step 6 ) and may be of polysilicon or any other suitable metal with the desired work function . the p and n doping in the channel layers 12 and 13 and the gate work function , i . e . the gate material , will define the threshold voltage of the device . once the gate electrode layers 16 have been deposited , the source - drain regions can be formed ( steps 7 and 8 ). preferably , nitride spacer layers 17 are first deposited around the gate region formed by the gate oxide layers 15 and the gate electrode layers 16 ( step 7 ). these nitride spacers may be between 25 nm and 100 nm thick . after this a source - drain implant step is performed . these implants may comprise arsenic ( as ) for the n - mosfet device n and boron ( b ) for the p - mosfet device p . finally , the source - drain contact layers 18 of any suitable metal are deposited ( step 8 ). turning now to the embodiment shown in fig2 , again a gap layer 21 is first grown on a si substrate 20 . however , in this embodiment , the channel layer 22 of the n - mosfet n is composed of gaas material and the channel layer 23 of the p - mosfet p is composed of a si0 . 75ge0 . 25 material . as discussed above , one problem associated with the growth of gaas on a gap / si substrate 21 , 20 is lattice mismatch between the si and gaas layers . this problem is overcome in the present embodiment by using intermediate layers 29 and 30 , each of which comprises a superlattice stack of between four and six layers . the manner in which this cmos device is manufactured will now be described with reference to fig4 . the first layer 29 is laid down over the gap layer 21 and comprises alternating layers of gap and gaasp each being between 5 nm and 10 nm thick and left undoped . the second layer 30 is laid down over the layer 29 and comprises alternating layers of gaasp and gaas , again each being between 5 nm and 10 nm thick and left undoped . each layer 29 , 30 may be grown between four and six times to absorb the lattice mismatching . initially , a base structure b comprising the si layer 20 , the gap layer 21 , the intermediate layers 29 and 30 , and the first channel layer 22 of the n - mosfet n is first grown in a single epitaxy step ( step 1 ) using either a molecular beam epitaxy ( mbe ) or a metalorganic chemical vapor deposition ( mocvd ) technique . the top gaas channel layer 22 may be intrinsically p - type doped to a desired value to form a p - well for the n - mosfet n . the thickness of gaas channel layer is preferably between 10 nm and 20 nm thick and the thickness of the gap layer 21 is preferably between 50 nm and 150 nm . once the base structure b has been formed , a portion of the top gaas layer 22 is dry etched at a place where the p - mosfet p is to be formed ( step 2 ). a si0 . 75ge0 . 25 layer 23 is then epitaxially grown ( step 3 ). this layer 23 is preferably between 10 nm and 30 nm thick and n - type doped in - situ during the epitaxy growth step . as in the first embodiment , the composition of the ge may be tuned ( x = 0 . 2 − 0 . 3 ) to match the lattice constant exactly with the gap layer 21 underneath . an isolation region 24 is then defined first by anisotropically etching the gaas layer 22 and the si0 . 75ge0 . 25 layer 23 to separate these layers and then by depositing silicon nitride or silicon dioxide by a conventional cvd technique ( step 4 ). the gate dielectric materials are then grown ( step 5 ). unlike the first embodiment shown in fig1 , in this embodiment these materials may be different . the gaas channel 22 of the n - mosfet n may be covered with a gallium oxide ( gao ) dielectric layer 25 that is be thermally grown or deposited to a thickness selected for a desired device performance . however , the si0 . 75ge0 . 25 material forming the channel layer 23 of the p - mosfet p is covered by a conventional sio2 dielectric material 31 , which is also thermally grown or deposited to a thickness selected for a desired device performance . other high - k materials , such as tao5 , hf02 or any other gate dielectric material may also be used for p - mosfet p . once the dielectric layers 25 and 31 have been formed , the gate electrode layers 26 are then deposited ( step 6 ) and may be of polysilicon or any other suitable metal with a desired work function . the electrode material may be the same for both the n - and p - mosfet devices n and p . the p and n doping in the top channel layers 22 and 23 and the gate work function , i . e . the gate material , will define the threshold voltage of the device . once the gate electrode layers 26 have been formed , the source - drain extensions may be implanted and are preferably arsenic ( as ) for the n - mosfet n and boron ( b ) for the p - mosfet p . as in the first embodiment , nitride spacer layers 27 are then deposited around the gate regions ( step 7 ). the nitride spacer layers 27 are preferably between 25 nm and 100 nm thick . finally , the source - drain metal contact layers 28 of any suitable metal are then deposited ( step 8 ). | 7 |
referring to the drawings in detail , and initially to fig1 - 5 , a shift arrangement 10 for a bicycle according to the present invention , includes a housing 16 to be secured to a handlebar 12 of a bicycle by a clamp 14 . for discussion hereafter , reference to an inner facing side or inner facing surface will refer to the side or surface facing the rider , and reference to an outer facing side or outer facing surface will refer to the side or surface facing away from the rider . specifically , housing 16 includes a first half housing shell 18 and a second half housing shell 20 secured to first half housing shell 18 so as to encase the assembly for effecting gear shifting . as shown best in fig5 - 8 , first half housing shell 18 includes a planar circular outer wall 22 having an annular inturned flange 24 at the periphery thereof . three equiangularly spaced ears 26 extend outwardly from annular inturned flange 24 , each ear 26 having a threaded opening 28 therein facing second half housing shell 20 . a central opening 30 is provided in planar outer wall 22 , with central opening 30 having a slightly oval or oblong configuration . two raised stops 32 and 34 extend inwardly from planar outer wall 22 at the edge of central opening 30 , with stops 32 and 34 being about 100 degrees apart around central opening 30 . an arcuate guide wall 36 is also provided on the inside surface of planar outer wall 22 between stops 32 and 34 and spaced away from central opening 30 . a gap 35 is provided between the end of arcuate guide wall 36 and stop 34 , the purpose for which will become apparent from the discussion hereafter . as best shown in fig5 and 9 - 14 , second half housing shell 20 also includes a planar substantially circular outer wall 40 having an annular inturned flange 42 at the periphery thereof . an annular wall 44 extends outwardly from the periphery of annular inturned flange 42 , with three equiangularly spaced ears 46 extending outwardly from annular wall 44 . each ear 46 has a through bore 48 therein . in this regard , bolts 50 ( fig1 ) extend into through bores 48 and are threadedly received in threaded openings 28 to secure second half housing shell 20 to first half housing shell 18 , with annular wall 44 seating on inturned flange 24 . annular inturned flange 42 includes an outwardly extending nose 52 of a generally frusto - conical configuration with a slight taper extending therefrom , and with a central bore 54 extending therethrough in communication with the interior of housing 16 . as shown in fig1 , nose 52 cooperates with cable adjust collar 56 , with the derailleur cable 57 extending through cable adjust collar 56 and nose 52 into the interior of housing 16 , as will be explained in greater detail hereafter . a cylindrical boss 58 extends inwardly from the center of the inner facing surface of circular outer wall 40 and has a substantially trapezoidal shaped upper end 60 with the longer side of substantially trapezoidal shaped upper end 60 being rounded , although the present invention is not limited to this shape . a central opening 61 is provided through cylindrical boss 58 and substantially trapezoidal shaped upper end 60 , and smaller offset openings 63 and 65 are provided in substantially trapezoidal shaped upper end 60 . a slight depression 62 is formed near the periphery of circular outer wall 40 at the inner facing surface thereof at a position approximately 70 degrees offset from nose 52 in the counterclockwise direction of fig1 , with a through opening 64 formed in the center of slight depression 62 . a raised projection 66 is formed to one side of depression 62 in the counterclockwise direction of fig1 , at the inner facing surface of circular outer wall 40 and at the inner facing surface of annular inturned flange 42 , and includes a threaded opening 68 therein . raised projection 66 includes a triangular shaped projection 70 extending inwardly from annular inturned flange 42 . a substantially triangular recess 72 is formed in the inner facing surface of annular inturned flange 42 directly behind slight depression 62 , and extends upwardly to annular wall 44 . a circular opening 74 extends into the bottom wall of recess 72 . a u - shaped recess 76 is formed in the inner facing surface of annular inturned flange 42 to the opposite side of slight depression in the clockwise direction of fig1 , and extends the entire height thereof . lastly , a through opening 78 extends through annular inturned flange 42 , substantially diametrically opposite u - shaped recess 76 . referring now to fig4 , 5 and 15 - 18 , a slide or mounting element 80 as part of a mounting arrangement 79 for the shift lever to be discussed hereafter , is slidably mounted to planar circular outer wall 22 of first half housing shell 18 . specifically , slide 80 includes a circular disc 82 having a circular boss 84 extending from the center of the outer facing surface of circular disc 82 . boss 84 is cut away to define a slightly raised pedestal 86 and raised walls 87 a and 87 b extending upwardly therefrom with a generally outer circular footprint . raised walls 87 a and 87 b define a large rectangular open area 88 between raised walls 87 a and 87 b , which is in communication with a small rectangular open area 90 between raised walls 87 a and 87 b through an intermediary curved open area 92 between raised walls 87 a and 87 b , all above slightly raised pedestal 86 . a central threaded opening 94 is provided on the outer facing surface of circular disc 82 at the center thereof . a cylindrical projection 96 is provided on the outer facing surface of circular disc 82 , adjacent to small rectangular open area 90 and at a lower height than slightly raised pedestal 86 . an annular advance roller 97 ( fig1 ) is rotatably mounted on cylindrical projection 96 , and is adapted to fit through gap 35 . the opposite inner facing surface of slide 80 includes an elongated recess 98 having a flat end 100 at one end thereof and extends in the same lengthwise direction as large rectangular open area 88 and centered therewith . a triangular recess 102 is provided to one side of elongated recess 98 and includes a guide wall 103 as will be discussed in greater detail hereafter . a further recess 104 is provided on the opposite side of elongated recess 98 for the purpose of reducing material . in addition , a slightly arcuate raised wall 106 extends upwardly from the inner facing surface of slide 80 at a position generally inline with elongated recess 98 but near the opposite periphery of circular disc 82 . a further slightly arcuate raised wall 108 of lesser dimensions than slightly arcuate raised wall 106 extends upwardly from one outer circumferential corner of slightly arcuate raised wall 106 . slide 80 is slidably mounted to planar circular outer wall 22 of first half housing shell 18 such that the outer facing surface of slide 80 rests against the inner facing surface of first half housing shell 18 and such that raised walls 87 a and 87 b extend through central opening 30 . a shift lever 110 , as shown in fig5 and 19 , is attached to the outer facing surface of slide 80 , to the outside of first half housing shell 18 . specifically , lever 110 has a generally human leg shaped appearance , with an upper leg section 112 connected to a lower leg section 114 at an angle of about 140 degrees through a knee section 116 , with the free end of lower leg section 114 including a foot 118 extending approximately at a right angle from lower leg section 114 . upper leg section 112 includes a main body 120 having dimensions corresponding to the dimensions of large rectangular open area 88 of slide 80 and fits therein . the free end of upper leg section 112 tapers down through an arcuate reducing section 122 to a reduced dimension rectangular parallelepiped section 124 . arcuate reducing section 122 has dimensions corresponding to the dimensions of intermediary curved open area 92 of slide 80 and fits therein , and rectangular parallelepiped section 124 has dimensions corresponding to small rectangular open area 90 and fits thereon . in this position , a through bore 126 in main body 120 is in coaxial alignment with central opening 94 of slide 80 . a rivet , bolt or the like ( not shown ) extends through bore 126 and central opening 94 to fixedly secure shift lever 110 to slide 80 . it will therefore be appreciated that rotation of shift lever 110 around the axis of through bore 126 results in corresponding rotation of slide 80 relative to first half housing shell 18 . in addition , since raised walls 87 a and 87 b have a generally outer circular footprint , and since central opening 30 of first half housing shell 18 has a slightly oval or oblong configuration , raised walls 87 a and 87 b can slide within central opening 30 . thus , when shift lever 110 is pushed by the user in an axial direction thereof , from the outer surface of foot 118 , as shown in fig4 , raised walls 87 a and 87 b slide within central opening 30 . referring now to fig5 , 20 and 21 , a post sleeve 130 as a rotatable element of an actuating arrangement is provided in the housing 16 against the inner facing surface of slide 80 . specifically , post sleeve 130 includes a thin generally circular plate 132 having two ears 134 and 136 extending outwardly in the plane of plate 132 and separated by an angle of about 100 degrees . a boss 138 is provided at the outer end of one ear 134 and has a post 140 extending therefrom at right angles to the plane of plate 132 , while a post 142 extends from the other ear 136 on the opposite side of plate 132 . an annular groove 141 is provided around post 140 near the free end thereof . a small opening 143 is provided on the opposite surface of ear 136 . in addition , plate 132 includes a central through bore 144 . a center shaft 146 as part of the mounting arrangement 79 is fixed in central opening 61 of cylindrical boss 58 and extends through bore 144 . the free end of center shaft 146 has a post sleeve roller 145 ( fig4 ) thereon which slidably fits within elongated recess 98 and which permits center shaft 146 to rotate therein . a compression spring 147 ( fig4 and 16 ) or other suitable spring member is fit within elongated recess 98 between flat end 100 thereof and post sleeve roller 145 to normally bias post sleeve roller 145 away from flat end 100 . post sleeve 130 is rotatably mounted on center shaft 146 such that post 142 extends within triangular recess 102 of slide 80 . an annular advance roller 148 is rotatably mounted on post 142 and is adapted to be guided along guide wall 103 of slide 80 , as will be discussed hereafter , during sliding movement of raised walls 87 a and 87 b within central opening 30 . advance roller 148 is shown disengaged from post 142 in fig3 merely for better illustration purposes . as shown in fig5 and 22 , a coiled torsion shift lever return spring 131 is mounted against the inner facing surface of post sleeve 130 . the inner end of shift lever return spring 131 is bent to form a bent spring projection 133 that is fixed in offset opening 63 , while the outer end of shift lever return spring 131 is bent to form a bent spring projection 135 that is fixed in small opening 143 provided in ear 136 of post sleeve 130 . in this manner , shift lever return spring 131 functions to normally bias post sleeve 130 in the clockwise direction of fig3 . as a result , annular roller 148 mounted on post 142 functions to rotate slide 80 and shift lever 110 therewith . as shown best in fig3 , 5 and 23 - 28 , a triple gear pulley 150 is rotatably mounted on cylindrical boss 58 of second half housing shell 20 at the inner facing surface of shift lever return spring 131 . triple gear pulley 150 includes a generally cylindrical body 152 having a central through bore 153 through which cylindrical boss 58 extends . cylindrical body 152 has a centrally located annular cable guiding groove 154 around the outer circumference thereof around which derailleur cable 57 extends . a pointed triangular nose 156 extends outwardly from the outer periphery of cylindrical body 152 and intersects with cable guiding groove 154 . triangular nose 156 includes a cylindrical recess 158 at one side which extends partly therethrough , and an elongated slot 160 at the opposite side which extends into open communication with cylindrical recess 158 . triangular nose 156 , as shown in fig4 , is normally oriented in a lower position to the right side thereof . in this manner , cable 57 enters housing 16 and extends within cable guiding groove 154 from a position slightly to the left of triangular nose 156 , and through elongated slot 160 and cylindrical recess 158 . a cylindrical plug 162 ( fig4 ) is fixed to the free end of cable 57 that extends through cylindrical recess 158 , and is fit within cylindrical recess 158 so as to secure the free end of cable 57 to triple gear pulley 150 at pointed triangular nose 156 . a small opening 157 is provided in the inner facing surface adjacent triangular nose 156 . it will be appreciated that cable guiding groove 154 divides the outer circumference of triple gear pulley 150 into an inner circumferential section and an outer circumferential section . a first set of inner gear teeth 164 extend from the inner circumferential section and a second set of outer gear teeth 166 extend from the outer circumferential section , respectively , both starting from a position immediately above triangular nose 156 and extending upwardly and around triple gear pulley 150 to a position approximately diametrically opposite to triangular nose 156 . it will be appreciated that inner gear teeth 164 have a generally symmetrical trapezoidal appearance , while outer gear teeth 166 each have the same inclination in a direction toward triangular nose 156 and have a greater pitch than gear teeth 164 . as a result , and as will be appreciated from the discussion hereafter , gear teeth 166 are slightly offset from gear teeth 164 . a third set of outer gear teeth 168 extend around the outer circumferential section from a position slightly spaced from the end of the second set of outer gear teeth 166 to a position adjacent to the opposite side of triangular nose 156 . gear teeth 168 have a generally symmetrical trapezoidal appearance . as shown in fig5 and 29 , a coiled torsion gear return spring 165 is mounted between second half housing shell 20 and triple gear pulley 150 . the inner end of gear return spring 165 is bent to form a bent spring projection 167 that is fixed in offset opening 65 of second half housing shell 20 , while the outer end of gear return spring 165 is bent to form a bent spring projection 169 that is fixed in small opening 157 adjacent triangular nose 156 of triple gear pulley 150 . in this manner , gear return spring 165 functions to normally bias gear return spring 165 in the counterclockwise direction of fig4 . as shown best in fig3 - 5 , 30 and 31 , a pawl flange 170 is fixed to the outer facing surface of second half housing shell 20 . pawl flange 170 includes a plate 171 having a main section 172 and a finger section 174 extending therefrom . finger section 174 includes a through bore 176 through which a bolt 178 ( fig3 and 4 ) extends from the outer facing side thereof into threaded engagement with threaded opening 68 to fixedly secure pawl flange 170 to second half housing shell 20 . pawl flange 170 further includes a short post 180 extending from the inner facing surface thereof at a left end position of main section 172 of plate 171 and a tall post 182 extending from the inner facing surface thereof at a lower position on main section 172 of plate 171 . as shown in fig3 - 5 , 32 and 33 , a hold pawl 184 as part of an actuating arrangement is rotatably mounted on tall post 182 of pawl flange 170 . hold pawl 184 includes a pawl lever 186 having a substantially central through bore 188 which is mounted on tall post 182 . a downwardly inclined pawl catch 190 is provided at one end of pawl lever 186 for engaging with gear teeth 166 of triple gear pulley 150 , to be described hereafter . further , a post 192 extends from the outer facing surface of pawl lever 186 at the end thereof opposite pawl catch 190 for engagement with the upper arcuate surface of further slightly arcuate raised wall 108 . as shown in fig3 - 5 and 34 , a main pawl 194 as part of an actuating arrangement is then rotatably mounted on long post 182 of pawl flange 170 on top of hold pawl 184 . main pawl 194 includes a pawl lever 196 having an upper engagement surface 197 and a through bore 198 at one end by which main pawl 194 is mounted on tall post 182 . a downwardly inclined pawl catch 200 is provided at an opposite end of pawl lever 196 for engaging with gear teeth 164 of triple gear pulley 150 , to be described hereafter . further , a post 202 extends from the outer facing surface of pawl lever 196 at the end thereof adjacent pawl catch 200 for engagement with the upper arcuate surface of slightly arcuate raised wall 106 . a main pawl spring 204 normally biases pawl catch 200 into engagement with gear teeth 164 , as shown in fig3 and 4 . specifically , main pawl spring 204 includes a cylindrical base 206 with a central through bore 208 through which tall post 182 extends . a first spring arm 210 extends from cylindrical base 206 at the inner facing end thereof and engages with the inner surface of annular inturned flange 42 . a second l - shaped spring arm 212 extends from cylindrical base 206 at the outer facing end thereof and engages with upper engagement surface 197 of pawl lever 196 . as a result , when an external force is applied to remove pawl catch 200 from gear teeth 164 , spring arms 210 and 212 are tensioned , so that when the external force is removed , spring arms 210 and 212 force main pawl 194 in the counterclockwise direction of fig1 to force pawl catch 200 into engagement with gear teeth 164 . as shown in fig3 - 5 , 36 and 37 , an advance pawl 214 as part of an actuating arrangement is rotatably mounted on post 140 of post sleeve 130 . advance pawl 214 includes a pawl lever 216 having a lower engagement surface 217 and a through bore 218 at one end by which advance pawl 214 is mounted on post 140 of post sleeve 130 . an upwardly inclined pawl catch 220 is provided at an opposite end of pawl lever 216 for engaging with gear teeth 168 of triple gear pulley 150 , to be described hereafter . an advance pawl spring 222 normally biases pawl catch 220 into engagement with gear teeth 168 , as shown in fig3 , 4 and 38 . specifically , advance pawl spring 222 includes a cylindrical base 224 with a central through bore 226 mounted on boss 138 of post sleeve 130 below advance pawl 214 . a first l - shaped spring arm 228 extends from cylindrical base 224 at the outer facing end thereof and engages with the side edge of thin generally circular plate 132 of post sleeve 130 . a second l - shaped spring arm 230 extends from cylindrical base 224 at the inner facing end thereof and engages with lower engagement surface 217 of advance pawl 214 . as a result , when an external force is applied to remove pawl catch 220 from gear teeth 168 , spring arms 228 and 230 are tensioned , so that when the external force is removed , spring arms 228 and 230 force advance pawl 214 in the counterclockwise direction of fig3 to force pawl catch 220 into engagement with gear teeth 168 . as shown in fig3 - 5 and 39 , an advance pawl retaining ring 232 is snap fit onto post 140 of post sleeve 130 , and is held in annular groove 141 thereof , in order to retain advance pawl 214 and advance pawl spring 222 in position . further , as shown in fig5 and 40 , a return spring spacer 234 is mounted on substantially trapezoidal shaped upper end 60 of cylindrical boss 58 between post sleeve 130 and triple gear pulley 150 . specifically , return spring spacer 234 includes a substantially circular plate 236 with a center substantially trapezoidal shaped through bore 238 of the same shape and dimensions as substantially trapezoidal shaped upper end 60 so as to fit therearound . as a result , return spring spacer 234 is not rotatable . an arcuate flange 240 extends in a coplanar manner from the edge of circular plate 236 for an angle of approximately 90 degrees , and has opposite inclined 242 and 244 . in operation , in the neutral or rest position in which no gear change occurs , pawl catch 220 of advance pawl 214 sits on arcuate flange 240 of return spring spacer 234 and is thereby out of engagement with gear teeth 168 . at this time , also , pawl catch 200 of main pawl 194 is biased by main pawl spring 204 into engagement with gear teeth 164 so that the particular gear of the derailleur stays in position . hold pawl 184 is not biased into engagement with gear teeth 166 , but may fall into one of these teeth by means of gravity . for shifting in a direction to pull cable 57 in a first shifting direction denoted by arrow 101 , the person rotates shift lever 110 in a first pivoting direction of arrow 246 in fig4 , that is , in the counterclockwise direction thereof . because slide 80 is fixed to shift lever 110 , slide 80 also rotates in the same counterclockwise direction of fig3 . in this position , compression spring 147 maintains the centered position of slide 80 . the amount of rotation of slide 80 is limited by advance roller 97 between stops 32 and 34 of first half housing shell 18 . in addition , advance of first roller 97 , during the initial rotation , is rotated to a position away from gap 35 , and in front of arcuate guide wall 36 , which prevents linear movement of shift lever 110 , that is , which only allows rotational movement thereof . arcuate guide wall 36 and advance roller 97 form a limiting arrangement 99 for preventing the substantially linear sliding movement of slide 80 upon movement of the single lever 110 in the first pivoting direction , that is , these elements form arrangement 99 for limiting movement of the single lever only in a rotational direction . further , because advance roller 148 abuts against guide wall 103 of slide 80 , post sleeve 130 also rotates in this counterclockwise direction . during this movement , advance pawl 214 rotates with post sleeve 130 and thereby moves past arcuate flange 240 of return spring spacer 234 . as a result , advance pawl 214 is no longer restrained by arcuate flange 240 and is biased by advance pawl spring 222 into engagement with gear teeth 168 . continued rotation causes advance pawl 214 to thereby rotate triple gear pulley 150 in the counterclockwise direction of fig3 in order to pull cable 57 . during this movement , main pawl 194 is caused to move out of a gear tooth 164 by the force of this rotation and against the force of main pawl spring 204 , and then be forced into engagement of the next gear tooth 164 by spring 204 . since shift lever 110 can be rotated a distance to effect up to four gear shiftings in a single movement , main pawl 194 would repeat this operation , that is , be moved out of one gear tooth 164 and into the next gear tooth 164 , and so on , during this gear shifting operation . in like manner hold pawl 184 would perform a similar operation since it is not restrained at all . when the rotational force on shift lever 110 is released , post sleeve 130 is biased in the clockwise direction by shift lever return spring 131 . because advance roller 148 abuts against guide wall 103 of slide 80 , slide 80 and shift lever 110 also rotate in this clockwise direction . because of the configuration of pawl catch 220 of advance pawl 214 , pawl catch 220 is caused to move in and out of gear teeth 168 during this return movement . in other words , advance pawl 214 is configured to move triple gear pulley 150 only in the counterclockwise direction . it is note that the tension on cable 57 would normally force triple gear pulley 150 back in the clockwise direction . however , to retain triple gear pulley 150 is this changed gear position , main pawl 194 engages gear teeth 164 and holds triple gear pulley 150 in position , because there is no rotational force of advance pawl 214 on triple gear pulley 150 . in this regard , cable 57 is pulled to effect a shifting operation in first direction denoted by arrow 101 . for shifting in the opposite direction , the person linearly moves shift lever 110 in the direction of arrow 248 in fig4 in a second substantially linear direction . preferably , there is no rotational movement of shift lever 110 , that is , movement is purely linear . since slide 80 is fixed to shift lever 110 , slide 80 also moves in this linear direction . as such , advance roller 97 on slide 80 moves through gap 35 on first half housing shell 18 . specifically , post sleeve or second roller 145 around the free end of center shaft 146 slidably moves within elongated recess 98 of slide 80 against the force of compression spring 147 . in addition , advance roller 148 rides along guide wall 103 of slide 80 . this arrangement of post sleeve roller 145 within elongated recess 98 of slide 80 and advance roller 148 riding along guide wall 103 of slide 80 together form an arrangement 199 for limiting movement of the single lever in a linear direction . it will be appreciated , however , that post sleeve 130 does not slide and is therefore stationary at this time . as a result , advance pawl 214 is restrained by arcuate flange 240 of return spring spacer 234 , and is thereby out engagement with gear teeth 168 during this entire shifting operation . during this sliding movement , slightly arcuate raised wall 106 of slide 80 engages post 202 of main pawl 194 to move downwardly inclined pawl catch 200 out of engagement with gear teeth 164 of triple gear pulley 150 . at the same time , slightly arcuate raised wall 108 abuts post 192 of hold pawl 184 to move downwardly inclined pawl catch 190 into engagement with gear teeth 166 of triple gear pulley 150 . therefore , at this time , triple gear pulley 150 is held in position only by hold pawl 184 . the spacing or pitch of gear teeth 166 is greater than the width of pawl catch 190 so that , during this initial engagement , triple gear pulley 150 is caused , by the pull force from cable 57 , to rotate slightly in the clockwise direction of fig3 by a slight distance equal to the difference between the spacing or pitch of gear teeth 166 and the width of pawl catch 190 , until pawl catch 190 abuts against the edge of the respective gear tooth 166 to hold triple gear pulley 150 in position . when the linear force applied to shift lever 110 is released , compression spring 147 forces slide 80 to move linearly to its original position . as a result , slightly arcuate raised wall 108 no longer abuts post 192 of hold pawl 184 , whereby downwardly inclined pawl catch 190 can be moved out of engagement with gear teeth 166 of triple gear pulley 150 . this occurs by reason of the tension on cable 57 moving triple gear pulley 150 in the clockwise direction of fig3 , whereby hold pawl 184 is forced by this rotation out of engagement with gear teeth 166 . at the same time , slightly arcuate raised wall 106 of slide 80 no longer engages post 202 of main pawl 194 , whereby main pawl spring 204 forces main pawl 194 to move in the counterclockwise direction of fig3 . however , triple gear pulley 150 already rotated slightly in the clockwise direction of fig3 , as described above . as a result , there is no gear tooth 164 for main pawl 194 to engage . therefore , triple gear pulley 150 starts to rotate in the clockwise direction of fig3 by reason of the tension on cable 57 , until downwardly inclined pawl catch 200 of main pawl 194 engages the next tooth 166 and is forced into this next tooth 166 by main pawl spring 204 in order to hold triple gear pulley 150 in this position . as a result , cable 57 is released to effect a shifting operation in a second opposite direction denoted by arrow 103 in fig4 . it will be appreciated that various modifications can be made to the invention within the scope of the claims . for example , rather than shift lever 110 moving only in a linear direction during the reverse shifting operation , it can move in a slightly arcuate path in which it also rotates slightly while moving linearly . further , it is possible to effect the linear movement of shift lever 110 after shift lever 110 is first rotated a small distance . in this regard , reference in the claims to substantially linear covers all of these arrangements . having described specific preferred embodiments of the invention with reference to the accompanying drawings , it will be appreciated that the present invention is not limited to those precise embodiments and that various changes and modifications can be effected therein by one of ordinary skill in the art without departing from the scope or spirit of the invention as defined by the appended claims . | 8 |
in fig1 designates generally a load vehicle of an arbitrary kind , which is equipped with a goods elevator in the form of a rear mounted elevator generally designated by 2 . a frame or chassis of the vehicle is designated by 3 . the elevator 2 comprises a base portion or attachment box 4 which is secured to the vehicle frame 3 , e . g . through welding or riveting . to this base portion 4 are connected two arms 6 which are pivotable about hinges 5 of the base portion 4 and only one of which is visible in fig1 since the other is disposed at the opposite side of the vehicle . the arms 6 are , in turn , at their ends facing away from the hinges 5 connected to a load carrier 7 , preferably in the form of a plate extending substantially over the whole width of the vehicle . each of the pivotable arms 6 is adapted to co - operate with a first piston - cylinder mechanism 8 which is pivotable about a second hinge 9 of the base portion 4 and connected to the load carrier 7 at a bracket 10 . it is obvious that the load carrier 7 can be raised and lowered to a desired level through pivoting the arms 6 through extension and retraction respectively of the piston rod in the piston - cylinder mechanism 8 . to provide for the pivoting or tilting of the load carrier 7 between the raised vertical position shown by dash lines and a lowered position , e . g . horizontal or inclined upwardly or downwardly from the horizontal direction , a second pair of piston - cylinder mechanisms 11 is provided which are at one end pivotally connected to the base portion 4 by hinges 12 , and at the opposite end likewise pivotally connected to the load carrier or plate 7 . on the pivoting arm 6 there may preferably be provided a drive - in guard of the kind known per se . now reference is made to fig2 which shows more in detail one of the two piston - cylinder mechanisms 11 comprised in the goods elevator for the pivoting or tilting of the plate 7 . a piston - rod 14 in this mechanism is slidably movable relative to an associated piston 15 , but is by means of a driver uniformly movable together with the piston between the starting position 15 and an intermediate position determined by a stop 16 limiting the travel of the piston 15 , the piston rod 14 being movable relative to the piston 15 between said intermediate position and a position furthermost extended out of the cylinder 17 . said driver consists in this case of the interior portion 18 of the piston 15 , engaging or being engaged by and thereby co - operating with a shoulder 19 formed in the transition between a piston rod portion having a greater diameter than the piston rod portion 21 . as shown in fig2 a support ring 22 may , if desired , be provided between the shoulder 19 and the piston 15 . the above - mentioned stop 16 comprises one or a plurality of stiff or rigid members which are exclusively attached to a flank wall 23 of the cylinder 17 , in fact the flank wall 23 through which the piston rod 14 extends . in this case the stop 16 consists simply of a tube which is secured , e . g . by welding , to the inner side of the flank wall 23 . the flank wall 23 is dismountably or detachably secured to the remaining portion of the cylinder 17 . more particularly the flank wall 23 is formed as a robust ring , which is secured inside one end of the cylinder 17 by means of a locking ring 24 . the wall or ring 23 has , on one hand , an exterior seal 25 to the inner side of the cylinder 17 , and , on the other , an interior seal 26 to the body surface of the piston rod 14 . both of these seals 25 and 26 consist preferably of o - rings . further , the flank wall 23 comprises preferably a wiper designated by 27 . the operation chamber of the cylinder 17 located at the left - hand side of the piston 15 in fig2 is designated by 28 . into the operating chamber 28 a conduit 29 opens which is connected to an arbitrary pressure medium source not shown in the drawings . the mechanism may operate either with a pneumatic or a hydraulic pressure medium , while it is here preferred to use a hydraulic medium . according to the invention the piston - cylinder mechanism 11 includes a spring 30 tending , when the piston rod 14 is in its position furthermost extending out of the cylinder 17 , to move the piston rod 14 in a direction towards its initial position . in this case the spring 30 consists of a compression spring , preferably a helical compression spring , which is adapted , when the piston rod 14 approaches its position furthermost extending out of the cylinder 17 , to be compressed between on one hand a first part fixed to the piston rod 14 , and on the other a second portion being at least during the compression phase fixed or stationary relative to the cylinder 17 . in the embodiment shown , the compression spring 30 is lodged in the operating chamber 28 of the cylinder 17 , said above - mentioned first part that provides the compression of the spring 30 consisting of a ring 31 disposed at or adjacent the inner end of the piston rod 14 , while the second part consists of the piston 15 . to accommodate the spring 30 a seat 32 is recessed into the piston 15 . the ring 31 is retained in place or positioned by a locking ring 33 . according to the invention the length of the spring 30 is equal to and preferably less than the difference between the travel of the piston rod 14 and the travel of the piston 15 , whereby the spring 30 will operate solely during the movement of the piston rod 14 relative to the piston 15 . the piston 15 has in a conventional manner , an exterior seal 34 sealing to the inner side of the cylinder 17 , besides which an interior seal 35 is provided to seal to the body surface of the piston rod portion 21 . in practice leakage of hydraulic liquid might occur from the operation chamber 28 through any of the seals 34 and 35 into the cylinder base 36 . to collect such leaking liquid a return conduit 37 is provided which opens behind the front edge of the stop 16 and conveys the liquid back to the pressure medium source of the mechanism . the mechanism is in a conventional manner provided with two pivot bearings 38 ; one disposed at one flank of the cylinder 17 and the other disposed at the free end of the piston rod 14 . to ensure that the pressure of the pressure medium can be brought to bear on the end surface 42 of the piston rod 14 at the position of the piston rod 14 furthermost inserted into the cylinder , a stop lug 44 is provided on the piston rod 14 in order to provide a space between the remaining end surface 42 of the piston rod 14 and the end wall 40 of the cylinder 17 . this may instead thereof also be effected by providing a stop , not shown , for the plate 7 of the goods elevator , i . e . said stop will ensure that the end surface 42 of the piston rod will not at the lower position of the goods elevator plate 7 come into contact with the cylinder end wall 40 . at the free end of the piston rod 14 may as shown in fig2 a protective cover 39 be provided . in fig2 the piston rod 14 is shown in a bottom position having the stop lug 44 of the piston rod 14 abutting on the end wall 40 of the cylinder 17 . in this position the plate 7 of the goods elevator is lowered into a position of maximum inclination to the horizontal direction ( see fig1 ). to pivot the plate 7 upwardly hydraulic liquid is supplied by the conduit 29 into the operation chamber 28 . of course , there is no seal around the ring 31 and there is sufficient clearance for the passage of fluid . the pressure of the hydraulic liquid introduced into the operation chamber 18 will act on the end surface 41 of the piston 15 , and on the end surface 42 of the piston rod 14 , the piston 15 and piston rod 14 then moving due to the driver arrangement 18 - 19 to the right hand in fig2 with an even , relatively low speed . after the piston 15 and piston rod 14 have moved a length corresponding to the distance between the end surface 43 of the piston 15 and the front edge of the stop tube 16 further movement of the piston 15 is stopped . the travel that the piston 15 and the piston rod 14 performed in this action corresponds to what is required to pivot the plate 7 from the downwardly inclined position into the position inclined upwardly from the horizontal direction , shown by full lines in fig1 . by a continued pumping of hydraulic liquid into the operation chamber 28 the piston rod 14 alone is capable of moving further . by the fact that the piston 15 is now stationary the partial pressure on the end surface 42 of the piston rod 14 will increase . this on the condition of a constant or unchanged supply of hydraulic liquid into the operation chamber 28 . as a consequence of the increased partial pressure on the piston rod 14 the same will move at a speed depending on the ratio between the cross sectional area of the piston rod 14 and the cross sectional area of the piston 15 . the smaller the cross sectional area of the piston rod 14 is in relation to the cross sectional area of the piston 15 , the greater the speed increase will be . it will be obvious from the above that the piston rod 14 , during the swivelling up of the plate 7 from the position inclined upwardly from the horizontal direction into the vertical position corresponding to the position of maximum projection of the piston rod 14 , will move considerably swifter than during swivelling within the lower range of movement . during the later phase of the movement of the piston rod 14 out of the cylinder 17 the spring 30 will be compressed by the ring 31 and obtain a maximum spring force when the piston rod 14 attains its extreme position . when the load plate 7 is to be lowered from its vertical raised position , the spring 30 will , as soon as the hydraulic pressure ceases , swiftly and positively activate the piston rod 14 through the spring 30 in such a manner that the piston rod will be moved into the cylinder and the plate 7 pivoted somewhat from the vertical position . thereby an initial pivoting of the plate 7 will be obtained so as to supply thereto , through its proper weight , a torque that swings the plate 7 swiftly and efficiently down into the position inclined upwardly from the horizontal direction shown with full line in fig1 . it is understood that by selection of the length of the stop 16 in relation to the positioning of the driver shoulder 19 it will be possible to vary the position of the plate 7 in which a change in the movement speed is desired . it will be understood that the invention is not limited solely to the embodiment described and shown in the drawings . thus the piston - cylinder mechanism according to the invention is not only applicable in connection with goods elevators and other lifting devices but as well in any context whatsoever wherein a variation of the movement speed of the piston rod 14 of the mechanism is desired . further , the invention is not limited to a piston - cylinder mechanism , the piston 15 of which can be supplied with two different movement velocities solely . it is thus conceivable to provide in one and the same cylinder , two or a plurality of telescopically or otherwise slidable piston rods , each having a piston co - operating with a particular stop . thereby the speed variation will be possible to obtain not only in one but in two or more steps . likewise a plurality of modifications of the embodiment shown in fig2 may be undertaken . the spring 30 may , for example , be lodged in the space 36 instead of in the operation chamber 28 , and it is also conceivable to use tension springs instead of compression springs . the design of the stop 16 may be varied in various manners though it is preferable to attach the same to the dismountable flank wall 23 . the stop lug 44 is shown in the example as a body projecting from the end surface 42 of the piston rod 14 to the end of utilizing the pressure of the pressure medium to operate actively on the end surface 42 in the retracted position of the piston - cylinder mechanism , but it may possibly be replaced by a convexity in the end surface 42 of the piston rod . various other modifications are possible within the scope of the appended claims . | 1 |
referring to fig1 filter body 1 contains two similar cylindrical filtering apertures disposed side by side , one of which is shown sectioned at 2 . the filtering apertures contain conically hollowed - out end caps 3 , 4 , 5 and 6 which are bolted onto filter body 1 by means of bolts , one of which is shown at 7 and each end cap carries a perforated supporting disk , two of which are shown at 8 and 9 , each provided with numerous , aligned perforations such as 10 and 11 . suitable filters 12 and 13 made , for example , from woven steel cloth pass between each pair of supporting disks . manifold 14 , provided with band heaters one of which is shown at 15 and a pressure transducer 16 , carries molten plastic and feeds it to the two filtering chambers via two valves 17 and 18 which are actuated when desired by means of a double - ended pneumatic cylinder 19 . each filtering aperture is provided with a purge valve such as 20 and 21 . filtered plastic , which has passed through either filter 12 or filter 13 , is collected by means of manifold 22 which is heated by means of band heaters , one of which is shown at 23 and with a further pressure transducer 24 ; plastic enters and leaves the apparatus in the direction of a -- a . in operation , with both filters 12 and 13 substantially unclogged as determined by the pressure difference measured by the transducers 16 and 24 , valves 17 and 18 are open and valves 20 and 21 are closed so that substantially molten plastic -- provided for example by an extruder feeding manifold 14 -- is filtered simultaneously in both filtering chambers and is collected by manifold 22 and passed , for example , to a granulator . when the difference between the pressures upstream and downstream of the filters reaches a pre - set limit one of the inlet valves associated with one of the two filtering chambers , say 17 is closed and the associated purge valve communicating with the same filtering chamber , here 20 is opened . substantially molten plastic driven by the downstream pressure within manifold 22 flows through one of the filters , here 12 , in a direction opposite to that which the plastic follows during filtering and a proportion of the impurities collected on filter 12 will be dislodged and carried out of the filtering chamber through purge valve 20 . when the bulk of the collected impurities has been disposed of , purge valve 20 is closed again and filtering re - commences through both filters . when the difference between the upstream and downstream pressures rises again to the pre - set limit , the other filter , here 13 , situated in the neighboring filtering chamber is similarly cleaned by the removal of contaminants using counterflow through purge valve 21 . this sequence of filtering and purging operations is repeated a number of times until following a purging operation the difference between the upstream and downstream pressures no longer returns to a sufficiently low value , indicating that filter cleaning is no longer efficient enough . at this stage plastic flow to one filtering chamber is shut off by means of , for example , valve 17 and , with both purge valves 20 and 21 closed and while filtering proceeds through filter 13 , filter 12 is moved through filtering chamber 2 in a manner similar to that described in gb - a - 1181075 but with one important difference : since filtering does not proceed across the filter being moved there is here no pressure differential across the moving filter 12 which can , accordingly , move easily and free of friction against the two perforated supporting disks 8 and 9 despite the severe clogging which filter 12 will by now be subject to . having moved filter 12 , valve 17 is reopened and valve 18 is closed , with purge valve 21 still closed , so that filter 13 can be moved in turn with no pressure differential across it whilst filter 12 is filtering . thereafter filtering again proceeds with both valves 17 and 18 open until there is sufficient clogging to require cleaning the filters once again by counterflow . it will be seen that , unlike using apparatus described in gb - a - 1181075 , the present apparatus does not provide constant pressure conditions in operation but , with the use of suitable automatic supervisory controls monitoring its two pressure transducers , it does permit continuously filtering even heavily contaminated plastic materials without requiring operator supervision until its filter supply is exhausted and owing to its filters being moved in the absence of differential pressure across the moving filter , it can operate using inexpensive , lightly constructed filters ; since these filters are continuously cleaned their useful life is greatly extended leading to further economies of operation . an important feature of the apparatus is the provision of novel flow valves for the plastic such as 17 , 18 and particularly 20 and 21 which must control the flow of plastic with a highly concentrated impurity content without requiring service over very long periods of continued operation . such a valve will be described in better detail with reference to fig2 and 3 . the valve consists of a body 25 , through which normally molten plastic flows in the direction b , which is provided with a side chamber 26 containing a piston 27 which can be reciprocated by means such as pneumatic cylinder 19 of fig1 or , in the case of high extrusion pressures , by other means such as a hydraulic cylinder . valve body 25 can be heated by means of heaters 28 , 29 , 30 , 31 and 32 and cooled by means of coolant flow through channels such as 33 , 34 and 35 ; cylindrical side chamber 26 is cooled by the flow of a suitable coolant such as water flowing in the annular space 36 surrounding it so that a substantially rigid plastic plug 37 forms in it , acting as a pressure seal . this plug is delimited on one side by the valve body and on the other side by operating piston 27 . when the valve is to be open flow channel 38 within its body is kept at a temperature at which the plastic being processed can flow . neck 39 situated between the now hot body 25 and the cold side chamber is of a reduced cross - section so as to minimize heat conduction . when it is desired to close the valve , piston 27 is moved so as to force plug 37 into flow channel 38 , closing it and valve body 25 is cooled so as to keep plug 37 sufficiently rigid and in situ . reopening the valve is achieved by reheating valve body 25 so that its contents remelt and piston 27 is withdrawn to its original , outer position as shown . fresh , hot plastic now enters sidechamber 26 and a new plug 37 begins to form . it will be seen that , since the valve achieves its tight shutoff without the necessity of metal - to - metal contact and re - forms its tight , sealing abutment every time it is operated it can tolerate the presence of even large and abrasive contaminants such as metal swarf or pebbles which , if they are located in the flow channel when the valve is shut , become imbedded in the plug forming the seal without impairing its operation . the temperature of the inner end of plug 37 , next to the valve body , can be adjusted by making neck 39 longer or shorter and the wall of the neck thicker or thinner : it is advantageous to allow that inner end to remain moderately warm so that it remains pliable enough to facilitate this embedment . the speed with which the valves can be operated is an important parameter of the apparatus described since it defines the worst - case contamination which the apparatus can still cope with and this speed depends on the time taken to cool plug 37 . one way of hastening this consists in making the sidechamber cross - section , and hence plug 37 , flat so that the core of its cross - section is more accessible to cooling . another way is shown in fig4 where piston 27 is provided with a pin 40 made from a material of good thermal conductivity such as a metal ; this helps the cooling of plug 37 from within and it also supports plug 37 when it is thrust into flow channel 38 : it is however best to make pin 40 sufficiently short so that it does not enter channel 38 too far and makes no contact with particulate contaminants carried in the flow . another way of speeding up valve operation consists in providing the valve with more than one side channel and hence , more than one plug ; these plugs can then close the flow in the valve in turn so that one plug operates while another is being formed . a two - side - chambered valve is shown in fig5 and 6 which operates like that described above but can achieve a faster repetition rate . pistons 40 and 41 , situated in side chambers flanking valve body 44 are taking turns closing valve bore 45 . both pistons 40 and 41 are pulled outwards while the valve is open and valve body 44 is kept heated by heaters such as 47 . when the valve is to close , one of the pistons is pushed inward , assuming the position of piston 41 so that the plug formed in side chamber 43 , not shown , is forced into bore 45 closing the valve ; the heaters 47 in valve body 44 are switched off and a suitable coolant such as water is circulated in coolant channels such as 46 so as to stabilize the cold plug in the valve body . meanwhile a fresh plastic plug is cooling in chamber 42 whose piston 40 is in its outer position as shown . the valve is reopened to flow by reheating it and by stopping coolant flow in its coolant channels such as 46 and piston 41 is withdrawn : however no sooner has plastic flow resumed through valve bore 45 it can , if desired , be stopped once more by actuating piston 40 whilst a fresh plastic plug is forming in side chamber 43 . it will be clear that more than two side chambers can be employed if an even faster repetition rate is desired . pistons 40 and 41 of the valve arrangement shown in fig5 and 6 can also be actuated by a common means as shown in fig1 . pistons 40a and 41a are both fastened to a frame 101 which is reciprocated by a double - acting pneumatic or hydraulic cylinder 102 which is fastened to valve body 44a by means of struts 102a . clearly two valves such as 44a can also be utilized in place of valves 17 and 18 if faster repetition is required . the valve arrangement shown in fig1 is actuated by valve operating means 19 situated between the valves 17 and 18 . an alternative arrangement in which the operating means are situated outside the valves is shown in fig1 and 15a . valves 17a and 18a here have their pistons 97a and 97b oriented outward and fastened to frame 93 which is reciprocated by hydraulic cylinders 94 and 95 actuated in turn , the hydraulic cylinders being fastened to supporting struts 96 which are affixed to body 1 by means not shown . fig7 and 8 represent an axial section taken in direction b -- b of fig1 and an end view seen from the direction c , with manifold 14 and valves 17 and 18 removed for clarity ; purge valve 20 is shown as a revolved section . body 1 is heated to processing temperature by heaters such as 46 and during filtering plastic flows through chamber 2 in the direction a ; purge valve 20 is closed at that time . filter 12 is cleaned in situ when required by closing the inflow of plastic from manifold 14 and by opening purge valve 20 in the manner disclosed above ; during this phase plastic flows into chamber 2 in a direction opposite to a and , having transversed supporting disks 8 and 9 and filter 12 , this flow leaves chamber 2 through channel 47 and valve 20 , taking with it impurities collected by the filter opposite apertures such as 10 . when sufficient cleaning has taken place purge valve 20 is closed once more and filtering recommences . it is found that after a number of such cleaning operations this process becomes progressively less efficient and eventually it becomes necessary to introduce a fresh filter part into chamber 2 . this is carried out by first stopping the inflow of plastic into chamber 2 by closing valve 17 , and , with purge valve 20 still closed , filter 12 is then moved in a manner generally described in gb - a - 1181075 while sealing plugs , formed from the plastic being filtered , are maintained in ports 48 and 49 respectively where filter 12 enters and leaves filter body 1 , by suitable thermal control means as disclosed e . g . in gb - a - 1181075 ; however since there is no plastic flow through filter 12 at that time this movement takes place substantially free of frictional resistance . filter advance involves extrusion of the sealing plug in the outlet port 49 . this outlet port is of greater cross - sectional area than the inlet port 48 , so that there is a net force assisting extrusion , arising from the pressure of material in the passage which is connected to the outlet of the other passage . preferably the entire contaminated portion of filter within the passage is replaced . filter cleaning is alternated between the two filtering chambers as is also the replacement of filters ; pressure fluctuations due to these operations can be lessened by utilizing more than two filtering chambers . fig7 shows a filtering chamber with two discrete perforated disks 9 and 8 flanking filter 12 and supporting it during filtering and backflushing respectively . fig1 and 17a show an arrangement in which a supporting structure taking the place of disk 8 is formed by cutting grooves 105a to 105i in filter body 1a ; walls such as 105 situated between these grooves support filter 12a during backflushing . plastic material to be filtered enters along channel 111 and , when this channel is closed during backflushing , the contaminants accumulated on filter 12a within grooves 105 are carried out of filter body 1a along channel 109 . fig9 and 11 represent an axial section taken in direction b -- b , an axial section taken at right angles in the direction d -- d and a side view taken in the direction c respectively of half or filter body 1 provided with a means of purging chamber 2 alternative to valve 20 . pocket 50 consists of two zones 51 and 52 thermally separated by neck 53 . inner zone 51 is provided with heaters 52 and 53 , coolant channels 54 and 55 and outer zone 52 has an internal constriction and is provided with heater 56 . during filtering in chamber 2 both zones 51 and 52 are kept cooled so that the plastic within them becomes sufficiently rigid to seal chamber 2 and so prevent any loss of plastic . when it is desired to clean filter 12 heater 56 close to the constriction is heated and it softens the plastic in the pocket in the vicinity of the constriction sufficiently to permit outward movement of the plug situated within pocket 50 ; this movement is accompanied by a flow of plastic in the opposite sense to a and this flow passes through filter 12 , taking with it impurities collected on the filter next to the apertures such as 10 in disk 8 and carrying them into pocket 50 through channel 57 . frictional resistance to the movement of the contents of the pocket may be lessened by heating inner zone 51 also , sufficiently to bring about a detachment from the inner walls of zone 51 and to lessen frictional drag but not so greatly as to unduly hasten the movement of the plug . when a sufficient amount of contaminants has been drawn into pocket 50 , a similar amount having been removed from it simultaneously , heating of both zones is stopped and cooling is resumed and subsequently movement of the plug ceases ; filtering is then resumed again through chamber 2 . when the removal of comparatively small amounts of impurities suffices to clean the filters sufficiently then a short purge valve shown in fig1 may be employed . when larger amounts of contaminants must be disposed of at a time this valve will be elongated as shown in fig1 . heaters 90a and cooling channels 90b are provided here in both sections of the valve so that the movement of the plug containing impurities can be swiftly arrested by recooling , the coolant channel near the constriction being particularly effective . the valve is provided with an adaptor section 91 securable to filter body 1 and at the other extremity the end of the constriction is shown at 90e . an axial section of a diverter valve suitable for regulating the flow of highly contaminated plastic without requiring external means of power such as hydraulics is shown in fig1 . the diverter consists of an actuator which utilizes the molten plastic being filtered as its working fluid and two valves such as 17 and 18 in an in - line configuration . the tubular actuator is divided by annular necks 59 and 60 , which serve to reduce thermal conduction , into a central zone 58 and outer zones 63 and 64 . the central zone 58 is cooled by means of a coolant , such as water , flowing in channels 61 and 62 while the two outer zones 63 and 64 are heated to a temperature at which the plastic being processed is substantially fluid by means of heaters 65 , 66 , 67 and 68 . in use , the actuator contains plastic which is substantially fluid in outer zones 63 and 64 but is sufficiently rigid in central zone 58 to act as a part of a hydraulic piston . the actuator is flanked on each side by a valve of the kind described above ; their side chambers 69 and 70 being here cooled by a suitable coolant such as water circulating in channels 71 and 72 . the actuator contains three perforated pistons , two of which are shown at 73 and 74 , fastened to piston rod 75 and all three are embedded in fully or at least sufficiently rigid plastic plugs , two of which are contained in the respective side chambers of the two valves flanking the actuator and the third , 74 in a plastic plug of a larger diameter situated in central zone 58 of the actuator . outer zone 63 is provided with two valves 76 and 77 each consisting of a chamber having a small bore such as 80 communicating with the bore of outer zone 63 and both valves are also provided with temperature control means such as heaters 81 and coolant channels 82 . outer zone 64 is likewise provided with similar valves 78 and 79 ; in use these valves are open when sufficiently heated to permit the passage of substantially molten plastic under pressure and closed when cold enough to render plastic material contained in them sufficiently rigid so as to resist flow . valves 77 and 79 are connected to manifold 14 and valves 76 and 78 are open to the atmosphere ; it will be seen that when valve 76 is heated and valve 77 cooled then outer zone 63 will contain plastic at atmospheric pressure and when valve 76 is cooled and valve 77 heated then it will contain plastic at the pressure present in manifold 14 . like considerations apply to outer zone 64 . piston rod 75 may be moved to one side by releasing the plastic pressure in the heated outer zone of the actuator on that side and by pressurizing the plastic in the heated outer zone on the opposite side of the actuator , this being brought about by rendering the plastic within two of valves 76 , 77 , 78 and 79 sufficiently rigid by cooling and rendering it sufficiently fluid by heating it in the other two . by reversing the thermal status of these four valves piston rod 75 and the three pistons keyed to it will be moved in the opposite sense . it will be seen that since the outer pistons adjoin the plastic plugs formed within the cooled sidechambers 69 and 70 of the two valves flanking the actuator , such as valve 17 these two valves will be suitably operated by the actuator , the operating force available depending on the ratio of the cross - sectional areas of pistons 74 and 73 . care must be taken that the two valves 76 and 77 serving outer zone 63 are not open simultaneously , the channel such as 80 to be closed being cooled first : in this way the plastic contained in that channel can be made sufficiently rigid while it is at rest so as to close that channel before the other channel communicating with the same outer zone is opened by heating . in this manner there is negligible plastic flow through the channel to be closed and therefore little heat is carried into it by plastic flow so that the closing of the channel by external cooling is facilitated . fig1 shows a schematic plan view of apparatus according to the invention comprising two extruders 83 and 84 which carry filtering chambers 85 and 86 respectively . the filtered plastic passes from these to a common collecting duct 87 and thence to , for example a pelletizer , in the direction of arrow d . certain known features of the apparatus disclosed herein , such as the details of the inlet and outlet ports , are disclosed in gb - a - 1181075 , the contents of which are incorporated herein by way of reference . in an example of filtering using the above filtering equipment polypropylene resin at about 200 degrees centigrade is made to flow through twin filtering chambers using 6 &# 34 ; diameter supporting plates such as 9a ; the initial pressure drop across clean filters such as 12 and 13 is typically between 250 and 500 psi . depending on filter construction and the flow rate and viscosity of the polymer . filtering is continued until the pressure drop across the filters reaches about 3000 psi . when backflushing is initiated ; thereafter the pressure drop again returns to near its initial value . after repeated cycles the instantaneous pressure drop after backflushing gradually rises . it will be found that the rate of filter clogging , as indicated by following the pressure drop , is not constant but increases more and more rapidly at higher levels of clogging and at the same time , the efficiency of filter cleaning decreases as seen from the pressure drop immediately following backflushing . for a given filter construction and depending also on the kind of impurities encountered a given value of the pressure drop following backflushing will be found , such as 2000 psi . in the example given , where it becomes necessary to change the filter areas in use so as to avoid having to backflush faster than the valves can cope with ; after introducing fresh filter areas the initial pressure drop across the filters returns once more to 250 to 500 psi . a practical limit is set on the pressure drop at which the filters are renewed by , in particular , the shortest time period during which the more frequently occurring backflushing operation can be carried out and this depends mainly on the cooling of the plastic plugs utilized to control flow in the valves . in the above example a satisfactorily hard polypropylene plug of 1 inch diameter will be formed in 10 to 12 minutes , utilizing cooling water at ambient temperature ; these plugs can then be sufficiently softened to be removed in about 1 . 5 to 2 minutes . in general workable flat plugs can be constructed to respond in half these times but the thicknesses that can be used depend on the mechanical strength of the plastic being filtered and the pressure differential which must be supported . finally , while a filter body has been shown as one embodiment with two side - by - side filtering apparatus served by a manifold , the present invention contemplates the use of any number of filtering apertures arranged in any arrangement provided that they are in a parallel flow configuration . the control of heating and cooling means and mechanical traction described above is preferably accomplished by electrical switchgear activated and controlled by a programmable computer . a flow chart showing steps involved in a suitable computer program is shown in fig1 and 19 . the operation of a filtering system according to the invention under computer control involves detecting the pressure drop across the filters , valve cooling and polymer plug forming in the valves , timing of a suitable period to facilitate plug forming , closing the valves either by cooling alone or by accompanying mechanical traction , heating the valve bodies in order to open them , moving the filters so as to introduce fresh filter parts and controlling the filter lengths so introduced , keeping track of which filtering chamber is to be operated next and which actuator ( in the case of double - acting actuators , which side of any actuator ) is to be powered next and in what sequence so that the backflushing and filter renewal operations are fully controlled and properly coordinated . filter movement may be controlled using a servo system of known art ( u . s . pat . no . 3783355 ) or by actuating an automatic cutter at the emerging filter end and detecting the position of the cut end by means of a photoelectric cell : in this way the filtering operation can be fully automated . in a similar way the semi - solid or solid plastic plug carrying the contaminants emerging from the purge valve can be severed and the position of the cut end can be likewise detected ; where the contaminants are carried out in a largely fluid stream timing the open period of the valve will suffice . during purging through valve 20 contaminants carried in polypropylene the removal of as little as 215 grs . ( less than half a pound ) sufficed to adequately clean the filter area , depending somewhat on filter construction and the nature of the contaminants . turning to the flowcharts of fig1 and 19 , the steps listed correspond to successive computer operations and are aimed at detecting the pressure drop across the filters , actuating the required heating , cooling and tractive steps according to a predetermined time schedule as well as severing the emerging polymer plugs and obtaining positional information of the cut ends . the term &# 34 ; initialize &# 34 ; refers to the establishment of known initial conditions in the apparatus and storing the data required for operating it . the term &# 34 ; side &# 34 ; refers to a selected filter and its associated valves , &# 34 ; counter &# 34 ; is an internal reminder keeping track of filter movement , &# 34 ; toggle &# 34 ; refers to changing the filter selected or the sense of actuator movement for the next operation . &# 34 ; photocells &# 34 ; are devices detecting the position of the emerging polymer plugs and &# 34 ; cutters &# 34 ; are devices such as pneumatically reciprocated motorized circular saws which severe these plugs ; the use of methods less prone to causing accidents such as detecting holes drilled in the plugs rather than severing the plugs are also anticipated . | 1 |
the system as described herein comprises a comprehensive color video display system for operation with two sources of image data , one of which may be a conventional digital image generator , referred to here simply as a processor 10 . for descriptive purposes , a matrix memory 12 included in the system is separately shown , and comprises a 512 column × 512 row matrix memory , each location storing a 7 bit pixel and thus capable of 128 color combinations or grey scale levels . the analog image source is , in this example , a closed circuit tv camera 14 , while the output display is to be generated on a tv monitor 16 including a crt 17 and synchronizing circuits 18 . the system is maintained in synchronism by conventional means which are not significant to the inventive concept and the details of which have accordingly been omitted for simplicity . broadly speaking , however , the processor 10 clock may serve as the master synchronizing signal reference for the timing of data transfer and for vertical and horizontal scanning purposes in the video devices . the presence of the memory 12 enables the system to effect precise synchronization between the image signal trains . in the figures , the use of multiple lines between functional elements is designated by the employment of a diagonal across the line accompanied by a numeral or other notation indicating the number of lines that are there represented . the digital image signal train is applied from the matrix memory 12 to an address register 20 , the output signals ( seven parallel lines ) from the address register 20 being applied through a decoder 22 to a table look - up device or memory 24 . inasmuch as the system operates essentially in real time and data is transferred on a serial basis , read control and bit timing signals that may be applied to the different functional units have been omitted for simplicity . the output of the decoder 22 comprises 27 , or a total of 128 , output lines to address a corresponding number of word storage locations in the table look - up memory 24 . the storage locations contain 4 bits each of red , green and blue color data and may also include 4 bits of control data although in the present example the control data used is primarily that contained in the analog signal channel . the table look - up memory 24 may comprise a prewired or program addressable type of storage , such as a read only memory , or a randomly addressable memory that may be distructively read but immediately rewritten . the 16 output bits from the memory 24 , comprising the 12 color bits ( and the 4 control bits where these are used ), are applied to an output register 26 , with the 4 control bits being converted to signals on 1 of 16 output lines in a control decoder 28 . the color bits may be applied to what is here called a &# 34 ; digital dimmer &# 34 ; 30 , which actually comprises a separate divider for each of the 4 bit color signals , and which can be set to divide each signal by unity , three - fourths , one - half , or one - quarter , so as to reduce the intensity of the signal . for this purpose , a &# 34 ; division control &# 34 ; input is utilized , and this may comprise either a manually selectable switch , processor control signals , or two selected bits in the control signal from the table look - up memory 24 may be used for this purpose . the three sets of 4 color input signals , with or without the optional digital dimming function , are applied to the arithmetic and logic unit 32 , which unit is also referred to herein as containing digital bit mixers . the arithmetic and logic unit 32 is described in greater detail hereafter in conjunction with fig2 . corresponding sets of color intensity signals are also derived in an analog channel commencing with the closed circuit tv 14 , signals from which are applied through an amplifier to a video analog signal digitizer 42 . in the digitizer 42 , a fixed number of adjustable signal amplitudes are utilized to define the grey scale range , from minimum to maximum . a chain of precision resistors 44a , 44b , 44c . . . 44p are coupled to a high and low voltage source respectively . the high voltage source is selectable in level , and provided by a first digital register 46 , here referred to as a &# 34 ; high number register &# 34 ;, which is settable to a selected value either by switch control or by program control to represent a desired maximum voltage for the voltage divider chain of resistors 44 . the output from the high number register 46 is transformed into a corresponding analog level by a first digital - to - analog converter 48 . similarly , the minimum potential to be established for the other end of the voltage divider chain is provided by a low number register 50 controlling an associated digital - to - analog converter 52 . by moving the maximum and minimum values further apart , the digital increments defined by the voltage divider chain are increased but a greater range is covered , while the converse may also be established . because the absolute values of the limits may be moved up or down concurrently , both threshold values and the degree of resolution of the grey scale may be changed by the digitizer 42 . taps taken from the successive intermediate points of the voltage divider chain are applied to individual inputs of a series of comparators 54a , 54b , 54c . . . 54o , comprising operational amplifiers arranged as threshold sensitive devices which give a binary output signal to indicate whether the applied signal is above or below a preselected level . the outputs of the comparators 54 are applied to a holding register 56 . the 15 comparators 54 that are coupled between the midpoints of the resistors 44 in the voltage divider chain provide inputs through the holding register 56 to a priority encode circuit 60 which provides 4 bits of parallel encoded data with , for example , 1111 representing the maximum value and all voltage levels above that value , and 0000 defining the minimum value and all voltage levels in the subband below it . these parallel signals are applied to a second table look - up memory 62 having 16 words of 16 bits each , with 4 bits each being devoted to the red , green and blue colors respectively , and 4 bits being devoted to control data . an address encoder 64 is employed to select the appropriate word . the control data groupings have been labeled &# 34 ; and &# 34 ;, &# 34 ; or &# 34 ;, &# 34 ; add &# 34 ;, &# 34 ; subtract &# 34 ;, &# 34 ; block a &# 34 ;, &# 34 ; block b &# 34 ;, and &# 34 ; average &# 34 ; but with 4 different bits up to a total of 16 different functions are available . the table look - up function here performed provides a conversion to pseudocolor from grey scale black and white , either derived from the closed circuit tv 14 or from some other source , so that the ability to discriminate is substantially greater than with a single color . output signals from the memory 62 are applied through an output register 66 to the arithmetic and logic unit 32 for the 12 color signals , and to a second control decoder 68 , for the control signals . both sets of control signals or combination bits from the decoders 28 and 68 are applied to a multiplexer 70 , along with another set of signals from a mode register 72 . the mode register 72 , which may be manually set or operated under program control to generate functional control signals , provides the equivalent of a static or external control for the system . whichever set , or combination of parts of sets , of control signals is utilized under selection control at the multiplexer 70 , the sixteen output lines from the multiplexer govern the functions performed within the arithmetic and logic unit 32 . the output signals from the arithmetic and logic unit 32 comprise the digital , 4 bit valued , signals for red , green and blue respectively , and these are applied to intensity control circuits 76 in the tv monitor 16 . the intensity control circuits 76 include digital - to - analog converters and conventional amplification circuits for modulation of display color intensity . details of the arithmetic and logic unit 32 are shown in part in fig2 which fragment relates only to the 16 possible control functions that may be exercised for each bit value of each color , such as the four bits r 1 , r 2 , r 3 and r 4 for each channel ( a & amp ; b ). in fig2 the functions have been designated in various ways , but all represent some type of arithmetic or logic operation . the four depicted bit mixers 80 , 81 , 82 , 83 each contain like functional gates or circuits , although only the r 1 bit mixer 80 is shown in some detail . thus for the logical &# 34 ; and &# 34 ; function , the two input signals r 1a and r 1b are applied to a three input and gate 86 that also receives a control signal to effect the designated function for the same picture element . for the next picture element , the &# 34 ; or &# 34 ; function provided by the circuit 87 may be desired , and the second control line is actuated , so that the circuit 87 responds to a signal on either input line . similarly , exclusive - or and other logical functions may also be defined . also included in this example are an add / subtract circuit 88 , circuits 90 and 91 for blocking the a and b signals respectively , a circuit 92 for averaging the two signals , and , by way of illustration , an arbitrary function designated simply as &# 34 ; function 16 &# 34 ;. where full addition , subtraction or averaging of each 4 bit value with a corresponding 4 bit color value is to be effected , conventional circuits providing carry between adder stages will be desired . where the blocking signal function is employed , the corresponding input signal is simply gated off . although the circuits are separately shown for ease of understanding , it will be apparent that these and many other functions could be established by a microprogram and that where hard wired circuits are to be used conventional logical design would substantially reduce the number of gating elements utilized . the operation of the system may perhaps best be visualized initially in terms of the concurrent generation of two color images , each consisting of an array of distributed pixels derived from a sequence of coded bit - valued representations . the 7 bit digital characters from the processor 10 provide extremely finely resolved grey scale values which are used to address a corresponding word location in the table look - up memory 24 . the chosen word location contains three different digitized color values , each 4 bits long , and may also contain the control or combinational bits , although others are used in this particular example . the output from the table look - up memory 24 is provided essentially in real time and represents the pseudocolor conversion of the input . great variety is possible because of the number of words available in this memory , which permits essentially all colors , including white , to be generated , and with a wide range of intensities . concurrently , the analog signal from the cctv source 14 is converted digital grey scale values at the comparators 54 , in relation to increments within a range established by the high and low number registers 46 , 50 respectively . although a lower number of grey scale values is available ( in this example ) the ability to shift limits and adjust increments within the limits enables the contrast and intensity of the analog input to be altered to best advantage . when this input is converted to pseudocolor in the associated table look - up memory 62 , it is read out concurrently with the accompanying control bit patterns in a coded sequence , and again in essentially real time fashion . both digital coded sequences of color values for a pixel are then combined in dynamic dependence on the control signal pattern for the same pixel , within the arithmetic and logic unit 32 . although the analog channel is used for data dependent control in this example , the groups of combination bits taken from the other image input , or static control bits may be taken from the mode register 72 , as selected at the multiplexer 70 . substantial advantages for video display systems are realized from the real time digitizing and generation of color - valued signals which are then dynamically combined in a data dependent manner . the use of a table look - up memory in each image signal path transforms each image to a more readily interpreted form , even if the type of control remains static ( e . g . if the whole images merely are combined in additive fashion ). the ability of the video analog signal digitizer to alter the range and resolution of the grey scale permits selective modifidation of the video input for advantageous display purposes but is not required for use of the invention . however various advantages are derived , because low level backgrounds may be eliminated , or the contrast in a scene having low level illumination may be substantially enhanced . it is more significant , however , that dynamic control on a pixel - by - pixel basis enables different parts of an image to be colored in advantageous and different ways depending on data content and relationships . referring to fig3 a , which represents a relatively simple condition , it may be seen that a background of a pure color a is to be viewed except where a pure color b from the other input exceeds a minimal level . thus , as shown , in writing color b there is no mixing with color a , and the region of color b can be of varying intensity ( as can the region of color a , although this is not shown ). consequently a line drawn in color b ( e . g . red ) appears to cut through the background of color a ( e . g . green ) and no color mixing results . of course , the &# 34 ; pure &# 34 ; colors need not be a primary red , green or blue , but can be any appropriate color of the spectrum including white . fig3 a thus represents a blocking function , and could be accompanied by concurrent conversion of pure color b to a maximum level wherever it is to be written . fig3 b shows that the blocking function can be independent of background , in that the varying intensity region of color b can be written without color mixing against a background of colors a , c and d generated during the pseudocolor transformation . because of the dynamic control of increments of picture area , further variations may be introduced , based upon the intensity of one or the other of the images . thus as seen in fig3 c , where color a is of less than a certain threshold in intensity , pure color b may be superimposed on a background of color a by blocking color a . at or above the chosen threshold for color a , the colors may be mixed ( additively or subtractively ) to give a different effect . as an extension of this capability , adding , blocking and subtracting functions can be used at different regions all dependent upon the intensity level of the signal in the channel corresponding to color a , as shown in fig3 d . a typical specific example of how signals may variably be combined based upon the data content in the signals themselves involves the display of digitally generated characters and vectors on a map reference which may be derived from a closed circuit tv monitor . lines and patterns of varying intensity are generated by the digital source but for best comprehension of the display it is not suitable to simply additively combine the signals . this would result in the lines having both different intensities and varying colors along their lengths . it is also not satisfactory for all purposes simply to block one of the signals so as to permit the lines to stand out more clearly , because there can be significant variations in the digital input . it may be desired to show only the highest intensity lines , and to leave the map image at its appropriate intensity where lines are not to be shown . in accordance with the invention these and other functions can be performed automatically and in real time . in order to provide a display in which characters and vectors generated in the digital channel starting with the processor 10 are uniquely presented relative to an analog image starting with the cctv 14 , a prearranged combination of control bits and color bit values is entered into the video look - up table 62 . the video analog signal digitizer 42 is set to appropriate maximum and minimum values , and it is assumed that a pseudocolor analog display of three different colors is to be generated . it is also assumed for this example that the digitally generated images will be arithmetically combined in each of the separate color regions . thus , the entry into the video look - up table 62 may employ the &# 34 ; add &# 34 ; function and provide a red color output in the address range of 0 to 5 , may employ the green color output and the &# 34 ; subtract &# 34 ; control function in the address range of 6 to 10 , and the blue color output together with the &# 34 ; add &# 34 ; control function for addresses from 11 to 15 . concurrently , the digital input is converted to a single color , or to a number of colors in a prearranged format in the video look - up table 24 . as the analog signals are digitized , a pseudocolor output is generated consisting of the three selected colors in different areas . these areas are overwritten by the digitally generated patterns in different colors . consequently , outstanding or significant features can readily be identified against the background . in this example and in example iii , it is assumed for convenience that the control bits are included in the video look - up table 24 in the digital channel instead of the video look - up table 62 in the analog channel . in this example , it is desired to provide sharply visible digitally generated characters and vectors against the analog pseudocolor image background . if the digital signal is divided into eight principal increments ( 0 to 7 ) and it is desired to display the digital signal clearly whenever the digital value is at increment levels 6 and 7 , then the entries in the video look - up table 24 are written as follows : consequently , the pseudocolor image of the map will appear at its normal intensity except where the digital lines are sufficiently bright , at which regions the digital lines will appear in full brightness , without color mixing with the pattern of the map . furthermore , the map display is generated throughout in pseudocolor in accordance with any rule that is established and entered into the second video look - up table 62 . obviously the options of having the map only in graduated tones of one color and having the superimposed digitally generated line patterns in one color , or in different colors , are readily available . consider another situation in which the analog signal has been converted to three color signals , red , green and blue , each with intensity values of 0 to 15 . the digital signal initially has intensity values of 0 to 127 , but is applied to the table look - up memory 24 so as to generate a pseudocolor signal of corresponding intensity variations , but in three different colors , each scaled from 0 - 15 . however , in this situation it is desired that when the grey scale intensity value of the digital signal is in excess of level 10 ( or 11 - 15 ), then the digital pseudocolor signal will override the analog signal , which will be blocked out , but otherwise the two signals will be summed and divided by two , or averaged . for these purposes , the control bit entries in the video look - up table memory 24 are set as follows : under these circumstances , if the pseudocolor output for the digital input is green for all addresses , then green lines will show on the screen for signal levels of digital input in the 11 - 15 range . however , for signal levels from the digital input of 1 - 10 , mixtures of the green digital input and the analog signal input , whatever color it is , will appear on the screen . thus wherever the analog signal is red , weaker green lines drawn on top will appear to be yellowish or orange in color . thus , depending on the input signal levels , one pattern can be seen through the other . although a number of variations and modifications have been described herein , it will be appreciated that the invention is not limited thereto but encompasses all forms and expedients within the scope of the appended claims . | 6 |
all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventor for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventor expects skilled artisans to employ such variations as appropriate , and the inventor intends for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context . unless defined otherwise , all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs . the specimen culture vehicle ( scv ) for microbiology specimens of the present invention is an automated device , which in one aspect is designed to be used as a component of a microbiology automation platform ( map ), described below . the scv and the map can be integrated to physically process specimens facilitated by a software scheduling and routing system through a series of steps involving : ( i ) pre - identification ; ( ii ) identification ; and ( iii ) post - identification processing of the specimen . the pre - identification can include , but is not limited to , growth and isolation , fixation , amplification , separation , and staining . the identification phase can include , but is not limited to , visual inspection and identification , uv / visible and mass spectrometry , enzyme - linked immunosorbent assay ( elisa ), immunoassay , and other biochemical methodologies . the post - identification phase can include , but is not limited to , holding for additional testing , storage , retrieval , and archiving . shown in fig1 - 3 is one embodiment of a specimen culture vehicle ( scv ) device for microbiology specimens , in both assembled and exploded views . in this embodiment , the scv 10 is shown to include a housing comprising a top shell 11 and a bottom shell 12 . preferably , the overall shape of the scv housing is spherical , the diameter of which is preferably smaller than 8 . 9 cm . the scv is preferably designed to fit in a typical hospital pneumatic tube transport system , and also to fit in a standard - sized biohazard transport bag . the bottom surface 13 of the housing is molded generally flat so that the scv remains upright , and is not subject to tipping over . because of its flat top and bottom surfaces , the scv is stackable and rackable . the integrity of the media , diluent , and specimen is maintained while held in the scv regardless of the physical orientation of the scv . the scv &# 39 ; s “ shell ” housing is preferably constructed of rigid plastic ( for example , polycarbonate ), and more preferably of injection molded plastic . as such , it is designed to protect the inoculated growth chambers in case of impact or if the scv is dropped . moreover , the scv &# 39 ; s physical composition is designed to withstand cleaning with standard laboratory cleaning solutions , and is designed to withstand adverse environmental conditions of temperature , humidity , stress , air particulates , and pressure . the scv material should preferably withstand temperatures of about 0 ° c . to about 50 ° c . and a relative humidity of about 15 % to about 80 % for about 180 days , while maintaining specimen integrity and preventing leakage , evaporation , desiccation or aerosolization of the specimen , media , or diluent ( s ). the scv physical composition should preferably support storage temperatures post - analysis of about 4 ° c . to about 8 ° c . for about 1 week . the scv construction materials are chosen so that they will maintain the integrity of the media and organisms to be isolated . the scv should withstand the range of mechanical forces and pressures to which it reasonably can be expected to be subjected without breakage or leakage . moreover , the materials selected for the scv structure , including its mechanisms , seals , and gaskets , should not interfere ( chemically or otherwise ) with the internal mechanisms , seals , growth media or microbiological specimen . nor should the materials selected for the seals and gaskets degrade significantly within the shelf life of the scv . preferably , the plastic structure should be able to have adhesive labels applied to it . the top shell 11 of the housing is formed to include a pair of exteriorly - exposed cylindrical cavities 14 , 15 for respectively receiving a specimen input chamber ( syringe ) 16 and a diluent chamber ( syringe ) 17 . the specimen input chamber 16 is designed to prevent leakage , aerosolization or cross - contamination , and is covered with a screw - top lid 18 . the lid 18 has a permeable aperture 19 ( conforming to standard industry requirements governing the use of these types of closures ) that allows a needle ( or canula ) to penetrate it while retaining the specimen within the chamber , and preventing air and possible contaminants from entering . the lid 18 for the specimen input chamber also has some feature ( not shown ) that indicates if the specimen has been tampered with . the specimen input chamber 16 is preferably clear on at least one side so that the integrity of the specimen can be observed by the operator from the exterior of the scv . in general , the specimen input chamber 16 is large enough to accept all standard sized swabs , and it is designed to contain preferably , at minimum , 4 . 0 ml of liquid sample and an additional 2 . 0 ml of fluid in case the operator applies diluent to the chamber . the specimen input chamber is designed to account for any losses due to dead volume and / or any volume changes due to temperature changes . the diluent chamber 17 contains a diluent ( preferably about 2 . 0 ml of 0 . 9 % saline ) that can be added to the specimen . a finger - operated plunger 20 permits the operator to apply a selective amount of the diluent to the specimen input chamber 16 . the diluent chamber 17 is designed to account for losses due to dead volume and volume changes due to temperature changes , and is designed to prevent leakage , aerosolization , tampering or cross - contamination . the specimen input chamber 16 and the diluent chamber 17 both are coupled through small apertures in the top shell 11 to an input manifold 21 . the input manifold 21 comprises a specimen port 22 , a diluent port 23 and an output port 24 , all connected by an internal fluid duct . an internal check valve 25 ( see fig4 ) in the fluid duct between the specimen input chamber 16 and the diluent chamber 17 prevents backflow of specimen into the diluent chamber . the output port 24 of the input manifold 21 is fluidly coupled via flexible tubing ( not shown ) to a first t manifold 26 , comprising first and second input ports 27 , 28 and an output port 29 ( all connected by an internal t - shaped fluid duct ). flow of the specimen / diluent mixture from the input manifold 21 to the first input port of the t manifold 26 is restricted by a shuttle valve mechanism 30 . in one embodiment , this mechanism comprises a sliding shuttle 31 , a cam 32 mounted on a rotatable shaft 33 , and a finger - operable control handle 34 . upon rotation of the handle ( which extends outside the scv housing ) by the operator , the shaft and cam are rotated , sliding the shuttle and thus opening or closing the valve mechanism 30 . a rehydrating water chamber 35 is fluidly coupled to the second input port of the t manifold 26 via flexible tubing ( not shown ) and an elbow manifold 36 . the elbow manifold 36 comprises an internal fluid duct with a check valve 37 ( see fig4 ) to prevent the specimen / diluent mixture from back flowing to the water chamber 35 . the water chamber 35 preferably contains distilled water for the purpose of rehydrating the culturing media in the growth chambers . in one embodiment , the amount of distilled water is 7 . 250 ml , plus an amount to make up for any dead volume losses . optionally , the rehydrating water chamber has a plunger 35 a ( see fig4 ) that is accessible on the exterior of the scv housing by the operator , whereby the operator can selectively control the amount of water introduced into the system . from the first t manifold 26 , the specimen / diluent / water mixture flows via a flexible tube ( not shown ) to a second t manifold 38 , comprising an input port 39 and first and second output ports 40 , 41 ( all connected by an internal t - shaped fluid duct ). this second t manifold includes an internal check valve 42 ( see fig4 ) to prevent backflow of the mixture . the pair of output ports 40 , 41 in the second t manifold 38 feed the specimen / diluent / water mixture ( via a pair of flexible tubes — not shown ) into an actuator which facilitates the flow of the mixture throughout the scv &# 39 ; s fluid circulation system . in the embodiment illustrated in fig1 - 3 , this actuator is a dual , low - pressure , rotary peristaltic pump 43 having a pair of input ports and a pair of output ports . as is well - known in the art , a peristaltic pump comprises a flexible tube fitted inside a circular pump casing , and a rotor with one or more rollers ( or wipers ) that intermittently compress the flexible tube as the rotor turns . the portion of the tube under compression closes , thus forcing fluid inside the tube to be pumped through the tube to an outlet port of the pump . as the tube opens to its natural state after the passing of a roller , fluid flow is induced into the inlet port of the pump . a dual peristaltic pump , such as used in the present embodiment , has a pair of compressible tubes and a pair of different rotor mechanisms , thus permitting pumping of fluids at two different rates as the rotors turn . the rotors of the dual peristaltic pump 43 are driven by a crank mechanism 44 having a drive shaft 45 and a crank handle 46 mounted on the surface of the scv housing . when the operator turns the crank handle in a clockwise direction , the rotors turn and the specimen / diluent / water mixture is drawn through the pump . it will be noted in the illustrated embodiment that flow of both the specimen / diluent mixture and the rehydrating water via separate flexible tubes to the first t manifold 26 ( and then on to the second t manifold 38 and the peristaltic pump 43 ) is restricted by a dual shuttle valve 50 . this valve is only opened upon turning by the operator of the crank mechanism 44 ( specifically , by the rotation of a tumbler 47 attached as part of the crank mechanism and its resultant movement of the shuttle valve &# 39 ; s armature 51 , cam mechanism 52 and shuttle 53 ). accordingly , it is impossible for any of the specimen / diluent mixture or the rehydrating water to reach either the pump or the growth chambers until the operator actuates the scv by turning the crank mechanism 44 . in an alternate embodiment ( not shown ), the scv includes a rotary motor within the housing and a rotatable crank mechanism coupled between the motor and the peristaltic pump . thus , rather than being operated by hand - cranking , the pump is operated when the motor is powered . power for the motor can be supplied either by a battery source within the scv housing or by a source external to the housing ( such as by plugging the scv into a vehicle power source during transport ). it will also be appreciated that the scv can comprise other types of pumps well known to persons skilled in the art . specimen / diluent / water mixture exiting the first output port of the pump travels via a flexible tube ( not shown ) to a first inlet of a growth chamber manifold 55 . in this manifold , the first inlet connects to a first fluid duct which branches into seven separate ducts ( each with its own backflow - preventing check valve 56 — see fig4 ), whereby the specimen / diluent / water mixture is directed to as many as seven of the eight growth chambers 60 a - g . likewise , specimen / diluent / water mixture exiting the second output port of the pump travels via another flexible tube ( not shown ) to a second inlet of the growth chamber manifold 55 . the second inlet connects to a second fluid duct ( with its own backflow - preventing check valve 56 ) which directs the specimen / diluent / water mixture to the eighth of the eight growth chambers 60 h . ideally , the eight growth chambers are visible to the operator through an orifice 70 in the top shell 11 of the housing so that the integrity of the media within the chambers can be observed and the amount of specimen / diluent / water mixture introduced into the chambers can be observed and controlled . in one embodiment of the scv , the eight growth chambers consist of one specifically for viral culture and six or seven chambers for bacteriology or mycology . if only six chambers are utilized for bacteriology or mycology , the remaining chamber is saved for future expansion and does not contain culturing media . the viral growth chamber contains , preferably , 0 . 50 ml of specimen and liquid media , specifically for viral culture ( total volume is determined as follows : 0 . 25 ml liquid media + 0 . 25 ml specimen ). the other seven growth chambers can contain , preferably , 1 . 05 ml of specimen and liquid media ( total volume is determined as follows : 1 . 00 ml liquid media + 0 . 05 ml specimen ). more specifically , the scv contains media suitable for the preservation and cultivation of all pathogenic bacteria , mycology , and viruses . the media selected for the scv meets the criteria of encouraging growth in a maximum amount of organisms with a minimum number of separate media . the culturing media does not consist of caustic or dangerous chemicals which will hinder the operation of the scv , and for pcr considerations the media does not contain any dna or rna fragments , or dead organisms . the media , when liquid , is transparent , which is necessary for turbidity checks ( or other growth checks ). preferably , the media contained in the growth chambers of the scv comprises tryptic trypticase soy media ; tryptic soy agar w 5 % sheep blood ; thioglycollate media ; chocolate ii agar ; bcye agar base ; viral transport medium ; selective 7h11 agar ; as separate media , or as any mixtures thereof . as will be appreciated , scvs can be manufactured with different combinations of growth media , thus providing different culturing choices to an operator to best match the circumstances of a particular biospecimen collection occurrence . the media is preferably lyophilized . once rehydrated , the media has the proper ph . optionally , one of the growth chambers ( specifically the chamber containing thioglycollate media ) has the capability of having the oxygen removed from the chamber to promote the growth of anaerobic organisms . the other growth chambers ( all except the one containing thioglycollate media ) should contain enough oxygen to promote the growth of aerobic organisms . the scv is manufactured sterile or the scv is sterilized prior to leaving the manufacturing facility . the culturing media and diluent are dispensed into the scv during the manufacture of the scv . importantly , the culturing media is sterile when inserted into the growth chambers of the scv , or the media is sterilized during the scv sterilization process mentioned above . the scv includes eight extraction portals — in the form of an eight - node plate 80 ( each node backed by a flexible septum 81 penetrable by a hypodermic needle )- that allow media containing the specimen sample to be withdrawn quickly and easily . these portals also allow multiple samples to be drawn over a period of time . each of the portals is connected fluidly to a separate one of the eight growth chambers 60 a - h via respective flow ducts in the growth chamber manifold 55 , eight flexible tubes ( not shown ), and respective flow ducts in an output manifold 82 . an output shuttle valve 83 simultaneously controls the flow of specimen / media samples through the eight flexible tubes . samples therefore can only be extracted from the scv when the valve handle 84 and connected cam mechanism 85 have been rotated 90 °, thus permitting the shuttle 86 to slide and opening the flexible tubes for fluid flow from the respective growth chambers . the valve handle 84 is configured and positioned so that it can be manipulated by either a human operator or a robotic unit in an automated analyzing platform . optionally , the scv is equipped with one or more indicators that show if temperature , pressure , aerobic / anaerobic conditions , shock exposure , and radiation exposure tolerances have been breached . moreover , the scv can have some type of indicator ( e . g ., broken safety seal ) to notify the user of potential contamination of the device prior to use . the internal temperature of each of the growth chambers can be dynamically adjustable to promote optimum growth of the microorganisms . in that case , each growth chamber may have a temperature sensor , and there is an electronic feedback loop for the purpose of maintaining a specific temperature range ( in other words , a thermostat or similar device ). the scv also has at least one electrically powered “ heater ” and / or “ chiller ”, for the purpose of creating an optimum growing environment . preferably , this heater or chiller is a well - known type of solid - state thermoelectric module , such as a peltier device 90 ( see fig4 ). accordingly , the scv requires a power source for any sensors , any associated leds , and the heater or chiller . in one embodiment , the scv does not require external power sources , and all on - board electronic devices and batteries preferably have a shelf life greater than 12 months . in an alternate embodiment , the scv has a power port which can readily be connected to an external power source ( such as a portable battery or a vehicle power outlet ). the scv is marked with a unique labeling that establishes the relationship of the patient and ordering event to the specimen acquired . this labeling can include conventional barcode , rfid tagging , similar techniques , or combinations thereof . for a barcode identification system , the hibcc standard is generally followed . for an rfid identification system , appropriate standards can be followed from iso / iec , ieee and ansi . an rfid tag preferably contains a data storage medium that will allow digital data to be written to it , stored on it and read from it , as defined by the version of the data storage medium . this identification “ links ” the particular specimen and the results of its analysis to the original patient , source , and presumptive diagnosis . the orders placed for analysis and the corresponding results are linked to the analysis of the scv contents and either stored with the specimen and / or transmitted via interface to a host information system , such as a laboratory information system ( lis ) or laboratory information management system ( lims ) that will store the patient demographics and test results or forward these results and patient demographics to other interfaced systems . the minimum identification information required by the microbiology laboratory and map on the scv is preferably stored in human - readable ( e . g ., label ) form , as well as in digital format . for example , a label on the scv should contain , for traceability purposes , some or all of the following : information regarding lot number , serial number , product identification number , manufactured date and expiration date . and the label on the scv should have an area on which an operator can hand write data . the handwritten portion of the scv &# 39 ; s label should include space for a patient name , a patient unique identifier or date of birth , the collection time and date , the name of the person collecting the specimen , and the specimen type . the information stored digitally on the scv is preferably accessible in the absence of the map by means of devices such as pc - based or hand - held readers . communication to the scv is performed through the scv &# 39 ; s identification system . the scv &# 39 ; s identification system comprises two parts : one that is physically attached to the scv at all times and another part that can read or acknowledge the existence of the part attached to the scv . the communication to the scv follows approved standards of communication . the scv is designed for single use , and is preferably disposable . thus , the scv should be capable of being sterilized for disposal using standard laboratory methodologies ( such as by lethal ionizing radiation ). sterilization of the scv should not degrade the scv &# 39 ; s construction materials , valving or internal mechanisms , nor should it hinder the readability of the written or digital information stored thereon . the scv can be disposed by using standard laboratory methodologies , including incineration . in an alternative embodiment of the scv , rather than having growth chambers of the type shown in fig1 - 3 , slots are provided within the housing for receiving a plurality of micro - lab plates ( such as are available commercially from micronics , inc .). the plates either can be preselected and installed in the scv during manufacture or can be “ field ” selected so that an operator can spontaneously configure the scv to best fit the circumstances of a biospecimen collection occurrence . each plate 100 ( fig5 ) comprises an inlet port 101 that , when the plate is installed within the scv , fluidly connects to one of the fluid ducts within the scv &# 39 ; s growth chamber manifold 55 , at least one outlet port 102 that fluidly connects to one of the scv &# 39 ; s extraction portals , and a series of interconnecting channels and chambers between the inlet and outlet ports for containment of culturing media and other substances deemed useful for the growth and preparation of the biospecimen . for example , appropriate substance can be provided in a plate to de - salt the cultured biospecimen ( thus rendering it more suitable for subsequent mass spectrometry analysis ). the scv is intended to integrate to an automated analyzing platform . the devices and methods of the present invention therefore preferably include a microbiology automation platform ( map ) and microbiology analyzers and the platform to which they interface . the map of the present invention is meant to automate the processes of the user ( operator ) whether or not there is physical hardware in place to do the actual manipulation of the cultured biospecimen . workflow logic determines and drives the series of steps required for a particular specimen . various workstations perform the designated procedure on the specimen and return it to the control of the platform following the procedure . the workstations can optionally be an automated instrument or a human user ( e . g ., medical technician ). in one example , the microbiology automation platform is a hybrid of a traditional laboratory information system ( lis ) and a laboratory device . the platform receives orders and order updates from an lis and sends results to an lis , but it does not manipulate patient information or perform other functions traditionally performed by an lis . it is possible to transmit data from the platform to national databases for the tracking of pathogenic outbreaks and trends in infectious diseases . such systems are associated , for example , with state health laboratories , health and human services at the state and national level , and the centers for disease control and prevention databases . the scv is designed with a physical feature that ensures proper orientation into the map . more specifically , the scv has an elongated slot 88 formed extending across the bottom shell 12 of the housing ( see fig1 and 3 ) that ensures its proper orientation on a conveyor track 110 used to automatically move one or more scvs to and through various analyzing workstations 111 - 114 within the map . when the scv is properly oriented in the map , the data storage medium ( i . e ., barcode or rfid tag ) is accessible to and readable by appropriate identification readers , the eight extraction portals on the scv are accessible to the medical device workstations performing the preparatory or analysis steps , and the valve handle 84 on the scv is easily accessible and manageable by robotic units in the map , as well as by manual operation . the graphic presentation of data on the map preferably includes : a windows ®- based color gui , message logging , status reporting , trending , management reports , epidemiology reports , images , inventory , quality control , and instrument utilization reports . the map preferably supports within the same configuration multiple pre - processing components , multiple detection components , multiple identification components , and multiple susceptibility components . referring now to fig6 , a schematic diagram of scv ( and biospecimen ) movement throughout the laboratory automation system is shown . this system operates as described in u . s . pat . no . 5 , 614 , 415 , the entirety of which is incorporated herein by reference . the scv ( with cultured biospecimen ) arrives at a specimen receiving station 120 , where the scv is loaded onto a conveyor track system designated generally at 110 . at specimen receiving station 120 , the scv is given an identification code which correlates with the scv and the biospecimen to be analyzed , so that the scv and biospecimen may be directed throughout the laboratory automation system , even when the scv is removed from the conveyor track for specific testing at a workstation . as shown in fig6 , conveyor track system 110 is preferably a continuously moving conveyor which will move scvs in a generally closed loop system . at receiving station 120 , the scv assignment is entered into the map &# 39 ; s cpu 130 to determine which workstations the biospecimen must utilize , the order in which the stations are to be utilized , the priority of the particular analyses to be conducted or steps to be taken , and any other pertinent information with respect to priority or turnaround time . entry of this information may be as easy as scanning the rfid tag or barcode of the scv . as represented by the double - headed arrows in fig6 , it will be appreciated that the cpu communicates ( wirelessly or by hard wire connection ) with each of the workstations 111 - 114 and the receiving station 120 . while fig6 shows only four specific workstations 111 - 114 , a conventional clinical laboratory could have a wide variety of such stations throughout a facility . the closed loop system of conveyor track 110 permits a biospecimen to stop at any given workstation in any desired order . thus , if time constraints require that the analysis of workstation 113 be performed first , and that an analysis of workstation 111 be performed at some time after the analysis of workstation 113 , the scv containing the biospecimen can travel on conveyor track 110 past workstations 111 and 112 , directly to workstation 113 , for immediate analysis . the scv is then reintroduced onto the conveyor track 110 to follow the closed loop around to the next workstation assigned to the biospecimen . once all desired analyses have been completed , the scv ( with any remaining cultured or original biospecimen ) is forwarded to a specimen archiving station 115 for removal from the conveyor track 110 and appropriate storage . the map supports the maintenance of a portion of the original biospecimen that is not contaminated or altered during processing and , therefore , is maintained for quality assurance purposes and / or confirmatory testing . the dispensing of the biospecimen / media combination from the extraction portals on the scv is preferably performed automatically by the map &# 39 ; s workstation equipment ( including robotic extraction probes or needles ), but it can also be done manually . the map equipment checks specimen volume prior to testing to ensure sufficient quantity for the testing to be performed , and the map continuously tracks the amount of specimen processed from the scv in order to determine availability of specimen volume for further testing . the map equipment also is capable of re - closing the scv after specimen has been removed or reagents / diluents have been added . the devices and methods of the present invention also include software . thus , the map can be configured to perform many different functions , as desired by a particular clinical facility . for example , the map has the capability to dynamically change the processing steps to completion of the specimen analysis based on information either received with the order or through information associated with the current status of the specimen . the map is developed with a rules engine that drives the logic of processing steps based upon microbiology standards in practice . this rule set is user configurable to mimic the current standard operating procedures of the microbiology laboratory staff . the map has the capability of sending revised or additional orders to a host system through a standard data communications interface 135 . the map is developed with on - line specimen tracking . specimen status is presented to the user interface in a graphical presentation . specimen status preferably includes : estimated time of testing completion , turn - around - time reporting , logging of any event where the scv is manually removed from the system , and a logging of the duration of time the scv spends at any sub - process in the system . the map records a complete processing history for each scv processed , including maintaining the data relationship between the scv ( the primary specimen ) and any aliquots ( secondary specimens ) that are created from the original scv specimen . data stored on the map are accessible remotely . the map contains an event monitoring , recording , and notification system . the map software supports auto - verification of patient results . the map software automatically accepts or rejects a specimen result based on a series of user - defined rule sets . rules for test scheduling and routing changes are customizable based on laboratory operational , business , and clinical objectives . the map can optionally have the capability to automatically prepare specimen and accompanying paperwork to refer specimens to public health entities . similarly , the map can optionally support the collection and reporting of data for peer - to - peer quality assurance programs ( and thus can optionally have the capability of maintaining various quality assurance reports on - line ). it is to be understood that this invention is not limited to the particular devices , methodology , protocols , subjects , or reagents described , and as such may vary . it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only , and is not intended to limit the scope of the present invention , which is limited only by the claims . other suitable modifications and adaptations of a variety of conditions and parameters , obvious to those skilled in the art of microbiological diagnostics , are within the scope of this invention . | 2 |
the present invention , which provides a self - aligned soi body capacitor and a method of fabricating the same , will now be described in greater detail by referring to the drawings that accompany the present application . the drawings are provided herein for illustrative purposes and thus they are not drawn to scale . in fig1 – 20 , the structure through various processing steps is illustrated in different views . drawing a represents a top - down view where cross - sections a — a and b — b , and in some instances c — c , are shown . drawing b is a cross sectional view along the line a — a , drawing c is a cross sectional view along the line b — b , and drawing d is a cross sectional view along the line c — c . “ a — a ” is a cross section in a vertical cutting a plane parallel to a wordline location , and through the center of the wordline location . “ b — b ” is a cross section in a vertical cutting plane parallel to a bitline location , and through the center of the bitline location . “ c — c ” is a cross section in a vertical cutting plane parallel to a bitline location , and through a capacitor plate . the process of fabricating a self - aligned soi body capacitor begins by first providing the structure 10 shown in fig1 a – 1c . the structure 10 includes a si - on - insulator ( soi ) substrate 12 , a patterned material stack 20 located on an upper surface of the soi substrate 12 and a patterned resist 30 located on an upper surface of the patterned material stack 20 . the soi substrate 12 includes a semiconductor layer 14 , a buried insulating layer 16 and a si - containing layer 18 . the semiconductor layer 14 of the soi substrate 12 comprises any semiconductor material known in the art . illustrative examples of semiconductor materials that can be employed as the semiconductor layer 14 include , but are not limited to : si , sic , sige , sigec , ge alloys , gaas , inas , inp as well as other iii / v or ii / vi compound semiconductors . typically , the semiconductor layer 14 is a si - containing semiconductor such as , si , sic , sige , or sigec . the thickness of the semiconductor layer 14 is inconsequential to the present invention . the buried insulating layer 16 is typically comprised of an oxide , nitride , oxynitride or multilayers thereof . more typically , the buried insulating layer 16 is comprised of an oxide . the thickness of the buried insulating layer 16 may vary depending on the origin of the layer . typically , however , the buried insulating layer 16 has a thickness from about 5 to about 500 nm , with a thickness from about 50 to about 200 nm being more highly preferred . the si - containing layer 18 of the soi substrate 12 is comprised of a silicon containing semiconductor including , for example , si , sic , sige , or sigec . the si - containing layer 18 of the soi substrate 12 is preferably monocrystalline . the thickness of the si - containing layer 18 may vary depending on the technique that was used in forming the soi substrate 12 . typically , the si - containing layer 18 of the soi substrate 12 has a thickness from about 2 to about 300 nm , with a thickness from about 5 to about 150 nm being more highly preferred . the crystal orientation of the semiconductor layer 14 and the si - containing layer 18 may be the same or different , with the same crystal orientation being typical for soi substrates made by separation of silicon by ion implantation of oxygen ( simox ). illustratively , the crystal orientation of layers 14 and 18 are typically chosen from ( 100 ), ( 110 ) or ( 111 ). the si - containing layer 18 of the soi substrate 12 can be unstrained , strained or a combination thereof . the soi substrate 12 shown in fig1 a – 1c can be fabricated using techniques that are well known in the art . for example , the soi substrate 12 may be formed by an ion implantation process referred to as simox in which ions such as oxygen ions are implanted into a starting wafer and thereafter the ion implanted wafer is subjected to an annealing process that causes the formation of the buried insulating layer 16 within the substrate . alternatively , the soi substrate 12 can be formed by a layer transfer process that includes wafer bonding . the patterned material stack 20 shown in fig1 a – 1c comprises at least three layers , with a fourth layer being optional . the bottom most layer of material stack 20 is a nitride layer 22 . an optional oxide marker layer 24 may be located on the nitride layer 22 . the purpose of using the optional oxide marker layer 24 will be discussed in relation to fig1 a – 10c . a polysilicon layer 26 may be located on the oxide marker layer 24 , if present , or on the nitride layer 22 . the uppermost layer of the material stack 20 comprises a nitride layer 28 . the thickness of the patterned material stack 20 may vary depending on the number of layers within the stack . typically , the overall thickness of the patterned material stack 20 is from about 20 to about 600 nm , with a thickness from about 35 to about 300 nm being more typically . this overall thickness for the patterned material stack 20 includes a thickness for the nitride layer 22 from about 5 to about 200 , preferably from about 10 to about 100 nm , a thickness for the optional oxide marker layer 24 from about 3 to about 10 , preferably , from about 4 to about 8 nm , a thickness for the polysilicon layer 26 from about 5 to about 200 , preferably from about 10 to about 100 nm , and a thickness for the nitride layer 28 from about 5 to about 200 , preferably from about 10 to about 100 nm . the patterned resist 30 is comprised of a conventional photoresist material and its thickness is well known to those skilled in the art . the patterned material stack 20 is formed by first forming the various material layers using one or more conventional blanket deposition techniques such as , for example , chemical vapor deposition ( cvd ), plasma enhanced chemical vapor deposition ( pecvd ), evaporation , chemical solution deposition , or atomic layer deposition . the polysilicon layer 26 can be formed by a cvd process . in addition to deposition processes , the various insulating layers of the material stack 20 can be formed by thermal means including oxidation and nitridation . a combination of the aforementioned techniques can also be used . after forming the various layers of the material stack , a resist is applied to the uppermost layer of the material stack 20 utilizing a conventional deposition process such as , for example , spin - on coating , and then the resist is subjected to a conventional lithographic process . the lithographic process includes exposing the resist material to a pattern of radiation and developing the resist utilizing a conventional developer . after the resist has been patterned , the pattern is transferred into the material stack , stopping on the upper surface of the soi substrate 12 , i . e ., on top of the si - containing layer 18 , utilizing one or more , preferably one , etching process . the etching process used to pattern the material stack includes a dry etching process ( including reactive ion etching , ion beam etching , plasma etching or laser ablation ), wet etching , or a combination thereof . preferably , the etching used to pattern the material stack comprises anisotropic reactive ion etching wherein the chemistry of the etchant is changed to selectively etch the exposed material layer . the patterned resist 30 can , in some embodiments , be removed from the structure following the formation of the patterned material 20 utilizing a conventional resist stripping process . prior to forming the material stack on the soi substrate , a pre - implant step is performed in which ions ( n - or p - type ) are implanted through the si - containing layer 18 and the buried insulating layer 16 stopping within the upper surface of the semiconductor layer 14 . that is , a heavily doped ( on the order of about 1 × 10 19 atoms / cm 3 or greater ) region ( not shown in the drawings ) can be formed at or near the interface between the buried insulating layer 16 and the semiconductor layer 14 . the dopant polarity of the heavily doped region is selected to be the same as the dopant polarity of the polysilicon body capacitor sidewall plate , to be subsequently formed and contacted to the substrate . this heavily doped region in the semiconductor layer 14 beneath the buried insulating layer 16 will serve to distribute the voltage that is applied to the sidewall plates , by enhancing conduction near the semiconductor layer 14 / buried insulating layer 16 interface . note that in fig1 a – 1c the patterned material stack 20 protects portions of the si - containing layer 18 , while leaving other portions of the si - containing layer 18 exposed . also , the patterned material stack 20 defines ( i . e ., covers ) the active region in which the transistor of the inventive structure will be subsequently formed . the optional oxide maker layer 24 is shown in fig1 a – 1c and is not shown again in the remaining drawings . next , and as shown in fig2 a – 2c , exposed portions of the si - containing layer 18 , not protected by the patterned material stack 20 , are then etched using the upper patterned nitride layer 28 as an etch mask . this etching step removes all the exposed portions of the si - containing layer 18 , stopping on the upper surface of the buried insulating layer 16 . the etching step is performed utilizing an etching process such as anisotropic reactive ion etching that selectively removes the si - containing layer 18 . if the patterned resist 30 was not previously stripped from the structure , it can be removed following this etching process . note that in fig2 a – 2c the si - containing layer 18 is patterned such that the sidewalls thereof all substantially aligned with the sidewalls of the patterned material stack 20 . moreover , in fig2 a – 2c , portions of the buried insulating layer 16 , not directly beneath the patterned material stack 20 , are now exposed . a dielectric 32 is then formed on the exposed sidewalls of the etched si - containing layer 18 as well as the exposed sidewalls of the polysilicon layer 26 . the dielectric 32 serves as the insulator between the sidewall plate ( to be subsequently formed ) of the body capacitor and the remaining si - containing layer 18 ( which will form the body of a mosfet ). the dielectric 32 may comprise sio 2 , silicon oxynitride , or a high k material ( k greater than 4 . 0 , preferably greater than 7 . 0 ) such as , for example , al 2 o 3 or ta 2 o 5 . the dielectric 32 , which can be formed by a variety of techniques including deposition ( such as , for example , cvd or pecvd ) or thermal ( such as oxidation or oxynitridation ), has a thickness from about 2 to about 20 nm . more typically , the dielectric 32 has a thickness from about 3 to about 6 nm . the structure including the dielectric 32 that is formed on the exposed sidewalls of the remaining si - containing layer 18 and the polysilicon layer 26 is shown , for example , in fig3 a - 3c . fig4 a – 4c show the structure that is formed after an insulating material 34 , such as an oxide , is formed over the surface of the exposed buried insulating layer 16 and atop the patterned material stack 20 . any conventional deposition process such as cvd or pecvd can be used to form a layer of the insulating material 34 . after forming the insulating material 34 , the insulating material 34 is planarized so that an upper surface of the insulating material 34 is coplanar with the upper surface of the polysilicon layer 26 of the patterned material stack 20 . that is , a planarization process such as chemical mechanical polishing ( cmo ) and / or grinding is used to provide a structure as shown in fig5 a – 5c in which the upper surface of the insulating material 34 is substantially planar to the upper surface of the polysilicon layer 26 . it is noted that the planarization process used in this step of the present invention removes the upper nitride layer 28 of the patterned material stack 20 . as shown in fig5 a – 5c , isolation regions 34 are formed adjacent to the remaining portions of layers 26 , optionally 24 , 22 and layer 18 . a pad nitride layer 36 is then deposited by conventional techniques over the planarized structure shown in fig5 a – 5c providing the structure shown , for example , in fig6 a – 6c . the pad nitride layer 36 is a relatively thick layer since it determines the height of the wordline wiring to be subsequently formed . typically , the pad nitride layer 36 has a thickness from about 30 to about 150 nm . stripes ( i . e ., openings or troughs ) 38 are then formed through the pad nitride layer 36 stopping on the upper surface of the polysilicon layer 26 in the active region ( see fig7 c ) and on the surface of insulating material 34 in the region that lies to the periphery of the active region ( see fig7 b ). the stripes 38 are formed by lithography and etching . the etching step is performed by utilizing an anisotropic reactive ion etch for silicon nitride that is selective to silicon and silicon oxide . the stripes 38 define the location of the sidewall capacitor plates , which will be self - aligned to the body ( i . e ., the remaining si - containing layer 18 ), and the location of the wordline gate conductors . both the sidewall capacitor plates and the wordlines are self - aligned to each other since they will be defined by and registered to the same structural features ( i . e ., through the opening in the pad nitride layer 36 ). the structure including the stripes 38 is shown , for example , in fig7 a – 7c . the exposed surfaces of the insulating material 34 outside of the active region shown along line a — a are then etched by a dry etching process such as anisotropic reactive ion etching through layer 34 and the underlying buried insulating layer 16 stopping on the upper surface of semiconductor layer 14 . the etching process used in this step of the present invention , which provides the structure shown in fig8 a – 8c , is selective to silicon and silicon nitride . in fig8 b , reference numeral 40 is used to define the recessed region formed by this step of the present invention ; note that no etching occurs in the active area during this step of the present invention , since it is protected by either polysilicon layer 26 or pad nitride 36 . the recessed region 40 and the stripes 38 are then filled with a conductor 42 and then the conductor 42 is planarized to the upper surface of pad nitride 36 providing the structure shown in fig9 a – 9c . the filling process includes any conventional deposition process , while planarization is performed utilizing cmp and / or grinding . the conductor 42 comprises a metal , a metal alloy , a metal silicide , polysilicon or a combination thereof . preferably , polysilicon is used as the conductor 42 . when polysilicon is used as the conductor 42 , it is typically formed using an in - situ doping deposition process . the polysilicon is doped with the same dopant polarity as the buried layer that was previously formed into the semiconductor layer 14 as described in connection with the structure shown in fig1 a – 1c . preferably , the dopant polarity of the polysilicon conductor 42 and of the deep implant region described above in fig1 a – 1c are p - type since a p - type workfunction for the capacitor plate will result in maximum body hole concentration , for the nmosfets in this exemplary embodiment . the exposed conductor 42 is then etched selective to nitride and oxide , recessing the top surface of the conductor 42 slightly below the top surface of the si - containing layer 18 . see , for example , the structure shown in fig1 b . in this step , all the exposed conductor 42 over the active region as well as portions of the polysilicon layer 28 are removed which exposes a top surface of nitride layer 22 . see , for example , the structure shown in fig1 c . in embodiments in which the optional oxide marker 24 is present in the structure , and when that layer is reached during the course of etching the conductor 42 in the active region , the oxide signature is detected to indicate that the remaining amount of conductor 42 to be etched is slightly thicker than the lower nitride layer 22 . the use of the optional oxide marker layer 24 results in excellent control of the depth of the conductor recess below the top surface of the si - containing layer 18 . the recessed conductor forms the sidewall plate conductors 42 ′. next , and as shown in fig1 a – 11b , an oxide layer 44 having a precisely controlled thickness is formed over the top surface of the recessed conductor 42 ′. this oxide layer serves as an insulating layer between the body capacitor plate and the subsequently formed overlying wordline conductor . the oxide layer 44 is formed utilizing an oxidation process to a thickness from about 5 to about 20 nm . the surface of the si - containing layer 18 in the active region ( see , fig1 c ) is protected during this thermal oxidation step by the nitride layer 22 . oxide layer 44 is however formed on the exposed sidewalls of polysilicon layer 26 in the active region . the exposed nitride layer 22 in the active region that overlays the si - containing layer 18 is then removed , preferably with an anisotropic etch to minimize undercutting of the nitride layer 22 elsewhere on the si - containing layer 18 . at this point in the process , channel doping ( not shown ) may be introduced into the exposed portions of the si - containing layer 18 using conventional ion implantation techniques . a screen oxide ( also not shown ) may optionally be formed prior to the implantation process and thereafter removed . the resultant structure that is formed after the foregoing step of removing the exposed nitride layer 22 overlaying the si - containing layer 18 is shown in fig1 a – 12c , for example . reference numeral 45 is used to denote the openings formed during this step of the present invention . a transfer gate dielectric 46 is then formed on the exposed surface of si - containing layer 18 through opening 45 . the transfer gate dielectric 46 comprises an oxide , oxynitride or a high k ( k greater than 4 . 0 , preferably greater than 7 . 0 ) dielectric . the thickness of the transfer gate dielectric 46 is typically from about 1 to about 10 nm . any conventional deposition process or thermal process can be used to form the transfer gate dielectric 46 . fig1 a – 13c show the structure after the transfer gate dielectric 46 has been formed . fig1 a – 14c shows the structure after wordline gate conductor 48 and an insulating cap 50 are formed . specifically , the wordline gate conductor 48 is formed through the opening 45 atop the transfer gate dielectric 46 by deposition . following the deposition process , the wordline gate conductor 48 is planarized to the upper surface of the pad nitride layer 36 . the planarized wordline gate conductor 48 is then recessed utilizing a timed etching process such as reactive ion etching . the wordline gate conductor 48 is comprised of a conductive material including , for example , a metal , metal alloy , metal silicide , polysilicon or any combination thereof . the insulating cap 50 , typically an oxide , is then deposited and planarized utilizing conventional processes well known in the art . the exposed pad nitride layer 36 is then removed utilizing a well known etching method such as , for example , hot phosphoric acid or reactive ion etching , exposing the polysilicon layer 26 and insulating material 34 . the resultant structure is shown in fig1 a – 15c . the exposed polysilicon layer 26 over the active region is then removed by etching , e . g ., reactive ion etching , thus exposing the nitride layer 22 over the active region . the structure formed after this step of the present invention has been performed is shown , for example , in fig1 a – 16c . at this point of the inventive process , an oxide spacer 52 is formed on each sidewall of the wordline conductor 48 . the purpose of the spacer 52 is to slightly widen the footprint of the wordline to avoid any possibility of etching into the seam between the wordline and the oxide layer 44 over the body capacitor plate 42 ′ when the nitride layer 22 is subsequently removed . if the spacer 52 was not present at this time , there would be a remote possibility that the etch to remove the lower nitride layer 22 may damage the protective oxide layer 44 between the wordline 48 and the body capacitor plate 42 ′. the oxide spacer 52 is formed using well known methods such as deposition of a conformal cvd oxide film , followed by an anisotropic etch . fig1 a – 17c show the structure including the oxide spacer 52 . the exposed lower nitride layer 22 over active si - containing layer 18 is then removed , for example , by reactive ion etching , stopping on the si - containing layer 18 surface outside of the wordlines 48 . the resultant structure in shown , for example , in fig1 a – 18c . a silicon nitride etch chemistry is typically employed to avoid erosion of the insulating material 34 and the insulating cap 50 . conventional processing follows , with formation of oxide spacers ( if not previously formed ), and source / drain implantation . since the sidewall plates 42 ′ and the source / drain diffusions 54 to be subsequently formed in the next processing step ( see fig1 a – 19c ) are each separately self - aligned with the wordline troughs 38 , they are self - aligned with each other . the self - alignment of the sidewall plates 42 ′ and the source / drain diffusions 54 is not taught or suggested in any prior art soi body capacitor known to the applicants of the present invention . source - drain implants ( including any extensions and halos ) and anneals are now done forming at least the source - drain diffusions 54 shown in fig1 a – 19c . fig2 a – 20d exemplify a typical layout of a portion of the 1 t - capacitorless memory array with self - aligned sidewall body plates 42 ′. specifically , in fig2 a – 20d , a structure including two transistors that share a common bitline diffusion 54 bl in the memory array is illustrated . the source line diffusion shown in these drawings are labeled as 54 sl . the structure shown in fig2 a – 20d includes source - line ( sl ) conductors 56 that are formed adjacent to selected wordlines using well known metal deposition and damascene processes . an interlayer dielectric ( ild , not shown ) is then typically deposited . bitline studs 58 are formed to selected diffusions , and bitline conductors 60 are formed using standard methods . higher level insulating and wiring layers are then formed to complete the fabrication of the chip . several specific layouts and technology options for a memory array employing the self - aligned body - capacitor will be shown next . it is noted that in the present invention , the wordlines lie perpendicular to the bitlines and arrays of transistors are arranged in rows and columns . note that a new cross - section ( c — c ) has been added in fig2 . c — c is a cut parallel to b — b but passing through the capacitor plate 42 ′ of the self - aligned body capacitor . a phantom of the soi region ( i . e ., si - containing layer 18 ) and source - drain diffusions 54 has also been incorporated into cross - sectional view c - c to illustrate the location of the capacitor plate 42 ′ with respect to the diffusions 54 in the si - containing layer 18 , as well as the wordline conductor 48 . it is emphasized that the edges of the capacitor plate 42 ′, the wordline conductor 48 , and the diffusions 54 are all self - aligned and are not subject to alignment tolerance . the above discussion , in reference to fig1 – 20 , illustrates the various processing steps that are used in fabricating the inventive self - aligned soi body capacitor structure shown in fig2 . fig2 and 22 illustrate some cell layouts that can include the inventive structure shown in fig2 . in fig2 and 22 , like reference numerals are used to describe the components that are present in the structure shown in fig2 . a first exemplary layout of a portion of an array of cells employing the inventive self - aligned soi body capacitor illustrated in fig2 is shown in fig2 . specifically , fig2 illustrates an open bitline architecture design where each wordline 48 gates a cell in each crossing bitline 60 . locations of the sidewall capacitor plate 42 ′, self - aligned to the wordlines and diffusions , are delineated by the dashed line rectangular regions . this embodiment defines continuous stripes of soi ( running horizontally in fig2 ). rows of soi stripes are separated by the inventive capacitor plate and regions of sti . bodies of adjacent mosfets sharing the same soi stripe are isolated by source - drain diffusions , which extend all the way to the box ( as previously described by the process flow ). if the technology were designed to use shallow source - drain diffusions that extend only partly to the box body charge of adjacent mosfets would not be isolated . in that case sti would be needed to provide isolation between bodies of mosfets sharing a common bitline . the case of source - drain diffusions extending partly to the box is discussed in fig2 . specifically , fig2 illustrates a second exemplary layout of a portion of an array of cells employing the inventive self - aligned soi body capacitor . in the folded bitline architecture design shown in fig2 , each wordline 48 gates a cell in alternate crossing bitlines . locations of the sidewall capacitor plate , self - aligned to the wordlines and diffusions 60 , are delineated by the - dashed line rectangular regions . regions of soi ( i . e ., the active si - containing layer 18 ) are indicated by rectangles bordered by dotted lines . these regions are labeled with reference numeral 100 in fig2 . a plurality of isolation regions ( i . e ., stis ) isolates soi regions that lie under each bitline . each one of the plurality of isolated soi regions contains a single mosfet with a single bitline contact diffusion on a first end and a single source line ( sl ) contact diffusion on a second end of said isolated soi region . corresponding soi regions in adjacent rows jog laterally by 1 minimum feature dimension ( 1f ), thus resulting in the folded bitline layout . since this second exemplary layout uses intervening sti to isolate bodies of mosfets sharing a common bitline , there is no restriction on the source - drain diffusion depth . no art has been found which illustrates a folded bitline layout for a body - charge storage type of memory device . all the known art for this type of cell employ continuous stripes of soi , thus necessitating deep diffusions . it may be advantageous to employ shallow diffusions for improved scalability . while the present invention has been particularly shown and described with respect to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in forms and details may be made without departing from the spirit and scope of the present invention . it is therefore intended that the present invention not be limited to the exact forms and details described and illustrated , but fall within the scope of the appended claims . | 7 |
referring now to fig1 a leadscrew assembly 10 is illustrated comprising a leadscrew 12 and a leadscrew drive nut 14 mounted on the leadscrew . a coupling of the present invention , for transferring motion from the drive nut 14 to a movable carriage , not shown , comprises a coupler member or plate 16 which is disposed around and connected to the drive nut , such as by mating threads 18 . a carriage plate 20 , or a member which can be connected to , or be part of , and move with the carriage , is also disposed in spaced relationship around the leadscrew in spaced relation to the coupler plate 16 . an intermediate member 22 , which in this embodiment is comprised of two mating plates 24 and 26 , is also disposed in spaced relationship around the leadscrew between the coupler plate 16 and the carriage plate 20 . the intermediate member 22 is connected to the coupler plate 16 by a first connecting means such as a pair of flexure members 28 which are fixed at opposite ends to both the intermediate member and the coupler plate . the flexure members are connected to the coupler plate at a pivot axis 30 which is substantially perpendicular to the axis 32 of the leadscrew , and are fixedly connected at the intermediate member end . a second pair of flexure members 34 connect the intermediate member 22 to the carriage plate 20 . the second pair of flexure members are also rigidly connected to the intermediate member end and are connected to the carriage plate at a pivot axis 36 , which is substantially perpendicular to the leadscrew axis and also substantially perpendicular to pivot axis 30 . thus , the second pair of flexure members is oriented 90 ° to the first pair . as illustrated , the intermediate member 22 is formed of two mating plates 24 and 26 which rigidly hold the ends of both pairs of the flexure members when the plates are tightly fastened together by means of screws or the like , not shown . the flexure assembly must be very stiff in the direction of the leadscrew axis and about the leadscrew axis . by flexing , the flexure members permit relative movement of the intermediate member rotationally about axes 30 and 36 , as well as perpendicularly to these axes . the flexure members have a sufficiently high aspect ratio of length to diameter that they permit the intermediate member 22 to move in the plane perpendicular to the leadscrew axis without permitting movement along the leadscrew axis . the flexure members must be stout enough that they will not buckle under the load being transferred form the leadscrew drive nut to the carriage , yet they must permit the small transverse motion of the leadscrew without transferring that motion to the carriage . thus , the coupler of the present invention prevents the transfer of the once - per - revolution errors in the leadscrew to the carriage . a first alternative embodiment is illustrated in fig2 similar to the embodiment of fig1 wherein similar components are identified with similar reference numbers with the prefix &# 34 ; 2 &# 34 ;. in this embodiment both pivot axes 230 and 236 are located in the same plane in intermediate member 222 . although the construction of this embodiment may be a bit more complex , the location of both pivot axes in the same plane prevents the introduction of induced motion , such as transverse motion caused by motion about a pivot axis . a second alternative embodiment is illustrated in fig3 similar to the embodiment of fig1 wherein similar components are identified with similar reference numbers with the prefix &# 34 ; 3 &# 34 ;. in this embodiment the intermediate member 322 , the flexure members 328 and 334 , and the connecting means for the carriage 320 , are all formed from a single sheet of folded sheet metal , for example . such a construction is very simple and economic to form , and yet provides all of the features and advantages of the preferred embodiment . a third alternative embodiment is illustrated in fig4 similar to the embodiment of fig1 wherein similar components are identified with similar reference numbers with the prefix &# 34 ; 4 &# 34 ;. in this embodiment , the coupling is folded so that the length thereof is substantially reduced . moreover , this embodiment provides a common plane for the pivot axes , such as provided by the embodiment illustrated in fig2 except that the common plane passes through the coupling member and the carriage connecting means which are also co - planar . fig5 and 7 illustrate variations of the formed sheet metal coupler construction of fig3 . the structure shown in fig5 is for a folded coupler similar to fig4 except that the pivot axes are not in a common plane . the structure shown in fig6 is for the folded coupler of fig4 . the structure shown in fig7 is for a coupler like that shown in fig2 wherein the pivot axes are in a common plane in the intermediate member 622 . fig8 illustrates the use of the coupler of the present invention as a flexible shaft coupling . in this application , the coupler member 816 is connected to an input shaft ( not shown ), and the connecting means 820 is connected to an output shaft ( not shown ). with the present coupler , movement of the input shaft transverse to its axis will not be imparted to the output shaft while transmitting the rotation of the input shaft to the output shaft . still further , it will be appreciated that the intermediate member can be connected directly to either drive nut or to the carriage without the need for a coupler member or a connector member so long as the form of the connection between the intermediate member and the drive nut or the carriage is the same as that described for the connection between the intermediate member and the coupler and the connector member , i . e . so long as the connection provides the same freedom of movement between the two members as well as the same constraints . it will thus be seen that the present invention provides a simple , inexpensive leadscrew coupling which corrects for lead screw drunkenness without the need to specify extremely accurately manufactured , and thus very expensive , lead screws for use in systems sensitive to such errors , such as scan printing apparatus . by compensating for once per revolution lead screw errors , the present invention permits the use of much less expensive lead screws . the invention has been described with reference to specific preferred embodiments and variations thereof , but it will be understood that other variations and modifications can be effected within the spirit and scope of the invention , which is defined by the following claims . | 8 |
hereunder , referring to the attached drawings , there are described embodiments in which a rotatively - operated electronic component according to the present invention is applied to a portable phone . as shown in fig1 the portable phone 1 includes a body case 2 made of synthetic resin , where various kinds of members are housed or mounted . at the upper part of the body case 2 , an antenna 3 is installed to be extracted or stowed freely , and through the antenna 3 transmission and reception of radio waves are conducted with base stations . at the front upper part of the body case 2 is installed a speaker 4 as an electro - acoustic conversion means . when calling , a voice of a called party is outputted from this speaker 4 . at the front lower part of the body case 2 is installed a microphone 5 as an acoustic - electronic conversion means . when calling , voice of a user is collected by this microphone 5 . at somewhat upper position from the front center of the body case 2 is installed a liquid crystal display ( lcd ) 6 as a display means capable of displaying various kinds of information such as receiving condition of radio waves , the amount of battery remaining , telephone numbers of called parties , registered contents as a telephone directory ( telephone numbers and names of called parties or the like ), outgoing and incoming history , and other kinds of registered contents . at the front lower half of the body case 2 , various operation keys 7 are installed as operating means . by pressing these operation keys 7 , input of various instructions , texts or the like may be performed . further , at the upper part of the left side surface of the body 2 , a jog dial 8 is installed as a different switch apparatus from the operation keys 7 . by rotating this jog dial 8 , menus displayed on the liquid crystal display 6 , scrolling display of various items such as a list of outgoing and incoming history , telephone number list or the like , and a cursor for selecting items , etc ., may be displayed . by the pushing operation ( pushing - in operation ) of the jog dial 8 to the internal direction of the body case 2 , the items displayed on the liquid crystal display 6 may be decided or executed . furthermore , selection or execution of the designated items may also be conducted by moving the jog dial 8 to the rear side of the portable phone along the side surface of the body case 2 to provide the pivoting operation ( push - down operation ) about the pivot axis parallel to the rotation plane of the jog dial 8 and orthogonal to the pushing - in direction , or by moving the jog dial 8 to the opposite direction of the push - down operation , namely , by moving it to the front side of the portable phone along the side surface of the body case 2 to provide the pivoting operation ( push - up operation ) about the pivot axis parallel to the rotation plane of the jog dial 8 and orthogonal to the pushing direction . various operations may be provided . for example , once decided items may be cleared by the push - up operation , and a hierarchy of the menu may be raised by one level during display of the menu or a display of a menu ( called catch menu hereafter ) by which a user is allowed to select procedures such as hold - on of call , microphone - off or the like when calling may be actuated during calling by the push - down operation . as shown in fig2 the jog dial 8 essentially consist of a disc member 9 , a detection circuit 10 , and a first to a third switches 11 , 12 and 13 . when the rotating operation is performed with the disc member 9 , its rotation direction and rotation angle are detected by the detection circuit 10 , and the result of the detection is outputted to a control means described later . when the disc member 9 is pushed into the interior of the body case 2 by the pushing operation , the first switch 11 is operated , and when the push - down operation is performed with the disc member 9 , the second switch 12 is operated , and when the push - up operation is performed with the disc member 9 , the third switch 13 is operated . the control means described later is operable to recognize operating condition of these switches , and to conduct various controls in accordance with the rotation direction and the rotation angle of the disc member 9 and the operating condition of the first to the third switches 11 , 12 and 13 . as shown in fig3 the disc member 9 is supported by a base member 14 made of insulation material to be rotative and movable to the pushing direction , namely , to an arrow a direction in fig3 . more specifically , an intermediate supporting plate 15 is supported by the base member 14 with freely pivoting , and the disc member 9 is supported at the position near the pivot edge of the intermediate supporting plate 15 . the intermediate supporting plate 15 is impelled to move to a clockwise direction shown in fig3 by a spring member ( not shown ), namely , to an arrow cw direction in fig3 whereby pivoting to the clockwise direction cw is made to stop at the initial position as shown in fig3 . at the rear side of the intermediate supporting plate 15 of the base member 14 , an intermediate operation element 16 having the shape of a letter l from side - view is supported with freely pivoting . at the position facing the rear edge 16 a of the intermediate operation element 16 of the base member 14 , the first switch 11 is disposed . accordingly , when the disc member 9 is pushed to the pushing - in direction a , the intermediate supporting plate 15 pivots to the counterclockwise direction , namely , to the arrow ccw direction in the drawing , against the impelling force of the spring member ( not shown ), so that the disc member 9 appears to move to the pushing - in direction a apparently . when the intermediate supporting plate 15 pivots to the counterclockwise direction ccw , a front edge 16 b of the intermediate operation element 16 is pressed by a rear edge 15 a of the intermediate supporting plate 15 , and the intermediate operation element 16 is pivoted such that the rear edge 16 a moves to the first switch 11 , and pushes down the first switch 11 , whereby a signal is outputted to the effect that the push - down operation is conducted by the first switch 11 . when the force of pushing the disc member 9 to the pushing - in direction a is removed , the intermediate supporting plate 15 pivots to the clockwise direction cw by the impelling force of the spring member and returns to the initial position . on the base member 14 , two supported pieces 14 a , 14 a are formed , each protruding to the opposite directions with respect to the direction orthogonal to the pushing - in direction a and parallel to the rotation plane of the disc member 9 . fig3 shows that the disc member 9 is supported by the intermediate supporting plate 15 which is freely pivoting , but the disc member may also be supported by an intermediate supporting plate which , when being pushed , slides straight to the pushing - in direction a with respect to the base member . as shown in fig5 the disc member 9 consists of two discs , namely , a stationary fixed disc and a rotating disc which is disposed coaxially with the fixed disc and rotative with respect to the fixed disc . at the portion near the rim of the rotating disc facing the fixed disc , there exist a pair of counter electrodes , each being spaced and facing in the direction of the radius . these counter electrodes contact on - the - slide with pairs of counter electrodes formed at the portion near the rim of the fixed disc . the counter electrodes of the fixed disc , both in the outer and in the inner circumference , are disposed in a little displacement with respect to the circumferential direction . for example , when the counter electrodes of the rotating disc contact the counter electrodes of the fixed disc , and by putting the counter electrodes of the rotating disc to be at grounding potential , rotating angle may be detected by counting the number of times when the counter electrodes of the rotating disc fall to the grounding potential . regarding the counter electrodes of the fixed disc , those of the outer circumference and the inner circumference are disposed in a little displacement with respect to the circumferential direction , so that the electrodes which earlier fall to the grounding potential according to the direction of rotation are different between those of the outer circumference and those of the inner circumference . such being the case , rotation direction may be detected according to which electrodes fall earlier to the grounding potential . therefore , by detecting by means of the detection circuit 10 the number of times when the counter electrodes fall to the grounding potential and which electrodes of the outer or inner circumference fall earlier to the grounding potential , a control means described later may know the rotation direction and the rotation angle of the disc member 9 , thereby capable of performing the required control . as shown in fig5 - 7 , the body case 2 is formed with a front case 2 f and a rear case 2 r . in the rear case 2 r is formed a placement unit 17 of the jog dial 9 . the placement unit 17 is formed long recessed in the lateral direction , and a notch 17 a is opened at the side surface in the left side . at the side walls 17 b and 17 c facing each other at the top and the bottom of the placement unit 17 , are provided pivoting fulcrums 18 . the pivoting fulcrum 18 is composed of two supporting pieces 19 , 19 ′, each facing spaced in the longitudinal direction , namely , to arrows b and c directions in fig1 and position control pieces 20 , 20 ′, each located at the left and right sides of the two supporting pieces 19 , 19 ′. the surfaces of the supporting pieces 19 , 19 ′ facing with each other are formed to shape protruded curve surfaces 19 a , 19 a ′ viewing in the vertical direction , namely , viewing in arrows d and e directions in fig1 . the space of the most narrow portion between the two protruded curve surfaces 19 a and 19 a ′ is made to be the same as or a slightly larger than a thickness f of the supported piece 14 a of the base member 14 of the jog dial 9 . the space between the two position control pieces 20 and 20 ′ is made to be a little larger than a width g of the supported piece 14 a . the supported piece 14 a of the base member 14 is respectively inserted between the supporting pieces 19 and 19 ′ of the respective pivoting fulcrum 18 , and sandwiched by the respective protruded curve surfaces of 19 a , 19 a ′, and a portion of the disc member 9 is made to protrude outside the body case 2 through the notch 17 a . movement thereof in the lateral direction is controlled by the position control pieces 20 , 20 ′. within the rear case 2 r , at the opposite surface to the surface of the base member 14 which supports the disc member 9 , namely , at the position facing the rear surface 14 b is disposed the second switch 12 . at the position facing the disc member 9 of the front case 2 f is disposed the third switch 13 . accordingly , by rubbing with a finger pad or the like the portion of the disc member 9 protruding outside the body case 2 to move upward , namely , to an arrow d direction in fig1 or to the rear side direction , namely , to an arrow e direction in fig1 the disc member 9 is rotated to be able to output a signal in accordance with its rotating direction and rotating angle , and by pushing to an arrow a direction , the first switch 11 is pushed down to be able to output the adapted signal . by pushing to the rear side direction with the finger pad or the like the portion of the disc member 9 protruding outside the body case 2 , namely , by pushing to an arrow c direction , the disc member 9 and the base member 14 supporting thereof are made to pivot to the rear side direction about the supported pieces 14 a serving as pivoting fulcrums supported by the supporting pieces 19 , 19 ′, whereby the second switch 12 is pushed down with the rear surface 14 b of the base member 14 to output the adapted signal . furthermore , by pushing to the front side direction with the finger pad or the like the portion of the disc member 9 protruding outside the body case 2 , namely , by pushing to an arrow b direction , the disc member 9 and the base member 14 supporting thereof are made to pivot to the front side direction about the supported pieces 14 a serving as pivoting fulcrums supported by the supporting pieces 19 , 19 ′, whereby the third switch 13 is pushed down with the front surface of the disc member 9 to be able to output the adapted signal . moreover , the space between the control pieces 20 and 20 ′ is made a little larger than the width g of the supported piece 14 a of the base member 14 , so that the supported piece 14 a may move freely within the space surrounded by these control pieces 20 , 20 ′ and the supporting pieces 19 , 19 ′ without being provided with stress , whereby occurrence of plastic deformation on the supported piece 14 a and the other parts of the base member 14 may be prevented . next , referring to fig2 there is described an outline of the circuit configuration of the portable phone 1 according to the present invention . firstly , command information inputted from the above - described various means such as operation keys 7 or the jog dial 8 is inputted to a cpu ( central processing unit ) 21 . the cpu 21 , based on the inputted command information , controls an lcd driver circuit 22 and displays on the liquid crystal display 6 various information according to the command information ( for example , telephone number being inputted , menu items , or outgoing history , telephone directory information or the like ). the cpu 21 , based on command information being inputted , controls a transmission - reception circuit unit 23 to execute various processing according to the command information such as call processing , call closing processing or the like . furthermore , the cpu 21 accesses a ram ( random access memory ) 24 which is a first storage means and makes it store designated information , or accesses an eeprom ( electrically erasable and programmable read only memory ) 25 which is a second storage means to make it store various information such as outgoing history or telephone directory list which do not want to be erased when power is tuned off . the cpu 21 is made to execute each control described above based on program code stored in a rom ( read only memory ) 26 . under control of the cpu 21 , the transmission reception circuit unit 23 is made to transmit control signal via the antenna 3 to conduct the call processing , and to receive incoming call signal from the base station via the antenna 3 to notify the cpu 21 about the incoming call . when calling , the transmission - reception circuit unit 23 also transmits a voice signal inputted from the microphone 5 after performing designated signal processing , or demodulates the voice signal after performing designated signal processing for a reception signal to output to the speaker 4 . the jog dial 8 of the portable phone 1 may provide respective command information according to the rotating operations of the disc member 9 , the pushing - in operation of the disc member 9 , the pivoting operation in the push - down direction of the disc member 9 and the pivoting operation in the push - up direction of the disc member 9 . accordingly , various instruction operation may be performed with the jog dial 8 by operating the disc member 9 into the five directions . functions conventionally allocated to the other operation keys , for example , clear of the decided item , shift - up of a menu hierarchy by one level , display of the catch menu during calling , etc ., may be performed by operating only the jog dial 8 and not using the other operation keys 7 . accordingly , it is possible to perform instruction operations with a finger of the thumb or the forefinger while holding the phone in a hand , thereby extremely increasing convenience of handling . fig8 shows another example of a jog dial 8 a . in the embodiment described above , the second and the third switches 12 , 13 are disposed in positions to sandwich the disc member 9 , and there is an advantage that the space produced by disposition of the three switches may be made compact . in the present invention , the second and the third switches 12 , 13 are not necessarily disposed in the positions to sandwich the disc member 9 . in the jog dial 8 a of fig8 the disc member 9 is supported on the base member 27 capable of rotating and moving to the pushing - in direction , namely , to an arrow a direction in the drawing , which is the same as the jog dial 8 of the embodiments described above . on the base member 27 is supported a first switch ( not shown ) which is operated by pushing the disc member 9 to an arrow a direction . the base member 27 is made longer in the pushing - in direction . at about the midpoint thereof , protruding supported pins 28 ( one of them is shown ) are provided . in the housing member , protruding supporting pieces 29 , 29 ′ are provided . in supporting holes 29 a , 29 a ′ of the protruding supporting pieces 29 , 29 ′, the supported pins 28 , 28 ′ of the base member 27 are supported allowing free pivoting movement . sandwiched between the front side direction edge of the base member 27 , namely , a position corresponding to the edge of the side where the disc member 9 is supported , and the backward edge ( the other side of the front side edge ) of the base member 27 , switches 30 , 31 are disposed at the positions respectively corresponding to the edge of the side where the disc member is supported and to the edge of the opposite side , sandwiching the supported pins 28 . the switches 30 , 31 are further supported by a flexible printed board 32 , and the switch 30 serves as the second switch and the switch 31 serves as the third switch . in the jog dial 8 a , in addition to the rotating operation of the disc member 9 to two directions and the pushing - in operation of the disc member 9 , the push - down operation of the disc member 9 , namely , the operation to ove the disc member 9 to the arrow c direction in the drawing is made to pivot the base member 27 to push the second switch with the front side edge of the base member 27 . also , the push - up operation of the disc member 9 , namely , the operation to move the disc member 9 to the arrow b direction in the drawing is made to pivot the base member 27 to push the third switch 31 with the backward edge of the base member 27 . accordingly , also with the switch apparatus of this example , a variety of instruction operations may be performed by operating only the disc member 9 . any of the shapes and the configurations of each part illustrated in the described embodiments and the examples thereto shows only an embodying example in carrying out the present invention , and it is to be understood that the technical scope of the present invention shall not be interpreted in a limited sense by these examples . | 7 |
in the payment process via a credit card transaction , shown in fig1 the network operator is only involved as service provider for communication services . he / she is excluded from the actual flow of money of the transactions . his / her income is low in relation to the credit card turnover . the billing accounts offered by the network operator ( conventional billing or credit account ) are also excluded from an international utilization given these prerequisites . the problem for the provider is that he / she must conclude billing contracts with the popular financial institutes , which can demand relatively high fees in comparison with the turnover , in order to reach a large circle of customers . if the provider does not support a method of payment preferred by the customer , the business will probably not be transacted . [ 0025 ] fig2 then shows the flows of money in a case where a purchase contract for goods or services has been concluded . customer and provider are , in each case , at home in different networks . when a payment is carried out , the customer ( consumer ) has a contract with a first credit card institute ( c 21 ). the provider ( merchant ) also has a contract with a credit card institute ( 12 m ). in the best case , it is the same credit card institute ( cci ); otherwise , it is still necessary again to conclude contracts . if not , the transmission of money will not function . the present invention can be implemented , for example , by the “ payment @ vantage ” system of siemens . this is a real - time accounting system which administers accounts both for customers and for providers . this accounting system is thus operated by the payment service provider . [ 0027 ] fig3 shows , by way of an example , the case of the use of a credit card by a customer ( consumer ) for making a payment to a provider ( merchant ). the customer has a business relationship with another network provider ( pspc ) in the home network of the customer ( mhn ) than the provider ( pspm ), who has his / her own home network ( chn ). in this example , the customer has a contract with a credit card institute ( cci ), but the provider does not need to have a contract with this credit card institute . at this point , it should be mentioned that other forms of payment are also possible : prepaid by pps ( prepaid server ), or postpaid by abc ( administration and billing center ). these “ internal ” forms of payment of the consumer psp will present for him / her the most attractive way of paying because , in this case , the consumer psp does not have to pay for any commissions ( such as , for example , in the case of credit cards ). according to the present invention , the home network of the customer ( chn ) provides the following services : debiting the credit card of the customer on order by the “ foreign ” provider ; use of ( debit ) accounts instead of billing via credit cards ( prepaid accounts or telephone account ) is also useful . this additionally simplifies the scenario and , in addition , is much more attractive for the network operators , ( see above ). the flows of money belonging to the scenario shown in fig3 are found again in fig4 . it can be seen that there only needs to be one business relationship as a basis for the provider ( merchant ). as such , there is a single point of entry for the payments and transactions for the provider . this point of entry charges additional fees for performing an international payment . the payment service provider at the customer end ( pspc ) maintains business relationships with all financial institutes ( cci ) at which his / her customers ( consumers ) have contracts . in the case of credit payments , he / she acts as dealer who wishes to receive a payment from the customer ( 2 ), with respect to the credit card institute ; i . e ., the credit card institute cannot recognize the actual provider ( merchant ). on the invoice paid by the customer ( 1 ), the network operator appears as dealer . information about the original dealer and the service received can be made visible , for example , in the transaction details so that the customer also obtains a detailed overview of his / her transactions . the clearing between the payment service provider of the customer ( pspc ) and provider ( pspm ) occurs directly between these two ( 3 ) and can take place by extending the pre - existing roaming agreement , and the existing technical means such as “ tap3 ” for gsm or other clearing formats ( e . g ., ciber ) can be used . the provider obtains his / her money ( 4 ) from his / her own payment service provider ( pspm ). he / she receives additional fees from the dealer for carrying out the transaction . although the present invention has been described with reference to specific embodiments , those of skill in the art will recognize that changes may be made thereto without departing from the spirit and scope of the present invention as set forth by the hereafter appended claims . | 6 |
an improvement is to change the gain of the watermark depending upon the dynamic attributes of the local area around the watermark . specifically , if the pixel represents a changing or moving area , the watermark is reduced in value , unless the movement is chaotic or noise - like , in which case the gain can remain large . more specifically , given the current value for one pixel , if that current value is similar to the values before and after the current frame ( for the same pixel ), the watermark gain , labeled time - gain , for that pixel should be near 1 . the time - gain should drop as the values of that pixel change in time , as long as the change is steady over time . the more the steady change , the smaller the time gain , where change can be measured as absolute difference or statistical variance . this should be repeated for each pixel or group of pixels in the frame . however , if the change in the pixel or group of pixels is chaotic or noise - like , the time gain can remain near 1 since noisy environments are a good place to hide watermarks . in addition , we may want to look only at the frame before and after or two or more frames in each time - direction . to this end , if the pixel represents a changing or moving area , the watermark is reduced in value . alternatively , one may want to determine the gain only from past values so that the system is causal and the embedder causes no delay . this can be accomplished by using the past values to calculate the gain directly or to estimate the future value and calculate the gain using this estimate . in one embodiment , the estimate ( s ) can be dependent upon the slope and change in slope of the current pixel value and previous values , and the resulting time - gain can be based upon the variance of the three existing values and estimated value ( s ). the predictive frames used in most video compression schemes , such as mpeg p and b frames , can be used to set the time gain . fig1 illustrates a diagram of a digital watermark embedder for video using time based perceptual masking to reduce visibility of the watermark . the inputs to the embedder include a video stream 100 and an auxiliary data message to be imperceptibly embedded into the video stream . conceptually , there are two components of the embedder : a message pre - processor for transforming the auxiliary data into an intermediate signal for embedding into the host video stream , and a human perceptibility system analyzer for computing a mask used to control the embedding of the intermediate signal into the host video stream . the message pre - processor transforms the message signal into an intermediate signal according to a protocol for the desired digital watermark application . this protocol specifies embedding parameters , like : the size of the message as well as number and meaning of data fields in the message ; the symbol alphabet used for the message elements , e . g ., binary , m - ary etc . the type of error correction coding applied to the message ; the type of error detection scheme applied to the message ; the type and nature of the carrier signal modulated with the message signal ; the sample resolution , block size , and transform domain of the host signal to which elements of the intermediate are mapped for embedding ; etc . the example shown in fig1 pre - processes as follows ( 104 ). first , it applies error correction coding to the message , such as turbo , bch , convolutional , and / or reed solomon coding . next it adds error detection bits , such as parity bits and / or cyclic redundancy check ( crc ) bits . the message 102 includes fixed bits ( e . g ., a known pattern of bits to verify the message and synchronize the reader ) and variable bits to carry variable data , such as frame number , transaction id , time stamp , owner id , content id , distributor id , copy control instructions , adult rating , etc . the embedder modulates the message with a carrier signal , such as a pseudo random sequence , features of the host video signal 100 , or both . the embedder also maps elements of the intermediate signal to samples in the host video signal ( e . g ., particular samples in the spatial or frequency domain of the video signal ). the mapping function preferably replicates instances of the message throughout the video signal , yet scrambles the message instances such that they are more difficult to visually perceive and detect through analysis of the video stream . for more about message processing for digital watermark embedding , see u . s . pat . nos . 6 , 122 , 403 and 6 , 614 , 914 . the human perceptibility analyzer calculates an “ intraframe ” perceptual mask ( 106 ) based on spatial visual attributes within a frame . this mask provides a vector of gain values corresponding to locations within the frame and indicating the data hiding capacity of the image at these locations in the frame . these gain values are a function of signal activity ( e . g ., a measure of local variance , entropy , contrast ), luminance , and edge content ( as measured by an edge detector or high pass filter ) at locations within the frame . locations with higher signal activity and more dense edge content have greater data hiding capacity , and therefore , the signal energy with which the intermediate signal is embedded can be increased . similarly , the changes made to the host signal due to the embedding of the watermark can be increased in these areas . further examples of such perceptual masking are provided in u . s . pat . nos . 6 , 122 , 403 and 6 , 614 , 914 . the human perceptibility analyzer also calculates a time based perceptual mask ( 108 ) as introduced above . the time based perceptual analyzer determines how pixels in a local area change over time ( e . g ., from frame to frame ), and adjust the gain of the perceptual mask accordingly . if the pixels in the local area change less then a predetermined threshold , then the gain in the perceptual mask is relatively unchanged . if the pixels in the local area change in a smoothly varying manner over time , then the gain in the perceptual mask is reduced to reduce the visibility of the digital watermark . finally , if the pixels in the local area change in a highly varying manner , e . g ., in a chaotic or substantially random manner , then the gain in the perceptual mask is increased to reflect the increased data hiding capacity of that location in the video stream . as noted previously , there are a variety of ways to measure the time varying changes of pixels at a location . one way is to use a statistical measure such as the mean , variance or standard deviation , and change in variance or standard deviation of pixel values ( e . g ., luminance ) over time at a location . for example , a variance near 0 , i . e . below a pre - determined threshold , identifies a stationary area - results in a time - gain near or greater than 1 . a variance greater than the threshold with minimal change in variance identifies a smoothly varying location , resulting in a time - gain below 1 . a variance greater than the threshold but with a large change in variance identifies a noisy area , resulting in a time - gain near or greater than 1 . another measure is the absolute change of a pixel value at a location , along with the time - derivative or rate of change of the absolute change in pixel value . a related measure is to determine how a pixel is changing by measuring absolute value and / or changes in motion vectors for that location ( e . g ., pixel or block of pixels ). calculating motion vectors is well known in the state of the art of video compression . for compressed video streams , this motion vector data is part of the data stream , and be used to determine the gain for embedding the intermediate signal in spatial domain samples or frequency domain coefficients ( e . g ., dct or wavelet coefficients ). for example , a non - near zero ( i . e . above the pre - determined threshold ) smoothly varying motion vector identifies a smoothly changing location and results in a reduced time - gain value . a near zero motion vector or chaotically changing motion vector identifies a stationary or noisy location , respectively , and both result in a time - gain value near or above 1 . alternatively , the system may use color values or combinations of colors that are more accurate than luminance to predict perceptibility of the watermark . for example , psycho - visual research may determine that watermarks are more visible in red during motion , and the system can be adapted to accommodate this finding . the optimal value of the time - gain will be determined via human perception experiments with actual video . after computing the perceptual mask in blocks 106 and 108 , the embedder uses the mask to control embedding of the intermediate signal into the host video stream . in one implementation , for example , the gain is applied as a scale factor to the intermediate signal , which in turn , is added to corresponding samples of the video signal ( e . g ., either spatial or frequency domain samples ). the result is a video stream with a hidden digital watermark 112 . a further innovation is to apply a time varying dither signal to control the strength of the digital watermark signal at locations corresponding to pixels or groups of pixels ( e . g ., 8 by 8 block of dct coefficients , group of wavelet subband coefficients , etc .) in the host video stream . this dither signal is preferably random , such as a pseudo random signal generated by a pseudorandom number generator ( a cryptographic hash ). it may be implemented by applying it to the intra frame gain or to the time - varying gain of the digital watermark signal . the dither creates a perturbation of the gain value . for example , if the gain value is one , the dither creates a fractional perturbation around the value of one . in one implementation , the dither for a pixel or group of neighboring pixel locations in a video stream varies over time and relative to the dither for neighboring pixel or group locations . in effect , the dither creates another form of time varying gain . the dither signal improves the visual quality of the digitally watermarked video signal , particularly in areas where the watermark might otherwise cause artifacts due to the difference in time varying characteristics of the host video signal relative to the watermark signal . the dither signal may be used with or without the time varying gain calculations described in this document . further , the user should preferably be allowed to turn the dither on or off as well as vary the gain of the dither in the digital watermark embedding environment ( on a frame , video object , or video scene basis ). another method to provide invisible watermarks for video is object - based masking . the method is to segment objects and have the watermarks move with each object , referred to as object - based masking . the digital watermark for one or each video object is designed to be invisible spatially within the object , and since the watermark moves with the object , motion cannot make the watermark visible . the segmentation must be accurate to alleviate edge effects . the segmentation can be performed on the composite video or on each video stream before the final mixing . if all objects are embedded , the system should take care to make sure that the watermarks do not interfere with each other . in one such embodiment , the background is not watermarked . in another , the objects contain payloads that are all spatially synchronized with a low - level background calibration signal ( for example , subliminal graticules disclosed in u . s . pat . no . 6 , 122 , 403 ). this calibration signal is not perceptible and helps the system synchronize with each object &# 39 ; s bit carrying payload . after one or more objects are watermarked , the video is saved as composite , such as in mpeg - 2 , or in an object based method , such as mpeg - 4 formatted video . in other words , the composite video may be created before distribution or at the player . for mpeg - 2 , the embedding system can guarantee that payloads for each object do not interfere with each other . for mpeg - 4 , each object &# 39 ; s watermark payload can be read before rendering , or can be designed not to interfere with the composite video . having described and illustrated the principles of the technology with reference to specific implementations , it will be recognized that the technology can be implemented in many other , different , forms . to provide a comprehensive disclosure without unduly lengthening the specification , applicants incorporate by reference the patents and patent applications referenced above . the methods , processes , and systems described above may be implemented in hardware , software or a combination of hardware and software . for example , the embedding processes may be implemented in a programmable computer or a special purpose digital circuit . similarly , detecting processes may be implemented in software , firmware , hardware , or combinations of software , firmware and hardware . the methods and processes described above may be implemented in programs executed from a system &# 39 ; s memory ( a computer readable medium , such as an electronic , optical or magnetic storage device ). the particular combinations of elements and features in the above - detailed embodiments are exemplary only ; the interchanging and substitution of these teachings with other teachings in this and the incorporated - by - reference patents / applications are also contemplated . | 7 |
according to the invention , in the method for the treatment and / or prophylaxis of multiple sclerosis in mammals , in particular in humans , the erythropoietin is now applied intermittently . this means that , with the present invention , an interval treatment is proposed . it is thereby particularly advantageous if the treatment comprises a sequence of periods of time with application of epo ( application period ) and periods of time without application of epo ( application - free periods ). the individual periods of time thereby comprise several weeks . a sequence has emerged as particularly advantageous in which each application period lasts 12 to 48 weeks , advantageously 18 to 36 weeks , advantageously 24 to 28 weeks , whilst the application - free periods last 8 to 53 weeks , advantageously 16 to 28 weeks . within the application periods , the dosage can be varied , for example firstly a period of time with a weekly application and a subsequent period of time with a two - weekly application . the present invention serves in particular for the use of erythropoietin in a method of this type or the use of erythropoietin for the production of a drug with which the described method can be implemented . the dosage is thereby respectively in the values described in the claims , particularly advantageously in a dosage range of 5 , 000 iu to 100 , 000 iu ( international units ) per week or per administration . with the mentioned interval dosage schemes , the result surprisingly is a constant improvement in the clinical symptoms during treatment . the improved level is maintained astonishingly in the interval and the second cycle produces a further improvement . surprisingly , an improvement in the symptoms was shown not only in the case of chronic - progressive multiple sclerosis but also in the case of relapsing - remitting multiple sclerosis . in particular in the case of chronic - progressive multiple sclerosis , a deterioration in the symptoms would have been expected during the treatment - free interval . however stabilisation also occurred here . the interval treatment according to the invention is an innovative approach to the entire concept of neuroprotection which , in the case of epo with multiple sclerosis , exploits in addition the fact that the result with half - yearly erythropoietin treatment is a latent , desired lack of iron . since lack of iron can be advantageous in addition for the known neuroprotective epo effect in chronic inflammatory diseases such as multiple sclerosis , advantageously iron is substituted neither in the treatment nor in the treatment - free phase . the treatment - free phase serves therefore also for slow replenishment of the depleted iron stores , as a result of balanced nutrition . in particular in the case of use of epo with haematopoietic effect , the neuroprotective effect is consequently supplemented by the latent lack of iron produced by the epo treatment . the effect according to the invention is however also achieved already by using epo derivatives or variants without haematopoietic effect . the above explanation relates to the method but the invention is not only directed to the therapeutic method but also to the use of epo in a method of this type and also the use of epo for the production of a drug for use in a method of this type . in the following , a few examples of use according to the invention of erythropoietin - α ( commercial name erypo / eprex ) or erythropoietin - β ( commercial name neorecormon ) are given . fig1 shows the course of the maximum walking distance ( prototype of motor function measurement in multiple sclerosis ) in a female patient ( case example ) who had an epo interval treatment over a period of 58 weeks . as is evident from the figure , the patient had an introductory phase of in total five weeks in order to determine the baseline values of her walking distance . there followed a weekly administration of epo over 14 weeks . after the 15 th week till the 28 th week inclusive , she received epo every two weeks . from week 29 to 45 , a treatment phase was provided , i . e . the patient obtained no epo . from week 46 to 58 , she was again treated weekly with epo . the illustrated “ trend line ” shows a constant increase in the maximum walking distance over the total course of examination . this course should be expected in the reverse direction ( progressive deterioration in the walking distance ) with chronic - progressive ms . fig2 shows , with the same patient as in fig1 ( epo interval treatment ), an improvement in attention capacity over the various treatment phases without setbacks in performance being able to be observed in the therapy - free interval . fig3 demonstrates the course of the haematocrit value in the same patient as in fig1 over the entire examination period . the result in this case example is that no value falls outside of the normal range . in this patient , no blood - letting was necessary over the entire treatment duration . fig4 summarises the functional improvement in walking distance with four patients who were treated in the same manner as the patient represented in fig1 . over ten weeks of epo treatment , a significant improvement is already shown . fig5 shows a summary of the attention capacity ( visual scanning ) in the four patients shown in fig4 over a period of time of in total nine weeks . the improvement in cognitive performance is significant . fig6 likewise shows a significant improvement in fine motor - function in the group of four patients , who were represented in fig4 , over the first nine weeks of the weekly epo treatment . fig7 demonstrates , using the group of patients illustrated in fig4 , that , with very good clinical safety / tolerance also of the classic ( haematopoietic ) epo , the necessity for blood - letting with ms patients is restricted to a small number . four patients in total were thereby treated with erythropoietin α ( eprex ) or erythropoietin β ( neorecormon ). in summary , it can be established that it was proved that long - term treatment of this type with epo is well tolerated by the patients . it was shown in particular that the therapy regime applied improved the motor and cognitive as well as the neurophysiological performance . | 0 |
referring now in more detail and by reference characters to the drawings which illustrate practical embodiments of the present invention , fig1 illustrates a circuit arragement of circuit switching device c forming part of the present invention connected to a two lamp high power factor ballast 20 and a pair of fluorescent lamps designated as l - 1 and l - 2 , respectively . the ballast 20 receives electrical power from a source thereof , over a pair of conductors designated as &# 34 ; black &# 34 ; and &# 34 ; white &# 34 ;. the normal two - lamp , high power factor ballast will also have a pair of conductors designated as &# 34 ; red &# 34 ; for operating the first lamp l - 1 , and a second pair of conductors designated as &# 34 ; blue &# 34 ; for operating the second lamp l - 2 . it can also be observed that a single yellow lead extends from the ballast 20 to the circuit device c and then to the opposite terminals of the pair of lamps l - 1 and l - 2 . fig2 more fully illustrates the circuit device c of the present invention . in this respect , the dotted line designated by reference numeral 22 would represent the outer casing or housing for the circuit device . it should be understood that the circuit device would normally be mounted within a housing of any suitable construction , such as a metal housing , plastic housing or the like . moreover , the housing would contain the electical components forming part of the circuit switching device , as hereinafter described in more detail and which would normally be sealed or relatively permanently enclosed . the housing would be provided with leads extending therefrom for connection to a ballast or plurality of ballasts and to the lamps . referring again to fig2 it can be observed that the circuit device c of the present invention comprises a switching relay mechanism 24 comprised of a switch means 26 , such as a four - pole , double - throw switch assembly . the four pole , double throw switch assembly 26 normally includes individual switches s - 1 , s - 2 , s - 3 and s - 4 . each of these switches have a pair of contacts and each of the contacts are connected to a pair of leads which extend from the housing 22 . the switching relay mechanism 24 also includes a relay means 28 or &# 34 ; so - called &# 34 ; relay which is comprised of a first relay coil normally referred to as a &# 34 ; set &# 34 ; relay coil 30 and a second relay coil 32 , normally referred to as a &# 34 ; reset &# 34 ; relay coil . it can be observed that each of the relay coils are connected to a conductor 34 which is , in turn , connected to one of the terminals of the switch s - 4 forming part of the double - throw four - pull switch 26 . moreover , the relay coils 30 and 32 are connected in such manner that diodes 36 and 38 are respectively connected across the coils 30 and 32 , in the manner as illustrated in fig2 . connected between the pair of diodes 36 and 38 is a resistor - capacitor circuit arrangment 40 which comprises a capacitor 42 and a resistor 44 connected across the capacitor in parallel arrangement therewith . this resistor - capacitor arrangement 40 often referred to as an &# 34 ; r - c circuit &# 34 ;, is then connected to the ballast and connected to one of the switches s - 2 in the manner as illustrated in fig2 . the resistance - capacitive circuit arrangement 40 is designed with a resistance and capacitive value so as to provide a desired time delay . in this circuit arrangement 40 will provide a continued feedback voltage to the set relay coil 30 and the reset relay coil 32 . the resisitive - capacitive circuit arrangement 42 has a time delay sufficient so that the reed of any one of the switches s - 1 - s - 4 will reach the opposite pole before the coil is discharged . moreover , each of the switches are magnetically operable so that the reed will magnetically latch at the opposite pole . it has been found that only about 1 / 10th of a second energization of any of the coils is required to obtain the desired latching effect . more specifically , it can be observed that the four - pole double - throw switch assembly 26 has a first lead 46 , which in this embodiment is connected to the ballast over a conductor designated as &# 34 ; red &# 34 ;, and a second lead 48 , which in this embodiment is connected to the ballast over another conductor designated as &# 34 ; red &# 34 ;, and which are , in turn , connected at the reeds of the switches s - 1 and s - 2 , respectively . the assembly 26 includes a third lead 50 which may be connected to the lamp l - 1 over one of the conductors designated as &# 34 ; red &# 34 ; and a fourth lead 52 which may be connected to the lamp l - 2 over one of the conductors designated as &# 34 ; blue &# 34 ;. the switch reed for this switch s - 1 is connected directly to the ballast over one of the &# 34 ; red &# 34 ; conductors 48 from the circuit device c to the ballast 20 . the second switch element s - 2 has a lead 54 which , in this case , may be connected to the lamp l - 1 over one of the conductors designated as &# 34 ; red &# 34 ; and another lead 56 connected to the lamp l - 2 over one of the conductors designated as &# 34 ; blue &# 34 ;. in this embodiment the switch s - 3 has a pair of leads 58 and 60 , but which remain unconnected in the circuit . the reed of this switch s - 3 also remains unconnected in this particular circuit arranement . finally , the switch s - 4 has a first lead 62 and a second lead 64 and which also extends internally within the housing 22 . the leads 62 and 64 are connected to the set relay coil and reset relay coil 32 in the manner as illustrated . the switch reed of the switch element s - 4 is connected to the ballast over one of the conductors designated as &# 34 ; red &# 34 ; and includes a diode 66 in the line connecting the switch reed to the ballast conductor , also in the manner as illustrated in fig2 . by analyzing the circuit of fig2 it can be observed that the lamp l - 1 remains energized when the four pole double throw switch assembly 26 is in the position as illustrated in fig2 . however , it can also be observed that when power is discontinued and reapplied , the coils 30 and 32 will be initially energized to cause the switches s - 1 , s - 2 , s - 3 and s - 4 to shift to the opposite position . in this case , by analyzing the circuitry , it can be observed that the lamp l - 2 will be energized . each time that the power from the ballast is interrupted , the four - pole , double throw switch assembly 26 will immediately switch to its opposite condition and thereby cause energization of the opposite of the lamps . in my u . s . pat . no . 4 , 348 , 614 , dated sept . 7 , 1982 , it was taught that a capacitor of sufficient value could be utilized as a substitute for one of the lamps in a plural lamp fixture . thus , if one of the lamps in a two lamp fixture were removed , the remaining lamp would not operate properly or efficiently . however , that problem was overcome by the use of a capacitive element inserted in place of the removed lamp . it has also been found in accordance with the present invention that it is possible to literaly short circuit the contacts from which a lamp is removed or de - energized . by carefully examining the circuit of fig2 it can be observed that a blue conductor from the ballast may be connected to the yellow conductor which was to be connected to the lamp which has been removed . in effect , this provides a short which takes the place of the actual capacitor and enables the remaining lamp or lamps to operate with at least the same degree of efficiency as if the any one or more lamps had not been removed . the circuit device c of the present invention , as illustrated in fig2 also has additional components which are not connected in the circuit arrangement for this particular type of two - lamp , high power factor ballast . these additional circuit components are hereinafter described in more detail in connection with the ballasts with which they would be used . fig3 illustrates a circuit arrangement of the circuit switching device c of the present invention connected to the pair of lamps l - 1 and l - 2 and to a single lamp , normal power factor ballast 70 . however , the single lamp normal power factor ballast 70 , in this case , is shown as being connected in circuit with a pair of fluorsecent lamps , such as the lamps l - 1 and l - 2 . with reference to fig3 it can be observed that only a single pair of conductors connect the circuit device c to the ballast 70 . the remaining portions of the circuit arrangement are similar to those illustrated in fig1 . however , one of the high power ballast conductors from the source of electrical power is connected directly to one of the terminals on each of the lamps l - 1 and l - 2 in the manner as illustrated . moreover , the lamps do not have one of the terminals connected to the circuit device c , but rather , they are directly to the ballast 70 in this particular circuit arrangement . referring now to fig4 it can be observed that only the leads 46 and 48 are connected to the ballast and the leads 50 , 52 , 54 and 56 are connected to the lamps l - 1 and l - 2 . by analyizing the circuit of fig4 it can be observed that this circuit device will operate in a manner similar to the circuit device of fig1 and 2 with the single lamp , normal power factor ballast operating the lamps alternately . fig5 illustrates a circuit arrangement with a single lamp , high power factor ballast 74 but which is also connected to a pair of lamps l - 1 and l - 2 . it can be observed that a circuit arrangement for connecting the circuit device c in a circuit relationship with respect to the lamps l - 1 and l - 2 and the high power ballast 74 is quite similar to that circuit arrangement employed in connection with fig3 . fig6 illustrates , in more detail , the connection of the circuit device c to the various conductors in the arrangement of fig5 . the leads 46 , 48 , 50 , 52 , 54 , and 56 are essentially connected in the same manner as in the circuit arrangement of fig2 . by examining the circuitry of figure 6 , it can be observed that when the four - pole , double - throw switch assembly 26 is in the position as illustrated , the lamp l - 1 will be energized and when the switch is in the opposite position , the lamp l - 2 will be energized . fig7 illustrates the circuit arrangement where a two lamp ballast 76 is provided for operating the initial lamps l - 1 and l - 2 at one time as well as two additional lamps l - 3 and l - 4 alternately when power is cut - off and reapplied . thus , the two lamp ballast 76 in the arrangement as illustrated in fig7 will energize and maintain the operation of four lamps , as illustrated . fig8 more fully illustrates in detail the circuit connections of the lamp switching device c to the various lamps and the ballast 76 in the circuit arrangement of fig7 . in this configuration , the circuit switching device c also utilizes the additional components forming a part thereof and which was mentioned with respect to the circuit configuration of fig2 . the switching circuit device c comprises a pair of additional switches s - 5 and s - 6 as illustrated in fig8 and which may constitute a double - pole , double throw switch assembly 80 . the switches s - 5 and s - 6 are respectively operated by means of a set relay coil 82 and reset relay coil 84 , in the manner as illustrated . the set relay coil 82 is connected to the lead 64 and hence , to one terminal of the switch s - 4 . the reset relay coil 84 is connected to the lead 62 , and hence , to the other terminal of the switch s - 4 . moreover , diodes 86 and 88 are respectively connected in parallel across each of the coils 82 and 84 . a resistor - capacitor circuit 90 is similarly connected to the coils 82 and 84 in the manner as illustrated in fig8 and comprises a capacitor 92 with a resistor 94 connected in parallel therewith . it can also be observed that the resistor - capicator circuit 90 is also connected to the common connection of the coils 30 and 32 and to the ballast . the circuit switching device c of the present invention is also provided with additional leads , such as a lead 96 , adapted for connection to a ballast over a conductor designated as &# 34 ; blue &# 34 ;, and additional leads 98 and 100 which are connected to the terminals of the switch s - 5 . a further pair of leads 102 and 104 and connected to the terminals of the switch s - 6 , and an additional lead 106 in also connected to the reed of the switch s - 6 and again adapted for connection to a ballast . in a circuit configuration using a two lamp ballast 76 and the four individual lamps l - 1 through l - 4 in the arrangement as shown in fig7 the additional components forming the circuit switching device c are also connected in the manner as illustrated in fig8 . thus , and for this type of arrangement , essentially all of the leads to the switches s - 5 and s - 6 are connected to the ballast and to the lamps . the leads to the switches s - 1 through s - 4 remain unconnected . it can be observed , by examining the circuit configuration of fig7 and 8 , that when the switches s - 1 , s - 2 , s - 3 , s - 4 , s - 5 and s - 6 are in the position as illustrated in fig8 lamps l - 1 and l - 2 will be energized . however , after power is discontinued and reapplied to the ballast 76 , the switches s - 1 , s - 2 , s - 3 , s - 4 , s - 5 and s - 6 will all switch to the opposite postions and then the lamps l - 3 and l - 4 will be energized when power is reapplied . the circuit switching device c of the present invention is highly effective in an arrangement of one ballast operating four lamps , in the manner as illustrated . in recent years , reflectors have been used in lamp fixtures which employ , for example , four individual lamps and which may be operated from a single ballast in the manner as shown in fig7 . reflectors are located in the fixture and two of the lamps are removed . if the two outermost lamps are removed , or otherwise , the two innermost lamps are removed , then there is a noticeable elimination of the lamps from the fixture , even with a defuser located over the remaining lamps . while the light output with the reflectors is actually greater than that which would normally be obtained from a pair of lamps without the reflectors , the noticeable effect of the eliminated lamps is still disconcerting . it would be desirable to disconnect one of the inner lamps and one of the outer lamps which are not adjacent to each other . however , and in many cases , this requires the removal of the entire fixture for purposes of re - wiring the fixture . the circuit device of the present invention eliminates this problem inasmuch as the lamps can be wired to the circuit device in the desired fashion so as to energize any two of the four lamps as may be required . for example , it if is desired to energize lamps one and three with lamps two and four de - energized , this can be easily accomplished by properly wiring the lamps and the ballast through the circuit device of the present invention . fig9 illustrates a circuit arrangement using the circuit switching device of the present invention connected to a pair of two lamp high power factor ballasts 110 and 112 with each operating a pair of lamps . thus , the two lamp high power factor ballast 110 operates lamps designated as l - 1 and l - 2 and the two lamp high power factor ballast 112 operates lamps l - 3 and l - 4 . accordingly , each of the ballasts 110 and 112 normally operate an individual pair of lamps much in the same manner as if the two ballasts and associated pair of lamps were separate and apart from one another . fig1 illustrates in more detail the connection of the various components of the circuit switching device c connected to the ballasts 110 and 112 and the lamps as shown . the power line designated as &# 34 ; white &# 34 ; is connected directly to the resistive - capacitive circuit 90 and the power line designated as &# 34 ; black &# 34 ; is connected directly to the reed of the switch s - 6 . in the circuit arrangements of fig9 and 10 , the four pole double throw switch assembly 26 is not connected to any of the lamps or to the ballast . it can be observed that the ballasts are connected directly to the lamps in a manner in which a pair of two high power factor ballasts would be connected to two individual pairs of lamps . in this case , it is necessary only to switch between the two ballasts 110 and 112 . fig1 illustrates the use of the circuit switching device c of the present invention in connection with a pair of two lamp instant start ballasts 110 and 112 . in this case , it can be observed that the black electrical conductor from the source of electrical power is connected directly through the circuit switching device of the present invention to one of the pair terminals of each of two of the instant start lamps in the manner as illustrated . in like manner , the white electrical conductor from the source of electrical power is connected through the circuit switching device of the present invention to the opposite terminal of the paired terminals on the same two instant start lamps . by simple examination of fig1 , it can be easily observed that the wiring connection through the circuit switching device c could be achieved to easily obtain the operation of four lamps with the two instant start ballasts of fig1 . fig1 illustrates a circuit arrangement in which a circuit device c in accordance with the present invention is used with a two lamp instant start ballast 120 . in this case , it can be observed that the electrical conductors from the power source , designated as &# 34 ; black &# 34 ; and &# 34 ; white &# 34 ; are connected through the circuit switching device c to lamps l - 1 and l - 2 in the manner as illustrated . moreover , the ballast 120 is connected to the circuit device c as shown . in this embodiment of the invention , the circuit switching device c may actually employ mechanically actuable switches , such as the switch 122 the switch 124 and the switch 126 . the circuit switching device c of this embodiment of the invention , illustrated in fig1 , comprises a bi - stable flip - flop 128 which controls a pair of relay coils 130 and 132 , in the manner as illustrated . thus , when the bi - stable flip - flop 128 is energized in one application of the power to the lamps , it will permit the switches 122 , 124 and 126 to remain in one position , as for example , the position as shown in fig1 . however , when power is interrupted and next applied to the circuit device c , the bi - stable flip - flop 128 will switch position and cause the relay coils 130 and 132 to move the switches 122 and 124 and 126 to the opposite positions . by tracing the circuitry in fig1 , it can be observed that the opposite of the lamps namely , the lamp l - 2 will be energized , whereas in the previous condition , the lamp l - 1 was energized . the circuit device of fig1 utilizes a bi - stable flip - flop as well as mechanically actuable switches . the circuit devices as shown in fig1 - 10 actually utilize solid state switching and solid state switch components . nevertheless , the switches as shown in the circuit switching device c utilized in fig1 - 10 , and in the other embodiments hereinafter described , actually were shown in a mechanically actuable switch form in order to facilitate the understanding in accordance with the present invention and to illustrate current flow through the various conductors . the circuit arrangement of fig1 also shows the circuit switching device c employing a 24 hour cycler 134 . in this case , the 24 hour cycler is normally used to automatically change the state of the bi - stable flip - flop 128 every 24 hours . it should be understood that any time period could be employed , for this purpose . in this embodiment , the cycler 134 which operates as a type of switch , will automatically change the state of the flip - flop 132 to thereby change the position of the switches 122 , 124 and 126 . in this way , the switching of the switches 122 , 124 , and 126 will cause the opposite of the lamps l - 1 or l - 2 to be energized when current is next applied . it should be understood that the 24 hour cycler 134 could be replaced by a random cycler such that it will randomly cause the bistable flip - flop 128 to change positions on a random basis . thus , such a random cycler will cause the circuit switching device c to randomly energize one of the lamps l - 1 or l - 2 any time that power is applied . in this way , each of the lamps will be energized on an average of about 50 percent of the time . fig1 and 14 illustrate an alternate arrangement of a two lamp high power factor ballast , such as the ballast 20 , operating a pair of lamps l - 1 and l - 2 . however , in this arrangement , the circuit switching device c of the present invention operates so as to cause the energization of one lamp and thereafter cause the simultaneous energization of both of the lamps l - 1 and l - 2 in an alternate arrangement , each time that power is re - applied to the high power factor ballast 20 . in other words , only the lamp l - 1 will operate as power is applied to the ballast and when power is discontinued and re - applied , both lamps l - 1 and l - 2 will operate . fig1 more fully illustrates in more detail the circuit arrangement using the circuit switching device c of the present invention in this circuit arrangement of fig1 . thus , fig1 illustrates in more detail the connection of the circuit switching device c to the pair of lamps l - 1 and l - 2 and the ballast 20 . by examining this fig1 , it can be observed that only one of the lamps , namely the lamp l - 1 is energized when the switches s - 1 through s - 4 are in the position as illustrated in fig1 . however , when power to the ballast is interrupted and re - applied , it can be observed that the reset relay coil 32 will be energized and will cause the reeds of the switches to shift to the opposite position . in this arrangement , it can be observed that each of the lamps l - 1 and l - 2 will be energized . the circuit switching arrangement utilized in fig1 and 14 is highly effective where it is desired to obtain two levels of light in a particular room or other environment . it may be desirable to energize both lamps l - 1 and l - 2 in a normal work environment but to energize only one of the lights , such as the lamp l - 1 , when it is only desirable to obtain a background light . as an example , in the case where one or more computer monitors are being used , a bright overhead light source would tend to create glare on the computer screen . thus , the reduced light would enable effective use of the computer monitor . the user of the environment or other room can merely obtain the desired amount of light by turning the switch which controls the light source off and on . by virtue of using the resistive capacitive network in the circuit switching device , there is no inefficiency of operation in the one lamp or bank of lamps which remain energized when the other lamp or bank of lamps are de - energized . in essence , the resistive - capacitor network eliminates a high degree of inefficiency would otherwise result in the energization of only one lamp as opposed to a pair of lamps connected to a ballast . the circuit switching device c of the present invention is highly unique in that it is capable of being used with several conventional lamp operating voltage circuits as for example , a 120 volt circuit to about a 600 volt circuit and with lamps of most commercially available wattage ranges . thus , the circuit switching device of the present invention is highly useful and versatile . in addition to the foregoing , it can also be observed that the circuit switching device c of the present invention is capable of being used with both rapid start lamps and instant start lamps and the associated ballasts which would be used for powering both such lamps . the circuit switching device of the present invention may also be incorporated in a small compact housing which is constructed so that it will have eyelets for screws or similar mechanical fasteners , in order to be secured to a fluorescent lamp fixture . moreover , the circuit switching device c will be manufactured primarily on a circuit board with standardized circuit components and standard circuit boards may be employed . in this way , it will be possible to produce this device at a relatively low cost . in addition , the circuit switching device c may be manufactured in the form of a cubical construction to allow for compact packaging within a container housing . it is only necessary that leads extend from the circuit outwardly from the container housing for connection to the various components of the lamp circuit in the manner as previously described . fig1 illustrates an embodiment of a circuit switching device fully incorporated in a ballast 140 and which is designed to operate a pair of lamps l - 1 and l - 2 in the manner as illustrated . the ballast 140 includes a primary coil 142 connected to a source of power over conductors 144 and 146 . a pair of secondary coils 148 and 150 are operable by the primary coil 142 , much in the same manner that a conventional ballast is constructed . for this purpose , one or more capacitors would be included within the transformer section of the ballast 140 . this ballast 140 also includes a circuit switching device c as illustrated in fig1 . this switching device c is similar to the previously described circuit switching device and is operated in a similar manner . moreover , and for purposes of operating a pair of lamps in the manner as illustrated in fig1 , the circuit switching device c would be connected somewhat in a manner similar to that arrangement used in fig2 . it should be understood that the ballast and circuit switching device incorporated , as shown in fig5 therein would be packaged in a suitable housing in a manner similar to that of a conventional ballast . in this embodiment , the ballast is designed as a two lamp ballast . however , with proper wiring , this ballast could become a direct replacement for an instant start ballast , a rapid start ballast and could also be wired to operate as a high power factor ballast or a normal power factor ballast . thus , there has been illustrated and described a unique and novel circuit switching device and method which enables alternate operation of one or more lamps in a series of lamps to thereby reduce lumen output and correspondingly reduce power consumption . thus , the present invention fulfills all of the objects and advantages which have been sought . it should be understood that many changes , modifications , variations and other uses and applications will become apparent to those skilled in the art after considering this specification and the accompanying drawings . therefore , any and all such changes , modifications , and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention which is limited only by the following claims . | 8 |
before describing the features of the present invention , it is appropriate to briefly describe the construction of one type of known cochlear implant system with reference to fig1 . known cochlear implants typically consist of two main components , an external component including a speech processor 9 , and an internal component including an implanted receiver and stimulator unit 2 . the external component includes a microphone 7 . the speech processor 9 is , in this illustration , constructed and arranged so that it can fit behind the outer ear 1 . alternative versions may be worn on the body . attached to the speech processor 9 is a transmitter coil 4 which transmits electrical signals to the implanted unit 2 via a radio frequency ( rf ) link . the implanted component includes a receiver coil 3 for receiving power and data from the transmitter coil 4 . a cable 41 extends from the implanted receiver and stimulator unit 2 to the cochlea 30 and terminates in an electrode array 20 . the signals thus received are applied by the array 20 to the basilar membrane 8 and the nerve cells within the cochlea 30 thereby stimulating an auditory nerve 5 . the operation of such a device is described , for example , in u . s . pat . no . 4 , 532 , 930 . one embodiment of a cochlear implant electrode assembly according to the present invention is depicted generally as 10 in fig2 and 3 . the depicted electrode assembly 10 has an electrical lead extending back to a stimulator / receiver housing , such as the stimulator unit 2 depicted in fig1 . in considering this invention , it is to be understood that each electrode 12 may have one or more wires ( not depicted ) electrically connected thereto and extending from each respective electrode 19 back through the lead to the stimulator / receiver . the assembly 10 comprises an elongate electrode carrier member 11 having a plurality of electrodes 12 mounted thereon . for the purposes of clarity , the electrodes 12 depicted in fig1 are not necessarily shown to scale . a larger number of electrodes than that depicted in fig2 can also be envisaged . the electrodes 12 are not depicted in fig3 for reasons of clarity . the depicted elongate member 11 is preformed from a resiliently flexible silicone with memory and is preformed to a curved configuration suitable for insertion in the scala tympani 31 of a human cochlea 30 . while an assembly that normally adopts a curved configuration when in a relaxed condition is depicted in the drawings , it will be appreciated that the present invention also could be utilised with respect to assemblies that are normally straight when in a relaxed condition . the elongate member 11 has a first end 13 that is firstly inserted into the cochlea 30 upon insertion of the assembly 10 . as depicted in fig2 , there is disposed within a lumen 14 , prior to insertion of the assembly 10 into the cochlea 30 , a substantially straight platinum stylet 15 . in the depicted embodiment , the stylet 15 has a stiffness that is sufficient to retain the silicone elongate member 11 in a straight configuration . the stylet could be constructed so as to have a stiffness that was insufficient alone to retain the elongate member 11 in a straight configuration . in this case , the elongate member could have a stiffening sheath 18 that at lest partially envelops the elongate member 11 . the stiffening sheath 18 could be formed of a bioresorbable material which prior to implantation assists the platinum stylet in maintaining the elongate member 11 in the straight configuration . while a platinum stylet is depicted , a bioresorbable stylet - like member formed from a bioresorbable material , such as polyacrylic acid ( paa ), that is also impregnated with a bio - active substance and which is adapted to dissolve or soften on exposure to cochlear fluids , could be utilised with appropriate modification to the elongate carrier member 11 . a stiffening polymer stylet could also be utilised which could be impregnated with a bio - active substance . such a stylet would soften quickly , but not dissolve quickly , with its very slow dissolution rate allowing the drug to effectively elute to the body . equally , whilst a substantially cylindrical lumen is depicted , the lumen 14 could indeed be any shape necessary to perform the function . again , the paa stylet - like member in this invention can have a stiffness that is either sufficient or insufficient to retain the silicone elongate member 11 in a straight configuration as depicted in fig2 . it will be appreciated that a bioresorbable stylet - like member could be formed from other suitable bioresorbable materials . a stylet - like member made from a shape memory or heat sensitive material could also be utilised instead of stylet 15 . in the depicted embodiment , the elongate member 11 is adapted to also act as a system for delivery of one or more pharmaceutical or bioactive substances to the cochlea 30 . in the depicted embodiment , this system is provided by an additional lumen 21 that acts as a reservoir for a fluid 23 constituting or including the one or more pharmaceutical or bioactive substances . the lumen 21 is pre - filled with the pharmaceutical or bioactive substances during manufacture and then sealed by the plug closure 22 . provided at the first end 13 of the member 11 is a fluid egress means comprising a valve 24 in the form of a slit formed in the structure of the elongate member 11 . other embodiments with more than one slit 24 can be envisaged . the slit 24 is adapted to allow fluid 23 within the lumen 21 to exit the lumen 21 but prevents fluid flow from external the member 11 back into the lumen 21 . to prevent flow of fluid through the slit 24 prior to implantation , the slit is covered with a layer 25 of bioresorbable paa . other suitable bioresorbable materials could be envisaged and the material could also be impregnated with the pharmaceutical substance . while only depicted as covering the slit 24 , the layer 25 could coat a greater portion or the entire surface of the elongate member 11 . on insertion of the elongate member 11 into the scala tympani 31 , the cochlear fluid commences to soften and dissolve the layer 25 of paa . in addition to lubricating the first end 13 , the dissolution of the layer 25 allows the fluid 23 to commence to flow from the lumen 21 into the scala tympani 31 . it is also possible that the pharmaceutical or bioactive substance 23 could be released from the lumen 21 by way of a mechanical means . such a means may include pushing the stylet 15 through the slit 24 at the end of the assembly 10 to break the seal just prior to insertion . as shown in fig6 a and 6b , another method of releasing the pharmaceutical substance would be to include a suture 26 down the lumen 21 and through the seal 25 . the suture 26 could then be pulled in an action similar to a “ rip - cord ” to open the end of the assembly 10 . in the embodiments shown in fig4 , lumen 21 is in fluid communication with an additional reservoir 45 for fluid 23 . additional reservoir 45 can be placed under the skin of the implantee and be tillable by a needle and syringe assembly when required . a pump 47 , such as an osmotic pump , can be used to transfer fluid from additional reservoir 45 to lumen 21 . while depicted with a lumen 21 , it can also be envisaged that the elongate member 11 could be impregnated with a pharmaceutical agent or other bioactive substance prior to implantation . the pharmaceutical agent or bioactive substance would then be free to leach from the elongate member 11 following insertion . in this embodiment , it can be envisaged that a layer of bioresorbable paa material may coat the entire impregnated portion of the elongate member 11 so ensuring that the pharmaceutical agent or bioactive substance does not leach from the elongate member 11 prior to implantation . while the elongate member 11 is manufactured with a preformed curved configuration , the depicted assembly 10 is typically delivered to a surgeon in a sterile package with the stylet 15 and pharmaceutical fluid 23 in place ( as depicted in fig2 ). on removal from the package and insertion into the scala tympani 31 of the cochlea 30 , the cochlear fluids commence to dissolve and soften the layer 25 . as the elongate member 11 is inserted into the scala tympani 31 of the cochlea 30 , the surgeon can commence to withdraw the stylet 15 from the lumen 14 through opening 17 . on withdrawal of the stylet 15 , the elongate member 11 is free to adopt the spiral configuration depicted in fig3 with the electrodes 12 facing the modiola within the cochlea 30 so that they are positioned as close as possible to the spiral ganglia thereof . the provision of a system for delivering a pharmaceutical substance that promotes healing and / or more efficient neural stimulation while preventing the formation of substantial scar tissue in the cochlea , enhances the likelihood of successful long - term placement of the assembly 10 in the cochlea and subsequent successful use of the cochlear implant by the implantee . while the preferred embodiment of the invention has been described in conjunction with a cochlear implant , it is to be understood that the present invention has wider application to other implantable electrodes , such as electrodes used with pacemakers . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive . all documents , patents , journal articles and other materials cited in the present application are hereby incorporated by reference . it is to be understood that the detailed description and specific examples , while indicating embodiments of the present invention , are given by way of illustration and not limitation . many changes and modifications within the scope of the present invention may be made without departing from the spirit thereof , and the invention includes all such modifications . | 0 |
the lightening conductor 10 illustrated in fig1 comprises a mast 12 to which is connected , via an insulating element 14 having a length of about 1 . 5m , a lightning rod 16 for capturing lightning , which rod is made of aluminum and has a length of about 2m . the lightning rod 16 , being insulated from the mast 12 which has a length of about 6m , has connected thereto an electrical conduit 18 which is vertically guided in parallel to mast 12 with the aid of mast spacers 20 . for this purpose , the electrical conduit 18 is guided through eyes 22 formed in the mast spacers 20 . in the lower region of mast 12 , conduit 18 is deflected by about 900 , thus extending substantially horizontally . in its horizontal part , conduit 18 is held at a distance to the underlying ground 26 by means of bottom spacers 24 . at a distance of about 10m from mast 12 , conduit 18 is connected to one or a plurality of deep grounding means 28 extending about three meters into the ground 26 . the mast spacers 20 attached to mast 12 can also be provided as cable ties which , by the effect of their own stiffness , keep the conduit 18 guided on mast 12 at a distance of about one meter from the mast . mast 12 is further fastened to a tripod 30 which , by use of anchor stakes 32 , is tightly fastened to the underlying ground 26 on a temporary basis . in case of a thunderstorm , lightning will tend to strike primarily into the lightning rod 16 of lightening conductor 10 so that the lightning current can be dissipated into the ground 26 via conduit 18 . as a result , the lightening conductor 10 generates a protection cone 36 starting from an upper tip 34 of the lightening conductor . within this cone , objects such as e . g . a tent 37 can be arranged for protection from lightening . mast 12 is arranged to be telescopically extended and retracted ( fig2 ) and comprises a first mast element 38 guided for movement in a second mast element 40 . for guidance of the first mast element 38 in the second mast element 40 , the first mast element 38 in an upper region thereof is passed through a guide ring 42 wherein the contact of a the guide ring 42 with the first mast element 38 is accomplished by a slide ring 44 preferably made of teflon . the guide ring 42 is tightly connected to the second mast element 40 , e . g . by clamping , and may be provided with a fastening element ( not shown ) for locking the first mast element 38 to the second mast element 40 . in the lower region , the first mast element 38 is guided in the second mast element 40 via a piston 46 , the contact of the piston 46 to the second mast element 40 being effected via further slide rings 44 . for pneumatic actuation of the telescopable mast 12 , air pressure is caused to press against piston 46 and / or a closure member of mast 12 in the upper region whereby the first mast element 38 is pressed or pulled out from the second mast element 40 in the direction schematically indicated by arrow 48 . to avoid escape of the pressurized air , piston 46 is provided , at the site of its contact to the first mast element 38 and at the site of its contact to the second mast element 40 , with a respective o - ring 50 and / or a sealing means of a comparable effect . in a further embodiment of a lightning protection system 52 illustrated in fig3 , four preferably identical lightening conductors 10 are provided , with their protection cones 36 forming a common lightning protection space 54 which is suited for arrangement of e . g . a plurality of tents 37 therein . the lightening conductors 10 each are provided with two electrical conduits 18 leading away from the tents 37 and the lightning protection space 54 at an angle α = about 90 ° c . relative to each other . this means that the conduits 18 arranged in the lightning protection space 54 are oriented to point away in outward directions from the lightning protection space 54 . depending on the lengths of the conduits 18 the deep grounding means 28 can be arranged inside or outside the lightning protection space 54 . | 7 |
in the following the invention is described in more detail by means of embodiments and figures . the invention uses the already existing information element request type of the location_report message for determining the recipient of a location information . the determination is executed in a control node . in the case that the request is a packet switched location request it is executed by a sgsn , in the case that it is a circuit switched request it is executed by a mobile services switching centre msc . fig3 depicts a flow chart of the invented method . in a first step , a control node sends a location_reporting_control message to a radio network controller . this message comprises an information element request type that identifies the type of request . the type of request is identified for example that the radio access network is requested to send location information in a location_report message at a change of service area by a user equipment or as a direct response on the location_reporting_control message . in a next step , the radio network controller receives the location_reporting —: - control message . it analyses it whether the value of the information element request type indicates to send a location_report message immediately , or not . if a location_report message is required immediately , the radio network controller determines the location of a user equipment and sends the location information together with the request type value received in the location_reporting_control message to the core network node . if the location_report message is required after a certain trigger event , in this example a change of service area by the user equipment , the radio network controller sets the respective trigger event and monitors , whether the user equipment changes the service area . if so , the radio network controller detects this trigger event , determines the location information of the user equipment and sends it together with the received request type value to the control node . the control node receives the location_report message including the request type . it checks whether the request type value indicated an immediate response . if so , the location information is intended for an external entity and the control node sends it to said external entity . if not , the information is used internal of the network . fig4 depicts another flow chart of an alternative of the invented method to the implementation as described by fig3 . in a first step , a control node sends a location_reporting_control message to a radio network controller . this message comprises an information element request type that identifies the type of request . the type of request is identified for example that the radio access network is requested to send location information in a location_report message at a change of service area by a user equipment or as a direct response on the location_reporting_control message . in a next step , the radio network controller receives the location_reporting_control message . it analyses it whether the value of the information element request type indicates to send a response , that is a location_report message , immediately , or not . if a location_report message is required immediately , the radio network controller determines the location of a user equipment and sends the location information together with the request type value received in the location_reporting_control message to the core network node . if the location_report message is required after a certain trigger event , in this example a change of service area by the user equipment , the radio network controller sets the respective trigger . the radio network controller monitors , whether the user equipment changes the service area . if so , the radio network controller detects this trigger , determines the location information of the user equipment and sends it to the control node . in this embodiment , the lack of the request type information element value in the location_report message , indicates that the message is to be used network internal . the control node receives the location_report message including the request type . it checks whether a request type value is returned . if so , the location information is intended for an external entity and the control node sends it to said external entity . if not , the information is used network internal , fig4 depicts an embodiment of the invention by means of a flow chart , wherein the determining is handled vice versa to the embodiment of fig3 . in the embodiment of fig3 , a request type value has been returned in the case that the location information is to be used network internal . in the embodiment of fig4 the request type value is returned , when the location information is to be forwarded to an external entity . request type values indicating that an immediate response is required are for example : “ request of current location ” or “ request of current or last known location ”. the invention further relates to software stored on a computer readable medium or in a form that can be loaded into a memory of a computing device . a computing device is for example a control node or a control node server that executes a stored program . | 7 |
this embodiment is an apparatus and process for processing mine tailings employing a slow cooling schedule , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . a sample of tailings from the idaho - maryland gold mine , having the general composition shown in table 1 , was air - dried to less than 3 % moisture and screened to remove material larger than 516 microns ( 30 mesh ). the raw tailings material was calcined in air at 900 degrees c . following calcining , the material , without additives , was mechanically compacted using a ram at a pressure of approximately 350 psi within a nitride - bonded - silicon - carbide process tube at a temperature of 1130 degrees c . for an extended period of time , approximately 60 hours at temperature . the material was then slowly cooled , at a rate of 1 to 3 degrees c . per minute , forming a synthetic rock hybrid material , which was then removed from the process tube . test specimens of the resulting synthetic rock hybrid material had an average modulus of rupture of about 85 mpa ( 12320 psi ), and an average water absorption of about 0 . 3 % as determined by method astm c373 . other resulting data are shown in table 2 . fig4 is the scanning electron microprobe back - scattered electron ( bse ) image of this synthetic rock hybrid material of idaho maryland mine tailings feedstock . fig4 illustrates the three characteristic phases typical of the unique microfabric of this synthetic rock material . these three phases include clasts ( partially dissolved remnant primary grains of the tailings feedstock ); a glass phase derived from the partial melting of primary mineral grains ; and a secondary crystalline phase comprised of similarly sized crystallites that occur in the glass phase . the latter secondary minerals crystallized from the melt prior to cooling and formation of the glass phase . fig4 shows a remnant primary quartz grain with rounded edges indicating dissolution of its formerly angular grain boundaries ( 31 ). the nearly complete melting of most other primary mineral constituents of the original feedstock components such as feldspar leaves little evidence of their existence in this synthetic rock other than mottled areas that retain the chemical signature of the parent mineralogy ( 32 ). the glass phase ( 33 ) with an aluminosilicate composition contains trace amounts of cations such as potassium , calcium , sodium , magnesium , and iron ( 33 ). eds microchemical analysis of the glass throughout the ceramic indicates that the glass composition is heterogeneous and varies with respect to the aluminum : silicon ratio as well as the trace cation content ( 34 ). the newly formed ( secondary ) crystallite comprises the crystalline phase of this synthetic rock . the longer processing time resulted in secondary crystallites comprising 40 - 50 % of the volume of this material . the crystallites appear in two recognizable morphologies each with distinct chemistries as determined by eds . some crystallites appear in narrow lath and skeletal shapes and occur singly and in clusters ( 35 ). crystallites of this morphology uniformly possess a chemistry most similar to the bronzite species of pyroxene having high magnesium but low calcium and iron contents ( 35 ). the size of the lath shaped crystallites ranges from 1 to 3 μm in width and from 5 to 25 μm in length . the other common morphology of crystallites is an equant blocky shape similarly occurring singly and in clusters ( 36 ). this latter crystallite morphology is associated with calcium to iron ratios similar to augite or pigeonite varieties of pyroxene having high calcium but low iron contents . the size of these blocky crystallites ranges from 4 to 15 μm . the continuous glass phase in this synthetic rock material leaves widely spaced isolated voids with little or no communication between them resulting in very low absorption values ( 37 ). this embodiment is a method of processing mine tailings employing a fast cooling schedule , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . a sample of tailings from the idaho - maryland gold mine , having the general composition shown in table 1 , was air - dried to less than 3 % moisture and screened to remove material larger than 516 microns ( 30 mesh ). the raw tailings material was calcined in air at 900 degrees c . following calcining , the material , without additives , was mechanically compacted using a ram at a pressure of approximately 300 psi within a nitride - bonded - silicon - carbide process tube at a temperature of 1140 degrees c ., with a residence time of approximately 6 hours at temperature . the material was then extruded through a rectangular die ( 15 . 2 by 1 . 3 cm ) with a land length of 3 . 5 cm , and subsequently cooled at a rate of about 10 to 20 degrees c . per minute , forming a synthetic rock hybrid material . test specimens of the resulting synthetic rock hybrid material had an average modulus of rupture of about 42 mpa ( 6060 psi ), and an average water absorption of about 3 . 2 % as determined by method astm c373 . other resulting data are shown in table 2 . fig5 shows the scanning electron microprobe back - scattered electron ( bse ) image of the resulting synthetic rock hybrid material . fig5 illustrates the three characteristic phases typical of the unique microfabric of this synthetic rock material . these three phases include clasts ( partially dissolved remnant primary grains of the tailings feedstock ); a glass phase derived from the partial melting of primary mineral grains ; and a secondary crystalline phase comprised of similarly sized crystallites enveloped in the glass phase . the latter secondary minerals crystallized from the melt during cooling , likely prior to the formation of the glass phase . fig5 shows a remnant primary quartz grain with rounded edges indicating dissolution of its formerly angular grain boundaries ( 41 ). the nearly complete melting of most other primary mineral constituents of the original feedstock components leaves little evidence of their existence in this synthetic rock . the glass phase ( 42 ) with an aluminosilicate composition contains trace amounts of cations such as potassium , calcium , sodium , magnesium , and iron ( 42 ). eds microchemical analysis of the glass throughout the ceramic indicates that the glass composition is heterogeneous and varies with respect to the aluminum : silicon ratio as well as the trace cation content ( 43 ). four newly formed secondary crystalline phases are apparent in this synthetic rock material including two distinct pyroxene types , anhydrite and ilmanite . pyroxene crystallites appear in two morphologies each with distinct chemistries as determined by eds . one pyroxene crystallite morphology is a narrow lath shape ( 44 ). the lath type pyroxenes uniformly possess a chemistry most similar to the bronzite species having high magnesium but low calcium and iron contents ( 44 ). the crystallite sizes range from 1 . 5 to 3 μm in width and from 5 to 50 μm in length . the faster processing time to produce this material ( relative to example 1 ) prevented complex cluster development of the crystallites . other pyroxene crystallites occur with an equant blocky shaped morphology ( 45 ). this latter type pyroxene occurs singly and in simple clusters . this latter pyroxene crystallite morphology is associated with calcium to iron ratios similar to augite or pigeonite varieties with high calcium but low iron contents . the blocky crystallites range from 1 to 5 μm . sulfur in this synthetic rock has combined with calcium to form crystallite clusters of anhydrite ( 46 ). individual crystallites within the clusters range from 2 to 7 μm in size . small similarly sized crystallites of ilmanite ( iron titanium oxide ) of 1 to 5 μm in size appear randomly arranged in the glassy matrix ( 47 ). the continuous glass phase in this synthetic rock material leaves few and widely spaced isolated voids ( 48 ) with little or no communication between them , resulting in very low absorption values . this embodiment is a method of processing metavolcanic mine development rock employing a fast cooling schedule , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . a composite of drill - core samples taken from metavolcanic ( andesite , dacite , diabase , and others ) rock from the idaho - maryland mine (“ development rock ”) was air - dried to less than 3 % moisture , and ground to a size fine enough to pass 100 % through a 516 - micron ( 30 - mesh ) screen . the development rock powder had a composition as shown in table 1 . the development rock powder , without additives , was processed through the apparatus described in u . s . pat . no . 6 , 547 , 550 ( guenther ) at a temperature of 1160 degrees c ., with a mechanical pressure oscillating between about 160 psi and 30 psi with a period of oscillation of 10 minutes , in a partial vacuum atmosphere ( about 170 mbar absolute pressure ), with a residence time of about 60 minutes before extruding the consolidated plug of synthetic rock hybrid material . following the extrusion , the plug was cooled at a rate of about 5 to 15 degrees c . per minute . test specimens of the resulting synthetic rock hybrid material had an average modulus of rupture of about 64 mpa ( 9280 psi ), and an average water absorption of about 0 . 8 % as determined by method astm c373 . other resulting data are shown in table 2 . fig6 is the scanning electron microprobe back - scattered electron ( bse ) image of the resulting synthetic rock material from composite idaho maryland development rock feedstock . fig6 illustrates the three characteristic phases typical of the unique microfabric of this synthetic rock material that collectively comprise an aggregate ( or breccia ) arrangement . these three phases include partially dissolved remnant primary grains of the original metavolcanic feedstock constituents ; a glass phase derived from the partial melting of primary mineral grains ; and secondary crystalline phases comprised of similarly sized crystallites enveloped in the glass phase . the latter secondary minerals crystallized from the melt during cooling , likely prior to the formation of the glass phase . fig6 shows numerous remnant grains of a variety of primary constituents forming a relatively coarse clasts fraction . these primary lithic grains include polymineralic metavolcanic rock fragments ( 51 ) and monomineralic mineral grains ( 52 ). specific minerals that occur either in monomineralic grains comprised of a single mineral or polymineralic rock fragments comprised of multiple minerals include plagioclase feldspar ( 53 ); pyroxene ( 54 ); and remnants of degraded chlorite ( 55 ). other primary minerals inherited from the feedstock constituents that also occur but not illustrated in fig6 include sphene , quartz and hematite . the partial melting of feldspar ( 53 ) occurring in the metavolcanic feedstock contributes to the formation of a melt phase that created a glass matrix upon cooling ( 56 ). the rounded feldspar grain margins indicate dissolution or melting of its formerly angular grain boundaries . the glass phase ( 56 ) with an aluminosilicate composition contains trace amounts of cations such as potassium , calcium , sodium , magnesium , and iron . eds microchemical analysis of the glass throughout the ceramic indicates that the glass composition is heterogeneous and varies with respect to the aluminum : silicon ratio as well as the trace cation content ( 57 ). fig6 illustrates the formation of the dominant secondary crystalline phase that crystallized from the melt . clusters of pyroxene crystallites appear in various locations enveloped by the glass phase ( 58 ). the individual pyroxene crystallites within the clusters possess an equant blocky morphology with calcium to iron ratios similar to augite or pigeonite varieties . other secondary minerals that crystallized from the melt but not illustrated in fig6 include maghemite ( spinel group ) and ilmanite ( iron titanium oxide ). the continuous glass phase of this synthetic rock material envelops nearly the entire grain margin of the clasts resulting in widely spaced isolated voids ( 59 ). there is little or no communication between the isolated voids resulting in the very low absorption values determined for this synthetic rock hybrid material . the unique structural attribute of this synthetic rock material is the aggregate breccia microfabric created by the three important components that includes 1 ) the primary remnant clasts , 2 ) the glass phase , and 3 ) the secondary crystallite phase . this aggregate breccia structural arrangement of components ( or constituents ) creates a strong aggregate microfabric with superior strength and durability properties unique to this synthetic rock material . this embodiment is a method of processing coal fly ash employing a fast cooling schedule , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . coal fly ash material was obtained from a coal power plant , specifically valmy train 2 in winnemucca , nev . the composition of the raw material is shown in table 1 . the material was air - dried to less than 3 % moisture , and screened to pass 100 % through a 516 - micron ( 30 - mesh ) screen . following calcining , the calcined coal fly ash material , without additives , was mechanically compacted using a ram at a pressure of approximately 300 psi within a nitride - bonded - silicon - carbide process tube at a temperature of 1115 degrees c ., with a residence time of approximately 10 hours at temperature . the material was then extruded through a cylindrical die , and subsequently cooled at a rate of about 10 to 20 degrees c . per minute , forming a synthetic rock hybrid material . test , specimens of the resulting synthetic rock hybrid material had an average modulus of rupture of about 57 mpa ( 8230 psi ), and an average water absorption of about 0 . 7 % as determined by method astm c373 . other resulting data are shown in table 2 . fig7 is the scanning electron microprobe back - scattered electron ( bse ) image of the synthetic rock material fabricated from coal fly ash waste material feedstock . fig7 illustrates the three characteristic phases typical of the unique microfabric of this synthetic rock material that collectively comprise an aggregate structural arrangement . these three phases include clasts of partially dissolved remnant primary grains of the original fly - ash feedstock constituents ; a glass phase derived from the partial melting of primary mineral and fly - ash grains ; and secondary crystalline phases comprised of similarly sized crystallites enveloped in the glass phase . the latter secondary minerals crystallized from the melt during cooling , likely prior to the formation of the glass phase . fig7 shows remnant grains of primary constituents that remain in this synthetic rock including quartz ( 61 ) and fly - ash glass spherules ( 62 ). the partial melting of fly - ash glass spherules — the dominant feedstock constituent — created a melt phase that formed a continuous glass matrix upon cooling ( 63 ). the glass phase ( 63 ) with an aluminosilicate composition contains trace amounts of cations such as potassium , calcium , sodium , magnesium , and iron . eds microchemical analysis of the glass throughout the ceramic indicates that the glass composition is heterogeneous and varies with respect to the aluminum : silicon ratio as well as the trace cation content ( 64 ). fig7 illustrates the formation of up to four secondary crystalline phases that crystallized from the melt during the cooling process . these secondary crystalline phases include : clusters of wollastonite crystallites ( 65 ) some of which nucleated on remnant primary quartz grains ( 61 ); lath - shaped plagioclase feldspar ( 66 ) and pyroxene ( 67 ) crystallites randomly distributed in the glass phase ; and blocky anhydrite crystallites ( calcium sulfate ) not shown in fig7 . the anhydrite phase is a major component of this synthetic rock material and serves as a major receptacle for the sulfur that was a dominant constituent of the coal fly - ash waste material . individual wollastonite crystallites range in size from 1 to 6 μm . the lath shaped plagioclase and pyroxene crystallites range from 1 to 5 μm in width and 2 to 15 μm in length . the larger blocky anhydrite phenocrysts are a size that can be resolved with the polarized light microscope with typical sizes ranging from 10 to 70 μm . the continuous glass phase of this synthetic rock material envelops the entire grain margin of the primary and secondary mineral grains resulting in few if any isolated voids ( 68 ). the predominant void space in this synthetic rock was inherited and associated with the primary fly - ash spherules ( 69 ). there is little or no communication between any of the isolated voids resulting in the very low absorption values determined for this synthetic rock material . the unique structural attribute of this synthetic rock material is the aggregate breccia microfabric created by the three important components that includes 1 ) the primary remnant clasts , which in this example include mineral grains and mineraloid grains such as glassy fly - ash spherules , 2 ) the glass phase , and 3 ) the secondary crystallite phase . the cluster development of the large wollastonite crystallites the crystallized around primary quartz grains contributes to the coarse aggregate fraction ( 65 ). this aggregate breccia structural arrangement of components ( or constituents ) creates a strong aggregate microfabric with superior strength and durability properties unique to this synthetic rock material . this embodiment is a method of processing waste mineral materials such as mine tailings , ash , slag , slimes , and the like , which results in applicant &# 39 ; s composition and corresponding articles of manufacture . referring to fig8 , raw material for synthetic hybrid rock manufacture 100 , may be for example mine tailings , waste rock , quarry fines , slimes , fly ash , bottom ash , coal ash , incinerator ash , wood ash , slag , or blends of these materials with each other or with pure ceramic feed materials such as clay , feldspar , quartz , talc , and the like . silicate waste materials are particularly well - suited for use as raw material . raw material 100 is delivered to screening apparatus 120 , which has an outlet 121 for oversize particles 122 with a size larger than a predetermined screen opening size , and which further has an outlet 123 for undersize particles 124 with a size smaller than a predetermined screen opening size . oversize particles 122 may be recycled to screening apparatus 120 via a grinding process ( not shown ), or disposed of . undersize particles of raw material 124 are conveyed to a hopper 131 of rotary calciner 130 . feed auger 137 is driven , for example by motor 136 , and particulate raw material is thereby conveyed to a heated rotating barrel 132 . barrel 132 is heated by any of various means including but not limited to electric resistance heaters , gas burners , and exhaust or waste heat from other processes . drive 139 rotates barrel 132 , which may have a smooth interior surface , or alternatively may have a surface that is corrugated or otherwise roughened , for example with lifters , to provide a means for the material to be repeatedly lifted and dropped as it moves through the barrel . barrel 132 is inclined at a shallow angle from horizontal in order to slowly drive the powder toward the discharge assembly 133 . calciner 130 optionally has gas inlet 135 for the addition of air or other gases and vent 134 for the removal of combustion products or other gaseous decomposition products . calciner 130 is operated at temperatures below the point where the material begins to soften and sinter , but at elevated temperatures such that the material is preheated and dried . other useful chemical transformations can be carried out in the calciner , including but not limited to combustion of organic materials , conversion of hydrated minerals to dehydrated oxides , desulphurization , decomposition of carbonates , and the like . the process temperature for each of these operations varies , but is generally in the range of 100 to 1000 degrees celsius . calcined particulate material 139 exits at a temperature within this range , preferably about 800 to 1000 degrees celsius , and passes through valve 140 to hopper 150 . valve 140 can be closed to provide a vacuum - tight seal between hopper 150 and calciner 130 . preferably valve 140 is a high - temperature rotary valve that can continuously flow material through while maintaining a pressure differential . hopper 150 is preferably thermally insulated , or alternatively provide with a source of heat to maintain the temperature of particulate material . vacuum outlet 151 may be provided for connection to vacuum 152 . vacuum removes entrained and interstitial gas from particulate material and contributes to the production of void - free synthetic hybrid rock material from a subsequent extrusion step . vacuum can also reduce the oxidation of minerals and can increase the variety or level of crystallization in the resulting product . outlet 61 of hopper 150 is connected to feeder 160 at inlet flange 161 . feeder 160 may function as a reciprocating ram , or as an auger , or as both . auger 162 is rotated by shall 163 and drive 164 , thereby conveying particulate synthetic hybrid rock material forward into extruder barrel 180 . the entire auger / drive assembly may be moved axially , for example by means of hydraulic ram 165 moving axially in hydraulic cylinder 166 due to pressure created by pump or hydraulic power unit 167 . the axial motion of auger 162 also conveys particulate material into extruder barrel 180 . a typical operation cycle for using both auger and ram aspects of the invention together is as follows . under little , or none , or perhaps backward force from the hydraulic ram 165 , drive 164 rotates auger 162 , which conveys particulate material into extruder barrel 180 . when the available space in extruder barrel 180 is filled with newly conveyed particulate material , drive 164 is shut down and auger 162 stops rotating . ram 165 is then energized by power unit 167 to provide an axial force on auger 162 , which in turn pushes on material in extruder barrel 180 . material is conveyed axially down extruder barrel 180 in this manner for a predetermined distance . once said predetermined distance has been reached , the force applied by hydraulic ram is reduced , and the cycle may be repeated . extruder barrel 180 may be constructed from a material with excellent resistance to high temperatures , good thermal conductivity , acceptable strength , and excellent resistance to wetting by or reaction with materials to be processed in the extruder . preferably , extruder barrel 180 is constructed from silicon carbide ( sic ). most preferably , extruder barrel 180 is constructed from nitride - bonded silicon carbide ( sin — sic ), for example advancer ™ material available from st . gobain industrial ceramics . extruder barrel 180 is compressed between feeder 160 and spider 190 and supported within furnace 170 . furnace 170 provides heat , for example by electrical resistance heaters or by gas combustion , and is preferably a split - tube design for ease of maintenance , and also preferably has multiple zones of temperature control along its length . furnace 170 provides heat to increase the temperature of extruder barrel 180 high enough to fuse , sinter , partially melt , or otherwise accomplish the desired vitrification of the material within . within extruder barrel 180 , particulate material fed by feeder 160 is conveyed axially toward reducer die 181 and heated , thereby consolidating and vitrifying particulate material into at least partially molten synthetic hybrid rock material . reducer die 181 connected to the end of extruder barrel 180 provides a resistance to the flow of said at least partially molten synthetic hybrid rock material and thereby increases the necessary pressure applied by ram 165 to convey the material , providing a mechanism for consolidation of the material . optional land die 182 connected to the end of reducer die 181 may further increase the resistance to flow . in the absence of land die 182 , a spacer may be used , for example an additional short length of barrel similar to extruder barrel 180 . at the discharge end of the extruder , that is where the land die or spacer exits furnace 170 , an insulator ring 183 made of strong , thermally insulating material , preferably zirconia , is placed . insulator ring 183 minimizes heat conduction from the furnace to spider 190 , and is captured in a recessed opening within spider 190 . spider 190 is a stiff plate that allows passage of extruded synthetic hybrid rock product 130 through a hole in the center while providing mechanical compression to insulator ring 183 , land die 182 , reducer die 181 and extruder barrel 180 . spider 190 is supported by a plurality of stiff springs 191 , each reacting against a load cell 192 mounted on a fixed rigid support . extruded synthetic hybrid rock product 130 exits land die 182 , proceeds through insulator ring 183 and spider 190 , and is supported and conveyed by a plurality of rollers 201 within heated chambers 200 and 220 . the temperature in heated chambers 200 and 220 is maintained such that extruded synthetic hybrid rock material 230 remains deformable enough to be cut by cutters 210 attached to actuators 212 . after cutting , extruded synthetic hybrid rock material 230 may be removed from heated chamber 220 and cooled by various means to produce useful products . alternatively , extruded synthetic hybrid rock material 230 may be conveyed to subsequent operations such as pressing , forming , rolling , molding , or glazing at a high temperature , thereby efficiently using the heat in the material . | 1 |
the present invention is generally directed to a window assembly 100 , such as the window assembly 100 shown in fig1 and 1 a . the window assembly 100 is preferably comprised of a window frame 102 , and a window sash assembly 104 that has pivot pins 500 and a glass window unit or windowpane 106 . the window assembly 100 is constructed and arranged so that the window sash assembly 104 and window frame 102 cooperate with one another to permit the rotation of the window sash assembly 104 relative to the window frame 102 . specifically , as shown in fig1 a , pivot pins 500 are able to move within kidney shaped receptacles 210 located on the window frame 102 that guide the tilting movement of the window sash assembly 104 relative to the window frame 102 . the window sash is therefore able to achieve a plurality of positions , including an open - tilted and closed position . while the present invention will be described primarily with respect to a single - hung window assembly , it should , however , be appreciated that the present invention can be used in connection with various other types of pivotal windows or structures including , but not limited to , a double - hung window assembly , a vertical pivot window assembly , and the like , wherein it is desired to install a window that is efficient in terms of time and cost . the window frame 102 comprises a plurality of members joined together at their respective ends . as shown in fig2 , the header 202 is joined at a first end 218 with a second end 232 of the left window jamb 206 . at its second end 220 , the header 202 is joined with the first end 222 of the right window jamb 208 . the second end 224 of the right window jamb 208 is joined with the first end 226 of footer 203 ( see fig1 a ). at its second end 228 , the footer 203 is joined with the first end 230 of the left window jamb 206 . as seen in fig1 a and 2 , the water dam 204 is located in front of footer 203 so as to prevent water , wind , or other elements of the outdoors from invading the interior of a building . as will be discussed in greater detail herein , the water dam 204 may also serve as a means for supporting the window sash in its open - tilted position . it should be appreciated , however , that the water dam 204 may be integrally formed with the footer 203 in order to save on the cost of materials during manufacture of the window frame 102 . referring to fig2 , a sash support 207 is located inwardly of the water dam 204 ( see also fig1 a ) and extends the length around the left window jamb 206 , header 202 , and right window jamb 208 of the window frame 102 . the sash support 207 supports the window sash 104 ( see fig1 a ) when the window sash 104 is in its closed position . it should be appreciated that the sash support 207 need not extend the length of left window jamb 206 , header 202 , and right window jamb 208 of the window frame 102 , nor does it need to be located on all three parts of the window frame 102 . an important feature of the present invention is best shown in fig3 - 3a , which are cross - sectional views of the left window jamb 206 and right window jamb 208 , respectively . specifically , a pair of kidney shaped receptacles 210 , 212 are located on the lower regions of the left window jamb 206 ( see fig3 ) and right window jamb 208 ( see fig3 a ), respectively , as well as , close to the water dam 204 . the kidney shaped receptacles have an upper kidney end 304 and a lower kidney end 302 . as shown in fig3 a , there is an insertion channel 214 located on the right window jamb 208 that is connected to the upper kidney end 304 of the kidney shaped receptacle 212 . additionally , there is a transition region 402 , located at the beginning of the insertion channel 214 . it should be appreciated that the insertion channel 214 may instead be located on the left window jamb , or alternatively on both left and right window jambs 206 , 208 . as can be seen in fig2 , the kidney - shaped receptacles 210 , 212 are disposed in a line substantially in parallel with the footer 203 to provide for tilting movement of the window sash 104 by means of the pivot pins 500 . referring back to fig2 , the depth d 1 of the kidney shaped receptacles 210 , 212 ranges from 0 . 325 - 0 . 425 inches . the depth d 2 of the insertion channel 214 is dependent upon the depth of the kidney shaped receptacle 212 to which the insertion channel 214 is connected . accordingly , the depth of the insertion channel 214 will also range from 0 . 325 - 0 . 425 inches . the depth of the transition region 402 of the insertion channel 214 is gradually shallower in depth than the remainder of the insertion channel 214 . however , at the point where the transition region 402 and insertion channel 214 meet , the depth of the transition region 402 will equal the depth of the insertion channel 214 . fig4 and 4 a show cross - sectional cut away portions of the lower portions of the left and right window jambs 206 , 208 that illustrate the kidney shaped receptacles 210 , 212 and insertion channel 214 in greater detail . in a preferred embodiment , the radii r 1 of the upper and lower kidney ends 302 , 304 of the kidney shaped receptacles 210 , 212 preferably range from approximately 0 . 20 - 0 . 30 inches . the length l 1 of the kidney shaped receptacles ranges from approximately 0 . 725 - 0 . 825 inches , and the width w 1 of the kidney shaped receptacles 210 , 212 ranges from 0 . 45 - 0 . 55 inches . as shown in fig3 a , the insertion channel 214 that connects to the kidney shaped receptacle 212 on the right window jamb 208 has a length ranging from 5 to 10 inches , and a width ranging from 0 . 45 - 0 . 55 inches . as shown in fig4 a , the insertion channel 214 has several curves at or near the point where it intersects the kidney shaped receptacle 212 . it is believed that such a configuration enables greater ease during installation and mounting of the window sash assembly 104 ( see fig1 a ) within the window frame 102 , as it helps to facilitate movement of the pivot pin 500 through the insertion channel 214 and into the kidney shaped receptacle 212 . a lower inner curve 410 is formed at the point where the insertion channel 214 is connected to the kidney shaped receptacle 212 . the lower inner curve 410 has a radius of curvature r 3 ranging from 0 . 075 - 0 . 175 inches . an intermediate curve 450 is located above the lower inner curve 410 and adjacent to the open - tilt support 300 . intermediate curve 450 has a radius of curvature r 4 ranging from approximately 0 . 20 - 0 . 30 inches . a right insertion channel curve 430 is located above the intermediate curve 450 and has a radius of curvature r 6 ranging from approximately 0 . 075 - 0 . 175 inches . a left insertion channel curve 440 is located above the upper inner curve 420 and has a radius r 5 ranging from approximately 0 . 20 - 0 . 30 inches . it should be appreciated , however , that the aforementioned dimensions of the kidney shaped receptacles 210 , 212 and insertion channel 214 may vary based on the size of the window frame . additionally , in insertion channel may have more or fewer curves without departing from the scope of the present invention . a preferred window sash assembly 104 according to the present invention is shown in fig5 . the window sash assembly 104 is formed by the union of the left sash rail 502 , right sash rail 504 , upper sash rail 506 , and lower sash rail 508 ( see fig1 a ) at their outermost ends . the pivot pins 500 are located on the outer portion of opposed lower ends of the window sash assembly 104 . the window pane 106 is embedded in the window sash assembly 104 . the window pane 106 may be comprised of any number of materials , such as plastic , glass , or a screen material . based on these features of the window sash assembly 104 and window frame 102 , mounting of the window sash assembly 104 into the window frame 102 is easily accomplished as compared with prior art windows which require the installation and assembly of additional window assembly parts . referring to fig6 , the window sash assembly 104 is mounted on the window frame 102 by first horizontally tilting the window sash assembly 104 so that the right sash rail 504 is higher than the left sash rail 502 . the pivot pin 500 located on the right sash rail 504 is then placed into the transition region 402 of the insertion channel 214 , while the pivot pin 500 located on the left sash rail 502 is placed into and engages the kidney shaped channel 210 located on the left window jamb 206 . once the pivot pin 500 located on the left window jamb 206 is secured within the kidney shaped receptacle 210 , the pivot pin 500 located on the right window jamb 208 is able to slide into the insertion channel 214 , beginning at the transition region 402 . due to the transition region 402 , the pivot pin 500 of the window sash assembly 104 is able to easily move through the insertion channel 214 , and down into the kidney shaped receptacle 212 on the right window jamb 208 . in an alternative embodiment of a window assembly 100 of the present invention , retractable pins , which could be the pins 500 , can be used on either or both the left and right sash rails 502 , 504 . the retractable pins can be retracted into the window sash assembly 104 , such that during window assembly , it is unnecessary to horizontally tilt the window sash assembly 104 so as to allow a pin to engage the insertion channel 214 . instead , retraction of the pins allows the window sash assembly 104 to fit directly into the opening of the window frame 102 , such that the pivot pins 500 are able to easily engage the kidney shaped receptacles 210 , 212 . this configuration eliminates the need for the construction and arrangement of the insertion channel 214 in the right window jamb 208 . accordingly , in such a configuration , only the kidney shaped receptacles 210 , 212 need be located on the lower regions of the left and right window jambs 206 , 208 . referring to fig7 - 10 , when mounted in the window frame 102 , the window sash assembly 104 is capable of achieving a plurality of angular positions . however , the kidney shaped receptacles 210 , 212 advantageously permit the window sash assembly to achieve two stationary or stable positions . a lower stable position provides a fully closed window , and a higher stable position provides a sufficient tilt - opening when a water dam is employed . accordingly , the window sash assembly 104 has a stable closed position , and a stable open - tilted position . it should be further appreciated that the window can also maintain various stable angular positions due to further construction and arrangement of the window assembly , without departing from the spirit and scope of the present invention . the window sash assembly 104 is in a non - pivoted or closed position when it rests within the left and right window jambs 206 , 208 of the window frame 102 . as shown in fig7 and 8 , this occurs when the pivot pin 500 of the left and right sash rails 502 , 504 ( see fig6 ) engage the lower end 302 of the kidney shaped receptacles 210 , 212 of the left and right window jambs 206 , 208 respectively . the window sash assembly 104 can then be locked in the window frame 102 when the left lock control 512 ( see fig5 ) and right lock control 513 manipulate a locking mechanism , such as a lock pin ( not shown ), to engage the lock openings 216 ( see fig2 ) of the window frame 102 . use of the two handles is advantageous to better secure the window frame , as well as , to help better insulate a building against the outdoor elements , such as wind and water . alternatively , one lock control may be utilized to secure the window sash . in such an alternative embodiment , the lock control is preferably located in the center of the upper rail of the window sash assembly 104 . referring to fig9 and 10 , the window sash assembly 104 is in an open - tilted stationary position when the window sash assembly 104 is at its maximum open position . this occurs when the pivot pins 500 of the left and right sash rails 502 , 504 engage the upper kidney end 304 of the kidney shaped receptacles 212 of the right and left window jambs 206 , 208 . additionally , in another important feature of the present invention , a support means is provided for holding the window sash assembly 104 in its open - tilted position . in a preferred embodiment , a water dam 204 is used to support the window sash assembly 104 in its open - tilted position . as such , the water dam 204 serves a dual purpose . first , it is a water barrier that minimizes the amount of water that may enter the interior of a building during a rainstorm . second , it is a support for the window sash assembly 104 when the window sash assembly 104 is in its open tilted position . the window sash assembly 104 will rest on the open - tilt support 300 , of the water dam 204 , so as to maintain an open - tilted position . the open - tilt support 300 preferably provides a flat surface at an angle that mates with the window sash . in a preferred embodiment , the height of the water dam 204 ranges from 1 - 2 inches . it should be appreciated that the height of the water dam 204 and / or angle of the open tilt - support 300 can be varied in order to alter the maximum open - tilted position of the window sash assembly 104 . this may be especially advantageous if the window assembly 100 is to be located above a tall object and it is desired to position the window such that it will not contact the object when in its open - tilted position . referring to fig1 - 13 , an alternative embodiment for a window assembly 1100 according to the present invention is shown . fig1 shows a front view of an alternative window assembly 1100 according to the present invention comprising a window frame 1102 and a window sash assembly 1104 . the window sash assembly 1104 is comprised of a left sash rail 1106 , a right sash rail 1108 , an upper sash rail 1110 , and a lower sash rail 1112 , each joined together at their respective ends , pivot pins ( not shown ), a sill lift 1114 located across the bottom of the window sash assembly 1100 , and right handle 1150 and left handle 1151 . the sill lift 1114 is constructed and arranged similar to the sill lift handle commonly utilized in a double hung window assembly . such sill lifts are manually used to lift a window into an open position . the window jambs include cooperating kidney shaped channels , one kidney shaped channel 1210 in a first vertical window jamb 1116 , and one kidney shaped channel 1200 ( see fig1 ) in a second vertical window jamb 1118 . the window frame 1102 further includes an upper border 1120 , and a lower border 1121 ( see fig1 ). a water dam 1122 is located in front of said lower border 1121 , and is integrally formed with said lower border 1121 . it should be appreciated , however , that the water dam 1122 may be formed separately from the lower border 1121 . referring to fig1 , there is a cross - sectional cut - away view of the window sash assembly 1104 located in its closed position within a first vertical window jamb 1116 and a second vertical window jambs 1118 ( see fig1 ), of the window frame 1102 . a kidney shaped receptacle 1200 is shown in the lower region of the second vertical window jamb 1118 ( see fig1 ). an insertion channel 1202 connects to the kidney shaped receptacle 1200 in the second vertical window jamb 1116 . a corresponding kidney shaped receptacle 1210 ( see fig1 ) is located on the first vertical window jamb 1116 without the insertion channel 1202 . however , it should be appreciated that the first vertical window jamb 1116 can be constructed and arranged so as to be a mirror image of the second vertical window jamb 1116 , thereby having an insertion channel 1202 . referring to fig1 , a cross - sectional cut - away view of the window sash assembly 1104 is shown in its open - tilted position . the pivot pins 500 engage the upper kidney end 1206 . the sill lift 1114 rests against the water dam 1122 , which preferably has a cam - shaped supporting surface 1123 , so as to support the window sash assembly 1104 in its open - tilted position . referring to fig1 - 19 there is shown an alternative window assembly according to the present invention comprising a window sash 1400 ( see fig1 and 15 ) and a window frame 1600 ( see fig1 ). in addition to the typical components of a window sash , such as the top , bottom , right and left sash rails , the window sash further comprises a sash mating surface 1402 . as shown in fig1 , the sash mating surface 1402 comprises an inner edge 1404 and a sash curve 1406 . the window frame 1600 shown in fig1 - 19 comprises a header ( not shown ), a right window jamb 1410 ( see fig1 ), a left window jamb 1412 ( see fig1 ), a footer 1604 , and a water dam 1606 . the footer 1604 and water dam 1606 are preferably formed from a unitary piece of material such that there is a uniform frame mating surface 1602 . the water dam 1606 is greater in height than the footer 1604 , such that the frame mating surface 1602 has an angular slope that is complementary to the sash mating surface 1402 ( see fig1 ). the angular slope of the frame mating surface 1602 preferably has a radius of curvature r10 ranging from 0 . 388 - 0 . 488 inches . there is also a frame mating edge 1608 located at the top of the water dam 1606 . at the point where the frame mating edge 1608 of the frame mating surface 1602 connects with the remainder of the frame mating surface 1602 , there is an upper radius of curvature r 12 preferably ranging from 0 . 15 - 0 . 20 inches . as shown in fig1 and 17 , the window frame is further characterized by kidney shaped receptacles 1610 , 1611 respectively located on the right and left window jambs 1410 , 1412 that receive the pivot pins 1401 of the window sash 1400 . the center c 1 of the lower kidney end 1616 of the kidney shaped receptacles 1610 , 1611 is located approximately 1 . 2 inches from the base of the footer 1604 . the center c 2 of the upper kidney end 1618 is displaced approximately 0 . 031 inches from c 1 . referring to fig1 , on the right window jamb 1410 , there is an insertion channel 1612 ( that connects to the kidney shaped receptacle 1610 . accordingly , a connection curve 1614 is formed at the point where the kidney shaped receptacle 1610 and insertion channel 1612 meet . in a preferred embodiment , the connection curve 1614 has a radius of curvature r 14 ranging in size from 0 . 045 - 0 . 55 inches . the insertion channel 1612 of this alternative embodiment is similar in function to the insertion channel 214 of fig2 and 3 a . it should be appreciated that there are slight differences between the insertion channel 1612 and insertion channel 214 of fig2 and 3 a . for example , the displacement between c 1 and c 2 is 0 . 045 , whereas the displacement between a 1 and a 2 of fig2 and 3 a is 0 . 068 . additionally , there are fewer radii of curvature in the present embodiment , as compared to fig2 and 3 a . despite such differences , both embodiments fall within the scope of the present invention . the window assembly 1400 has two stationary positions , an open - tilted and a closed position . as shown in fig1 and 17 , in its closed position , the sash mating surface 1402 of the window sash 1400 is complementary to the frame mating surface 1602 of the window frame 1600 . furthermore , the pivot pins 1407 are located in the lower kidney ends 1616 . referring to fig1 and 19 , in its open - tilted position , the pivot pins 1401 are located in the upper kidney ends 1618 . the window sash is able to maintain a stable and open - tilted position when the inner edge 1404 of the window sash 1400 rests on top of or over the frame mating edge 1608 of the water dam 1606 . although the invention herein has been described with reference to particular embodiments and preferred dimensions or ranges of measurements , it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention . additionally , it is to be appreciated that the present invention may take on various alternative orientations . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims . | 8 |
the invention provides a coagulant composition and a method of using the same . the invention provides improved coagulation and improved drainage of water from coal tailings in a twin belt press process . the invention uses a polymer containing vinylamine to accomplish this goal . in thickener applications , the polymers of the invention may be added before or after the slurry is flocculated with a standard flocculant in the industry . preferably , in twin belt press applications , the coagulants of the invention are added after the slurry is flocculated . for purposes of this invention , polyvinylamine consists of vinylamine and those monomers which are hydrolyzable to the following formula : ## str1 ## wherein : r is , preferably , one substituent group selected from the group consisting of hydrogen and an alkyl group having from 1 - 10 carbon atoms . more preferably , r is hydrogen or is an alkyl group having 1 - 4 carbons . in a preferred embodiment of the invention , the vinylamine - containing polymer is a homopolymer of polyvinylamine . in an alternative embodiment , the vinylamine - containing polymer is a copolymer comprised of from about 1 to 99 percent by weight vinylamine and from about 99 to 1 percent by weight vinylformamide . in yet another embodiment of the invention , the vinylamine - containing polymer is a copolymer of two compounds selected from the group consisting of an amide , an ester , nitriles and salts of acrylic acid or methacrylic acid . the vinylamine - containing polymers of the invention are preferably used in conjunction with a high molecular weight flocculant . preferably , the flocculant has a molecular weight greater than 2 million daltons . the preferred flocculants include anionic copolymers selected from the group consisting of acrylamide / sodium acrylate , acrylamide / acrylamidopropyl sulfonic acid ( amps ) and poly ( sodium acrylate ). the polyvinylamine polymers of the invention preferably have molecular weights of from about 10 , 000 to about 5 , 000 , 000 daltons ( da ). more preferably , the polyvinylamine polymers of the invention have a molecular weight of from about 100 , 000 to about 3 , 000 , 000 da . most preferably , however , the poly - vinylamine polymers of the present invention have molecular weight of from about 750 , 500 to about 3 , 000 , 000 da . the coagulant compositions of the present invention are applied to the coal tailings slurry as a dilute aqueous solution . preferably , the aqueous solution is applied to the coal tailings slurry in a dosage of from about 0 . 1 to about 200 . 0 parts per million ( ppm ) of the polymers of the invention based on the total volume of the slurry . more preferably , the polymers of the invention are added to the slurry in a dosage of from about 1 . 0 to about 100 parts per million . most preferably , the polymers of the invention are added to the slurry in a dosage of from about 2 . 0 to about 50 . 0 parts per million . processes for making the polymers of the invention are well known in the art . u . s . pat . nos . 5 , 126 , 395 , 5 , 037 , 927 , 4 , 952 , 656 , 4 , 921 , 621 , 4 , 880 , 497 and 4 , 441 , 602 all describe methods for preparing the polymers of the invention . solution polymerization produces the desirable molecular weight range . the resulting polymers are susceptible to alkaline hydrolysis which converts all of the amide groups to amine groups . this hydrolysis phenomena is described in u . s . pat . no . 4 , 421 , 602 , the disclosure of which is incorporated herein by reference . unlike other amine - containing polymers like poly ( dadmac ) or epichlorohydrindimethylamine polymers the amine containing polymers of this invention do not possess a permanent charge . these polymers can best be described as having a transient positive charge that is dependent on the ph of the system . at high ph the amines are unprotonated , at low ph they adopt a positive charge , at intermediate ph only a portion of the amines are protonated , the other amine groups can be viewed as &# 34 ; free &# 34 ; amines that can interact as a 1 ° amine . the following examples are presented to describe preferred embodiments and utilities of the invention and are not meant to limit the invention unless otherwise stated in the claims appended hereto . the coagulants of the invention were evaluated using a gravity dewatering test . the gravity dewatering test is a standard test in the industry and is a valuable tool for reliably screening and evaluating coagulants for twin belt press dewatering . results obtained in testing can be directly translated to the plant process . the following procedure outlines the steps used in performing the test . five to ten gallons of untreated coal tailing slurry feed was obtained . using a mixer , the slurry was mixed to uniformly disperse any coarse solids . five hundred ml of slurry was transferred into a 500 ml graduated cylinder . the coagulant was prepared as a 1 % aqueous solution . the cylinder was inverted four times to thoroughly disperse the solids , then immediately 68 ppm of flocculant was added to the slurry . the cylinder was then inverted four additional times . the flocculant used was nalco ® 9810 , a standard flocculant in the industry . the coagulant solution is then immediately added to the slurry and inverted two additional times . the coagulants used are identified in table 1 below . the control was coagulant &# 34 ; a &# 34 ;. coagulant a was nalco ® 9853 , a standard coagulant used in this application in the industry . table 1______________________________________a nalco ® 9853 -- b pva 2 - 6 millionc pva 1 - 2 milliond pva 200 , 000 - 500 , 000e pva coagulant ( cat ) f pva 10 , 000 - 20 , 000______________________________________ pva polyvinylamine the conditioned slurry was poured over a fine mesh , and immediately the amount of water draining was collected and measured as a function of time . the drainage was collected and recorded every ten seconds for a time period greater than actual plant process time for gravity drainage . it is desirable to have the water drain as fast as possible at the lowest possible polymer dose . the results are summarized in table 2 . table 2__________________________________________________________________________reagent dose ( ppm ) inversions free drainage volume ( mi )# floc cat floc cat floc cat 10 sec 20 sec 30 sec 40 sec 60 sec__________________________________________________________________________1 9810 a 68 7 . 50 4 2 42 64 70 74 802 9810 a 68 3 . 75 4 2 32 48 58 66 713 9810 a 68 1 . 88 4 2 28 46 52 60 684 9810 b 68 7 . 50 4 2 56 76 82 88 925 9810 b 68 3 . 75 4 2 44 61 78 84 906 9810 c 68 7 . 50 4 2 42 58 70 76 827 9810 c 68 3 . 75 4 2 46 66 74 80 848 9810 d 68 7 . 50 4 2 40 52 66 72 809 9810 d 68 3 . 75 4 2 36 46 58 66 7610 9810 e 68 7 . 50 4 2 50 68 77 80 8611 9810 e 68 3 . 75 4 2 44 59 70 77 8412 9810 f 68 7 . 50 4 2 30 46 56 62 7013 9810 f 68 3 . 75 4 2 25 36 42 52 66__________________________________________________________________________ as shown in table 2 , the polymers of the invention consistently outperformed the standard coagulant in the industry ( polydadmac ). focusing on the 10 and 20 second drainage values ( since they most effectively model the drainage times in industry ), the vinylamine - containing coagulants of this invention provide equivalent or greater drainage at 3 . 75 ml than the industry standard . in fact , in selected samples , vinylamine polymers at 1 / 2 the dose give better drainage then the dadmac coagulants . a possible explanation may lie in the fact that the amine polymers of the invention are not fully charged and &# 34 ; free amine &# 34 ; groups may interact with the coal and or flocculant to provide more effective drainage . changes can be made in the composition , operation and arrangement of the method of the present invention described herein without departing from the concept and scope of the invention as defined in the following claims | 1 |
these are rearrangement reactions of silanes of the general formulae ( 2 ) and ( 3 ) to silanes of the general formula ( 1 ). in the moving bed reactor , the catalyst is moved and spent catalyst is discharged continuously at the same time . there is thus a constant exchange of the catalyst . emptying and refilling of the reactor and the associated problems are avoided . examples of moving bed reactors include sliding bed reactors , screw reactors and fluidized bed reactors . in the case of the moving bed and sliding bed reactor , the catalyst moves by virtue of gravity as a fixed bed through the reactor and leaves it at the reactor base . in the screw reactor , the catalyst is moved through the reactor by means of a screw and leaves it at its end through an orifice . in the case of the fluidized bed reactor , spent catalyst is discharged continuously with the gas stream and can be separated out , for example , by means of cyclones . the deactivated catalyst removed from these reactors can then be disposed of or regenerated either batchwise or continuously in separate plants , and then fed back to the reaction . the product mixture is worked up by known methods . preferably , the r radical has 1 to 3 carbon atoms . more particularly , the r radical is a methyl or ethyl radical . ( ch 3 ) 3 sicl + hsicl 3 →( ch 3 ) 2 sicl 2 + ch 3 hsicl 2 +( ch 3 ) 2 hsicl [ 6 ] ( ch 3 ) 4 si + hsicl 3 →( ch 3 ) 2 sicl 2 +( ch 3 ) 3 sicl +( ch 3 ) 2 hsicl [ 11 ] preferably , the alumina catalyst has 2 to 8 , especially 3 to 6 , parts by weight of aluminum chloride per 100 parts by weight of alumina . the aluminum chloride content of the alumina catalyst can be generated by treatment of alumina by known methods with hydrogen chloride , for example , and subsequent drying in a hot gas stream , under reduced pressure or with ( ch 3 ) 3 sicl . the alumina catalyst may contain up to 10 % by weight of a metal oxide selected from magnesium oxide , copper oxide , zinc oxide and mixtures thereof . preferably , the alumina catalyst includes 0 . 5 % to 5 % by weight of the metal oxide . metal oxides or mixed oxides used may be any oxides or mixed oxides of the metals magnesium , copper and zinc . particular preference is given to magnesium oxide . preferably , the alumina catalyst has a bet surface area of at least 100 m 2 / g , more preferably at least 200 m 2 / g , and preferably at most 600 m 2 / g . preferably , the alumina catalyst has an hg pore volume of at least 0 . 2 cm 3 / g , more preferably at least 0 . 5 cm 3 / g , and most preferably at most 1 . 5 cm 3 / g . the particle size distribution of the alumina catalyst should be chosen for achievement of optimal operating conditions for the particular reactor type , for example for attainment of a well - defined fluidized bed . preferably , the alumina catalyst for use in a fluidized bed reactor has a particle size distribution of 20 to 1000 μm , more preferably of 30 to 5000 μm and especially of 40 to 250 μm . for use in a moving bed reactor , preference is given to pellets of a diameter of from 1 - 10 mm . the process is preferably conducted at at least 200 ° c ., more preferably at least 300 ° c ., and especially at least 350 ° c ., and preferably at most 600 ° c ., more preferably at most 550 ° c ., and especially at most 520 ° c . the process is preferably conducted at at least 0 . 5 bar , more preferably at least 2 bar , and especially at least 4 bar , and preferably at most 30 bar , more preferably at most 10 bar , and especially at most 7 bar . since silanes of the general formula ( 3 ) in which e has the value of 1 or 2 also promote reactions between silanes of the general formulae ( 2 ) and ( 3 ) in which e in the general formula ( 3 ) has a value of 0 , preference is given , in the case of such reactions , to adding silane of the general formula ( 3 ) in which e has the value of 1 or 2 . silanes of the general formula ( 3 ) in which e has the value of 1 or 2 therefore have cocatalytic action . the proportion of silane of the general formula ( 3 ) in which e has the value of 1 or 2 in the mixture of silanes of the general formulae ( 2 ) and ( 3 ) is preferably at least 0 . 5 % by weight , more preferably at least 5 % by weight , and especially at least 10 % by weight . the silanes of the general formula ( 3 ) in which e has the value of 1 or 2 that are used may also be used in the form of mixtures , for example in the form of distillate fractions in which , for example , ch 3 hsicl 2 , ( ch 3 ) 2 hsicl and hsicl 3 are present . the alumina catalyst is preferably prepared by treating alumina containing the metal oxides with hydrogen chloride , preferably at least 100 ° c ., more preferably at least 180 ° c ., and most preferably at most 250 ° c . subsequently , the alumina catalyst thus prepared is dried in the hot gas stream , preferably under reduced pressure , or with trimethylchlorosilane . all the above symbols in the above formulae are each defined independently of one another . in all the formulae , the silicon atom is tetravalent . in the examples and comparative examples which follow , unless stated otherwise in each case , all the amounts and percentages stated are based on weight and all the reactions are conducted at a pressure of 1 bar ( abs .). the examples which follow are based on a continuously operated glass fluidized bed reactor heated electrically to 500 ° c ., having diameter 30 mm and length 450 mm , with an upstream reactant evaporator in the case of operation without elevated pressure . the gas distributor used was a glass frit . the fluidized material used was 100 ml ( 46 g ) of a screen fraction of 50 - 180 μm gamma - alumina with 1 % by weight of mg as oxide , having a bet surface area of 276 m 2 / g and an hg pore volume 0 . 89 cm 3 / g , in which 4 . 5 % by weight of aluminum chloride had been formed from the alumina beforehand by treatment in a hydrogen chloride stream . the products were analyzed by means of gc ( calibrated for % by mass ). here , the space - time yields of m2 silane in the reactions of m1 + m3 = 1 : 1 mol from de 102008043331 ( not in accordance with the invention , mgo - containing catalyst at 300 ° c . ; 6 . 5 bar ( abs .)) were compared with the yields in the fluidized bed ( in accordance with the invention , with similar mgo - containing catalyst ; 1 bar , 500 ° c . ): the catalyst density was assumed to be equal . the cocatalytic action of a silane of the general formula ( 3 ) having si - bonded hydrogen is maintained in the process of the invention . under the same conditions , m3 is reacted with sicl 4 : not in accordance with the invention in a tubular reactor at 6 . 5 bar ( abs . ); and at 300 ° c . and 500 ° c ., 1 bar in accordance with the invention in a fluidized bed : | 2 |
fig1 a , 1b and 1c show a semiconductor device assembly 10 . generally , as disclosed in the aforementioned , commonly - owned , copending u . s . patent application ser . no . 380 , 174 , the semiconductor device assembly 10 includes an upper , segmented plastic film layer 14 ( formed of segments 14a , 14b , 14c and 14d ), a lower plastic film layer 16 , metallic leads 18 sandwiched between the two plastic layers 14 and 16 , a metallic ( preferably copper ) die attach pad 20 supported between the two plastic layers 14 and 16 , a semiconductor device 22 mounted on the die attach pad 20 and bond leads 24 connecting the semiconductor device 22 to the leads 18 . as disclosed in the aforementioned u . s . patent application ser . no . 115 , 228 , in lieu of employing bond wires 24 , conductive bumps may be employed to provide a conductive path from the device 22 to the leads 18 in a tape automated bonding ( tab ) process . more particularly , the semiconductor device assembly 10 is formed as follows . the upper plastic layer 14 does not form a continuous surface , but rather is segmented to include an inner ring portion 14a , an intermediate ring portion 14b disposed outside of the inner ring portion , an outer ring portion 14c disposed outside of the intermediate ring portion and an exterior ring portion 14d disposed outside of the outer ring portion . the upper plastic layer 14 is preferably formed of kapton , and forms a thin , insulating supportive structure for the leads 18 . in a region between the inner and intermediate ring portions 14a and 14b , respectively , &# 34 ; inner &# 34 ; portions of the leads 18 are very closely spaced . in a region between the intermediate and exterior ring portions 14b and 14d , respectively , &# 34 ; outer &# 34 ; portions of the leads 18 are more spread out . the inside periphery of the inner ring portion 14a supports the outside periphery of the die attach pad 20 , and the outside periphery of the inner ring portion 14a supports the innermost ends of the leads 18 , in essence forming a &# 34 ; bridge &# 34 ; between the die attach pad and the leads . a rubber - like or plastic - like ring (&# 34 ; body frame &# 34 ;) 26 is disposed atop the leads 18 between the intermediate ring portion 14b and the outer ring portion 14c . the body frame 26 is preferably formed of ryton , and is joined to the leads 18 by an adhesive , such as a b - stage adhesive such as rt - 4b ( trademark of rjr polymers ). as shown , a layer - like quantity of silicone gel 28 , such as dow corning q1 - 4939 , having a 1 to 10 mixing ratio of curing agent to base , encapsulates the leads 24 . the quantity of silicone gel acts as a moisture barrier and a stress relief for the leads 24 during assembly of the semiconductor device assembly , and further prevents an ultimate encapsulation epoxy ( not shown ) disposed over the semiconductor device in an area defined by the body frame from contacting the semiconductor die . surface tension between the silicone gel and the leads 24 keeps the silicone gel in place around the leads during assembly of the semiconductor device assembly . the lower plastic layer 16 covers the bottom of the die attach pad 20 , and generally over the entire area described by the outer ring portion 14c , on the opposite side of the leads 18 and die attach pad 20 . the lower plastic layer 16 is preferably formed of kapton . as disclosed in the aforementioned u . s . patent application ser . no . 380 , 174 , a surrogate lead frame ( edge ring ) 12 is provided for handling the semiconductor device assembly during manufacture thereof , and shorts the outer ends of the leads 18 to support the leads and to facilitate electroplating . further , the semiconductor device assembly is encapsulated with epoxy extending over the semiconductor device 22 , bond leads 24 ( including the silicone gel layer 28 ) and inner and intermediate ring portions 14a and 14b , respectively , up to the ryton ring 26 . further , after completion of the manufacturing process the semiconductor device assembly is excised from the lead frame 12 and exterior ring portion 14d , neither of which properly form any part of the ultimate semiconductor device assembly 10 . the ryton ring 26 also prevents the intermediate kapton ring portion 14b from &# 34 ; wicking &# 34 ; moisture into the semiconductor device assembly . four corner sections ( regions ) 30 of the intermediate ring portion 14b are enlarged in area , each extending inwardly toward the inner ring portion 14a and forming a square kapton &# 34 ; pad &# 34 ;. further , at each of the four corners of the inner ring portion , a first kapton &# 34 ; bridge &# 34 ; 32 is formed connecting the inner ring portion 14a to the intermediate ring portion 14b at a pad 30 . further , at each of the four corners of the intermediate ring portion 14b , a second kapton bridge 34 is formed connecting the intermediate ring portion 14b to the outer ring portion 14c . further , at each of the four corners of the outer ring portion 14c , a third kapton bridge 36 is formed connecting the outer ring portion 14c to the exterior ring portion 14d . ultimately , the second and third kapton bridges 34 and 36 may be excised from the semiconductor device assembly , as is illustrated in fig1 a . with particular attention to fig1 c , two cornermost leads 18 ( as shown in fig1 c ) radiate ( extend ) outwardly from each of the four corners of the die 22 ( as attached by corresponding bond leads 24 , passing underneath the four corner regions 30 ( one corner region 30 illustrated in fig1 c , 2a and 3a ). these two cornermost leads 18 would typically carry power to the semiconductor device 22 , and the pattern of two corner leads 18 carrying power to the device is repeated four times , once at each corner of the semiconductor device assembly , since power levels typically exceed signal levels for semiconductor devices . it should be noted that the pair of power leads do not have to be adjacent , because the pads ( 30 ) are insulating . there may be other , non - power leads passing between the pair of power leads . fig2 a and 2b shows an embodiment of the internal capacitor arrangement for semiconductor device assembly of the present invention . as discussed with reference to fig1 a , 1b and 1c , the semiconductor device assembly includes an upper , segmented plastic film layer 14 ( including portions 14a , 14b . 14c and 14d ), a lower plastic film layer 16 , metallic leads 18 sandwiched between the two plastic layers 14 and 16 , a metallic die attach pad 20 supported between the two plastic layers 14 and 16 , a semiconductor device 22 mounted atop the die attach pad 20 and bond leads 24 connecting the semiconductor device 22 to the leads 18 . as further discussed with reference to fig1 a , 1b and 1c , the upper plastic layer 14 does not form a continuous surface , but rather is segmented to include an inner ring portion 14a , an intermediate ring portion 14b disposed outside of the inner ring portion and an outer ring portion 14c disposed outside of the intermediate ring portion . the upper plastic layer 14 is preferably formed of kapton . the inside periphery of the inner ring portion 14a supports the outside periphery of the die attach pad 20 , and the outside periphery of the inner ring portion 14a supports the innermost ends of the leads 18 . a rubber - like or plastic - like ring 26 , preferably formed of ryton , is disposed atop the leads 18 between the intermediate ring portion 14b and the outer ring portion 14c . a layer - like quantity of silicone gel 28 encapsulates the leads 24 , and the semiconductor device assembly is eventually encapsulated with &# 34 ; glop - top &# 34 ; epoxy . of the above - described elements of the semiconductor device assembly , only the intermediate ring portion 14b , some of the leads 18 , and the kapton pad 30 are illustrated in fig2 a and 2b . further , the &# 34 ; bridges &# 34 ; 32 and 34 are illustrated . directing attention now to the kapton pad 30 , four pads 30 ( one pad illustrated ) are disposed in the semiconductor device assembly just inside the four interior corners of the body frame ( ryton ring ) 26 . a pair of ( two ) leads 18 pass directly underneath each pad 30 . these two leads 18 carry power ( typically vdd and vss ) to the semiconductor device 22 . ( the remaining intermediate leads 18 , illustrated in fig1 a , which may number in the hundreds , carry signals to and from the semiconductor device ). for each of the four pads in the semiconductor device assembly , a pair of power leads pass directly underneath a corresponding pad . each pad 30 is provided with four cutouts 30 . 1 , 30 . 2 , 30 . 3 and 30 . 4 , which are arranged as follows . the cutout 30 . 1 extends into the pad 30 from the outside edge of the intermediate ring portion 14b , from one side of the bridge 34 . the cutout 30 . 2 extends into the pad 30 from the outside edge of the intermediate ring portion 14b , from an opposite side of the bridge 34 . the cutout 30 . 3 extends into the pad 30 from an inside edge of the intermediate ring portion 14b , from one side of the bridge 32 . the cutout 30 . 4 extends into the pad 30 from an inside edge of the intermediate ring portion 14b , from an opposite side of the bridge 32 . the cutouts 30 . 1 and 30 . 4 are aligned along the extent of one of the pair of power leads 18 , and the cutouts 30 . 2 and 30 . 3 are aligned along the extent of another of the pair of power leads 18 . a capacitor 40 is disposed atop the pad 30 , and has a body portion and two conductive legs 42 . the capacitor 40 is a readily available &# 34 ; chip &# 34 ; capacitor . the capacitor 40 is sized and oriented so that the each of the conductive legs are aligned with one of the pair of power leads 18 . as best viewed in fig2 a , each of the conductive legs 42 is spaced from a corresponding power lead 18 by the thickness of the kapton pad 30 . in order to effect a connection between a power lead 18 and a respective conductive leg 42 , the void formed by the cutouts aligned with the power lead is filled with conductive epoxy 44 . alternatively , the conductive leg 42 is connected to the respective power lead by soldering or spot welding . as mentioned hereinbefore , the capacitor 40 is a readily - available chip capacitor . preferably , the capacitor has a low inductance characteristic . an inportant advantage of the internal capacitor arrangement of the present invention is that four capacitors can be arranged symmetrically about the semiconductor device , and that the capacitors are well protected within the semiconductor device assembly package . the invention also has utility in connection with bridging multiple semiconductor devices within a single package . fig3 a and 3b show an alternate embodiment of the internal capacitor arrangement for semiconductor chip assembly of the present invention . this embodiment differs from the previously - discussed embodiment ( of fig2 a and 2b ) primarily with respect to the shape and configuration of the cutouts in the pad 30 . ultimately , the arrangement of the capacitor 40 is the same as that previously discussed in that the two conductive legs 42 are connected to the pair of power leads 18 , such as by conductive epoxy filling voids left by the cutouts in the pad 30 . again , it is anticipated that four capacitors will be arranged within the semiconductor device assembly , each capacitor residing atop a pad underneath which passes two leads powering the semiconductor device . each pad 30 is provided with a plurality of cutouts 30 . 11 , 30 . 12 , 30 . 13 , 30 . 14 , 30 . 15 and 30 . 16 , which are arranged as follows . the cutouts 30 . 11 , 30 . 12 and 30 . 13 are simply holes disposed in the pad 30 along the extent of one of the pair of power leads 18 . the cutouts 30 . 14 , 40 . 15 and 30 . 16 are simply holes disposed in the pad 30 along the extent of another of the pair of power leads 18 . it should be understood that the capacitor ( 40 ) is any suitable edge - contact type chip capacitor . typically , the legs ( 42 ) are simply conductive regions disposed along two opposing edges of the capacitor , and do not protrude as significantly as illustrated . a generally flat , edge - contact chip capacitor is suitable . the important feature is that the &# 34 ; legs &# 34 ; ( conductive regions ) of the capacitor line up with the cutouts ( e . g ., 30 . 1 - 30 . 4 or 30 . 11 - 30 . 16 ) for making contact with a pair of leads ( 18 ). | 8 |
when the bit patterned storage media is used in a data storage device , it is necessary to detect and control the relative position of a read and / or write transducer , e . g ., a recording head , with respect to the islands on the media . in one aspect , this invention provides a method and apparatus for providing a position signal that can be used for timing recovery in a data storage device including a bit patterned media . a non - magnetic sensor can be used to sense the presence of islands in the media . fig1 is a schematic representation of portions of a data storage device 10 including a slider 12 and an associated data storage media 14 . in this example , the data storage media is a patterned media including a plurality of islands 16 of magnetic material separated by trenches 18 , which may be filled with non - magnetic material . a slider or carrier is positioned adjacent to a surface of the storage media in accordance with known techniques , and includes a write head 20 , a read head 22 , and a bit pattern sensor 24 . the write head includes a write transducer 26 that applies a magnetic field to the storage media to control the direction of magnetization of the islands . the read head includes a sensor 28 , such as a magnetoresistive ( mr ) element , tunneling magnetoresistive ( tmr ) element , or giant magnetoresistive ( gmr ) element , which produces an analog voltage signal in response to magnetic fields produced by the magnetized islands . the bit pattern sensor 24 produces a signal that contains information about the relative locations of the bit pattern sensor and islands on the media . an arm 30 can be used to position the slider with respect to the media . the arm can be controlled in accordance with known servo techniques . in normal operation , the slider flies over a track ( or a pair of sub - tracks if staggered ) and the tracks include a plurality of bit islands separated by trenches . the write head passes close enough to the islands to magnetize the whole bit island to the desired polarization ( up or down , for example ) depending on the information bit being written . however the write head field does not penetrate the trenches well and no information can be written in the trenches . in effect the trenches act as stable domain - wall boundaries between neighboring bits . the read and write heads are connected to a control circuit 32 that includes a write channel 34 for delivering voltage or current write pulses to the write head and a read channel 36 for processing signals produced by the read head . a timing recovery circuit 38 uses the signals from the bit pattern sensor to provide a control signal that can be used to adjust the timing of the write pulses . the control circuit can contain other elements that are not specifically related to this description , and are therefore not shown . the write channel can communicate with other components in the control circuit and / or with a host device on a bus 40 . the read channel can communicate with other components in the control circuit and / or with a host device on a bus 42 . fig2 is a schematic plan view of a bit patterned media 50 . the media includes a plurality of islands 52 of magnetic material separated by trenches 54 . in this example , the islands are arranged in linear arrays to form data tracks 56 . in other examples , the islands could be arranged in a staggered array , with the data tracks being formed by two adjacent sub - tracks . fig3 is a cross - sectional view of the bit patterned media of fig2 . the magnetic islands are arranged in a recording layer 60 that is supported by a substrate 62 . other layers , such as a heat sink layer 64 may also be included . to form a planarized media , a non - magnetic dielectric material 66 may be positioned between the islands . in an unplanarized media , the islands can be spaced apart without any solid material in the spaces between the islands . a bit pattern sensor 68 is positioned adjacent to the track . in one aspect , this invention uses a non - magnetic bit pattern sensor 68 to sense the bit island locations . a non - magnetic sensor can use physical properties of the bit patterned media to produce a signal that is related to the relative position of the sensor and bit islands on the media . by using a non - magnetic sensor , interference with the magnetic fields produced by the write head or sensed by the read head , is avoided . in one example used for simulation purposes , the islands were assumed to have a square cross - sectional shape in a plane parallel to or coincident with the surface of the media , with each bit island being in the form of a pillar having a 24 nm by 24 nm square cross - sectional shape . in this example , the islands are separated by a distance of 24 nm . the islands can be a magnetic material , and dielectric material can be for example sio 2 . it should be understood that the islands may have other cross - sectional shapes and the shapes may not be uniform . in one example , the bit pattern sensor includes an optical transducer to direct light onto the media and an optical detector to detect light reflected from the media to produce a position signal that can be processed and used to control the relative position of a read and / or write transducer with respect to the islands on the media . since the bit islands have a different coefficient of reflectivity from the trenches , or dielectric material in the trenches , light reflected from the surface of the media can be used to track the bit islands and synchronize the head to write bits at those locations . fig4 is a block diagram of a timing recovery circuit 70 . the timing circuit includes a front end including an input 72 to a channel 74 , and a low pass filter 76 . the signal produced by a sensor is a signal a n that is transmitted through the channel , resulting in a received signal r ( τ ). the received signal is filtered by the low pass filter to produce filtered signal s ( τ ). the filtered signal is then sampled as illustrated by a sampling switch 78 to produce a sampled signal y n on line 80 . the sampled signal is processed by an equalizer 82 to produce an equalized signal z n on line 84 . the equalized signal is then detected in a detector 86 to produce an output signal . a timing error detector 88 uses the equalized signal and the output signal to produce an error signal on line 90 . the error signal is filtered by a loop filter 92 and the output of the loop filter is used to control the frequency of a voltage controlled oscillator 94 . the voltage controlled oscillator then controls the sampling times that are used to take samples of the filtered signal s ( τ ). thus it can be seen that for timing detection , a pattern sensor can be used to produce a signal that is sampled to produce a plurality of samples . timing recovery architectures include a timing error detector that processes the received samples to produce a quantity that is a measure of the timing phase error . this quantity is further passed through a loop filter to produce a correction signal that is used to control the sampling timing , for example by driving a sampler through a voltage controlled oscillator ( vco ). the detected bits are used by the timing recovery algorithm with the assumption that they are error free . fig5 is a schematic representation of an optical tracking system 100 for use with a bit patterned storage media . the system includes a light source 102 that directs light 104 through a semi - transparent mirror 106 to a near field optical transducer 108 . the near field optical transducer 108 concentrates the light into a small spot 110 on the surface 112 of the bit patterned storage media 114 . a portion 116 of the incident light is reflected back toward the mirror and reflected by the mirror to a detector 118 . the detector produces an error signal 120 that can then be processed by a servo system 122 to control the position of the recording head . fig6 is a schematic representation of a near field optical transducer 108 positioned adjacent to a surface 112 of a bit patterned storage media 114 , including a recording layer 124 positioned adjacent to an electrically conductive heat sink layer 126 , which is positioned adjacent to a substrate 128 . in this example , the near field optical transducer 108 includes an objective lens 130 , a solid hemispherical lens 132 and a metallic pin 134 . the near field optical transducer condenses and delivers the light to the surface of bit patterned media . a radially polarized beam of light 136 is brought to focus onto the center of the hemispherical lens by the objective lens , and illuminates the metallic pin , which may be , for example gold . the end of the metallic pin can be positioned about 10 nm from the surface of the storage medium . in one example , the gold pin has a 12 nm pointed tip and its dimension is optimized for maximum optical efficiency . the storage media includes square granular islands , separated by a dielectric material such as sio 2 . each granule has size 24 nm by 24 nm in the recording film plane . the separation between granules is also 24 nm . fig7 is an enlarged plan view of a portion 140 of a surface 142 of a bit patterned storage media 144 , including islands 146 , 148 , 150 , 152 and 154 . the numbers on and around island 148 represent approximate locations of a center of an optical spot . in the example of fig5 the optical spot 156 is centered at the lower and right corner of the central bit ( i . e ., position 1 ). the incident light spot is reflected and the reflected beam can be monitored while the optical spot is placed at different positions , as shown in fig7 . a quadrant detector can be used to detect the reflected intensity . fig8 is a schematic representation of a quadrant detector 158 . the quadrant detector detects light in four quadrants numbered 1 , 2 , 3 and 4 . from the four quadrants 1 , 2 , 3 and 4 , the detector produces signals s 1 , s 2 , s 3 and s 4 , respectively . signals s 1 , s 2 , s 3 and s 4 can be combined to produce various error signals . for example , a differential phase detection ( dpd ) error signal can be defined as : [( s 2 + s 4 )−( s 1 + s 3 )]. for comparison purposes , the dpd signal can be normalized by the total intensity ( s 1 + s 2 + s 3 + s 4 ) to produce a normalized dpd signal sdpd : it was found that the normalized dpd signal is only about 10 − 5 . the signal reverses sign between positions 3 and 4 . fig9 is a graph of a push - pull error signal with respect to the position of an optical spot on an island of the media . fig9 shows the push - pull error signal when the optical spot scans from position 5 to 2 and from position 1 to 3 . it is seen that the push - pull error signal is 1 . 5 × 10 − 3 . fig9 shows the push - pull error signal as the optical spot scans across the middle of a bit , from position 5 to position 2 , or scans along the edge of a bit , from position 1 to position 3 . this signal may be used for a servo , because it is a differential signal and the noise level is also low . however , this signal is zero when the optical spot is in the middle between two rows of bits . fig1 is a graph of an edge detection error signal with respect to the position of an optical spot on an island of the media . fig1 shows the push - pull error signal when the optical spot scans from position 5 to 2 and from position 1 to 3 . fig1 shows the edge detection signal as the optical spot scans across the middle of a bit , from position 5 to position 2 , or scans along the edge of a bit , from position 1 to position 3 . it is evident that the edge detection signal has the same magnitude as the push - pull signal but it behaves differently from the push - pull signal . it may be used to pinpoint the spot position on the bit . the reflection also changes as the optical spot moves . the amount of change is about 0 . 8 % since it is a sum signal , and the noise level is high . in another implementation , the optical sensor need not have the resolution of an individual bit on the media . for example , the sensor could sense light reflected from a plurality of n bit islands , and the write clock can be multiplied to account for sensing of multiple bit islands . if the phase of the signal resulting from light reflected from n bit islands is accurate enough , then there is no need to resolve each bit island with the optical sensor . as an example , if one of every 10 bits is missing , or if every 10 bit islands is shifted by half a bit , then a sensor that detects light reflected from at least 10 bit islands can be used . while the invention has been described in terms of several examples , it will be apparent that various changes can be made to the described examples without departing from the scope of the invention as set forth in the following claims . the implementation described above and other implementations are within the scope of the following claims . | 6 |
as is well - known , flash memory card arrays and media are organized in erase units , including full and transfer erase units . such erase units are described in detail below . as part of a clean - up operation , the full and transfer erase units cooperate to ensure the removal of all valid data units from full erase unit to corresponding memory locations in transfer erase unit , prior to erasure of full erase unit . clean - up is performed when predetermined conditions are met . for example , if there are no bad blocks , clean - up begins when there are only two free blocks available , beyond any free blocks required to account for flash translation layer structure blocks . if there are bad blocks , depending on the number of bad blocks , cleanup is undertaken much earlier , before the number of free blocks diminishes below a threshold which is a function of no less than twice the number of bad blocks and twice the number of flash translation structure blocks , plus a constant , which is preferably two . as is known , an erase unit includes an erase unit header ; a block allocation map ( bam ); a plurality of bam indications of the status of particular blocks in full erase unit as valid , invalid , or free ; and a plurality of memory locations for data storage in sectors as will be described in detail below in the text accompanying fig1 . valid blocks of a full erase unit are moved to corresponding free memory locations in a transfer unit . thus , memory units of the transfer erase unit which were formerly designated &# 34 ; free &# 34 ; are now redesignated as &# 34 ; valid ,&# 34 ; by the movement of the associated data in full erase unit to corresponding memory locations in transfer erase unit . once all valid blocks of data in a full erase unit have been moved to corresponding locations in a transfer unit , the full erase unit is erased . next , the erased full erase unit is redesignated as a new transfer unit . additionally , the flash translation layer structures and tables are updated to reflect new address locations for information which has been relocated from the full erase unit to the transfer erase unit . fig1 is a detailed map or diagram of a typical erase unit 25 including an erase unit header 25a and a block allocation map 25b , according to the prior art . in particular , fig1 shows a typical sector organization of erase unit 25 . erase unit 25 includes a plurality of sectors . 25 ( 1 )- 25 ( n ), which each may be 512 byte in size . erase unit 25 further includes a distribution of block allocation map 25b over several 512 byte sectors . as shown in fig1 erase unit header is located in first 512 byte sector 25 ( 1 ). block allocation map 25b is located in both first and second 512 byte sectors 25 ( 1 ) and 25 ( 2 ). erase unit header 25a includes a count of the number of erase units in a block of memory subject to memory management . erase unit header 25a further includes an indication of the size of the particular erase unit . additionally , erase unit header 25a includes an indication of the size of the sectors in the erase unit . fig2 is a block diagram showing the relationship between an operating system file management system 25 and a flash medium 27 in terms of a flash translation layer 26 , using first and second file indication maps 25 &# 39 ; and 31 , respectively held in the operating system of file manag 25 and in flash translation layer 26 . a well - known flash translation layer is disclosed to interface between flash memory card erase blocks and the file system used by a pc operating system . this is described in u . s . pat . no . 5 , 404 , 485 issued in 1995 , which is hereby incorporated in its entirety by reference and made a part hereof . the ftl connects flash memory card 27 to file management system 25 used by operating system 503 ( fig4 ) of personal computing system 500 ( fig4 ). according to an embodiment of the present invention , non - tabular , distributed indications or pointers are used to associate files with sectors in flash memory . in operation , when the operating system reads or writes to or from flash memory medium 27 , flash translation layer 26 translates the addresses of flash memory medium 27 to addresses used by the operating system file management system 25 . thus , a particular location of file indication map 25 &# 39 ; contains a reference to a corresponding location in file indication map 31 , which in turn can refer to one or more locations in flash memory medium 27 . thus , when the key generated is stored by operating system 503 ( fig4 ) on flash memory card 27 , the operating system directs storage to a location in file indication map . the actual storage will however be directed to the locations on flash memory card which are established in virtual file indication map 31 , according to the reference linkage provided by file indication map 25 &# 39 ;. thus , as per the former example , ultimate storage of the key would be to one or more flash memory card locations . cleanup is undertaken responsive to a determination as to whether there are any bad blocks . if not , the threshold , freethold , is set equal to a value of two ( 2 ). however , if there are bad blocks , the number of bad blocks is determined , and the threshold at which cleanup is to be undertaken equals the value of two ( 2 ) plus twice the number of bad blocks , plus twice the number of flash translation structure blocks . in other words , if the number of free blocks left available in an erase unit is less than the indicated threshold , then cleanup is undertaken . with no bad blocks , only two free blocks need to be available , and cleanup can be delayed until only two free blocks are left . two blocks are required as a minimum , because one block needs to be reserved for the virtual map page and one needs to be reserved for data transferred to the transfer erase unit . however , if there are bad blocks present within the particular erase unit , then cleanup must begin much earlier , i . e ., at least two free blocks earlier for each bad block . thus , for one bad block , the threshold at which cleanup is required occurs when there are four free blocks left within the erase unit . according to the present invention , this number is increased by twice the number of flash translation structure blocks . accordingly , assuming one flash translation structure block and one bad block exists , then cleanup must begin at a threshold of 6 free blocks . the first two are reserved for the data transferred and for the virtual map page . the next two are reserved to accommodate bad blocks . the final two of the six total are required for the flash translation structure block . fig3 is a flow chart of a method according to the present invention , showing redesignation of deleted file memory locations are invalid , permitting an end to any preservation of the deleted file information during erase unit transmittal of valid data to a transfer erase unit . in particular , according to the present invention , a selected flash memory card medium is formatted and an associated file indication map is stored 400 in the flash medium at a particular memory location as well as in operating system memory . next , a particular file is deleted 401 by action of a user acting through the operating system . the file system working with the operating system next changes 402 the file indication map at the operating system and writes the file indication map to the file transfer layer . next , the file transfer layer reads 403 the original fim version from flash memory . then , the file transfer layer compares 404 the versions of the fim it has resident and makes the blocks associated with each deleted file invalid in the block allocation map . this making invalid in the block allocation map of deleted files , means that when blocks are moved to a transfer erase unit during cleanup , the blocks containing deleted files will not be moved . instead , they are left behind to face erasure , when the full or fuller erase unit is in fact erased , after the valid files thereon have been moved to the targeted transfer erase unit . fig4 is a block diagram showing the relationship between a computer system 500 and a flash memory card array and medium 501 in terms of a flash translation layer 502 . computer system 500 includes an operating system 503 which in turn includes a file indication map 504 . flash memory card array and medium 501 includes a file indication map 505 . file indication maps 504 and 505 are related to each other and may at points of time be similar or the same . flash translation layer 502 includes first and second file indication maps respectively 504a and 505a . first file indication map 504a is derived from file indication map 504 , and second file indication map 505a is derivative of file indication map 505 . when a file is deleted by action of operating system 503 , this deletion is reflected in file indication map 504 , and in derivative file indication map 504a . when the deletion is reflected in derivative file indication map 504a , this is reflected in a difference which will be detected in a comparison between respective file indication maps 504a and 505a . as a result of any such difference being detected , a block allocation map is modified to reflect invalidity of the particular file . thus , during cleanup , the deleted file will not be transferred and preserved to live on at another location . instead , the file will be left behind with other invalid files to be erased . a well - known flash translation layer is disclosed to interface between flash memory card erase blocks and the file system used by a pc operating system . this is described in u . s . pat . no . 5 , 404 , 485 issued in 1995 , which is hereby incorporated in its entirety by reference and made a part hereof . fig4 is a block diagram of a computer system 500 and a flash memory card array and medium 501 interfaced with a flash translation layer 502 . computer system 500 includes an operating system 503 which in turn includes a file system 503 &# 39 ; which in turn includes a file indication map 504 . flash memory card array and medium 501 includes flash translation layer structures 501a including block allocation map 501a ( 1 ) and virtual map table 501a ( 2 ). flash memory card array and medium 501 further includes file indication map 505 which is derived , as will be seen , from file indication map 504a . according to the present invention , file indication map 504a in fig4 is written over file indication map 505 , thus replacing former file indication map 505 . according to one embodiment of the present invention , the replacement is made without a comparison between file indication map 504a and file indication map 505 for possible file deletions in file indication map 504a over a version of files indicated in file indication map 505 . according to this embodiment , that determination is made by comparing file indication map 504a with file indication map 505a . according , to another embodiment of the present invention , the replacement is made after a comparison for the indicated purpose between file indication map 504a and fieindication map 505 . fig4 particularly shows the multiplication scheme of a file indication map 504 according to one embodiment of the present invention . originally file system 503 &# 39 ; directs the establishment of a file indication map 504a in flash translation layer 502 . when file system 503 &# 39 ; in fig4 modifies file indication map 504a it reads table 504a , modifies it , and writes it back in modified form in flash translation layer 502 . accordingly , file system 503 &# 39 ; includes a version of file indication map 504 . according to the present invention , flash translation layer 502 stores file indication map 504a at a location in flash memory card array and medium 501 , as map 505 . further , flash translation layer 502 , according to one embodiment of the present invention , stores a copy of file indication map 5o5 in flash translation layer 502 , as file indication map 505a . according to the present invention , file indication maps 504a and 505a are compared to determine whether the files indicated in table 505a and 504a are the same . simply stated , if file system 503 &# 39 ; has modified file indication map 504a by deleting a file in the table which was formerly there , as evidenced by a reference to the file in another version of an old or earlier file indication map , for example either file indication map 505 or file indication map 505a , then the deletion of the file is evidenced by the noted discrepancy , i . e ., the absence of a file reference in file indication map 504a which is made in either file indication map 505 or file indication map 505a . if there is a discrepancy in files referenced in file indication map 504a and either of file indication maps 505 or 505a , then , according to an embodiment of the present invention , block allocation map 501a ( 1 ) is updated to delete the association between the physical location at which the identified deleted file was stored and the virtual address formerly connected with the particular physical location . the block allocation map is a physical to virtual map which associates particular physical sectors of the flash medium with a related virtual address , provided that a relationship exists . if a relationship exists , the sector of the flash memory affected is no longer free , but valid . after a file is deleted , the sector of flash memory referred to in the block allocation map is indicated as other than valid , preventing preservation by transfer out to a transfer unit prior to erase operation . since no copy of the data is transferred out , the sector and its data are completely erased during erase operation . according to another embodiment of the present invention , when there is a file deletion noted by comparison with file indication map 504a , virtual map table 501a ( 2 ) is modified to delete an association established between virtual and logical addresses expressed in the virtual map table , which corresponds to a physical address containing data to be erased without preservation on a transfer erase unit . fig5 is a flow chart of a method according to the present invention in which the flash translation layer receives 600 an updated file indication map sector . according to the method of the present invention , a check is made 601 for updated changes in the updated file indication map sector against the corresponding old file indication map sector . further , a determination is made 602 whether one or more file deletions have occurred . then , according to one embodiment , block allocation map 501a ( 1 ) and virtual map table 501a ( 2 ) are updated on flash memory card array and medium 501 . according to another embodiment , only block allocation map 501a ( 1 ) is updated . finally , the updated file indication map sector is written in flash memory card array and medium 501 . according to one embodiment of the present invention , a copy of the updated file indication map sector is made or stored in flash translation layer separately from file indication map 504a . this provides a status record of a former file indication map for comparison agyainst subsequent modifications of file indication map 504a . according to the present invention , comparisons to determine file deletion are made between file indication map 504a and file indication map 505 or 505a . the comparison between file indication maps 504a and 505a is speedy , because tables in the flash translation layer are being compared without reference to storage of a file indication map 505 in flash memory card array and medium 501 . | 6 |
the present invention is best understood by reference to the detailed figures and description set forth herein . embodiments of the invention are discussed below with reference to the figures . however , those skilled in the art will readily appreciate that the detailed description given herein with respect to these figures is for explanatory purposes as the invention extends beyond these limited embodiments . for example , it should be appreciated that those skilled in the art will , in light of the teachings of the present invention , recognize a multiplicity of alternate and suitable approaches , depending upon the needs of the particular application , to implement the functionality of any given detail described herein , beyond the particular implementation choices in the following embodiments described and shown . that is , there are numerous modifications and variations of the invention that are too numerous to be listed but that all fit within the scope of the invention . also , singular words should be read as plural and vice versa and masculine as feminine and vice versa , where appropriate , and alternative embodiments do not necessarily imply that the two are mutually exclusive . it is to be further understood that the present invention is not limited to the particular methodology , compounds , materials , manufacturing techniques , uses , and applications , described herein , as these may vary . it is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only , and is not intended to limit the scope of the present invention . it must be noted that as used herein and in the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include the plural reference unless the context clearly dictates otherwise . thus , for example , a reference to “ an element ” is a reference to one or more elements and includes equivalents thereof known to those skilled in the art . similarly , for another example , a reference to “ a step ” or “ a means ” is a reference to one or more steps or means and may include sub - steps and subservient means . all conjunctions used are to be understood in the most inclusive sense possible . thus , the word “ or ” should be understood as having the definition of a logical “ or ” rather than that of a logical “ exclusive or ” unless the context clearly necessitates otherwise . structures described herein are to be understood also to refer to functional equivalents of such structures . language that may be construed to express approximation should be so understood unless the context clearly dictates otherwise . unless defined otherwise , all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs . preferred methods , techniques , devices , and materials are described , although any methods , techniques , devices , or materials similar or equivalent to those described herein may be used in the practice or testing of the present invention . structures described herein are to be understood also to refer to functional equivalents of such structures . the present invention will now be described in detail with reference to embodiments thereof as illustrated in the accompanying drawings . from reading the present disclosure , other variations and modifications will be apparent to persons skilled in the art . such variations and modifications may involve equivalent and other features which are already known in the art , and which may be used instead of or in addition to features already described herein . although claims have been formulated in this application to particular combinations of features , it should be understood that the scope of the disclosure of the present invention also includes any novel feature or any novel combination of features disclosed herein either explicitly or implicitly or any generalization thereof , whether or not it relates to the same invention as presently claimed in any claim and whether or not it mitigates any or all of the same technical problems as does the present invention . features which are described in the context of separate embodiments may also be provided in combination in a single embodiment . conversely , various features which are , for brevity , described in the context of a single embodiment , may also be provided separately or in any suitable subcombination . the applicants hereby give notice that new claims may be formulated to such features and / or combinations of such features during the prosecution of the present application or of any further application derived therefrom . as is well known to those skilled in the art many careful considerations and compromises typically must be made when designing for the optimal manufacture of a commercial implementation any system , and in particular , the embodiments of the present invention . a commercial implementation in accordance with the spirit and teachings of the present invention may configured according to the needs of the particular application , whereby any aspect ( s ), feature ( s ), function ( s ), result ( s ), component ( s ), approach ( es ), or step ( s ) of the teachings related to any described embodiment of the present invention may be suitably omitted , included , adapted , mixed and matched , or improved and / or optimized by those skilled in the art , using their average skills and known techniques , to achieve the desired implementation that addresses the needs of the particular application . detailed descriptions of the preferred embodiments are provided herein . it is to be understood , however , that the present invention may be embodied in various forms . therefore , specific details disclosed herein are not to be interpreted as limiting , but rather as a basis for the claims and as a representative basis for teaching one skilled in the art to employ the present invention in virtually any appropriately detailed system , structure or manner . it is to be understood that any exact measurements / dimensions or particular construction materials indicated herein are solely provided as examples of suitable configurations and are not intended to be limiting in any way . depending on the needs of the particular application , those skilled in the art will readily recognize , in light of the following teachings , a multiplicity of suitable alternative implementation details . embodiments of the present invention will be described which provide means and methods for delivering a charged particle beam to arbitrary points in a region controlled by small angle deflection of the charged particle beam . a non - limiting example of an application for deflection and delivery of a charged particle beam includes particle therapy associated with the practice of medicine . a multi - pole electromagnet when disposed with an appropriate excitation may operate to steer a charged particle beam with energy in a typical range of 60 mev to 6 gev , via a sequence of trajectories in order to deliver an ion beam to desired positions located in a transverse surface located at a distance from the electromagnet . the multi - pole electromagnet may be connected to a multiplicity of power amplifiers . the power amplifiers may be connected to opposing coils associated with the multi - pole electromagnet . furthermore , the multiplicity of power amplifiers may be connected to a power supply . as an example associated with particle beam therapy , the control of particle beam position combined with kinetic energy adjustment may operate to control the lateral distribution and range of particles projected into a body . furthermore , modulation of the particle beam intensity may allow a desired volumetric dose distribution to be delivered . the multi - pole electromagnet , via appropriate currents applied to the coils of the electromagnetic , may operate to position a charged particle beam at a location associated with a traverse plane defined in polar coordinates as r and θ . for sinusoidal currents applied to six or more coils as a function of the pole angles , the resulting magnetic field created between the coils may provide a good quality dipole magnetic field which can be rotated to any arbitrary angle . furthermore , the size of associated electromagnets may be reduced , and higher quality beams may be produced as compared to conventional means and methods . in other embodiments of the present invention , methods and means will be described for providing a multi - pole electromagnet with modified tips for improving the quality of the generated magnetic field . the modified tips may be configured with various geometric shapes . non - limiting examples of geometric shapes include circular and elliptical . in other embodiments of the present invention , methods and means will be described for providing a multi - pole electromagnet with modified air gaps for providing greater clearance for a charged particle beam , resulting in less likelihood of sustaining particle beam losses . in other embodiments of the present invention , methods and means will be described for providing magnetic field probes for providing feedback in order to support systems operating with non - linear configurations . fig3 presents an illustration of an example multi - pole deflection apparatus for deflecting a charged particle , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 300 may operate to deflect a received charged particle via a generated magnetic field . for simplicity , a yoke for magnetic flux return is not shown . multi - pole deflection apparatus 300 includes an electromagnetic portion 302 , an electromagnetic portion 304 , an electromagnetic portion 306 , an electromagnetic portion 308 , an electromagnetic portion 310 , an electromagnetic portion 312 , an electromagnetic portion 314 , an electromagnetic portion 316 , an amplifier 318 , an amplifier 320 , an amplifier 322 , an amplifier 324 and a power supply 326 . as a non - limiting example , power supply 326 may be configured as direct current ( dc ). electromagnetic portions 302 , 304 , 306 , 308 , 310 , 312 , 314 and 316 may operate to generate an associated magnetic field . amplifier 318 , 320 , 322 , 324 may operate to provide amplified power . power supply 326 may operate to provide electrical power . the electromagnetic portions may be configured in a circular fashion about a z - axis 328 . a first node of electromagnetic portion 310 may be connected to a first node of amplifier 318 via a conductor 330 . a second node of electromagnetic portion 310 may be connected to a first node of electromagnetic portion 302 via a conductor 332 . a second node of electromagnetic portion 302 may be connected to a second node of amplifier 318 via a conductor 334 . electromagnetic portion 302 and electromagnetic portion 310 may be configured as physically opposing . electromagnetic portions 302 , 304 , 306 , 308 , 310 , 312 , 314 and 316 may be configured and connected ( not shown ) to amplifiers 320 , 322 and 324 in a similar fashion as described previously with reference to electromagnetic portion 302 , 310 , amplifier 318 and conductors 330 , 332 and 334 . amplifiers 318 , 320 , 322 and 324 may be connected to power supply 326 via a power conduit 336 . a charged particle 338 may initially be moving in the direction of z - axis 328 . after transitioning through electromagnetic portions 302 , 304 , 306 , 308 , 310 , 312 , 314 and 316 and subjected to a dipole magnetic field located in the central channel of multi - pole deflection apparatus 300 , charged particle 338 may be moving in a different trajectory as denoted by a trajectory 340 . the operation of multi - pole deflection apparatus 300 with appropriated electrical currents traversing the coils of electromagnetic portions 302 , 304 , 306 , 308 , 310 , 312 , 314 and 316 may provide a high quality dipole magnetic field . for the number of electromagnetic portions six or greater and a pattern of currents with an associated sinusoidal function of the pole angles , a high quality dipole magnetic field may be created which can be rotated to any angle . the present invention combines the small physical size of the quadrupole structure as illustrated with reference to fig2 and the high quality magnetic field of the dipole pair as illustrated with reference to fig1 . fig4 presents a cross - section illustration of an example sextupole deflection apparatus for deflecting a charged particle , in accordance with an embodiment of the present invention . a sextupole deflection apparatus 400 includes six electromagnetic portions with a sampling denoted as an electromagnetic portion 402 , six coils with a sampling denoted as a coil 404 and a yoke structure 406 . non - limiting examples of materials for constructing yoke structure 406 include iron and steel . the six electromagnetic portions may be arranged in a circle about a central axis 408 . magnetization may be produced by applying electrical currents to electrical coils for opposing electromagnetic portions using three independent power amplifiers ( connections between coils and amplifiers not shown ). a desired dipole magnetic field may be created in the region enclosed by the electromagnetic portions . the created magnetic flux may be returned via yoke structure 406 . fig5 presents a cross - section illustration of an example octupole ] deflection apparatus for deflecting a charged particle , in accordance with an embodiment of the present invention . an octupole deflection apparatus 500 includes eight electromagnetic portions with a sampling denoted as an electromagnetic portion 502 , eight coils with a sampling denoted as a coil 504 and a yoke structure 506 . non - limiting examples of materials for constructing yoke structure 506 include iron and steel . the eight electromagnetic portions may be arranged in a circle about a central axis 508 . magnetization may be produced by applying electrical currents to electrical coils for opposing electromagnetic portions using four independent power amplifiers ( connections between coils and amplifiers not shown ). a desired dipole magnetic field may be created in the region enclosed by the electromagnetic portions . the created magnetic flux may be returned via yoke structure 506 . the dipole magnetic quality increases with the number of electromagnetic portions , but so does the complexity of the apparatus ( e . g . number of power amplifiers required — one for every opposing electromagnetic portion ). common applications for the present invention may be configured with six or eight electromagnetic portions . fig6 presents a geometrical illustration for calculating coil currents for an example n - pole deflection apparatus for deflecting a charged particle , in accordance with an embodiment of the present invention . a deflection apparatus 600 includes n electromagnetic portions with a sampling denoted as an electromagnetic portion 602 , an electromagnetic portion 604 , an electromagnetic portion 606 and an electromagnetic portion 608 . the excitation pattern for the associated coils of the electromagnetic portions for deflection apparatus 600 for steering a charged particle via a high quality dipole field may be explained with reference to fig6 . the electromagnetic portions may be configured in a circle about a z - axis 610 with z - axis 610 projected into the page . furthermore , electromagnetic portions may be configured with respect to an x - axis 612 directed to the left with respect to the page and a y - axis 614 directed vertically upwards with respect to the page . a charged particle ( not shown ) may enter deflection apparatus 600 parallel and in close proximity to z - axis 610 . magnetic poles , denoted as p k , k = 1 to n , associated with n magnetic portions may be arranged in a circular array at angles , denoted as a k , with respect to x - axis 612 . a positive charged particle deflection angle , denoted as an angle 616 , resulting from a uniform dipole field 618 may be generated by coil currents denoted as i k , k = 1 to n / 2 . the zero degrees direction of particle deflection may be taken to be along x - axis 612 . angle 616 may be considered as the direction of deflection relative to zero degrees with respect to x - axis 612 . a deflection for a positive ion with a value of 0 degrees for angle 616 may be associated with magnetic field vectors for uniform dipole field 618 rotated from the arbitrary angle illustrated so that they are pointing from the top of the page to the bottom of the page and positioned in the plane of the page . furthermore , the n magnetic poles p k , k = 1 to n , may be arranged in a circular array with an even value for n . furthermore , the first n / 2 magnetic pole tips may be centered at angles a k , k = 1 to n / 2 , with an increasing positive angle denoted in the clockwise direction . furthermore , corresponding opposing magnetic portions may be positioned at a k + 180 degrees . furthermore , every opposing pole pair may be powered by a single power amplifier whereby coils may be connected in series such that the same electrical current may traverse the coil pairs . furthermore , the operation may be considered similar as in the case of a conventional magnetic dipole deflection apparatus . for purposes of explanation and as a non - limiting example , the magnetic poles and coils may be identical and arranged at regular angles starting from zero degrees , however , any known configuration may be considered . a regular distribution of magnetic poles about z - axis 610 may operate to generate a high quality magnetic field . to generate a particular dipole magnetic field for deflecting a charged particle zero degrees for angle 616 , the exciting currents i k , k = 1 to n / 2 may be represented by equation ( 1 ) as shown below : for equation ( 1 ), i p may represent a particular electrical current determining an amount of deflection to be applied in the direction associated with the magnetic pole . a positive value for the electrical current for i p may be associated with a clockwise flow of electrical current when viewing a magnetic portion from z - axis 610 . a negative value for i p may be associated with a counter - clockwise flow of electrical current when viewing a magnetic portion from z - axis 610 . furthermore , a coil for a pole may be considered as similar and connected in series with a coil 180 degrees opposed , in a fashion similar to a conventional dipole magnet . in order to rotate the dipole magnetic field direction for producing a deflection in another direction θ , the excitation for i k , k = 1 to n / 2 may be represented as equation ( 2 ) as shown below : the variable θ may be associated with any known value . furthermore , the rotation of the magnetic field may be associated with any direction and as a result , the deflection direction may also be associated with any direction . furthermore , the magnitude of the dipole magnetic field may remain constant , independent of θ . fig7 presents an example illustration of traverse plane magnetic field vectors associated with the bore of a multi - pole electromagnetic apparatus , in accordance with an embodiment of the present invention . a multi - pole electromagnetic apparatus 700 includes a multiplicity of electromagnetic tip portion with a sampling denoted as an electromagnetic tip portion 702 and an electromagnetic tip portion 704 . multi - pole electromagnetic apparatus 700 may be oriented with respect to an x - axis 706 , a y - axis 708 with a z - axis 710 projected into the page . the electromagnetic tip portions may be separated by a multiplicity of gaps with a sampling denoted as a gap 712 . for example , gap 712 may be located between electromagnetic tip portion 702 and electromagnetic tip portion 704 . furthermore , the electromagnetic tip portions may be located such as to surround a bore area 714 . a magnetic field may be created by multi - pole electromagnetic apparatus 700 with the resultant magnetic field illustrated by a multiplicity of magnetic field vectors with a sampling denoted as a field vector 716 . magnetic field vectors presented as black arrow heads may be oriented at a traverse plane with respect to multi - pole electromagnetic apparatus 700 . the equal magnitude and direction orientation for the magnetic field vectors illustrates the quality of the dipole magnetic field . for example , the more diversity observed for the magnetic field vectors with respect to magnitude and direction orientation , the less the quality of magnetic field generated . for this example , the calculation for coil current pattern produced a deflection angle of 260 degrees , which illustrates that there may be no constraint that the field direction is aligned with the angular arrangement of the electromagnetic tip portions . the illustration presented by fig7 provides a visual indication of the dipole magnetic field quality for a magnetic field rotated to an arbitrary angle . the associated magnetic field quality may be confirmed quantitatively by evaluating legendre polynomial coefficients for the region where charged particles may travel and by measuring the aberrations introduced into a known beam transverse profile resulting from the beam traversing through multi - pole electromagnetic apparatus 700 . fig8 presents an example illustration of an electromagnetic portion deflecting a beam of charged particles and the orientation of the charged particles with respect to a downstream plane , in accordance with an embodiment of the present invention . the illustration of fig8 includes a charged particle beam 802 , a multi - pole electromagnetic portion 804 and an intersect plane 806 . charged particle beam 802 , multi - pole electromagnetic portion 804 and intersect plane 806 may be orientated with respect to an x - axis 808 , a y - axis 810 and a z - axis 812 . multi - pole electromagnetic portion 804 may operate to receive and deflect charged particle beam 802 . multi - pole electromagnetic portion 804 may be located a distance 814 , denoted as d , from intersect plane 806 and with z - axis 812 traversing through its longitudinal center . typical values for d may be in the range of 1 m to 10 m . charged particle beam 802 may be deflected from z - axis 812 in the plane of the deflection direction by an angle 816 , denoted as α , and intersect plane 806 at a point 818 . typical values for a may be in the range of − 10 degrees to + 10 degrees . point 818 may be located a distance 822 from x - axis 808 , a distance 824 from y - axis 810 and a distance 820 , denoted as r , from z - axis 812 . furthermore , point 818 may be located at an angle 826 , denoted as θ , with respect to x - axis 808 . charged particle beam 802 may be considered as intersecting intersect plane 806 at a polar location as denoted by r and θ . the intersection of charged particle beam 802 with intersect plane 806 at point 818 may also be resolved into x and y coordinates . multi - pole electromagnetic portion 804 may operate to rotate a fixed strength dipole magnetic field to any angle and as a result deflect charged particle beam 802 to any angle . furthermore , multi - pole electromagnetic portion 804 may control the deflection of charged particle beam 802 via parameters r and θ . for multi - pole electromagnetic portion 804 operating sufficiently far from yoke saturation , the relationship between i p and the dipole magnetic field may be considered as linear with r a linear function of i p . thus , maintaining i p constant and incrementing θ transfers the location of point 818 ( i . e . where charged particle beam 802 intersects intersect plane 806 ) in a circle about intersect plane 806 . for any particular set of circumstances , point 818 may lie within a maximum diameter circle . the diameter may be set by d and α . in a non - limiting example , typical values for particle therapy are diameters of 100 cm and less , although some treatments such as the spine require larger fields . this may be achieved by increasing d because a may be constrained by practical magnet design issues . furthermore , the maximum diameter of the circle may be dependant upon a particular configuration and associated circumstances . non - limiting examples of circumstances contributing to the maximum diameter of the circle include particle beam magnetic rigidity , multi - pole electromagnetic portion 804 configuration , power supply and distance of electromagnetic portion from intersect plane 806 . charged particle beam 802 movement may not be dependant upon any particular axis . conversion from coordinates associated with intersect plane 806 defined by cartesian coordinates x , y to polar parameters r , θ may be accomplished via conventional mathematical transformations . for small angles of deflection for α , the i p , θ values for a given x , y position located on intersect plane 806 may be given by equation ( 3 ) and equation ( 4 ) shown below : standard sign conventions may be applied to θ based upon whether point 818 lies within the right or left hand halves of intersect plane 806 . the element c in equation ( 4 ) may represent a proportionality constant . non - limiting examples of parameters for determining the value of c include coil design , size of electromagnetic portion air gap , length of electromagnetic portion and permeability of the magnetic flux for the return yoke . non - limiting examples of methods for determining the value of c include direct measurement or electromagnetic modeling and ray tracing . as a good approximation , a may be expressed in terms of the beam rotation angle θ ( or angle 826 ) and other geometric parameters as given by equation ( 5 ) below : for equation ( 5 ) d ( or distance 814 ) may represent the displacement along z - axis 812 from the center of multi - pole electromagnetic portion 804 to intersect plane 806 and x ( or distance 824 ) may represent the displacement along x - axis 808 . the power amplifiers connected to the coils for supplying power to electromagnetic portions may be of four - quadrant design for supporting a charged particle beam placement at any geometric location of intersect plane 806 . the n / 2 power amplifiers may provide high - current and be supplied via a single dc power supply with associated energy storage capacitors . the inductance of the electromagnetic portion may be considered an energy storage device which exchanges energy with the storage capacitors while maneuvering the charged particle beam . high efficiency may be experienced for a circular motion about z - axis 812 , as the total energy stored in multi - pole electromagnetic portion 804 remains constant with small associated changes in electrical current , resulting in small power amplifier switching losses . dipole magnetic field quality improves with an increased number of poles . furthermore , for most real - world cases , an eight pole electromagnetic portion may be considered adequate for practical and economic considerations . furthermore , a six - pole electromagnetic portion may yield sufficient dipole magnetic field quality for many applications . fig9 presents a cross - section illustration of an example multi - pole deflection apparatus with modified pole tips for improving the quality of the associated dipole magnetic field for deflecting a charged particle , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 900 has a similar construction as sextupole deflection apparatus 400 ( fig4 ) except the pole tips , with a sampling denoted as a pole tip 902 , may be configured with an associated circular profile in order to improve the quality of the dipole magnetic field . pole tips shaped as shown for an inscribed circle 904 may operate to improve the magnetic field quality at distances removed from a central axis 906 . furthermore , the pole tips shaped for inscribed circle 904 may operate to reduce charged particle beam aberrations at larger angles of deflection . fig1 presents an illustration of an example multi - pole deflection apparatus with modified air gap between poles for providing greater clearance for a charged particle beam as it deflects in the magnetic dipole field , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 1000 includes a multiplicity of poles ( some not shown ) with a sampling denoted as a pole 1002 and a pole 1004 . pole 1002 and pole 1004 may be oriented with a z - axis 1006 running longitudinally through an air gap 1008 located between pole 1002 and pole 1004 . a charged particle 1014 may enter air gap 1008 at an entry gap 1010 and exit at an exit gap 1012 . a smaller distance between pole 1002 and pole 1004 may be provided at entry gap 1010 than at exit gap 1012 . furthermore , the distance between pole 1002 and pole 1004 may increase as a charged particle progresses from entry gap 1010 to exit gap 1012 . as a result of the magnetic field provided by multi - pole deflection apparatus 1000 , charged particle 1014 may follow a trajectory path 1016 . large deflection angles result in a charged particle beam coming in close proximity to poles . in order to reduce the risk of a charged particle beam coming in contact with a pole and an associated charged particle beam loss , the inscribed diameter for the air gap may be increased along the length of the electromagnetic portion . the associated flaring of the inscribed diameter may be continuous along the full length of the electromagnetic portion or may initiate at some distance along the length of the electromagnetic portion . the resulting deflection for a given set of excitation currents may be reduced by the associated flaring . fig1 presents a cross - section illustration of an example multi - pole deflection apparatus with a non - circular bore , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 1100 has a similar construction as octupole deflection apparatus 500 ( fig5 ), except with a non - circular bore 1102 . for this example , an elliptical bore has been presented for non - circular bore 1102 , however any known geometrical shape may be applied . an electromagnetic portion with a non - circular bore may operate in a similar manner as described previously for a circular bore ( e . g . fig5 ). for example , for an elliptical bore , a rotating magnetic field with constant i p generates an elliptical path at an intersection plane , rather than a circular path . coil currents may be delivered to the coils not conforming to the sinusoidal pattern described previously . other patterns of coil currents introduce higher order terms into the magnetic field and result in distortion in the shape of the charged particle beam . in some embodiments additionally imposed pattern of currents may be non - sinusoidal or sinusoidal to produce beam shaping . in a non - limiting example an additional superimposed sinusoidal pattern , at twice the spatial frequency of the basic pattern that gives the dipole field , may produce a useful quadrupole field component that gives beam shaping typical of a quadrupole magnet . application of particular patterns of coil currents may be applied in order to introduce deliberate charged particle beam shaping such as , but not limited to , the beam transverse shape to be more like a line than a circle . furthermore , a separate power amplifier may be connected to individual coils , rather than to pairs of opposed coils as described previously , providing further control over charged particle beam shaping . in a non - limiting example , a useful use of this beam shaping capability is to make the quadrupole field component of this multipole magnet one half of a quadrupole doublet . the other member of the doublet would be a conventional quadrupole magnet structure positioned before the multipole magnet in the beam path . this combination may provide focusing in both transverse axes orthogonal to the beam axis , which is the typical function of a quadrupole doublet . the benefit is that the need for a second conventional quadrupole is avoided , and thus cost and space are saved . for many applications , the ability to perform timely magnetic field changes may be required . a beam scanning magnetic apparatus may be considered as a non - limiting example for an application making use of a fast changing magnetic field . furthermore , to support a fast changing magnetic field , the return yoke structure may be constructed from thin laminations in order to minimize losses and field distortions associated with eddy currents . furthermore , as a non - limiting example , the yoke structure maybe constructed of laminated steel , ferrite or any material with relative permeability greater than 1 . furthermore , to support a fast changing magnetic field , the coils may have a relatively small number of turns in order to minimize the inductance . furthermore , to support a fast changing magnetic field , the power amplifiers may support high current capability , typically hundreds of amperes , in order to support the small number of turns in the coils . furthermore , to support a fast changing magnetic field , the power amplifiers may support a wide voltage range , typically up to +/− 800v with currents up to 800 a , in order to allow the inductive load to transition to a new current level . furthermore , to support a fast changing magnetic field , the power amplifiers may support a wide bandwidth , typically dc to a multiplicity of kilohertz in order to minimize the settling time after transitioning to a new current level . fig1 presents a cross - section illustration of an example multi - pole deflection apparatus incorporating a hall effect probe to provide magnet field feedback for monitoring and control , in accordance with an embodiment of the present invention . a multi - pole deflection apparatus 1200 has a similar construction as octupole deflection apparatus 500 ( fig5 ), except with a multiplicity of hall effect probes , with a sampling denoted as a hall effect probe 1202 , configured in a multiplicity of recesses , with a sampling denoted as a recess 1204 . for applications where large magnetic field strengths may be required , assumptions previously described for a magnetic field as a linear function of i p may not hold . the magnetic field as a linear function of i p may also not hold for conditions of significant eddy currents and steel hysteresis . for these types of applications and conditions , hall effect probe 1202 may be configured for accurately measuring magnetic fields . the signal provided by hall effect probe 1202 may be used as a confirmatory function or as a process feedback for closed - loop electromagnetic field control . hall effect probe 1202 may be positioned at the tips of individual poles in order to enable measurement of the individual contributions to the net magnetic field . those skilled in the art will readily recognize , in accordance with the teachings of the present invention , that any of the foregoing steps and / or system modules may be suitably replaced , reordered , removed and additional steps and / or system modules may be inserted depending upon the needs of the particular application , and that the systems of the foregoing embodiments may be implemented using any of a wide variety of suitable processes and system modules , and is not limited to any particular computer hardware , software , middleware , firmware , microcode and the like . for any method steps described in the present application that can be carried out on a computing machine , a typical computer system can , when appropriately configured or designed , serve as a computer system in which those aspects of the invention may be embodied . having fully described at least one embodiment of the present invention , other equivalent or alternative methods of performing electromagnetic deflection of a charged particle beam according to the present invention will be apparent to those skilled in the art . the invention has been described above by way of illustration , and the specific embodiments disclosed are not intended to limit the invention to the particular forms disclosed . for example , the particular implementation of the power amplifiers described with reference to fig3 may vary depending upon the particular application the apparatus is to be applied . the exemplary power amplifiers described in the foregoing were directed to medical implementations ; however , similar techniques may be demonstrated for other applications such as for semiconductor manufacture . implementations of the present invention are contemplated as within the scope of the present invention . the invention is thus to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the following claims . claim elements and steps herein may have been numbered and / or lettered solely as an aid in readability and understanding . any such numbering and lettering in itself is not intended to and should not be taken to indicate the ordering of elements and / or steps in the claims . | 6 |
referring now specifically to the drawings , wherein like numerals indicate like parts throughout , the water purification system of the present invention is generally designated 10 and comprises a cylindrical pressure vessel 12 with a circular support leg 14 designed to provide stable disposition when the system is placed on a level surface such as a countertop . the pressure vessel 12 comprises a top member 16 and a base member 18 which can be adjoined and sealed to provide an interior compartment for housing water purification mediums in concentric disposition . the base member 18 and the support leg 14 are configured to define a storage compartment 19 between the base member 18 and the surface upon which the system 10 rests and as enclosed by the support leg 14 . in a preferred embodiment , as shown in fig1 - 4 , the top member 16 is secured to the base member 18 by threaded engagement , top member 16 has male threads 20 which are capable of secure connection by engagement with female threads 22 disposed on the base member 18 . to seal the connection from leakage through the threaded engagement area , an o - ring 24 is disposed between the top member 16 and the base member 18 at a sealing point such that the pressure inside the pressure vessel 12 forces the o - ring 24 to seal the connection . although it is preferred that the top member 16 and the base member 18 be connected using square threads such as is shown in the drawings , it should be understood that other types of threads or other forms of connection may be used so long as the connection maintains the integrity of the pressure within the pressure vessel 12 . the pressure vessel 12 further comprises interior seals and gussets for positioning the purification mediums and defining flow paths of the water as it passes through the system 10 . a circular base seal 26 and a circular top seal 28 are provided to seal the influent water from bypassing the first purification medium , as shown in fig1 . a circular base gusset 30 and a circular top gusset 32 are provided to position a perforated core cylinder 34 about the core area of the pressure vessel 12 and to secure the perforated core cylinder 34 from lateral or longitudinal movement . the perforated core cylinder 34 has a plurality of perforations 35 and is sealed into position by o - rings 36 . the base member 18 also comprises an inlet 38 , a reject water outlet 40 , and a receiving portal 42 . the inlet 38 is easily connectable to a source of influent potable water from a tap or faucet by tubing ( not shown ). the reject water outlet 40 is equipped with a flow restrictor 44 such as a small capillary tube or a larger diameter tube of a length sufficient to restrict the flow of effluent reject water from the system 10 and to maintain water pressure within the system 10 so that the purification mediums can operate at optimum efficiency . the receiving portal 42 is configured to receive in sealed engagement any of a plurality of center tubes for disposition within the perforated core cylinder 34 . in the embodiment shown in fig1 the center tube in use is an activated carbon 46 filled filter center tube 48 with a top portal 50 . turning now to the purification mediums shown in the preferred embodiment illustrated in fig1 it should be understood that the disposition of the purification mediums in concentric stages eliminates the need for interconnecting tubing , thus eliminating a great deal of complexity from the system 10 . the first purification medium comprises a sediment filter 52 impregnated with carbon . the primary purpose of the sediment filter 52 is to remove chlorine and sediment from the water before it enters the next stage of purification . a preferred type of sediment filter 52 is a batting with carbon powder impregnated within the fiber , but other types of sediment filters 52 may be used . the sediment filter 52 is disposed between a base annular barrier 54 and a top annular barrier 56 each of which are impermeable to water so that there is no leakage of water through the seals formed by the top seal 28 and the top annular barrier 56 and by the base seal 26 and the base annular barrier 54 . the base annular barrier 54 contacts an o - ring 55 disposed between the base annular barrier 54 and the second purification medium , thereby restricting the flow of water from bypassing the second purification medium . in the embodiment shown in fig1 through 4 , the second purification medium comprises a conventional reverse osmosis module 58 . the reverse osmosis module 58 comprises a reverse osmosis membrane which is wound spirally around the perforated core cylinder 34 . typically , a reverse osmosis membrane comprises a three - layer combination wherein one layer is an open netted material , the center layer is the membrane of cellulose acetate , polyamide , or some other suitable membrane material , and the third layer is a material such as sail cloth . the reverse osmosis membrane acts like an envelope which captures the water within the envelope and the water traverses the membrane in a type of molecular traversal separating the water from impurities which are carried out in the reject water which does not traverse the membrane . configured or rolled reverse osmosis membranes are commonly called leafs and can be made to various lengths . in the preferred embodiments of the present invention , a plurality of leafs are wound spirally about the perforated core cylinder 34 , one to three leafs have been found to be ideal depending on the length of the leafs to achieve an acceptable amount of purified water passing through the reverse osmosis stage . it should be understood ; however , that more than three leafs may be used . to achieve the most efficient separation by reverse osmosis , water pressure must be maintained at a level conducive to the process . the flow restrictor 44 through which reject water ( i . e ., water that does not go through the reverse osmosis stage ) passes is instrumental in maintaining the pressure within the system 10 at between 25 and 150 psi when the influent water from the water source is supplied at typical household water pressure . if the discharge flow of reject water was not restricted , but allowed to flow freely out of the pressure vessel 12 , the water pressure in the system 10 would be lost and reverse osmosis could not efficiently occur . in the preferred embodiment shown in fig1 a third purification stage is provided which utilizes the cylindrical filter center tube 48 filled with activated carbon 46 . by directing potable water through the three stages of purification shown in fig1 chlorine , organics , undesirable chemicals , heavy metals , dissolved solids , and particulate solids are removed from the water . because the filter center tube 48 may be removed from the pressure vessel 12 easily , the activated carbon 46 filter is readily replaceable without requiring the user to discard the entire system 10 . additionally , three devices for water purification are housed in one attractive , appliance - shaped apparatus . fig2 illustrates a preferred embodiment of the present invention which utilizes essentially the same three stage purification system as is shown in fig1 except a modified first purification stage is used . instead of the sediment filter described in fig1 an assembly comprising a pre - filter 60 and a bed of activated carbon 62 is used . the bed of activated carbon 62 is disposed in an annular casing 64 and the casing 64 is wound with a fibrous material which serves as the pre - filter 60 . although fig2 shows a space between the inside wall of the pressure vessel 12 and the pre - filter 60 , it should be understood that the pre - filter 60 may occupy most all of the space between the inside wall of the pressure vessel 12 and the casing 64 housing the bed of activated carbon 60 . referring now to fig3 an alternative preferred embodiment of the present invention is shown . the system 10 utilizes the same first two stages of purification as is shown in fig1 namely , the sediment filter 52 and the reverse osmosis module 58 , but the third stage of purification differs . fig3 shows a hollow center tube 66 with a quartz envelope 67 enclosed an ultraviolet tube 68 disposed therein . the use of the ultraviolet tube 68 gives the user an option for disinfecting the water by eliminating bacteria and viruses . as water circulates through the hollow center tube 66 , it is exposed to the radiation from the ultraviolet tube 68 before it is discharged from the system 10 for use . although the embodiment shown in fig3 shows a sediment filter 52 and a reverse osmosis module 58 as the first two mediums , it should be understood that alternative filtration and / or separation mediums may be used as the first two purification stages without departing from the spirit of the present invention . with reference now to fig4 an alternative preferred embodiment is shown in which an additional purification stage is introduced to the system 10 without detracting from the outward attractiveness of the apparatus . a modified center tube 70 is provided which comprises an annular base filter 72 and does not have a top portal . in the absence of the top portal , a bridge plug 73 ( see fig1 - 3 ) is removed thereby altering the flow direction of the water . removal of the bridge plug 73 can be accomplished by striking it with a solid object . the modified center tube 70 then assists to direct the flow of the water leaving the reverse osmosis module 58 towards the base member 18 and through a conduit 74 into the base filter 72 which is disposed within the storage compartment 19 . internal of the base filter 72 is a fibrous mat 76 which serves to disperse the water flow evenly across the face of an activated carbon ring 78 . a second fibrous mat 80 , within the base filter 72 , serves to collect the water percolating through the carbon ring 78 and direct the water to a feeder channel 82 connected to a feeder tube 84 directed into the modified center tube 70 . within the modified center tube 70 is an ultraviolet tube 68 for disinfecting the water passing therethrough . in this embodiment , both filtration and disinfection is accomplished after the water is separated from impurities by traversing the reverse osmosis module 58 . referring now to fig5 a type of twist - lock connection is shown for connecting the perforated core cylinder 34 to either a filter center tube 48 , a hollow center tube 66 , or a modified center tube 70 . each of the center tubes has an ear 86 disposed on the exterior of the center tube , a bevelled lip 88 , and o - rings 90 . ears 86 are disposed and configured to engage a slot 92 and a notch 94 formed in the interior wall of the perforated core cylinder 34 . also formed in the interior wall of the perforated core cylinder 34 is a bevelled annular seat 96 . when one of the interchangeable center tubes is inserted into engagement with the perforated core cylinder 34 , the ear 86 slides up the slot 92 until the bevelled lip 88 engages the bevelled annular seat 94 and then the center tube is rotated to position the ear 86 in locking engagement with the notch 94 . the o - rings 90 serve to seal the connection from leakage . to remove the positioned center tube , the center tube is rotated in an opposite direction to release the ear 86 from the notch 94 so that the center tube can be retracted from the core area of the pressure vessel 12 . the removed center tube may be re - inserted or one of the interchangeable center tubes may be inserted . although a twist - lock connection is shown in fig5 for connecting one of the center tubes to the perforated core cylinder 34 , it should be understood that any other type of detachable connection that seals the connection from the water pressure inside the pressure vessel may be used without departing from the spirit of the invention . the methods for purifying potable water by using the preferred embodiments of the present invention vary according to which embodiment is used . such methods are best understood by following the flow path of the water through each embodiment . in fig1 influent potable water is introduced into the system 10 by connecting a tube or hose ( not shown ) to a water source such as a faucet or tap ( not shown ) and passing that tube or hose through a doorway 100 in the circular support leg 14 for connection with the inlet 38 . the connections for connecting the hose or tube to a faucet or tap and to the inlet 38 may be of a conventional type , and a quick - release pressure connection is preferred . water enters into the pressure vessel 12 through inlet 38 as shown by arrow a . upon entering the pressure vessel 12 , the water fills an entry plenum 102 which is an annular space between the inside wall of the pressure vessel 12 and the sediment filter 52 of the first purification stage . due to the water pressure typically supplied by the water source , water is forced through the sediment filter 52 , as shown at arrows b . in passing through the sediment filter 52 , the water is filtered to remove certain impurities such as chlorine , sediment and the like . as the water exits the sediment filter 52 , it enters into an annular internal plenum 104 which directs the water flow into the reverse osmosis module 58 , as shown at arrows c . water that traverses the reverse osmosis module 58 is separated from impurities ( e . g ., dissolved solids ) in manner that can be characterized as a molecule filter . such traversal of the water in the spirally wound reverse osmosis module 58 is signified by the curved arrows d . the water that does not traverse the reverse osmosis membrane collects in a reject water reservoir 106 where such reject water makes its way into and through the flow restrictor 44 and is discharged ( typically to a drain ) through the reject water outlet 40 , as shown at arrow e . as was explained with regard to the hose or tube connected to the water source , a hose or tube ( not shown ) is connected in conventional fashion to the reject water outlet 40 and is directed through the doorway 100 to a drain or to some other use for the reject water . the water traversing the reverse osmosis module 58 exits through the perforations 35 ( see arrows f ) in the perforated core cylinder 34 into a core area 108 of the pressure vessel 12 . this purified water , having passed through two stages of purification , enters into the filter center tube 48 through top portal 50 ( see arrow g ) and percolates through the activated carbon 46 to a purified water outlet 110 where the water is discharged to the user ( see arrow h ). the purified water passes through the purified water outlet 110 into a hose or tube ( not shown ) connected in a conventional fashion to the outlet 110 . the hose or tube carries the effluent purified water through the doorway 100 to the user for consumption or use . in a similar manner , the water travels through the system 10 in the preferred embodiment illustrated in fig2 except that instead of passing through the sediment filter described in fig1 the potable water entering the system 10 passes through the pre - filter 60 before entering into and percolating through the bed of activated carbon 62 . such pre - filtering is designed to remove impurities that can damage the reverse osmosis membrane . turning now to fig3 water travels inwardly through the concentric first and second purification mediums , as described above , into the core area 108 . the purified water is then directed through top portal 50 into the hollow center tube 66 ( arrow g ) where it is exposed to ultraviolet radiation from the ultraviolet tube 68 . the now disinfected water exits the hollow center tube 66 at the purified water outlet 110 ( arrow h ) for delivery to the user . with reference now to the embodiment of the present invention shown in fig4 the water travels inwardly through the concentric first and second purification mediums , as previously described , and enters the core area 108 where it is directed through conduit 74 ( as shown by arrow i ) into the base filter 72 . the fibrous mat 76 disperses the water evenly over the face of the activated carbon ring 78 . the water percolates through the carbon ring 78 and is collected by the second fibrous mat 80 which delivers the newly filtered water into the feeder channel 82 . the pressure within the system 10 then forces the water within the feeder channel 82 into the feeder tube 84 which communicates with the feeder channel 82 . the water is then directed into the modified center tube 70 where it is exposed to the disinfecting ultraviolet radiation from the ultraviolet tube 68 . the purified water , having also been disinfected , is discharged to the user through the purified water outlet 110 in a manner as previously described . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope . | 2 |
referring now to fig1 and 2 , there is shown a hinge 10 in its closed position , having first hinge member 12 and second hinge member 11 . the hinge 10 has holes 14 , 15 for receiving fasteners , for example bolts , to secure the first and second hinge members to a post and gate ( not shown ), respectively . it will also be appreciated that the hinge can be used with a door , with the first hinge member 12 being mountable to the door frame and the second hinge member 11 being mountable to the door . the holes 15 are preferably of elongate form to allow some adjustment of the height of the hinge relative to the gate or door during installation . once the hinge is positioned appropriately , a further fastener can advantageously be attached through hole 16 to prevent movement of the hinge under the weight of the door or gate . the first hinge member 12 has a substantially cylindrical body portion 30 . the second hinge member 11 may rotate about the longitudinal axis of the body portion 30 in order for the hinge to move between the closed and open position . the second hinge member 11 has a pair of collars 21 a , 21 b , one at each end . as best shown in fig4 , collar 21 a acts as a sleeve for end piece 60 , which is engaged with the flattened terminal segment 52 of a first end 55 of a biasing means 50 , via slot 62 . the biasing means 50 of the embodiments shown in the figures is a helical spring . end piece 60 also has a hole ( not shown ) to receive a pin or bolt ( or any other suitable fastener ) 80 . when the hinge is assembled , pin or bolt 80 passes through the hole 81 in collar 21 a into the hole in end piece 60 to secure end piece 60 to collar 21 a . a first end 55 of the helical spring 50 is thus fixed with respect to the end of the second hinge member 11 . the second end 56 of helical spring 50 also has a flattened terminal segment ( not shown ) which fits into a slot ( also not shown ) in a tooth portion 42 of an adjustment member 40 ( fig1 ), which also has a tool - receiving portion 41 . the adjustment member 40 is fixed with respect to the first hinge member 12 by virtue of the engagement of the second face 43 b ( fig2 ) of at least one of the teeth 43 with one of the stops 33 . stops 33 are asymmetric teeth located on the lower surface of a flange 31 which is located on the inner surface of the body portion 30 of first hinge member 12 . since opposite ends 55 , 56 of the helical spring are fixed with respect to respective hinge members 12 , 11 , rotational movement of the hinge members with respect to each other , for example by opening a gate to which the hinge 10 is attached , will tend to create a torsional restoring force to move the hinge 10 back to its original ( i . e . closed ) position . in fig1 and 2 it will be observed that the asymmetric teeth 43 have an inclined face 43 a . when a hex key ( not shown ) of appropriate dimensions is placed in the hexagonal recess 44 of the tool - receiving portion 41 of adjustment member 40 and turned clockwise ( as indicated by the arrows on tool - receiving portion 41 ), the inclined faces 43 a of teeth 43 will slide over the inclined faces 33 a of stops 33 , thereby compressing the spring 50 and increasing the longitudinal and torsional components of the tension as they do so . when the second faces 43 b of teeth 43 pass the ends of the inclined faces 33 a of the stops 33 , the longitudinal component will decompress the spring 50 in the longitudinal direction , but the spring 50 is restrained from decompression in the torsional direction as the teeth 43 bear against the second faces 33 b of the stops 33 . the teeth 43 of the adjustment member 40 thus act as a ratchet means by allowing rotational movement of the adjustment member 40 in one direction only ( in this example , the clockwise direction ). the second faces 33 b , 43 b need not be non - inclined faces as shown in the figures . angled faces could also provide the ratcheting mechanism described above . referring now to the exploded view of fig4 , it will be seen that the tool - receiving and tooth portions 41 , 42 of adjustment member 40 can be formed as two separate parts to form a releasable ratchet means . the portions 41 , 42 are engaged via the placement of boss 72 of tooth portion 42 in the corresponding aperture 71 of tool - receiving portion 41 . in the assembled hinge , the lower surface 73 of tool - receiving portion 41 sits on the upper surface 32 of the flange 31 ( fig3 ), while the teeth 43 of tooth portion 42 bear against the teeth 33 on the lower ( opposite ) surface of flange 31 . the recess 44 has a substantially flat base in which is formed an aperture or bore ( not shown ), the aperture having smaller diameter than the recess 44 and passing through tool - receiving portion 41 . a tool having sufficiently small diameter may then be inserted into the aperture and a compression force applied to the boss 72 of tooth portion 42 . this serves to disengage the teeth 43 from stops 33 , allowing the spring 50 to snap back to its original position . although it is of course highly advantageous for the teeth 43 and stops 33 to be located directly adjacent the tool - receiving portion 41 for efficient transfer of force to the ratchet means , the skilled person will appreciate that other arrangements are possible in which the teeth 43 and stops 33 are located at the end opposite the tool - receiving portion 41 . for example , tooth portion 42 could be in engagement with end portion 60 and the first end 55 of spring 50 . a shaft ( for example , a much more elongate version of the boss 72 ) passing through the centre of spring 50 and in engagement with tool - receiving portion 41 would be used to transmit force to the ratchet means . the second end 56 of spring 50 could be fixed with respect to hinge member 11 by any suitable means , for example by providing a sleeve around tool - receiving portion 41 , the sleeve being adapted to receive the second end 56 . it will be appreciated that many other modifications of the specific embodiments described herein are possible without departing from the scope of the present invention , as defined by the claims appended hereto . for example , the roles of the first and second hinge members may be reversed with suitable rearrangement of the internal components . the terminal segments 52 of the spring 50 need not be transverse to the axis of the cylindrical body portion 30 as shown , but may be aligned longitudinally to fit into recesses in end portion 60 and tooth portion 42 . end portion 60 could also be replaced with a second adjustment member to provide additional scope to adjust the spring tension . the number of teeth 43 on tooth portion 42 is not fixed , and indeed may be increased to provide even finer stepped adjustment of the tension , if so desired . | 8 |
the arrangement of the print hammer striking surfaces and the print magnets 2 thereof is as shown in fig1 . in such a printing device , as is well known in the art , printing data codes for one line to be printed by the above - described print hammers are received from a data source such as a cpu ( central processing unit ) and stored in the above - described plb 11 , as shown in fig2 . during a printing cycle , whenever a type on a type carrier ( not shown ) is moved by one pitch , the plb 11 is scanned so that the code of a type confronting a print hammer is compared with the code of a character to be printed . when the two codes coincide with each other as a result of the comparison , the print hammer of that column is driven to print the character . for convenience in description , the method of scanning the plb 11 will be described with reference to a band printer in which during one main scan , i . e ., whenever a type is moved by one pitch , sub - scan is carried out five times . in a printing device carrying out the sub - scan five times , the columns of print hammers driven in each sub - scan are as listed below : in this connection , 132 columns are provided for one line . in the sub - scan 1 , the plb 11 is scanned in the order of 1st , 6th . . . and 131st columns . each printing data code is outputted by the plb , and the codes of types confronting respectively with the print hammers of the columns are outputted by a type code generator 14 ( hereinafter referred to as &# 34 ; a ccg 14 &# 34 ;). the printing data codes and type codes are subjected to comparison in a comparator 15 . before the comparison is carried out to drive a print hammer , detection is carried out as to whether the print magnets 2 on both sides of the relevant column have been excited or not . this detection method will now be described . in the plb 11 , in addition to a printing data code memory region 111 , a flag memory 112 is provided which stores a logic value &# 34 ; 1 &# 34 ; ( hereinafter referred to as &# 34 ; 1 &# 34 ;) while each print hammer and accordingly each print magnet 2 is being excited and stores a logic value &# 34 ; 0 &# 34 ; ( hereinafter referred to as &# 34 ; 0 &# 34 ;) while it is not driven . accordingly , when the printing data code of each column is received from the data source , &# 34 ; 0 &# 34 ; is written into all of the columns of the flag memory 112 . when the sub - scan 1 is started in the printing cycle , the 1st column print hammer can be driven first . the 3rd column and the - 1st column ( which does not exist and is a phantom column ) are next to the column of the 1st column print magnet 2 . thus , it is detected whether or not these columns &# 39 ; print magnets 2 are being excited . when a memory scan is started in the sub - scan 1 , the top address (- 1st column ) of the sub - scan 1 in a plb address memory 21 is specified by a signal c 1 , c 2 , c 3 indicating the sub - scan number , and a plb counter 12 specifies the - 1st column with the aid of a preset signal d . the output of the plb 11 for this column is ineffective but scans the plb 11 . thereafter , four count - up clock pulses a are outputted by a scan controller 13 . as a result , the content of the plb counter 12 is increased by four counts and the 3rd column is specified . since the 3rd column of the flag memory 112 is &# 34 ; 0 &# 34 ;, a latch 18 is maintained reset , and the output of the latch 18 is &# 34 ; 0 &# 34 ;. thereafter , the scan controller 13 outputs two count - down clock pulses b . as a result , the content of the plb counter 12 is decreased by two counts , and the 1st column is specified . the plb 11 outputs a printing data code for the 1st column , and the printing data code is applied to a comparator 15 . the code of a type confronting with the 1st column print hammer is outputted by the ccg 14 and is applied to the comparator 15 . when the printing data code coincides with the type code , then the output e of the comparator 15 is set to &# 34 ; 1 &# 34 ;. in this case , the outputs of a latch 17 and the latch 18 are &# 34 ; 0 &# 34 ;, that is , the adjacent print magnets 2 are not being excited . therefore , the output of a nand gate 20 is &# 34 ; 1 &# 34 ;. if , when the output of the comparator 15 is &# 34 ; 1 &# 34 ;, a hammer firing signal f is provided , then a nand gate 19 is opened to output a signal hamset . as a result , the 1st column print hammer is driven by a drive circuit and a print magnet ( not shown ). the 6th column print magnet can be excited next . the columns of the print magnets adjacent thereto are the 4th and 8th columns . in order to detect whether or not these adjacent print magnets are excited , three count - up clock pulses a are outputted by the scan controller 13 . as a result , the content of the plb counter 12 is increased by three counts , and the 4th column is specified . in this operation , the latches 17 and 18 are reset by a signal k from the scan controller 13 . because the 4th column of the flag memory 112 is &# 34 ; 0 &# 34 ;, the latch 17 is maintained reset and the output of the latch 17 is &# 34 ; 0 &# 34 ;. thereafter , four count - up clock pulses a are outputted by the scan controller 13 and the content of the plb counter 12 is increased by four counts . hence the 8th column is specified . as the 8th column of the flag memory 112 is &# 34 ; 0 &# 34 ;, the latch 18 is maintained reset . thereafter , two count - down clock pulses b are provided by the scan controller 13 , the content of the plb counter 12 is decreased by two counts , and the 6th column is specified . the printing data code for the 6th column is provided by the plb 11 and is applied to the comparator 15 . the code of a type confronting with the 6th column print hammer is outputted by the ccg 14 , and is applied to the comparator 15 . when the printing data code coincides with the type code , then the output e of the comparator 15 is raised to &# 34 ; 1 &# 34 ;. in this case , the output of the nand gate 20 is &# 34 ; 1 &# 34 ;. therefore , if the output of the comparator 15 is &# 34 ; 1 &# 34 ;, the signal hamset is set to &# 34 ; 0 &# 34 ;, and the 6th column print hammer is driven . similarly , the information in the flag memory 112 of the plb with respect to the - 2nd and + 2nd columns from the column of a print hammer which can be driven in the sub - scan 1 is detected . when the information in the flag memory 112 is &# 34 ; 1 &# 34 ;, the latches 17 and 18 are set . however , when the information in the flag memory 112 is &# 34 ; 0 &# 34 ;, the latches 17 and 18 are maintained reset . the printing data code for the column of the print hammer is applied from the plb 11 to the comparator 15 , where it is compared with the respective type code . when the sub - scan 2 is started after the completion of the sub - scan 1 , the plb counter 12 presets the top address of the sub - scan 2 in the plb address memory 21 and specifies the 0 - th column ( which does not exist and is a phantom column ). the output of the plb 11 for this column is ineffective but scans the plb 11 . thereafter , four count - up clock pulses a are provided by the scan controller 13 and as a result , the content of the plb counter 12 is increased by four counts and the 4th column is specified . since the 4th column of the flag memory 112 is &# 34 ; 0 &# 34 ;, the latch 18 is maintained reset , and the output of the latch 18 is &# 34 ; 0 &# 34 ;. then , two count - down clock pulses b are outputted by the scan controller 13 . consequently the content of the plb counter 12 is decreased by two counts and the 2nd column is specified . a printing data code for the 2nd column is applied from the plb 11 to the comparator 15 . on the other hand , the code of a type confronting the 2nd column print hammer is outputted by the ccg 14 , and it is applied to the comparator 15 . when the two codes are coincident with each other , the output e of the comparator 15 is set to &# 34 ; 1 &# 34 ;. the output of the nand gate 20 is &# 34 ; 1 &# 34 ; and therefore the signal hamset is set to &# 34 ; 0 &# 34 ;. hence , the 2nd column print hammer is driven . thereafter , similarly as in the sequence of the sub - scan 1 , the information in the flag memory 112 of the plb with respect to the - 2nd and + 2nd columns from the column of a print hammer which can be driven in the sub - scan 2 is detected . when the information in the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latches 17 and 18 are set , whereas if the information is &# 34 ; 0 &# 34 ;, then the latches 17 and 18 are maintained reset . thereafter , the printing data code for the column of the print hammer is applied from the plb 11 to the comparator 15 , where it is compared with the type code . when the sub - scans 3 , 4 and 5 are started , the plb counter 12 specifies the 1st , 2nd and 3rd columns with the aid of the plb address memory 21 , respectively . thereafter , as in the above - described sequence , the information in the flag memory 112 with respect to the - 2nd and + 2nd columns from the column of a print hammer which can be driven in each subscan is detected . when the information in the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latches 17 and 18 are set . however , if the information is &# 34 ; 0 &# 34 ;, then the latches 17 and 18 are maintained reset . thereafter , the printing data code for the column of the print hammer from the plb 11 is compared with the respective type code in the comparator 15 . the case where the device according to the invention becomes effective will be described with reference to fig3 . it is assumed that in the sub - scan 5 of the n - th main scan , the 5th column print hammer is driven . in this operation , &# 34 ; 1 &# 34 ; is written into the 5th column of the flag memory 112 . furthermore , it is assumed that at this time none of the 1st , 3rd , 7th and 9th print hammers are driven . in the sub - scan 1 of the ( n + 1 )- th main scan , the 1st print hammer is driven and &# 34 ; 1 &# 34 ; is written into the 1st column of the flag memory 112 . in driving the 7th column print hammer in the subscan 2 of the same main scan , first the 5th column of the flag memory 112 is &# 34 ; 1 &# 34 ;, therefore the latch 17 is set , and the output of the latch 17 is set to &# 34 ; 1 &# 34 ;. next , the 9th column of the flag memory 112 is &# 34 ; 0 &# 34 ;, and therefore the latch 18 is maintained reset . accordingly , the output of the nand gate 20 is &# 34 ; 1 &# 34 ;, and the printing data code for the 7th column from the plb 11 is compared with the type code in the comparator 15 . when the two codes are coincident with each other , the signal hamset is set to &# 34 ; 0 &# 34 ;, and the 7th column print hammer is driven . however , if the printing data code does not coincide with the type code , then the 7th column print hammer is not driven , and the 7th column of the flag memory 112 is maintained at &# 34 ; 0 &# 34 ;. in driving the 3rd column print hammer in the subscan 3 of the same main scan , first the 1st column of the flag memory 112 is &# 34 ; 1 &# 34 ;, and therefore the latch 17 is set , and the output of the latch 17 is set to &# 34 ; 1 &# 34 ;. next , the 5th column of the flag memory 112 is also &# 34 ; 1 &# 34 ;, therefore , the latch 18 is set , and the output of the latch 18 is set to &# 34 ; 1 &# 34 ;. accordingly , the output of the nand gate 20 is &# 34 ; 0 &# 34 ;. thereafter , the printing data code for the 3rd column from the plb 11 is compared with the type data . it is assumed that as a result of the comparison the two data are coincident with each other . in this case , the output of the nand gate 20 is &# 34 ; 0 &# 34 ; as described above , and accordingly the signal hamset is not set to &# 34 ; 0 &# 34 ;. therefore , the 3rd column print hammer is not driven . that is , driving the 3rd column print hammer is postponed until the next coincidence of the data occurs . signals g and h applied from the scan controller 13 to and gates 16 and 16 respectively are timing signals . more specifically , in exciting the print magnet 2 of each column , the timing signals are employed to specify the information in the flag memory with respect to the - 2nd and + 2nd columns adjacent to the each column . this embodiment of the invention has been described with reference to the band printer . in the case of a drum printer , the magnetic interference of the adjacent print magnets 2 ca be prevented according to the invention . in a drum printer , all of the columns are scanned by one scanning operation to perform one memory scanning in one main scan . in this case , the flag bits of the ( n - 2 )- th and ( n - 2 )- th columns are checked before the n - th column print hammer is driven . if the print hammers of the two adjacent columns are driven , driving the n - th column print hammer is inhibited . when the memory scan of each main scan is started , the plb counter 12 specifies the - 1st column ( which does not exist and is a phantom column ). although the output of the plb 11 for this column is ineffective , it carries out the scan . thereafter , four count - up clock pulses are provided by the scan controller 13 , the content of the plb counter 12 is increased by four counts , and the 3rd column is specified . if the 3rd column of the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latch 18 is set , whereas if it is &# 34 ; 0 &# 34 ;, then the latch 18 is maintained reset . thereafter , two count - down clock pulses are produced by the scan controller 13 . as a result , the content of the plb counter 12 is decreased by two counts , and the 1st column is specified . in the case of driving the 1st column print hammer , the latch 17 is maintained reset , and therefore the output of the nand gate 20 is &# 34 ; 1 &# 34 ;. when the printing data code is coincident with the type code for the 1st column , then the 1st column print hammer is driven . then , one count - down clock pulse is provided by the scan controller 13 , the content of the plb counter 12 is decreased by one count , and the 0 - th column ( which does not exist and is a phantom column ) is specified . in this operation , the latches 17 and 18 are reset . the output of the plb 11 for the 0 - th column is ineffective , but carries out the scanning . thereafter , four count - up clock pulses are provided by the scan controller 13 . as a result , the content of the plb counter 12 is increased by four counts and the 4th column is specified . when the 4th column of the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latch 18 is set , whereas if it is &# 34 ; 0 &# 34 ;, then the latch 18 is maintained reset . then , two count - down pulses are outputted by the scan controller 13 , so that the content of the plb counter 12 is decreased by two counts , and the 2nd column is specified . in driving the 2nd column print hammer , the latch 17 is maintained reset , and therefore the output of the nand gate 20 is &# 34 ; 1 &# 34 ;. therefore , if the printing data code and the type code for the 2nd column are coincident with each other , then the 2nd column print hammer is driven . thereafter , one count - down clock pulse is provided by the scan controller , the content of the plb counter 12 is decreased by one count , and the 1st column is specified . in this operation , the latches 17 and 18 are reset . if the 1st column of the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latch 17 is set , and if it is &# 34 ; 0 &# 34 ;, then the latch 17 is maintained reset . thereafter , the scan controller 13 provides four count - up clock pulses , the content of the plb counter 12 is increased by four counts , and the 5th column is specified . when the 5th column of the flag memory 112 is &# 34 ; 1 &# 34 ;, then the latch 18 is set , and when it is &# 34 ; 0 &# 34 ;, then the latch 18 is maintained reset . then , the scan controller 13 outputs two count - down clock pulses , so that the content of the plb counter 12 is decreased by two counts , and the 3rd column is specified . in the case of driving the 3rd column print hammer , when both the 1st and 5th columns of the flag memory 112 are &# 34 ; 1 &# 34 ; and the output of the nand gate 20 is &# 34 ; 0 &# 34 ;, the signal hamset is not set to &# 34 ; 0 &# 34 ;. this happens even if the printing data code coincides with the type code and the output of the comparator 15 is therefore &# 34 ; 1 &# 34 ;. that is , in this case , the 3rd column print magnet 2 is not excited . succeedingly , the scan controller 13 outputs one count - down clock pulse . hence the content of the plb counter 12 is decreased by one count , and the 2nd column is specified . thereafter , the flag bits of the - 2nd and + 2nd columns from the column of a print hammer to be driven are checked . when both of the columns are &# 34 ; 1 &# 34 ;, the latches 17 and 18 are set , and the output of the nand gate 20 is set to &# 34 ; 0 &# 34 ;. even if the printing data code coincides with the type code , driving of the print hammer for the column is inhibited . in the above - described embodiment , the adjacent print magnets occur every two columns ; however , it should be noted that the invention is not limited thereto or thereby . for instance , in a printing device in which the print magnets 2 are disposed adjacent to one another as shown in fig4 before the n - th column print hammer is driven , the flag bits of the ( n - 1 )- th and ( n + 1 )- th columns are checked , and when both are &# 34 ; 1 &# 34 ;, driving the n - th column print hammer is inhibited . a second preferred embodiment invention will be described with reference to fig5 - 8 . fig5 is an excitement timing diagram of the print magnet 2 shown in fig1 . fig6 is a characteristic diagram indicating the change of flight time due to the magnetic interference . if the n - th column print magnet 2 is excited x time and y time respectively after the excitement of the ( n - 2 )- th column and ( n + 2 )- th column print magnets , then the change in flight time of the n - th column print hammer is as indicated in fig6 because of the change of the x time and y time , i . e . the change of the n - th column print magnet &# 39 ; s excitation timing . in fig5 reference character t w designates the pulse width of the print magnet 2 which is for instance 1140 μs , and reference character t f designates the flight time of the print hammer which is for instance 1350 μs . if it is assumed that the movement speed of the type carrier is 6 . 7 m / s , then the printing shifts corresponding to the flight time shifts 10 μs , 20 μs , 30 μs , 40 μs and 50 μs are 0 . 067 mm , 0 . 134 mm , 0 . 201 mm , 0 . 268 mm and 0 . 335 mm , respectively . accordingly , in order to accept a printing shift less than 0 . 2 mm and to prevent the occurrence of a printing shift more than 0 . 2 mm , the excitation of the n - th column print magnet 2 should be inhibited only when the aforementioned x time and y time , i . e . both of the excitement lapse time of the adjacent print magnets on both sides of the n - th column print magnet 2 are in the range of from about 474 μs to about 948 μs . before a method of monitoring the excitement lapse times of the print magnets 2 is described with respect to this embodiment it is appropriate to review the operation of a band printer having 132 columns per line in which five sub - scans are carried out in one print scan operation , i . e . whenever the types of a type carrier running horizontally is moved by one type pitch . this embodiment uses the technique of dividing into various cycle periods . the exciting pulse widths of the print magnets of all of the columns can be collectively controlled by employing a method in which , in the sub - scan , the comparison period of a column is divided into the first half period ( hereinafter referred to as &# 34 ; the reset cycle &# 34 ;) and the second half period ( hereinafter referred to as &# 34 ; the set cycle &# 34 ;), and in the reset cycle the excitement ending timing of each column is controlled while in the set cycle the excitation starting timing of the print magnet 2 of each column is controlled . listed below are the columns for which the comparison is carried out in the sub - scans . numerals in the parentheses () designate the numbers of columns which are read out in the reset cycle , and numerals outside the parentheses () designate the numbers of columns which are read out in the set cycle . all the columns are regularly and sequentially read out . ______________________________________ sub - scan 1 ; 1 ( 4 ), 6 ( 9 ), 11 ( 14 ),..... 126 ( 129 ), 131 ( x ) sub - scan 2 ; 2 ( 5 ), 7 ( 10 ), 12 ( 15 ),..... 127 ( 130 ), 132 ( x ) print sub - scan 3 ; 3 ( 1 ), 8 ( 6 ), 13 ( 11 ),...... scan 128 ( 126 ), x ( 131 ) sub - scan 4 ; 4 ( 2 ), 9 ( 7 ), 14 ( 12 ),..... 129 ( 127 ), x ( 132 ) sub - scan 5 ; 5 ( 3 ), 19 ( 8 ), 15 ( 13 ),..... 130 ( 128 ), x ( x ) ______________________________________ the above - described exciting pulse width collective control can be achieved by adding at least three flag bits to a printing data code transferred from a data source . the flag bits correspond to the respective printing data codes . first , if when a printing data code is transferred from the data source , data to be printed are available for the column , then flag bits ( 000 ) are added to the printing data code . if not , then flag bits ( 111 ) are added to the printing data code . thereafter , in the printing operation , the printing data code is compared with the type code in the set cycle of each sub - scan . if both of the codes are coincident with each other , the print magnet 2 of the column is excited , while the flag bits ( 000 ) of the column is changed to the flag bits ( 001 ). the flag bits of the column the print magnet 2 for which has been excited are changed from ( 001 ) to ( 010 ) when read out in the set cycle of the respective sub - scan in the next print scan . the flag bits are changed from ( 010 ) to ( 011 ) when read out again in the next print scan . in the reset cycle of each sub - scan , if the flag bits of a column read out are ( 011 ), then the excitement of the column is ended , and the flag bits are changed from ( 011 ) to ( 111 ). in the reset cycle , if the flag bits are not ( 011 ), then the operation is not carried out . this can be readily understood by reference to fig8 which is a timing diagram indicating the excitation of the 1st , 3rd and 5th column print magnets 2 . the excitation lapse time of each print magnet 2 can be detected by reading the flag bit data of the relevant column . if it is assumed that the period of each sub - scan is 95 μs , then the flag bits are ( 010 ) in the excitation lapse time of from 474 μs to 948 μs described above . accordingly , in exciting the print magnet 2 of a column , the flag bits of columns corresponding to the adjacent print magnets on both sides of the firstly - mentioned print magnet are read out . if both of the flag bits are ( 010 ), then the excitation of the print magnet is inhibited . if they are not ( 010 ), then the excitement is started . fig7 is a block diagram showing a second embodiment of the device according to this invention . the same elements as in the first embodiment have been similarly numbered . a buffer memory 11 ( hereinafter referred to as &# 34 ; a plb 11 &# 34 ;) stores separately according to the columns the printing data codes for one line which are transferred from the above - described data source . the plb 11 comprises : a printing code memory 111 , and flag memories 112 and 113 for storing the above - described excitation lapse time information , i . e . the flag bits . the flag memory 112 is employed to control the exciting pulse width of the print magnet 2 , while the other flag memory 113 is employed to control whether or not the excitation of the print magnet 2 should be started for the prevention of magnetic interference . the addresses in the printing code memories 111 and the flag memory 112 are accessed in a predetermined sequence by an address controller 23 in the above - described sub - scan &# 39 ; s set and reset cycles . writing is effective for the flag memories 112 and 113 simultaneously in the sub - scan &# 39 ; s set cycle as described above . however , the writing method and the method of accessing with the address controller 23 will not be described because the technical concept of controlling the exciting pulse width with the flag bits is well known in the art . the printing data code from the plb 11 is applied to a comparator 15 , where it is compared with a type code which is applied to the comparator 15 from a type code generator 14 ( hereinafter referred to as &# 34 ; a ccg 14 &# 34 ;) and corresponds to the print hammer of the relevant column . when both of the codes are coincident with each other , the comparator 15 outputs a coincidence signal e having &# 34 ; 1 &# 34 ;. the flag memory 113 is accessed by a plb scan controller 13 with the aid of a plb counter 12 and a plb address memory 21 as described later . among the flag bits b 0 , b 1 and b 2 of the flag memory 113 , the flag bits b 0 and b 2 are applied through inverters 27 to an and gate 28 , and the flag bit b 1 is applied directly to the and gate 28 . when the flag bits are ( 010 ), the and gate 28 provides an output having &# 34 ; 1 &# 34 ;. the output &# 34 ; 1 &# 34 ; is applied to the &# 34 ; d &# 34 ; input terminals of d - type flip - flops 30 and 31 . a timing signal g for designating the ( n - 2 )- th column and a timing signal h for designating the ( n + 2 )- th column are applied from the plb scan controller 13 to the trigger input terminals t of the flip - flops 30 and 31 , respectively , when the n - th column scanning is effected . the &# 34 ; q &# 34 ; outputs of the flip - flops 30 and 31 are applied through a nand gate 32 to one input terminal of an and gate 29 , to the remaining two input terminals of which the coincidence signal e from the comparator 15 and a fire timing signal f having &# 34 ; 1 &# 34 ; from the scan controller 13 are applied , respectively . when all of these input signals are &# 34 ; 1 &# 34 ;, the gate 29 is opened to apply a signal having &# 34 ; 1 &# 34 ; to a print magnet drive circuit ( not shown ). accordingly , when both of the flag bits of the ( n - 2 )- th and ( n + 2 )- th columns are ( 010 ), both of the &# 34 ; q &# 34 ; outputs of the flip - flops 30 and 31 are raised to &# 34 ; 1 &# 34 ;, and the nand gate 32 is opened . that is , the output of the nand gate 32 is set to &# 34 ; 0 &# 34 ;. therefore , the and gate 29 is not opened , so that the excitation of the print magnet is inhibited . the operation of the device of the invention shown in fig7 will be described . in the sub - scan 1 , the column of the print magnet 2 which can be excited is the 1st column . the - 1st column ( which does not exist and is a phantom column ) and the 3rd column are adajacent to the 1st column . accordingly , the excitation lapse times for these adjacent columns should be detected . in starting the memory scanning of the sub - scan 1 , the plb address memory 21 specifies the top address - 1st columns of the sub - scan 1 with the aid of a signal c 1 , c 2 , c 3 indicating the sub - scan number . the plb counter 12 specifies the - 1st column with the timing of a preset signal d from the scan controller 13 . as a result , the flag bits in the flag memory 113 , which corresponds to the - 1st column , i . e . the excitation lapse time information having &# 34 ; 0 &# 34 ; is produced by the flip - flop 30 with the timing of the above - described timing signal g . then , the scan controller 13 outputs four count - up clock pulses a to increase the content of the plb counter 12 by four counts . as a result , the 3rd column is specified . the excitation lapse time information having &# 34 ; 0 &# 34 ; corresponding to the 3rd column is produced by the flip - flop 31 with the timing of the aforementioned timing signal h . thereafter , two count - down clock pulses b are provided by the scan controller 13 , the content of the plb counter 12 is decreased by two counts , and the 1st column is specified . simultaneously , in the printing code memory 111 , the 1st column is accessed by the address controller 23 , and the printing code thereof is applied to the comparator 15 . when the printing code is coincident with the type code from the ccg 14 , then the comparator 15 outputs the coincidence signal e having &# 34 ; 1 &# 34 ;. the and gate 29 is opened with the timing of the timing signal f to thereby start the excitation of the 1st column print magnet 2 . the 6th column can be excited next , and the 4th and 8th columns are adjacent to the 6th column . therefore , the scan controller 13 successively produces three count - up clock pulses a , four count - up clock pulses a and two count - down clock pulses b to specify the 4th column , the 6th column and 8th column , respectively . the above - described operations are repeatedly carried out . thereafter , as in the above - described case , the scan operation of the sub - scan 1 is carried out . the excitation of the 3rd column print magnet in the sub - scan 3 will be described . in this connection , it is assumed that the excitations of the 1st and 5th print magnets adjacent to the 3rd column print magnet are as indicated in fig8 . the plb address memory 21 specifies the top address 1st column with the aid of the aforementioned signal c 1 , c 2 , c 3 designating the sub - scan number , and the plb counter 12 specifies the 1st column with the timing of the preset signal d from the scan controller 13 . the flag bits for the 1st column of the flag memory 113 are ( 001 ) in the ( n + 1 )- th print scan , ( 010 ) in the ( n + 2 )- th print scan , and ( 111 ) in the ( n + 3 )- th print scan . therefore , the &# 34 ; q &# 34 ; output of the flip - flop 30 is set to &# 34 ; 0 &# 34 ; in the ( n + 1 )- th print scan and in the ( n + 3 )- th print scan , and it is set to &# 34 ; 1 &# 34 ; in the ( n + 2 )- th print scan . as in the above - described case , the plb counter 12 next specifies the 5th column . similar to the case of the 1st column , the flag bits for the 5th column in the flag memory 113 are ( 001 ), ( 010 ) and ( 111 ) respectively in the ( n + 1 )- th , ( n + 2 )- th and ( n + 3 )- th print scans , and therefore the &# 34 ; q &# 34 ; output of the flip - flop 31 is raised to &# 34 ; 1 &# 34 ; only in the ( n + 2 )- th print scan . accordingly , the start of excitation of the 3rd column print magnet 2 is inhibited only in the ( n + 2 )- th print scan . however , it is allowed in the ( n + 1 )- th and ( n + 3 )- th print scans . the above - described exciting pulse width and flight time are merely examples ; that is , they can be changed as desired depending on the speed of the type carrier , etc . furthermore , in the above - described embodiment , the start of excitation is inhibited in the case where both of the flag bits for the columns on the both sides are ( 010 ). however , the values of the flag bits can be changed if necessary . as is apparent from the above description , according to the invention , the magnetic interference attributing to the leakage flux can be positively prevented . as a result , characters can be printed with high quality , and the size of the print hammer module , or the actuator module , can be reduced . furthermore , according to the invention , even if the adjacent print magnets on both sides of a central print magnets are excited , the excitation of the central print magnet is not immediately inhibited . that is , the start of excitation thereof is inhibited only for the predetermined excitation lapse time during which the effect of the magnetic interference is significant . accordingly , the number of times of inhibitions is reduced , which leads to the prevention of the lowering of the printing speed . | 1 |
as used herein , a hosf is a microprocessor circuit and associated memories with busses coupling them that configured to perform the steps described herein . the vanc is a microprocessor controller circuit and associated memories and busses coupling them that are configured to perform the steps described herein . referring to fig4 , an embodiment of the invention is shown . as seen therein , an lte attachment or tau will trigger ue 401 to start the register or register update procedure . the ue 401 may not start the register or register update procedures during an active call . the vanc 402 will upon receiving the register or register update check if a plurality of hosfs 403 a - n ( shown as hosf 1 - 3 ), have been informed before that the ue 401 is registered to the vanc 402 . if not , the vanc 402 will send data with the vanc name / address and international mobile subscriber identity ( imsi ) of the ue 401 , all in parallel , to the plurality of hosfs 403 a - n in the network . the addresses of each of the plurality of the hosfs are provisioned via operations and maintenance ( o & amp ; m ) activity . the addresses could either be ip addresses or fully qualified domain names ( fqdns ). each of the plurality of hosfs acknowledge the request with a response . the method of the first embodiment are the steps of triggering , by an lte attachment or tau , a ue 401 to start the register or register update procedure , provided the ue 401 may not start the register or register update procedures during an active call ; then checking , by the vanc 402 , upon receiving the register or register update , if a plurality of hosfs 403 a , 403 b , 403 c , have theretofore been notified that the ue 401 is registered to the vanc 402 . if not , then the next step is sending , by the vanc 402 , data with the vanc name / address and imsi of the ue 401 , all in parallel , to the plurality of hosfs 403 a , 403 b , 403 c in the network . to accomplish this step , the step also includes provisioning the addresses of each of the plurality of the hosfs via o & amp ; m activity . in such case , the addresses could either be ip addresses or fqdns . the final step is acknowledging , by each of the plurality of hosfs , the request with a response . fig5 illustrates another embodiment 500 of the invention . as seen therein , an lte attachment or tracking area update ( tau ) will trigger the ue 501 to start the registration / registration update procedure . the ue 501 will start the registration update procedures during an active call , thus at every ho , if there is a tau , the registration update procedures will start . the vanc 502 will , upon receiving a register and register update , select a hosf 503 based on the ta id received . note that the ta will have 2g / 3g neighbors that an enb will select for ho targets . the vanc 502 will then check if the selected hosf 503 has been theretofore notified that ue 501 is registered to said vanc 502 . if not so notified , vanc 502 will send a signal with the vanc name / address and imsi of the ue 501 to the selected hosf 503 . the address of the hosfs in the network and the ta 2g / 3g neighboring cell relation are pre - provisioned via o & amp ; m activity . the addresses could either be ip addresses or fqdns . the hosfs then acknowledge the request with a response . the handover procedures are then performed as in the ims based solution without database as disclosed in applicant &# 39 ; s co - pending patent application u . s . ser . no . 61 / 105 , 623 . as disclosed therein , at ho to 2g / 3g , the mme will , based on target cell , select a hosf ( instead of an msc as in srvcc ), then the hosf will determine at which vanc the ue is registered , and forward the ho signaling to that vanc . the hose does this based on the imsi received in the first phase as disclosed therein . all ho signaling will pass the hosf for this ho . referring to fig6 a , the method starts at step 601 a . at step 602 a , the register or register update is received at the vanc . at step 603 a , the vanc will select a hose based on received ta and configured data . at step 604 a , it will check if the hosf has already been informed about the ue &# 39 ; s whereabouts , via its imsi . if so , the vanc will not contact the selected hosf , and the method will stop at step 606 a , otherwise , at step 605 a , the vanc will signal the hosf to inform that the ue is registered within this vanc . referring to fig6 b , the method starts at step 601 b . at step 602 b , the register or register update is received at the vanc . at step 603 b , the vanc will select a number of hosfs based on received ta and configured data . at step 604 b , it will check if these hosfs have already been informed about the ue &# 39 ; s whereabouts , via its imsi . if so , the vanc will not contact the selected hosfs and the method will stop at step 606 b , otherwise , at step 605 b , the vanc will signals to all the selected hosfs in parallel to inform that the ue is registered within this vanc . the invention may be realized in hardware , software , or a combination of hardware and software . the invention may be realized in a centralized fashion in at least one computer system , or in a distributed fashion where different elements are spread across several interconnected computer systems . any kind of computer system or other apparatus adapted for carrying out the methods described herein is suited . a typical combination of hardware and software may be a general - purpose computer system with a computer program that , when being loaded and executed , controls the computer system such that it carries out the methods described herein . the invention may also be embedded in a computer program product , which comprises all the features enabling the implementation of the methods described herein , and which when loaded in a computer system is able to carry out these methods . computer program in the present context means any expression , in any language , code or notation , of a set of instructions intended to cause a system having an information processing capability to perform a particular function either directly or after either or both of the following : a ) conversion to another language , code or notation ; b ) reproduction in a different material form . while the invention has been described with reference to certain embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from its scope . therefore , it is intended that the invention not be limited to the particular embodiment disclosed , but that the invention will include all embodiments falling within the scope of the appended claims . | 7 |
as shown in fig1 feedstock used oil passes through a filter 1 and a pump 2 before being heated to the required temperature in a heat exchanger 3 , from which it then passes to the cyclonic evaporator 4 by way of a flowmeter 5 which controls a valve 6 so as to regulate the flow of feedstock . the feedstock is then tangentially injected into the evaporator 4 , in which predetermined temperature and pressure conditions are applied . since the pressure in the evaporator 4 is less than atmospheric pressure , a predetermined fraction of the feedstock will be flashed off and pass upwards through a spray condenser 7 , while the remaining fractions will fall to the bottom of the evaporator to form the bottoms product 8 . the bottoms product 8 is recirculated by way of a pump 9 and a heat exchanger 10 to the evaporator 4 . a temperature sensor 11 controls a valve 12 in the thermal oil supply 13 to the heat exchanger 10 , thereby enabling control over the temperature of the recirculating bottoms product 8 . a level controller 14 in the evaporator 4 controls a valve 15 which allows a proportion of the recirculating bottoms product 8 to be passed on for further processing as the bottom of the evaporator 4 fills up . part of the vapour fraction evaporated from the feedstock tangentially injected into the evaporator 4 is condensed in the spray condenser 7 . this distillate is recirculated to the spray head 16 by way of a holding tank 17 , a pump 18 and a heat exchanger 19 . the cooling water input to the heat exchanger 19 is controlled by a temperature sensor 20 connected to the spray condenser 7 , thereby enabling control of the temperature in the spray condenser to be achieved . a level controller 33 in the holding tank 17 controls a valve 21 which allows a proportion of the recirculating distillate to be fed to storage . the vapour fraction which is not condensed in the spray condenser 7 passes to a subsequent condenser 22 . the liquid fraction condensed in the condenser 22 is recirculated by way of a holding tank 23 , a pump 24 and a heat exchanger 25 . the cooling water input to the heat exchanger 25 is controlled by a temperature sensor 26 connected to the condenser 22 , thereby enabling control of the temperature in the condenser to be achieved . a level controller 34 in the holding tank 23 controls a valve 27 which allows a proportion of the recirculating distillate to be fed to storage . the vapour fraction which is not condensed in the condenser 22 passes to a vacuum system comprising two pumps 28 and 29 , a cooler 30 and a holding tank 31 . the primary function of the vacuum system is to maintain the vacuum in the main evaporator 4 . a distillate produced in the vacuum circuit may be fed to storage , while the remaining vapour fraction may be fed through pipe 32 for incineration . fig2 shows four interconnected evaporator stages similar to that shown in fig1 . in the first stage , water and some light ends are obtained in the spray condenser 7 , while further light ends are obtained in the secondary condensation circuit 35 . the evaporator 4 of the first stage may operate at a temperature of 160 ° to 180 ° c . and a pressure of 400 mbar vacuum to atmospheric pressure . a proportion of the bottoms product of the first stage is passed on to the second stage for further processing . in the second stage , the evaporator 4 ′ is operated at a temperature of 260 ° to 290 ° c . and a pressure of 40 to 100 mbar vacuum . light oil and light fuel oil are condensed in the spray condenser and gas oil is condensed in the secondary condensation circuit 35 ′. the bottoms product of the second stage is fed to the third stage , where the evaporator 4 ″ is operated at a temperature of 290 ° to 330 ° c . and a pressure of 15 to 25 mbar vacuum . 150 sn base oil distillate is obtained in the spray condenser and 100 sn base oil distillate in the secondary condensation circuit 35 ″. finally , the bottoms product of the third stage is fed to the fourth stage , where the evaporator 4 ′″ is operated at a temperature of 320 ° to 345 ° c . and a pressure of 5 to 15 mbar vacuum . 350 + sn base oil distillate is obtained in the spray condenser and 250 sn base oil distillate in the secondary condensation circuit 35 ′″. the various base oil distillates are stored at 36 , from where they may be passed blockwise for finishing treatment . fig3 shows a re - refining plant in which each evaporator 4 and its associated ancillary apparatus , such as condensers 22 and 37 , is mounted in a frame 38 so as to form a modular unit , indicated generally at 39 . input and output to each modular unit is arranged so that two or more modular units may be brought together and interconnected to a straight - forward manner , thereby allowing a plant to be built up quickly and simply . fig4 is an end elevation of the plant of fig3 . the following tables give the results , respectively , of an analysis performed on used lubricating oil , on base oil distillate produced from the used oil by an embodiment of the present invention , and on rerefined base oil to which a finishing treatment has been applied : | 1 |
fig1 and 2 illustrate a plurality of overlying tear sheets 2 which define a pad 4 . any number of tear sheets 2 may be used although as a practical matter at least two tear sheets 2 would normally be utilized . the plurality of tear sheets 2 are adapted to cling to one another by means of static cling . such action tends to unitize the plurality of tear sheets 2 as they are attracted to one another so as to define a flip - chart pad 4 . each tear sheet 6 from the plurality of tear sheets 2 comprise of material capable of generating static cling . it has been found that sufficient static forces are generated when each tear sheet 6 has a thickness between one and three thousandths of an inch ; and generally good results are exhibited when the thickness of each tear sheet 6 is in the vicinity of two thousandths of an inch . furthermore , in the preferred embodiment each tear sheet 6 comprises of oriented polypropylene film , and particularly good static cling characteristics have been experienced by utilizing polypropylene film sold by mobil chemical company , putsford , n . y . under the trade marks oppalyte and bicor . the &# 34 ; oppalyte &# 34 ; trade mark film presents a white surface for writing thereon , while the &# 34 ; bicor &# 34 ; trade mark film presents a clear transparent surface . more particularly the polypropylene film sold under the trade mark oppalyte has the following characteristics : ______________________________________ approximate approximatetrade mark thickness yielddesignation description ( microns ) ( m . sup . 2 / kg . ) ______________________________________oppalyte high opacity 38 . 1 49 . 8350 tw white core , non - heat sealable , modified opp two sidesoppalyte high opacity 50 . 8 39 . 6278 tw white core , non - heat sealable , modified opp two sidesoppalyte high opacity 63 . 5 33 . 2233 tw white core , non - heat sealable , modified opp two sidesoppalyte high opacity 50 . 0 32 . 0220 tw white core , non - heat sealable , modified opp two sides______________________________________ particularly good results are exhibited through the use of oppalyte 278 tw . furthermore transparent sheets having the following characteristics have exhibited good static cling characteristics : ______________________________________ approximate approximatetrade mark thickness yielddesignation description ( microns ) ( m . sup . 2 / kg . ) ______________________________________bicor 240 b non - sealable , 32 . 0 34 . 1 unmodified homopolymer polypropylene______________________________________ other film or sheets 6 which have exhibited good static cling characteristics are : ( a ) polyester film sold by ici america , inc ., wilmington , del . under the trade mark melinex which is a polyethylene terephtharate ( pet ) polymer , ( b ) vinyl film sold by ici america , inc ., wilmington , del . under the trade mark mela sheet . each sheet 6 is adapted for writing thereon by means of a pen , felt pen or the like . in the preferred embodiment a felt pen may be used to write information on the sheet 6 . the information written on the sheet 6 is erasable by a brush , tissue paper or the like , when the ink is still wet or even when the ink is dry . in other words , each sheet 6 is dry erasable so as to be capable of reuse . each tear sheet 6 is adapted to be removeable from the pad 4 for releaseable securement to a surface by means of static cling as best illustrated in fig3 . each tear sheet 6 is self - adherent to most surfaces by means of static cling . if the surface 8 is such that the sheet 6 is not capable of retention thereto by static cling no securement will occur . in other words the static cling forces generated between the sheet 6 and surface 8 must be great enough to overcome the gravitational forces exerted on the sheet 6 . for example , it has been found that tear sheet 6 made of vinyl best adhere to smooth surfaces , while sheet 6 made of polypropylene film adhere to surfaces commonly used for walls which are either painted , wallpapered , or drywalled . therefore the user of the flip - chart pad 4 may either write upon the top sheet 6 of pad 4 and then remove such sheet 6 for releaseable securement or adhesion to a wall 8 by means of static cling , and then continue writing on the fresh sheet 6 exhibited on flip - chart pad 4 ; or the user may first remove a tear sheet 6 from pad 4 to place the sheet 6 on the wall 8 for securement by means of static cling and then write on the sheet 6 . before writing on the tear sheet 6 , four to five strokes of the hand smoothing out the sheet 6 on the surface 8 will increase the static cling charge and allow the tear sheet 6 once removed from the flip - chart pad 4 to self - adhere to the wall surface without tape or tacks . in this manner the tear sheet 6 may be used in the same fashion as a white board but with considerable cost savings as well as being able to secure the sheet 6 to a wall 8 without the need of tape fasteners or the like . furthermore , since the tear sheet 6 is adapted to be dry erasable any writing on the tear sheet 6 may be erased so as to enable the user to reuse same . the flip - chart pad 4 may also include a backing sheet or cover stock 10 for supporting the plurality of overlying sheets 2 as best illustrated in fig2 . the backing 10 presents a folded edge 12 which is adapted to overlie a portion of the overlying tear sheets 2 . staples 16 are presented in the region of the folded edge portion 12 so as to fasten the plurality of tear sheets 2 between the folded edge 12 and backing 10 so as to define the flip - chart pad 4 . the backing sheet may be made of any suitable material such as for example bristol board . furthermore the backing sheet 10 may overlie only a portion of the tear sheets 2 so as for example to be similar in size and extent to the folded edge 12 as illustrated in fig1 and 2 ; or backing 10 may be coextensive with the tear sheets 2 ( not shown ). each tear sheet 6 may be removed from the stapled pad by sharply pulling downward on each tear sheet 6 so as to tear the tear sheet 6 away from the flip - chart pad 4 and particularly away from the staples 16 . the flip - chart pad 4 illustrated in fig2 also includes a transparent film 14 disposed between the plurality of overlying tear sheets 2 and backing 10 . the transparent film 14 is also adapted to be capable of generating static cling so as to cling to the plurality of tear sheets 2 as well as being adapted to be removed from the flip - chart pad 4 for securement to a wall surface 8 by means of static cling . in a particular advantageous application the transparent film 14 may be adapted to overlie a tear sheet 6 which has adhered to a wall surface 8 by means of static cling so as to allow the user to show interaction of information included on the transparent film 14 with information included on tear sheet 6 , or to permit the user to write on the transparent film 14 while overlayed over the tear sheet 6 so as not to mark up the information included on tear sheet 6 . the flip - chart pad 4 also includes apertures 18 through folded edge 14 , plurality of tear sheets 2 , transparent film 14 and backing 10 for receiving hooks or the like ( not shown ) so as to hang the flip - chart pad 4 from a suitable surface . furthermore in one particular embodiment the staples 16 are located below apertures 18 so as to present a design weakness in the tear sheets thus faciliting the removal of the tear sheets 6 from the flip chart pad 4 . by tearing tear sheets 6 from pad 4 torn corners 40 are presented which represent the material left in the pad 4 between staples 16 and the corners of the tear sheets 6 located in the region of the folded portion 12 . in one particular embodiment of the invention tear sheets 16 are heat sealed together along edge 42 in a manner so that tear sheet 6 will &# 34 ; tear &# 34 ; along a straight line 42 so as to eliminate the presence of any torn corners 40 . such heat sealing may be accomplished by utilizing sealing bars or ultrasonic welding which welds the film 6 together by agitating the molecules of the sheets 6 and generating heat for welding . the flip - chart pad 4 may be shipped in a corrugated package 20 best illustrated in fig4 . the corrugated package 20 comprises a back support 22 and flaps 24 , 26 , 28 and 30 which are adapted to move from an open position as illustrated in fig4 so a to permit insertion of a flip - chart 4 therein to a closed position as illustrated by the phantom lines in fig4 for shipment . corrugated package 20 also includes holes 32 which may be adapted to hold flip - chart pad 4 by means of the apertures 18 . furthermore the corrugated package 22 may be used as a backing for the flip - chart pad 4 by removing the flaps 24 , 26 , 28 and 30 . it has been found that the best results occur when the plurality of tear sheets 2 include the following characteristics : the plurality of tear sheets 2 may also be adapted to be permanently fastened together in a colouring book form so as to present caricatures or designs adapted to be filled in by children with felt pens . each sheet 2 could then be erased for reuse as a colouring book at a later date . in another embodiment each sheet 6 may also include advertising material printed thereon and adapted to be placed on a transparent surface such as a glass or the like for securement thereto by means of static cling . for example , such sheet 6 may include advertising material and have particular advantages for use for the sale of new or used cars as the sheet 6 could be placed against the inside of the front window of a ca for securement thereto by static cling for advertising the price and financing features of the used car . such adaptation would eliminate the need to paint such information on the outside surface of a front window of a new or used car . although the preferred embodiment as well as the operation and use has been specifically described in relation to the drawings it should be understood variations in the preferred embodiment could easily be achieved by a man skilled in the art without departing from the invention . accordingly , the invention should not be understood to be limited to the exact form revealed in the drawings . | 8 |
referring to the drawings and , in particular , to fig1 a flexible , twin - blade wet - shaving razor unit 10 is shown . razor unit 10 includes a seat portion 12 having a guard bar 14 , a cap portion 16 , a seat blade 18 and a cap blade 20 . disposed between the blades is a corrugated spacer 22 . as best shown in fig2 spacer 22 extends along the entire length l of seat blade 18 . spacer 22 includes a plurality of corrugations 24 , which increase the flexibility of the spacer , interconnected by a plurality of plates 26 . plates 26 extend across a substantial portion of the width w of seat blade 18 . as will be apparent to those skilled in the art , the design and configuration of spacer 22 will increase the rigidity of the blades , while , at the same time , still allowing such blades to flex in response to forces encountered during shaving . in this regard , a preferred embodiment of the present invention may provide that the plates are fixedly connected to the seat blades by means of spot welds 28 . fixedly connecting the spacer to the blade ensures that the alignment of such components remains constant and , in addition , further increases the rigidity of the blade . however , it is not necessary to fixedly connect the spacer to the seat blade ; instead , as explained below , merely sandwiching the uniquely designed components together can provide the desired increase in rigidity of the blade . referring to fig3 it can be seen that cap blade 20 , spacer 22 and seat blade 18 are sandwiched between cap portion 16 and seat portion 12 . more specifically , cap portion 16 includes a plurality of securing pins 30 that pass through a series of co - linear openings in the cap blade , spacer and seat blade . the securing pins are received by openings in seat portion 12 that are dimensioned so that pins 30 can be &# 34 ; snapped &# 34 ; in and , thereafter , not withdrawn . in addition , the pins are dimensioned so that once the unit is assembled , the components of such units are tightly sandwiched between the cap and seat portion . to allow relative movement of the blades during flexing , the openings in these components ( except for the centrally - positioned openings ) may be formed in the configuration of a slot . with respect to the spacer , the openings ( except for the centrally - positioned opening ) are formed with a diameter slightly larger than the diameter of the securing pins . together , the design allows the components to slide pass one another as the razor unit is flexed . when the razor unit is assembled , upper surface 32 of corrugations 24 will contact and , hence , support the lower surface of cap blade 20 . the support these corrugations provide to the cap blade translates into increased rigidity of such blade . in addition , it is possible to configure the components of the razor unit such that both the cap blade and the seat blade are equally supported . finally , as already mentioned above , the corrugated spacer provides increased rigidity to the blades , which , in turn , decreases the amplitude of vibration introduced into such blade . while there have been described what are presently believed to be the preferred embodiments of the invention , those skilled in the art will realize that various changes and modifications may be made to the invention without departing from the spirit of the invention and it is intended to claim all such changes and modifications as fall within the scope of the invention . | 1 |
a magnetization curve is shown in fig1 for an anti - theft security strip constructed in accordance with the principles of the present invention have a soft - magnetic inner constituent and a hard - magnetic outer constituent . the induction is shown on the ordinate in tesla given low modulation , i . e ., given field strengths of + 400 ma / cm through - 400 ma / cm . as can be seen from the curve of fig1 the coercivity field strength of the wire lies at approximately 0 . 17 a / cm , so that fields beginning at 0 . 2 a / cm already cause a magnetic reversal of the soft - magnetic part , and can thus cause an alarm to be triggered in the examination zone . the magnetization loop of the same composite member is shown in an enlarged scale in fig2 . it can be seen from fig2 that field strengths above 200 a / cm are required for the complete magnetization of the hard - magnetic constituent , and that changes in the magnetic field of the hard - magnetic constituent are only identifiable at all given magnetic field of more than 10 a / cm . given an alternating field of between 0 . 2 and 10 a / cm in the examination zone , therefore , a reliable magnetic reversal of the soft - magnetic part will occur with the frequency of the alternating field without a change in the magnetization of the hard - magnetic constituent occurring . the defined mechanical prestress of the soft - magnetic constituent , which can be set using manufacturing parameters ( selection of material , tempering and annealing treatments ), insures a defined barkhausen effect in the magnetic reversal , so that voltage pulses having a steep edge are produced . it is desirable to produce voltage pulses having a steep edge because this insures that a large number of evaluatable harmonics , characteristic for the security strip , will be present given relatively slow field changes ( for example , 50 hz ) of the alternating field . in the manufactured state of the anti - theft security strip , the hard - magnetic constituent is always demagnetized , and therefore the strip is in the active condition , because during manufacture annealing will take place above the curie temperature . if for some reason the curie temperature is not exceeded during manufacture , the strip would have to be demagnetized by the application of an alternating field having decreasing amplitude in order to place the security strip in the active condition . it is sufficient for deactivation to bring the anti - theft security strip into contact with sufficiently strong magnets having alternating polarity . because , in contrast to the strip disclosed in german os no . 38 24 075 , the demagnetizing boundary phenomena are not prevented in the security strip disclosed herein by magnetized permanent magnetic material , it is necessary to provide a minimum length of the strip , dependent on the cross section of the soft - magnetic part . for this purpose , it has been found that the length in millimeters should be more than approximately 4000 times the cross section in square millimeters . for example , an anti - theft security strip having a length of slightly more than 30 mm or greater can be employed if the diameter of the soft - magnetic part is less than or equal 0 . 1 mm . fig3 illustrates an exemplary embodiment of a wire having a hard - magnetic constituent 10 and a soft magnetic constituent 12 . the hard - magnetic constituent 10 and soft magnetic constituent 12 are formed into a composite elongated member . the hard - magnetic constituent 10 and soft magnetic constituent 12 mechanically support one another . the hard - magnetic constituent 10 is demagnetized in an activated condition of the security strip . the soft magnetic constituent 12 has a coercivity field strength which is below the field strength of the alternating field in the examination zone . the hard - magnetic constituent 10 has a coercivity field strength which is higher than the field strength of the alternating field in the examination zone . the hard - magnetic constituent 10 is disposed at an exterior 14 of the elongated member , and the soft magnetic constituent 12 is disposed in an interior 16 of the elongated member . the composite member can also be formed of a wire consisting of the soft magnetic constituent 10 disposed inside a tube consisting of the hard - magnetic constituent 12 . fig4 illustrates an exemplary embodiment of a foil including the soft magnetic constituent 12 and hard - magnetic constituent 10 formed into a composite elongated member . the soft magnetic constituent 12 and the hard - magnetic constituent 10 mechanically support one another . the hard - magnetic constituent 10 is demagnetized in an activated condition of the security strip . the soft magnetic constituent 12 had a coercivity field strength which is below the field strength of the alternating field in the examination zone . the hard - magnetic constituent 10 has a coercivity field which is higher than the field strength of the alternating field in the examination zone . the hard - magnetic constituent 10 can be disposed at the exterior 14 of the elongated member , and the soft magnetic constituent 12 can be disposed in the interior 16 of the elongated member . fig5 illustrates the magnetization of the hard - magnetic constituent 10 for deactivation of the security strip , wherein deactivation of the security strip is undertaken by sections having different polarities . the hard and soft and magnetic constituents , 10 , 12 , mechanically support each other as illustrated in fig3 and 4 respectively . for example , where the core is the soft magnetic constituent 12 and the hard - magnetic constituent 10 centrally surrounds the core , the two constituents can be drawn together and thus formed as a unit , as illustrated in fig3 . further , if the core of the security strip has a rectangular cross section , the exterior portion can be connected to the core by rolling the hard - magnetic constituent 10 onto the core at both sides , and by annealing at a temperature preferably higher than 1000 ° c . a deactivatable anti - theft security strip manufactured in accordance with the principles of the present invention results in a defined barkhausen effect in the magnetic reversal of the deactivatable anti - theft security strip . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventor to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of his contribution to the art . | 6 |
plasma - channel drilling , as explained herein , is the process of delivering electrical power to an electrode assembly acting as a drill bit , in a sequence of discrete high power pulses to form highly destructive short lived electrical plasma channel discharges , which in turn cause localised fragmentation and disintegration of a material , such as a rock structure , ahead of the electrode assembly . referring to fig1 , there is illustrated a plasma - channel drilling apparatus , generally represented by reference numeral 10 , for removal of surface material 12 from a body of material 16 . the apparatus 10 comprises a high voltage pulsed generator 18 which is coupled by an hv cable 9 to an electrode assembly 20 . the electrode assembly 20 is arranged such that a plasma channel 22 is produced within or on the surface of the body of material 16 , which causes a localised region of the surface material 12 to fracture and fragment . the high voltage pulsed generator 18 includes a drive circuit capable of producing high voltage pulses , between 10 - 50 kv at an energy level of about 10 - 500 joules per pulse . the drive circuit also enables a pulse repetition rate of 1 - 100 pulses per second to be produced at the electrode assembly 20 , thereby forming a plasma channel at up to 100 times per second resulting in an effective and controlled drilling process . an increase in the pulse repetition rate of the hv generator 18 does not necessarily result in an increase in the drilling rate of the plasma channel drilling apparatus 10 . in one test bore holes drilled using a drive circuit set to 35 kv at an energy level of 122 . 5 joules per pulse , resulted in a drilling rate of 5 cm per minute at a pulse repetition rate of 10 pulses per second . however , in a different sample a drilling rate of 6 . 5 - 7 . 5 cm per minute was achieved with a pulse repetition rate of 5 pulses per second . furthermore , the pulse repetition rate has a direct effect on the energy efficiency of the apparatus , with a decrease in the pulse repetition rate resulting in a decrease in the specific energy consumption . thus a 20 % decrease in the specific energy consumption was achieved at a pulse repetition rate of 5 pulses per second compared to that of 10 pulses per second , when drilling with apparatus set at an energy level of 207 . 5 joules per pulse , 38 . 5 kv and output generator capacitance of 280 nf . the pulse repetition rate as regards removal of material is related to the time taken for the created plasma - channel to deplete to a sufficient level , before a succeeding generated plasma channel can have full effect on removal of material . this is due to the fact that the plasma channel causes the material to fracture and fragment by rapid expansion of the plasma channel on or within the surface of the material , and it is therefore necessary to wait until the created plasma channel has subsided sufficiently before the next plasma channel is created . an increase in the pulse energy of the hv generator has a direct effect on the specific energy consumption of the plasma channel drilling process . the increase of the energy available per pulse results in improvement of the energy efficiency of the plasma drilling channel apparatus . in test bore holes drilled in sandstone samples using a drive circuit set to 35 kv at an energy level of 61 j / pulse resulted in a specific energy of drilling of 803 j / cm 3 at a pulse repetition frequency of 10 pulses per second , and in a specific energy of drilling of 474 j / cm 3 at a pulse repetition frequency of 5 pulses per second at an energy level of 122 . 5 j / pulse . increasing the energy available per pulse by a factor of 2 for a constant voltage resulted in a 59 % reduction in the specific energy of drilling . further increase of the energy would result in saturation and a consequent decrease in the efficiency of the drilling apparatus . therefore for maximising of the efficiency of the plasma channel drilling apparatus it is necessary to determine the optimal parameters ( particularly applied voltage , pulse repetition frequency , energy available per pulse ) for different materials to which the plasma - channel drilling apparatus is being applied . referring to fig2 , there is shown a cross section of the electrode assembly 20 of fig1 . the electrode assembly 20 comprises a hv electrode 32 which is made from a material such as stainless steel in order to increase the lifetime and reliability of the overall assembly . the hv electrode 32 is coupled to an hv shank 34 by a threaded and pinned portion 36 so as to secure the electrode 32 in position . the hv shank 34 is in turn coupled via a connector 40 to the core 38 of hv cable 9 connecting pulse generator 18 to the electrode assembly 20 . the connector 40 is arranged such that at one end of the connector 40 there is provided a threaded portion 58 into which the hv shank 34 is coupled , and at an opposite end there is provided a bore 60 into which the cable core 38 is fitted . the hv cable core 38 is secured in place via grub screws 62 . surrounding the shank 34 , connector 40 and cable core 38 are plastic insulators 42 , 43 , 44 which prevent electrical breakdown from occurring between the hv components of the electrode assembly and the return , or grounded portions of the electrode assembly . a cup - shaped grounded electrode 46 surrounds the hv electrode 32 , there being a predetermined inter - electrode gap spacing 48 between the two electrodes 32 , 46 . electrode 46 at its exposed annular end lies in the same plane as the exposed outer surface of the disc electrode 32 ( and may have a sharpened end face or edge ). the grounded electrode 46 is electrically connected to a grounded metal tube or pipe 50 , such as copper , via a conductive sleeve 52 , which has male and female threaded portions , to which the metal pipe 50 and grounded electrode 46 are respectively connected . the metal pipe 50 is electrically connected at an opposite end , via cable 9 to the pulse generator 18 , creating a return path for the flow of current to pass when the plasma channel 22 is created . the upper portion of the grounded electrode 46 is provided with slots 70 and with through holes 54 to which are connected pipes 72 allowing a fluid such as water to be passed to the inter - electrode gap 48 . as is schematically shown in fig3 this arrangement enables a flow of fluid such as water to be supplied to cutting surface 66 to entrain and remove cuttings or debris 68 by circulating water down through the copper pipes 72 and up into the drilled bore 74 , such that the water will pick up and carry away the cuttings 68 from the cutting surface 66 . the cuttings 68 may be carried away from the cutting surface 66 either traversing the gap 48 between the two electrodes , or , without traversing the gap 48 , through venting slots 70 provided in the grounded electrode . the plasma channel 22 is also shown in fig3 at two of its instantaneous positions during a drilling period . channel 22 at each time instant is elongate and extends in an arc from an edge or face of electrode 32 to a local region of an inner edge or lower face of the outer electrode 46 . fig3 also illustrates the applied electrical pulse in the form of a fast - rise impulse . now referring to fig4 , the pulsed generator 18 comprises ( typically ) an energy storage capacitor 78 which is charged by a primary power source 80 at a voltage level up to 50 kv , via a coupling resistor 82 ( e . g . 100 ohms ) and a wavetail or decoupling resistor 84 ( e . g . 10 kilo - ohms ) with switch 86 open . when the capacitor 78 is fully charged , switch 86 is closed on command . the switch closure transfers energy from the capacitor into the electrode assembly 20 via the high voltage co - axial feed 9 . energy from the capacitor 78 and the high voltage co - axial feed 9 is dissipated in the plasma - channel with a current waveform determined by the natural oscillatory frequency of the circuit . this energy dissipation in the plasma - channel results in the drilling process . fig5 illustrates typical current and voltage waveforms generated during plasma channel formation . thus , on the micro second timescale denoted in fig5 , the first voltage pulse commences at about 6 μs and rises very rapidly in far less than 1 μs to about 35 kv . the voltage level remains in the range 35 kv dropping to 26 kv over the time interval 6 μs to about 13 μs during which time the body of material is electrically stressed but without breakdown occurring . electrical breakdown occurs at about 13 μs when the conductive plasma channel is formed ( and physically expands rapidly ) and the voltage collapses in damped oscillation to terminate at about 40 μs whilst concurrently the plasma channel current is established as a damped oscillation also terminating at about 40 μs . when the energy in the capacitor 78 has been dissipated in the plasma - channel circuit , the power source 80 recharges the capacitor 78 by opening of switch 86 , ready for another cycle of the circuit . plasma channel creation between the electrodes of the electrode assembly is dependent upon a number of factors , which include the electrode profile , electrical properties of the fluid on or in the material and the material itself ; temperature , pressure , voltage magnitude and pulse profile . furthermore , if the apparatus is self - firing , i . e ., there is no trigger signal to initiate the creation of the plasma channel , it is important to provide an electrode assembly having a pre - characterised geometry for the fluid and material present to ensure that the applied high voltage pulse initiates the desired plasma formation . if the electrode assembly is not configured for the specific environmental conditions , then a significant amount of the energy available may be lost through ionic conduction in the fluid . it has been found that for fast rising voltages ( approximately 10 mv per microsecond ), solids suffer dielectric breakdown ( plasma formation ) earlier than fluids such as water and oil . referring to fig6 , there is provided a graph showing breakdown delay time against voltage characteristics of sandstone and water for different inter - electrode distances . it can be seen for these sets of curves , that if the applied voltage is high enough the sandstone will suffer electrical breakdown ( plasma formation ) more rapidly than the water . fig7 shows the relationship between applied electric field and breakdown delay time for different rock structures , transformer oil and water . these sets of curves show the same trend as in fig6 , in that if the applied voltage is high enough the different rocks will suffer electrical breakdown more rapidly than water or transformer oil . however , for the transformer oil , it can be seen that the electric field applied to the electrode assembly must be greater than that of water to ensure electrical breakdown in the rock structure before that of the transformer oil . therefore , for plasma channel drilling it is desirable to apply as high a voltage with as rapid a rise time as possible to the electrodes , in order that the rock suffers electrical breakdown before the water or oil . this would theoretically maximise the efficiency of the drilling process , except that for certain applications it is desirable to restrict the maximum operating voltage of the system to less than 50 kv . voltages above this value , of 50 kv , result in system insulation requirements becoming of significance , which may result in an increase in the overall size of the drill , electrical feed and power supply . fig8 shows the relationship for negative polarity pulses between the delay time and electrode gap spacing for water - saturated red sandstone . it can be seen that for both applied voltages (− 30 kv and − 35 kv ) the delay time increases with increasing gap spacing . this is expected since the electric field , which influences the delay time , decreases with increasing gap size . the disadvantage that the delay time has with respect to plasma channel drilling , is that as the delay time increases , the amount of energy available to the plasma channel is reduced due to losses through the water . plasma channel drilling can be conducted in rock formations saturated in brine or oil . in spite of the fact that the salinity of connate water in oil bearing rock formation can be as high as 100 g of electrolyte per one liter of water , the use of low conductive water as a drilling fluid significantly reduces the delay time and ionic conduction losses and provides an effective plasma channel drilling process . in test bore holes in sandstone samples the plasma channel drilling apparatus demonstrated a drilling rate of 7 . 0 cm / min for water - saturated sandstone , and 5 . 5 cm / min for brine - saturated sandstone with the use of tap water as the drilling fluid . in order to produce efficient plasma channel drilling lower conductivity drilling fluids such as tap water or mineral oil should be used . therefore , to maximise the energy available to the plasma channel , the gap spacing must be reduced or the voltage increased in order to reduce the delay time . as previously stated , plasma - channel drilling uses a plasma discharge that is formed on the surface or through the material to be drilled . therefore , in order to produce an efficient plasma channel drilling process it is necessary to maximise the rate of pressure rise during the fast expansion period , that is during the first few hundreds of nanoseconds of creating the plasma channel . this may be achieved by maximisation of mean power dissipated in the active load of the plasma channel during the first half period of the current oscillation , which may be accomplished by producing a pulse having a duration in the region of 1 - 50 microseconds and having a rise time of less than 150 nanoseconds , preferably in the order of 100 nanoseconds . the pulse generator used to drive the drilling process can generate high peak powers of between 10 - 100 mw at the electrode assembly . however , due to known pulsed power and energy consumption techniques , the average power output for the generator is in the region of a few kilowatts whilst drilling . this enables the pulse generator and associated equipment to be compact and portable , such that the apparatus can be deployed by wire - line or coiled - tubing equipment into a bore , with the plasma channel apparatus split into a downhole electrode assembly and a surface pulse generator . alternatively , the pulse generator may be incorporated into an electrical cartridge such that the pulse generator and the electrode assembly may be deployed together within the bore . by exploiting the differences in temporal dielectric strength between the fluid within the bore and the rock formation , as can be derived from the graphs shown in fig6 and 7 , the plasma - channel is forced to form along the surface of , or inside the formation ahead of the apparatus . in addition , by utilising single or multiple annular electrode geometries within the electrode assembly , the plasma - channel will change position around the electrode gap so as to seek out new areas of material , such that different sections of the formation are removed . this is achieved because the plasma - channel seeks out the path of least resistance , and because the rock formation electrically breaks - down before that of the fluid , at high voltages , the plasma - channel will be formed within or on the surface of . the formation . the plasma - channel will therefore rotate with time through 360 ° seeking out the path of least resistance through the material , thereby removing the material ahead of the electrode assembly and eliminating the requirement to rotate the electrode assembly itself . the electrical breakdown of solids by plasma - channel drilling results in the formation of a gas plasma filled breakdown conductive channel . the resistance of this plasma filled breakdown channel is related to the electrical and physical properties of the channel and depends upon the physical properties of the solids ( ionisation potential , molecular weight ) and also depends on characteristics of the discharge circuit ( initial potential of output , capacitance of the circuit , inter - electrode spacing ). for optimal performance of the plasma - channel drill , the inter - electrode gap spacing together with the parameters of the electrical drive circuit need to be optimised , such that the current waveform produced is close to its critically damped response . in practice , this means that the optimal inter - electrode gap spacing must be determined for the different materials to which the plasma - channel drilling apparatus is being applied . it is desired to produce a current waveform that is close to its critically damped response as this has been seen to result in the highest rate of energy deposition in the plasma breakdown channel . it will be appreciated that various modifications may be made to the embodiment hereinbefore described without departing from the scope of the present invention , e . g ., a pulse generator which is deployed downhole with the electrode assembly may be powered by a downhole power source , such that there is no need for any surface power to be provided . in this way , the entire apparatus may deployed on drill pipe or the like and power supplied by the downhole power source . the electrode assembly may include more than two electrodes , and the cutting removal fluid may be mud based so as to help balance well conditions . it will be appreciated that a principal advantage of the present invention is that the above apparatus is small , compact and readily deployable , making the apparatus ideal for work - over applications on platforms , rigs or the like , to maintain maximum well production . furthermore , the apparatus can produce small bore holes , typically up to 100 mm , that can be exploited to enhance production zones so as to ensure maximum productivity from the well . in addition , this method of drilling produces sub - millimetre drill cuttings in the region of 300 micrometres , in comparison to that of known systems in which cuttings in the region of 2 - 7 millimetres are produced . the reduction in the size of the cuttings reduces the need to use equipment to further reduce the cutting size , as is common practice , such that the cuttings can be transported via a pipe network to a storage area . in addition , this method of drilling enables the drill cuttings to be readily re - injected into the subsurface formation , thereby reducing the environmental impact , and the amount of waste produced . other advantages of the invention include the possible reduction in fluid pump rates ; eliminating the need for rotary equipment to drive the drill bit ; and a reduction in the specific energy needed to create a bore hole . initial results have shown that the specific energy for plasma channel drilling is in the region of 250 - 290 joules per cm 3 , compared to 350 - 560 joules per cm 3 for rotary ( oilfield ) drilling , of a medium hardness rock . | 1 |
it is to be understood that the figures and descriptions of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the present invention , while eliminating , for purposes of clarity , many other elements found in typical digital multimedia content delivery methods and systems . however , because such elements are well known in the art , a detailed discussion of such elements is not provided herein . the disclosure herein is directed to all such variations and modifications known to those skilled in the art . the exemplary embodiment comes within the framework of digital television in the scope of mpeg compression , but the invention is not limited to this particular environment and may be applied within other frameworks where content may be compressed in a high and low resolution . the system according to the embodiment is illustrated in fig2 . a server 6 receives a video source 1 and encodes the video source with a video encoder 2 . it is encoded into a full resolution stream and a low resolution stream . the streams can be received at a video receiver 4 through an internet protocol network 3 . the video receiver 4 can decode the stream . when decoded a stream is sent to a video display that displays the video . a video receiver 4 according to the embodiment is illustrated in fig3 . a front end 41 selects a signal received at a given frequency and transmits this signal in baseband to a demultiplexer 42 which extracts there from a digital data stream , for example according to the mpeg standard . this data stream is then translated into a video signal and into an audio signal by an audio / video decoder 47 . as illustrated the demultiplexer extracts a video in a full resolution that is sent to a first buffer 43 . it also extracts a video in a low resolution that is sent to a second buffer 44 . the decoder 47 may access either the first or the second buffer . this is controlled and managed by a decoding controller 45 . the decoding controller is adapted to carrying out the arbitration between the buffered decompressed pictures to be decoded , according to the compressed pictures type ( i , p , b ), the decoding time stamps ( dts ) and presentation time stamps ( pts ) of the access unit and the system time clock ( stc ) slave 46 to the program clock reference ( pcr ). the decoding controller reads these values in the compressed pictures header . it selects a picture to decode according to the method described herein below . it also selects the buffer that is made accessible to the decoder . the pictures that are not decoded are removed from the buffer . the selected picture is then sent to the video decoder . when decoded , the video is buffered 48 before being sent to a display device 5 . according to the embodiment , the receiver comprises a decoder . in an alternative , the decoder could be comprised in another device . the receiver then arbitrates in a same manner the pictures that are transmitted to the decoder for being decoded and transmitted to the display . fig4 depicts a channel change process illustrating the waiting time before an i - frame is received and the video decoder buffer delay . the receiver device starts receiving data for the new service from the “ zap ” arrow point , which is around the middle of a compressed “ i ” picture . the decoder buffer delay for a given access unit is noted δ pcr / pts . this is the delay of the pcr at the beginning of the decoder buffer loading of an access unit with respect to its presentation time stamp ( pts ) which represents the time that decoded access unit will be rendered . here , the compressed “ i ” picture with pts = 20 is sent before the pcr = 20 packet , and their relative time difference is δ pcr / pts . the decoder buffer delay δ pcr / pts is implicitly related to the end - to - end delay , from the input of the encoder to the output or presentation of the decoder , which is defined in the standard iso / iec 13818 - 1 amendment 5 dated 2005 on “ information technology — generic coding of moving pictures and associated audio information : systems ”, noted iso / iec 13818 - 1 hereinafter . it is a constant value determined by the encoding process . the encoder ensures that a given access unit of the stream can be decoded with a decoder buffer size fixed to δ pcr / pts . in other words it ensures that no access unit will buffer more than δ pcr / pts . the δ pcr / pts is generally not longer than the gop length . in fig4 , when the receiver changes channel , it first waits for the waiting time corresponding to the next compressed “ i ” picture . then when this “ i ” picture is received , it checks the corresponding pts ( pts = 30 ) and has to wait for the decoder “ buffer ” time which corresponds to a pcr = 30 , before starting the picture rendering process . the tune - in companion stream is used to improve the waiting time by configuring a shorter gop . in order to maintain the synchronization of both services presentation , the encoding process configures the gops of the two streams in such a way that they remain aligned with respect to the pcr . moreover the encoding process of the two services is based on the same constant end - to - end delay , which means that the delay from the input to the encoder to the presentation from the decoder of the two services is the same . fig5 depicts an original lmb service with an additional “ tune - in ” companion service , carried respectively in the full and low resolution streams . in this example the tune - in companion service has a gop length which is half the length of the full resolution stream . when the receiver changes or selects a channel , it waits for the waiting time corresponding to the next compressed “ i ” picture , in both the full - resolution and the low - resolution streams . as indicated in fig5 most of the time the first compressed “ i ” picture found is the low - resolution one . then the buffer is filled normally until the rendering of the low resolution stream can start , the decoder “ buffer ” time . this is indicated in fig5 by the “ start rendering ” arrow which indicates the rendering of low resolution compressed “ i ” picture with a pts = 25 , carried out when pcr = 25 . compared to fig4 , the waiting time has been reduced . finally the “ switch ” arrow at pcr = 30 shows when the full resolution stream is ready to be presented ; this is equivalent to the “ start rendering ” arrow in fig4 . at this time the low - resolution video is no longer rendered . the companion stream can be disconnected from by the receiver . the full - resolution video is displayed . the channel change phase is finished . fig6 depicts the tune - in companion service and an original lmb service carried respectively in the low and full resolution streams . each service has its own encoding constraints . the original lmb service is encoded with a constant end - to - end delay noted “ end - to - end - delay - full - res ” which leads for a given access unit to the decoder buffer delay “ δ pcr / pts full - res ”. the tune - in companion service is encoded with a shorter constant end - to - end delay “ end - to - end - delay - low - res ” which leads for a given access unit to the decoder buffer delay “ δ pcr / pts low - res ”. in order to maintain synchronization during the presentation of both services , the tune - in companion service is delayed as compared to the original service before the encoding process . the value of the delay is equal to the difference between the values of the end - to - end delay used during the encoding process of each of the two streams : “ end - to - end - delay - full - res ”-“ end - to - end - delay - low - res ”. indeed it is known from iso / iec 13818 - 1 that the end - to - end delay is a constant value . so when the low resolution stream is encoded with a lower end - to - end delay compared to the full resolution stream , the pictures in the low resolution stream are presented before the corresponding pictures of the full resolution stream . then to synchronize the presentation of the two streams it is necessary to delay the low resolution stream compared to the full resolution stream . delaying it before the encoding process allows encoding the two streams with the same system time clock ( stc ), keeping the pcr alignment between the full resolution and the delayed low resolution streams . in fig6 , the compressed “ i ” picture with pts = 20 of the two streams are not transported in a synchronized way anymore . after being buffered in the video decoders they resynchronize themselves because the buffer decoder delays configured by the encoder are such as the difference between the end - to - end delays used to encode them equals the transport delay . when the receiver changes or selects a channel , it first waits for the waiting time corresponding to the next compressed “ i ” picture that is found in the low resolution stream . then it fills the video decoder buffer and waits for the “ δ pcr / pts low - res ” decoder buffer time that is shorter than the “ δ pcr / pts full - res ”. this is indicated in fig6 by the “ start rendering ” arrow which indicates the rendering of the low resolution compressed “ i ” picture with a pts = 20 , carried out at pcr = 20 . compared to fig5 , the buffer time has been reduced . finally the “ switch ” arrow at pcr = 30 is the same as in fig4 . the companion tune - in service is presented during a longer time to the end - user : this is because the presentation of the new service is much faster . the decoding controller performs the selection between the full resolution stream and the low resolution stream as illustrated in fig5 and 6 . the full and low resolution streams are stored in respective buffers . the controller selects the appropriated picture to be decoded so that this picture is sent to the decoder . a decoding arbitration strategy according to the embodiment is illustrated in fig7 . after a channel change request , the receiver stops receiving the old service and performs the necessary actions to receive and buffer the new original service , the one encoded in full resolution , and its tune - in companion service , the one encoded in low resolution . then the receiver waits for a compressed “ i ” picture to be decoded in both services streams ( step 1 . 1 ). if the first compressed “ i ” picture to be decoded ( step 1 . 2 ) belongs to the original service stream ( step 2 . 1 ), the receiver stops to process the tune - in companion service , processes the original service and the channel change is effective . if the first compressed “ i ” picture to be decoded ( step 1 . 2 ) belongs to the companion service stream ( step 2 . 2 ) the receiver begins to decode that picture and continues to process that stream until a compressed “ i ” picture in the original stream has to be decoded ( step 4 . 2 ). if the compressed “ i ” picture of the original stream has to be presented in the next time slot ( pts = dts + 1 / frame rate ) ( step 5 . 1 ) then the original stream is processed . otherwise ( step 5 . 2 ) the decoding of this compressed “ i ” picture is delayed up to the time slot ( 1 / frame rate ) just before their presentation and during this time the tune - in companion service is decoded . when arbitration between compressed pictures of the two streams to be decoded is necessary and the compressed picture of the original service is chosen , the corresponding picture of the tune - in service is deleted from its buffer . in this case the presented picture in a time slot where no decode picture is available leads to the presentation of the previous decoded picture . fig8 illustrates the way the decoding conflicts are managed in the receiver of the embodiment . it shows the same streams as the one indicated in fig1 . the decoding process is different , which conducts to a different display order . this fig8 also shows that when any decoded picture is available in a time slot of the tune - in companion stream then the strategy to present the previous decoded picture is adopted . in the last two examples , there is no conflict when switching from the low resolution stream to the full resolution one . this is due to the fact that the first i - frame of the full resolution stream is presented in the time slot following the one in which this frame is decoded . and , the frame of the low resolution stream to be presented during the time slot the decoder decodes the first i - frame of the full resolution stream is already decoded . in the third example , in the time slot the decoder decodes the high resolution “ i 11 ” frame , it is presenting the low resolution “ p 10 ” frame which is already decoded . after this last frame , the decoder presents the high resolution “ i 11 ” frame . consequently the switch between both streams is seamless . in the first two examples , the switch is achieved seamlessly with the decoder . the first example is further illustrated in fig9 that also shows the time slots 1 to 19 . the user performs a channel change after the high resolution “ i 1 ” frame was delivered but before the low resolution “ i 7 ” frame was received by the decoder . the decoder decodes respectively the low resolution frames “ i 7 ”, “ p 10 ”, “ b 11 ” and “ b 12 ” during the time slots 7 , 10 , 11 and 12 and presents them respectively during the time slots 10 , 13 , 11 and 12 . then the decoder receives the high resolution i - frame “ i 13 ” that should be decoded during time slot 13 as well as the low resolution i - frame “ i 13 ”. only one of them is decoded during this time slot . the decoding controller checks if the high resolution “ i 13 ” frame should be presented during the next time slot , i . e . time slot 14 . as “ i 13 ” should be presented during time slot 16 and not during time slot 14 , the decoding controller makes the decoder decoding the low resolution “ i 13 ” frame . it also delays the high resolution “ i 13 ” frame decoding . during this time slot the decoder presents the low resolution “ p 10 ” frame . when the time slot 14 starts , the decoding controller checks if the high resolution “ i 13 ” frame should be presented during the next time slot , i . e . time slot 15 . as it should not be presented , the decoding controller makes the decoder decoding the low resolution “ b 14 ” frame and delays the high resolution “ i 13 ” frame decoding . during this time slot the decoder presents the low resolution “ b 14 ” frame . when the time slot 15 starts , the decoding controller checks if the high resolution “ i 13 ” frame should be presented during the next time slot , i . e . time slot 16 . as it should be presented , the decoding controller makes the decoder decoding this frame and stops making decoding the low resolution stream . during this time slot , the decoder has no decoded frame to present as both low resolution and high resolution “ b 15 ” frames were not decoded . the decoder manages this transition by repeating during a second time slot the low resolution “ b 14 ” frame . the end user sees the same frame during 2 frame periods . of course , if the decoder stops decoding the low resolution stream as soon as the high resolution i - frame should be decoded , during time slot 13 in fig9 , the same low resolution “ p 10 ” frame is displayed during three frame periods . alternatively the transition is not managed by the decoder but by the controller . the controller indicates to the decoder that it should present the last decoded frame again . references disclosed in the description , the claims and the drawings may be provided independently or in any appropriate combination . features may , where appropriate , be implemented in hardware , software , or a combination of the two . reference herein to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment can be included in at least one implementation of the invention . the appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment , nor are separate or alternative embodiments necessarily mutually exclusive of other embodiments . reference numerals appearing in the claims are by way of illustration only and shall have no limiting effect on the scope of the claims . | 7 |
fig5 is a circuit diagram showing an active matrix panel according to a first embodiment of the present invention . in fig5 numeral 10 indicates a display area where a plurality of scanning lines s 1 , s 2 . . . and a plurality of data lines d 1 , d 2 . . . are arranged in such a manner that they are perpendicular to each other , and near the points of intersection , tfts 101 , 102 . . . are formed . a gate electrode of the respective tfts is connected to the respective scanning lines ( s 1 . . . sn ) and a drain electrode is connected to the respective data lines ( d 1 . . . dn ). on the other hand , each source electrode of the tfts 101 , 102 . . . is connected to respective pixel electrodes 111 , 112 . . . which are arranged in the form of matrix , and liquid crystal is sealed in between the pixel electrodes and common electrodes ( coms ) which are arranged facing to each other . in this panel , a scanning line drive circuit and a data line drive circuit 3 are built in together with the display area , and scanning line signals are supplied to the scanning lines s 1 , s 2 . . . from the scanning line drive circuit which is not shown in the drawings . further , the data line drive circuit 3 is comprised six color video signal lines 1 r , 1 g , 1 b , 2 r , 2 g , and 2 b for receiving two series of rgb color video signals in the panel ; switching elements 11 , 31 . . . for connecting the data lines d 1 , d 7 . . . to the color video signal line 1 r ; switching elements 12 , 32 . . . for connecting the data lines d 2 , d 8 . . . to the color video signal line 1 g ; switching elements 13 , 33 . . . for connecting the data lines d 3 , d 9 . . . to the color video signal line 1 b ; switching elements 21 , 41 . . . for connecting the data lines d 4 , d 10 . . . to the color video signal line 2 r ; switching elements 22 , 42 . . . for connecting the data lines d 5 , d 11 . . . to the color video signal line 2 g ; switching elements 23 , 43 . . . for connecting the data lines d 6 , d 12 . . . to the color video signal line 2 b ; and a drive pulse generating circuit 6 comprising a series of shift register 60 for sequentially generating drive pulses pc 1 , pc 2 , pc 3 . . . in response to clock signals clks . drive pulse pc 1 at the first stage of the shift register 60 is applied to the switching elements 11 , 12 , and 13 , drive pulse pc 2 at the next stage is applied to the switching elements 21 , 22 , and 23 , and the same processes are subsequently repeated . in other words , the respective drive pulses at different stages of the shift register are applied to each three switching elements . more specifically , the drive pulses pc 1 , pc 3 . . . at odd stages of the shift register 60 are applied to each three switching elements of the same series which are connected to the first series of video signal lines 1 r , 1 g , and 1 b . the drive pulses pc 2 , pc 4 . . . at even stages of the shift register 60 are applied to each three switching elements of the same series different from the above - mentioned series which are connected to the second series of video signal lines 2 r , 2 g , and 2 b . here , the shift register 60 is constituted such that a latch circuit which operates in response to a rise of clock signal clk and a latch circuit which operates in response to a fall of clock signal clk are alternately connected . a start signal sth which becomes high level for about one cycle of the clock signal clk is input to an input terminal at the first stage . the clock signal clk is used for determining timing of writing each signal corresponding to a pixel into crystal liquid , synchronizes with a dot clock , and its cycle is set to be six times that of the dot clock . first , a case of applying the panel to the three dots corresponding system will be described . in this case , as shown in fig9 at the exterior of the panel , there are provided the sample hold circuit 100 for a series of rgb color video signals for sequentially sampling each rgb color video signal and simultaneously outputting hold signals for a prescribed period , and the inversion amplifier 200 for amplifying each rgb signal which has under gone sample hold , and outputting the signals after inverting them at every horizontal and vertical period . there is also provided an external color video signal line 210 for branching a series of three outputs from the inversion amplifier 200 into two series of six outputs and leading them out to the panel . it is arranged so that six outputs from the external color video signal line 210 are input to the six color video signal lines ir , 1 g , 1 b , 2 r , 2 g , and 2 b in the panel . in the sample hold circuit 100 , the sample hold circuits 101 , 102 , 103 perform sample hold of the respective analog color signals r , g , and b to be input at a timing which is successively delayed by one third of the cycle of clock signal clk in response to sampling clocks ckr , ckg , and ckb which are shown by waveforms ( a ), ( b ), and ( c ) in fig6 . further , sample hold circuits 104 and 105 further perform sample hold of output of the sample hold circuits 101 and 102 at the same timing as that of the sample hold circuit 103 in response to the sampling clock ckb which is shown by waveform ( c ). thus , rgb video signals equivalent to three dots vr 1 , vg 1 , and vb 1 which constitute one pixel are simultaneously input to the first series of color video signal lines 1 r , 1 b , and 1 g in the panel , as shown by a waveform ( j ) in fig6 . these video signals are held for a half cycle of the clock signal clk , and afterward new video signals are input every half cycle . further , since the external video signal line 210 merely branches the same video signal , as shown by a waveform ( k ) in fig6 video signals vr 2 , vg 2 , and vb 2 identical to the video signals vr 1 , vg 1 , and vb 1 are input to the second series of color video signal lines 2 r , 2 b , and 2 g in the panel , too . on the other hand , when a start signal sth as shown by waveform ( e ) in fig6 is input to the shift register 60 , a drive pulse pc 1 from the first stage becomes high level in response to a rise of the clock signal clk as shown by waveform ( f ) in fig6 and the high level is maintained for a cycle of the clock signal clk . further , in response to a fall of the clock signal clk , a drive pulse pc 2 from the next stage becomes high level as shown by a waveform ( g ) in fig6 and the high level is maintained for a cycle of the clock signal clk . the same processes are repeated , or , in other words , respective drive pulses pc 3 , pc 4 . . . which become high level for a cycle are sequentially output at every half cycle of the clock signal clk , as shown by waveforms ( h ) and ( i ) in fig6 . as described above , among these drive pulses , drive pulses from odd stages pc 1 , pc 3 . . . are applied to each three switching elements which are connected to the first series of video signal lines 1 r , 1 g , and 1 b , and drive pulses from even stages pc 2 , pc 4 . . . are applied to each three switching elements which are connected to the second series of video signal lines 2 r , 2 g , and 2 b . therefore , during a period t 1 of the drive pulse pc 1 being high level , three switching elements 11 , 12 , and 13 are turned on and three dots video signals o 1 from the first series of video signal lines 1 r , 1 g , and 1 b are supplied to the data lines d 1 , d 2 , and d 3 . and , during the next period t 2 of the drive pulse pc 2 of being high level , three switching elements 21 , 22 , and 23 are turned on and three dot video signals o 2 from the second series of video signal lines 2 r , 2 g , and 2 b are supplied to the data lines d 4 , d 5 , and d 6 . similarly , when drive pulses pc 3 , pc 4 . . . sequentially become high level , the first and second series of each three dots video signals are alternately supplied to the respective corresponding data lines . here , although two series of video signal lines are provided in the panel , video signals for the same dot are input to the first and second series of signal lines ( vr 1 = vr 2 , vg 1 = vg 2 , and vb 1 = vb 2 ), and therefore new video signals are inputted to each video signal line at every three dots . in other words , driving by the three dots corresponding system is realized . next , a case which the panel is applied to a six dots corresponding system will be described . here , when , for example , for the purpose of displaying computer graphics , video signals to be input are 8 - bit - per - dot digital signals and three dots rgb video signals corresponding to one pixel are simultaneously supplied . in this case , as shown in fig1 , at the exterior of the panel are provided a sample hold circuit 600 for two series of rgb color video signals for sequentially sampling each series of rgb color video signals and outputting hold signals equivalent to three dots at different timing , a d / a converter 400 for converting digital signals equivalent to six dots from the sample hold circuit 600 into analog signals , and an inversion amplifier 500 for amplifying the converted analog signals equivalent to six dots and outputting the signals after inverting them at every horizontal period and vertical period . it is arranged so that six outputs of the amplifier 500 are input to six color video signal lines 1 r , 1 g , 1 b , 2 r , 2 g , and 2 b in the panel . the sample hold circuit 600 comprises d flip flops 601 , 602 , and 603 equivalent to three dots for sample hold input digital video signals in response to a sample clock ck 1 and d flip flops 604 , 605 , and 606 equivalent to three dots for sample hold input digital video signals in response to a sample clock ck 2 . further , as shown by waveforms ( 1 ) and ( n ) in fig6 the sample clock ck 1 is identical to the clock signal clk shown by the waveform ( d ) and the sample clock ck 2 is an inverted clock signal clk . thus , as shown by a waveform ( m ), three dots rgb video signals vr 1 , vg 1 , and vb 1 which constitute one pixel are simultaneously input to the first series of color video signal lines 1 r , 1 b , and 1 g in the panel in response to a rise of the sample clock ck 1 . these video signals are held for a cycle of the clock signal clk and then new video signals are input at every cycle . further , as shown by a waveform ( o ) in fig6 , three dots rgb video signals vr 2 , vg 2 , and vb 2 which constitute one pixel are simultaneously input to the second series of color video signal lines 2 r , 2 b , and 2 g , in the panel in response to arise of the sample clock ck 2 . these signals are held for a cycle of the clock signal clk , and then new video signals are input at every cycle . therefore , during the period t 1 of the drive pulse pc 1 being high level , three switching elements 11 , 12 , and 13 are turned on , and three dots video signals o 1 from the first series of video signal lines 1 r , 1 g , and 1 b are supplied to the respective corresponding data lines d 1 , d 2 , and d 3 . during the next period t 2 of the pc 2 being high level , three switching elements 21 , 22 , and 23 are turned on , and three dots video signals o 2 from the second series of video signal lines 2 r , 2 g , and 2 b are supplied to the respective corresponding data lines d 4 , d 5 , and d 6 . similarly , when drive pulses pc 3 , pc 4 . . . sequentially become high level , the first and second series of video signals equivalent to three dots are alternately supplied to the respective corresponding data lines . here , since the sample hold circuit 600 performs sampling at different timing at intervals of one pixel ( rgb signals equivalent to three dots ), unlike the circuit shown in fig9 video signals corresponding to different pixels are input to the first and second series of video signal lines in the panel . therefore , new video signals are input to each of the video signal lines only at every six dots . in other words , driving by the six pixel corresponding system can be realized and this system enables optimum graphics display . with respect to the constitution of a circuit shown in fig5 since the drive pulse generating circuit 6 is comprised one series of shift register 60 , it is necessary to operate the shift register 60 using high speed clock signals clks . if it is difficult to do so , the drive pulse generating circuit 6 may be composed of a plurality of series of shift registers . fig7 shows an example drive pulse generating circuit 6 comprises two series of shift registers 61 and 62 . in this example , the constitution of the respective shift registers is nearly identical to that of the shift register 60 , and the frequency of clock signals ck 1 , ck 2 and the start signal sth to be applied is half as much as that of the signals to be applied the shift register 60 . further , and gates 63 , 65 . . . which calculate logical product of an output are provided at a certain stage and an output at the next stage of the shift register 61 , and these outputs are intended to be drive pulses pc 1 , pc 3 . . . for the switching elements connected to the first series of video signal lines 1 r , 1 g , and 1 b . similarly , and gates 64 and 66 . . . which calculate product of an output are provided at a certain stage and an output are provided at the next stage of the shift register 62 , and these outputs are intended to be drive pulses pc 2 , pc 4 . . . for the switching elements connected to the second series of video signal lines 2 r , 2 g , and 2 b . with the constitution described above , as shown by the waveform ( d ) in fig8 from each stage of the first series of shift register 61 , outputs pd 1 , pd 2 , pd 3 . . . whose pulse width is equivalent to one cycle of the clock signal ck 1 , namely , two cycles of the clock signal clk are sequentially output synchronizing with a rise of the clock signal clk . further , as shown by waveforms ( h ) to ( j ) in fig8 from each stage of the second series of shift register , outputs pe 1 , pe 2 , pe 3 . . . whose pulse width is equivalent to one cycle of the clock signal ck 2 , namely , two cycles of the clock signal clk are sequentially output synchronizing with a fall of the clock signal clk . thus , as shown by waveforms ( k ), ( l ), ( m ), and ( n ) in fig8 from the and gates 62 , 63 , 64 . . . , drive pulses pc 1 , pc 2 , pc 3 . . . which are identical to those shown by waveforms ( f ), ( g ), ( h ), and ( i ) in fig6 are output . in other words , the drive pulse generating circuit which is composed of two series of shift registers 61 and 62 shown in fig7 only requires a half operating frequency and performs the same operation as that of a series of shift register 60 shown in fig5 . although a circuit having two series of video signal lines has been described above , it may also be preferable to have three or more series of video signal lines . | 6 |
the invention now will be described more fully hereinafter with reference to the accompanying drawings , in which embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . like reference numerals refer to like elements throughout the description of the figures . it will be understood that when an element is referred to as being “ on ” another element , it can be directly on the other element or intervening elements may be present . in contrast , when an element is referred to as being “ directly on ” another element , there are no intervening elements present . it will be understood that when an element is referred to as being “ connected ” or “ coupled ” to another element , it can be directly connected or coupled to the other element or intervening elements may be present . in contrast , when an element is referred to as being “ directly connected or coupled ” to another element , there are no intervening elements present . furthermore , “ connected ” or “ coupled ” as used herein may include wirelessly connected or coupled . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . it will be understood that , although the terms first , second , etc . may be used herein to describe various elements , these elements should not be limited by these terms . these terms are only used to distinguish one element from another . for example , a first layer could be termed a second layer , and , similarly , a second layer could be termed a first layer without departing from the teachings of the disclosure . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” or “ includes ” and / or “ including ” when used in this specification , specify the presence of stated features , regions , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , regions , integers , steps , operations , elements , components , and / or groups thereof . furthermore , relative terms , such as “ lower ” or “ bottom ” and “ upper ” or “ top ,” may be used herein to describe one element &# 39 ; s relationship to other elements as illustrated in the figures . it will be understood that relative terms are intended to encompass different orientations of the device in addition to the orientation depicted in the figures . for example , if the device in one of the figures were turned over , elements described as being on the “ lower ” side of other elements would then be oriented on “ upper ” sides of the other elements . the exemplary term “ lower ”, can therefore , encompass both an orientation of “ lower ” and “ upper ,” depending of the particular orientation of the figure . similarly , if the device in one of the figures is turned over , elements described as “ below ” or “ beneath ” other elements would then be oriented “ above ” the other elements . the exemplary terms “ below ” or “ beneath ” can , therefore , encompass both an orientation of above and below . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and the present disclosure , and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein . embodiments of the present invention are described herein with reference to cross section illustrations that are schematic illustrations of idealized embodiments of the present invention . as such , variations from the shapes of the illustrations as a result , for example , of manufacturing techniques and / or tolerances , are to be expected . thus , embodiments of the present invention should not be construed as limited to the particular shapes of regions illustrated herein but are to include deviations in shapes that result , for example , from manufacturing . for example , a region illustrated or described as flat may , typically , have rough and / or nonlinear features . moreover , sharp angles that are illustrated may be rounded . thus , the regions illustrated in the figures are schematic in nature and their shapes are not intended to illustrate the precise shape of a region and are not intended to limit the scope of the present invention . in the description , a term “ substrate ” used herein may include a structure based on a semiconductor , having a semiconductor surface exposed . it should be understood that such a structure may contain silicon , silicon on insulator , silicon on sapphire , doped or undoped silicon , epitaxial layer supported by a semiconductor substrate , or another structure of a semiconductor . and , the semiconductor may be silicon , germanium , indium gallium arsenide ( ingaas ), or lead sulfide . ingaas is a semiconductor composed of indium gallium arsenic . other combinations thereof , may not be used in combination but not limited to the above . in addition , the substrate described hereinafter may be one in which regions , conductive layers , insulation layers , their patterns , and / or junctions are formed . as stated in wikipedia , a photodiode is a type of photodetector capable of converting light into either current or voltage , depending upon the mode of operation . when used in zero bias or photovoltaic mode , the flow of photocurrent out of the device is restricted and a voltage builds up . the diode becomes forward biased and “ dark current ” ( internally generated current ) begins to flow across the junction in the direction opposite to the photocurrent . this mode is responsible for the photovoltaic effect which is the basis for solar cells . as further stated in wikipedia , in the photoconductive mode , the diode is often reversed biased dramatically reducing the response time at the expense of increased noise . this increases the width of the depletion layer , which decreases the junction &# 39 ; s capacitance resulting in faster response times . the reverse bias induces only a small amount of current ( known as saturation or back current ) along its direction while the photocurrent remains virtually the same . the photocurrent is linearly proportional to the illuminance . one facet of the invention , which is simply an option , is to build the led and solar cell using a common substrate . in so doing , the device becomes more integral for stability and lighter for energy conservation . for example , shown in fig1 are the semiconductor layers forming a photodiode . as reported in science daily , in an article titled “ advance brings low - cost , bright led lighting closer to reality ,” jul . 21 , 2008 , a new breakthrough in solid state lighting led solid - state lights on regular metal - coated silicon wafers . inside a reactor , gallium nitride is deposited on silicon at temperatures of about 1 , 000 degrees celsius , or 1 , 800 degrees fahrenheit . in the new silicon - based led research , the purdue engineers “ metallized ” the silicon substrate with a built - in reflective layer of zirconium nitride . ordinarily , zirconium nitride is unstable in the presence of silicon , meaning it undergoes a chemical reaction that changes its properties . the purdue researchers solved this problem by placing an insulating layer of aluminum nitride between the silicon substrate and the zirconium nitride . fig1 is a side view of a preferred embodiment of the present invention . the assembly shown in fig1 is a preferred embodiment assembly 10 comprising solar panel support surface 2 , led support 3 , central portion 4 , cover 5 , wind direction detector 7 , and motor / generator 9 . it can be readily appreciated by those of ordinary skill in the art that the solar support surface 2 may comprise one or a plurality of panels 2 p and may take a variety of forms , such as circles , squares , rectangles or arcuate sections . the solar panels 2 may range in dimensions from 1 inch by one inch to two square feet depending on the application , power requirements , and resources available . the led support 3 is shown as a “ disk ” but can be any configuration or form . led support 3 supports led 3 l ; which may be a plurality of up to 50 depending on the intensity desired . moreover , the selection of leds 3 l is exemplary and any type of light may be used without departing from the scope of the invention . the function of the solar support 2 and led support 3 may be combined and a single support may perform both functions . additionally , the solar support 2 and led support 3 as well as solar diodes 2 s and leds 3 l may be one integral unit . inasmuch as both leds 3 l and photodiodes 2 s comprise substrates , a preferred embodiment utilizes the same substrate for both the photodiode and leds . in this regard , the leds 3 l may be formed using , for example , a sapphire substrate . the same substrate may be used for the photodiode configuration . by doing so , the assembly weight and material requirements are reduced . moreover , an integral unit comprising the solar support 2 and led support 3 provides for ease of assembly and greater strength and durability . assembly 10 further comprises vanes 6 mounted on the support 3 . the vanes may be plastic or aluminum or any material which provides a light weight , durable , rigid construction . the vanes cause the support 3 to turn in response to the force of the wind . wind screen 5 is substantially semicircular in configuration and shields one side of the led support 3 while the other side is subjected to the wind . wind screen 5 is rotatably mounted and is controlled by central vane 7 which responds to wind direction . in addition , led support 3 is operatively attached to central portion 4 so as to rotate as motor / generator 9 turns , as will be described later . as shown in fig2 , the wind screen covers half of the vanes 6 so that the force applied by the wind to the vanes cases them to turn in a single direction . other configurations which achieve this result are contemplated within the scope of the invention . the wind screen is substantially clear so as to allow the sun rays to penetrate to the solar panels 2 . optionally the vanes 6 may be solar panels or mirrors that form the blades of the wind turbine . on the opposite side to solar panels 2 s , led support 3 may comprise additional vanes 6 which mirror or focus light from the led support 3 . in other words , mirrors operate to focus light onto solar panel as well as focus light onto subject area . turning of turbine creates strobe effect to decrease light energy being used . the turbine blades 6 are optionally adjustable so that maximum wind speed does not damage generator / battery charger and / or structural supporting structure . shown in fig3 is a preferred embodiment in which the vanes 6 are positioned between the solar panels 2 and led support 3 . this configuration effectively channels the wind between the solar panels 2 and led structure . the wind dissipates the heat energy given off by the leds so as to facilitate cooling or temperature control . in the absence of wind , the vanes 6 may be turned by motor 9 to facilitate cooling . fig3 further shows a side view of the led support 3 , photodiodes or solar panels 2 , wind screen or cover 5 and wind directional vane 7 , wind directional vane 7 operates in a manner similar to a weather vane in that it points in the wind direction . wind directional vane 7 may be a variety of configurations the directional vane 7 and wind screen form an integral unit and are designed so the weight is evenly distributed each side of the axis of rotation , but the pointer can move freely on its axis . the area of the directional vane 7 is distributed so that the side with the larger area is blown away from the wind direction . the optional directional pointer may be mounted such that is always on the smaller side . for the wind direction reading to be accurate , the directional vane must be located well above the ground and away from buildings , trees , and other objects which interfere with the true wind direction . but the same is not necessary for the basic functioning of the assembly 10 . shown in fig4 is a “ see - through view ” showing the overlay of the photodiode panels 2 vis - à - vis the led support 3 , and the central pivot or rotating shaft - like portion or housing 4 . these elements are not intended to be transparent , but are shown as being transparent for illustrative purposes only . although four panels 2 occupying quarter sections are shown in fig4 , any number of panels may be utilized . the panels may be shaped in the form of a rectangle , square , circle , arcuate segment or can be solid or contain holes for the passage of air . fig5 illustrates the support 3 which can be rotatably attached to a central shaft . the led segments 3 a or blocks may be of any configuration and the four arcuate segments are but an example of a variety of possible configurations . led modules which are commercially available may be placed on the led support 3 in a conventional manner . fig5 illustrates an optional shaft 4 s , housing 4 , key 8 k and solenoid 8 s . when solenoid 8 s is energized , the central portion of the solenoid 8 s engages the key 8 k in the shaft 4 s causing the shaft to turn with the support 3 . fig5 a is an overhead illustration of a cut - away view of led support 3 illustrating optional vanes 6 a which can be used to propel rotation of the support 3 and provide an additional cooling effect . optionally , cover 5 may cover one half the circumference of vanes 6 a so that the wind imparts only vanes turning in the direction of the wind . shown in fig6 is a plan view of a preferred embodiment of the present invention . as shown in fig6 , for a prevailing wind direction from right to left ( as shown in the figure ) the wind direction detector 7 would point to the left and the cover 5 would cover half of the vanes 6 so that the support 2 and the support 3 would turn in a counterclockwise direction on central portion 4 . central portion 4 may be a shaft which is operatively connected to shaft 11 and motor / generator 9 . although four vanes ( or eight vane segments are shown in fig6 , any number of vanes could be used to enable the wind to propel or rotate the subassembly . shown in fig7 is a plan view of a preferred embodiment of the present invention . as shown in fig7 , for a prevailing wind direction from bottom to top ( as shown in the figure ) the wind direction detector 7 would point to the top and the cover 5 would cover half of the vanes 6 so that the solar panels 2 and the led support 3 would turn in a counterclockwise direction on central portion 4 . central portion 4 may be a shaft which is operatively connected to shaft 11 and motor / generator 9 . although four vanes ( or eight vane segments are shown in fig7 , any number of vanes could be used to enable the wind to propel or rotate the subassembly . shown in fig8 is a plan view of a preferred embodiment of the present invention . as shown in fig8 , for a prevailing wind direction from bottom left to top right ( as shown in the figure ) the wind direction detector 7 would point to the top right and the cover 5 would cover half of the vanes 6 so that the solar panels 2 and the support 3 would turn in a counterclockwise direction on central portion 4 . although the cover 5 is shown as solid and not transparent to like , the cover 5 may be transparent or translucent to allow passage of sunlight to panels 2 . shown in fig9 is a preferred embodiment subassembly that is an optional portion of the invention . the subassembly comprises a central portion 4 which is operatively connected to a shaft 11 , which may be solid or hollow . although only a portion of the support 3 is shown in fig9 , it can be appreciated that the support 3 extends outward from the portion shown in fig9 . in an optional embodiment , the shaft 11 has a first electrical contact which may be a metal such as copper , gold , silver or aluminum . as the support 3 turns on the shaft 11 , a second electrical contact 8 b makes intermittent electrical connection with the contact 8 a . when powering the leds through this contact , a strobe - like effect is achieved when the leds are turned on and off as intermittent contact is made through the connection of contacts 8 a and 8 b . the contact portion 8 b may be adjustable thought the expansion and contraction of the area of the contact 8 b . this strobing effect conserves energy and creates a decorative effect . in an embodiment in which the battery level is monitored , when the battery reaches a low charge level , the assembly may automatically be switched to a mode in which the leds are flashed on and off in the strobe mode to conserve energy from the battery . optionally , controller 21 may control the operation of contacts 8 a , 8 b and shaft 11 . moreover , the shaft and support 3 may have an integral setting or mode in which the support 3 is substantially locked ( such as for example by a solenoid 8 s ) so as to turn integrally with the shaft 11 . this may be accomplished mechanically , such as by using a sliding pin , or remotely such as by using magnetism to lock the contacts 8 a , 8 b in place . when the contacts are locked into position freely relative to one another , in this mode , the contacts 8 a and 8 b remain in direct contact as the shaft 11 turns . alternately , the shaft 11 may turn freely in one direction , yet be prevented from turning in another such as by a rachet - type system well known to those of ordinary skill in the art . contacts 8 a and 8 b are merely examples of a strobe element which function may be perform by other means which cause power to the leds 3 l to be intermittent . the strobe element may be controlled through the use of programmable controller 21 . shown in fig1 is an example of a preferred embodiment support 3 section and led modules 3 l . more specifically , conventional led modules 3 l are shown . the modules may be connected to the battery 13 in a conventional manner . any variety or type of led may be used without departing from the scope of the invention . fig1 is a schematic side view of a preferred embodiment of the present invention in which assembly 10 c comprises support 3 , solar panels 2 , cover 5 , and wind direction vane 7 . motor - generator 9 is pivotally mounted by supports 14 . each of supports 14 are attached to a pivot or shaft or pivot 15 . shaft or pivot 15 is in turn driven by a motor ( shown in fig1 b ) inside housing 12 which causes the entire assembly 10 c to pivot as shown in fig1 . as a result the solar support 2 and elements 2 s on the assembly 10 c can track the sun as it rises in the east and sets in the west . for example , a motor 16 slowly turns the pulley which drives the belt resulting in the angular disposition of the elements 2 s . fig1 b is a schematic showing the inside of housing 12 , which may for example comprise a motor 16 , timer 18 and belt 17 which drives a pulley 15 p mounted on shaft 15 to drive the pivoting of the subassembly shown in fig1 . timer 18 is set so that the solar cells 2 s will face in a predetermined direction at a predetermined time in order to maximize the sunlight or environmental light on the solar panels , elements , or diodes 2 s . the timer 18 activates the motor 16 which drives belt 17 to drive pulley 15 p on pivot or shaft 15 that causes the entire assembly 10 to pivot . as a result the solar elements 2 s on the assembly 10 can track the sun as it rises in the east and sets in the west . fig1 is an illustration of an alternate solar panel assembly 2 sa comprising a positive grid , n - type layer , active section , p - type layer and metal electrode . the solar element is connected to the circuit 20 and battery 13 as described herein . fig1 is an illustration of an alternate solar panel assembly 2 sb comprising a negative grid , p - type layer , active section , n - type layer and metal electrode . the solar element is connected to the circuit 20 and battery 13 as described herein . fig1 is a schematic illustration of an optional embodiment in which the led and solar cell are integrally formed or combined after manufacture . specifically , shown in fig1 is a top anode or transparent electrode . shown next is a grid , p - type layer , active section , n - type layer , metal electrode ( cathode ), silicon layer , insulating layer of aluminum nitride , built - in reflective layer of zirconium nitride , and gallium nitride . schematically shown in fig1 is circuit subassembly 20 and battery 13 . fig1 is a schematic diagram showing a device 19 for regulating the voltage , controlling the charge into , and / or current from the battery 13 which also may optionally function as an on / off switch which prevents overcharging of the battery 13 and / or effectively removes battery 13 from the circuit 20 a . motor generator 9 operates to recharge battery 13 when in the generator mode and when a low battery indicator 23 indicates the need for a charge . the motor / generator 9 is optional in that the solar diodes may optionally be the sole means for recharging the battery 13 . also , when the motor / generator 9 is operating in the circuit 20 a , in cases where the wind is causing the rotation of the vanes 6 , the battery may be bypassed using device 19 to disconnect the battery from the circuitry entirely . similarly , a device 19 a may optionally be position in series with the motor / generator 9 to disconnect it from the circuitry when desired . as a further option , devices 19 and 19 a may be combined into a combined voltage regulator , charge controller and / or charge level indicator . when the battery is determined to be low , ( from optional low battery indicator 23 or the function could be incorporated into the power controller / regulator 19 ) the contacts 8 a , 8 b may be positioned such that the contacts are only intermittently connected to create a strobe - like effect for the activation of the leds 3 l . similarly , temperature sensor 22 may be operatively connected to the contacts 8 a , 8 b shorten the contact duration through contacts 8 a , 8 b or optionally may operate to open the optional switch 16 l to prevent over heating of the leds 3 l , and / or activate motor / generator 9 to rotate the support 3 to create a cooling effect . moreover , alternatively the light detector 25 ( such as commonly used part 2n3904 ) may operate to turns the leds on and off at daylight and dusk either by sensing the intensity of light from the sun and / or environment or by a timer which turns the led on and off at specified times and also be responsive to the temperature sensor . fig1 is a schematic diagram showing circuitry 20 b comprising an optional controller 21 , with control lines represented by dashed lines . controller 21 may be a microprocessor , programmable controller , processor , programmable chip device , computer , microcomputer , controller or the like . controller 21 may receive control signals from the low battery indicator 23 and , in turn , regulate the contacts 8 a , 8 b such that the contacts are only intermittently connected to create a strobe - like effect for the activation of leds 3 l . similarly , if temperature sensor 22 sends a high temperature control signal to the controller 21 , controller 21 may send control signals via the control lines to any one of or in tandem open the optional switch 16 l to prevent over heating of the led , activate motor / generator 9 to rotate the support 3 to create a cooling effect , and / or shorten the contact duration through contacts 8 a , 8 b . moreover , alternatively controller 21 may have a light detector which turns the led on and off at daylight and dusk either by sensing the intensity of light from the sun and / or environment or by a timer which turns the led on and off at specified times . moreover the controller 21 may be a programmable controller includes a feedback routine for measuring the intensities of the leds 3 l and using the actual intensities as feedback . optionally , the controller may cause the leds 3 l to be supplied with approximately 50 % of said maximum current capacity or some fraction thereof to either conserve power or reduce the temperature of the leds . optionally , the programmable controller may operate to adjust the intensity , with the programmable controller including an intensity compensation routine for adjusting the intensity of the led , based on the intensity as detected by feedback means . fig1 is a schematic diagram showing the circuitry of a preferred embodiment assembly 20 c comprising an optional controller 21 with control lines being represented by dashed lines illustrating the sending of control signals and receiving of data signals . these control lines may be wired or connect wirelessly such as for example , by bluetooth technology . the circuit assembly 20 c may further comprise an optional remote control and bypass circuitry . shown in fig1 is a controller 21 which is optionally controlled by a remote control 26 . controller 21 , which is optionally programmable , controls switch 17 which causes the motor / generator 9 and battery 13 to become connected to the solar cell and leds 3 l . controller 21 may operate to select one of the motor or generator to rotate the support 3 using the motor mode of motor / generator 9 or select the generator mode in order for the rotation of the support 3 to be used to generate electricity in the generator mode of motor / generator 9 . optionally , the extent of the battery charge may trigger the mode of the motor / generator 9 . such as , for example , if the battery is low , and the wind is causing the support 3 to turn , power from the rotation can be used to generate electricity to power to leds 3 l or for storage into battery 13 . controller 21 is linked by control lines to the low battery indicator 23 . if a low battery is sensed and the solar cells are not in the process of recharging the battery ( such as for example , during nighttime ), the controller , which includes a day / night photosensor , may either disconnect the battery from the led circuitry or cause the leds to flash intermittently through contacts 8 a , 8 b in strobe - like fashion to conserve power . inasmuch as controller 21 is also optionally connected by control lines to motor / generator 9 , if the operator who operates the remote control 26 decides that a turning of the support 3 is beneficial to cause rotation of the leds 3 l , then the operator turns the motor 9 on via the remote control . similarly , the control lines are connected to an optional direct activation circuit which bypasses the photoelectric light detector 25 and turns on the leds 3 l for purposes of testing or daylight operation . optionally , a motion senor 27 may be used to activate the leds 3 l when motion is sensed by the motion sensor 27 . controller 21 may optionally be connected to the motion sensor 27 to deactivate the motion sensor 27 through either programming or through operator activation via the remote control 26 . as depicted in fig1 , an optional controller 19 which may be or include a voltage regulator / charge control that optionally functions as a switch to effectively regulate the charging of the battery 13 , regulate the voltage / current or electrical power being sent to and / or from the battery 13 and / or disconnect the battery 13 from the remaining circuitry . for example , if wind power is driving the wind vanes and producing electric power via the motor / generator 9 and the battery is not in need of a charge , the controller 19 may receive control signals from the controller 21 which effectively opens a switch within controller 19 to remove the battery 13 from the remainder of circuit 20 . if the wind power is available , but either the leds 3 l are nonoperational or power is in excess of that needed to power the leds , then the controller 21 in conjunction with the controller 19 may cause the current generated by the motor / generator 9 to charge the battery 13 . controller 21 may be optionally connected to the motor generator 9 . control signals may be used to set the motor / generator into either the motor mode , which operates to turn the support 3 or in the generator mode whereby rotation of the support 3 drives the generator 9 . controller 21 may be connected to sense the motion of the support 3 to determine if the wind is driving the turbine blades 6 so that power from the generator 9 may be used to either recharge the battery or power the leds . controller 21 may also connected via control lines to temperature sensor 22 . should the temperature being sensed exceed a predetermined temperature above which the circuitry or leds 3 l or solar elements 2 s may be damaged or effected by to much heat , the controller may ( 1 ) turn off the leds , ( 2 ) intermittently activate the leds and / or ( 3 ) cause the motor 9 to rotate support 3 effectively operating as a fan to cool down the leds 3 l . fig5 a is an overhead illustration of a cut - away view of support 3 including led panels 3 a . fig5 a illustrates optional vanes 6 a which can be used to propel rotation of the support 3 and provide an additional cooling effect . optionally , cover 5 may cover one half the circumference of vanes 6 a so that the wind imparts only vanes turning in the direction of the wind . with the vanes placed in the proximity of the leds 3 l , the cooling effect is enhanced . with the optional embodiment shown in fig5 a , the vanes may be placed in the proximity of the leds 3 l to enhance the cooling effect . the leds 3 l shown in fig5 a are merely illustrative as to a potential location of 3 leds 3 l are exemplary and not limiting . the light from the leds 3 l as shown is reflected by the mirrored surfaces of the wind vanes 6 a to either scatter or intensify the light depending upon the nature of the application , environment and purpose of the light . for example , the mirrored vanes may provide a decorative effect or may be used to increase coverage of the light being emitted from the leds 3 l . controller 21 may optionally be programmed to turn on and off certain of the leds 3 l at either specific times or in a specific sequence . optionally , the leds may vary in color and the controller 21 may be used to vary the colors and / or the sequence of colors . this may be programmable and / or operator activated through remote control 25 . moreover , in conjunction with the motion activated circuitry or motion sensor 27 , the leds may flash red , for example , when an intruder is sensed . thus , the device is operable as a security system . optionally , an alarm may be activated upon the sensing of motion . the controller may optionally be used to select a security mode or the remote control may be used by the operator to select a security mode . controller 21 is also connected by control lines ( shown in fig1 and 17 by dashed lines ) to a controller 19 a which optionally may include voltage regulator or charge control functions . controller 19 a may optionally include a switch which effectively removes the motor generator 9 from the circuit 20 . for example , in extreme wind conditions , it may be desirable to remove the generator completely from the circuitry . the terminology controller as used herein may be a microprocessor , computer , programmable controller , programmable chip , processor or the like . the terminology motor / generator as used herein means a combination motor / generator or , in the alternative , a motor operatively connected to a generator . the motor / generator having a motor mode when it is used to turn a shaft and a generator mode in which a turning shaft generates electrical power . although a few exemplary embodiments of the present invention have been shown and described , it would be appreciated by those skilled in the art that changes may be made in these embodiments , without departing from the principles and spirit of the invention , the scope of which is defined in the claims and their equivalents . | 5 |
hereinafter , a board connector of an embodiment of the invention will be described with reference to the accompanying drawings . as shown in fig1 to 4 , the board connector 1 is used for electrically connecting a board ( pcb ) 2 a and another board ( pcb ) 2 b which are juxtaposed , and configured by : a board connector 6 a which is configured by adding a cover member 5 a to a pair of a plug 3 a and a socket 4 a ; another board connector 6 b which is configured by adding another cover member 5 b to a pair of a plug 3 b and a socket 4 b ; and an insulating member 7 . in the plug 3 a , plural thin contact grooves 31 are disposed in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction in a plug body 30 which is made of an insulating material ( synthetic resin ), and which has an approximately rectangular parallelepiped shape that is laterally elongated . one - end sides 11 a of plug contacts 10 which are configured by plural thin plate - like conductors , and which are easily bent or bendable are fitted into the contact grooves 31 from the side of the lower end ( insertion side end ) of the plug body 30 . the one - end sides 11 a are bent into a substantially u - like shape along the longitudinal direction of the plug contacts . in the plug contacts 10 , outer - side pieces elongating from lower - end bent portions of the one - end sides 11 a are pressingly inserted into and fixed to the respective contact grooves 31 so as to be substantially flush with the rear side face of the plug body 30 , and inner - side pieces elongating from lower - end bent portions of the one - end sides 11 a are fitted into the contact grooves 31 in an elastically deformable manner in the front side of the plug body 30 , so that the one - end sides 11 a of the plug contacts 10 are fixed in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction . on the rear side face of the plug 3 a , therefore , the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a are exposed in a substantially flush manner , and , from an upper portion of the front side face of the plug 3 a , the plug contacts 10 are drawn out . in order to attach the cover member 5 a to the plug 3 a , a horizontal laterally - directed fulcrum shaft 32 which is perpendicularly projected from upper portions of the right and left side faces of the plug body 30 is integrally disposed . in the socket 4 a , a plug fitting recess 41 into which the plug 3 a is inserted from the upper face side and fitted is disposed in a front portion of a socket body 40 which is made of an insulating material ( synthetic resin ), and which has an approximately rectangular parallelepiped shape that is laterally elongated . plural thin contact grooves 42 in which the lower ends are opened in the bottom face of the socket body 40 , and which communicate with the plug fitting recess 41 with breaking a partition wall with respect to the plug fitting recess 41 are disposed in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction in a rear portion of the socket body 40 . plural legged socket contacts 20 which are configured by plural thin plate - like conductors , and which are bent into a substantially inverted u - like shape along the longitudinal direction are fitted into the contact grooves 42 from the bottom face side of the socket body 40 . in the socket contacts 20 , rear side pieces elongating from upper - end bent portions are pressingly inserted into and fixed to the respective contact grooves 42 so as to elongate along the rear wall faces of the contact grooves 42 , and front side pieces elongating from the upper - bent portions , i . e ., movable contact pieces 21 which are disposed in one - end sides of the socket contacts 20 , and which are elastically displaceable are fitted into the contact grooves 42 in an elastically deformable manner . tip end portions ( free - end portions ) of the movable contact pieces 21 are projected in the plug fitting recess 41 . in a state where leg portions which are horizontally rearward extended from lower ends of the rear side pieces with respect to the upper - end bent portions of the socket contacts 20 , i . e ., soldering portions 22 which are disposed in the other - end sides of the socket contacts 20 are projected in the rear outer side of the socket body 40 so as to be substantially flush with the bottom face of the socket body 40 , the socket contacts 20 are fixed in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction . thin groove holes 43 are disposed in a front portion of the socket body 40 and in right and left outer sides of the plug fitting recess 41 . one piece of a reinforcing terminal 44 which is an l - like metal part is pressingly inserted into and fixed to each of the groove holes 43 from the side of the bottom face of the socket body 40 , and the other piece of the reinforcing terminal 44 , i . e ., a soldering portion ( leg portion ) is projected to each of the right and left outer sides of the socket body 40 so as to be substantially flush with the bottom face of the socket body 40 . therefore , a plug insertion port ( the open end of the plug fitting recess 41 ) is opened in a front portion of the upper face of the socket 4 a , and the soldering portions 22 of the socket contacts 20 and the soldering portions of the reinforcing terminals 44 are exposed on the bottom face of the socket 4 a so as to be substantially flush with each other . the soldering portions 22 of the socket contacts 20 are projected to the rear outer side of the socket 4 a , and the soldering portions of the reinforcing terminals 44 are projected to the right and left outer sides of the socket 4 a . in order to fix the cover member 5 a when the plug 3 a and the socket 4 a are fitted to each other , engagement claws 45 are integrally disposed in right and left or two places of the rear side face of the socket body 40 . the socket 4 a is surface - mounted on the board 2 a , whereby the soldering portions 22 of the socket contacts 20 and the soldering portions of the reinforcing terminals 44 are fixed by soldering to the board 2 a , and the socket contacts 20 are electrically connected to the board 2 a . in the socket 4 a , positioning protrusions 47 are integrally disposed in two places of the bottom face of the socket body 40 in order to fit the socket to positioning holes 60 disposed in the board 2 a and position the socket with respect to the board 2 a . the cover member 5 a is a molded piece made of an insulating material ( synthetic resin ), and covers the plug 3 a and the socket 4 a in the fitting state from the upper and rear sides . as shown in fig6 also , in the cover member 5 a , the following components are integrally disposed : a rectangular plate - like cover top plate portion 50 which covers the plug 3 a and the socket 4 a in the fitting state from the upper side ; a rectangular plate - like cover rear side plate portion 51 which is perpendicularly continuous to the rear edge of the cover top plate portion 50 , which covers the plug 3 a and the socket 4 a in the fitting state from the rear side , and which covers the soldering portions 22 of the socket contacts 20 from the upper side ; and cover right and left side plate portions 52 which are perpendicularly bent so as to extend along the right and left side edges of the cover top plate portion 50 and those of the cover rear side plate portion 51 , which are projected from a front portion of the upper side face of the socket 4 a into which the plug 3 a is fitted , and which laterally integrally cover rear portions of the right and left side faces of the socket 4 a from upper portions of the right and left side faces of the plug 3 a . in the cover member 5 a , front portions of the right and left side plate portions 52 are pivotally supported via mounting holes 53 by the fulcrum shaft 32 which is disposed on the plug 3 a . the cover member 5 a is swingably attached to the plug 3 a via the fulcrum shaft 32 . the plug 3 a is set by the cover member 5 a to a state where the upper , rear , and right and left sides are covered , and the front side in the direction of drawing out the plug contacts 10 , and the lower side in the direction of inserting the contacts into the socket 4 a are opened . in the cover member 5 a , a protrusion 54 in which the tip end continuously butts against the upper end face of the plug 3 a in a range from the left end to the right end at a swing position where the cover top plate portion 50 is perpendicular to the plug 3 a is integrally disposed on the inner face of the cover top plate portion 50 , and engagement claws 55 which , when the plug 3 a and the socket 4 a are fitted to each other , are engaged in the plug extraction direction with the engagement claws 45 disposed on the socket body 40 to fix the cover member 5 a to the socket 4 a are integrally disposed in right and left or two places of the inner face of the cover rear side plate portion 51 . furthermore , joining portions 46 , 56 which , when the plug 3 a and the socket 4 a are fitted to each other , are joined to each other in a front side with respect to the fulcrum shaft 32 are disposed in the socket 4 a and the cover member 5 a . when the plug 3 a and the socket 4 a are fitted to each other , front - end portions of the lower end faces of the cover right and left side plate portions 52 are joined to right and left end portions of the upper end face of the front sidewall of the socket body 40 . the right and left end portions of the upper end face of the front sidewall of the socket body 40 are set as the joining portions 46 on the side of the socket 4 a , and the front end portions of the lower end faces of the cover right and left side plate portions 52 are set as the joining portions 56 on the side of the cover member 5 a . in the cover member 5 a , u - like cutaways 57 which are upward opened are formed in right and left or two places of an upper portion of the cover rear side plate portion 51 , right and left side portions of the cutaways 57 are elongated from a rear portion of the cover top plate portion 50 , and movable plate portions 58 which are surrounded by the cutaways 57 , which are configured by parts of the cover rear side plate portion 51 and a part of the cover top plate portion 50 , and which are perpendicularly bent are integrally disposed . in the movable plate portions 58 , operation levers 59 which are projected from and flushly with parts of the cover top plate portion 50 more rearward than parts of the cover rear side plate portion 51 are integrally disposed , and the engagement claws 55 on the side of the cover member 5 a are integrally disposed on the inner faces of lower end portions of parts of the cover rear side plate portion 51 which are free - end portions of the movable plate portions 58 . in order to facilitate elastic deformation , parts of the cover rear side plate portion 51 in the movable plate portions 58 are thinned . as described above , the board connector 6 a is configured as a board connector with a dust - proof cover in which the cover member 5 a is added to the pair of the plug 3 a and the socket 4 a . next , the other pair of plug 3 b and socket 4 b of the other board connector 6 b , and the cover member 5 b to be added to the plug and the socket have the same structure as the pair of plug 3 a and socket 4 a of the board connector 6 a and the cover member 5 a to be added to the plug and the socket , and the other board connector 6 b is configured as the same board connector with a dust - proof cover as the board connector 6 a . therefore , the identical components are denoted by the same reference numerals , and there detailed description is omitted . as shown in fig3 , however , the other plug 3 b of the other board connector 6 b is configured so that other one - end sides 11 b which are bent into a substantially u - like shape along the longitudinal direction of the plug contacts 10 are fixed to the plug body 30 in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction . furthermore , the other socket 4 b of the other board connector 6 b is surface - mounted on the other board 2 b , whereby the soldering portions 22 of the socket contacts 20 and the soldering portions of the reinforcing terminals 44 are fixed by soldering to the board 2 b , and the socket contacts 20 are electrically connected to the board 2 b . next , a plug insertion method in which , in order to fit the plug 3 a and socket 4 a of the board connector 6 a to each other , the plug 3 a is inserted into the plug fitting recess 41 of the socket 4 a will be described with reference to fig7 to 10 . as shown in fig7 , first , the cover member 5 a which is swingably attached via the fulcrum shaft 32 to the plug 3 a is swung about the fulcrum shaft 32 , and held to a swing position where the cover top plate portion 50 is perpendicular to the plug 3 a and the tip end of the protrusion 54 butts against the upper end face of the plug 3 a . by butting ( surface contact ) between the tip end of the protrusion 54 and the upper end face of the plug 3 a , the plug 3 a is held to a posture perpendicular to the cover top plate portion 50 . in this state , the cover member 5 a is positioned directly above the socket 4 a mounted on the board 2 a , and the cover member 5 a is lowered to approach the board 2 a , whereby the rear lower end side of the cover member 5 a is fitted from the upper side into the tall rear outer side of the socket 4 a . as result of this fitting , the cover member 5 a and the plug 3 a are positioned with respect to the socket 4 a , and the plug 3 a is positioned directly above the plug fitting recess 41 of the socket 4 a . in this state , the cover member 5 a is further lowered to approach the board 2 a , whereby , while the rear portion of the cover member 5 a is further fitted into the rear outer side of the socket 4 a , the lower end portion of the plug 3 a is fitted into the plug insertion port opened in the low - height front upper face side of the socket 4 a ( start of plug insertion ). in this state , the cover member 5 a is further lowered to approach the board 2 a , whereby , while the rear portion of the cover member 5 a is further fitted into the rear outer side of the socket 4 a as shown in fig8 , the plug 3 a is inserted into the plug fitting recess 41 of the socket 4 a until the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 hit the tip end portions of the movable contact pieces 21 of the socket contacts 20 which are projected in the plug fitting recess 41 of the socket 4 a . in the subsequent insertion , the movable contact pieces 21 of the socket contacts 20 produce an insertion resistance against the plug 3 a . when the cover member 5 a is pressed down to cause the protrusion 54 of the cover top plate portion 50 to press down the plug 3 a , therefore , the rear portion of the cover member 5 a presses the movable contact pieces 21 of the socket contacts 20 to cause the contacts to be elastically deformed , while the rear portion of the cover member 5 a is further fitted into the rear outer side of the socket 4 a , and the tip end portions of the movable contact pieces 21 are pressed back from the plug fitting recess 41 into the contact grooves 42 . when the plug 3 a passes beyond the tip end portions of the movable contact pieces 21 to be further inserted into the plug fitting recess 41 of the socket 4 a , the tip end portions of the movable contact pieces 21 of the socket contacts 20 are pressed against and contacted with the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 which are exposed on the rear side face of the plug 3 a so as to be substantially flush with each other . in this state , the cover member 5 a is further pressed down , and the plug 3 a is pressed down by the protrusion 54 of the cover top plate portion 50 . as a result , as shown in fig9 and 10 , while the rear portion of the cover member 5 a is further fitted into the rear outer side of the socket 4 a , the plug 3 a is completely inserted into the plug fitting recess 41 of the socket 4 a until the lower end of the plug 3 a bumps against the bottom face of the plug fitting recess 41 of the socket 4 a , whereby the plug 3 a and the socket 4 a are fitted together ( completion of the plug insertion ). during fitting of the plug 3 a and the socket 4 a ( when the plug 3 a and the socket 4 a are to be fitted to each other ), the plug 3 a is hidden by the cover member 5 a . since the positioning of the plug 3 a with respect to the socket 4 a can be performed by the cover member 5 a , however , it is not difficult to insert the plug 3 a . as the number of contacts of the plug contacts 10 and socket contacts 20 is more increased because of multiplication of the number of pins of the board connector 6 a , the insertion resistance on the plug 3 a in fitting of the plug 3 a and the socket 4 a becomes higher . the protrusion 54 disposed on the cover top plate portion 50 of the cover member 5 a continuously butts against the upper end face of the plug 3 a in the range from the left end to the right end to press the plug 3 a in the insertion direction , and hence the force of inserting the plug can be evenly transmitted by the cover member 5 a to the whole plug 3 a . even when the number of contacts is increased as a result of multiplication of the number of pins , therefore , insertion of the plug 3 a can be easily performed . in the embodiment , the protrusion 54 is disposed on the side of the cover member 5 a . alternatively , the protrusion may be disposed on the side of the plug 3 a . as shown in fig1 to 3 , 9 , and 10 , from the timing just before the fitting of the plug 3 a and the socket 4 a , the engagement claws 55 disposed on the movable plate portions 58 of the cover member 5 a ride on the engagement claws 45 disposed on the socket 4 a while producing elastic deformation of the movable plate portions 58 , the engagement claws 55 disposed on the movable plate portions 58 of the cover member 5 a pass beyond the engagement claws 45 disposed on the socket 4 a to enter below the claws when the plug 3 a and the socket 4 a are fitted together , and at the same time the engagement claws 55 disposed on the movable plate portions 58 of the cover member 5 a are engaged with the engagement claws 45 disposed on the socket 4 a in the plug extraction direction by an elastic return of the movable plate portions 58 . therefore , the cover member 5 a is fixed ( locked ) to the socket 4 a , the plug 3 a is fixed ( locked ) to the socket 4 a by the fixed cover member 5 a , and the fitting states of the plug 3 a and the socket 4 a , and the cover member 5 a and the socket 4 a are held . as a result , in the plug fitting recess 41 of the socket 4 a , the contact between the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 , and the tip end portions of the movable contact pieces 21 of the socket contacts 20 is held , and the one - end sides 11 a of the plug contacts 10 are electrically connected to the board 2 a . when the plug 3 a and the socket 4 a are fitted together , the plug 3 a and the socket 4 a in the fitting state are covered from the upper and rear sides by the cover member 5 a fixed to the socket 4 a , and contact portions of the plug 3 a and socket 4 a in the fitting state , i . e ., the plug fitting recess 41 of the socket 4 a is covered to cause dust and the like to hardly enter the plug fitting recess 41 . therefore , occurrence of a contact failure between the contacts 10 , 20 of the plug 3 a and socket 4 a because of a narrowed pitch of the contacts 10 , 20 can be suppressed . furthermore , the soldering portions 22 of the socket contacts 20 are covered from the upper side by the cover member 5 a , so that dust and the like hardly fall and deposit on the surfaces of the soldering portions 22 and gaps therebetween . therefore , an insulation failure in the soldering portions 22 of the socket contacts 20 because of a narrowed pitch of the contacts 10 , 20 of the plug 3 a and socket 4 a can be suppressed . when the plug 3 a and the socket 4 a are fitted together , the joining portions 46 on the side of the socket 4 a , and joining portions 56 on the side of the cover member 5 a which are disposed in the front side with respect to the fulcrum shaft 32 are joined to each other . namely , the right and left end portions of the upper end face of the front sidewall of the socket body 40 are joined to the front - end portions of the lower end faces of the cover right and left side plate portions 52 . a plug insertion method in which , in order to fit the plug 3 b and socket 4 b of the other board connector 6 b to each other , the plug 3 b is inserted into the plug fitting recess 41 of the socket 4 b , and a fitting state of the plug 3 b and the socket 4 b are identical with the plug insertion method of the board connector 6 a and the fitting state of the plug 3 a and the socket 4 a shown in fig7 to 10 . therefore , their detailed description and corresponding drawings are omitted . as shown in fig1 to 3 , in the board connector 6 a , the plug 3 a is inserted and fitted into the plug fitting recess 41 of the socket 4 a , and , in the plug fitting recess 41 of the socket 4 a , and the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 , and the tip end portions of the movable contact pieces 21 of the socket contacts 20 are contacted and held to each other , thereby electrically connecting the one - end sides 11 a of the plug contacts 10 to the board 2 a . by contrast , in the other board connector 6 b , the other plug 3 b is inserted and fitted into the plug fitting recess 41 of the other socket 4 b , and , in the plug fitting recess 41 of the socket 4 b , and the outer - side pieces elongating from the lower - end bent portions of the other - end sides 11 b of the plug contacts 10 , and the tip end portions of the movable contact pieces 21 of the socket contacts 20 are contacted and held to each other , thereby electrically connecting the other - end sides 11 b of the plug contacts 10 to the board 2 b . therefore , the board 2 a and the other board 2 b can be electrically connected together via the plug contacts 10 , the socket contacts 20 of the socket 4 a , and the socket contacts 20 of the other socket 4 b . next , a plug extraction method in which , in order to separate from each other the plug 3 a and socket 4 a of the board connector 6 a in the fitting state shown in fig1 to 3 , 9 , and 10 , the plug 3 a is extracted from the plug fitting recess 41 of the socket 4 a will be described with reference to fig1 . first , in the board connector 6 a in the fitting state shown in fig1 to 3 , 9 , and 10 , an operation of lifting up a rear portion of the cover member 5 a is performed by engaging the fingers with the operation levers 59 disposed on the movable plate portions 58 of the cover member 5 a . when the rear portion of the cover member 5 a is lifted up in this way , the engagement claws 55 disposed on the movable plate portions 58 of the cover member 5 a separate from the rear side face of the socket body 40 while producing elastic deformation of the movable plate portions 58 , and the engagement with the engagement claws 45 disposed on the socket 4 a is canceled . in this state , as shown in fig1 , the cover member 5 a is swung with setting as a lever fulcrum the joining portions 46 , 56 joined to each other in the front side with respect to the fulcrum shaft 32 by which the cover member 5 a is swingably attached to the plug 3 a . in accordance with the swinging operation of the cover member 5 a , the plug 3 a is pulled up in the plug fitting recess 41 of the socket 4 a via the fulcrum shaft 32 ( with setting the fulcrum shaft 32 as a point of action ). namely , the plug 3 a can be pulled up in the plug fitting recess 41 of the socket 4 a with using the cover member 5 a as a lever . by the operation of pulling up the plug 3 a , the plug 3 a is pulled up in the plug fitting recess 41 of the socket 4 a by the degree at which the lower end portion of the plug 3 a is lifted up to the vicinity of the tip end portions of the movable contact pieces 21 of the socket contacts 20 . then , the cover member 5 a is lifted up substantially directly above the socket 4 a , whereby the plug 3 a is extracted away from the plug fitting recess 41 of the socket 4 a . in the process of pulling up the plug 3 a in the plug fitting recess 41 of the socket 4 a , in an initial stage of the extraction in which the tip end portions of the movable contact pieces 21 of the socket contacts 20 are in contact with the outer - side pieces elongating from the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 , the contact pressure functions as a large pulling resistance on the plug 3 a . when the lower end portion of the plug 3 a is lifted up to the vicinity of the tip end portions of the movable contact pieces 21 of the socket contacts 20 , the tip end portions of the movable contact pieces 21 of the socket contacts 20 are contacted with the lower - end bent portions of the one - end sides 11 a of the plug contacts 10 . at this timing , the contact pressure ( the pulling resistance on the plug 3 a ) is reduced . as the contact pressure is further reduced when the lower end portion of the plug 3 a passes beyond the tip end portions of the movable contact pieces 21 of the socket contacts 20 and the one - end sides 11 a of the plug contacts 10 separate from the tip end portions of the movable contact pieces 21 of the socket contacts 20 , the pulling resistance on the plug 3 a is further substantially eliminated . when , as described above , the plug 3 a is pulled up with using the cover member 5 a as a lever in the plug fitting recess 41 of the socket 4 a by the degree at which the lower end portion of the plug 3 a is lifted up to the vicinity of the tip end portions of the movable contact pieces 21 of the socket contacts 20 , the pulling and extraction of the plug 3 a in the plug fitting recess 41 of the socket 4 a can be easily performed with applying a small force . as the number of contacts of the plug contacts 10 and socket contacts 20 is increased as a result of multiplication of the number of pins of the board connector 6 a , the pulling resistance on the plug 3 a is larger in extraction of the plug 3 a fitted to the socket 4 a . since the plug 3 a can be pulled up by a small force with using the cover member 5 a as a lever in the plug fitting recess 41 of the socket 4 a , however , extraction of the plug 3 a can be easily performed even when the number of contacts is increased as a result of multiplication of the number of pins . a plug extraction method in which , in order to separate the plug 3 b and socket 4 b of the other board connector 6 b in the fitting state shown in fig1 to 3 from each other , the plug 3 b is extracted from the plug fitting recess 41 of the socket 4 b is identical with the plug extraction method of the board connector 6 a shown in fig1 . therefore , its detailed description and corresponding drawings are omitted . the socket contacts 20 which are configured by plural thin plate - like conductors are formed in parallel into a state where end portions of the soldering portions 22 are continuous to a carrier ( not shown ) with forming predetermined intervals at predetermined pitches therebetween , by punching and bending a thin conductive metal plate . in this state , the socket contacts 20 are fitted into the contact grooves 42 of the socket body 40 , and fixed to the socket body 40 in parallel in an insulated state with forming predetermined intervals ( regular intervals ) in the right and left or lateral direction , and then the carrier is separated from the socket contacts 20 , thereby configuring the sockets 4 a , 4 b . the plug contacts 10 which are configured by plural thin plate - like conductors , and which are easily bent or bendable are formed in parallel into a state where end portions of the one - end sides 11 a are continuous to a carrier ( not shown ), and end portions of the other - end sides 11 b are continuous to another carrier ( not shown ), by punching and bending a thin conductive metal plate with disposing predetermined intervals at predetermined pitches between the carrier and the other carrier . in this state , the one - end sides 11 a of the plug contacts 10 are fitted into the contact grooves 31 of the plug body 30 , the one - end sides 11 a of the plug contacts 10 are fixed to the plug body 30 in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction , and then the carrier is separated from the one - end sides 11 a of the plug contacts 10 , thereby configuring the plug 3 a . by contrast , the other - end sides 11 b of the plug contacts 10 are fitted into the contact grooves 31 of the plug body 30 , the other - end sides 11 b of the plug contacts 10 are fixed to the plug body 30 in an insulated state in parallel at predetermined intervals ( regular intervals ) in the right and left or lateral direction , and then the carrier is separated from the other - end sides 11 b of the plug contacts 10 , thereby configuring the other plug 3 b . as shown in fig1 to 3 , and 5 , in the plug contacts 10 through which the plug 3 a is linked with the other plug 3 b , intermediate portions 12 , 13 ( between the one - end sides 11 a and the other - end sides 11 b ) between the plug 3 a and the other plug 3 b are formed into a linear shape so as to elongate in parallel to the boards 2 a , 2 b , except their both end portions . the both end portions are formed into an inclined state which is upward inclined toward the respective end portions . the lengths of the linear portions of the intermediate portions 12 , 13 are set on the basis of the distance between the board 2 a and other board 2 b which are placed in parallel to each other , i . e ., the connecting distance . one - end side inclined upper ends of the intermediate portions 12 , 13 , and upper end portions of the inner - side pieces elongating from the lower - end bent portions of the one - end sides 11 a are continuously integrally linked with each other , and other - end side inclined upper ends of the intermediate portions 12 , 13 , and upper end portions of the inner - side pieces elongating from the lower - end bent portions of the other - end sides 11 b are continuously integrally linked with each other . the plug contacts 10 are formed so as to be symmetrical about a point where the length of the linear portion of the intermediate portion 12 or 13 is bisected . as shown in fig2 , and 7 to 10 , the inclined portions of the both end portions of the intermediate portions 12 , 13 of the plug contacts 10 are drawn out obliquely downward from the front side faces of the plugs 3 a , 3 b . as shown in fig1 , therefore , the front portions of the cover members 5 a , 5 b which are lowered by the swing of the cover members 5 a , 5 b in pulling of the plugs 3 a , 3 b in the plug fitting recesses 41 of the sockets 4 a , 4 b with setting the cover members 5 a , 5 b as a fulcrum do not interfere with the plug contacts 10 drawn out from the front side faces of the plugs 3 a , 3 b , and hence it is possible to prevent the plug contacts 10 from being bent and damaged . as shown in fig1 to 5 , the plug contacts 10 are formed into two kinds in which only the level positions of the linear portions are differentiated by changing the lengths of the inclined portions of the both end portions in the intermediate portions 12 , 13 . the plug contacts 10 having the intermediate portion 12 in which the level of the linear portion is high , those having the intermediate portion 13 in which the level of the linear portion is low are alternately arranged . therefore , the linear portions of the intermediate portions 12 , 13 of the plug contacts 10 are positionally shifted from each other in the thickness direction ( the vertical direction ) of the contacts , so that predetermined gaps 14 in a side view are ensured in the linear portions of the intermediate portions 12 , 13 of the plug contacts 10 . the both ends of the gaps 14 are closed by the inclined portions of the both end portions of the intermediate portions 13 in which the level of the linear portion is low . as shown in fig1 to 4 , an insulating member 7 is disposed in the intermediate portions 12 , 13 of the plug contacts 10 between the plug 3 a and the other plug 3 b . a predetermined gap is ensured between the adjacent plug contacts 10 by the insulating member 7 , so that the plug contacts are prevented from contacting with each other . the insulating member 7 is made of an insulating material ( synthetic resin ), and has an approximately rectangular parallelepiped shape that is laterally elongated . plural thin contact grooves 70 through which the intermediate portions 12 , 13 of the plug contacts 10 are to be passed at a predetermined pitch with forming predetermined intervals are alternately distributively disposed in the upper and lower faces of the insulating member 7 . the linear portions of the intermediate portions 12 of the plug contacts 10 having the intermediate portion 12 in which the level of the linear portion is high are fitted from the upper face side into and passed in the anteroposterior direction through the contact grooves 70 disposed in the upper face of the insulating member 7 , and those of the intermediate portions 13 of the plug contacts 10 having the intermediate portion 13 in which the level of the linear portion is low are fitted from the lower face side into and passed in the anteroposterior direction through the contact grooves 70 disposed in the lower face of the insulating member 7 . a plate - like core part 71 that is the insulating member 7 the thickness of which is reduced by the contact grooves 70 is interposed in the thickness direction ( the vertical direction ) of the core part between the linear portions of the intermediate portions 12 of the plug contacts 10 having the intermediate portion 12 in which the level of the linear portion is high , and those of the intermediate portions 13 of the plug contacts 10 having the intermediate portion 13 in which the level of the linear portion is low , and the insulating member 7 is interposed between the intermediate portions 12 , 13 of the plug contacts 10 so as to be movable in the contact length direction , whereby a predetermined gap is ensured between the adjacent plug contacts 10 by partition walls 72 which are the insulating member 7 between the contact grooves 70 , so that the plug contacts are prevented from contacting with each other . the adjacent plug contacts 10 are prevented from contacting with each other by the insulating member 7 which is simply interposed between the intermediate portions 12 , 13 of the plug contacts 10 so as to be movable in the contact length direction , and which is not fixed . therefore , the attachment position and number of the insulating member 7 can be easily changed , and can readily cope with the connecting configuration such as the connecting distance between the boards 2 a , 2 b and the connecting direction thereof . the predetermined gaps 14 in a side view are ensured from the beginning between the linear portions of the intermediate portions 12 of the plug contacts 10 which are passed through the contact grooves 70 disposed in the upper face of the insulating member 7 , and those of the intermediate portions 13 of the plug contacts 10 which are passed through the contact grooves 70 disposed in the lower face of the insulating member 7 . therefore , interposing of the insulating member 7 can be easily performed . when the attachment position or number of the insulating member 7 is changed , furthermore , a deforming force is not applied to the plug contacts 10 , and hence plastic deformation can be prevented from occurring . in the embodiment , the board connector 1 used for electrically connecting the board 2 a and other board 2 b which are placed in parallel has been described . alternatively , the plug contacts 10 may be bent in the linear portions of the intermediate portions 12 , 13 , thereby enabling also stepped or angled boards to be connected to each other . the sockets 4 a , 4 b of the surface - mount type have been described . alternatively , sockets of the pin - mount type may be used . | 7 |
in the following detailed description of the preferred embodiments , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration specific preferred embodiments in which the invention may be practiced . the preferred embodiments are described in sufficient detail to enable these skilled in the art to practice the invention , and it is to be understood that other embodiments may be utilized and that logical changes may be made without departing from the spirit and scope of the present invention . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined only by the appended claims . referring to fig1 , a block diagram of a frequency synthesizer in accordance with one preferred embodiment of the present invention is schematically illustrated . in fig1 , the frequency synthesizer of the present invention comprises a divider 10 , a noise - shaped quantizer 12 and an analog phase locked loop ( pll ) device 14 . a high speed very stable digital clock dclk , normally based on a crystal oscillator reference , is employed as a stable reference baseline period . the reference clock dclk provided with a higher frequency will give the preferable results . for example , in the application of flat panel display controllers , 200 mhz or above can be provided for the reference clock dclk . in order to obtain a desired output clock frequency , the reference clock dclk is received and divided by a time - varying value nd ( t ) in the divider 10 so as to generate an output clock clkq having a time - varying period td ( t ). although the output clock clkq has the time - varying period td ( t ), the time - varying algorithm will be arranged to give the output clock clkq a very precise average period such that precise average output clock frequency can be obtained . as shown in fig1 , the output clock clkq is fed back to the noise - shaped quantizer 12 which receives a period control word . the noise - shaped quantizer 12 is employed to quantize the period control word to the time - varying value nd ( t ) in response to the feedback output clock clkq . according to the present invention , the noise - shaped quantizer 12 can be a delta - sigma quantizer so that the time - varying value nd ( t ) is spectrally shaped by the noise - shaped quantizer 12 using a digital delta - sigma algorithm . preferably , the period control word is configured with a bit resolution greater than that of the time - varying value nd ( t ). in this preferred embodiment , the period control word is a precise word of 24 - bit resolution which is quantized into a low precision value nd ( t ) of 5 - bit resolution . as mentioned above , the noise - shaped quantizer 12 of the present invention converts the high resolution input , that is , the period control word , to the low resolution output nd ( t ) in such a way as to spectrally shape the quantization error , most of which is at very high frequency range . noted that the quantization error is directed to the difference between the period control word and time - varying integer value nd ( t ). with delta - sigma quantization , the spectral density of the quantization error in nd ( t ) or td ( t ) is very low at low frequencies and rises with increasing frequency . in some systems no further processing need be done to the output clock clkq if cycle - cycle jitter is not critical . in other systems , the output clock clkq may not be useful as a low jitter output clock due to the large amount of jitter from the time - varying nature of the period td ( t ). to reduce the jitter , the output clock clkq may be input to the analog pll 14 which can filter the jitter to produce a stable output clock clkp . if the spectral properties of the time - varying period td ( t ) are properly designed , the amount of jitter reduction from the analog pll 14 can be very significant . in other words , the output clock clkq can be filtered by using the analog pll 14 to suppress the high frequency jitter if the cycle - cycle jitter is a design concern . thus , the analog pll 14 serves as a filter means for effectively filtering the jitter from the output clock clkq . moreover , the divider 10 can take any value between minimum and maximum given by the noise - shaped quantizer 12 . thus , using the time - varying divider 10 to divide down the high frequency fixed - period clock reference clock dclk to synthesize a precise long - term average frequency output clock clkq directly in digital domain . therefore , the average period of the output clock clkq or the filtered output clock clkp is kept very precise . referring to fig2 , a detailed block diagram of the noise - shaped quantizer of fig1 is schematically depicted as an example . in fig2 , a delta - sigma quantizer is exemplified in 2 nd - order shaping for reference . however , such a detailed example is not to be taken in a limiting sense , and it is to be understood that other embodiments may be utilized and that logical changes may be made without departing from the spirit and scope of the present invention . fig3 and 4 depict power spectral plot diagrams of clkq and clkp , respectively , where y - axis is dbc and x - axis is frequency . these simulation fig3 and 4 are plotted upon dclk = 214 . 6 mhz , the period control word = 0 × 2864d2 ( fractional divider equivalent = 0 × 05 . 0c9a4 ), m ( feedback divider for the analog pll 14 )= 2 and the required clkp = 85 mhz . by comparing fig3 and 4 , the use of the analog pll 14 as the jitter low pass filter to filter out the high frequency jitter from the output clock clkq . thus , the low - jitter output clock clkp can be produced such that aliasing effect can be suppressed effectively . accordingly , the frequency synthesizer , in accordance with the present invention , uses the time - varying divider 10 to divide down the high frequency fixed - period clock reference clock dclk to synthesize the precise long - term average frequency output clock clkq directly in digital domain . therefore , no look - up table , digital - to - analog converter , phase locked loop or delay locked loop is required for the divider 10 . also , no conventional approach of n , n + 1 divider is required for the frequency synthesizer of the present invention . moreover , the frequency synthesizer of the present invention uses the delta - sigma algorithm to quantize the precise period control word to the low precision time - varying integer value nd ( t ). such a way forces most of the jitter of the reference clock dclk to be at high frequency by making the divider value nd ( t ) be selected from a set of small integer values . in addition , higher frequency jitter decreases the cost of the subsequent jitter low - pass filtering block when required . if the frequency of the reference clock dclk is chosen properly , the required integer values can be less than 60 for the time - varying value nd ( t ). furthermore , the frequency synthesizer of the present invention uses the very precise digital input , that is , the high resolution period control word , to the noise - shaped quantizer 12 to ensure that the average period of the output clocks clkq and , subsequently , clkp are kept very precise . though no further processing need be done to the output clock clkq if cycle - cycle jitter is not critical in some systems , the output clock clkq can be filtered by using the analog pll 14 to suppress the high frequency jitter when the cycle - cycle jitter is a design concern . the frequency synthesizer of the present invention uses the analog pll 14 as the jitter low pass filter to filter out the high frequency jitter from the output clock clkq to produce low - jitter output clock clkp . although the description above contains much specificity , it should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of the present invention . thus , the scope of the present invention should be determined by the appended claims and their equivalents , rather than by the examples given . | 7 |
as used herein , spatial or directional terms , such as “ inner ”, “ outer ”, “ left ”, “ right ”, “ up ”, “ down ”, “ horizontal ”, “ vertical ”, and the like , relate to the invention as it is shown in the drawing figures . however , it is to be understood that the invention can assume various alternative orientations and , accordingly , such terms are not to be considered as limiting . further , all numbers expressing dimensions , physical characteristics , and so forth , used in the specification and claims are to be understood as being modified in all instances by the term “ about ”. accordingly , unless indicated to the contrary , the numerical values set forth in the following specification and claims can vary depending upon the desired properties sought to be obtained by the present invention . at the very least , and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims , each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques . moreover , all ranges disclosed herein are to be understood to encompass any and all subranges subsumed therein . for example , a stated range of “ 1 to 10 ” should be considered to include any and all subranges between ( and inclusive of ) the minimum value of 1 and the maximum value of 10 ; that is , all subranges beginning with a minimum value of 1 or more , e . g . 1 to 6 . 3 , and ending with a maximum value of 10 or less , e . g ., 5 . 5 to 10 . also , as used herein , the terms “ deposited over ”, “ applied over ”, or “ provided over ” mean deposited , applied , or provided on but not necessarily in direct surface contact with . for example , a material “ deposited over ” a substrate does not preclude the presence of one or more other materials of the same or different composition located between the deposited material and the substrate . in the following discussion , the invention will be described for use on vehicular laminated transparencies . as will be appreciated , the invention is not limited thereto , and may be practiced on any laminate that has an internal member responsive to stimuli and an interconnecting activating member , and leads to providing external access to the interconnecting activating member to stimulate the internal member . for example , but not limiting the invention thereto , the invention may be practiced on laminated windows for residential homes , commercial buildings and refrigerator doors having a viewing area . the internal member may be , but not limiting to the invention thereto , an electric conductive member that generates heat as current moves through the member , or a thermally or electrically sensitive coating that changes transmittance upon heating or application of current . the interconnecting activating member may be a pair of spaced bus bars between which current is passed through the internal member . further and not limiting to the invention , the internal member may be an electric circuit to activate the windshield wipers , and the interconnecting activating member may be an electric lead connecting the sensor to a monitoring , circuit . types of conductive members that may be used in the practice of the invention , but not limiting the invention thereto are discussed in u . s . pat . nos . 4 , 401 , 609 ; 5 , 040 , 411 and 5 , 066 , 111 ; pct application u . s . 02 / 06153 filed feb . 28 , 2002 , for “ moisture detection system and method of use thereof ”; u . s . patent application ser . no . 09 / 738 , 306 filed dec . 15 , 2000 , in the names of chia cheng lin et al . for “ electrochromic transparency incorporating security system ”, and u . s . patent application ser . no . 09 / 591 , 572 filed jun . 9 , 2000 , in the name of c . b . greenberg for “ electrochromics ”, which documents are hereby incorporated by reference . the vehicular transparence in the following discussion is an automotive windshield ; however , the invention is not limited thereto and can be any type of a vehicular transparency such as , but not limiting the invention thereto , an automotive sidelight for example of the type disclosed in european patent application no 00936375 . 5 which document is hereby incorporated by reference , a moon roof and a backlite or rear window . further , the transparency can be for any type of vehicle such as but not limiting the invention thereto land vehicles such as but not limiting the invention thereto trucks , cars , motorcycles , and / or trains , to air and / or space vehicles , and to above and / or below water vehicles . with reference to fig1 , there is shown an automotive windshield 10 incorporating features of the invention . the windshield 10 includes a pair of glass sheets or blanks 12 and 14 , and an internal member 16 on inner surface of one of the glass sheets , e . g . outer surface of the inner sheet 14 also referred to as the no . 3 surface of the laminate or windshield assembly . in this discussion the internal member 16 is an electrically conductive member that is heated as current moves through the member to heat both the outer surfaces of the windshield 12 by conduction to remove fog , ice and / or snow , as the case may be . an interlayer composite 20 incorporating features of the invention laminates the glass sheets 12 and 14 together and provides facilities discussed below to move current between the sheets 12 and 14 and through the conductive member 16 . although the invention is not limited thereto , the electrically conductive member 16 is usually on or against the outer surface of the inner sheet as the windshield is mounted in the automobile . as can be appreciated by those skilled in the art , the invention is not limited to the composition of the glass sheets 12 and 14 , for example and not limited to the invention the glass sheets may be clear or tinted glass , for example , of the type disclosed in u . s . pat . nos . 5 , 030 , 592 ; 5 , 240 , 886 , and 5 , 593 , 929 which patents are hereby incorporated by reference . the glass sheets can be annealed , tempered or heat strengthened . the glass sheets can have uniform thickness or can be wedged as viewed in cross section . the glass sheets can be soda - lime - silicate glass or borosilicate glass or any type of refractory glass . further the invention is not limited to the electrically conductive member 16 . the conductive member 16 may be a plurality of spaced conductive elements such as wires , e . g . as discussed in u . s . pat . no . 5 , 182 , 431 ; or strips of conductive material , e . g . a plurality of discreet spaced areas of conductive coating , or a continuous conductive coating . in the practice of the invention and without limiting the invention thereto , the conductive member 16 is a coating having two metal films usually infrared reflecting films , e . g . silver , separated by dielectric layers , e . g . a film of an oxide of a tin zinc alloy and / or a zinc oxide film . the coating is of the typed disclosed in european patent application no . 00939609 . 4 , which application is hereby incorporated by reference . it is the normal practice , but not limiting to the invention , when using a sputtered type coating having multiple films to terminate the coating short of the edges of the glass sheet on which it is applied , e . g . short of the edges of the sheet 14 to provide uncoated marginal edge portions or non - conductive strip 21 between the perimeter of the conductive coating and the peripheral edge of the sheet 14 as shown in fig1 . this can be accomplished by coating the total surface of the sheet and deleting the coating e . g . as disclosed in u . s . pat . no . 4 , 587 , 769 or using a mask during sputtering e . g . as disclosed in u . s . pat . no . 5 , 492 , 750 to provide the non - conductive strip . the disclosures of u . s . pat . nos . 4 , 587 , 769 and 5 , 492 , 750 are hereby incorporated by reference . with reference to fig2 – 4 as needed , the discussion will be directed to the interlayer composite 20 incorporating features of the invention . for ease of discussion , and an appreciation of the elements and the cooperation of the elements of the interlayer composite 20 , the interlayer composite shown in fig2 – 4 is prior to laminating the glass sheets and interlayer composite together as discussed below . the composite 20 includes a sheet of interlayer material 22 , a pair of spaced bus bars 24 , 26 adhered to the sheet 22 in any convenient manner and a lead assembly 28 and 30 associated with each of the bus bars 24 and 26 , respectively . the interlayer sheet 22 is not limiting to the invention and any of the types used in the laminating art to join two substrates , e . g . two transparent sheets such as glass sheets of an automotive transparency may be used in the practice of the invention . in the case of an automotive transparency the material of the interlayer sheet can be polyvinyl butyral (“ pvb ”), polyvinyl chloride (“ pvc ”), or polyurethane . the sheet 22 can have a uniform thickness though out its length and width or it can have varying thickness , e . g . as disclosed in u . s . pat . no . 4 , 998 , 784 , which patent is hereby incorporated by reference , to provide an interlayer in cross section having one or more wedged portions . the thickness , outer dimensions and configuration of the interlayer sheet 22 are not limiting to the invention ; however in the practice of the invention it is preferred that the interlayer sheet 22 have dimensions and a configuration to laminate the glass sheets 12 and 14 together . usually after lamination about 1 / 16 inch ( 0 . 16 centimeters (“ cm ”)) of the interlayer extends beyond the peripheral edges of the glass sheets to insure a complete lamination of the surfaces of the glass sheets . the thickness of the sheet 22 is not limiting to the invention and should be of sufficient thickness to laminate the two sheets 12 and 14 together . the bus bars 24 and 26 are made of metal foil 32 , e . g . gold , silver , aluminum , or copper foil to name a few metal foils that may be used in the practice of the invention . in the practice of the invention , it is preferred to use copper foil because unlike gold and silver foils , it is inexpensive and unlike aluminum foil , it is non - reactive with most other current conducting materials . the width and thickness of the copper foil is not limiting to the invention ; however it should be of sufficient thickness and width to carry the current required to heat the conductive member 16 to heat the outer surfaces of the windshield . the voltage and current usually carried by the bus bars to heat an automotive windshield is 42 volts and 31 amperes . in one nonlimiting embodiment the thickness of the copper foil of the bus bars used was 2 . 8 mils . the width of the copper foil of the bus bar 24 having an electrical power feed located at the center of the bus bar was 7 millimeters , and the width of the copper foil of the bus bar 26 having an electrical power feed located at the side of the bus bar was 14 millimeters . a wider bus bar is preferred when using a side feed instead of a center feed to provide for an even current flow along the extended path of the bus bar . more particularly , the current moving through the right portion of the metal foil 32 of the bus bar 26 as viewed in fig2 has to travel a longer distance and has more surface of the conductive member to pass current than the length of the bus bar 24 on each side of its respective lead . therefore , the bus bar 26 should have a greater cross sectional area than the bus bar 24 . because a metal foil is used and because different thickness bus bars may cause laminating concerns , it is preferred , although not limiting to the invention to have bus bars of uniform thickness and increase the width of the bus bar to increase its cross sectional area . the length of the bus bars is not limiting to the invention and should be sufficient to extend across the surface of the conductive member 16 . a more detailed discussion regarding the length of the bus bars is presented below . with reference to fig2 – 4 , the metal foil 32 of the bus bars is attached to surface 34 of the sheet 22 by a layer 36 of adhesive , e . g . an adhesive layer that has tacky surfaces at room temperature and adheres the sheet and foil together by biasing the sheet 22 and foil 32 together , i . e . a pressure sensitive adhesive . as can be appreciated , in place of a single layer of pressure sensitive adhesive , a double backed tape may be used , i . e . a tape having a layer of pressure sensitive adhesive on each side of a substrate . the material or type of adhesive of the layer 36 is not limiting to the invention and any type of adhesive . in selecting an adhesive material to mount the metal foil of the bus bars on the sheet 22 , the adhesive material selected should be compatible with the material of the interlayer sheet 22 and the laminating process . more particularly , the adhesive should not chemically react with the material of the interlayer sheet , or any other material it comes into contact with , to produce by products such as gas that may result in delamination of the laminate . the adhesive material should also be compatible with the process , e . g . withstand the edge sealing temperature in the range of 200 to 275 ° f . ( 93 . 3 to 135 ° c .) and the autoclave temperature in the range of 275 to 300 ° f . ( 134 to 148 . 8 ° c .). in the practice of the invention , a pressure sensitive adhesive of the types sold by 3m corporation and fralock company of california were used . with continued reference to fig2 – 4 , and in particular to fig3 and 4 , the lead assembly 28 and 30 provides external electrical access to the bus bars . each of the lead assemblies includes an electrically conductive lead 40 connected to one of the bus bars 24 or 26 , and each lead 40 has a protective sleeve 42 adhered thereto by an adhesive layer to prevent air from moving through the sleeve and between the glass sheets after edge sealing and during autoclaving . for ease of discussion and not limiting to the invention , the adhesive layers are shown and discussed as adhesive layers 44 and 46 . the material of the lead , physical thickness and configuration is not limiting to the invention . the lead provides a path to move current from a power supply , e . g . a car battery ( not shown ) to its respective bus bar . for an automotive transparency it is expected that the lead will carry 42 volts and 32 amps . although not limiting to the invention and as shown in fig1 and 2 , the lead 40 is an extension of its respective bus bar , i . e . the lead is contiguous with its respective bus bar . the bus bars and leads may be considered to have a “ t ” shaped configuration with the bus bar or horizontal member or first elongated member of the “ t ” adhered to surface 34 of the interlayer sheet 22 . the lead or vertical member or second elongated member of the “ t ” extends outwardly from its respective bus bar beyond the edges of the laminate . the protective sleeve 42 protects the lead 40 against mechanical damage resulting from bending the lead about the edges of the glass sheets 12 and 14 of the laminate during handling and shipping of the laminates , and electrically insulates a portion of the lead , e . g . exposing only that portion of the lead need to make electrical contact with the connector to connect the lead to the power supply ( not shown ). the protective sleeve has one end portion between the sheets 12 and 14 , and the other end extending beyond the laminate and terminating short of the end of its respective lead as shown in fig2 . the protective sleeve can be made of any material that electrically insulates the lead and prevents damage to the lead , and is compatible with the material of the interlayer sheet 22 , and the edge sealing and autoclaving processes . in one nonlimiting embodiment of the invention , the material of the protective sleeve was a polyamide of the type sold by dupont chemical company under its trademark kapton . the polyamide material selected for its electrically insulating and mechanical properties maintains its structural stability at the edge sealing and autoclave temperatures , but is not viscid those temperatures . in those instances when the material of the protective sleeve is not viscid or does not become viscid at the sealing and autoclaving temperatures , it is necessary to prevent air from moving around the sleeve and between the sheets after edge sealing , and during autoclaving . in accordance to the invention , an air barrier is provided to prevent air from moving between and through the protective sleeve , and an air barrier is provided to prevent air from moving around the protective sleeve and thereafter between the glass sheets , i . e . prevent the ingress of air between the sheets . the layer 46 as viewed in fig3 – 5 and the adjacent inner surface of the protective sleeve blocks the air path to prevent the ingress of air between the bottom surface of the lead 40 and adjacent inner surface of the sleeve . the layer 46 can be provided by extending the adhesive layer 36 along the bottom surface of the lead 40 beyond the end of the protective sleeve as shown in fig3 and 4 . there is no air path between the bottom surface of the bus bar and the interlayer because of the adhesive layer 36 eliminates or blocks the ingress of air . there is no air path or ingress of air between the outer surface of the sleeve 42 and the glass sheet 12 because the interlayer sheet 22 flows around the outer surface portion of the sleeve during edge sealing . the air path between the upper surface of the lead and the adjacent inner surface of the protective sleeve 42 as viewed in fig3 – 5 is between the upper surface of the bus bar and the glass sheet and continues between the bus bars and the conductive coating . the air path or ingress of air between the upper surface of the lead 40 and the adjacent inner surface of the protective sleeve 42 is blocked by providing a layer 44 of adhesive between the upper surface of the lead and adjacent inner surface of the sleeve . the adhesive layer 44 may be similar to the adhesive of the layer 36 or 46 , or may be pieces of pvb , pvc or polyurethane . the air path or ingress of air between the upper outer surface of the protective sleeve 42 and the glass sheet 14 , and between the upper surface of the bus bar and the non - conductive strip 21 of the glass sheet 14 and coating 16 on the glass sheet 14 is blocked by an adhesive layer 48 ( see fig3 – 5 ) between the upper surface of the protective sleeve and adjacent surface of the sheet 14 . it is preferred that the layer 48 be a non - tacky material at the temperatures at which the two glass sheets 12 , 14 and interlayer composite 20 are assembled prior to the edge sealing operation so that the interlayer composite and glass sheets may be easily moved relative to one another to properly position the bus bars on the conductive coating . further , the adhesive should be compatible with the materials of the interlayer and the protective sleeve to prevent the formation of chemical by - products such as gas . any adhesive that does not deteriorate at the edge sealing and autoclaving temperatures to the extent that it does not prevent the ingress of air , and is compatible with the materials of the laminate , may be used in the practice of the invention . types of adhesives that may be used for the layer 48 include but are not limiting to thermo - set adhesives , polyvinyl butyral , rubber cement , acrylic adhesives and pressure sensitive adhesives . in the discussion of the invention , the layers 44 , 46 and 48 were discussed as adhesive layers ; however , the invention is not limited thereto and any material that reduces or prevents ingress of air between the sheets 12 and 14 may be used in the practice of the invention . for example , compressible material held in place by friction may be used . the amount of air prevented from flowing around and through the protective sleeve is not limiting to the invention , and the amount of airflow restricted should be that amount to prevent damage to the laminate , e . g . by delamination . in the case of an automotive laminate of the type discussed above , it is preferred , but not limiting to the invention , to maintain the laminate substantially free of air to prevent subsequent delamination of portions the windshield . the structural strength of the layers 44 , 46 and 48 that make up the air barriers should be sufficient to withstand the pressure forcing air through and around the protective sleeve after edge sealing and autoclaving . in the figs ., especially in fig3 – 5 , the physical dimensions , e . g . thickness of the elements or components are not to scale in order that an appreciation of the relationship of the components to one another can be had . the physical dimensions used to make a windshield incorporating features of the invention have or will be discussed . as can be appreciated , the exit location of the lead assemblies 28 and 30 from the laminate is not limiting to the invention . for example , both lead assemblies 28 and 30 can exit from the same side of the windshield as disclosed in u . s . pat . no . 5 , 213 , 828 , which disclosure is hereby incorporated by reference ; the lead assemblies can exit from opposite sides as shown in fig1 ; the lead assemblies can each exit from the same location on their respective side of the laminate or from different locations on their respective side of the laminate as shown in fig1 . in the practice of the invention , the edge sealing of the windshield subassembly ( the interlayer composite 20 positioned between the glass sheets prior to edge sealing ) is enhanced by the practice of the invention . more particularly , after edge sealing , the ingress of air between the glass sheets is prevented by the adhesive layers 44 and 46 provided between the inner surface of the protective sleeve and the lead 40 , and the adhesive layer 48 on the upper surface of the protective sleeve as shown in fig3 – 5 . in one experiment ( the first experiment ), ten ( 10 ) pieces of copper foil having a pressure sensitive adhesive on one surface were mounted on a pvb sheet having a generally trapezoidal shape . the pieces of copper foil were each 3 . 5 mils ( 0 . 089 millimeters ( mm )) thick , 8 to 10 inches ( 20 . 32 to 25 . 4 cm ,) long ( the length was not actually measured ) and ½ inch ( 13 mm ) wide . two pieces were positioned completely within the perimeter of the pvb sheet , and eight ( 8 ) pieces had a portion positioned on the pvb sheet and had 1 inch ( 2 . 54 cm ) extend beyond the perimeter of the pvb sheet . a piece of kapton polyamide having a layer of pressure sensitive adhesive on one surface was adhered to each side of the portion of the foil extending beyond the perimeter of the pvb sheet . the pieces were 1 inch ( 2 . 54 cm ) in length , 6 mils ( 15 mm ) wide and 3 mils ( 0 . 08 mm ) thick . one - half inch ( 1 . 27 cm ) of each of the eight pieces extended out from the pvb sheet . six ( 6 ) of the pieces ( nos . 1 – 6 ) partially on the pvb sheet were spaced along one short side , e . g . the right side of the pvb sheet as viewed in fig1 , and one piece ( no . 7 ) was placed at the right side completely within the perimeter of the sheet . one piece ( no . 8 ) extended out of the center of one long side , e . g . the bottom side of the pvb sheet ; one piece ( no . 9 ) extended out of the center of the top side of the pvb sheet and one piece ( no . 10 ) was completely within the perimeter of the pvb sheet adjacent the top side of the pvb sheet as shown in fig1 . no . 3 and 4 pieces had rubber cement on the outer surface - of both polyamide pieces within the perimeter of the pvb ; no . 5 and 6 pieces had a layer of acrylic pressure sensitive adhesive one the outer face of both polyamide pieces . nos . 1 , 2 and 7 – 10 did not have . adhesive on the outer surface of the polyamide pieces . the pvb sheet having the pieces of foil was placed between two glass sheets with the sleeve halfway between the glass sheets and the remaining half out of the glass sheets . a vacuum channel was placed around the edges of the subassembly and a vacuum was pulled for 5 minutes at room temperature after which the laminate with the vacuum applied was heated in an oven at a temperature set at 250 ° f . ( 212 ° c .) for 12 minutes ; the subassembly attained a temperature 225 ° f . ( 107 ° c .) . after edge sealing , the laminate was autoclaved . after autoclaving , portions of the pvb sheet that extended out from between the glass sheets around the sleeve were pushed inwardly around the sleeve . the laminate was tested for air bubbles within the laminate by boiling the laminate for 2 hours in water heated to 212 ° f . ( 100 ° c .). the pieces of foil within the laminate were viewed by the unaided eye to observe the presence of bubbles around the pieces of foil . the no . 1 , 2 , 8 and 9 pieces that did not have any sealant between the outer surface of the polyamide pieces and the glass sheets and pvb sheet had air bubbles along the edges of the copper foil . the no . 3 and 4 pieces that had rubber cement , and the no . 5 and 6 pieces that had acrylic adhesive , on the outer surfaces of the polyamide pieces had no air bubbles along the edges of the copper foil . the no . 7 and 10 pieces within the perimeter of the glass sheets had no bubbles around the edges of the copper foil . the first experiment demonstrated that providing an adhesive , e . g . rubber cement or acrylic around the outer surfaces of the polyamide pieces prevented the ingress of air between the glass sheets during the laminating process . a second experiment was conducted to determine if the pvb , a thermo - set adhesive , would adhere to the polyamide to prevent ingress of air between the glass sheets . in the second experiment , 10 pieces of copper foil similar in size to the copper foil pieces of the first experiment were mounted using pressure sensitive adhesive on a pvb sheet in the following arrangement . the no . 11 – 16 pieces were placed in positions similar to the no . 1 – 5 and 7 pieces with the end portions of the no . 11 – 15 pieces extending beyond the perimeter of the sheet , and the no . 16 piece within the perimeter of the sheet . the no . 17 piece was placed at the center portion of the top edge of the sheet with an end potion extending beyond the edge , similar to the no . 9 piece . the no . 18 piece was placed at the center portion of the bottom edge of the sheet as viewed in fig1 with an end portion extending beyond the bottom edge of the sheet , similar to no . 8 piece . the no . 19 piece was placed at the upper left corner of the sheet with an end portion extending beyond the top edge of the sheet , similar to the no . 17 piece . the no . 20 piece was placed at the bottom left corner of the sheet with an end portion extending beyond the bottom edge of the sheet , similar to the no . 18 piece . pieces of polyamide were placed on the portions of the pieces extending beyond the edge of the pvb sheet as discussed in the first experiment . the surface of the polyamide piece facing away from the pvb sheet had either rubber cement or acrylic adhesive applied to the surface . the pvb sheet was placed between two glass sheets and laminated ; thereafter the laminated was boiled tested . the laminating and boil test procedures were similar those practiced in the first experiment . the boiled laminate was viewed with the unaided eye . no bubbles were observed around the copper foil within the glass sheets ; however , air bubbles were observed around the polyamide pieces . it was and is believed that the pvb did not attain the heat softening temperature during the edge sealing operation , i . e . the subassembly needed more soak time . a third experiment was conducted to test three types of adhesives discussed below . in the third experiment , 16 pieces of copper foil similar in size as the pieces of the first experiment were mounted on the pvb sheet with pressure sensitive adhesive in the following arrangement . four ( 4 ) pieces spaced from one another were positioned along each edge of the pvb sheet with a portion of each piece extending beyond the edge of the pvb sheet . each of the pieces had polyamide pieces around portion of the foil pieces at the edge of the pvb sheet as discussed in the first experiment . the surface of the polyamide piece facing away from the pvb sheet was coated with one of three adhesives . one adhesive was liquid paper glue sold by stockwell office products under the mark glue stick ; the other adhesive was contact cement sold by avery dennison , under the mark gluepen , and the third adhesive was contact cement sold by avery dennison under the mark glue stic . the adhesives were applied in a liquid state and were allowed to dry before the pvb sheet was placed between two glass sheets . the subassembly was laminated and boil tested as in the first experiment . the laminate was viewed with the unaided eye , and a few very minor air bubbles were observed around the pieces of copper foil . although the presence of even minor amounts of air bubbles are of concern for automotive windshields and other laminated automotive transparencies , there can be applications where laminates are used and a few minor bubbles can be managed . as can now be appreciated , the above - discussed embodiments of the invention are not limited to the position of the bus bars on the conductive member or the relationship of the ends of the bus bars to the perimeter of the coating . it is however , preferred in the practice of the invention to use the relationship of the ends of the bus bar to the perimeter of the coating to minimize , if not eliminate hot spots at the end potions of the bus bar as disclosed in u . s . patent application ser . no . 07 / 759 , 971filed even date . “ hot spots ” as the term is used herein are areas of the bus bar that are at a temperature higher than the adjacent portions of the bus bar as a result of more current moving through the area than through the adjacent portions of the bus bar . with reference to fig1 , and as disclosed in the u . s . application ser . no . 07 / 607 , 947 filed even date , the top bus bar 24 , the bottom bus bar 26 and the non - conductive strip or uncoated area 21 have a relationship to minimize , if not eliminate hot spots at the end portions of the bus bars . although not limiting to the invention , the parameters of interest in this non - limiting embodiment of the invention include ( 1 ) the position of the ends of the bus bar relative to the perimeter of the conductive member , ( 2 ) the spacing between the bus bars and ( 3 ) the change in the horizontal distance between the sides of the conductive member between the bus bars . regarding the position of the ends of the bus bar relative to the perimeter of the conductive member , as shown in fig1 end portions 60 of the top bus bar 24 and the bottom bus bar 26 extend beyond perimeter 61 of the conductive member 16 into the non - conductive strip 21 , with the ends of the bus bars preferably terminating short of the periphery 62 of the sheet 14 . through observations of ir photographs , it has been concluded that with the ends of the bus bars terminating short of the perimeter of the conductive coating while maintaining the remaining parameters constant , hot spots are observed at the end of the bus bar . as the distance between the end of the bus bar and the perimeter 61 of the coating 16 increases , the hot spots increase in size and temperature and vice versa . extending the ends of the bus bars into the non - conductive strip 21 while keeping the remaining parameters constant reduces the temperature and / or area of the hot spots when compared to ends of the bus bars that terminate short of the perimeter of the coating . it is believed that the hot spots result from more current moving through the end portions of the bus bar to heat the surrounding area of the conductive member between the end portions of the bus bar and the perimeter of the coating . based on the forgoing , it is expected that perfect alignment of the ends of the bus bar with the perimeter of the conductive coating while maintaining the other parameters constant , will reduce the current distribution at the end portions of the bus bars when compared to ends of the bus bar that terminate short of the perimeter of the coating . although it is expected that hot spots are minimized with perfect alignment of the ends of the bus bars with the perimeter of the conductive member , because of the difficulty in a production environment of continuously aligning the ends of the bus bars with the perimeter of the conductive coating , it is preferred in the practice of the invention to have the ends of the bus bars extend into the non - conductive strip 21 . the length of the end portions 60 of the bus bars 24 , 26 extending into the non - conductive strip 21 is not limiting to the invention . as long as the ends of the bus bars extend beyond the perimeter of the coating , the temperature and area of the hot spots decrease as compared to hot spots at the end portions of the bus bars terminating short of the perimeter of the conductive member . in the practice of the invention , it is preferred to have the ends of the bus bars terminate short of the peripheral edge 62 of the laminate 10 to avoid shorting of the bus bar when the windshield is mounted in the opening of the automotive body . consider now the spacing between the bus bars 24 and 26 . with continued reference to fig1 , the upper and lower edges of the glass sheet 14 and of the windshield 10 usually have a radius . the upper edge of the sheets 12 and 14 has a smaller radius and length than the bottom edge of the sheets 12 and 14 , which is the normal configuration of sheets used in the fabrication of windshields . the perimeter configuration of the conductive coating usually has the same or similar peripheral configuration as the sheets to heat the vision area of the windshield . with the bus bar 24 generally following the shape of the top edge of the conductive coating , and the bus bar 26 generally following the shape of the bottom edge of the conductive coating as viewed in fig1 , the length of the bottom bus bar is greater than the length of the upper bus bar . as the difference in length between the bus bars increases , the area of conductive coating to be heated by the bottom bus bar increases . the result of this differential is the end portions of the bottom bus bar on the coating 16 carrying more current to heat more area of the conductive coating 16 , which contributes to temperature increases at the end portions of the bottom bus bar . one solution to the problem is to provide a conductive member with a rectangular shape . however , since the windshield does not have a rectangular shape , a significantly large portion at the bottom of the windshield ( where the snow and ice usually accumulate ) would not be heated . in the practice of the invention , the solution to this problem is to reduce the space between the bus bars . for example and not limiting to the invention , the bus bar 24 is spaced from the top edge of the conductive coating 16 , and the bottom bus bar 24 is spaced from the bottom edge of the conductive member to decrease the area of the conductive member between the bus bars . in other words , the distance between the bus bars is reduced . in this manner the difference in the area to be heated by the top bus bar and the bottom bus bar is reduced . the invention is not limited to the distance between the bus bar and the adjacent side of the conductive coating ; however in the practice of the invention it is preferred to keep the bus bars out of the vision area of the windshield . consider now the change in the distance between the vertical sides or edges of the coating 16 between the bus bars 24 and 26 . in the practice of the invention , it is preferred that no portion of the vertical edges of the conductive member as viewed in fig1 between the bus bars extend beyond one or both ends of the longer bus bar . as viewed in fig1 , no portion of the coating 16 between the bus bars extends beyond the bottom bus bar 26 , the longer of the two bus bars . although not limiting to the invention , the distance between the vertical edges of the conductive member increases as the distance from the bottom bus bar decreases . portions of the conductive member between the bus bars that extend beyond the an end of the longer bus bar will result in the bus bar having to heat more area of the conductive coating . in the practice of the invention , a sputtered infrared reflecting coating was deposited onto the surface of a flat piece of glass . a mask was positioned on the glass piece to provide an uncoated marginal edge portion , the non - conductive strip 21 , after the glass sheet is cut from the glass piece . since the process of sputtering and the sputtered coating is not limiting to the invention and are well known in the art , the sputtering process and coating will not be discussed . the coating 16 terminated 16 millimeters from the peripheral edge of the sheet to provide the uncoated area 21 shown in fig1 . the coating had a generally trapezoidal shape with the width of the coating generally increasing moving from the top edge to the bottom edge of the coating as shown in fig1 . a black band of ceramic paste was silk screened on the marginal edges ( not shown ) of the sheet 12 to provide uv protection for the underlying adhesive securing the windshield in position in the automotive body . the sheet 14 having the conductive coating 16 and the sheet 12 having the black band on the marginal edge were shaped and annealed . since the process of shaping and annealing of sheets for automotive windshields is well known in the art and is not limiting to the invention , the procedures will not be discussed . with reference to fig3 and 4 , an interlayer composite 20 incorporating features of the invention had a pvb sheet 30 mils ( 0 . 76 mm ) thick and a surface area and configuration to overlay and cover the surface of the sheet 12 . the bus bars had a length sufficient to extend across the conductive coating and 0 . 25 inch ( 6 mm ) into the non - conductive strip 21 of the sheet 14 . the top bus bar , i . e . bus bar 24 , and its respective lead 40 were contiguous with another and were made of a copper foil having a thickness of 2 . 8 mils ( 0 . 07 mm ). the top bus bar was 27 mils ( 7 mm ) wide and its associated lead was 54 mils ( 14 mm ) wide with the lead exiting the center portion of the sheet 22 as shown in fig1 and 2 . the bottom bus bar 26 and its respective lead 40 were contiguous with one another and were made of a copper foil having a thickness of 2 . 8 mils ( 0 . 07 mm ). the bottom bus bar and it associated lead were 54 mils ( 14 mm ) wide with the lead exiting the left side portion of the sheet 22 as shown in fig1 and 2 . each of the leads had sufficient length to extend 1 to 1½ inches ( 2 . 54 to 3 . 81 centimeters ) from the edge of the windshield . the copper foil was secured on the sheet 22 by a pressure sensitive adhesive having a thickness of 1 mil ( 0 . 0254 mm ) and a width similar to the width of its associated metal foil . the pressure sensitive adhesive was of the type sold 3m . the pressure sensitive adhesive extended along the surface portion of the lead 40 extending beyond the sheet and is designated by the numeral 46 in fig3 – 5 . the bus bars were generally parallel to one another and spaced 36 . 5 inches ( 92 . 7 cm ). two pieces of kapton polyamide each having a thickness of 0 . 5 mils ( 0 . 013 mm ) and a width and length of 0 . 79 inch ( 20 mm ) provided the protective sleeve 42 . one piece of the polyamide was place around the bottom of each lead 40 and held in position by the adhesive layer 46 . a polyamide piece was secured on the top of each lead by providing a layer 44 of a pressure sensitive adhesive similar to the adhesive of the layer 46 . one - half ( ½ ) inch ( 1 . 27 cm ) of the polyamide was within the edge of the sheet 22 . a layer 48 of a thermo - set - adhesive no . 1500b100 ( r / flex ) supplied by roger corporation of connecticut was purchased from fralock company of california was applied to the outer surface of the protective sleeves 28 and 30 as shown in fig3 and 4 . the thermo - set adhesive had a thickness of 1 mil ( 0 . 25 mm ) and a width and length to cover the portion of the sleeve to be positioned between the glass sheets . the interlayer composite was positioned on the shaped sheet 14 with the bus bars in electrical contact with the coating 16 . the shaped sheet 12 was placed over the composite 20 . a vacuum ring of the type used in the manufacture of laminated windshields was positioned over the periphery of the assembly ( the interlayer composite 20 positioned between the sheets 12 and 14 as discussed above ) and vacuum of 20 – 28 inches of mercury was pulled . the windshield subassembly having the vacuum applied was place in an oven set at 260 ° f . ( 126 . 7 ° c .) for 15 minutes to heat the subassembly to a temperature of about 225 ° f . ( 127 . 2 ° c .). while the windshield subassembly was in the oven , the vacuum was continuously pulled through the channel to pull air from between the blanks . the heat and vacuum sealed the marginal edges of the windshield subassembly . thereafter the edge sealed windshield subassembly was placed in an air autoclave and laminated . as can be appreciated by those skilled in the art of laminating , the edge sealing of the subassembly and laminating of the edge sealed subassembly is not limiting to the invention . for example , the subassembly may be sealed using nipper rollers or bagging the subassembly , and the edge sealed subassembly may be laminated by oil autoclaving . providing the air barriers of the invention between the inner surface of the protective sleeve and the surfaces of the lead , and between the outer surface of the protective sleeve , e . g . the upper outer surface of the protective sleeve and the surface of the sheet 14 , prevents the ingress of air between the sheets 12 and 14 and between the surfaces of the conductive coating and the adjacent surfaces of the bus bars after edge sealing and during autoclaving . as can be appreciated , the outer surface of the windshield may be provided with a coating to keep the surface clean such as the type disclosed in u . s . pat . no . 6 , 027 , 766 , or a hydrophobic coating of the type sold by ppg industries , inc . under the trademark aquapel and disclosed in u . s . pat . no . 5 , 523 , 162 , which patents are hereby incorporated by reference . the particular embodiments described in detail herein are illustrative only and are not limiting to the scope of the invention , which is to be given the full breadth of the appended claims and any and all equivalents thereof . | 1 |
fig1 is a perspective view of the chassis of a fork lift truck incorporating features of the invention . fig1 shows the battery compartment 1 , which is open on the bottom and on a side , e . g ., the right side of the fork lift truck in the figure . on the left side of the fork lift truck , the battery compartment 1 is delimited by one side wall 2 of the chassis . toward the top , the battery compartment 1 is delimited by a plate 3 , and toward the front by an additional plate 4 . as will be appreciated , directional terms , such as “ left ”, “ right ”, “ vertical ”, “ horizontal ”, “ top ”, “ bottom ”, “ front ”, “ rear ”, and the like , used in the specification and claims refer to the invention as it is shown in the drawing figures . however , it is to be understood that the invention can assume various other orientations and , thus , such terms are not to be considered as limiting . to give the chassis a desired rigidity , e . g ., sufficient rigidity for typical industrial uses , the invention teaches that a beam 5 that extends in the longitudinal direction of the fork lift truck is located directly above the battery compartment 1 on its open side ( i . e ., the right side in the illustrated embodiment ). the beam 5 can be the primary load - bearing chassis component on the open side ( right side ) of the fork lift truck and can be used to transmit forces and moments between the front and the rear sections of the fork lift truck . in its forward area , the beam 5 can be curved downwardly and can run along ( e . g ., can contact ) the front plate 4 of the battery compartment 1 . the beam 5 can be rigidly connected in the forward area with a receptacle 6 for the front axle of the fork lift truck . in the rear area , the frame , and thus also the beam 5 , directly or indirectly can be rigidly connected with the rear counterweight r of the fork lift truck , for which purpose , in the illustrated exemplary embodiment , threaded holes 7 are provided . the battery compartment 1 , which is open on the bottom , makes it possible to change a battery block b by running a pallet truck underneath the battery compartment 1 , lifting the battery block , and moving it out of the battery compartment 1 . the procedure for inserting a new battery block is in the reverse order . as the battery block is being removed or inserted , the forks of the pallet truck are located between the contact points 8 that are located on the chassis . the battery block can sit on these contact points during the operation of the fork lift truck . fig2 – 4 show a number of exemplary configurations of the cross section of the beam 5 . the cross section shapes are thereby selected so that the beam 5 has a high section modulus in torque around a horizontal or vertical axis . at the same time , it is advantageous to manufacture the beam 5 using the smallest possible amount of material which , in turn , makes it more economical . in the application in the form of a beam , the cross sections described below can be used in the illustrated orientation or they can also be rotated , e . g ., by 180 degrees . in the variant illustrated in fig2 , the beam has a t - shaped profile and includes a first ( horizontal ) metal plate 10 and a second ( vertical ) metal plate 11 that is attached perpendicular to it . the two metal plates 10 , 11 can be welded to each other , for example . the variant illustrated in fig3 also includes a first ( horizontal ) metal plate 10 and a second metal plate 12 that is attached perpendicular to it . although , on the end farther from the metal plate 10 , the metal plate 12 makes a transition to the horizontal ( e . g ., an end portion extends substantially perpendicular to the rest of the metal plate 12 ). in the variant illustrated in fig4 , instead of a vertical metal plate , there is a hollow section 13 which is placed on a horizontal ( e . g ., flat ) metal plate 10 . it will be readily appreciated by those skilled in the art that modifications may be made to the invention without departing from the concepts disclosed in the foregoing description . accordingly , the particular embodiments described in detail herein are illustrative only and are not limiting to the scope of the invention , which is to be given the full breadth of the appended claims and any and all equivalents thereof . | 1 |
the following description and the drawings sufficiently illustrate specific embodiments to enable those skilled in the art to practice them . other embodiments may incorporate structural , logical , electrical , process , and other changes . portions and features of some embodiments may be included in , or substituted for , those of other embodiments . embodiments set forth in the claims encompass all available equivalents of those claims . fig1 illustrates a mmw bss , in accordance with some embodiments . the mmw bss 100 includes a plurality of mmw stations 104 that may communicate using millimeter waves . one of the mmw stations 104 , the central coordinator 102 , may operate as central coordinator for the mmw bss 100 to coordinate communications among the mmw stations 104 and control access to the wireless medium . in some embodiments , the central coordinator 102 may broadcast a beacon frame that indicates the length of a beacon interval during which communications are to take place . the beacon frame may be received by the other mmw stations 104 , thereby allowing the other mmw stations 104 to know when the next beacon interval will occur . the central coordinator 102 and the mmw stations 104 may utilize directional antennas and may employ beamforming , beam steering or beam directing techniques to communicate therebetween . these embodiments are described in more detail below . in accordance with some embodiments , a simplified and unified frame - format scheme for both station and information discovery is provided . the frame - format scheme may be suitable for use in both a mmw wpan and a mmw wlan . as described in more detail below , through the use of a station - capability information element , an information - request action frame , and an information - response action frame , the mmw stations 104 of the mmw bss 100 may be able to discover each other and exchange station - capability information so that non - central coordinator devices , such as mmw station 104 a and mmw station 104 b , can communicate directly in a peer - to - peer ( p2p ) manner . in some embodiments , the central coordinator 102 and the mmw stations 104 are configured to operate as part of a personal bss ( pbss ). the central coordinator 102 may be a pbss control point ( pcp ) operating as a central coordinator for the pbss , and the pbss may be configured to operate in accordance with a wireless gigabit alliance ( wigig or wga ) specification or an ieee 802 . 11 specification such as the task group ad ( ieee 802 . 11ad ) draft specification for multi - gigabit speed wireless communications technology operating over an unlicensed 60 ghz frequency band . the pbss may be configured to operate in accordance with the wigig media - access control ( mac ) or physical layer ( phy ) specifications , version 1 . 0 or later , although this is not a requirement . in some other embodiments , the pbss may be configured to operate in accordance with an ieee 802 . 15 . 3 specification for high - rate wpans , including the ieee 802 . 15 . 3 task group 3c ( tg3c ). in some embodiments , the central coordinator 102 and the mmw stations 104 comprise an infrastructure bss ( ibss ). the central coordinator 102 may be an access point ( ap ) operating as a central coordinator for the ibss . the ibss may be configured to operate in accordance with the wigig specification or the ieee 802 . 11ad specification referenced above . the mmw stations 104 may include wireless display devices , laptop and portable computers , mobile communication devices ( e . g ., cell phones , smart phones or personal digital assistant ( pdas )), hard drives and other storage devices , digital audio players ( e . g ., mp3 players ), web tablets , wireless headsets , pagers and instant messaging devices , digital cameras , televisions , medical devices ( e . g ., a heart rate monitor , a blood pressure monitor , etc . ), or other device that may receive and / or transmit information using millimeter waves . through the use of the frame - format scheme described herein , the mmw stations 104 may discover each other and exchange station - capability information , which may allow for p2p communications therebetween . for example , wireless docking and sync & amp ; go techniques for a laptop computer may be achieved . furthermore , a laptop computer will be able to determine that a wireless display device is indeed a display and not a wireless hard drive , for example , which will allow for wireless use of the display by the laptop computer . a cell phone may be able to discover and determine the capabilities of an mp3 player so that it can synchronize music files with the mp3 player . the mmw stations 104 associated with a laptop ( which may be operating as the central coordinator 102 ) may be able to discover , each other , learn each other &# 39 ; s capabilities , and subsequently establish wireless connections therebetween . in a conventional wlan or wifi network configured in accordance with conventional ieee 802 . 11 specifications , station and service discovery are less important since wean devices use microwave frequencies ( which are less directional the mmw frequencies ) and because wlan devices are generally configured to communicate directly with an access point . fig2 illustrates communications between a central coordinator 102 and anon - central coordinator station 104 a , in accordance with some embodiments . a non - central coordinator station , such as mmw station 104 a ( fig1 a ), may be configured to transmit a station - capability ie 204 to the central coordinator 102 during association 202 with the bss 100 ( fig1 ). the station - capability ie 204 may be configured to provide station - capability information to the central coordinator 102 . the non - central coordinator station 104 a may also be configured to transmit an information - request action frame 206 to a target station to either discover or request information about the one or more other mmw stations 104 ( fig1 ) of the bss 100 . the target station may be either the central coordinator 102 ( as illustrated in fig2 ) or one of the other mmw stations ( e . g ., non - central coordinator station 104 b ( fig1 )). the non - central coordinator station 104 a may receive an information - response action frame 208 from the target station ( e . g ., the central coordinator 102 ) that includes the requested information . in some embodiments , an unsolicited information - response action frame 210 may be sent unsolicited ( i . e ., not in response to an information - request action frame 206 ) by one of the mmw stations 104 , such as by the central coordinator 102 , to provide updated information to the mmw stations 104 of the bss 100 . in some of these embodiments , the unsolicited information - response action frame 210 may be transmitted by the central coordinator 102 to the associated mmw stations 104 upon association of a new mmw station 104 with the bss 100 or upon disassociation of a mmw station 104 with the bss 100 . the unsolicited information - response action frame 210 may include station - capability information of all currently associated mmw stations 104 and may include the station - capability information of the central coordinator 102 . an unsolicited information - response action frame 210 may also be sent at any time by the central coordinator 102 . in these embodiments , the transmission of the unsolicited information - response action frame 210 by the central coordinator 102 to all mmw stations 104 associated with bss 100 allows currently associated mmw stations 104 to maintain up - to - date information about the other currently associated mmw stations 104 . an unsolicited information - response action frame 210 may also be sent by a non - central coordinator station 104 to provide an information update directly to one or more other non - central coordinator stations 104 in the bss 100 . as described in more detail below , the station - capability information provided in the station - capability ie 204 , requested and / or provided in the information - request action frame 206 , or provided in the information - response action frame 208 allows a mmw station 104 to know the capabilities of other mmw stations 104 . the station - capability information may include one or more of beamforming capabilities , the number of antennas and antenna capabilities , the number of elements per antenna , supported modulations and modulation capabilities , supported channels , and multi - user ( mu ) multiple - input output ( mimo ) capabilities , among other things . this exchange of information may allow any non - central coordinator station 104 to subsequently perform beamforming training for subsequent communication therebetween . fig3 illustrates communications between two non - central coordinator stations , in accordance with some embodiments . an initiating non - central coordinator station 304 a may transmit an information - request action frame 306 to another non - central coordinator station 304 b to either discover or request information about the other the other non - central coordinator station 304 b . the other non - central coordinator station 304 b may be configured to respond by transmitting an information - response action frame 308 that includes the requested information . in some embodiments , the initiating non - central coordinator station 304 a may transmit the information - request action frame 306 to the other non - central coordinator station 304 b after the initiating non - central coordinator station 304 a has received station - capability information about the other non - central coordinator station 304 b from the central coordinator 102 ( fig1 ), although this is not a requirement . the initiating non - central coordinator station 304 a may correspond to non - central coordinator station 104 a ( fig1 ) and the other non - central coordinator station 304 b may correspond to non - central coordinator station 1049 ( fig1 ). fig4 illustrates a station - capability ie , in accordance with some embodiments . station - capability ie 400 may be suitable for use as station - capability ie 204 ( fig2 ) and may be transmitted from one mmw station 104 ( fig1 ) to another mmw station 104 to provide station - capability information to the other mmw station 104 . in some embodiments , the station - capability ie 400 may be transmitted by a mmw station 104 to the central coordinator 102 ( fig1 ) during association 202 ( fig2 ) with the bss 100 ( fig1 ) to provide station - capability information to the central coordinator 102 . in some embodiments , one or more station - capability fe 400 may be included as part of the information - request action frame 206 ( fig2 ) or the information - request action frame 306 ( fig3 ) to provide station - capability information within the frame . one or more station - capability ie 400 may also be included as part of the information - response action frame 208 ( fig2 ) or the information - response action frame 308 ( fig3 ) to provide station - capability information within the frame . in accordance with some embodiments , the station - capability if 400 may include a station ( sta ) address 402 of the sending mmw station ( e . g ., mmw station 104 a ( fig1 )), an association identifier ( aid ) 404 of the sending mmw station , and station - capability information 406 of the sending mmw station . the station address 402 may be a mac address of the sending mmw station , and the association id 404 may have been assigned by the central coordinator 102 during association 202 . the station - capability information 406 may include station - capability information of the sending mmw station and may include at least some basic capabilities of the sending mmw station . as discussed in more detail below , the information included in the station - capability ie 400 may be distributed by the central coordinator 102 in an information - response action frame 208 ( fig2 ) when requested or in an unsolicited information - response action frame 210 ( fig2 ). fig5 illustrates an information - request action frame 500 , in accordance with some embodiments . information - request action frame 500 may be suitable for use as information - request action frame 206 ( fig2 ) and information - request action frame 306 ( fig3 ). in some embodiments , a sending mmw station , such as non - central coordinator station 104 a ( fig1 ), may transmit the information - request action frame 500 to a target station to either discover or request information about the one or more other mmw stations 104 ( fig1 ) in the bss 100 ( fig1 ). the target station may be either the central coordinator 102 ( fig1 ) or one of the other mmw stations ( e . g ., non - central coordinator station 104 b ). in some embodiments , the information - request action frame 500 may also include station - capability information of the sending mmw station . the sending mmw station may also configure the information - request action frame 500 to include station - capability information of other mmw stations 104 that are known to the sending mmw station , in addition to the station - capability information of the sending mmw station . the information - request action frame 500 may allow the sending mmw station to either discover other mmw stations 104 or request information about the one or more other mmw stations 104 of the bss 100 . in some embodiments , the information - request action frame 500 includes at least a target address field 503 and a request ie field 504 . the target address field 503 may include an address of the target station , and the request ie field 504 may be configured to indicate the types of information elements that the sending mmw station is requesting from the target station ( e . g ., either the central coordinator 102 or anon - central coordinator station such as mmw station 104 b ). when the information - request action frame 500 is transmitted to the central coordinator 102 ( as illustrated in fig2 ) and when the target address field 503 includes a broadcast address , the sending mmw station may be requesting information about all the other mmw stations 104 that are associated with the central coordinator 102 . the request ie field 504 may allow the sending mmw station to specify which types of ies are being requested from the target station . in some embodiments , almost any type of ie may be requested in the request ie field 504 . as further illustrated in fig5 , the information - request action frame 500 may also include a category field 501 to indicate that the information - request action frame 500 is a frame applicable to a mmw bss , and an action field 502 to indicate that information - request action frame 500 is requesting information . in some embodiments , category field 501 , action field 502 , and request ie field 504 may be configured in accordance with section 7 . 3 . 2 . 12 of the ieee 802 . 11ad specification , although this is not a requirement . when the information - request action frame 500 is transmitted to another non - central coordinator station , such as non - central coordinator station 304 b ( as illustrated in fig3 ), the target address field 503 may include a mac address of the other non - central coordinator station 104 b indicating that the sending mmw station is requesting information about the other non - central coordinator station 104 b directly from the other non - central coordinator station 104 b . accordingly , peer non - central coordinator stations may discover each other and request information about each other . furthermore , this exchange of information may allow direct - link setup ( dls ) performed between peer non - central coordinator stations . accordingly , an information - request action frame 500 may be used by a mmw station 104 to request information about either a single station in the bss 100 or about all of the associated mmw stations 104 in the bss 100 . if a mmw station 104 is requesting information about only a single mmw station 104 in the bss 100 ( fig1 ), the requesting station may set the target address field 503 in the frame to the mac address of that single mmw station 104 . if a mmw station 104 is requesting information about all of the mmw stations 104 in the bss 100 , it may set the target address field 503 in the frame to the broadcast address and may transmit the information - request action frame 500 to the central coordinator 102 . in some embodiments , the information - request action frame 500 may also include a station - capability field 505 that includes station - capability information about the sending mmw station ( i . e ., the source station ) and station - capability information about other mmw stations 104 that are known to the sending mmw station . the information - request action frame 500 may also include an optional ie - provided field 506 that includes an actual ie that the sending mmw station is providing to the target station . in these embodiments , an information - request action frame 500 may provide the capabilities and any other ies of the sending mmw station ( i . e ., the source station ). this reduces the number of handshakes between the two mmw stations 104 . as illustrated in fig5 , a station - capability field 505 may be included in the information - request action frame 500 for each mmw station for which station - capability information is being provided . as also illustrated in fig5 , an ie - provided field 506 may also be provided for each ie that is provided . as also illustrated in fig5 , one or more vendor - specific ie 507 may also be included in the information - request action frame 500 . accordingly , a simplified and unified frame - format scheme for both station and information discovery suitable for use in a mmw wpan or a mmw wlan is provided . fig6 illustrates an information - response action frame 600 , in accordance with some embodiments . the information - response action frame 600 may be suitable for use as information - response action frame 208 ( fig2 ) or information - response action frame 308 ( fig3 ). the information - response action frame 600 may transmitted by a mmw station either unsolicited or in response to receipt of the information - request action frame 500 ( fig5 ). when the information - response action frame 600 is sent in response to an information - request action frame 500 , it may be referred to as a solicited information - response action frame because it was requested by another mmw station . when the information - response action frame 600 is not sent in response to an information - request action frame 500 , it may be referred to as an unsolicited information - response action frame 210 ( fig2 ). in accordance with the embodiments illustrated in fig6 , the information - response action frame 600 may include a target address field 603 and a request ie field 604 . the target address field 603 may include an address of a target station ( i . e ., that station that is to receive the information - response action frame 600 ) when the information - response action frame 600 is solicited . the target address field 603 may include a broadcast address when the information - response action frame 600 is unsolicited . the request ie field 60 . 4 may be configured to indicate the types of information elements that are being provided in the information - response action frame 600 . the information - response action frame 600 may also include one or more optional station capability fields 605 to indicate station capability of one or more mmw stations 104 . the information - response action frame 600 may also include one or more optional ie - provided fields 606 to include the actual information elements that the mmw station 104 transmitting the information - response action frame 600 is providing to the mmw station 104 receiving the information - response action frame 600 . as also illustrated in fig6 , the information - response action frame 600 may also include a category field 601 , an action field 602 , and one or more vendor - specific fields 607 , similar to fields 501 , 502 and 507 , respectively , as discussed above . fig7 illustrates a functional block diagram of a mmw station 700 , in accordance with some embodiments . the mmw station 700 may be suitable for use as any one of mmw stations 104 ( fig1 ), including the central coordinator 102 ( fig1 ). the mmw station 700 may include one or more antennas 701 that may be configured for communicating millimeter wave signals either in a directional manner or in a non - directional manner . in accordance with embodiments , the mmw station 700 may configure the antennas 701 for non - directional communications for establishing an initial contact with another mmw station , and may configure the antennas 701 for directional communications after establishing an initial contact with the other mmw station . in these embodiments , station - capability information received from the other station or received from the central coordinator 102 may be used for the directional communications . in some embodiments , beam - forming training may be performed and beamforming coefficients may be employed for the directional communications . the mmw station 700 may include mmw phy layer 702 , mac layer 704 , and memory 706 . in some embodiments , the mmw station 700 may implement the mmw phy layer 702 and the mac layer 704 in accordance with a wigig pew and mac specifications ( or the ieee 802 . 11ad specification ) for multi - gigabit speed wireless communications technology operating over the unlicensed 60 ghz frequency band . memory 706 may be configured to store , among other things , the station - capability information received from other mmw stations for use in communicating with the other mmw stations . although mmw station 700 is illustrated as having several separate functional elements , one or more of the functional elements may be combined and may be implemented by combinations of software - configured elements , such as processing elements including digital signal processors ( dsps ) and / or other hardware elements . for example , some elements may comprise one or more microprocessors , dsps , application specific integrated circuits ( asics ), radio - frequency integrated circuits ( rfics ) and combinations of various hardware and logic circuitry for performing at least the functions described herein . in some embodiments , the functional elements of mmw station 700 may refer to one or more processes operating on one or more processing elements . antennas 701 may comprise one or more directional or omnidirectional antennas , including , for example , dipole antennas , monopole antennas , patch antennas , loop antennas , microstrip antennas or other types of antennas suitable for transmission of rf signals . in some embodiments , instead of two or more antennas , a single antenna with multiple apertures may be used . in these embodiments , each aperture may be considered a separate antenna . in some mimo embodiments , antennas 701 may be effectively separated to take advantage of spatial diversity and the different channel characteristics that may result between each of antennas 701 and the antennas of a sending mmw station . in some mimo embodiments , antennas 701 may be separated by up to 1 / 10 of a wavelength or more . in some embodiments , the mmw station 700 may be configured to perform association beam - forming training ( a - bft ) with collision avoidance , in accordance with u . s . patent application ser . no . 12 / 559 , 770 , filed sep . 15 , 2009 , entitled “ millimeter - wave communication station and method for scheduling association beamforming training with collision avoidance ,” in some embodiments , the mmw station 700 may be configured to perform multiple - access beamforming and beamforming training in accordance with u . s . patent application ser . no . 12 / 574 , 140 , filed oct . 6 , 2009 entitled “ millimeter - wave communication station and method for multiple - access beamforming in a millimeter - wave communication network .” referring to fig1 - 6 , in accordance with some embodiments , the mmw stations 104 and the central coordinator 102 may implement a set of protocol procedures . for example , a sending mmw station 104 may transmit an information - request action frame 500 to a destination station 104 in the bss 100 with a length field of the request ie 504 set to zero to determine if the destination mmw station is still present in the bss 100 and is within range of the sending mmw station 104 . a sending mmw station 104 , such as non - central coordinator station 104 a , may transmit an information - request action frame 500 that includes its station - capability information element 400 and other information elements . however , a sending mmw station 104 , such as non - central coordinator station 104 a , may be prohibited from including the station - capability information of another station within an information - request action frame 500 . as discussed above , a sending mmw station 104 may transmit an information - response action frame 600 either as a response to an information - request action frame 500 , or it may be sent unsolicited . if the sending mmw station 104 is providing information about a single other mmw station of the bss 100 , the sending mmw station 104 may set the target address field 603 in information - response action frame 600 to a mac address of that single other mmw station . if a sending mmw station 104 is providing information about all of the stations in the bss 100 in the information - response action frame 600 , it may set the target address field 603 in information - response action frame 600 to the broadcast address . in accordance with some embodiments , a responding station 104 ( either a station 104 or the central coordinator 102 ) may be configured to include , an information - response action frame 600 , the information elements that were requested by the station requesting the information . a responding station ( either a station 104 or the central coordinator 102 ) may also be configured to send an information - response action frame 600 with an empty payload in response to a received information - request action frame 500 for which the requesting mmw station solicits information about a single station that is not a member of the bss 100 and the responding station is the central coordinator 102 ( or that is not the responding station itself ). otherwise , the responding station may send an information - response action frame 600 with the information requested by the requesting station . embodiments may be implemented in one or a combination of hardware , firmware and software . embodiments may also be implemented as instructions stored on a computer - readable storage device , which may be read and executed by at least one processor to perform the operations described herein . a computer - readable storage device may include any non - transistor mechanism for storing information in a form readable by a machine ( e . g ., a computer ). for example , a computer - readable storage device may include read - only memory ( rom ), random - access memory ( ram ), magnetic disk storage media , optical storage media , flash - memory devices , and other storage devices and media . in some embodiments , system 100 may include one or more processors and may be configured with instructions stored on a computer - readable storage device . the abstract is provided to comply with 37 c . f . r . section 1 . 72 ( b ) requiring an abstract that will allow the reader to ascertain the nature and gist of the technical disclosure . it is submitted with the understanding that it will not be used to limit or interpret the scope or meaning of the claims . the following claims are hereby incorporated into the detailed description , with each claim standing on its own as a separate embodiment . | 7 |
synthetic peptides were prepared by normal fmoc - chemistry using preloaded tentagel resins , pybop / nmm for in situ activation and 20 % piperidine in nmp for fmoc removal [ h . s . hiemstra et al ., proc . natl . acad . sci . u . s . a . 94 : 10313 - 10318 ( 1997 )]. couplings were performed for 60 minutes with six - fold acylating species . after final fmoc removal , peptides were cleaved with tfa / h 2 o 19 / 1 ( v / v ) containing additional scavengers when c ( triethylsilane ) or w ( ethanethiol ) were present in the peptide sequence . peptides were isolated by ether / pentane 1 / 1 ( v / v ) precipitation and isolation of the product by centrifugation . after air - drying at about 40 ° c ., peptides were dissolved in acetic acid / water 1 / 10 ( v / v ) and lyophilized . peptides were checked on purity using uplc - ms ( acquity , waters ) and on integrity using maldi - tof mass spectrometry ( microflex , bruker ), showing the expected molecular masses . the clinical isolate of methicillin - resistant staphylococcus aureus ( mrsa ), luh14616 was kindly provided by dr . s . croes , maastricht university medical center , maastricht , netherlands ( see s . b . m . c . croes , microbiol . 2009 ; 9 : 229 . doi : 10 . 1186 / 1471 - 2180 - 9 - 229 ) and that of mupirocine - resistant mrsa luh15051 was a gift from dr . m . e . o . c . heck ( laboratory for infectious diseases and screening , national institute for public health and environment , rivm , bilthoven , netherlands ). s . aureus jar is described in campoccia et al . ( int . j . artif . organs , 2008 september ; 31 ( 9 ): 841 - 7 ). bacteria were stored at - 80 ° c . until use . inoculi of mid - log phase bacteria were prepared by incubating isolated mrsa colonies from blood agar plates in tryptic soy broth ( tsb ) medium ( becton dickinson , le pont de clax , france ) for 2 . 5 hours and then diluted to the concentration needed . for the in vitro killing assay on mid - log phase bacteria , mrsa luh14616 and mrsa luh15051 were resuspended to a concentration of 1 × 10 6 bacteria / ml in pbs . subsequently , 200 μl was added to a concentration range of peptides ll - 37 , p60 . 4ac ( op - 145 ) and p10 that were lyophilized in advance . subsequently , the bacteria - peptide mixture was incubated for 1 hour at 37 ° c . to establish the killing capacity of these peptides , the suspensions were serially diluted and plated onto dst agar plates to measure viable cfu counts . ic90 , ic99 and ic99 . 9 values are calculated by linear regression analysis . for the in vitro killing assay with p10 variants , s . aureus jar ( 1 min cfu / ml ) were incubated for 2 hours at 37 ° c . with various concentrations of the peptides in pbs or in pbs / human plasma ( 1 / 1 , v / v ). depicted in tables 2 - 6 is the concentration of the peptide that resulted in killing of 99 . 9 % of the bacteria ( 1000 cfu / ml remaining ). the lc99 . 9 is the average value of two independent experiments . human skin equivalents were prepared as described in el ghalbzouri et al . ( lab . invest . 2004 january ; 84 ( 1 ): 102 - 12 ). in brief , 5 × 10 5 normal human keratinocytes were seeded onto fibroblast - populated rat - tail collagen matrices . the collagen matrices were prepared in advance by making a basal ( 0 . 1 % acetic acid , 4 mg / ml collagen , hank &# 39 ; s balanced salt solution ( hbss , 10 ×), 1 m naoh and fcs ) and a top collagen layer in which normal human fibroblasts were seeded ( 4 mg / ml collagen , 10 × hbss , 1 m naoh , fcs and fibroblasts ). transwell filters with 3 μm pore size ( corning 3414 , costar ) were used to culture the human skin equivalents . the collagen matrices were cultured in fibroblast medium for a week . the full thickness human skin equivalents were first cultured submerged in keratinocyte medium for 2 or 3 days at 37 ° c . and 7 . 3 % co 2 and were then cultured in keratinocyte medium as described above , but with 1 % fcs and supplemented with 2 m l - serine , 10 mm l - carnitine , 1 μm dl - α - tocopherol - acetate , 50 μm ascorbic acid , a lipid supplement that contained palmitic acid , linoleic acid and arachidonic acid in a 1 : 1 : 1 ratio and 2 . 4 × 10 − 5 m bovine serum albumin . after 2 or 3 days , the hses were then cultured at the air - liquid interface for 14 days in keratinocyte medium as described above , but without serum and supplemented with 2 m l - serine , 10 mm l - carnitine , 1 μm dl - α - tocopherol - acetate , 50 μm ascorbic acid , a lipid supplement that contained 25 μm palmitic acid , 30 μm linoleic acid and 7 μm arachidonic acid ( 2 : 1 : 1 ) and 2 . 4 × 10 − 5 m bovine serum albumin . culture medium was refreshed twice a week . full - thickness skin models were reconstructed as described above using transwell filters with a pore size of 0 . 4 μm , corning 3460 , costar ). after 10 days of culturing at the air - liquid interphase , burn wounds of 20 mm 2 were made by applying liquid nitrogen on the skin equivalents for 15 seconds . the thermally injured skin equivalents were incubated for 1 hour at 37 ° c . and 7 . 3 % co 2 before infection . infection was done by applying an inoculum of 1 × 10 5 mrsa onto the skin equivalents . after incubation for 1 hour , the non - adherent bacteria were removed . treatment started 1 hour or 8 hours after infection and one dose ( 100 μg in 100 ml of pbs ) of ll - 37 , p60 . 4ac or p10 was given . treatment was prolonged for 4 hours or 24 hours before processing . the skin equivalents were washed with 1 ml of pbs to remove all non - adherent bacteria . then two biopsies of 4 mm were taken and homogenized in 1 ml of pbs . the homogenates and the washes were serially diluted to measure viable cfu counts on diagnostic sensitivity test ( dst ) agar plates . a set of 15 peptides was synthesized . the peptides were designed to either strengthen or weaken the predicted amphipathic structure when compared to p60 . 4ac ( m . j . nell et al ., peptides ( 2006 ) 649 - 660 ), as based on computer - assisted structure predictions . anti - biofilm activity is highly variable among the peptides ( both higher and lower activity antimicrobial peptides were generated in this way ). it was anticipated that a delicate relation exists between modification of the amphipathic helical structure and anti - biofilm activity within antimicrobial peptides . therefore , a series of short synthetic peptides were developed based on these observations , and their antimicrobial activity was evaluated . the activity of these peptides varied from no antimicrobial activity , to peptides with an activity that exceeded that of ll - 37 on a molar basis . peptide p10 kills mrsa lyh14616 very efficiently . it has the highest activity against mrsa luh14616 of all peptides tested , and is even considerably more effective than p60 . 4ac ( op - 145 ), see fig2 a and 2b . for instance , p10 has an ic99 . 9 of 0 . 59 μm , meaning that at this concentration , p10 kills 999 out of 1000 bacteria . p60 . 4ac , at a similar , even slightly higher concentration of 0 . 75 μm , kills only 900 out of 1000 bacteria ( ic90 of 0 . 75 μm ). thus , 100 times more bacteria survive after treatment with p60 . 4ac as compared to treatment with p10 at a similar concentration . hence , p10 has an approximately 100 times better activity than p60 . 4ac . peptide 10 was more effective than ll - 37 and p60 . 4ac in killing mrsa and mupirocine - resistant mrsa and in eliminating these bacteria from thermally wounded human skin equivalents ( fig3 - 5 ). p 10 is highly effective against mrsa bacteria in log phase , stationary bacteria and bacteria residing in biofilms . 1 ) gram - positive bacteria , e . g ., various strains of methicilline - resistant as well as - sensitive strains ( see fig4 and 5 ), staphylococcus epidermidis , 2 ) gram - negative bacteria including various ( drug - resistant ) pseudomonas aeruginosa strains , ( drug - resistant ) acinetobacter baumannii strains , 3 ) mycobacteria , and 4 ) the fungal pathogens ( fluconazole - resistant ) candida albicans and aspergillus niger . p10 variants in which one or all amino acids have been replaced by their corresponding d - amino acid , or one amino acid has been replaced by another l - amino acid have antimicrobial activity that is comparable to that of p10 . also , variants having an elongated n - terminal or c - terminal with different groups including acetyl , amide , nh —( ch 2 — ch 2 — o ) 11 — co , hexanoyl , decanoyl , myristoyl , propionyl , one or two amino - hexanoyl groups , and shorter p - 10 variants have antimicrobial activity that is comparable to that of p10 . the sequence and activity of these p10 variants are shown in tables 2 , 3 , 5 and 6 . peptides in which proline substitutions were introduced to break the helix were mostly inactive ( see table 4 ). | 0 |
fig1 shows diagrammatically an x - ray examination apparatus which comprises an image pick - up apparatus according to the invention . an x - ray source 1 irradiates an object 2 , notably a patient to be examined , by means of an x - ray beam 3 and an x - ray image is picked up by an entrance screen 4 of an x - ray image intensifier which converts the x - ray image into a light image on the exit window 6 . via a lens system 7 , the light image is imaged on an image sensor 8 in the form of a charge - coupled ( ccd ) sensor 8 which forms part of a camera 9 which forms an electronic image signal from the light image . a control circuit 10 is arranged to adapt the adjustments of the electric gate voltages of the ccd sensor to the selected mode of operation , for example x - ray imaging or fluoroscopy . the camera 9 and the control circuit 10 constitute an image pick - up apparatus 12 . the electronic image signal is applied to a monitor 11 so as to be observed , for example by a radiologist , or is applied to a buffer circuit 13 to await further processing . the x - ray examination apparatus also comprises an adjusting unit 14 for adjusting the x - ray examination apparatus , notably the x - ray source 1 in respect of energy , dose and pulse duration of the x - rays emitted by the x - ray source . the adjusting unit 14 is coupled to a control unit 15 of the image pick - up apparatus . the adjusting unit 14 supplies the x - ray source 1 and the control unit 15 with an adjustment signal . the control unit selects a mode of operation of the image pick - up apparatus in conformity with the adjustment of the x - ray source . selection of such a mode of operation implies the supply of a selection signal to the control circuit 10 for adjustment of a selection signal for supply to a gate circuit in order to adjust the gate voltages so as to obtain a desired spatial resolution , but also for the adjustment of a diaphragm 16 or for the adjustment of an electronic amplifier unit 17 for amplifying the electronic image signal . fig2 is a diagrammatic front view of a ccd sensor of the image pick - up apparatus shown in fig1 . the ccd sensor comprises an image pick - up section 20 and a storage section 21 . the image pick - up section 20 comprises a plurality of gate electrodes 22 1 , 1 - 22 n , m which are arranged in a matrix . a gate circuit 28 applies electric voltages to the gate electrodes of the image pick - up section 20 . the gate electrodes are arranged on an isolator layer which is composed , for example of silicon oxide , or of silicon nitride , or of a combination of silicon dioxide and silicon nitride . the isolator layer is provided on a crystalline silicon substrate . the electric voltages applied to the various gate electrodes co - determine the potential variation in the depth direction of the substrate . regions in the substrate which are situated underneath gate electrodes carrying a positive electric voltage constitute light - sensitive elements . when an image - carrying light beam which is emitted , for example by the exit window 6 of the x - ray image intensifier , is incident on the image pick - up section of the ccd sensor , charge carriers are released in the light - sensitive elements , which charge carriers are collected underneath the collecting gate electrodes and the isolator layer and the substrate . these charge carriers may be electrons , but also holes . for the description of the figures of the drawings , it is assumed , by way of example , that the charge carriers collected are electrons . gate electrodes carrying a positive electric voltage operate as collecting gate electrodes which collect electrons released by radiation absorption . gate electrodes carrying a negative electric voltage isolate light - sensitive elements from one another , so that they act as isolating gate electrodes . the charges collected in the light - sensitive elements correspond to the light intensities incident on the light - sensitive elements ; a light image is thus converted into an electron image in the image pick - up section of the ccd sensor . the gate circuit 28 supplies groups 23 of gate electrodes , electrically connected to the gate circuit via contact lines 29 , with an electric voltage which is positive relative to the gate electrodes adjoining said groups , the groups 23 being isolated from one another by gate electrodes which receive a negative electric voltage via the gate circuit . the light - sensitive elements are thus formed by metal oxide semiconductor ( mos ) capacitances operating in deep depletion , and the light - sensitive elements are isolated by mos capacitances connected in the reverse direction . after formation of the charge carrier image , being an electron image when electrons are collected by the collecting gate electrodes , the gate circuit repeatedly shifts the pattern of applied electric voltages through one matrix row in the direction of the storage section 21 so as to transfer the electron image from the image pick - up section to the storage section . to this end , the image sensor also comprises a storage section having a matrix of gate electrodes 24 1 , 1 - 24 n , m on an isolator layer which is composed of , for example silicon dioxide provided on a silicon substrate . the image pick - up section is shielded from light incident on the ccd sensor by way of a light - impermeable shield 25 . the gate electrodes 24 k , 1 of the storage section receive electric voltages via a transfer circuit 26 which electrically connects the gate electrodes 24 to the transfer circuit via contact lines 29 . a read - out circuit 27 is formed as a horizontal read - out register and is connected to the columns of gate electrodes of the storage section 21 . in order to read - out an electron image stored in the storage section , the transfer circuit transfers the charges constituting the picked up electron image to the read - out circuit 27 by repeatedly shifting the pattern of the electric voltages applied to the gate electrodes 24 k , 1 of the storage section 21 in the direction of the read - out circuit 27 . from the read - out circuit 27 the charges of successively read - out matrix rows are applied to an amplifier which converts the charges into electric voltage pulses which constitute an electronic video signal . fig3 a , 3 b and 3 c offer a diagrammatic impression of respective lateral dimensions , i . e . dimensions in the face of the image sensor which faces the light beam incident on the image sensor , of a light - sensitive element for different electric gate voltages applied to the ccd sensor of the image pick - up apparatus of fig1 . the electric voltages applied to the gate electrodes are controlled by the control circuit . the control circuit 10 applies a selection signal to the gate circuit 28 and to the transfer circuit 26 in order to select an electric voltage pattern in conformity with a selected mode of operation of the x - ray examination apparatus or the image pick - up apparatus 12 . the spatial resolution of the ccd sensor is determined by the lateral dimensions of the groups of gate electrodes 23 whereto positive electric voltages are applied during the picking up of an image . fig3 a shows a 5 × 5 part of the gate electrodes of the image pick - up section . as is shown in fig3 a , a group 23 a of 3 × 3 gate electrodes 23 k + 1 , 1 + 1 23 k + 3 , 1 + 3 receives an electric voltage which is positive relative to the gate electrodes surrounding the group 23 a , the group 23 a being surrounded by gate electrodes which receive a negative electric voltage relative to the group 23 a . the electric voltage pattern for the entire image pick - up section consists of a periodic continuation in the row and column directions of the spatial resolution of the ccd sensor ; thus , the smallest detail in the light image that can still be distinguished in the electron image derived therefrom is now determined by the lateral dimensions of the surface of the region 30 a as determined by the group 23 a . the enclosure of the group 23 b by gate electrodes carrying a negative electric voltage consists of regions having a width of one gate electrode in the row direction as well as in the column direction . image details in the light image , imaged on the image sensor by means of the lens system 7 , of dimensions smaller than the dimensions of the region 30 b cannot be distinguished from one another in the electron image formed when the applied electric voltages are adjusted in this manner . using the control circuit 10 , an alternative electric voltage pattern can be applied to the gate electrodes of the image pick - up section 20 by application of a selection signal during the picking up of an image . an example of a first alternative electric voltage pattern is shown in fig3 b in which a group 23 b of 2 × 2 gate electrodes receives a positive electric voltage , said group being enclosed by gate electrodes carrying a negative electric voltage . the enclosure of the group 23 b by gate electrodes carrying a negative electric voltage consists of regions having a width of two gate electrodes in the row direction as well as the column direction . the region 30 b underneath which electrons are collected after absorption of light has a light collecting surface area whose dimensions are smaller than those of the corresponding region 30 a in fig3 a . as a result , the modulation transfer function of the image sensor is increased for the electric voltage pattern of fig3 b , so that smaller details can be distinguished in the electron image and the spatial resolution of the image pick - up apparatus is enhanced by using the electric voltage pattern shown in fig3 b . fig3 c shows an example of a second alternative electric voltage pattern ; a group 23 c of 2 × 3 gate electrodes then receives a positive electric voltage , said group being enclosed by gate electrodes carrying a negative electric voltage relative to the group 23 c . in the column direction the enclosure of the group 23 c consists of regions of a width of one gate electrode , whereas in the row direction it consists of regions of a width of two gate electrodes . the region 30 c underneath which electrons are collected has a light collecting surface whose dimension in the row direction is smaller than that of the corresponding region 23 a in fig3 a . as a result , the modulation transfer function is increased , and hence also the spatial resolution of the image pick - up apparatus in the row direction of the ccd sensor , whereas the spatial resolution remains the same in the column direction . increasing the spatial resolution in one direction , for example the row direction , is advantageous in an image pick - up apparatus in which two or more ccd sensors are used , each of which picks up the same image , be it with a shift amounting to a fraction of the distance between adjacent rows relative to one another . in the case where use is made of two ccd sensors , said fraction preferably amounts to half the distance between adjacent rows . from the electronic image signals of the two image sensors there is formed one electronic image signal in that image lines of the electronic image signal of one ccd sensor constitute the odd image lines in the composite image and the image lines of the other ccd sensor constitute the even image lines in the composite image . by adjusting the electric gate voltages in conformity with fig3 c it is achieved that the spatial resolution becomes substantially equal in both directions in the composite image . fig3 d is a plan view of an alternative embodiment of an image sensor of an image pick - up apparatus according to the invention ; this figure offers a diagrammatic impression of lateral dimensions of a light - sensitive element of an image sensor provided with isolating barriers between the columns of light - sensitive elements . a group of collecting gate electrodes 23 d is formed by gate electrodes which have been selected as collecting gate electrodes . the region 30 d defines the active surface area of a light - sensitive element . the gate electrodes 22 k + 1 , 1 + 2 and 22 k + 1 , 1 + 3 have been selected as collecting gate electrodes by applying an electric voltage thereto which is positive relative to adjoining gate electrodes 22 k + 1 , 1 and 22 k + 1 , 1 + 4 . the columns of light - sensitive elements are isolated from one another by isolating barriers 31 . fig4 a is a sectional view , taken along the line i — i , of the image sensor shown in fig3 d . the image sensor is described , by way of example , as an image sensor in which the collected charge carriers are electrons . to this end , an n - type crystalline silicon layer which acts as a charge channel 41 is provided on a p - type crystalline silicon substrate 40 . on the charge channel 41 there is provided an isolator layer 42 of , for example silicon dioxide and on the isolator layer there are provided the gate electrodes which are made of polycrystalline silicon and which are rendered adequately conductive by doping . the contact lines 29 are also made of such polycrystalline silicon . it is thus achieved that gate electrodes are electrically connected to the gate circuit 28 by conductors which are also transparent to the incident radiation . light incident on the image sensor releases electron - hole pairs in the n - type charge channel ; the holes are drained to the p - type substrate and the electrons are collected in the charge channel 41 , notably underneath the collecting gate electrodes . fig4 b is a sectional view , taken along the line ii — ii , of the image sensor shown in fig3 d . fig4 b shows notably that the charge channel 41 is bounded on both sides by isolating barriers 31 made of p - type silicon . migration of electrons to adjacent columns is impeded by the isolating barriers 31 because a p - n - junction in the reverse direction is formed at the interface between the charge channel 41 and the isolating barriers 31 . instead of being made of p - type silicon , the substrate may also be made of n - type silicon which is isolated from the charge channel 41 by a p - type silicon intermediate layer . this version of an image sensor according to the invention also offers the advantage that deeply penetrating radiation , for example infrared radiation , releases charge carriers in the n - type substrate which cannot reach the charge channel because the intermediate layer constitutes a barrier . when in the event of high incident light intensities such large quantities of charge are collected underneath the collecting gate electrodes that diffusion to an adjacent light - sensitive element could occur , diffusion is avoided in that superfluous charge is drained , through the intermediate layer , to the n - type silicon substrate instead of to an adjacent light - sensitive element . fig5 shows diagrammatically an image pick - up apparatus 12 , comprising a beam splitter 50 for splitting a light - image - carrying beam into an image - carrying reflected sub - beam 51 r and an image - carrying transmitted sub - beam 51 t . these image - carrying sub - beams are projected onto separate image sensors 52 and 53 , each of which comprises a plurality of gate electrodes 22 . the image sensors convert the image - carrying sub - beams into collected charge carriers which from electronic sub - images in the image sensors and which are converted into electronic sub - image signals which are applied to signal combiner 54 in which the electronic sub - image signals are combined to form an electronic image signal of a composite image . the image sensors 52 and 53 are , for example ccd sensors , each of which picks up the same image , be it with a shift of a fraction , for example half , of the distances between adjacent rows of gate electrodes in one direction . from the electronic sub - image signals of the two image sensors an electronic image signal is composed in that image lines of the electronic image signal of one image sensor constitute the odd image lines in the composite image and the image lines of that of the other image sensor constitute the even image lines in the composite image . such combination enhances a spatial resolution in a direction transversely of the direction of the image lines . the control circuit 10 is coupled to the image sensors 52 and 53 in order to adjust the electric gate voltages on the gate electrodes 22 in such a manner that the spatial resolution in the composite image is substantially the same in directions parallel to and transversely of the image lines . | 7 |
fig1 illustrates an example system 80 that efficiently acquires signals received from a global navigation satellite system ( gnss ) in accordance with an embodiment of the present invention . the system 80 includes a code multiplication and frequency downconversion unit 84 , a code generation component 86 , a local oscillator ( lo ) 88 , a filter and downsample component 90 and a signal power metric and frequency offset estimator 94 . the code multiplication and frequency downconversion unit 84 receives signals from the gnss via an antenna and front end receiver components ( not shown ) and generates a plurality of downconverted intermediate frequency ( if ) signals representing varied relative time shifts between local code replica and incoming signal based on spreading codes received from the code generation component 86 and only a single frequency signal generated by the lo 88 . the filter and downsample component 90 further reduces ( decimates ) the sample frequency ( f s ) of the signals outputted from the code multiplication and frequency downconversion unit 84 . filtering also occurs at the filter and downsample component 90 as will be described later . the signal power metric and frequency offset estimator 94 receives the output of the filter and downsample component 90 and generates both a signal power metric value and estimate of the frequency offset of that received signal . the estimator 94 performs signal power metric and frequency offset estimation based on each of the time - varied spreading codes . the output of the estimator 94 is sent to an acquisition and tracking controller 96 that uses the output of the estimator 94 for detection of signal presence , estimation of its parameters and initialization of tracking . the functions performed by the downconversion unit 84 , the code generation component 86 , the lo 88 and the filter and downsample component 90 are performed by the prior art except that the lo 88 in the prior art produces a plurality of frequencies stepped by some δf through a range of frequencies based on a predefined estimation of possible frequencies of the gnss signals that may be received . also , in the present invention , the filter and downsample component 90 is implemented with hardware components not found in the prior art , although the function performed is known by the prior art . fig2 illustrates a system 100 that is a more detailed example of the system 80 as shown in fig1 . the example system 100 includes a plurality of slices of hardware components that receive a preprocessed if signal . in this embodiment , a single code generation component 86 can be used to supply time delay spreading codes across each of the slices . the code generation component 86 includes a code generator 140 , a code clock 142 , and a shift register 144 . the code generator 140 generates spreading codes based on input information from the acquisition and tracking controller 96 and a clock signal from the code clock 142 . the output of the code generator 140 is sent to the shift register 144 , which performs a time delay delivery of the spreading codes to the slices . alternatively only a single code can be outputted from code generator 86 and the shift register 144 can be placed at the preprocessed if input to deliver time delayed samples of incoming signal to multiple slices . within each of the slices , the code multiplication and frequency downconversion unit 84 receives the spreading code at a first multiplier 150 that multiplies it with the preprocessed if signal . the lo 88 includes a local oscillator 156 and a phase delay component 160 . the local oscillator 88 produces i and q signals that are sent to multipliers 158 and 162 in the downconversion unit 84 in order to perform frequency downconversion of the signal outputted from the multiplier 150 . the i and q signals from the downconversion unit 84 are fed to the cascaded integrator - comb ( cic ) filters 90 - 1 and 90 - 2 of the filter and downsample component 90 . the cic filters 90 - 1 and 90 - 2 perform further downsampling and filtering . other hardware devices may be used in place of the cic filters 90 - 1 and 90 - 2 . one of the major advantages of described acquisition method is the possibility of using a fixed lo 156 for relatively slow spreading codes ( gps c / a and boc ( 1 , 1 ) planned for gps and galileo li ). the easiest and most hw economical implementation is with lo running at ¼ of sampling frequency f s . however it must be noted that for fast spreading codes ( gps military p - code and codes planned for gps and galileo l 5 ) the integration time is limited by received code drift caused by doppler and local clock error . thus for sensitive acquisition ( long integration times ) at least code clock and optionally local oscillator used to generate local replica must be adjustable and size of frequency bins evaluated by herein presented method must be limited by generation of replica at an appropriate number of frequency offsets . this way the method becomes similar to classical approach , however it can still be beneficial in some implementations , e . g . due to possible frequency estimate accuracy improvement . also the number of evaluated frequency bins can still be significantly lower than with classical methods . also , it can be expected that in most applications independent acquisition of fast codes ( l 5 ) will not be necessary as it can be aided by results obtained from li acquisition . code multiplication and frequency downconversion can be done in any order . also , the input signal can be downconverted to zero if externally by an analog quadrature mixer , i . e ., conversion to zero if can be done as part of the receiver front end . fig3 and 4 illustrate two different embodiments for the signal power metric and frequency offset estimator 94 . as shown in fig3 , an estimator 200 receives a combination of the in - phase i and quadrature q signals from the cics 90 - 1 and 90 - 2 ( fig2 ). the received combined signal is applied to a multiplier 210 and is multiplied with the same signal that is delayed by a delay device 206 and acted upon by a complex conjugate component 208 , which operations are known to those having ordinary skill in the art . i δ and q δ are outputted from the multiplier 210 and sent to an averaging component 214 . an example averaging component is an integration and dump ( i & amp ; d ) device . the output ( avg ( i δ )+ javg ( q δ )) of the component 214 is then supplied to a device 220 that performs a cartesian to polar conversion to produce an amplitude component ( signal power metric ) and a phase component ( frequency offset estimate ). an example algorithm that performs cartesian to polar conversion is the coordinate rotation digital computer ( cordic ) algorithm . other conversion algorithms may be used . the amplitude and phase components are then sent to the acquisition and tracking controller 96 . the cartesian to polar conversion device 220 generates the signal power metric ( amplitude ) in accordance with the following embodiment : where j is imaginary unit and s k is complex number representing i and q components coming from the cic filters 90 - 1 and 90 - 2 at time k / f s ( f s is sample frequency at output of cic filters ). a is amplitude of harmonic signal ( if present ) and 0 if no signal is present . depending on particular hw implementation usage of square of amplitude ( a 2 ) can be also advantageous . the cartesian to polar coordinate conversion device 220 generates phase as follows : frequency is estimated directly from angle of averaged i δ and q δ as : where f s is sampling frequency ( at input of multiplier 210 ). to avoid biased estimates , additive noise at the input of the multiplier 210 needs to be white , i . e . consecutive samples need to be independent of each other . this condition is well satisfied if cic filter with single delay in comb section is used and no additional smoothing is applied . fig4 illustrates an alternate embodiment for the signal power metric and frequency offset estimator 94 as shown in fig1 and 2 . an example estimator 250 receives the i and q signals from the cics 90 - 1 , 90 - 2 into optional filtering components 256 and 258 . one example is moving average filtering ( sum of n consecutive samples optionally divided by n ) but generally any other digital filter can be applied . to achieve maximum sensitivity , as much additive noise as possible needs to be filtered out . depending on particular implementation phase modulo arithmetic can require sampling frequency significantly higher than 2f ifmax ( nyquist sampling theorem ). in this case , additional filtering ( smoothing ) is applied . this can be achieved either by more than one sample delay in cic &# 39 ; s comb section or by additional filtering in component 256 . a cartesian to polar conversion device 260 generates amplitude and phase values from the received i and q signals . cartesian polar conversion can be accomplished using e . g . cordic algorithms . the outputted phase value ( φ ) is subtracted at a combiner 266 from phase delayed by a delay device 264 . next , the output of the combiner 266 is sent through a phase unwrap component 268 for performing smoothing of the phase value to produce a delta phase ( δφ ). the δφ outputted by the phase unwrap component 268 is sent to an i & amp ; d ( averaging ) component 270 . the averaged output avg ( δφ ) is then sent to an optional scaling device 274 in order to generate the frequency offset estimate according to the following equation : the δφ is also sent to a variance estimator 282 that produces a phase increase variance value ( var ( δφ )) or a modified second moment of phase increase value ( var mod ( δφ )) depending upon a predefined option . a power discriminator 284 receives the averaged amplitude value ( avg ( a )) from an i & amp ; d device 280 and one of the outputs of the variance estimator 282 to determine signal power metric value . see the following power discriminator options : option 3 ( not depicted ): for strong signals only one of the discriminator inputs is used . option 4 ( not depicted ): any of these metrics can be used in combination with that shown in fig3 to support weak signals detection . the present invention can exploit data and pilot channels that are going to be used in galileo and modernized gps systems . each data and pilot channel use different spreading codes but are modulated on the same carrier . data and pilot channels can thus be combined at various levels . out of all the options combining data and pilot metrics at input of integrate and dump ( i & amp ; d ) blocks depicted in fig3 and 4 is believed to be most reasonable : i δ = i δ , pilot + i δ , data , q δ = q δ , pilot + q δ , data fig4 : fig5 illustrates an example process 300 performed by the acquisition and tracking controller 96 . first , at a block 310 , the amplitudes / power metrics from all the slices are compared to a predetermined threshold and eventually to each other to determine potential signal presence . the concrete implementation of block 310 may be varied , however methods similar to those used in standard acquisition methods for correlation peak search can be used . if the peak is positively detected at the output of particular slice ( decision block 316 ), the controller proceeds to standard acquisition refinement ( fine carrier and code synchronization in phase locked loops and delay locked loops , bit synchronization and frame synchronization — block 312 ) and tracking performed in tracking units 96 . code offset and rough frequency offset estimates corresponding to slice where the peak was detected are used as initial conditions for this subsequent process . if the peak is not detected at the output of particular slice ( decision block 316 ), the controller selects a new code delay bin or a new satellite ( block 320 ). the present invention describes processing after analog to digital conversion , i . e . in digital hw like a field programmable gate array ( fpga ) or application specific integrated circuit ( asic ). while the preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment . instead , the invention should be determined entirely by reference to the claims that follow . | 6 |
fig1 is a perspective view of a continuous lateral circulator , generally indicated at 10 , installed within a cultivation pond 12 . the continuous lateral circulator 10 has the general form of a conveyor belt turned on its side , such that the breadth of the belt 14 extends vertically . the belt 14 is endless and is trained over two vertically - extending pulleys 16 , 18 . a motor 20 coupled to one of the pulleys 16 drives the belt 14 in a loop . a series of angled cleats 22 , arranged at a regular pitch along the length of the belt 14 , help to push the water in the pond as the belt 14 is driven . the pond 12 itself is typical for a cultivation pond , and as can be seen in fig1 , the circulator 10 is installed in the center of it and extends substantially the entirety of the length of the pond 12 , evenly spaced between the sides and the two ends . for example , if the pond 12 is 1 , 000 feet ( 305 meters ) long and 100 feet ( 30 meters ) wide , the circulator 10 may be approximately 900 feet long , leaving an equal distance at each end . of course , the circulator 10 need not be perfectly centered in the pond 12 in all embodiments , and ponds 12 may be of any size . as will be described below in more detail , one advantage of circulators 10 according to embodiments of the present invention is that they may remove agitation - based size restrictions on cultivation ponds 12 , thereby allowing for larger ponds . the pond 12 may be of any depth , although typical cultivation ponds are relatively shallow — depths of less than 1 foot ( 0 . 3 meters ) are common . as shown in fig1 , the circulator 10 in the illustrated embodiment is taller than the illustrated depth or water level of the pond 12 in which it is placed . that is , the illustrated water level in the pond 12 is lower than the top of the belt 14 and pulleys 16 , 18 . in most embodiments , the circulator 10 will extend at least substantially the entire depth of the pond 12 , and in many of those embodiments , the circulator 10 may be taller than the average expected pond depth . the extra height allows the water level in the pond 12 to be increased , as might be done for temperature control and for various other reasons known to those skilled in the art . as one example , if a typical water height of a pond 12 is about 12 inches ( 30 cm ), the circulator may be about 18 inches ( 46 cm ) tall . while the cultivation pond 12 illustrated in fig1 is uncovered and open , cultivation ponds 12 may be covered and closed , as is known in the art . there is no particular limitation to the height of the belt 14 and its pulleys 16 , 18 , or to the length of the belt 14 . particularly with long belts , it may be helpful to include idler pulleys or rollers , also oriented vertically , which would provide support along the length of the belt 14 . additionally , the circulator 10 may include belt tensioners and other such devices . the length of the belt 14 , its height , and the speed at which it is to be driven are among the factors that dictate how much power is required to drive the belt 14 . in the illustrated embodiment , a motor 20 directly drives one of the pulleys 16 to move the belt 14 . that motor 20 may , in some embodiments , be as small as ½ horsepower or , in other embodiments , as large as 10 horsepower . the placement of the motor 20 , however , is not critical . in some embodiments , the motor 20 may be placed on the other pulley 18 . in yet other embodiments , the motor 20 may be located elsewhere , and one or both pulleys 16 , 18 may be driven by a drive - train connected between the motor 20 and the pulleys 16 , 18 . generally speaking , various methods of driving conveyor belts are known , and any compatible method may be used in embodiments of the present invention . in fig1 , the circulator 10 is relatively narrow , with nothing between the two sides of the belt 14 . that may not be the case in some embodiments . in some cases , the belt 14 may be arranged around a berm , wall , or other structure , with more pulleys or rollers , if needed , to dictate its path around that structure . for example , many cultivation ponds have walls and other dividing structures , and a belt 14 may be arranged around those walls and structures . as another example , a belt 14 may be placed around a pair of parallel walls that are about as high as the belt 14 and are spaced from each other at a distance of about 3 feet ( 1 meter ). such walls could be used , for example , to support an elevated horizontal walkway , located between the two sides of the belt 14 , that allows maintenance workers to walk along the center of the pond 12 in order to service the circulator 10 or the pond 12 itself . additionally , while the belt 14 of fig1 is trained over the pulleys 16 , 18 such that it has two long sides that are parallel to one another , that need not be the case in other embodiments . instead , the belt 14 may be trained over any number of pulleys , rollers , idlers , and other structures to have any desired shape , e . g ., polygonal or serpentine , if the geometry of the cultivation pond or other factors dictate it . fig2 is a side elevational view of the circulator 10 in isolation . in fig2 , the evenly - spaced cleats 22 can be seen . cleats 22 are used to drive the water in the pond 12 . in the illustrated embodiment , each cleat 22 is a continuous bar of constant cross - section that extends across the height of the belt 14 at an angle . the cleats 22 of the illustrated embodiment overlap such that if one draws a straight line down the belt 14 , that line may intersect several cleats 22 , e . g ., 4 - 6 cleats , depending on their number and angle . the cleats 22 are arranged at a regular pitch , which will vary from embodiment to embodiment , but may be on the order of , e . g . 3 - 6 inches . it should be understood that for reasons of legibility and ease in illustration , the drawing figures show fewer cleats at a greater pitch than would be used in most typical operational embodiments . fig3 is a cross - sectional view of one of the cleats 22 . as shown , it has a generally trapezoidal cross - section in the illustrated embodiment , such that it is narrower at the top ( i . e ., the outermost point ) than it is at the base . in a typical embodiment , a cleat 22 might have a height in the range of about 1 - 2 inches ( 2 . 5 - 5 centimeters ), and a width in that range as well . the cleat 22 of fig3 has a base of about 1 inch ( 2 . 5 centimeters ) and an outward extent of about 2 inches ( 5 centimeters ). it may be helpful if the cleats 22 , taken together , have at least the same effective surface contact area as a paddlewheel suitable for use in the same size of cultivation pond 12 . (“ effective surface contact area ” in this context refers to the area that actually contacts and drives water at any point in time .) in some cases , if numerous cleats 22 are on the belt 14 , the effective surface area of those cleats 22 may be greater than that of a paddlewheel that would be used in the same pond , which may allow the belt 14 to move more slowly and provide the same quality of effective circulation . of course , the cleats 22 may vary in form and arrangement from embodiment to embodiment , depending on any number of factors . for example , the cleats may instead have a rectilinear cross - section , but may curve downwardly as they extend outwardly from the belt 14 . ultimately , the cleats 22 are present to push water , and any cross - sectional shape that accomplishes that purpose may be used . additionally , the cleats 22 need not be continuous bars , they may have different cross - sectional shapes , and they may be inclined at different angles . the forces developed by each cleat 22 are shown in fig4 , a schematic view of the belt 14 with only a single cleat 22 . if the belt 14 is driven forward with a longitudinal velocity v l , the cleat 22 will generate a forward force ( f l ) and a forward velocity ( v l ), as well as a downward force ( f d ) and a downward velocity ( v d ). the amount of forward versus downward force ( i . e ., the forward and downward components of the overall force vector ) is in proportion to the inclination angle of the cleat , θ , and can be readily determined trigonometrically . in most embodiments , the angle θ will be in the range of about 10 - 45 °, although a more preferable range for at least some embodiments might be 10 - 30 °, and in some cases , the range might be narrower still , e . g ., 18 - 22 °. the cleat of fig4 is inclined at an angle of 22 °, although it should be understood that the angles shown and described above assume that it is desirable to push the water down ; if one wished to push the water up , instead of down , the orientation of the cleats 22 would be reversed . in some embodiments , the ratio of v d to v l may be , e . g ., 3 : 1 , 4 : 1 , etc . fig4 is a two - dimensional schematic illustration of the effect of the cleats 22 on the water . the cross - section of the cleats 22 may be chosen specifically to cast water outward , away from the belt 14 . fig5 is a top plan view of the pool 12 and the circulator 10 . as shown in fig5 , the belt 14 is driven forward at some longitudinal velocity , v l , that is aligned with the central long axis of the pond . however , the motion of the belt 14 also drives water forward , down , and away from the belt 14 , creating continuous lateral circulation ( i . e ., in the direction indicated by arrows v t ) between the circulator 10 and the sides and the bottom of the pool 12 . fig6 is a schematic end - elevational view of the pool 12 illustrating the circulation from that perspective . as fig5 and 6 make clear , the circulator 10 is not a point - source agitator placed , for example , on one end of the pond 12 . rather , by extending over virtually the entire length of the pond 12 , it provides continuous circulation and agitation energy to essentially the entirety of the pond 12 . in so doing , it may remove agitation - based size restrictions on cultivation ponds 12 . while in many cases , the circulator 10 will be operated continuously , in this context , the term “ continuous circulation ” to the fact that the circulator 10 spans and is physically continuous over substantially the entirety of the pond 12 . the circulation or agitation in the pond 12 is distributed across almost the entire pond 12 ; the circulator 10 is not a point source for agitation , like a paddlewheel . in a typical scenario , the belt 14 is driven and the cleats 22 are adapted to ensure a relatively mild turbulent flow in the direction of belt movement , but a relatively strong turbulent flow in the lateral direction . with conventional ponds that use paddlewheels as point - source agitators , reynolds numbers of 60 , 000 or more are commonly achieved , indicating very strong turbulent flow . however , large amounts of energy are expended in maintaining those flow conditions , and some of the invested energy may be lost . by contrast , with lateral circulators 10 according to embodiments of the present invention , reynolds numbers of 15 , 000 - 30 , 000 in the lateral ( i . e ., transverse ) direction may be more commonly used . the belt 22 itself may be driven at relatively low velocity longitudinally , e . g ., on the order of 2 inches ( 5 cm ) per second . as those of skill in the art will realize , the velocity at which the belt 14 is driven and the velocity of the water around the belt 14 are , in many cases , two different things . the degree to which the belt 14 pushes the water , the momentum imparted , and the direction will vary with the drive velocity ; the orientation , number , and shape of the cleats 22 ; and a number of other fluid - dynamic factors . as those of skill in the art might also appreciate , even without cleats 22 to aid in moving water , a belt 14 driven at a high enough velocity could probably produce a desired lateral velocity of the water , but the fraction of that energy that would be transferred to the water would likely be much less than it would be with cleats 22 . ultimately , the desired water velocities will also depend on non - mechanical factors , such as the type of algae or other organism , and the presence of wind and other environmental factors . as was described above , the belt 14 will typically be given a longitudinal velocity , referred to in this description as v l . while that velocity may be continuous over long periods of time , it need not necessarily be . the overall velocity may be varied from moment to moment , if necessary , based on conditions within the cultivation pond 12 , the needs of the particular organism being cultivated , and environmental factors that affect the pond 12 . it should also be understood that the speed at which the motor 20 runs may not be equal to v l ; in most cases , gearing or a drive train between the motor 20 and the pulley 16 that it drives will alter the speed of the motor 20 . in many cases , a gearbox may be integrated into the motor . beyond imparting motion to the belt , other drive signals may be used , and in some cases , superposed on the main drive signal that creates the longitudinal velocity of the belt 14 . for example , it has long been known that vibrations introduced into mechanical systems can help to prevent friction and make mechanisms operate more smoothly — a technique called dithering . embodiments of the present invention may use dithering — for example , by altering the velocity , acceleration , or direction of the belt 14 at a rate that is significantly different than the velocity of the belt 14 or the rate at which it drives the water . for example , if v l is selected to drive the water at a rate of 1 hz , a lower - amplitude , low frequency signal equivalent to about 0 . 1 hz may be used for dithering . the resulting movement may be an oscillation , a vibration , or a non - cyclic pattern of acceleration , velocity , or directional changes . the nature and amplitude of the dithering may vary from embodiment to embodiment , and is not particularly limited , so long as the dithering does not detract from the primary motions that the moving belt 14 is to impart to the water . of course , depending on the belt velocity and other factors , dithering may not be required . in a typical embodiment , the turbulent flows that surround the belt 14 and impinge on it during operation may vibrate the circulator 10 in the same way that dithering would — without the need to drive the belt 14 in any special way . the belt 14 itself may be made in any of a variety of ways . for example , the belt may be made of a rubber , or of a rubberized or coated fabric or other textile . as was described above , the exterior of the belt 14 has cleats in order to better interact with the water in the cultivation pond 12 . the inward - facing side of the belt 14 may also have grooves , cleats , or other features in some embodiments . because the belt 14 is mounted vertically , slippage of the belt 14 on the pulleys 16 , 18 may be more of an issue than in a belt 14 of similar dimensions that is mounted horizontally . thus , grooves , cleats , or other inward - facing gripping features may be helpful in retaining the belt 14 on the pulleys 16 , 18 . for example , the belt 14 and pulleys 16 , 18 may have the cleats and pulley - grooves shown in u . s . pat . no . 4 , 011 , 939 to conrad , the contents of which are incorporated by reference in their entirety . additionally , while the pulleys 16 , 18 in the illustrated embodiment are rounded , additional features may be included to prevent slippage or other tracking problems . in some cases , sprockets mounted near or at the edges of the pulleys 16 , 18 may be made to insert into series of complementary slots cut or formed in coincident positions near the edges of the belt 14 . in other words , the belt 14 and pulleys 16 , 18 may have male and female complementary engaging structures to prevent belt slippage and so - called tracking problems . in some cases , the male structures may be carried by the belt 14 and the female structures may be carried by the pulleys 16 , 18 , while in other cases , the opposite may be true . belts 14 may also be made of a number of rigid sections of plastic , rubber , or metal connected together to articulate or flex . as one example of this , fig7 is an elevational view of a section of a belt 100 , that is comprised of a number of modular sections 102 , 104 , 106 , 108 , 110 , 112 , each of which is rigid or semi - rigid . the sections 102 , 104 , 106 , 108 , 110 , 112 have edges that define a series of complementary projections and grooves , allowing the sections 102 , 104 , 106 , 108 , 110 , 112 to be essentially enmeshed in one another . a series of openings 114 , which line up when the sections 102 , 104 , 106 , 108 , 110 , 112 are enmeshed , allow for the insertion of pins 116 , about which the sections 102 , 104 , 106 , 108 , 110 , 112 hinge to allow the belt 100 to flex . in the description above , it was briefly explained that the cleats 22 need not be continuous bars . on the belt 100 , the cleats are not only discontinuous , but portions of them are carried by different sections 102 , 108 , 110 . more specifically , in the illustration of fig7 , three cleat sections 118 , 120 , 122 are each carried by a different section 102 , 108 , 110 of the belt . the cleat sections 118 , 120 , 122 have the inclination angle described above , and may have the cross - sectional shape described above or any other desirable shape . as shown , when the sections 102 , 108 , 110 are assembled , the cleat sections 118 , 120 , 122 roughly line up , although there may be some discontinuity . additionally , the two segments 102 , 104 that define the top of the belt 100 and the two segments that define the bottom of the belt 100 in the illustration of fig7 include a series of slots 124 at a regular pitch positioned to engage a drive sprocket on one of the belt - drive pulleys . fig8 illustrates the engagement of the belt 100 trained over a pulley 130 with sprockets 134 . in the description above , a single circulator 10 with a single belt 14 , 100 spans the length of the cultivation pond 12 . however , that need not be the case in all embodiments . instead , in some embodiments , multiple circulators arranged in series or , in some cases , in parallel , may be used . fig9 is a top plan view illustrating three circulators 10 a , 10 b , 10 c arranged in series , aligned end - to - end , to cover the same length of a cultivation pond 12 . each of the circulators 10 a , 10 b , 10 c has its own endless belt 14 , trained over its own set of pulleys 18 , 20 . the ends of the circulators 10 a , 10 b , 10 c are spaced closely together , although the spacings may be modified to effect control over circulation in the areas between the circulators 10 a , 10 b , 10 c . of course , any number of circulators 10 a , 10 b , 10 c may be used to cover any desired length or distance . smaller circulators 10 a , 10 b , 10 c may be used in parallel when the cultivation pond , or a channel within the pond , is particularly wide . circulators 10 a , 10 b , 10 c may also be used in parallel when the pond 12 is divided or partially divided such that a single circulator 10 or in - series line of circulators 10 a , 10 b , 10 c is unlikely to produce a lateral circulation that will reach essentially the entire pond . although this description places some emphasis on the circulator 10 providing continuous circulation or agitation across an entire cultivation pond 12 , and that arrangement has a number of advantages , it need not be used in that way in all embodiments to be effective . in some cases , a lateral circulator may be considerably shorter than the circulator 10 of fig1 . in cases where the circulator is relatively short or small compared to the size of the cultivation pond 12 , that circulator essentially becomes a point source for circulation or agitation , in which case , its longitudinal velocity may be significantly greater than a circulator 10 with a more extensive area in order to achieve the same degree of circulation or agitation . while the invention has been described with respect to certain embodiments , the description is intended to be exemplary , rather than limiting . modifications and changes may be made within the scope of the invention , which is defined by the appended claims . | 8 |
a dual leash 10 is illustrated in side perspective views in fig1 a and 1 b . the dual leash 10 has a handle portion 11 with an opening for a user &# 39 ; s hand 16 and a main body portion 12 . extending from the body portion 12 are two clips 13 for securing to an animal collar wherein each clip 13 is attached to a retractable lead cable 14 . the retractable lead cables 14 may be locked from retracting by compression of the push button lock 15 . a dual leash 10 is illustrated in a first exploded perspective view in fig2 . the main body 12 is hollow with a support spindle 21 inserted centrally within . the support spindle 21 extends across the hollow opening of the main body 12 and is mounted at the top of the main body 12 with a spindle top cap 32 and at the bottom of the main body 12 with a spindle bottom cap 33 . a compression spring ( not shown ) is inserted over the support spindle 21 external to the spindle bottom cap 33 and biases the hollow opening of the main body 12 towards a push button lock 15 in the handle portion 11 . compression of the push button lock 15 causes the hollow opening of the main body 12 to move relative to the support spindle 21 by sliding along the longitudinal axis of the support spindle 21 and as a result compressing the compression spring ( not shown ) and engaging the spool stop features 22 on the main body 12 . engagement of the down position lock 42 may be utilized for hands - free locking of the cord spools 31 . when the push button lock 15 is released , the compression spring forces the hollow opening of the main body 12 to move back towards the mounting point of the push button lock 15 in the handle portion 11 thereby releasing the spool stop features 22 . two cord spools 31 are mounted on the support spindle 21 within the hollow opening of the main body 12 . the cord spools 31 rotate about a vertical rotation axis as a function of spring steel contained within the central chamber 25 of each cord spool 31 . the cord spools 31 are secured within the main body 12 on the top by a spindle top cap 32 and on the bottom by a spindle bottom cap 33 . a body top plate 35 secured by screws 36 holds a precision thin section ball bearing 34 in position above the top cord spool 31 . the ball bearing 34 enables the main body 12 to rotate freely in relation to the handle portion 11 with minimal friction thereby ensuring the non - entangling of the separate retractable lead cables 14 . eyelets 41 provide guidance for the smooth extension and retraction of the cord within the main body 12 . a dual leash 10 is illustrated in a second exploded perspective view in fig3 . the push button lock 15 is shown mounted over the support spindle 21 and provides a lever - like action to push the hollow opening of the main body 12 relative to the support spindle 21 . the cord spools 31 are secured within the main body 12 on the top by a spindle top cap 32 and on the bottom by a spindle bottom cap 33 . a body top plate 35 secured by screws 36 holds a precision thin section ball bearing 34 in position above the top cord spool 31 . the cord spools 31 within the main body 12 and the main body 12 rotate relative to the handle portion 11 about a vertical rotation axis . the push button lock 15 shares the same rotation axis as the cord spools 31 and main body 12 , providing that the push button lock 15 can be depressed no matter the rotational position of the main body 12 to the handle portion 11 . the locking of the cord spools 31 is triggered by a series of teeth 37 that extend from the circular flat surface of the cord spools 31 . the teeth 37 are arranged in a radial pattern . spool stop features 22 ( see fig2 ), not visible in fig3 , are provided within the hollow opening of the main body 12 , extending from the inner wall of the main body 12 . at least one spool stop feature 22 is configured to engage the teeth 37 . when the push button lock 15 is compressed , the hollow opening of the main body 12 is shifted such that the cord spools 31 are moved toward the spool stop features 22 inside the main body 12 and the teeth 37 on each cord spool 31 engage the spool stop features 22 to prevent the rotation of the cord spools 31 . eyelets 41 provide guidance for the smooth extension and retraction of the cord within the main body 12 . engagement of the down position lock 42 may be utilized for hands - free locking of the cord spools 31 . a dual leash 10 is illustrated in a cross - section perspective view in fig4 . the handle portion 11 with an opening for a user &# 39 ; s hand 16 is adjacent to the push button lock 15 , shown in the “ up ” position such that the cord spools 31 and the retractable lead cables 14 ( not shown ) can retract in and out of the main body 12 . eyelets 41 provide guidance for the retractable lead cables 14 . a down position lock 42 allows the user to stop the rotation of the cord spools 31 by securing the push button lock 15 in a compressed position without the need to continually compress the push button lock 15 . when the push button lock 15 is compressed , the spindle 21 is forced downward causing tension in the compression spring 45 at the base of the main body 12 . the precision thin section ball bearing 34 , secured in place by the body top plate 35 , allows for the free movement of the handle portion 11 in relation to the main body 12 about the vertical axis . spring steel positioned within the central chamber 25 of the cord spools 31 provides the automatic retraction of the lead cables 14 once the tension on the spring steel is released . a dual leash 10 is illustrated in a cross - section perspective view in fig5 . the compression of the push button lock 15 results in the vertical downward movement of the support spindle 21 / cord spool 31 assembly as shown by the large downward arrow , which allows for the engagement of the teeth 37 with the spool stop features 22 to prevent the rotation of the cord spools 31 . a handle portion 11 of a dual leash 10 is illustrated in a close - up cross - section perspective view in fig6 . the spool stop features 22 on the main body 12 are shown in fig6 a . when the push button lock 15 is in the “ down ” position , as shown in fig6 b , the down position lock 42 can be pushed forward to engage a hook to secure the push button lock 15 in the “ down ” position without having to hold down the locking mechanism 15 , as shown in fig6 c . the down position lock 42 can be disengaged by a downward motion and a compression spring will force the support spindle / cord spool assembly upwards further allowing the cord spools to rotate and the cables to retract or extend ( not shown ). details of a single retractable lead cable 14 and attached cord 75 are shown in fig7 . the internal end 71 connected to the spooling portion 72 of cord 75 is shown in fig7 a . the internal end 71 is a loop that is secured about the cord spool 31 ( not shown ). the external end of the retractable lead cable 14 which contains a clip 13 for attaching to an animal collar ( not shown ) is shown in fig7 b . the securing of the internal end 71 of the spooling portion 72 is shown attached to a cord spool 31 in fig7 c . a retraction blocking element 74 , positioned on the spooling portion 72 of the cord 75 where the cord 75 connects to the external end of the retractable lead cable 14 is shown in fig7 d . the retraction blocking element 74 prevents the external end of the retractable lead cable 14 from retracting into the main body 12 . the spring steel 82 within each cord spool 31 ( not shown ) is shown in fig8 . a single spring steel 82 placed within a cord spool 85 is shown in fig8 a . a single spring steel 82 is shown in fig8 b . when in a native position , the spring steel 82 is coiled as shown in 8 b devoid of tension resulting in the complete retraction of the spooling portion 72 if the cord 75 . the center of the spring steel 83 is secured to the support spindle 21 ( not shown ) such that when the retractable lead cable 14 is extended , the cord spool 31 ( not shown ) rotates vertically about the support spindle 21 causing the spring steel to move into a tensioned state about the support spindle 21 . when the tension in the spring steel 82 is released the retractable lead cable 14 and the spooling portion 72 of the cord 75 are automatically retracted into the main body 12 by means of the cord spool 31 rotating about the support spindle 21 . the present invention provides a multi - cabled retractable pet leash for walking two pets simultaneously using a single compact design . one embodiment of the present invention provides a multi - cabled retractable pet leash , the leash comprising : a main body extending vertically , defined by a top portion and a bottom portion and defining the main chamber within said main body ; a stationary support spindle located centrally within the main body and extending between the top portion and the bottom portion ; a first cord spool positioned vertically in relation to a second cord spool within the main body such that each cord spool may rotatably engage with the support spindle about a vertical rotational axis ; a first cord coiling about said first cord spool ; a second cord coiling about said second cord spool ; a spindle top cap positioned externally to said first cord spool ; a spindle bottom cap positioned externally to said second cord spool ; a precision thin section ball bearing located above said first cord spool ; a body top plate positioned above the precision thin section ball bearing secured with screws ; a handle positioned above the support spindle and exterior to the precision thin section ball bearing ; a first lead cable and a second lead cable extending from the main body wherein the end of each lead cable comprises a clip ; and a locking feature in said handle . in another embodiment of the present invention , the multi - cabled retractable pet leash contains a main chamber within the main body which is further divided into an upper chamber positioned vertically in relation to a lower chamber within the main body . in a preferred embodiment , the lower floor of the first chamber further contains spool stop features which protrude vertically from said floor and the lower floor of the second chamber further contains spool stop features which protrude vertically from said floor . in another embodiment of the present invention , the multi - cabled retractable pet leash is further comprised of a single cord spool located within each of said upper chamber and said lower chamber . in a preferred embodiment , a first cord is coiled about said first cord spool and a second cord is coiled about said second cord spool . in yet another embodiment , the lower surface of said first cord spool and said second cord spool contain teeth which engage the spool stop features in the upper and lower chamber when the locking mechanism is compressed . in another embodiment of the present invention , the multi - cabled retractable pet leash is further comprised of a spring steel retractable feature located in the center of each of said first cord spool and said second cord spool . in a preferred embodiment , the spring steel is secured at one end to the support spindle . in yet another embodiment , the first cord spool and second cord spool extend and retract independent of each other . in another embodiment of the present invention , the multi - cabled retractable pet leash has a retraction lock feature wherein the retraction of the cord may be locked without the user having to continue to compress the locking mechanism . in another embodiment of the present invention , the multi - cabled retractable pet leash has a precision thin section ball bearing mounted at the juncture of the main body and the handle such that the ball bearing allows the main body and the handle to rotate independently with minimal friction thereby ensuring the non - entanglement of the separate lead cables . in a preferred embodiment , when the push button lock is engaged , the central spindle is pressed in the downward position , causing the cord spools to interact with the spool stop features on the main body . the stop features will engage each spool independent of the position of the housing in relation to the handle and allow the housing to rotate freely about the ball bearing ring even when the locking mechanism is engaged . this feature is a key improvement over the prior art because the dual leashes described in the prior art become locked when the spools are locked . pet owners will appreciate the continued free rotation of the housing while locking the rotation of the spools because dogs may continue to roam and move about in relation to each other and the leash housing even when the owner has the desire to control the length of leash released from the spool . in addition to the rotation of the housing , even when spool rotation is locked , the simplified locking mechanism is an improvement over the prior art . the use of a central spindle for the positioning of the spools as well as the action point of the locking mechanism eliminates the requirement of the shaft mounted to the housing , which is a required element in the prior art . the direct action of the locking mechanism on the central spindle to press the spools into a locked position ( i . e . engaging with the spool stop features ) requires fewer components compared to the prior art . the requirement of fewer components translates to fewer points of malfunction in the locking mechanism as well as a lower cost in manufacturing because of fewer , less complex internal components . it will be appreciated that details of the foregoing embodiments , given for purposes of illustration , are not to be construed as limiting the scope of this invention . although several embodiments of this invention have been described in detail above , those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiments without materially departing from the novel teachings and advantages of this invention . accordingly , all such modifications are intended to be included within the scope of this invention , which is defined in the following claims and all equivalents thereto . further , it is recognized that many embodiments may be conceived that do not achieve all of the advantages of some embodiments , particularly of the preferred embodiments , yet the absence of a particular advantage shall not be construed to necessarily mean that such an embodiment is outside the scope of the present invention . | 0 |
illustrative embodiments of the system of the present disclosure are described below . in the interest of clarity , all features of an actual implementation may not be described in this specification . it will of course be appreciated that in the development of any such actual embodiment , numerous implementation - specific decisions must be made to achieve the developer &# 39 ; s specific goals , such as compliance with system - related and business - related constraints , which will vary from one implementation to another . moreover , it will be appreciated that such a development effort might be complex and time - consuming but would nevertheless be a routine undertaking for those of ordinary skill in the art having the benefit of this disclosure . in the specification , reference may be made to the spatial relationships between various components and to the spatial orientation of various aspects of components as the devices are depicted in the attached drawings . however , as will be recognized by those skilled in the art after a complete reading of the present disclosure , the devices , members , apparatuses , etc . described herein may be positioned in any desired orientation . thus , the use of terms such as “ above ,” “ below ,” “ upper ,” “ lower ,” or other like terms to describe a spatial relationship between various components or to describe the spatial orientation of aspects of such components should be understood to describe a relative relationship between the components or a spatial orientation of aspects of such components , respectively , as the device described herein may be oriented in any desired direction . referring to fig1 in the drawings , a rotorcraft 102 is illustrated . rotorcraft 102 has a rotor system 101 with a plurality of rotor blades 103 . rotorcraft 102 further includes a fuselage 104 , landing gear 106 , and an empennage 108 . a main rotor control system can be used to selectively control the pitch of each rotor blade 103 in order to selectively control direction , thrust , and lift of rotorcraft 102 . it should be appreciated that even though the system of the present application is depicted on a rotorcraft 102 having certain illustrated features , it should be appreciated that the system of the present application can be implemented on other aircraft and aircraft configurations , as one of ordinary skill in the art would fully appreciate having the benefit of this disclosure . referring to fig2 , rotor hub 101 includes a plurality of rotor blades 103 coupled to a central yoke 109 , via a rotor grip 107 . yoke 109 is coupled to a rotor mast 105 such that rotation of rotor mast 105 , in a direction 113 , causes the yoke 109 and rotor blades 103 to rotate about the rotor mast axis of rotation . it should be appreciated that even though rotor hub 101 is illustrated with four rotor blades 103 , the system of the present application is equally applicable to rotor hubs having an alternative number of rotor blades 103 . referring now also to fig3 - 6 , an electrical wiring system 301 is illustrated . system 301 is configured for the routing of electrical lines in a dynamic environment . in the illustrated embodiment , system 301 includes a wiring harness 303 a routed between a powered unit 305 and a connector 313 a . system 301 further includes a connector 313 b and wiring harness 303 b . one feature of system 301 is a contoured recess 307 in a cap member 311 located at the root end of spar 309 . in the illustrated embodiment , spar 309 is a partially hollow member ; however , cap member 311 functions in part to seal off the interior portion of spar 309 . connectors 313 a and 313 b allows the wiring harness 303 a to be routed in the interior of rotor blade 103 to powered unit 305 , thus protecting harness 303 a from damage . in the illustrated embodiment , powered unit 305 is a de - icing heater blanket ; however , it should be appreciated that powered unit 305 can be any power consuming device , such as a light , an actuator for a moveable airfoil , or a vibration reduction system , to name a few examples . further , harnesses 303 a and 303 b can alternatively be hydraulic hoses instead of power wire harnesses . further , harnesses 303 a and 303 b can provide a data or control signal in addition or in lieu of providing power . for example , harnesses 303 a and 303 b can provide hydraulic power to a hydraulic actuator in rotor blade 103 . harness 303 b can be secured with one or more harness clips located within recess 307 . recess 307 forms a contoured radius along the chordwise direction at the root end portion of cap member 311 . recess 307 and harness 303 b are configured such that an operationally generated centrifugal force 315 acts to position a slack portion of harness 303 b into the trailing edge side of recess 307 . a slack portion of harness 303 b can be necessary to compensate for all the flap , lead / lag , and pitch motions of rotor blade 103 . in the illustrated embodiment , the harness 303 b is routed away from the body of the rotor blade 103 toward a lead / lag damper 317 ; however , it should be appreciated that an alternative embodiment may not include lead / lag damper 317 . harness 303 b is routed along the axis of lead / lag damper 317 , and further extends back towards the axis of rotation . a loop or slack in the harness 303 b can be implemented where the lead / lag damper 317 joins yoke 109 , allowing for relative motion therebetween . system 301 is configured to minimize aerodynamic drag penalties that may otherwise be associated with conventional harness routing . further , system 301 allows connectors 313 a and 313 b , and its terminals , to be enclosed in recess 307 of blade 103 , away from potential environmental damage . further , potential manufacturing damage to harness 303 a is reduced by reducing the exposed amount of harness 303 a . further , coupling harness 303 b to the blade portion harness 303 a at connectors 313 a and 313 b reduces damage to may otherwise occur to conventional wire attachments that are susceptible to fatigue induced breakage . connector 313 a is mounted on a wall 321 near a leading edge portion of recess 307 . wall 321 can be a flat surface suitable for mounting connector 313 a . in the illustrated embodiment , wall 321 is approximately normal to an inner surface of recess 307 such that the harness 303 b is directed inboard toward the rotor mast until approximately reaching a centerline 100 of the root end , in which recess 307 is contoured in an outboard direction until reaching the trailing edge termination . this trailing edge portion of recess 307 provides a secure housing for the slack portion of harness 303 b as centrifugal forces acts upon harness 303 b . in the illustrated embodiment , rotor blade 103 is coupled to rotor grip 107 with bolts 319 a and 319 b . it can be particularly desirable to fold and stow rotor blades 103 . system 301 is configured to allow folding of rotor blade 103 without having to disconnect connectors 313 a and 313 b from each other . for example , bolt 319 b can be removed such that rotor blade 103 is allowed to rotate about bolt 319 a in a rotation r 1 . in such a configuration , when rotor blade 103 is rotated towards its leading edge , slack in harness 303 b is generated and allowed to build within recess 307 . such a configuration of system 301 saves time and maintenance costs associated with disconnecting a harness for rotor blade folding . the particular embodiments disclosed herein are illustrative only , as the system may be modified and practiced in different but equivalent manners apparent to those skilled in the art having the benefit of the teachings herein . modifications , additions , or omissions may be made to the system described herein without departing from the scope of the invention . the components of the system may be integrated or separated . moreover , the operations of the system may be performed by more , fewer , or other components . furthermore , no limitations are intended to the details of construction or design herein shown , other than as described in the claims below . it is therefore evident that the particular embodiments disclosed above may be altered or modified and all such variations are considered within the scope and spirit of the disclosure . accordingly , the protection sought herein is as set forth in the claims below . to aid the patent office , and any readers of any patent issued on this application in interpreting the claims appended hereto , applicants wish to note that they do not intend any of the appended claims to invoke paragraph 6 of 35 u . s . c . § 112 as it exists on the date of filing hereof unless the words “ means for ” or “ step for ” are explicitly used in the particular claim . | 1 |
while the invention is susceptible of various modifications and alternative constructions , certain illustrated embodiments thereof have been shown in the drawings and will be described below in detail . it should be understood , however , that there is no intention to limit the invention to the specific form disclosed , but , on the contrary , the invention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention as defined in the claims . the present invention includes an engineered lumber unit , a method of making said engineered lumber unit , and a wall made of said engineered lumber units . other embodiments of the present invention likewise exist and are considered within the disclosure herein . referring initially to fig1 , shown is one embodiment of the present invention . fig1 shows the formation of one embodiment of an engineered lumber stud 10 . this embodiment &# 39 ; s engineered lumber stud 10 created by first creating or providing a panel body 12 . this panel body 12 comprising a first structural skin 14 and a second structural skin 18 , said skins preferably comprised of oriented strand board ( osb ). other skins other than osb can be used , including but not limited to sheetrock . the preferred thickness of the osb is 7 / 16 ″, however other sizes of osb ( and other materials such a sheetrock , cement board , etc . ), including but not limited to ⅜ ″, ⅝ ″, and ¾ ″ may be used . the osb serves ( among other things ) like a lumber stud , to serve as a location to attach pictures , etc . the osb could likewise be replaced by cement , board , plywood , metal , mineral , plastic , dimensional lumber , etc . a foam core 16 , preferably of expanded polystyrene ( eps ), is injected or otherwise adhered there between thereby forming the aforementioned panel body 12 . while a foam core is preferred , other types of material can likewise be utilized . other types of panel bodies exist in the prior art , namely current sip wall panels , these sip wall panel bodies likewise could be cut into the invented engineered studs . in the preferred construction , the structural skins are placed within a jig and the eps is injected into the cavity defined there - between . the eps adhering to both of the structural skins , thereby forming a integrated wall panel . the eps serving , among other things , as a spacer , spacing the structural skins apart . referring still to fig1 , this embodiment of the invented stud 10 of the present invention is manufactured by taking such a panel body 12 ( including a preformed sip panel ) and cutting it into at least one engineered lumber stud 10 . each of these lumber studs 10 having a width 20 and a depth 22 . it is preferred that the depth 22 be greater than the width 20 . the resulting engineered lumber stud 10 having a first structural skin 114 , a foam core 116 , and a second structural skin 118 . the resulting engineered stud can be of any size and shape so created by its manufacturer , however it is envisioned that studs having a width of 1 . 50 inches and a depth of 3 . 50 inches , forming a generally right rectangular parallelepiped shape . however , other size , shapes , and manufactures are likewise possible . it is preferred that the engineered stud 10 be formed with a first end 46 and a second end 48 . preferably , the first end 46 has defined therein a first channel 42 and the second end 48 has defined therein a second channel 44 . these channels configured for receiving in structural spacers ( fig4 , ## 38 , 40 ) and / or framing plates ( fig3 , ## 24 , 26 , 124 ) for instance a top plate ( s ) and a bottom plate ( s ). in the embodiment shown , the foam core 116 does not extend to the first end 46 or the second end 48 , thereby defining said channels between the respective ends of the first structural skin , the foam core , and the second structural skin . the stud 10 could be formed with the channels therein , the channels could be cut into the stud through removal of excess foam , etc . alternatively , the first structural skin and the second structural skin could be independently cut and joined in a sandwich fashion with the foam core . this foam core itself can be precut , can be formed between the structural skins , etc . such embodiments are less preferred , in that substantial savings in time and labor could be achieved in preparing one panel body from which multiple engineered studs can be cut . referring now to fig2 , shown is one embodiment of a modular wall panel 28 built with the present invention &# 39 ; s engineered studs 10 , 110 . this figure showing studs 10 of the construction shown in fig3 and studs 110 of the construction shown in fig4 . other stud constructions are likewise envisioned . while this figure shows use of two different kinds of stud constructions ( 10 , 110 ), it is unlikely that more than one stud construction type will be used within a particular wall , the diversity shown for illustrative purposes only . the studs 10 , 110 are spaced apart at a predetermined space and attached between one or more top plates 24 , 124 and at least one bottom plate 26 . while the utilization of dimensional lumber for the top and bottom plates is shown , other types and styles of structures can likewise be utilized , including but not limited to the invented engineered studs , other engineered studs , steel studs , etc . the embodiment shown in fig2 utilizes a pair of top plates 24 , 124 and a single bottom plate 26 . it is preferred that the top plate extend ¾ ″ out of the channel . the preferred construction of the wall shown would be done by laying the studs on the floor , installing the top and bottom plate ( s ) thereon ( attaching them to the studs ), and standing said wall up . the attachment of the studs to the plates can be through the usual construction means , including but not limited to nails , screws , adhesives , etc . the studs can be placed a desired distance apart , for instance 24 ″ o . c ., 19 . 2 ″ o . c ., 16 ″ o . c ., 12 ″ o . c ., etc . it is preferred that the studs 10 , 110 ( shown in fig3 - 4 ) additionally comprise conduits 50 ( shown in fig3 - 4 ) for ease of installation of wiring , plumbing , and other subcomponents . for instance , a 1 - ½ ″ horizontal wire chase at 46 ″ and / or a 1 - ½ ″ horizontal wire chase at 16 ″. fig2 shows the utilization of conduits to permit wiring 30 to be easily ( without the use of a drill at the job site ) run through a fabricated wall panel . such conduits are frequently found in sip construction . one novel feature of the present invention is shown in fig2 . the electrical wiring 30 can be looped 34 through the foam of a stud 10 before connecting with an outlet box 32 or other electrical feature . by looping the wiring through the foam , the wiring becomes fixed to the stud , removing the necessity of stapling the wiring to the stud ( as can be found in dimensional lumber walls ). alternatively , a wire or plastic tie 36 could be wrapped around the electrical wiring 30 and attached to the stud 10 before connection with outlet box 32 . referring now to fig3 , shown is one embodiment of an engineered stud 10 of the present invention . this stud 10 having , as discussed before , a first structural skin 114 , a foam core 116 , and a second structural skin 118 . the stud 10 having a first end 46 extending to a second end 48 . the first end 46 defining a first channel 42 and the second end 48 defining a second channel 44 . the first channel 42 receiving therein the top plate ( s ) 24 , 124 . these top plates being preferably affixed to said stud , preferably through fasteners affixed through the first and second structural skins , however other manners of attachment are likewise envisioned . the second channel 44 receiving therein the bottom plate ( s ) 26 . this bottom plate being preferably affixed to said stud through the use of fasteners affixed through the first and second structural skins . however , other manners of attachment can likewise be utilized . a conduit 50 is likewise provided in or through the foam core 116 . in such a configuration , typically , figuring that the first and second skins are each 7 / 16 ″ thick , and the foam core is 3 . 5 ″ thick , the resulting engineered stud has a depth 22 of 4 - ⅜ ″. obviously , other dimensions and depths are included within the present invention , this depth illustrative only . referring now to fig4 , shown is another embodiment of an engineered stud 110 of the present invention . this stud 110 having , as discussed before , a first structural skin 114 , a foam core 116 , and a second structural skin 118 . the stud 110 having a first end 46 extending to a second end 48 . the first end 46 defining a first channel 42 and the second end 48 defining a second channel 44 . the first channel 42 receiving therein at least one top spacer 38 , this spacer preferably comprising a 1 - ⅛ ″× 2 - ⅝ ″ piece of osb . this spacer serving as a nailer for the 2 × 4 top and bottom top plates , this spacer could be comprised of other thicknesses ( other than 1 - ⅛ ″), for instance , 7 / 16 ″, ⅝ ″, ¾ ″, ⅞ ″, and could obviously be comprised of other materials , including but not limited to plywood , dimensional lumber , metal , and plastic . this spacer affixed therein , preferably through fasteners affixed through the first and second structural skins , however other manners of attachment are likewise envisioned . the top plates 24 , 124 would then be affixed to the top spacer 38 . the second channel 44 receiving therein at least one bottom spacer 40 , this spacer preferably comprising a 1 - ⅛ ″× 2 - ⅝ ″ piece of osb . this spacer affixed therein , preferably through fasteners affixed through the first and second structural skins . however , other manners of attachment are likewise envisioned . the top plates 24 , 124 would then be affixed to the top spacer 38 . a conduit 50 is likewise provided in or through the foam core 116 . in such a configuration , typically , figuring that the first and second skins are each 7 / 16 ″ thick , and the foam core is 2 - ⅝ ″ thick , the resulting engineered stud has a depth 22 of 3 - ½ ″ ( the depth of a typical interior wall framed in dimensional lumber ). obviously , other dimensions and depths are included within the present invention , this depth illustrative only . referring now to fig5 , shown is another embodiment of an engineered stud 210 of the present invention . this stud 210 having , similar to what was discussed before , a first structural skin 214 , a foam core 216 , and a second structural skin 218 . a conduit 250 is provided in or through the foam core 216 . the stud 210 having a first end 246 extending to a second end 248 . the first end 246 defining a first channel 242 and the second end 248 defining a second channel 244 . the first channel 242 receiving therein at least one top spacer 238 , this spacer 238 preferably comprising a 2 ″× 4 ″ piece of dimensional lumber that has had a pair of channels or notches dado cut along the lumber &# 39 ; s longitudinal axis . these notches configured for receiving the ends of the first structural skin 214 and second structural skin 218 . this spacer 238 serving as a nailer for the 2 ″× 4 ″ top plate 224 and / or the bottom plate ( not shown ). while it is preferred that the spacer be comprised of a modified 2 ″× 4 ″, other manners and methods of construction are likewise possible . this spacer affixed therein , preferably through fasteners affixed through the first and second structural skins , however other manners of attachment are likewise envisioned , including but not limited to adhesives . the second channel 244 receiving therein at least one bottom spacer 240 , this spacer 240 preferably comprising a 2 ″× 4 ″ piece of dimensional lumber that has had a pair of channels or notches dado cut along the lumber &# 39 ; s longitudinal axis . these notches configured for receiving the ends of the first structural skin 214 and second structural skin 218 . this spacer 240 affixed therein , preferably through fasteners affixed through the first and second structural skins . however , other manners of attachment are likewise envisioned . in such a configuration , typically , figuring that the first and second skins are each ¾ ″ thick , and the foam core is 2 ″ thick , the resulting engineered stud has a depth 222 of 3 - ½ ″ ( the depth of a typical interior wall framed in dimensional lumber ). obviously , other dimensions and depths are included within the present invention , this depth illustrative only . while the present invention is preferably utilized as an interior wall , finished with sheetrock or other surface , it is likewise envisioned , although not preferred , that the present invention could be used as an exterior wall , or other building component . while it is preferred that the invented wall panel be built on the job site , it is expressly envisioned that the wall panel could be build off site , even finished ( sheetrock and / or paint , etc .) off site before installation at the job site . a problem with such off site construction is in protecting the finished panels from damage and wear in transit to the job site , the absence of such a problem is one benefit to building the studs on site . the resulting wall is square , plum , and easy to wire . the invented studs , due to their construction , do not warp or twist , are straight and light weight . these studs likewise being easier to sheetrock , are made of readily available materials , and are more environmentally friendly than using traditional dimensional lumber . while there is shown and described the present preferred embodiment of the invention , it is to be distinctly understood that this invention is not limited thereto but may be variously embodied to practice within the scope of the following claims . from the foregoing description , it will be apparent that various changes may be made without departing from the spirit and scope of the invention as defined by the following claims . | 4 |
the following detailed description is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary or the following detailed description . as used herein , the word “ wheel ” whether singular or plural is intended to be inclusive of the tire mounted thereon . for example , reference to data from a particular wheel is understood to include the desired information about the tire mounted thereon . further the words “ receiver ” and “ transmitter ” or “ sender ” are not intended to be limited merely to signal incoming and outgoing functions , respectively , but are intended to include the meaning of “ transceiver ” that is , be capable of two - way wireless communication as the need arises . for convenience of explanation , it is assumed for purposes of the present invention that the learning mode has been completed and that each wheel is capable of transmitting its individual id and its relevant function codes that define the wheel location on the vehicle and the wheel status , e . g ., tire pressure , temperature , and so forth . the exact nature of the status information being transmitted by each wheel is not important to the present invention . fig2 is a simplified schematic diagram of five vehicle wheels 10 a – 10 e interacting with on - board vehicle electronics system 20 comprising wheel data receiver 14 and data - processing sub - system 30 , for monitoring wheel id , location and status , according to the present invention . rf signals 18 a – 18 e are transmitted by senders 11 a – 11 e of individual wheels 10 a – 10 e and received by on - board antenna 15 and receiver 14 . the learning mode is presumed to be complete so that signals 18 a – 18 e contain for each wheel , at least the wheel id , location and status information . for convenience of explanation , reference number 10 is intended to refer to any and all of wheels 10 a – 10 e , reference number 11 is intended to refer to any and all of senders or transmitters 11 a – 11 e and reference number 18 is intended to refer to any and all of signals 18 a – 18 e . further , for convenience of explanation and not intended to be limiting , signals 18 are referred to as comprising id and “ function code ” information where the functions codes carry the status information ( e . g ., temperature , pressure , rotating or stationary , etc .). receiver 14 demodulates signals 18 and sends the id and function code information for each sending wheel to processor 16 via leads or bus 17 . sub - system 30 further comprises speed sensor 24 , display 22 and memory 28 , coupled to processor 16 via leads or buses 23 , 21 , 25 , respectively . processor 16 desirably but not essentially includes timer or timing function 26 . timing function 26 may be a software timer or a hardware timer as a part of processor 16 or separate from processor 16 . either arrangement is useful . the learning process is presumed to have been already accomplished according to arrangements described in the prior art ( e . g ., using individual wheel well transmitters sending location info to the wheel electronics ) and each particular wheel id has been associated with a wheel location , e . g ., left front ( lf ), right front ( rf ), left rear ( lr ), right rear ( rr ) and spare ( sp ), and that information stored in memory 28 . thus , during routine operation when signal 18 arrives with id and status function codes , processor 16 is able to correlate the wheel id with the wheel locations by retrieving the locations from memory for each wheel id . speed sensor 23 is conveniently included to provide processor 16 with information on the vehicle motion but this is not essential , since in most cases , the function codes received from the individual wheels will include an indication as to whether that wheel is moving or stationary . when a flat has occurred and the spare ( sp ) used to replace the flat tire , unless the learning mode is repeated , the location information stored in memory 28 is no longer correct and should be updated . the process flow in fig3 illustrates how system 20 of the present invention updates the location - id correlation information stored in memory 28 without having to repeat the learn mode process . this is a significant advantage , especially with those automotive electronics systems where manual intervention is needed to initiate a learn mode sequence to correlate wheel ids with altered wheel locations . fig3 is a simplified flow chart illustrating method 100 of the present invention for determining whether the spare tire ( sp ) has been mounted on a rotating wheel ( rw ) position and vice - versa . for convenience of explanation and not intended to be limiting it is assumed that the data transmitted by each wheel and recovered in receiver 14 are assigned to particular fields ( e . g ., time slots ) in the transmitted message , for example , that there is a data field for wheel id , another data field for tire pressure data , a further data field for motion data , and so forth . this is intended to be merely exemplary and any method of encoding and distinguishing the wheel information and function codes may be used . method 100 begins with start 102 that conveniently occurs on power up or at least when the vehicle begins to move as determined by speed sensor 24 or by examining the function codes on any message received from sender 11 . in receive sp sender message step 104 , receiver 14 receives message 18 from sender 11 of the spare ( sp ) wheel , e . g ., wheel 10 e . method 100 then executes sp motion sensor active ? query 106 wherein it is determined whether or not the function codes contained in signal 18 from the spare , e . g ., signal 18 e , show that the spare is rolling or stationary . this may be determined by processor 16 by , for example , comparing the function code received from wheel 10 e in the appropriate ‘ motion ’ field in detected signal 18 e with the function codes for ‘ moving ’ and / or ‘ stationary ’ stored in memory 28 . if the outcome of query 106 is no ( false ), that is , the spare is not moving , then vehicle in motion ? query 108 is executed wherein it is determined whether or not the vehicle is moving . query 108 may be performed , for example , by processor 16 interrogating speed sensor 24 or by any other available means , as for example but not limited to , examining the ‘ motion ’ field codes of signals 18 received from other wheels 10 . if the outcome of query 108 is no ( false ), meaning that the vehicle is not moving , then as shown by path 109 method 100 returns to start 102 and initial query 104 . if the outcome of query 108 is yes ( true ), then method 100 executes initialize usage timer step 110 , wherein timer 26 is set to an initial value , e . g ., zero for a count - up timer and t for a count - down timer or whatever pother value is appropriate depending upon the type of timer used . timer 26 is conveniently used to measure the amount of time that signal 18 e from the spare tire shows that the spare tire is ‘ moving ’. persons of skill in the art will understand that initialize usage timer step 110 refers to setting timer 26 with the initial start value . any type of counter or other timing arrangement may be employed . thus , as used herein , the words “ initialize usage timer ” are intended to include any means of initializing a counter or timer of any type . thereafter , method 100 returns again to start 102 and initial query 104 . returning now to sp motion sensor active ? query 106 , if the outcome of query 106 is yes ( true ) indicating that the spare ( sp ) wheel is moving , e . g ., rotating , then sp usage timer active ? query 112 is executed wherein it is determined whether timer 26 or equivalent measuring how long the spare tire has been rotating , is active or not , i . e ., still measuring motion time for the spare tire . if the outcome of query 112 is no ( false ) then method 100 proceeds to start usage timer step 114 wherein timer 26 or equivalent is started to measure the time during which the spare tire is in motion . thereafter method 100 returns to start 102 and initial query 104 as shown by path 115 . returning now to query 112 , if the outcome of query 112 is yes ( true ) indicating that timer 26 is active ( e . g ., from a prior loop through step 114 ), then method 100 proceeds to sp usage timer expired ? query 116 . if the outcome of query 116 is no ( false ) then method 100 returns to start 102 and initial query 104 as shown by path 117 . during first portion 118 of method 100 , processor 16 has determined that the spare wheel , e . g ., wheel 10 e is in motion and has been in motion for predetermined time duration t measured by timer 26 . steps 104 , 106 , 112 , 116 of portion 118 repeat until either unit 11 e on spare wheel 10 e stops sending signal 18 e indicating that spare wheel 10 e continues in motion or until time t has expired . time duration t is chosen to be greater than those accidental movements of spare tire 10 e as might from time to time occur in the life of the vehicle aside from mounting the spare on a rolling wheel location . about 5 to 60 minutes is suitable for time interval t with about 15 minutes being preferred . system 20 has now logically determined that the spare wheel , e . g ., wheel 10 e , is no longer on the customary spare tire location , since where it still there it would not be in motion for time t . knowing that the spare tire is no longer in its normal position , second portion 120 of method 100 determines where it has probably been placed by determining which of the four other tires is no longer moving . this is accomplished by processor 16 executing some or all of steps 122 – 136 . steps 122 , 126 , 130 , 134 may be executed in any order . for example , processor 16 examines the detected signal received from another of wheels 10 , e . g ., the wheel correlated in memory 28 with the left - front ( lf ) wheel location on the vehicle , by executing lf sender stopped ? query 122 . it does this , for example , by examining the ‘ motion ’ field code in the detected signal for that wheel . if the outcome of query 122 is yes ( true ) indicating that that wheel is not moving , then in step 124 , processor 16 swaps the sp and lf sender ids in memory 28 so that the id for the spare is now correlated with the lf wheel location , and the id for the lf wheel is now correlated with the sp location . following step 124 , then as shown by path 125 , method 100 returns to start 102 and initial query 104 . if the outcome of query 122 is no , them method 100 performs the same test on another wheel location , e . g ., rf sender stopped ? query 126 . if the outcome of query 126 is yes ( true ) indicating that that wheel is not moving , then in step 128 , processor 16 swaps the sp and rf sender ids in memory 28 so that the id for the spare is now correlated with the rf wheel location , and the id for the rf wheel is now correlated with the sp location . following step 128 , then as shown by path 129 , method 100 returns to start 102 and initial query 104 . if the outcome of query 126 is no , them method 100 performs the same test on another wheel location , e . g ., rr sender stopped ? query 130 . if the outcome of query 130 is yes ( true ) indicating that that wheel is not moving , then in step 132 , processor 16 swaps the sp and rr sender ids in memory 28 so that the id for the spare is now correlated with the rr wheel location , and the id for the rr wheel is now correlated with the sp location . following step 132 , then as shown by path 133 , method 100 returns to start 102 and initial query 104 . if the outcome of query 130 is no , them method 100 performs the same test on another wheel location , e . g ., lr sender stopped ? query 134 . if the outcome of query 134 is yes ( true ) indicating that that wheel is not moving , then in step 136 , processor 16 swaps the sp and lr sender ids in memory 28 so that the id for the spare is now correlated with the lr wheel location , and the id for the lr wheel is now correlated with the sp location . if the outcome of query 134 is no , them method 100 conveniently but not essentially proceeds to set alarm step 138 wherein for example , processor 16 causes display 22 to indicate that a malfunction condition has occurred , since an ‘ in motion ’ outcome from all wheels including the spare indicates a malfunction in a vehicle with only four rolling wheels . nevertheless , step 138 is not essential and in place of or following step 138 , method 100 returns to start 102 and initial query 104 . those of skill in the art will appreciate that method 100 can include providing on display 22 a wheel status indication after any of steps 124 , 128 , 132 , 136 , 138 or any other step where such indication would be useful to the driver . while steps 120 are described in terms of swapping in memory 28 the sp id with the id of whichever of lr , rf , rr , lr wheel positions is not moving , this is merely one way of correcting the wheel id - wheel location correlation information stored in memory 28 and is not intended to be limiting . persons of skill in the art will understand based on the description herein that any way of correcting the wheel id - wheel location correlation information may be used . what is important is that after method 100 is executed , the wheel ids associated with the various wheel locations are correct , even though a new learn mode has not been executed . the present method does not depend upon re - executing a learn mode , but deduces the current wheel locations by executing method 100 . the wheel id versus wheel location information stored in memory 28 is updated to accurately reflect the current situation . thus , as used herein , the words “ swap sp & amp ; lf / rf / rr / lr sender id locations ” are intended to encompass these alternative methods of correcting the wheel id versus wheel location information stored in memory 28 or equivalent . it will also be noted that if no tire rotation - replacement has occurred , method 100 leaves the wheel id versus wheel location information in memory 28 unchanged . fig1 – 3 depict the situation for a vehicle with four rolling wheels and one spare , for a total of five wheels . however , persons of skill in the art will understand that the present invention applies to a vehicle with any number of rolling wheels more or less than four . thus , in the general case , the present invention applies to vehicles with two or more rolling wheels . the present invention is useful even when there are multiple spares provided that both are not changed at the same time . for example , in a vehicle with multiple spares , if one spare is swapped for a previously rolling wheel , e . g ., because of a flat on that previously rolling wheel location , then method 100 corrects the wheel id versus wheel location data stored in memory 28 for that post - flat situation . if subsequently , a further rolling wheel goes flat ( e . g ., in the same or another rolling wheel location ) and a second spare is mounted in place of the new flat , then method 100 once again unequivocally corrects the wheel id versus wheel location data in memory 28 . it does not matter how many spare wheels there are nor how many rolling wheels there are on the vehicle nor how many flats occur , method 100 will correct the wheel id versus wheel location information without uncertainty as long as two or more previously rolling wheels are not replaced at the same time . this is a significant advantage , particularly with vehicles having larger numbers of rolling wheels and spares . when multiple spares are present , steps 118 , 120 are repeated for each spare . when two ( or more ) flats occur at the same time and , for example , two spares are mounted at the same time before the vehicle resumes normal operation , method 100 can still determine useful information : specifically , that both simultaneously mounted spares are rolling and that two of the previously rolling wheels are now in the spare positions , but cannot determine unequivocally which spare has gone into which of the two replaced rolling wheel positions . thus , the spare wheel ids can be in either of two replaced rolling wheel locations , but not elsewhere . this information while not completely precise is useful because it can alert the driver to the fact that two spares are now rolling in either of two wheel locations . the larger the number of wheels on the vehicle , the more useful this information . when multiple spares are changed , steps 118 , 120 are repeated for each spare . where the multiple spares are mounted sequentially , then method 100 determines the spare locations exactly . where two spares are mounted at the same time , then , on a first pass , method 100 will swap the id of the first spare with the id of the first location in steps 122 , 126 , 130 , 134 leading to one of steps 124 , 128 , 132 , 136 , and on a second pass it will swap the id of the second spare with the next location in steps 122 , 126 , 130 , 134 leading to one of steps 124 , 128 , 132 , 136 . however , it cannot tell unequivocally which of the two newly mounted spares is in which of the two replaced rolling wheel position , but can tell that these spares are not on other rolling wheel positions . while at least one exemplary embodiment has been presented in the foregoing detailed description , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing the exemplary embodiment or exemplary embodiments . it should be understood that various changes can be made in the function and arrangement of elements without departing from the scope of the invention as set forth in the appended claims and the legal equivalents thereof . | 1 |
the preferred embodiment of the present invention will now be described in connection with the above - mentioned drawings . refer now to fig1 , which is an overall conceptual drawing of a preferred embodiment of the “ hitch - mounted fold - out camper ”, hereafter referred to as the “ camper ”, in its folded , covered state . here we can see the compacted “ camper ” [ fig1 ( 1 )] covered with a weather - proof cover [ fig1 ( 2 )]. a preferred cover , due to its light weight , would be vinyl but any lightweight , weather proof , material including hard - sided material could be used . in this case the “ camper ” is mounted on an extended hitch - arm [ fig1 ( 3 ) and fig1 ( 3 )] with an additional rear hitch receiver [ fig1 ( 4 ) and fig1 ( 4 )]. a regular 2 inch hitch arm utilizing a 2 - inch , ¼ inch walls , square pipe ( class 3 hitch ) will allow a 1 . 5 - inch hitch - arm to be fitted inside said 2 inch arm , creating a class 2 hitch [ fig1 ( 5 )], enough to tow a mid - size trailer / boat . fig2 is a conceptual drawing of a preferred embodiment of the “ camper ” in its unfolded , for camping , usable state . in this case the unit is still connected to the car but it could very well be unhooked as an independent camper by pulling the pin [ fig1 ( 7 )] holding the hitch - arm to the vehicle &# 39 ; s hitch - receiver [ fig1 ( 8 )]. as the unit is totally supported by the ground with its adjustable fold - out legs [ fig2 ( 9 )] there is no need to keep it attached to the vehicle . fig1 show a close - up of the “ height - adjustable fold - out legs ”, hereafter referred to as the “ legs ”, with its lockable support arm ( 6 ) and adjustable inner tube ( 34 ). fig3 is a cut - away drawing of the basic concept to better illustrate the invention . in basic terms , the unit is comprised of one or more floor board [ fig3 ( 10 )] with at least one of them attached to the vehicle &# 39 ; s receiver . in this case the forward floor board [ fig3 ( 10 )] , from here on referred to as the “ base - plate ”, is mounted to the vehicles hitch - arm [ fig1 ( 3 )] . to this “ base - plate ” are possibly one or more floor - boards attachedreleasably attached floor - boards . in this sample three additional floor - boards [ fig3 ( 12 )( 13 )( 14 )] . they are in turn connected with the means of quick - release hinges [ fig1 ( 15 ) with detailed drawing [ fig1 ] , so as to be able to unfold the said floor - boards into a largely flat surface ( floor ) supported to the ground with the “ legs ” [ fig1 ] . around the peripheral of this “ floor ” is an easily erected tent enclosure [ fig3 ( 16 )] semi - permanently , by means of readily available canvas - snaps , mounted to create a living space while unfolded . optionally , as shown in fig3 , the floor can be wholly or partly covered by semi - permanently installed mattresses [ fig3 ( 17 )] . the “ camper ” is designed to be able to hold each and all of the bedding equipment as well as the semi permanently mounted tent structure [ fig3 ( 16 )] including its tent poles ( 35 ), both in its folded state [ fig5 ( 35 )] as well as unfolded state [ fig3 ( 35 )] . while not in use as a camper the floor sections can all be disassembled as single floor sections and reassembled in the home to be used as a regular everyday bed or a guest bed . in this sample , floor boards [ fig3 ( 12 )( 13 )( 14 )] can be assembled to create a light - weight king size bed . although the unit can be made in any size , the preferred sizes are , u . s . double , queen and king not counting the base - plate [ fig3 ( 10 )]. the “ base - plate ” is designed to be used for storage , heaters , camping gears and such . for larger trucks and vans a 74 - inch - wide unit allowing two double beds , arranged crosswise to the vehicles travel direction , can be made . in either case this will allow the “ camper ” to use regular form - fitted bedding sheets for the respective size . fig4 illustrates the additional advantage of being able to simultaneously utilize the towing hitch &# 39 ; s normal function , in this case towing a boat . here the optional class 2 hitch [ fig1 ( 5 )] fitted into the extended hitch - arm [ fig1 ( 3 )] was used to connect the trailer to the “ camper ”. refer now to fig5 to 8 for an illustrated step - by - step instruction on how to unfold the “ camper ”. to make the procedure clear the tent canvas has been removed for this demonstration . step 1 . [ fig5 ] remove the cover . the interior of the camper ” can now be seen with , in this case , the folded mattresses ( 17 ) and tent poles ( 35 ). step 2 . unfold the “ legs ” ( 9 ) on the rear vertical floor board ( 12 ) and swing the unit backward until the “ legs ” rest on the ground as in ( fig6 ). step 4 . do the same with floor board ( 13 ) and lower it to the ground . [ fig7 ]. step 5 . again do the same with floor board [ fig8 ( 14 )]. in case a foldable mattress is used it can now be flipped [ fig7 ( 19 )] into place . the only thing left at this point is to erect the normally attached tent . again for this demonstration the tent canvas has not been shown to make the demonstration clear although the steps with the canvas attached are the same . while in its folded state the whole unit can be folded back , as illustrated in [ fig9 ], to be able to access the vehicle &# 39 ; s back door . this is accomplished by adding a hinged swing arm [ fig1 ( 20 )] to each side of the extended hitch - arm [ fig1 ( 3 )] with a rear pivot point [ fig1 ( 21 )]. by pulling the forward pin [ fig1 ( 22 )] the compacted , folded , “ camper ” can swing back as a unit [ fig9 ] and thereby allow easy access to the rear of the vehicle . fig1 shows the framework for the “ camper ” as well as the suggested hardware used in the assembly . the frame ( 23 ) is preferably made of lightweight aluminum covered by any light - weight material , solid or soft , such as plywood or stretched canvas [ fig3 ( 10 )]. each fold - out frame has at least two “ legs ” ( 9 ), detailed in fig1 . it also illustrates the locations of the quick release hinges between the fold - out sections [ fig1 ( 15 )]. a detailed illustration of the hinges can be found in fig1 . as seen on this partially cut - away drawing [ fig1 ] of the quick - release hinge , the two sections a and b can be easily separated by pressing the two release levels ( 24 ) compressing the spring ( 26 ). this forces the two hinge pins ( 25 ) to pull out of the two hinge sections ( 27 ) attached to section a , thereby disconnecting the two floor sections . this will allow for quick assembly as well as disassembly of the unit , breaking it down to smaller , light - weight , floor boards that can be easily handled , stored as flat units , or used as a regular bed by reassembling the sections in the home . to prevent the floor sections from folding beyond 90 degrees while folding the unit and to make the unit more rigid while folded , each section also contains an angulation limiting device ( 28 ) detailed in fig1 and 14 . this angulation device is comprised of a tube ( 29 ) and a rod ( 30 ) inserted to each other and attached in one end of each rod / tube to a hinge - bracket ( 31 ) which in turn is fixed to the frames for the floor - boards . the length of the rod is so designed as to reach the tube &# 39 ; s hinge pin ( 32 ) when the two sections reach an angle of 90 degrees preventing further angulation . although not a required addition , it greatly helps in handling the unit . fig1 illustrates the use of an optical rear light - bar / license plate holder ( 33 ) inserted into the rear end of the extended hitch - arm ( 3 ). this is only needed in case the folded “ camper ” would cover the vehicles rear lights or license plate . the electrical hookup to the vehicle is made by using the regular trailer light outlet just like a trailer . this light bar could in addition be outfitted with a tow hitch as illustrated in fig1 ( 5 ). fig1 ( 3 ) is a perspective view of a preferred extended hitch - arm that the “ camper ” is resting on . the rear end of the extended hitch arm ( 4 ) with its square hole ( hitch receiver ) can also be seen . this “ receiver ’ will allow for an optional hitch arm / ball - holder and / or the previously mentioned light - bar ( 33 ) to be fitted to said extended hitch - arm . the forgoing description of the preferred embodiment of the invention has been presented for the purpose of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the above teaching . it is intended that the scope of the invention be limited not only by this detailed description , but rather by the claims appended hereto . | 4 |
having reference to the drawings , wherein like reference characters designate identical or corresponding parts throughout the different views , and more particularly to fig1 thereof , one embodiment of an improved machine safety guard arrangement , 4 , is shown in its relation to a drop hammer machine 5 . equipment of the latter type occasions a distinctive risk possibility , inasmuch as it involves a movable work - forming member , 6 , which must at times be permitted to travel essentially unchecked , if it is to perform its intended functions , and which is then unfortunately in a condition to cause harm in the unlikely event that an operator or some foreign object should somehow come in contact with it . the specific form which the movable member 5 takes in the case of the illustrated pneumatic drop - hammer machine is that of a massive weight or &# 34 ; hammer &# 34 ; which has its vertical movements guided by two stationary columns 7 and 8 which extend upright from above a work table surface 9 atop a base or anvil 10 . an operator controls such a machine from its front , 11 , where there may be a seat 12 , and from that position may cause the hammer 6 to be raised relatively slowly in a known manner by compressed air forced into a piston - cylinder unit 13 so as to lift the piston rod 14 and the depending weight 6 . for that purpose , the work table mounts at the right a pneumatic control handle 15 fixed with a upright control shaft 16 leading upwardly to the pneumatic control valving 17 fed from the compressed - air line 18 . the handle must be pushed in direction away from the operator to cut off the air supply to unit 13 , and , when that is done , the hammer 6 is no longer restrained from free fall by the air supply . however , unless the operator also pushes a second control lever , 19 , at the left , in direction away , the hammer 6 will remain elevated by virtue of its being caught upon the known form of mechanical stop or so - called &# 34 ; safety - dog &# 34 ; 20 fixed with the upright shaft 21 . typically , such known control levers , 15 and 19 , must be turned about 45 to 60 degrees , by the operator , to free the weight for its intended work - forming fall , and , preferably , unless the operator continues to push those levers in opposite directions laterally away , they are automatically urged back to the positions where they respectively cause air pressure to keep the hammer raised and cause the safety dog to be interposed as a mechanical stop against fall of the hammer . spring 22 may serve that angular - return function for shaft 21 , for example . in addition , a known further safety for such a machine includes an air - safety dog or trigger unit 23 , and , if for any reason the hammer should unintentionally commence its drop without the operator having first pushed handle 15 to cause that drop , the unit 23 will be engaged by the hammer and will in turn trigger a supply of compressed air into unit 13 which attempts to raise it and halt its descent . the raising and dropping of weight 6 is for forming purposes , such as the striking of design or ornamentation onto precut blanks of metal , and cooperating male and female dies 24 and 25 which effect that result are disposed atop the anvil table 9 and at a lower end of the movable weight 6 , respectively . an operator working at such a machine normally confronts it in a conditon wherein the weight has been raised and is so being maintained . any previously - struck piece in die 24 is anually removed and an unstruck blank inserted in its place , after which the operator &# 39 ; s left and right hands are placed upon the levers 19 and 15 , which normally are self - turned inwardly , and those levers are then simultaneously pushed outwardly away from the operator to effect cut - off of the supply to unit 13 and displacement of safety dog 20 to an out - of - the - way position , whereupon the hammer free - falls to forcefully close the dies about the blank . release of the levers allows them to turn back inwardly , such that the weight is again raised by the compressed air , the safety - dog again occupies a stopping position , and the dies are parted , to allow another such operating cycle to occur . the region between the operator and the opening - and - closing dies is one which could become a danger zone if , somehow , an operator were to improperly push control lever 15 but release lever 15 and very swiftly and improvidently move a hand or object to the zone of closure where the falling weight is about to strike . accordingly , that region is temporarily blocked , at all critical times , by a broad - area mechanical guard membrer 26 which is interposed on anvil table 9 in front of the operator position and which is pivotably mounted on a stanchion 27 for limited angular movements between a first substantially horizontal position where it blocks the said zone of closure , as characterized by dashed linework 26 &# 39 ;, and a second relatively elevated and out - of - the - way position , as illustrated in full linework in fig1 wherein it does not block that zone . the actuations of the guard member into the aforesaid first blocking and protective position cannot be left to any choice or chance if the intended safeguards are to be realized , and , on that account , the guard member 26 is mechanically linked in a secure slaved relationship with one of the control levers , preferably the lever 19 associated with safety - dog shaft 21 , which establishes that the lever will not free the weight to drop unless the lever movement which does so has also first physically displaced the guard member into its protective position . details of the aforementioned type of linkage appear in fig2 and 3 , and it will be observed there that the guard - member pivoting between the first or &# 34 ; blocking &# 34 ; position , as shown in fig3 and the second or out - of - the - way position , as shown in fig2 as well as fig1 takes place about the horizontal axis 28 -- 28 of a shaft 29 mounted near the top of the stanchion 27 . member 26 must be able to withstand rigorous usage and should therefore be of an appropriately sturdy heavy construction ; in turn , even though it may have numerous openings therethrough , as illustrated , it can be expected to exhibit enough mass and inertia to warrant the use of a counterbalancing weight , 30 , at the opposite end of its support about pivot shaft 29 , on cross - arm 31 . for proper operation , the tendency of safety - dog shaft 21 to turn normally in the direction of arrow 32 , clockwise about its vertical axis 33 -- 33 in fig2 as urged by a spring or the like , should be consistent with a normal out - of - the - way positioning of guard member 26 , and that tendency is in fact exploited by way of a yoke - like crank arm 34 angularly movable with shaft 21 and forcing a longitudinally - reciprocatable member 35 to crank the cross - arm 31 counterclockwise about axis 28 -- 28 . to implement those purposes , the wrist pin 36 of crank arm 34 is fitted within a transverse slot or slide 37 of member 35 , and , at its opposite end , the member 35 carries a transverse wrist pin 38 fitted within a slot or slide 39 in a part of cross - arm 31 which is suitably displaced radially about its pivot axis 28 -- 28 and can therefore help develop a desirably large turning moment for positioning the guard member . upon the operator &# 39 ; s pushing the control lever 19 away and in the opposite , clockwise , direction about axis 33 -- 33 , the crank arm 34 must turn with it , pulling the slide 37 and member 35 to the left , and thereby causing the pin 38 to force a turning of cross arm 31 clockwise about its pivot axis 28 -- 28 , via its slide coupling 39 . by the time the control lever has reached the point in its turning when its attached safety - dog or catch 20 ( fig1 ) becomes clear of the elevated weight and will allow it to drop , the guard member will thus have necessarily been forced into its horizontal protective position ( fig3 ) blocking the danger zone , and it protects the operator . the illustrated linkage involving mutually - perpendicular wrist pins and slides or slots ( 36 , 37 and 38 , 39 ) achieves a difficult translation of cranking motions from about a vertical axis to about a laterally - spaced horizontal axis , and it affords mechanical freedom or play which prevents the parts from binding or catching which might impair system operation . in other arrangements , the couplings might be specifically different , so long as the results are of like advantage and effect . guard - member configurations may be modified to complement other machines with which they may be used , and foot - operated or power - actuated control shafts may be utilized in place of a control lever , and the guard mechanism may of course be oriented somewhat differently but with like improvement of operator safety . it should therefore be understood that the specific embodiments and practices shown and described herein have been presented by way of disclosure rather than limitation , and that various modifications , combinations and substitutions may be effected by those skilled in the art without departure in spirit or scope from this invention in its broader aspects and as set forth in the appended claims . | 8 |
before the description of the present invention proceeds , it is to be noted that like parts are designated by like reference numerals throughout the accompanying drawings . referring now to the drawings , there is shown in fig1 an etching apparatus of si wafer according to a first embodiment of the present invention , which includes isopropanol 1 as liquid soluble with treatment liquid 2 , the treatment liquid 2 employed as an etching liquid for si wafer , rinsing water 3 , a retaining jig 4 ( hereinafter referred to as hanger ) for si wafer , the si wafer 5 as a substrate to be treated , an exhaust port 6 for evacuating gaseous isopropanol or fluorine , and a drain port 7 for draining overflown water 3 . with the above , the experimental , practical method according to the embodiment of the present invention will be described in detailed hereinafter . hot sio 2 films of 3000 å , 10 , 000 å and 20 , 000 å are formed through the various period of treatment time by a pyrogenic method on the face of the si wafer 5 having a diameter of 5 inches and sliced by the crystalline face of ( 1 , 0 , 0 ). thereafter , the photoresistance is applied on the face of si wafer 5 in the thickness of 1 . 2 μm so that many line - shaped patterns lack being 1 . 5 μm in width , 0 . 5 in length , separated by 5 μm are developed on the entire si wafer 5 . the si wafer 5 is dry - etched in sio 2 film by the use of the mixed gas ( pressure 700 m torr ) between chf 3 and c 2 f 6 . thereafter , the photoresistances are removed by the resistance ascha of the oxygen plasma . according to the observation by a microscope , the si wafer 5 , even in the si wafer of any film thickness , provides at this time a hydrophilic sio 2 pattern 22 formed in the rectilinear shape on the hydrophobic si monocrystal 21 as shown in fig2 . on the other hand , the etching liquid 2 of sio 2 including fluoric acid and water having a mixing ratio of 1 : 200 as treatment liquid of the si wafer 5 , and the isopropanol having surface tension of 22 . 9 dyne / cm as liquid soluble with the etching liquid are put separately into a cell in the etchinhg apparatus shown in fig1 . it is to be noted that the isopropanol is normally circulated by a bellows pump and filtered by the filter ( 0 . 1 μm ) made of fluorine - resin film ( not shown ). pure water 3 having specific resistance value of 18 mω · cm as the rinsing water is overflowed from the cell top - portion , normally flowing . after the si wafers 5 formed in the pattern are retained one by one by the hanger 4 and are quietly dipped in the isopropanol 1 for three minutes , they are pulled up from the isopropanol and are dipped in the etching liquid 2 for five minutes . according to the visual observation of the surfaces of the si wafer 5 from the tower upper portion while the si wafer 5 is dipped in the etching liquid , no air bubbles are attached on the si wafers 5 of the film thickness . the si wafers whose etching is finished are spin - dried after the sufficient washing operation with the pure water 3 . according to the microscope observation of the si wafers 5 , whose treatment operation is completed , the sio 2 film is etched and is made smaller in film thickness and width even in any si wafer pattern , with no unevenness on the patterns . on the other hand , as a first comparison embodiment for comparison , the si wafer 5 provides the pattern of the sio 2 film formed through the dry etching to remove the resistance . then , the si wafer is quietly dipped in etching liquid 2 directly without being dipped in the isopropanol 1 . according to the observation the surfaces of the si wafer 5 from the upper portion of the cell , several air bubbles are observed on the surface of the si wafer 5 . the si wafer 5 is dipped for five minutes in the etching liquid 2 , thereafter is dipped sufficiently in pure water 3 , and is spin - dried . then , according to the microscope observation of the surface of the si wafer 5 , the rectilinear pattern is out of shape , the pattern is recognized in which the convex portion 23 non - etched is provided on the end face of sio 2 film . the sio 2 films are observed particularly in the si wafer 5 of 10 , 000 å and 20 , 000 å . this is because the air bubbles are attached when the si wafer 5 is dipped in the etching liquid 2 , and the bubble - attached locations remain without being etched . also , the similar experiments are performed even about n - propanol having surface tension of 25 . 3 dyne / cm , methanol having surface tension of 24 . 0 dyne / cm , ethanol having surface tension of 24 . 1 dyne / cm , acetic acid having surface tension of 29 . 6 dyne / cm , acetone having surface tension of 26 . 3 dyne / cm , acetic methyl having surface tension of 28 dyne / cm , methyl ethyl ketone having surface tension of 26 . 8 dyne / cm , instead of isopropanol as liquid soluble with treatment liquid , but the convex portion 23 non - etched of fig3 is not observed . ( the mixing ratio of each liquid is defined by volume ratio .) the material soluble with the treatment liquid to be used in the present embodiment is required to be properly selected in accordance with the type of the treatment , the properties of the substrate to be treated , the nature of the treatment liquid or the like . as the water treatment liquid is mainly used in the washing or the etching of the si wafer , alcohols such as methanol , ethanol , n - propanol , isopropanol , glycol and so on , ketones such as acetone and so on , carboxylic - acid such as acetic acid and so on , esters such as methyl acetate , ethyl acetate and so on , amines such as ethyl amine and so on , further sulfonic acid , electro - kinetic activator or the like , including the above - described materials used , are provided as the material soluble with the treatment liquid to be used . howerver , in the present invention , the simple substances or mixtures of any substance among them may be used . the methanol , ethanol , ethyl amine , acetic acid , methyl acetate , ethyl acetate , acetone , isopropanol , n - propanol or the like which is small in adsorption ability into the si wafer , is likely to be displaced by the treatment liquid , and is 30 dyne / cm or smaller in surface tension . these materials have a hydrophilic group of 13 oh , & lt ; o , -- cooh , -- coo --, so 3 h or the like and a hydrophobic alkyl group within the molecule . when the si wafer is exposed to the liquid or the steam ( gas ), the hydrophilic group is preferentially adhered on the hydrophilic portion of the si wafer , the hydrophobic group is preferentially adhered on the hydrophobic portion of the si wafer to form an accumulation film so that the entire si wafer is likely to get wet with the hydrophilic treatment liquid or lipophilic treatment liquid . also , as these materials are soluble with the treatment liquid such as water , they are dissolved in the treatment liquid during the treatment , and are decomposed in the treatment liquid . furthermore , the air bubbles are likely to be disconnected from the compound of 30 dyne / cm or less in surface tension with no air bubbles remaining on the si wafer surface . thus , the uniform treatment may be performed without the air bubbles attached on the si wafer so that the si surface is not polluted . furthermore , a method of dipping the si wafer in the liquid material , a method of jetting and spraying the liquid material from the nozzles or the like onto the si wafer retained horizontal or vertical , a method of heating the material soluble with the treatment liquid , or applying ultrasonic waves producing gas to expose the si wafer to the atmosphere , or other methods are available as a method of exposing the si wafer to the material soluble with the treatment liquid . in the present invention , any method may be used . the dipping method is more preferable , because the apparatus is simple and the risk of the gas explosion is small . also , a method of dipping the si wafer in the pure water or jetting the pure water in a shower condition to perform the washing operation is generally used as a method of removing the treatment liquid attached on the si wafer . in order to increase the washing effect , the functions of oscillating the si wafer , causing the bubbling of the ultrasonic waves or the gas in the rinsing cell , or rapidly exchanging the rinsing water are added . in the present invention , any method may be used or the combination of a plurality of methods from them may be used . the present invention may use any method of spin drying , steam drying , blow - off drying or the like as the method of drying the si wafer , or may use the combined method . the above method of the present invention can be applied to the same treating performance even in the sheet - number treatment or the patch treatment independently of the number of the sheets to be treated . the second embodiment of the present invention will be described hereinafter . the isopropanol placed in the glass beaker is dipped in the water bath heated to 100 ° c . to heat the isopropanol to 70 ° c . thereafter , the glass beaker with the isopropanol in it is placed in a covered desiccator . the desiccator is filled with the steam of the isopropanol . on the other hand , in the first embodiment , the pattern of the sio 2 film is formed through the dry etching and the resistances are removed . thereafter , the si wafer 5 of 10 , 000 å in sio 2 film thickness is quietly placed for thirty minutes in the desiccator filled with the isopropanol steam , and is exposed to the isopropanol steam . the si wafer 5 is retained by the hanger 4 of the etching apparatus used in the first embodiment , is dipped for five minutes in the etching liquid 2 including fluoric acid and water with a mixing ratio of 1 : 200 , is washed with the pure water 3 , thereafter is spin dried . the pattern of the si wafer 5 is examined after the drying operation as in the first embodiment , but unevenness caused by a non - etched portion of the sio 2 pattern does not exist . also , the same experiments are performed with the methanol , ethanol as the liquid soluble with the treatment liquid , thus showing the same results . the third embodiment will be described hereinafter . the mixed liquid between ethanol and acetic acid , ( for example , with mixing ratios of ethanol to acetic acid being 6 : 4 , 5 : 5 and 4 : 6 ), the mixed liquid between the ethanol and the water ( for instance , with mixing ratios of ethanol to water being 8 : 2 , 6 : 4 , 5 : 5 and 4 : 6 ), the mixed liquid between the acetic acid and the water ( for instance , with mixing ratios of acetic acid to water being 8 : 2 , 6 : 4 , 5 : 5 and 4 : 6 ), the mixed liquid between isopropyl alcohol and water , for instance , with mixing rations being 6 : 4 , 5 : 5 and 4 : 6 , and the mixed liquid of 1 : 1 between the isopropyl alcohol and ethanol are used as the liquid soluble with the treatment liquid on the etching apparatus used in the first embodiment . the pattern is examined after the etching , washing and drying as in the first embodiment , and uneven surfaces caused by a non - etched portion remaining are not recognized . furthermore , the rca washing liquid ( nh 4 oh : h 2 o 2 : h 2 o - 1 : 2 : 7 ; volume ratio , 80 ° c .) instead of the etching liquid in the first embodiment , and the isopropanol , methanol , ethanol as the liquid soluble with the rca washing liquid , and the various kinds of mixed liquid are used to form the rectilinear sio 2 pattern on the si base plate in the method similar to that of the embodiment 1 . the si wafer is dipped for three minutes in the above - described liquid soluble with the rca washing liquid , thereafter is dipped for ten minutes in the rca washing liquid . thereafter , the si wafer is sufficiently washed with water , is dried , and the surface is observed , by sem ( scanning type electronic microscope ), for foreign materials attached on the si wafter surface . five through ten foreign materials ( per fifty linear patterns ) are sparsely recognized independently of the unevenness on the si wafer surfaces . a large difference is not caused in the condition of the foreign - material attached due to the differences among the liquids soluble with the rca washing liquid . the si wafer is directly dipped in the rca washing liquid without being dipped in the liquid soluble with the rca washing liquid , is washed , water - washed , dried . thereafter , according to the observation of the si wafer surface by the sem , comparatively more foreign materials are recognized on the contact portion between the side face of the linear pattern 22 of the sio 2 and the si crystal face 21 , and a group of large foreign materials are confirmed to be located in places . the fourth embodiment of the present invention will be described hereinafter with reference to the drawings . there is shown in fig4 a container in section provided with a rotary pump 113 as means for reducing the pressure therein in the fourth embodiment of the present invention , which includes a container 111 , a cell 112 for having the treatment liquid therein , a vacuum pump 113 as means for reducing the pressure , a stand 114 for having the si wafer mounted thereon ( hereinafter referred to as hanger ), treatment liquid 115 , a valve 116 , an si wafer as the substrate to be treated . the sio 2 film of 10 , 000 å is formed by the pyrogenic method on the si wafer ( 5 inches in diameter ), whose surfaces are finished into mirror face through the slicing operation with the crystal face of ( 1 , 0 , 0 ), thereafter the photo - resistance is applied into the thickness of 1 . 2 μm . the line - shaped pattern of 100 μm in length , 0 . 5 μm through 4 . 0 μm in width ( every 0 . 5 μm ) is developed by plurality on the entire si wafer . si wafer is etched in sio 2 by the dry etching ( with gas to be used , for instance , mixed gas of chf 3 + c 2 f 6 having pressure of 700 m torr ). the si wafer is etched further by the dry etching ( with gas to be used , for instance , mixed gas of ccl 4 + o 2 having pressure of 80 m torr ) into the various depths ( hereinafter referred to as the depths of the groove ) of 1 , 3 , 5 , 7 μm in the si monocrystal through the variation of the etching time . thereafter , the photoresistances are removed by the oxygen plasma . to observe the cross - sectional shape of the etching portion at this time by an electronic microscope ( hereinafter referred to as sem ), one portion of the si wafer is broken by the pattern forming portion . the condition is shown in fig5 . the bottom portion where the si mono - crystal is etched ( hereinafter referred to as groove ) is made v in shape . the si wafer , whose groove depth is etched by 5 μm is placed into the hanger of fig4 the mixed acid between the fluoric acid and nitric acid ( hf : hno 3 = 3 : 97 ( volume ratio ), hereinafter referred to as mixed acid ) as treatment liquid is placed into the cell 112 . thereafter , the container 111 is sealed , the hanger 114 is thrust in so that the si wafer 117 is sunk completely into the mixed acid 115 . thereafter , the pressure within the container 111 is immediately reduced down to 30 torr ( 15 ° c . at the liquid temperature of the mixed acid 115 ) by the use of the rotary pump 113 . thereafter , the hanger 114 is vibrated several times from the outside of the decompression container 117 , the valve 116 is opened to introduce the air into the container 111 to restore the pressure to the atmospheric pressure . after the lapse of 15 minutes from the dipping of the si wafer 117 in the mixed acid 115 it is removed from the hanger 114 with a pincette . immediately the si wafer is washed with a large amount of superpure water having specific resistance value of 18 mω · cm , and , thereafter , is spin - dried at 5000 rpm . the etching is performed in the same manner even about the other si wafers each being different in the groove depth . according to the observation of the si wafer by the sem , the side wall of the groove is uniformly etched with mixed acid to extend the groove width even in any pattern different in the groove width and the groove depth as shown in fig6 with the groove bottom portion being changed to have such round shape from the v - shape like in fig6 . the mixed acid which is the wet etching treatment liquid of the si wafer is penetrated into the entire groove so that the uniform treatment can be performed . also , although many grooves are observed in the same manner across the entire si wafer faces , the result is completely the same . also , although the similar experiments are performed respectively at 50 , 70 , 100 , 150 torr , the results are the same . on the other hand , the si wafer is etched with the mixed acid without the pressure reduction within the container 111 with the use of the treatment apparatus shown in the fourth embodiment as a second comparison embodiment for comparison , by the method completely the same as that of the fourth embodiment in the other processes . it is found by the sem observation ( hereinafter referred to as the second comparison embodiment ) that the portions where the interior portion of the groove is etched to extend the groove width are mixed with the portions where the groove width is not extended without the etching operation so as to cause the unevenness within the groove to make the etching unequal although the groove is etched with the mixed acid near the entrance thereof to extend the groove width even in any si wafer different in the groove width and depth . the operation of the treatment method in the above - described fourth embodiment will be described hereinafter . the si wafer which is the substrate to be treated is brought into contact against the treatment liquid within the container for decreasing the pressure therein . the pressure within the container is restored again to the atmospheric pressure after the pressure inside the container is reduced . the air bubbles which remain within the small unevenness on the si wafer surface and are large enough to exert harmful influences upon the treatment are inflated to a large extent in the treatment liquid to disconnect them from the si wafer surface through buoyancy . accordingly , the air bubbles do not prevent the concaved inner face of the si wafer surface from coming into contact against the treatment liquid . the treatment liquid may be poured deep into the rear of the indentation by the atmospheric pressure if it may be different in size , thus resulting in uniform treatment ( the thickness of the si wafer of 5 inches in diameter with respect to the atmospheric pressure of 760 mm hg &# 39 ; is 0 . 5 through 0 . 6 mm ). also , the corrosion of the pressure - decreasing apparatus does not progress in the third treatment process of the conventional art even if the corrosive gas is caused , thus resulting in longer service life , because the pressure decreasing operation is temporarily performed . furthermore , the treatment method of the fourth embodiment has effects of applying the mechanical vibrations on the si wafer , performing oscillations , and taking the si wafer out of the treatment liquid for short time during the pressure reduction or stirring the treatment liquid by a pump , stirrer , ultrasonic waves or the like so as to disconnect the air bubbles as soon as possible . a fifth embodiment of the present invention will be described hereinafter . in the fifth embodiment of the present invention , the rca washing liquid including nh 4 oh , h 2 o 2 and h 2 o in a mixing volume ratio of 1 : 2 : 7 at 80 ° c ., instead of the mixed acid for wet etching in the fourth embodiment , is used . in the other processes , the si wafer is etched , washed with water , dried in the completely same manner as in the fourth embodiment . the number of particle - shaped foreign materials on the side wall of the groove is observed by the sem . also , the above - described rca washing liquid , instead of the mixed acid in the second comparison embodiment is used for comparison . the number of the particle - shaped foreign materials on the groove side - walls ( hereinafter referred to as the third comparison embodiment ) is counted in the same manner as that of the second comparison embodiment . the counted number of the particle - shaped foreign materials in the fifth embodiment and the third comparison embodiment will be shown in the following table 1 . it is to be noted that the counted value of table 1 is the total of the foreign materials each being 0 . 3 μm or more in diameter among the fifth line - shaped grooves , which are of 1 . 5 μm in width , 100 μm in length , respectively . it may be found from the results that the treatment operation may be performed with the washing liquid down to the bottom of the deep concave portion by the use of the treatment method of the present invention . table 1______________________________________method of washing number of particlessi wafer on groove side wall______________________________________fifth embodiment 7third embodiment 30______________________________________ a sixth embodiment of the present invention will be described hereinafter . in the sixth embodiment of the present invention , the line - shaped groove is formed on the si wafer through the dry etching as in the fourth embodiment . the si wafer is set in the hanger 114 shown in fig4 . thereafter , the water which is liquid soluble with the mixed acid is put into the cell 112 to seal the pressure decreasing container 111 . the hanger 114 is thrust in . the wafer 117 is dipped in the water . then , the pressure - decreasing container is reduced inside as low as 20 torr ( 15 ° c . at the low temperature ) by a vacuum pump 113 . also , the hanger 114 is rotated in the pressure - decreased condition by four times or five times at the angle of about 45 °. thereafter , the valve is opened to restore the pressure of the decompression apparatus to the atmospheric pressure . thereafter , the si wafer is dipped in the mixed acid , is etched , washed with water and dried . according to the observation of the groove - shaped pattern portion by the sem , the groove - bottom portion is changed into the round v - shape as in fig6 also the side wall of the groove is uniformly wet - etched , and can be uniformly treated as in the fourth embodiment . on the other hand , by the use of the apparatus shown in the sixth embodiment for comparison , the pressure within the decompression container 111 is not decreased , but the si wafer is etched in the mixed acid in completely the same method as in the fifth embodiment . according to the sem observation ( hereinafter referred to as the fourth comparison embodiment ), the groove is etched near the entrance thereof to extend the groove width even in any si wafer different in the groove depth . however , the interior of the groove can be treated only in the unequal way as in the second comparison embodiment . a seventh embodiment of the present invention will be described hereinafter . methanol having surface tension of 24 dyne / cm , ethanol having surface tension of 24 . 1 dyne / cm , n - propyl alcohol and isopropyl alcohol having surface tension of 22 . 9 dyne / cm , acetone having surface tension of 26 . 3 dyne / cm , and methyl ethyl ketone having surface tension of 26 . 8 dyne / cm , acetic acid having surface tension of 29 . 6 dyne / cm , in methyl acetate , ethyl acetate and nonionic series interfacial activator diluted to 0 . 5 % with water , mixture of 1 : 1 between ethanol and acetic acid , mixed liquid between ethanol and water at a mixing ratio of either 6 : 4 or 4 : 6 , the mixed liquid between acetic acid and water at a mixing ratio of either 6 : 4 or 4 : 6 are used as the liquid soluble with the mixed acid which is the wet etching agent of the si wafer . the wet etching is performed as in the sixth embodiment so that the groove bottom portion is changed into the round v - shaped likewise and the mixed acid for etching use is penetrated through the entire groove . also , the similar examinations are performed with the use of the mixed liquid between methanol and water , isopropyl alcohol and water , or acetic acid and water , with the results being completely the same . an eighth embodiment of the present invention will be described hereinafter . in the eighth embodiment of the present invention , the rca washing liquid including nh 4 oh , h 2 o 2 and h 2 o at a ratio of 1 : 2 : 7 , at 80 ° c ., instead of the mixed acid for the wet etching in the sixth embodiment , is used . in the other processes , the si wafer is etched , washed with water and dried in completely the same manner as in the sixth embodiment the number of particle - shaped foreign materials on the side wall of the groove is observed by the sem . also , the above - described rca washing liquid , instead of the mixed acid in the fourth comparison embodiment , is used for comparison . the number of the particle shaped foreign materials on the groove side walls ( hereinafter referred to as the fifth comparison embodiment ) is counted in the same manner as that in the fourth embodiment . the counted number of the particle - shaped foreign materials in the eighth embodiment and the fifth comparison embodiment will be shown in the following table 2 . it is to be noted that the counted value of table 2 is the total of the foreign materials each being 0 . 3 μm or more in diameter among the fifty line - shaped grooves , which are of 1 . 5 μm in width , 100 μm in length respectively . it may be found from the results that the treatment operation may be performed with the washing liquid down to the bottom of the deep concave portion by the use of the treatment method of the eighth embodiment . it is to be noted that each of the above - described embodiments shows only the examples of the wet etching and the washing process of the si wafer . the present invention may be applied not only to the examples , but also to all the processes of treating , with the use of the treatment liquid , a substrate which is shaped like a plate and has unevenness on the surfaces . table 2______________________________________ number of particle - shapedmethod of washing foreign materials onsi wafer groove side wall______________________________________eighth embodiment 7fifth embodiment 35______________________________________ in the treatment method of embodiment 6 through embodiment 8 , the liquid which is soluble with such treatment liquid as described hereinabove is contacted with the surface of the substrate to be treated , thereafter the pressure in the container is reduced , then the pressure is restored to atmospheric pressure , and the large air bubbles in the concave portion are inflated by the decompression , are removed with buoyancy , and the liquid is gradually penetrated into the surface between the very few small air bubbles remaining on the surface of the substrate to permit the entire surfaces of the substrate to be wetted with the treatment liquid . it is possible for the interior of the decompression container to be made completely vacuum . the degree of vacuum increases only up to the steam pressure when the liquid exists with the decompression container . for example , it is about 20 torr at 20 ° c . in the case of water . accordingly , the air which is originally located in the concave portion of the substrate may be mostly removed by the decompression de - airing operation , but air in an amount equivalent to 20 / 760 of the volume of the concave portion remains as it is . the decompression degree of the treating method in the sixth through the eighth embodiments is determined by the steam pressure of the treatment liquid . the vacuum arrival degree is up to about 20 torr at 20 ° c . in the diluted liquid through the fluoric - acid water , the effective vacuum degree is within the range of 150 through 20 torr ( 20 ° c . ), preferably 40 through 20 torr . the various pumps such as rotary pump , diffusion pump , mechanical booster pump , water seal pump and so on which are generally used as vacuum pumps are provided as apparatuses for decreasing the pressure within the container . in the present invention , any pump may be used , and a plurality of combinations from among them may be used . a ninth embodiment of the present invention will be described hereinafter with reference to the drawings . in sample and the apparatus used in the present embodiment are the same as those manufactured and used in the fourth embodiment . the line - shaped pattern of 100 μm in length , every 0 . 5 μm in width ( or there may be employed a value of 0 . 5 through 4 . 0 μm in width ), and 1 , 3 , 5 , 7 μm in depth is formed on the surface , and , thereafter , the photoresistance is removed . the si wafer like this is used . the treatment apparatus of fig4 which is the same as that of the fourth embodiment , is used . the si wafer , whose groove depth is etched by 5 μm is placed into the hanger of fig4 the mixed acid between the fluoric acid and the nitric acid ( hf : hno 3 ) in a mixing volume ratio of 3 to 97 ( hereinafter referred to as a mixed acid ) as treatment liquid is placed into the cell 112 . thereafter , the container 111 is sealed , the pressure within the container 111 is reduced to 30 torr at 15 ° c . of the liquid temperature of the mixed acid 115 by the use of the rotary pump 113 . then , the hanger 114 is thrust in so that the si wafer 117 is sunk completely into the mixed acid 115 . thereafter , the valve 116 is opened to introduce the air into the container 111 to restore the pressure to the atmospheric pressure . after the lapse of 15 minutes from the dipping of the si wafer 117 in the mixed acid 115 , the si wafer 117 is lifted from the mixed acid 115 to take it out from the hanger 114 with a pincette . immediately , the si wafer is washed with a large amount of super - pure water having specific resistance value of 18 mω · cm , and thereafter , is spin - dried at 5000 rpm . the etching is performed in the same manner even about the other si wafers each being different in the groove depth . according to the observation of the si wafer by the sem , the side wall of the groove is uniformly etched with mixed acid to extend the groove width even in any pattern different in the groove width and the groove depth as shown in fig6 with the groove bottom portion being changed to have such round shape as in fig6 from the v - shape . the mixed acid which is wet etching treatment liquid of the si wafer is penetrated into the entire groove so that the uniform treatment can be performed . also , although many grooves are observed in the same manner across the entire si wafer faces , the result is completely the same . also , although the similar experiments are performed respectively at 50 , 70 , 100 , 150 torr , the results are the same . on the other hand , the si wafer is etched with the mixed acid without the pressure reduction within the container 111 with the use of the apparatus shown in the fourth embodiment for comparison by the method which is completely the same method as that of the ninth embodiment in the other processes . it is found by the sem observation ( hereinafter referred to as the fifth comparison embodiment ) that the portions where the interior portion of the groove is etched to extend the groove width are mixed with the portions where the groove width is not extended without the etching operation so as to cause the unevenness within the groove to make the etching unequal although the groove is etched with the mixed acid near the entrance thereof to extend the groove width even in any si wafer different in the groove width and depth . a tenth embodiment of the present invention will be described hereinafter . in the tenth embodiment of the present invention , the rca washing liquid including nh 4 oh , h 2 o 2 , h 2 o in a volume ratio of 1 : 2 : 7 at 80 ° c ., instead of the mixed acid for the wet etching use in the ninth embodiment , was used . in the other processes , the si wafer is etched , washed with water , dried in the completely same manner as in the ninth embodiment . the number of particle - shaped foreign materials on the side wall of the groove is observed by the sem . also , the above - described rca washing liquid , instead of mixed acid used in the ninth comparison embodiment is used for comparison . the number of the particle - shaped foreign materials on the groove side walls ( hereinafter referred to as the sixth comparison embodiment ) is counted in the same manner . the counted number of the particle - shaped foreign materials is the tenth embodiment and the sixth comparison embodiment will be shown in the following table 3 . it is to be noted that the counted value of table 3 is the total of the foreign materials each being 0 . 3 μm or more in diameter among the fifty line - shaped grooves , which are of 1 . 5 μm in width , 100 μm in length , respectively . it may be found from the results that the treatment operation may be performed with the washing liquid down to the bottom of the deep concave portion by the use of the treatment method of the present embodiment . table 3______________________________________method of washing number of particles onsi wafer groove side wall______________________________________tenth embodiment 3sixth embodiment 32______________________________________ an eleventh embodiment of the present invention will be described hereinafter . in the eleventh embodiment of the present invention , the line - shaped groove is formed on the si wafer through the dry etching as in the ninth embodiment . the si wafer it set in the hanger 114 shown in fig4 . thereafter , the water which is liquid soluble with the mixed acid is put into the cell 112 to seal the pressure - decreasing container 111 . the pressure - decreasing container 111 is reduced inside as low as 20 torr at 15 ° c . of the low temperature , by a rotary vacuum pump 113 . then , the hanger 114 is rotated in the pressure - decreased condition by four times or five times at the angle of about 45 °, where the hanger is thrust in , and the wafer 117 is dipped in the water . thereafter , the valve is opened to restore the pressure of the decompression apparatus to the atmospheric pressure . thereafter , the si wafer is dipped in the mixed acid , is etched , washed with water and dried . according , to the observation of the groove - shaped pattern portion by the sem , the groove - bottom portion is changed into the round v - shape as in fig6 also the side wall of the groove is uniformly wet - etched , and can be uniformly treated as in the ninth embodiment . on the other hand , by the use of the apparatus shown in the eleventh embodiment for comparison , the pressure within the decompression container 111 is not decreased , in the other process steps the si wafer is etched in the mixed acid in completely the same method as in the ninth embodiment . according to the sem observation ( hereinafter referred to as the seventh comparison embodiment ), the groove is etched near the entrance thereof to extend the groove width even in any si wafer different in the groove depth . however , the interior of the groove can be treated only in the unequal way as in the fifth comparison embodiment . in the treatment method in the ninth through eleventh embodiments , the si wafer and the treatment liquid are placed separately within the container provided with an apparatus for decreasing the pressure within the container , and the pressure within the container is decreased . thus , the air on the wafer surfaces can be removed even if unevenness caused by fine or deep grooves exists . the si wafer is brought into contact against the treatment liquid in this condition , thereafter the pressure is restored to the atmospheric pressure . accordingly , the air bubbles do not prevent the concaved inner face of the si wafer surface from coming into contact against the treatment liquid . the treatment liquid may be poured deep into the rear of the indentation by the atmospheric pressure if it may be different in size , thus resulting in uniform treatment . in this embodiment , the thickness of the si wafer of 5 inches in diameter with respect to the atmospheric pressure 760 mmhg is 0 . 5 through 0 . 6 mm . a twelfth embodiment of the present invention will be described hereinafter . in the treatment method of the twelfth embodiment of the present invention , the liquid soluble with the treatment liquid is brought into contact with the surface of the substrate to be treated under the decreased pressure , thereafter the pressure is restored to the atmospheric pressure . the liquid is gradually penetrated into the boundary between very few air bubbles remaining on the surfaces of the substrate so that the entire surface of the substrate may be wetted with the treatment liquid . the concrete contents of the twelfth embodiment using the liquid will be described hereinafter . the kind of the liquid soluble with the treatment liquid to be used in the treatment method of the twelfth embodiment is the same as that used in the treatment method of the sixth through eighth embodiments , and the operation is also similar . methanol having surface tension of 24 dyne / cm , ethanol having surface tension of 24 . 1 dyne / cm , n - propyl alcohol and isopropyl alcohol having surface tension of 22 . 9 dyne / cm , acetone having surface tension of 26 . 3 dyne / cm , and methyl ethyl ketone having surface tension of 26 . 8 dyne / cm , acetic acid having surface tension of 29 . 6 dyne / cm , in methyl acetate , ethyl acetate and nonionic series interfacial activator diluted to 0 . 5 % with water , mixture of 1 : 1 between ethanol and acetic acid , mixed liquid between ethanol and water at a ratio of either 6 : 4 or 4 : 6 , the mixed liquid between acetic acid and water at a ratio of either 6 : 4 or 4 : 6 are used as the liquid soluble with the mixed acid which is the wet etching agent of the si wafer . the wet etching is performed as in the eleventh embodiment so that the groove bottom portion is changed into the round v - shape likewise and the mixed acid for etching use is penetrated through the entire groove . also , the similar examinations are performed with the use of the mixed liquid between methanol and water , isopropyl alcohol and water , or acetic acid and water , with the results being completely the same . a thirteenth embodiment of the present invention will be described hereinafter . in the thirteenth embodiment of the present invention , the rca washing liquid including nh 4 oh , h 2 o 2 , h 2 o at a ratio of 1 : 2 : 7 at 80 ° c ., instead of the mixed acid for wet etching use in the twelfth embodiment , is used . in the other processes , the si wafer is etched , washed with water , dried in the completely same manner as in the twelfth embodiment . the number of particle - shaped foreign materials on the side wall of the groove is observed by the sem . also , the above - described rca washing liquid , instead of the mixed acid used in the seventh comparison embodiment is used for comparison . the number of the particle - shaped foreign materials on the groove side walls ( hereinafter referred to as the eighth comparison embodiment ) is counted in the same manner . the counted number of the particle - shaped foreign materials in the thirteenth embodiment and the eighth comparison embodiment will be shown in the following table 4 . it is to be noted that the counted value of table 4 is the total of the foreign materials each being 0 . 3 μm or more in diameter among the fifty line - shaped grooves , which are of 1 . 5 μm in width , 100 μm in length , respectively . it may be found from the results that the treatment operation may be performed with the washing liquid down to the bottom of the deep concave portion by the use of the treatment method of the present invention . table 4______________________________________ number of particle - shapedmethod of washing foreign materials of groovesi wafer on groove side wall______________________________________thirteenth embodiment 2eighth comparison 35embodiment______________________________________ although the present invention has been fully described by way of example with reference to the accompanying drawings , it is to be noted here that various changes and modifications will be apparent to those skilled in the art . therefore , unless otherwise such changes and modifications depart from the scope of the present invention , they should be construed as being included therein . | 7 |
the drip stopper shown in fig1 comprises a substantially cylindrical pipe part 1 which , for the purpose of drip - free pouring , is to some extent inserted in the neck of an opened bottle . the lower part of the pipe part in the drawing which , in its inserted state extends into the bottleneck , is denoted as insertion part 3 , and the upper part which , in its inserted state protrudes from the bottleneck , is denoted as pouring - out part 4 . the upper opening of the pouring - out part 4 is shaped such that a defined pouring - out edge 4 is formed . in the present example , this is achieved by cutting the pipe part at the top at an angle to its axis . between the pouring - out part 4 and the insertion part 3 , a plurality of radially outwardly oriented position elements 6 are arranged which , in the inserted state of the drip stopper , rest on the upper edge of the bottleneck , thus delimiting the insertion depth . at the lower end section of the insertion part 3 , a plurality of guide elements 7 are attached through molding . they are oriented downward obliquely to the axis of the insertion part 3 and facilitate the accurate insertion of the drip stopper in narrower bottlenecks . on the side opposite of the pouring - out edge 5 , the substantially cylindrical wall of the pipe part has a nook - shaped recess 8 which extends in axial direction over the entire length of the pipe part and is formed by two side walls 9 and a rear wall 10 . as shall be explained in the following using fig2 , the front edges 11 of the recess , formed by the side walls with the lateral surface , are brought closer to one another by pressing together the cylindrical area . as a result , the recess folds up and shall in the following description thus also be denoted as folding zone 8 . fig2 a shows schematically a cross - section of the insertion part 3 , i . e . a section perpendicular to the axis of the pipe part , with the preferred folding zone 8 in the operational basic position the way the drip stopper is delivered . in this basic position , the outer diameter of the insertion part 3 is minimally greater than the inner diameter of the largest bottleneck provided . when the drip stopper is inserted in the bottleneck , the insertion part 3 is narrowed . simultaneously , the front edges 11 are pushed closer to one another . the rear wall 10 is tensioned and slightly bent toward the axis of the insertion part 3 . the tilting side walls 9 are forced to position themselves between the rear wall 10 and the outer wall . inevitably , the rear wall 10 is also radially pulled outward , as can be seen in fig2 b which shows the state of the folding zone 8 , when the drip stopper is inserted in a bottleneck with the smallest aforementioned diameter . the force required to insert the drip stopper in the bottleneck generates a tension in the insertion part 3 as well as in the side walls 9 and the rear wall 10 of the folding zone 8 . the functioning of the sealing is thus based on pressure and counter - pressure generated between the insertion part 3 and the folding zone 8 due to the narrowing when the drip stopper is pushed into the bottleneck . the angle adjustments between rear wall 10 , side walls 9 , and insertion part 3 determine , how and in which direction the side walls 9 must move , when the insertion part 3 is narrowed . in order to ensure this function , primarily the pressing against the inner side of the bottleneck , it is necessary that the front edges 11 and the inner edges between rear wall 10 and the side walls 9 are able to transfer tension forces between the adjacent areas . in other words , they must not be bent so sharply that they can be folded free from tension . preferably , this is achieved in that the edges have a curvature radius of a few millimeters . due to the narrowing of the insertion part 3 , the folding zone 8 is tensioned , while this tension simultaneously presses the insertion part 3 everywhere and evenly against the bottleneck , thus generating a seal . as a result , no wine can penetrate between insertion part 3 and bottleneck . wine can also not flow through the area of the folding zone 8 because this is prevented by the backwards flowing air . in addition , if poured correctly , the wine only flows in the lower area of the passage . fig3 shows another option for the design of a folding zone with an open angle , namely on the left side in an operational state , i . e . as delivered ; in the middle with an approximately right - angled position of the folding zone in a bottleneck with medium inner diameter ; and on the right in a bottleneck with the smallest inner diameter . fig4 shows a similar version as fig2 , but with an outwardly oriented bend in the rear wall 10 . in this version , the rear wall 10 is pressed closer to the bottle wall when the insertion part 3 narrows than in the version according to fig2 . the drip stoppers can be stacked by inserting one into another to save space . in order to make this possible , the following is provided : the pouring - out part 4 has thinner walls than the insertion part 3 . the inner diameter of the pouring - out part 4 corresponds approximately to the outer diameter of the insertion part 3 . as a result , on the wall inner side between the pouring - out part and the insertion part , a continuous recess is created in the area , in which the position elements 6 are attached on the outside through molding . in the area of the pouring - out part 4 , on the same level with the upper edge of the folding zone 8 , a support is molded on the inside . the lower area of the insertion part is tapered in a short section in order to facilitate the insertion into the bottleneck . for the same length as said tapering , the folding zone 8 is omitted . the guide elements 7 are arranged such that they are located in the stack on the side of the folding zone 8 and the support . therefore , when the drip stoppers are inserted into one another , the insertion part 3 of the upper drip stopper sits on the folding zone 8 and the support of the lower drip stopper . when stacked , a drip stopper only takes up space that is equal to the length of the insertion part 3 . the drip stopper is made of resilient , tough , hydrophobic plastic , e . g . pe . there are several possibilities for designing the folding zone . for example , an inward bulge can be formed instead of the side walls and the rear wall . the principle remains the same . fig5 shows a drip stopper , in which , contrary to the drip stopper with guide elements , the lower area of the insertion part is tapered . due to this tapering , the accurate insertion of the drip stopper in the bottleneck with the smallest aforementioned diameter is facilitated . the rear wall or the apex of the folding zone is incised all the way to the end of the tapering . as a result , the tapering cannot influence the even contact pressure of the insertion part on the bottleneck . fig6 and 7 schematically show a packaging , in which individual or stacked drip stoppers are stored without being able to be touched by fingers . the packaging comprises a decorative , flat cardboard box with a folding lid , similar to a box of chocolates . in the interior , there is a foil 20 which is downwardly deep - drawn , having a flat surface . this foil 20 comprises a plurality of annular indentations as staking space 21 , in which drip stoppers 1 can be stored individually or preferably stacked with the pouring - out parts 4 on top . the outer diameter of this stacking space 21 corresponds approximately to the outer diameter of the circle of the end sections of the position elements 6 . an also deep - draws column 22 if formed in the center of the stacking space 21 , said column 22 being adjusted , at some distance , to the inner contours of the drip stopper 1 . the column serves as an orientation element . the drip stoppers 1 are thus oriented and stacked in the stacking space 21 at a depth , where they cannot be touched by fingers , i . e . a gap is formed between the surface of the packaging and the pouring - out edge 5 of the topmost drip stopper 1 . the stacking space , in which the drip stoppers are located , is smaller than the thickness of a finger . in the stack , the upper drip stopper 1 sits in the pouring - out part 4 of the corresponding subjacent drip stopper 1 . the inner diameter of the pouring - out part 4 of each of the subjacent drip stoppers 1 corresponds , as mentioned before , approximately to the outer diameter of the insertion part of the next drip stopper 1 above , and so the upper drip stopper is held slightly by the subjacent drips stopper 1 . in the lower area , the indentations in the foil 20 are designed so as to be narrower than in the upper area . the lower area of the indentation is adjusted to the drip stopper such that the position elements 5 of the lowermost drip stopper are slightly clamped . since , as a result , the drip stopper is pressed against the packaging , and the upper drip stoppers are held by the corresponding subjacent ones , there is no danger that the stack can slide out of the packaging , even if it is turned on its head . the insertion device 25 shown in fig8 consists of a handle 26 and a push part 27 . the handle 26 consists of a pipe which is open at the bottom and extends to the lower end section of the push part 27 . the inner diameter of the pipe is minimally smaller than the outer diameter of the circle of the pouring - out part 2 of the drip stopper 1 , when the drip stopper 1 is not tensioned . the outer diameter of the push part 27 is approximately equal to the outer diameter of the indentation in the foil 20 and somewhat smaller than the outer circle of the position elements 6 of the drip stopper 1 . the lower end section of the pipe is cut straight and , similar to the lower surface of the push part 27 , is positioned at a right angle to the axis of the pipe . at the bottom , the push part 27 is closed all the way to the edge of the pipe . for removal from the packaging and insertion in the bottleneck , the insertion tool is gripped by the handle and the push part is guided into the annular indentation of the packaging , i . e . into the stacking space 21 . in the indentation , a drip stopper 1 points upward with its pouring - out part 4 . the pipe , having a short expansion in the lower section , is pulled over this pouring - out part 4 . the pipe clamps the pouring - out part 4 of the drip stopper and holds it tight by pressing it together . simultaneously , the circumference of the insertion part 3 of the drip stopper 1 is becoming smaller , and so it can come loose from the lower drip stopper . the pipe ( handle ) is lifted with the clamped pouring - out part 4 . now the drip stopper with the insertion device 25 is pressed into the bottleneck until the position elements 6 are positioned on the edge of the bottleneck . the drip stopper 1 is now securely positioned in the bottleneck . due to the pressing into the bottleneck , the diameter of the drip stopper 1 as well as the diameter of the pouring - out part 4 becomes smaller . the pouring - out part 4 thus comes loose from the insertion device 25 . the insertion device 25 can be lifted and placed into the packaging , or a new drip stopper can be collected and inserted in a bottleneck . in a different version , the pipe is supplemented by a flat section in the receiving space for the pouring - out part 4 , said flat section being located in the interior of the insertion part 3 , when receiving the drip stopper , and pressing slightly against the rear wall 10 . this flat section can extend to the lower end section of the insertion part 3 . this version is advantageous with a very short pouring - out part . of course , the deep - drawn packaging foil 20 is adjusted . | 1 |
referring to fig1 , a system and apparatus in accordance with an embodiment of the present invention , for treating fecal incontinence , are illustrated in schematic form . the system includes an apparatus comprising an implantable stimulator 1 and a device comprising contractile tissue 2 which is arranged to be stimulated by a signal that is generated by the stimulator 1 and , in this embodiment , applied to the contractile tissue 2 via an electrode 3 conductively connected between the stimulator 1 and contractile tissue 2 . in this embodiment , the stimulator 1 includes a signal generator for producing a pulsatile signal which is housed in a bio - compatible housing 4 . the stimulator 1 will be described in more detail later . the contractile tissue 2 in this embodiment is formed into a sphincter which is implanted about the fecal sphincter region , in this embodiment proximate to the anus . in fig1 , the external fecal sphincter is designated by reference numeral 5 and the internal fecal sphincter by reference numeral 6 . failure of operation of the external and / or internal fecal sphincters perhaps because of nerve damage , or other reason ) have led to fecal incontinence in this patient . stimulation of the contractile tissue sphincter 2 , in operation , causes the contractile tissue 2 to contract and maintain closure of the fecal canal 7 , maintaining fecal continence . in this embodiment , the contractile tissue is smooth muscle tissue . the smooth muscle tissue may be obtained from elsewhere in the body , formed into a sphincter and surgically implanted . alternatively , the smooth muscle tissue may be grown from smooth muscle stem cells and / or proliferative smooth muscle cells . alternatively , the smooth muscle tissue may be transplanted smooth muscle tissue augmented by smooth muscle stem cells and / or proliferative smooth muscle cells . alternatively , the smooth muscle tissue may be the tissue of the internal fecal sphincter . international patent application no : pct / 2006 / 001301 , referred to above , discloses augmentation of contractile tissue using proliferative smooth muscle cells or smooth muscle stem cells . growth , maturation and stability of the tissue may be influenced by growth factors ( trophic and / or neurotrophic factors ) that are a component of the treatment . smooth muscle may be taken from anywhere or grown ( as discussed above ). in an embodiment the smooth muscle may be taken from the smooth muscle of the bladder and transplanted about the urethra , with its circulation intact . alternatively , the muscle is venous smooth muscle , anococcygeus smooth muscle or terminal ileum transplanted as a segment devoid of mucosa and having its circulation intact . a further alternative is the dartos smooth muscle from the scrotum or a portion of the vagina or labia . in an embodiment , smooth muscle may be taken as a free graft . in this case , the tissue is separated from its normal circulation and becomes vascularised by ingrowth of blood vessels at the site of implant . the stimulator 1 includes a signal generator arranged to provide a stimulation signal for stimulating the smooth muscle sphincter 2 . a lead 8 extends from the stimulator 1 to the electrode 3 at the smooth muscle sphincter 2 , for providing the stimulation signal 2 to the smooth muscle sphincter 2 . the stimulation signal may be a signal of frequency and amplitude determined to maintain contraction of the smooth muscle sphincter 2 to facilitate continence . the stimulator 1 may also be arranged to produce a further electrical signal to stimulate the sphincter 2 to relax , to enable the patient to defecate . as an alternative to a further electrical signal , the stimulator 1 may be arranged to stop producing any electrical signal and it is the absence of the signal that causes the sphincter 2 to relax . in this embodiment , the stimulator 1 is arranged to have the stimulation signal varied under control of the patient by way of an external controller . fig2 shows an alternative embodiment . in the fig2 drawing , the same reference numerals have been used as in fig1 for equivalent components . those components have the same function as in fig1 and no further description will be given here . in the fig2 embodiment , the contractile tissue sphincter 2 is placed further up the colorectum , in the abdomino - pelvic region , away from the anus . this different positioning may be used if surgically convenient . in some cases , this different position may be utilised where there is some damage to the anus . such damage may occur , for example , from the former use of prosthesis in an attempt to correct the incontinence problem . there does not have to be any damage to the anus for this alternative positioning to be used . in a further alternative embodiment , the sphincter 2 may be positioned about the external fecal sphincter . in a further alternative embodiment , a neosphincter may not be utilised , instead stimulation may be applied directly to the internal fecal sphincter 6 . the stimulator 1 is shown in more detail in fig3 . in this embodiment , a signal generator that is arranged to provide the electrical signal for stimulation of the sphincter 2 is in the form of a control unit 9 and stimulus driver 10 . the control unit 9 encodes the stimulus and provides a signal to the stimulus driver 10 which provides the stimulation signal at output 16 . the output 16 outputs to conductor 32 and to one or more electrodes 3 . in this embodiment , the control unit 9 and stimulus driver 10 form , together with a demodulator 18 , a processing unit for generating the stimulation signal ( s ) at output 16 . the demodulator 18 is arranged to demodulate a signal received by transceiver 15 . an external control unit and external programmer unit ( both to be described later ) are able to communicate via the transceiver 15 with the processing unit 14 in order to control application of stimuli and / or vary the stimuli . in addition , as described in more detail later , the processing unit 14 may transmit , via control unit 9 , demodulator 18 and transceiver 15 , signals to the control unit or programmer unit . the transmitted signals may deliver telemetry information indicative of parameters of the stimulator , for the purposes of calibration and control . the entire stimulator 1 ( including components 14 and 15 ), is enclosed in a housing which includes a casing made from a bio - compatible material , such as titanium , silicone polymer or other acceptable materials , or combinations of materials , including , but not limited to inert materials . the frequency of the rf signal for transmission and reception by the transceiver 15 may depend on the material of the casing of the stimulator . fig4 shows a system in accordance with an embodiment of the present invention . the system incorporates the implanted stimulator 1 , with transceiver 15 . the electrode ( s ) 3 is shown schematically together with cable 32 . the system also comprises an external controller 17 which includes a transmitter 11 . the controller 17 is intended for operation by a patient with the stimulator implanted , for control of the stimulator 1 . the controller 17 includes an actuator ( such as a button , not shown ) operable by the patient to selectively send signals to the implanted stimulator 1 , for control of the stimulation signals being sent to the electrode ( s ) 3 . in one embodiment , the stimulator is “ fail safe ”. unless a signal is received from the controller 17 , the stimulator produces a signal which maintains tone in the smooth muscle implant 2 , maintaining fecal continence . when the patient wishes to defecate , the patient actuates the controller 17 to send , via the transmitter 11 , a signal to the stimulator 1 . in response to receiving the signal , the control unit 9 operates to turn the stimulating signal off causing the sphincter 2 to relax and allow the patient to defecate . the controller 17 may also be arranged to provide a further signal under patient control , once the patient has finished defecating , the further signal causing stimulator 1 to resume providing the stimulation signals to the electrode ( s ) 3 . in “ fail safe ” mode , if the further signal is not produced , the stimulator may resume providing the stimulation signal to the electrode ( s ) 3 after a predetermined period of time . the stimulation signal 16 provided to contract the smooth muscle sphincter 2 is selected so as to provide a substantially continuous tone in the sphincter 1 . a generally rectangular and symmetrically biphasic pulse may be suitable for this . the signal has a substantially constant current less than or equal to 50 ma , 15 ma , 10 ma , or 5 ma , and in some preferred embodiments may be in the order of 4 ma , 8 ma , 12 ma , or 15 ma . stimulation pulse frequency provided to sphincter 1 is in the range of 0 . 1 hz to 5 hz , 0 . 2 hz to 4 . 0 hz . 0 . 25 hz to 3 . 0 hz , 1 hz to 3 . 0 hz , 1 . 5 hz to 3 hz , 1 . 75 hz to 2 . 5 hz , or a 0 . 25 hz to 2 . 25 hz , and in one embodiment , is 1 hz , 2 hz , 2 . 5 hz or 3 hz . stimulation phase width of each phase is in the range of 0 . 05 ms to 2 . 0 ms , 0 . 1 ms to 1 . 5 ms , 0 . 2 ms to 1 ms , 0 . 25 ms to 0 . 75 ms , and in one embodiment is 0 . 2 ms , 0 . 4 ms , 0 . 5 ms or 1 ms . the stimulator is current regulated , and accordingly the stimulation voltage will vary with the resistance of the muscle tissue between the electrodes . typical values for the voltage are between 0 . 1 and 15 volts , 0 . 2 and 12 volts , 0 . 5 and 12 volts , 0 . 5 and 10 volts , or 0 . 5 and 7 . 5 volts . in one embodiment , the voltage is 2 . 5 volts , 5 volts , 7 . 5 volts or 10 volts . either a current source ( voltage limited ) or a voltage source ( current limited ) stimulator may be used . it is also possible to use an asymmetric biphasic pulse , in which , for example , the first phase is shorter in duration than the second phase . fig5 shows a system in accordance with an embodiment of the present invention , including a programmer unit 13 which may be utilised by a physician to set and adjust parameters of the implanted stimulator 1 . the programmer unit is arranged for communication with the stimulator via transceiver 11 , and may comprise a computing device . the control unit 9 is also arranged to transmit stimulator telemetry information indicative of one or more of the parameters of the stimulator 1 , for detection by the programmer 13 via transceiver 1 . the programmer unit 13 can therefore determine parameters of the stimulator from telemetry information and can adjust the parameters by transmitting control signals to the stimulator 1 . the signal from the programmer may be able to selectively vary the output current , shape , frequency and / or pulse width of the stimulation signal ( s ). in operation , a physician adjusts parameters of the stimulation signal ( s ). the physician will note feedback from the patient as to the effect of the stimulus on fecal continence control , and may subsequently re - adjust the parameters until the stimulation is optimum . for example , patient perceived feedback may be used to set the maximum stimulation threshold of the smooth muscle sphincter . in the above - described embodiments , signals between the controller or programmer and the stimulator are rf signals . other types of transmission media other than rf may be used . for example , microwave signals may be used for transmission , optical signals may be used , and in another embodiment magnetic transmission may be used . magnetic transmission may be used for the controller 17 to cause the stimulator to stop producing stimulation signals and therefore allow the patient to defecate . in this embodiment , the controller 17 may be a simple magnet which , when passed over a magnetic receiver of the stimulator 1 , results in the stimulator ceasing to provide stimulation signals for contracting the sphincter . in the above embodiments , any suitable electrode ( s ) may be utilised to stimulate the implant 2 . for example , button electrodes , cuff electrodes or any other suitable electrode may be utilised . in embodiments , an electrode arrangement such as a disclosed in pct / au / 20054 / 001698 may be utilised . fig6 illustrates an embodiment of the present invention where a “ peg ” electrode 3 a such as disclosed in pct / au20054 / 001698 is utilised to transmit signals to the implant 2 from the stimulator 1 . in fig6 , the same reference numerals as used in previous embodiments have been utilised to designate similar components , and no further description will be given here of these components . the electrode 3 a will now be described in more detail . the electrode comprises a number of components . these include an electrode cover 100 ( shown in most detail in fig1 through 18 ). the components also include an electrode shroud ( shown in best detail in fig1 through 13 ) and also an electrode lead 102 ( shown in fig7 , 8 & amp ; 9 , together with the other components of the electrode arrangement ). in this embodiment first and second electrode elements are formed by the electrode cover 100 , which includes insulating elements 103 , 104 extending from a base 105 . the insulating extending elements 103 , 104 are formed with a slot 106 , 107 , respectively , extending substantially along the length of the extending elements 103 , 104 . when the electrode arrangement is assembled , platinum foil electrodes 108 , 109 ( fig7 ) are placed on the outer surfaces of the elements of the elements 103 , 104 so that they are insulated from the gap 110 formed between the elements 103 , 104 apart from the slots 106 , 107 , which expose portions of the conductive plates 108 , 109 to the gap 110 ( and , in use , to any tissue seated within the gap ). when assembled , the electrode cover 100 and platinum electrode foils 108 , 109 seat within the electrode shroud 101 as best shown in fig1 , 11 , 12 & amp ; 13 . fig1 in particular shown in cross - section where the electrode cover seats . electrode shroud 1 is formed from silicone . in order to provide reinforcement , pet mesh covers 111 , 112 are provided to fit to upper 113 and lower 114 extending portions of the shroud 101 . suture holes 115 , 116 are provided in the covers 111 , 112 and also in the elements 113 , 114 of the shroud 101 . note that the reinforcement can be provided by other means and is not limited to pet mesh . further , the electrode shroud need not be in silicone but could be of other bio - compatible material and may not require reinforcement . further , note that other means for affixing to the tissue may be provided other than suture holes or instead of suture holes . the electrode lead 102 is a multi - component arrangement which includes an outer insulating cover 120 , a tine collar 121 including tines 122 for retaining the lead in position within a patient . it also includes a sutured collar 123 including suture holes 124 for suturing to patient tissue to also facilitate retaining the lead 102 in position . there is also bifurcation moulding 125 which enables the lead to split into two parts 126 , 127 which may contain separate conductors , and connectors 128 , 129 which may be arranged to contact to a simulation device . in the above embodiments , the electrode arrangement includes a pair of electrode elements which extend away from a base which joins them together at their proximal ends . in a further embodiment , a single electrode element which is not joined at any base is provided . this single electrode element may be used to provide stimulation to contractile tissue on its own , or may be used together with one or more similar electrode elements to provide stimulation . in the above described embodiments , each electrode element is provided with a single electrode . the single electrode is an elongate electrode extending substantially the majority of the length of the electrode element . one advantage of having thin electrodes bounded by insulating material on either side is that the arrangement operates to confine the electric field produced by the electrode to the tissue immediately adjacent the electrode . this reduces or prevents stimulation of tissue that it is not desirable to stimulate e . g . tissue external to a contractile tissue sphincter being controlled . in operation , the electrodes 108 , 109 and extending elements 103 , 104 are positioned either side of the smooth muscle implant to enable signals to be transmitted to the implant for operation . electrode arrangement 3 a allows application of an electric field between the opposing electrode elements to stimulate the tissue between them . the electric field in one embodiment is confined so that stimulation is to a band of tissue between the electrodes . in one embodiment , innervation runs within the implant 2 perpendicular to the band of tissue being stimulated . the elements in electrode 3 a extend over the tissue in a manner analogous to that of a clothes peg . the elements in electrode 3 a extend over the tissue in a manner analogous to that of a clothes peg . other electrode patterns then a single line electrode on the surfaces of the elements may be utilised . as discussed above , in an embodiment , the stimulater implant is preferably sealed and encased in a biologically inert material such as a biocompatible silicone material . metallic electrodes and leads may be of plantinum - iridum alloy . the connecting wires are , in one embodiment , insulated with a silicon coating . the implant may be placed between the abdominal muscle and the skin . in the above embodiment , the stimulator is a totally implantable device . in an alternative embodiment , the stimulator may not be implantable . the stimulator in this embodiment may comprise a stimulator device having similar componentry to that discussed above in relation to the embodiment of fig3 , 4 and 5 , but being ranged to be placed externally of the patient . in one embodiment , signals are coupled to electrodes placed within the patient in order to stimulate the contractile tissue . coupling may be by way of inductively coupling the signals across the patient &# 39 ; s skin to an internally positioned electrode arrangement . in another embodiment , part of the stimulator componentry may be placed outside the patient and part inside the patient . in the above embodiments a single stimulation signal generator is used to provide the electrical signal . other embodiments may use two or more signal generators . other embodiments may use two or more stimulators , which may be placed in different locations . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive . in the claims which follow and in the preceding description of the invention , except where the context requires otherwise due to express language or necessary implication , the word “ comprise ” or variations such as “ comprises ” or “ comprising ” is used in an inclusive sense , i . e . to specify the presence of the stated features but not to | 0 |
fig3 shows a digital data sampling circuit 30 according to a first embodiment of the invention . digital data sampling circuit 30 comprises ( n − 1 ) stages flip - flop 32 ( 1st ˜( n − 1 ) th ), logic circuits ( 36 a , 36 b and 36 c ) and sample latch circuits 34 ( 1st ˜ nth ). each stage flip - flop 32 ( 1st ˜( n − 1 ) th ) respectively receives start pulse horizontal signal sth and clock horizontal signal ckh , and transmits and receives output signal ( out 1 , out 2 . . . out ( n − 1 )). each stage sample latch circuit 34 ( 1st ˜ nth ) serially receives digital data data according to each control signal ( sp 1 ˜ spn ). first stage logic circuit 36 a comprises an inverter 38 a and an and logic gate 39 a . inverter 38 a inverts second stage output signal out 2 from second stage flip - flop 32 ( 2nd ) and generates an inverting logic signal . and logic gate 39 a is coupled between inverter 38 a and first stage sample latch circuit 34 ( 1st ). and gate 39 a receives the inverting logic signal from inverter 38 a and first stage output signal out 1 from first stage flip - flop 32 ( 1st ) producing first control signal sp 1 . nth stage logic circuit 36 b comprises an inverter 38 b and an and logic gate 39 b . inverter 38 b inverts ( n − 2 ) th stage output signal out ( n − 2 ) from ( n − 2 ) th stage flip - flop 32 (( n − 2 ) th ) and generates an inverting logic signal . and logic gate 39 b is coupled between inverter 38 b and nth stage sample latch circuit 34 ( nth ). and gate 39 b receives the inverting logic signal from inverter 38 b and ( n − 1 ) th stage output signal out ( n − 1 ) from ( n − 1 ) th stage flip - flop 32 (( n − 1 ) th ) for producing nth control signal spn . according to the embodiment of the invention , each stage logic circuit 36 c may be an and logic gate . using a second stage logic circuit as an example , the second stage and logic gate 36 c is coupled between second stage sample latch circuit 34 ( 2nd ) and second stage flip - flop 32 ( 2nd ), and receives first stage output signal out 1 from first stage flip - flop 32 ( 1st ) and second stage output signal out 2 from second stage flip - flop 32 ( 2nd ) for producing second control signal sp 2 . fig4 shows first stage flip - flop 32 ( 1st ) and second stage flip - flop 32 ( 2nd ) according to the embodiment of the invention . the embodiment uses the d - type flip - flop as each stage flip - flop 32 ( 1st ˜( n − 1 ) th ) and the circuit structure of each two stage d - type flip - flops is similar . first stage flip - flop 32 ( 1st ) receives clock horizontal signal ckh and start pulse horizontal signal sth respectively and transmits first stage output signal out 1 . first stage flip - flop 32 ( 1st ) comprises inverters 43 ˜ 45 . the output of inverter 44 is coupled to the input of inverter 45 . the output of inverter 45 is coupled to the input of inverter 44 . inverter 43 receives and inverts start pulse horizontal signal sth and outputs to the input of inverter 44 . second stage flip - flop 32 ( 2nd ) receives clock horizontal signal ckh and first stage output signal out 1 respectively and transmits second stage output signal out 2 . second stage flip - flop 32 ( 2nd ) comprises inverters 46 ˜ 48 . the output of inverter 47 is coupled to the input of inverter 48 . inverter 46 receives and inverts first stage output signal out 1 and output to the input of inverter 47 . when clock horizontal signal ckh is at high voltage level , first stage d - type flip - flop 32 ( 1st ) transfers the voltage level of start pulse horizontal signal sth to first stage output signal out 1 . when clock horizontal signal ckh is at low voltage level , second stage d - type flip - flop 32 ( 2nd ) transfers the voltage level of first stage output signal out 1 to second stage output signal out 2 . the other stage flip - flop is similar to the above d - type flip - flop . fig5 shows that digital data data and control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) are synchronous according to the embodiment of the invention . using the digital data sampling circuit of the first embodiment of the invention illustrates the relationship of each signal in time domain . when one of control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) is triggered to high voltage level , the corresponding sample latch circuit 34 ( 1st ˜ nth ) receives digital data data . therefore , if it can trigger each control signal ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) in serial , it can serially transmit digital data data to an lcd display . in the first embodiment of the invention , clock horizontal signal ckh transmits to each stage flip - flop 32 ( 1st ˜( n − 1 ) th ) and triggers each stage flip - flop to receive output signal ( out 1 , out 2 . . . out ( n − 1 )) from each prior stage flip - flop . for example , when clock horizontal signal ckh is at high voltage level , first stage flip - flop 32 ( 1st ) receives start pulse horizontal signal sth and transmits first stage output signal out 1 to second stage flip - flop 32 ( 2nd ). when clock horizontal signal ckh is at low voltage level , second stage flip - flop 32 ( 2nd ) receives first stage output signal out 1 and transmits second stage output signal out 2 to third stage flip - flop 32 ( 3rd ). when first stage output signal out 1 is triggered to high voltage level and second stage output signal out 2 is at low voltage level , first inverter 38 a inverts second stage output signal out 2 to high voltage level . the inverting second stage output signal out 2 ( high voltage level ) and the first stage output signal out 1 ( high voltage level ) both input to and logic gate 39 a . thus , first stage control signal sp 1 is also triggered to high voltage level . when second stage output signal out 2 is triggered to high voltage level and first stage output signal out 1 is at high voltage level , simultaneously second stage control signal sp 2 is triggered to high voltage level and first control signal sp 1 switches to low voltage level . when n − 2 stage output signal out ( n − 2 ) is at high voltage level and n − 1 stage output signal out ( n − 1 ) is also triggered to high voltage level , n − 1 stage control signal sp ( n − 1 ) is triggered to high voltage level simultaneously . when n − 2 stage output signal out ( n − 2 ) switches to low voltage level , inverter 38 b inverts n − 2 stage output signal out ( n − 2 ) to high voltage level . inverting n − 2 stage output signal out ( n − 2 ) ( high voltage level ) and n − 1 stage output signal out ( n − 1 ) ( high voltage level ) both input to and logic gate 39 b . thus , n stage control signal spn is triggered to high voltage level and n − 1 stage control signal sp ( n − 1 ) switches to low voltage level . therefore , each control signal ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) is triggered to high voltage level serially . fig6 shows a digital data sampling circuit 60 according to a second embodiment of the invention . the difference between the first embodiment and the second embodiment is the circuit structure of the n stage logic circuit 66 . according to the second embodiment of the invention , an n stage logic circuit 66 comprises an inverter 68 and a nor logic gate 69 . inverter 68 inverts n − 1 stage output signal out ( n − 1 ) from n − 1 stage flip - flop 32 (( n − 1 ) th ) and generates an inverting logic signal . nor logic gate 69 is coupled between inverter 68 and n stage sample latch circuit 34 ( nth ). nor logic gate 69 bases on the receiving inverting signal from inverter 68 and n − 2 stage output signal out ( n − 2 ) from n − 2 stage flip - flop 32 (( n − 2 ) th ) to generate n stage control signal spn . fig7 shows a digital data sampling circuit 70 according to a third embodiment of the invention . the difference between the second embodiment and the third embodiment is the circuit structure of the first stage logic circuit 36 a . according to the third embodiment of the invention , a first stage logic circuit 76 comprises an inverter 78 and a nor logic gate 79 . inverter 78 inverts first stage output signal out 1 from first stage flip - flop 32 ( 1st ) and generates an inverting logic signal . nor logic gate 79 is coupled between inverter 78 and first stage sample latch circuit 34 ( 1st ). nor logic gate 79 bases on the receiving inverting signal from inverter 78 and second stage output signal out 2 from second stage flip - flop 32 ( 2nd ) to generate first stage control signal sp 1 . fig8 shows a digital data sampling circuit 80 according to a fourth embodiment of the invention . the difference between the first embodiment and the fourth embodiment is the circuit structure of the first stage logic circuit 36 a . according to the fourth embodiment of the invention , a first stage logic circuit 76 comprises an inverter 78 and an nor logic gate 79 . inverter 78 inverts first stage output signal out 1 from first stage flip - flop 32 ( 1st ) and generates an inverting logic signal . nor logic gate 79 is coupled between inverter 78 and first stage sample latch circuit 34 ( 1st ). nor logic gate 79 bases on the receiving inverting signal from inverter 78 and second stage output signal out 2 from the second stage flip - flop 32 ( 2nd ) to generate first stage control signal sp 1 . fig9 shows three kinds of logic circuits . a logic circuit 91 comprises an and logic gate 95 and an inverter 94 . a logic circuit 92 comprises an nor logic gate 97 and an inverter 96 . a logic circuit 93 comprises two mos ( metal oxide semiconductor ) transistors 99 and an inverter 98 . because the boolean result of three kinds of logic circuits in fig9 are the same , logic circuits 91 , 92 and 93 in fig9 have the same function and can substitute for logic circuit 36 a . for example , logic circuit 91 is logic circuit 36 a in fig3 and logic circuit 92 is logic circuit 76 in fig7 . fig1 shows three kinds of logic circuits . a logic circuit 101 comprises an and logic gate 105 and an inverter 104 . a logic circuit 102 comprises an nor logic gate 107 and an inverter 106 . a logic circuit 103 comprises two mos ( metal - oxide - semiconductor ) transistors 109 and an inverter 108 . because the boolean result of three kinds of logic circuits in fig1 are the same , logic circuits 101 , 102 and 103 in fig1 have the same function and can substitute for logic circuit 36 b . for example , logic circuit 101 is logic circuit 36 b in fig3 and logic circuit 102 is logic circuit 66 in fig6 . therefore , the digital data sampling circuit 60 in fig6 , the digital data sampling circuit 70 in fig7 and the digital data sampling circuit 80 in fig8 all have the same function which the digital data sampling circuit 30 in fig3 has . fig1 schematically shows another embodiment of a system for displaying images which , in this case , is implemented as a display panel 400 or an electronic device 600 . as shown in fig1 , the display panel 400 comprises a digital data sampling circuit 200 . the display panel 400 can form a portion of a variety of electronic devices ( in this case , electronic device 600 ). generally , the electronic device 600 can comprise the display panel 400 and a power supply 500 . further , the power supply 500 is operatively coupled to the display panel 400 and provides power to the display panel 400 . the electronic device 600 can be a mobile phone , digital camera , pda ( personal data assistant ), notebook computer , desktop computer , television , or portable dvd player , for example . according to the embodiment of the invention , digital data sampling circuit ( 30 , 60 , 70 and 80 ) can in advance generate control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ). for example , according to the embodiment of the invention , control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) of digital data sampling circuit 30 in fig5 are half clock period earlier than control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) in fig2 . therefore , it can use less delay buffers to achieve the same goal that digital data data and control signals ( sp 1 , sp 2 , sp 3 . . . sp ( n − 1 ), spn ) synchronize and consume less power , less layout area and cost less in circuit design . while the invention has been described by way of example and in terms of preferred embodiment , it is to be understood that the invention is not limited thereto . to the contrary , it is intended to cover various modifications and similar arrangements ( as would be apparent to those skilled in the art ). therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 6 |
referring now to the drawings and , first , particularly to fig1 thereof , there is diagrammatically and schematically shown therein a feeder of an otherwise non - illustrated sheet - processing machine in the form of a printing press . sheets 5 are taken from a sheet pile 6 by a non - illustrated conventional suction head , and transported to a conveyor table 1 . sheet transport in the region of the conveyor table 1 is either in single sheets or in shingled sheet streams . when a sheet 5 arrives at the conveyor table 1 , a cycled or timed feeder roller 7 sets down on the sheet and pushes it in a direction towards a conveyor belt 2 . in particular , the timed feeder roller 7 also serves to hold the leading edge of the sheet on the sheet conveyor table 1 until a suction box 4 , which is disposed below the conveying plane , assumes this task . by means of the conveyor belt 2 , which is guided over deflection rollers 3 , the sheet 5 is transported to front stops 8 of the conveyor table 1 . the sheet briefly comes to rest at these front stops 8 , and can then be transferred in - register to the printing press , which is represented by only one cylinder 9 thereof . a motor 10 is assigned to one of the deflection rollers 3 . according to the invention , this motor 10 is triggered via a velocity profile especially formed and optimally adapted to existing conditions in accordance with the printing - press operating cycle . this velocity profile is made available to the motor 10 with the inclusion of the signals of an angle encoder 12 by a computing and control device 11 . to the computing and control device 11 , there is also assigned a memory device 13 , in which the velocity profiles are stored both as a function of the angular position , as well as of the respective printing velocity . fig2 shows different velocity profiles 15 and 20 with which the motor 10 is triggered to drive the conveyor belt 2 . in particular , this fig2 shows velocity profiles for both maximum velocities v max1 and v max2 over the course of one machine revolution . both velocity profiles start at the same minimum velocity . this type of configuration offers the advantage that the setting of the feeder for all printing velocities is made uniform and thereby simplified . choosing the &# 34 ; maximum printing velocity &# 34 ; variable as a parameter in the velocity profiles affords the advantage that the separate drive for the conveyor table 1 can be adapted optimally to the maximum operating velocity of the sheet - processing printing press . the velocity profiles shown in fig2 have a characteristic shape : in the vicinity of the front lays 8 of the illustrated embodiment of fig1 i . e ., the region around 0 ° or 360 ° in fig2 the curves show a constant value , a so - called plateau . the curves also have a plateau in the region of the maximum velocity . this formation has a positive effect upon the synchronism of the feeder because , within certain given angular ranges , constant velocities of the conveyor belt are expected . in a region around the 180 ° angular position of the printing press , the drive of the conveyor belt 2 exhibits a further minimum which , however , does not reach the minimum velocity of the conveyor belt 2 . that minimum occurs in a region in which the feed roller 7 is set onto the sheet 5 and the sheet stream , respectively . the reduction in the velocity of the conveyor belt 2 in this region is selected precisely so that negative effects of the timed feed roller 7 on sheet advancement will be virtually entirely compensated for . without major problems , the device according to the invention is also suitable for compensating for errors in adjustment of the velocity of the conveyor belts 2 , by means of suitably modified velocity profiles in the drive of the conveyor belt 2 . for that purpose , the pressman is given the opportunity , via a device 14 , of making a corrective change in the particular velocity profile being used . in an advantageous further feature of the device according to the invention , as shown in another embodiment thereof in fig3 sensors 16 are provided for detecting so - called &# 34 ; out - of - square or misaligned , late or early sheets &# 34 ;. the sensors 16 are disposed in the front region of the conveyor table 1 , in the vicinity of the front stops 8 , and are connected to the computing and control device 11 by suitable conducting elements ( electric lines or leads ). fig4 represents a further development of velocity profiles in the field of industrial process technology , which simultaneously takes into account both early and late sheets . the mean velocity v of the conveyor belt 2 is so modulated in velocity profile 17 during one revolution ( 360 °) of the sheet - processing machine that only one velocity minimum 18 is present . this velocity minimum is advantageously shifted into the region of sheet arrival at the front stop 8 of the sheet - processing machine and is kept constant over an angular range 22 , which corresponds to the inaccuracy of sheet arrival . consequently , within the limits of permissible sheet arrival inaccuracy , all the sheets have the same low sheet arrival velocity and , as a result thereof , an exact alignment of the sheet 5 can be assured prior to the transfer of the sheet to the sheet - processing machine . a velocity maximum 19 is preferably located in a region in which there are no feeder events critical to the paper path , preferably approximately 180 ° away from the velocity minimum 18 , so that the necessary accelerations can still be maintained . referring to fig3 by defining the overlap length s of the successively transported sheets 5 as an integral divisor n of the conveying table length l , so that n × s = l ( where n = 1 , 2 , 3 , . . . ), the preferred conveying state is obtained , wherein a sheet 5 to be fed to the front stops 8 is slowed down precisely in the region minimum velocity represented in the characteristic curve 17 when a trailing sheet 5 , which is offset in accordance with the number of overlaps s on the conveyor table 1 , is transported by means of the feed roller 7 onto the conveyor table 1 . accordingly , during the operation of the sheet - processing printing press , both the overlap or stagger length s and , with reference thereto , the course of the velocity profile 17 can be varied . a further modification , i . e ., shift , in the velocity profile 17 takes place within the context of sheet arrival regulation or control : upon a detection of early and late sheets , respectively , by the sensors 16 , the velocity profile 17 , i . e ., the characteristic curve of the mean velocity course of the conveyor belt 2 , is lowered and raised , respectively , by means of the computer and control device 11 , by a value corresponding to the amount of failed arrival of the sheet 5 . if an early sheet is detected , a &# 34 ; negative offset &# 34 ; results , which is a parallel shift of the velocity profile 17 downwardly . if a late sheet is detected , a &# 34 ; positive offset &# 34 ; results , which is a parallel shift of the velocity profile 17 upwardly . the raising and lowering of the velocity profile as a function of the sheet arrival measured by the sensors 6 leads to an overlap or stagger length which varies continuously during operation of the sheet - processing machine . accordingly , the location of the velocity minimum 18 relative to the sheet arrival at the front stops 8 and relative to the paper transfer to the conveyor table 1 by the feed roller 7 is advantageously not shifted , and constant transfer conditions are thereby achieved . in an advantageous further development of the method according to the invention , it is proposed that the velocity profiles are so formed as to be a function of the material to be imprinted . fig5 shows not only the contemplated velocity profile 17 , which in essence corresponds to a velocity course for cardboard or pasteboard , but also a further velocity profile 21 , which by way of example is employed with thin paper , such as onionskin paper . onionskin paper , because of its very low inertia , has a favorable or , in other words , reduced tendency to slip relative to the conveyor belt 2 , so that with onionskin paper , greater accelerations of the conveyor belt 2 can be performed and , accordingly , lower velocity minimums can be achieved , which in turn lead to reduced paper deformations at the moment the sheet arrives at the front stops 8 . conversion from one velocity profile 17 to another , for example to the velocity profile 21 , is effected by means of the input device 14 . naturally , measuring instruments for measuring the sheet thickness , and so forth , may also be provided , which transmit the measurement values directly to the computer and control device 11 , so that an automatic conversion is also possible . in this regard , ( standard ) velocity profiles stored in the memory device are called up by the control or regulating device as a function of the material being imprinted in order to regulate the motor 10 . the velocity profiles , adapted individually to the quality , thickness and size of material being printed on , differ in number and location from freely selectable velocity specifications for freely selectable angular positions . thus , even the acceleration conditions can be varied in the individual velocity profile segments . a given final predetermined value , respectively , for the angle and appertaining velocity within a velocity profile , preferably the maximum 19 , is selected so that the desired overlap or stagger length s is established , or in other words the area below the velocity profile 19 becomes as large as the area below the mean velocity value . depending upon the quality , thickness , size , and so forth , of the material being printed on , individually desirable velocity profiles 17 , 21 can be transmitted to the computer and control or regulating device 11 by means of the input device 14 . the slopes , zero points and turning points for the desired velocity profile 17 , 21 can be selected freely . in controlling or regulating the velocity of the conveyor belt 2 , the computer and control or regulating device 11 provided for controlling the electric motor 10 receives a signal which is a function of the velocity of the sheet - processing machine . a signal stored in the memory device 13 , with one minimum 18 and one maximum 19 per machine cycle , is superimposed on the aforementioned signal . in addition , as a consequence of the measured sheet arrival , a signal is generated and fed to the computer and control or regulating device 11 , and the overall result thereof is a raising or lowering , respectively , of the conveyor belt velocity . a suitable input device 14 and memory device 13 are provided in a personal computer such as that of the digital equipment corporation . the computer / control device 11 may be a microcomputer such as that known as type t805 - 6255 of the firm inmos or may also be a personal computer such as that of the aforementioned digital equipment corporation . | 1 |
the door assembly illustrated in fig1 , generally referred to as 10 , includes : a frame assembly 20 , a prime door 40 , and a screen door 60 . frame assembly 20 has a u - shaped main frame member 21 with an open lower end 211 , which is closed by an extruded aluminum threshold 23 , attached to the main frame member by screws ( not shown ) that extend through the frame member into semicircular screw bosses 233 shown in fig2 . threshold 23 rests on the body of the vehicle v in which the door assembly is installed . as shown in fig2 and 3 , the main frame member is fastened to the vehicle by screws ( not shown ) extending through a mounting flange 213 and a layer of butyl tape 33 , which seals any gaps between the main frame member and the side of the vehicle . a screw cover 31 , which snaps into mounting flange 213 , covers these screws . a laterally extending flange 29 on the main frame , and a trim ring 39 , attached to the inner wall of the vehicle , close any gaps between the inside wall and the frame . a sill filler strip 27 , attached to the vehicle by screws ( not shown ) extending through the filler strip and through a layer of butyl tape 33 , closes any gap between the lower edge of the threshold and the vehicle . the doors are attached to the frame by three hinge assemblies 80 , shown in fig3 , 4 , and 6 - 10 . each hinge assembly consists of a fixed leaf 81 bolted to the main frame 21 , a prime leaf 83 which supports the prime door 40 , a screen leaf 85 which supports the screen door 60 , and associated hardware described below . fig3 provides a horizontal cross - sectional view of a hinge , with the doors in the closed position . the enlarged fragmentary cross - sectional view in fig4 shows the frame 21 and screen door 60 rotated clockwise 90 ° and 45 °, respectively , for ease of understanding . the prime door 40 has a core 41 of an expanded material such as polystyrene , a smooth skin 43 of a material such as fiberglass or aluminum on the outside of the core , and a similar smooth skin 45 on the inside of the core . a generally u - shaped steel stile 47 protects the edges of the foam core , and provides substantial strength and rigidity . the inner and outer skins 43 , 45 , are laminated to the core 41 and to the stile 47 . as also shown in fig2 - 4 , an extruded aluminum door surround 49 encloses and reinforces the outer and inner door skins 43 , 45 and the stile 47 . surround 49 has a seal flange 491 which , in connection with hinge assemblies 80 , supports a substantially continuous weather seal assembly 55 , as explained below . an unbroken u shaped weather seal member 555 , mounted in cruciform - shaped kerfs 493 in the door surround seal flange 491 , and in kerfs 835 in the prime hinge leafs 83 , as shown in fig8 a , 8 b and 10 , provides an unbroken u - shaped weather seal around the sides and top of the prime door 40 . weather seal member 555 , in conjunction with a lower seal member 553 mounted in the door surround seal flange 491 at the bottom of the prime door , forms a substantially continuous unbroken weather seal 55 around the prime door . the kerf 835 in the prim hinge leaf 83 supports weather seal member 555 , as shown in fig7 and 8b , across the notch 816 ( in the fixed hinge leaf 81 ) or the prime hinge leaf . the kerf 493 in surround seal flange 491 supports the weather seal 555 around the rest of the main frame , as shown in fig8 a and 10 , and supports the weather seal assembly 553 across the bottom of the door . kerfs 493 and 835 are aligned . thus , they provide continuous support for the unbroken weather member 555 , and eliminate any requirement for short seal pieces in the hinge area . as shown in fig5 , weather seal members 555 and 553 have two parts : a relatively rigid spine 551 which is inserted into kerfs 493 and 835 , and a more flexible serpentine member 557 . the spine is preferably made of a relatively rigid material such as polypropylene , and the serpentine member is preferably made of a more flexible material such as santoprene ® shore 65a flexible , which are made by monsanto . these materials can be co - extruded to make a single integrated strip . a noise reduction seal 57 may optionally be used with weather seal member 555 . as shown in fig5 and 10 , noise reduction seal 57 is l - shaped . the shorter leg fits into the outer curve of the seal member 555 . adhesive secures the other leg to the outside of the door surround seal flange 491 . when used , the noise reduction seal preferably extends from the threshold to the top of the straight portion of the hinge side of the prime door . the noise reduction seal may be an extruded foam . when the prime door is closed , weather seal 55 presses against a substantially continuous and coplanar sealing surface formed by main frame member 21 , threshold 23 , and the hinge assemblies 80 . as best seen in fig6 and 10 , the main frame member 21 has an outwardly extending rib 35 with an outwardly facing surface 215 which is one of the main parts of this continuous sealing surface . the threshold 23 has a similar outwardly facing surface 235 . as may be seen in fig2 , surfaces 215 and 235 are substantially coplanar , and are substantially parallel to the outer and inner skins 43 , 45 of the door when the door is closed . as also best seen in fig6 , the rib 35 on the main fame has notches 37 for the hinge assemblies 80 . similarly , the fixed leaf 81 of each hinge assembly has notches 813 for the screen door leaf . the outwardly facing , unnotched sections 215 of the main same seal rib 217 , the outwardly facing , unnotched sections of the fixed hinge leaves and the outwardly facing sections 853 in the screen hinge leaves 85 are substantially coplanar and provide a continuous outwardly facing sealing surface across the hinges . thus , an unbroken seal can be provided across the hinges with a single unbroken weather sealing member 555 , which contributes significantly to performance , dependability and manufacturing economy . referring to fig6 and 10 , there are two small ribs 821 on the back side of the rearwardly extending or laterally facing step 823 in the fixed hinge leaf 81 . they minimize the risk that flash or scrap from the cutting of the notches 813 in the fixed hinge leaf will keep the hinge assemblies from being positioned properly in the main frame notches 219 . the main frame member , hinge assemblies and prime door are also designed for ease of assembly and structural integrity . as best seen in fig4 , the main frame assembly has a groove 221 20 with an inwardly sloping or dove - tailed side 223 . the fixed hinge leaf and screen hinge leaf have ribs ( 815 and 855 respectively ) with complimentary front edges 817 , 857 that fit into and interlock with the sloping side 223 of groove 221 . this facilitates alignment of the hinge assembly during assembly , and provides additional strength . in addition to providing a continuous mount for weather seal member 555 , as described above , prime hinge leaf 83 and door surround 49 contribute to ease of assembly , structural integrity , and effective sealing . as may be seen in fig8 a and 8b , a rib on the door surround seal flange 491 extends into a mating groove 837 on the prime hinge leaf 83 . this ensures perfect alignment of the kerf 493 in the surround and the kerf 835 in the prime hinge leaf , and also contributes to structural rigidity . the prime hinge leaf also has a rib 839 , on the opposite side of the leaf from groove 837 . as seen in fig1 , this closes the gap created by the notch 815 for the prime hinge knuckle 831 when the prime door is closed . the weather seal provided by seal assembly 55 is supplemented by a screen door seal assembly 61 , shown in fig2 , consisting of a u - shaped strip 611 of pile , preferably polypropylene , mounted in a screen door seal flange 221 at the inner end of mainframe member , and a similar strip 613 , mounted in the bottom of the screen door . as best seen in fig6 , the filler plug 24 has a rib 241 which fits into the groove 222 in the main frame member , and 2 prongs 243 which are inserted into spaces in the outer ( and lowest ) section of threshold 23 . as best seen in fig7 , the fixed hinge leaf has three knuckles 811 for a hinge pin 91 . these knuckles are separated by two notches : a smaller notch 814 for the prime hinge leaf 83 and a larger notch 815 for the screen hinge leaf 85 . the prime hinge leaf and screen hinge leaf have similar knuckles ( 831 and 851 respectively ), partially cut away to accommodate acetal plastic hinge bushings 87 , which are inserted into the top of the bores 825 in the fixed hinge leaf knuckles 811 and the bottom of the bores 845 , 856 in the prime hinge leaf knuckle 831 and screen hinge leaf bushing 851 . hinge pin 91 extends through the bushings , through plugs 89 in each knuckle , one of which is illustrated in the cut - away portion of the screen leaf bushing in fig7 , and through a washer 93 beneath the lowest fixed hinged bushing . the lower end 91 of the hinge pin is swedged to provide a secure assembly . with the positive location afforded by the notches in the weather seal rib 217 , the hinge assemblies lend themselves to removal of an entire door and / or replacement of an individual hinge , if damaged through negligence . the bushings in hinge knuckles 811 , 831 and 851 may be designed to hold one or both doors in a certain open position . fig9 a and 9b illustrate two types of bushings 86 , 88 . the bodies 861 , 881 of both bushings , i . e . the smaller parts of the bushings that are inserted into the bores in the hinge knuckle , have a number of relatively narrow , “ v ” shaped ribs 871 , 891 designed to fit into complimentary v shaped grooves in the bores of the hinge knuckles 811 , 831 and 851 , best seen in fig1 , and one or more wider ribs designed to fit into wider grooves 823 in the bores of the knuckles . as best seen in fig1 , the illustrated bores and bushings have two wider grooves or ribs , on opposite sides of the bore or bushing . thus , the illustrated bushings can be inserted into the illustrated bushings in two positions , 180 ° apart . bushing 86 has a head 875 with a flat contact surface 876 that does not influence the position of either door , but indexing bushing 88 is designed to hold either door in place when it is opened 90 °. the head 885 of the indexing bushing 88 has two steps 886 on opposite sides of head 875 , and two indentation is 887 separating the steps . inclined surfaces 888 connect the steps and indentations . each of the steps and indentations surfaces spans an arc of approximately 30 ° with these indexing bushings , the steps 886 of the bushings in the prime hinge knuckle 831 and the screen hinge knuckle 851 rest on the steps 886 of bushings in fixed hinge knuckles 811 when the doors are closed . however , when a door is opened 90 °, the steps of the bushings in the pivoting leaves will rest in the indentations of bushings in fixed hinge knuckles 811 , and the door will remain in this position until it is closed , manually , or opened further . the doors described above are considerably thicker than conventional doors . this provides extra stiffness and allows the doors to be manufactured as a flat assembly , unlike conventional doors that bowed to provide compression against seals to provide additional compression against seals and reduce door vibration and “ flutter ” in motion . the ability of the doors to seal as a flat rather than a concave assembly reduces closing force and adds to the perceived quality of the door during operation . as those skilled in the art will recognize , the structures described above , shown in the accompanying drawings and defined by the following claims offer substantial advantages over door assemblies previously available for recreational vehicles , including a substantially continuous sealing surface around the entire periphery of the main door frame , which in turn makes it feasible to use a substantially continuous weather seal around substantially the entire periphery of the door , including the area where the hinges are mounted . the substantially continuous sealing surface is formed , in part , with an interfitting frame and hinges . the hinges are also mechanically locked into the frame , which increases structural integrity and eases assembly . knuckles of the pivoting leaves of the hinges are spaced from the fixed leaf knuckles by bushings , and further separated from the hinge pin by plugs . the bushings and plugs eliminate metal - to metal wear . the bushings may also serve as indexing function , holding the doors in position when open . of course , those skilled in the art will readily appreciate that many modifications may be made in the structure disclosed above . the foregoing description is merely illustrative , and is not meant to limit the scope of this invention , which is defined by the following claims . | 8 |
the present invention adapts electrical - based metrology of near surface doping ( nsd ) using surface photovoltage ( spv ) to meet the requirements of the semiconductor industry in terms of sensitivity and reproducibility of implant dose and energy measurements . the method in the present invention consists of the following principal steps : 1 : forming a dielectric layer ( preferably a layer of thermally grown oxide ) on the semiconductor surface followed by the determination of the nsd using spv . the latter makes use of the non - equilibrium depletion transient condition created by charging the semiconductor surface with charge density , q ( c · cm − 2 ). the relationship between q and said depletion layer is shown in equation 1 : where w is the depletion width , q s , is the induced charge density and na is the acceptor density . when a known amount of charge , of density q , is injected into a semiconductor surface , a portion of the induced charge may be imaged into the semiconductor space charge region , while the rest will be imaged into the interface traps between the layer of native oxide and the semiconductor surface . as native oxide is known to be very leaky , the decay of resulting surface barrier ( v sb ) is expected to behave as shown in fig1 . in order to confine the induced charge density , q s , within the semiconductor depletion layer , a layer of a good quality dielectric ( preferably thermal oxide ) is formed on the semiconductor surface prior to implantation . alternatively , this dielectric layer can be grown after implantation as part of the activation process . normally , rapid thermal annealing ( rta ) is used as the activation process after implantation . however , in order to grow this dielectric layer after implantation , rta can be replaced by rapid thermal oxidation . having the surface of the semiconductor capped with thermal oxide helps to minimize the density of surface traps and charge leakage . 2 : tailoring the implant profile so that implanted peak concentration is at or close to the dielectric - semiconductor interface . the effective depth of nsd measurements relates to the semiconductor depletion layer . eqn . ( 2 ) shows the relationship between the depletion width , w , the surface barrier , v sb , and the doping , n a : w =[ ( 2 ∈ 0 ∈/ q · n a )·( v sb − kt / q )] ½ eqn . ( 2 ) where ∈ 0 is the permitivity of free space , ∈ is the si dielectric constant , q is the elementary charge , and kt is the thermal energy . depletion width , w , is dependent on the junction voltage , thus a change in bias will bring about readjustment of w to a new appropriate value . the various examples shown in fig2 are plots of resistivity as a function of distance from the oxide - semiconductor interface . as shown there , when the bias changes between q + δq and q − δq , the depletion width varies by w ± δw . the doping concentration in the depletion region , which corresponds to the area under the curve there , will also therefore vary . under conditions of non - uniform doping , measurements done where the implant profile slopes significantly are highly susceptible to the introduction of variations in w ( fig2 a examples ) as compared with measurements done at the peak of the implant profile ( see fig2 b examples ). if the depletion width remains unchanged for every measurement , as shown in fig3 a and 3 b , changes in dose can still be accurately resolved . however , a surface concentration that changes as the depletion width changes ( going from 3 a to 3 c ) will result in large errors because of the varying nature of the implant profile slope . however , if the concentration within the original and expanded depletion regions is relatively flat ( going from 3 b to 3 d ) the possibility for error is greatly reduced . thus , it is necessary to adjust the implant profile so that its peak comes closer to the semiconductor - dielectric interface . there is more than one way to tailor the implant profile . by varying the thermal oxide thickness and freezing the implant energy or by varying the implant energy based on a fixed thermal oxide thickness . to confirm the effectiveness of the invention , the second way was selected . a layer of thermal oxide having a thickness of 10 nm was formed on the semiconductor wafers . these oxidized wafers are implanted with boron at different implant energies ranging from 16 kev to 20 kev so as to determine the optimum implant energy . the nsd of the wafers were then measured for different surface barrier voltages ( v sb ) using spv techniques on our equipment ( sdi faast230 ). as seen in fig4 , doping at an implant energy of 18 kev provided the flattest curve , implying that , at this implant energy , the concentration is least dependent on v sb . 3 : determining the surface barrier , v sb , measurement range such that surface concentration is independent of v sb for a given implant dose : from the experimental result obtained in step 2 , it is possible to determine a range of surface barrier voltage over which the nsd remains relatively constant for small changes in the surface barrier voltage . in this invention , nsd remains almost constant for v sb ranging from 0 . 29 v to 0 . 36 v at 18 kev . this constant v sb range is different for different implant energies , as shown in fig4 . 4 : selecting v sb for starting measurement and determine the total amount of charge density needed to bias surface into the space - charge region . as the initial surface condition of a si / sio 2 is arbitrary , v sb on the oxidized semiconductor surface has to be adjusted so as to ensure that it is biased into depletion at the start of the optimum range . this adjustment is done by introduction of charges to bias the semiconductor surface . in order to determine the total amount of charge density needed to bias the surface into space - charge measurement , repetitive charging and contact potential difference measurements were performed . fig5 shows the results of the measurements with interface traps both present and absent . when there is no interface trap , as shown in fig5 ( a ), total amount of charge needed to bias the semiconductor surface is q c at v sb = 0 . 29 . however , in the presence of interface trap 51 , as shown in fig5 ( b ), a plateau occurs at v sb = 0 . 29 . selecting the correct v sb is important if interface traps are to be avoided . in the case of fig5 ( b ), when v sb = 0 . 20 the total amount of charge required is q c1 but when v sb = 0 . 35 the total amount of charge required is q c2 which can then be selected . 5 : compensating for variations in the initial wafer surface condition by controlling the charging dose and sequence . after the total amount of charge density needed to bias surface into space - charge measurement for a predefined v sb has been determined , the next step is to define the charge density for each successive pulse of charging . this is done by dividing the total charge density by half the allowed charging sequence provided by the equipment . as illustrated in fig6 , a single pulse of large charge ( e . g . 1 . 3e12 c / cm 2 ) can bring about large variations in the surface barrier for the starting measurement due to the initial surface variations . so , instead of applying a single charging pulse to bias the surface barrier into depletion , the charging dose is reduced to ( e . g . 2 . 2e11c / cm 2 ). each small pulse is then successively applied until the predefined v sb ( e . g . 0 . 20v ) is reached . using this technique , the number of pulse required to bias v sb to 0 . 20v can be varied to ensure that every measurement starts at almost the same surface barrier setting for all wafers , despite wide initial surface variations . 6 : obtaining spv signals to determine the near surface doping concentration . the spv measurement to determine the nsd value is performed . for the present invention this measurement was performed using metrology tool , sdi faast230 . as the noise of a spv signal can also contribute to the reproducibility problem for such a measurement , the filter of the doping diode in the measuring tool was replaced to enhance the signal - to - noise performance . such filter replacement may not be necessary for other spv measurement tools . implementing the methodology of the present invention , as detailed in the above steps , has resulted in a tremendous improvement for electrical - based measurement of ion implant dose in terms of reproducibility and sensitivity , as shown below in fig7 and 8 respectively . highly reproducible measurements of dopant concentration , especially for low dose implants . highly sensitive measurements of dopant concentration , especially for low dose implant ; can serve as a powerful resource for process improvement , monitoring , and control of the implant process . can give early warning of potential problems if incorporated in spc control . | 6 |
the preferred embodiments of the present invention will now be explained with reference to the accompanying drawings . it should be understood however that the disclosed embodiments are merely exemplary of the invention , which may be embodied in various forms . the following description and drawings are not to be construed as limiting the invention and numerous specific details are described to provide a thorough understanding of the present invention , as the basis for the claims and as a basis for teaching one skilled in the art how to make and / or use the invention . however in certain instances , well - known or conventional details are not described in order not to unnecessarily obscure the present invention in detail . in one embodiment , the present invention provides a method for tracking the mobile equipment ( me ) by initiating the me to detect possible misuse ( i . e ., when the phone is stolen and subscriber identity module / user services identity module ( sim / usim ) replaced , or if the device is not a phone , when the device accesses a network ), and reporting the misuse to the actual mobile device owner , without the network initiating any queries . fig2 illustrates a block diagram of a mobile electronic device according to the present invention used within a telecommunications network . in fig2 , the mobile electronic device includes a tracking control module 100 , which described below with respect to fig3 . in operation , whenever the sim / usim card is changed or powered up with a different sim / usim card , the mobile device automatically send an alert - sms / mms / email to a preset destination . the mobile device also initiates the camera application , stealthily , ( e . g ., without showing a preview screen on the device display and then captures a few pictures or records a short video clip which is configurable , depending on available memory . these pictures or video clips will then be sent to a preset destination stored in the device by the original user using a multimedia message service ( mms ) or email . furthermore , the mobile device provides the user with a menu option having password protection or a tracking control key ( tck ). in this case , the menu option choices allow the user to turn on / off password protection feature , to edit the destination email - address / phone number , or to edit the user - defined part of the message content for sending the alert sms / mms / email . when the user tries to activate the tracking feature , the user is prompted for the tracking control key . to access / change the alert - message destination and the customizable contents , the user has to input the tracking control key . if the user wishes to access / change a password , a destination email - id / phone number , or a customized message content for sending the sms / mms / email message , the configured password has to be input by the user . in the sms / mms / email message , the location information and mobile station integrated services digital network / international mobile subscriber identity ( msisdn / imsi ) of the current user is included in addition to customized message . the user - authentication information stored in the nvram is the imsi of the current sim / usim card for a mobile phone supporting the sim / usim card . if there is no sim / usim card , the user is prompted to insert the sim / usim card . if the initial attempt to send an sms / email fails , the mobile device keeps trying periodically or with increased delay after each attempt , until successful , where the number of permitted attempts is preset in the mobile device . if the sim / usim card of the new user has ‘ outgoing calls barred ’ option already set , when the card is inserted the mobile device sends an alert sms / mms / email when call barring is removed . fig3 illustrates a block diagram of the tracking control module of the mobile electronic device according to the present invention . in fig3 , there is shown a tracking control module , including a tck authentication module 110 , a customization module 120 , a subscriber identity module / universal subscriber identity module ( sim / usim ) info access module 130 , a location information access module 140 , a call barring status check module 150 , an info display module 160 , a network - access check module 170 , and a camera module 180 . the tck authentication module 110 handles activation / deactivation of tracking control and for accessing the customization of the information to be sent in the message . the customization module 120 maintains the message format and content information . the sim / usim information access module 130 receives the required information ( e . g ., the imsi , the call barring status , etc .) from the sim / usim and detects a change of sim / usim card . the location info access module 140 receives the information concerning the current location information of the device , if the user has opted for it to be sent in an alert message . the call barring status check module 150 , if an outgoing call is barred , periodically checks if the status has changed and sends the alert message . the network access check module 170 detects if a mobile device does not use a sim card and thus triggers the alert sms / mms when the mobile device is connected to a network . the camera module 180 stealthily takes pictures or video clips whenever a new sim / usim card is detected . these pictures and video are included as part of the mms or email which is sent to a pre - defined destination as determined by the mobile device user . in another embodiment , the tracking control module 100 includes an instant messaging module , which has instant messaging applications . fig4 illustrates a process of activating the tracking control feature of the tracking control module of the mobile device according to the present invention . when the user tries to activate the feature , the user is prompted for a password ( i . e ., the tracking control key ( tck )). thereafter , the user is prompted for the alert - message destination and optionally the customizable contents of the alert message . the tracking control module is then activated . if the user then chooses to access / change any of these features , the tck has to be input by the user . in the alert - sms / mms / email - message , the location information , mobile station integrated services digital network / international mobile subscriber identity ( msisdn / imsi ), etc . of the current mobile device user can be included , in addition to any user - defined text information . the mobile device then initiates the camera application ( without activating the display preview setting on the display module ), and through the camera module takes a few pictures or records a short video clip of the immediate surroundings . advantageously , with a non - activated display preview , the non - authorized users of the mobile device will be unaware that their actions are being recorded . furthermore , these recordings may be stored in memory unit of the mobile device . also , these recorded pictures or video clips will then be sent to a preset destination stored in the mobile device by the original owner using the mms feature . these picture and video recordings can also be sent if the sim is supporting general packet radio service ( gprs ) or third generation ( 3g ) services , even by email . in addition , with the user - authentication information which accesses the sms / mms / email message , the destination email address / phone number , or any other pre - defined text to be sent will be stored in non - volatile random access memory ( nvram ) of the mobile device . in the present invention , when the tracking control feature is activated as for a mobile device supporting a sim / usim card , the imsi of the current sim / usim card is stored in the nvram , or if there is no sim / usim card , the user is prompted to insert sim / usim card . once the tracking control feature is successfully activated as above , whenever a new sim card is inserted , the device will compare the imsi stored in the nvram with the new imsi and if there is a mismatch , will send an sms / mms / email to the destination that was specified by the owner . the current location information of the mobile device ( based on the location identity ) as obtained from the radio access technology ( e . g ., global system for mobile communications / universal mobile telecommunications system / code division multiple access ( gsm / umts / cdma )), will also be included in the message . if the initial attempt to send the sms / mms / email message fails , the device keeps trying periodically until successful . here , the number of times the mobile device tries to send the sms / mms / email message can be configured by the user through the mobile device . however , if the sim / usim card of the new user has an ‘ outgoing calls barred ’ option already set , when the sim / usim is inserted , the device can be programmed to remember that the sim / usim card was changed and can , subsequently , send the sms / mms message later when the call barring function is removed . fig5 illustrates a sequence of events between various functions when the tracking feature of the mobile device is activated according to the present invention . when the device is powered on in step 501 the sim / usim information access module 130 is initialized and receives the required information from the sim / usim , like , for example , imsi data and call , barring status etc , and detects the change of sim / usim card . if the tracking feature is enabled , the current imsi value is retrieved from the sim and compared with the nvram information in step 505 wherein the user - authentication information for accessing the sms / mms / email message feature , the destination email address / phone number , and any predefined text to be sent are stored . if the imsi from the sim is the same as that stored in the nvram , the sim / usim information access module 130 takes no action in step 507 . otherwise , the imsi mismatch flag is set in step 509 . if the mismatch flag is set , the system then checks whether the registration has been successful or not in step 515 . if it is not successful the system waits until the registration status changes in step 521 . if the registration is successful the system checks whether the outgoing calls are barred . if the outgoing call is barred then the system waits until the call barring status changes . on change of call barring status , the system checks whether the tracking feature is enabled and the imsi mismatch flag is set . moreover , if the user wanted to include location information , the location information access module 140 is activated to obtain location information . the camera module 180 is initiated without showing the preview display setting on the display , and takes on or more pictures or a video snapshot of the immediate surroundings . a sms / mms / email message is then sent to a configured destination from the tracking control module 100 with all the relevant data in step 517 . if the user has specified both a phone number and an email id , then the sms , mms and email are sent . moreover , the sms / mms / email are sent multiple times to increase reliability in step 519 . thereafter , the system then checks whether the secret sms / mms / e - mail has been send successfully in step 523 . if transmission of the sms / mms / email is successful , the process ends , or the mobile device may continue sending the sms / mms / email with an increased delay between each attempt to increase transmission reliability and to ensure that the mobile device owner receives any other related details in step 525 . however , if the message was not sent successfully , a staggered periodic timer is initialized . upon expiration of the timer , the system tries to send an alert sms / mms / e - mail to the configured destination from tracking control module 100 with all the relevant data . if transmission is not successful , the system increases the timer duration in step 527 and restarts the timer and repeats the process . it will also be obvious to those skilled in the art that other control methods and apparatuses can be derived from the combinations of the various methods and apparatuses of the present invention as taught by the description and the accompanying drawings and these shall also be considered within the scope of the present invention . further , description of such combinations and variations is therefore omitted above . it should also be noted that the host for storing the applications include but not limited to a microchip , microprocessor , handheld communication device , computer , rendering device or a multi function device . although the present invention has been fully described in connection with the preferred embodiments thereof with reference to the accompanying drawings , it is to be noted that various changes and modifications are possible and are apparent to those skilled in the art . such changes and modifications are to be understood to be within the scope of the present invention as defined by the appended claims . | 7 |
the compounds of formula iv wherein hal is iodo are novel compounds . they may be prepared from the known compound 2 - amino - 4 , 5 - difluoro benzoic acid by reaction with sodium nitrite in a solution of dilute sulfuric acid at a temperature of about - 10 ° to 0 ° c . and ambient pressure . the formed diazonium compound is then treated with a solution of potassium iodide in dilute sulfuric acid at a temperature between about - 10 ° to 0 ° c ., and the resulting dark slurry stirred for about 12 to 24 hours on slow warming to ambient temperature . the preparation of anthranilic acid compounds of the formula iii from compounds of the formula iv proceeds in the presence of catalytic amounts of copper ( 0 ) or a copper compound such as cupric oxide or cuprous oxide , or a copper salt such as cupric acetate , cupric sulfate , cupric chloride , cupric bromide , cupric triflate , cuprous chloride , cuprous bromide , and cuprous triflate . the copper catalyst is generally present in amounts of at least about 5 mole %, and generally about 10 to 20 mole %. the reaction is in the presence of an inert , dipolar , aprotic solvent such as dimethylformamide , tetrahydrofurane , dimethoxyethane , n - methyl - pyrrolidinone , dimethyl acetamide or dimethyl sulfoxide , and in the presence of an organic base such as pyridine or dimethylaminopyridine in the optional presence of a tertiary amine base such as triethyl amine or diisopropylethyl amine . the organic base is generally present in amounts of 1 to 2 mole equivalents , usually 1 . 5 mole equivalent . the reaction temperature depends on whether hal in formula iv is iodo , bromo or chloro . when hal is iodo , the reaction may be conducted at about 10 ° to 40 ° c ., and advantageously at ambient temperature such as about 20 ° to 25 ° c . when hal is bromo , the reaction temperature is from about 20 ° to 50 ° c . when hal is chloro , the reaction temperature is about 50 ° to about 100 ° c ., generally about 70 ° c ., and the reaction is conducted in a sealed vessel causing a reaction pressure of between one atmosphere to about two atmospheres . when hal in formula iv is iodo or chloro , the reaction is at least initially in the absence of air , for instance by introduction of an inert gas such as nitrogen into the reaction vessel , or by conducting the reaction in a sealed vessel . it was found that high yields are obtained by using about two mole equivalents of the reagent of the formula r 3 nh 2 , about 1 . 5 mole equivalents of the organic base pyridine in dimethyl formamide , and about 0 . 2 mole equivalent of the copper catalyst . the reaction may also be conducted with one equivalent of r 3 nh 2 , one equivalent of copper or its salts and 1 . 5 equivalent pyridine in dimethyl formamide . the isatoic anhydrides of formula ii are prepared from compounds of formula iii by reaction with a reagent of the formula r 5 r 6 c ═ o wherein r 5 and r 6 are as defined above . for instance , the reagent is phosgene or , preferably , bis -( trichloromethyl ) carbonate ( triphosgene ) which is commercially available and , as a solid , is easy to handle . when the above reagent is a solid , the reaction is conducted in an inert solvent such as a chlorinated alkane , e . g . methylene chloride , chloroform , carbon tetrachloride or dichloroethane , or an aromatic solvent such as toluene , benzene , or xylene . the reaction is conducted at about - 10 ° to 15 ° c . for about 15 minutes to 1 . 5 hours , usually for half an hour . when the reagent is phosgene , the solvent may also be an aqueous acid such as hydrochloric acid . when the reagent is a liquid such as methyl chloroformate or ethyl chloroformate , the solvent may be omitted and an excess of the reagent may be used instead . the reaction mixture is then heated between about 150 ° and 200 ° c . for about 18 to 24 hours . the reaction to form the isatoic anhydrides of formula ii is performed in the presence of an organic base such as pyridine or dimethylaminopyridine in the optional presence of a tertiary amine such as triethyl amine or diisopropylethylamine . the quinolones of formula i are prepared from the isatoic anhydrides ii by reaction with at least about one equivalent of the alkali metal salt of c 1 - c 3 - alkyl 3 - hydroxyacrylate . the alkali metal is sodium , lithium or potassium . the reaction is conducted in a dipolar aprotic solvent such as dimethylformamide , tetrahydrofurane , dimethoxyethane , n - methylpyrrolidinone , or dimethylacetamide . the reaction temperature ranges from about 20 ° to 100 ° c ., usually about 50 ° c ., and the reaction time is about 1 to 24 hours , usually about 1 hour . the reaction is advantageously conducted in the presence of a chelating agent for alkali metal ions . examples of suitable chelating agents are n , n &# 39 ;- dimethylimidazolidinone , hexamethyl phosphoric triamide , n , n &# 39 ;- dimethylpropylene urea , and tris [ 2 -( methoxyethoxy ) ethyl ] amine . the quinolones of formula i wherein r 4 is hydroxy may be prepared from the corresponding esters of formula i wherein r 4 is c 1 - c 4 alkoxy by conventional hydrolysis , for instance by heating with an acid such as hydrochloric acid . to a 1 liter four neck round bottom flask equipped with mechanical stirrer , two dropping funnels and a thermometer was introduced 20 g ( 86 . 71 mmol ) of 2 - amino - 4 , 5 - difluorobenzoic acid and a solution of 12 . 3 ml concentrated sulfuric acid in 90 ml water . the slurry was cooled to between 0 ° and - 5 ° c . in an ice - acetone bath . one of the dropping funnels was charged with a solution of 6 . 57 g ( 95 . 22 mmol ) sodium nitrite in 30 ml of water and slow addition of the solution was begun . the internal reaction temperature never rose above 0 ° c . and all the solution has been introduced after 5 minutes . the second dropping funnel was charged with a solution of 21 . 6 g ( 128 . 31 mmol ) potassium iodide in 45 ml of 1n sulfuric acid . this solution was then added dropwise over a period of 10 minutes with the internal temperature at or below 0 ° c . during addition , the reaction mixture releases nitrogen gas which causes some foaming . once the addition was completed , the dark mixture was stirred overnight while slowly warming to room temperature . the reaction mixture was quenched with a solution of 30 g of sodium bisulfite in 165 ml water and the suspension was adjusted to ph 2 . 5 with 5 ml of 6n hydrochloric acid . the resulting slurry was stirred at 0 ° c . for 30 minutes and then filtered . purification of the dark material was effected by dissolving the majority of the solid in ethyl acetate followed by clarification and treatment with activated charcoal . after filtration through a filter aid ( celite ) and evaporation there was obtained 20 g ( 82 %) of 2 - iodo - 4 , 5 - difluorobenzoic acid ; m . p . : 126 °- 127 ° c . to a 35 ml single neck round bottom flask equipped with magnetic stir bar and nitrogen inlet was charged 45 mg ( 0 . 704 mmol ) copper bronze , 5 ml of anhydrous dimethylformamide ( dmf ), 430 μl ( 5 . 28 mmol ) of pyridine and 537 μl ( 7 . 75 mmol ) cyclopropylamine . the resulting suspension was then treated with a solution of 1 g ( 3 . 52 mmol ) 2 - iodo - 4 , 5 - difluorobenzoic acid in 5 ml of dmf and the mixture was stirred overnight at room temperature . the reaction mixture , now a near solution , was clarified and then added to water ( 100 ml ) at ph 4 . 5 . a slurry forms immediately but before filtration the mixture was once again adjusted to ph 4 . 5 with 6n hydrochloric acid and cooled to 0 ° c . filtration of the white solid afforded 0 . 720 g ( 95 %) of 2 - n - cyclopropylamino - 4 , 5 - difluorobenzoic acid ; m . p . : 175 °- 176 ° c . to a 10 ml resealable pressure reaction flask equipped with a magnetic stirrer and teflon septum cap was charged a solution of 1 . 0 g ( 5 . 19 mmol ) 2 - chloro - 4 , 5 - difluorobenzoic acid , 792 μl ( 11 . 43 mmol ) cyclopropylamine , 800 mg ( 4 . 15 mmol ) copper ( i ) iodide and 630 μl ( 7 . 79 mmol ) pyridine in 8 . 0 ml of n , n - dimethylacetamide . the flask was sealed and was heated to 70 ° c . during stirring for a period of 16 hours . the reaction mixture was allowed to cool to room temperature and was then added to 100 ml of water . the suspension was adjusted to ph 13 with sodium hydroxide solution and was stirred for 15 minutes at room temperature . the suspension was filtered and the filtrate was adjusted to ph 4 . 5 with concentrated aqueous hcl . filtration of the resulting slurry provided 451 mg ( 41 %) of 2 - cyclopropylamino - 4 , 5 - difluorobenzoic acid ; m . p . : 175 °- 176 ° c . to a 10 ml single neck round bottom flask equipped with a septum and magnetic stirring bar was charged a solution of 100 mg ( 0 . 46 mmol ) of 2 - n - cyclopropylamino - 4 , 5 - difluorobenzoic acid and 62 μl ( 0 . 44 mmol ) of triethylamine in 2 ml of methylene chloride . the solution was cooled to 0 ° c . and was treated with a solution of 45 mg ( 0 . 147 mmol ) bis -( trichloromethyl )- carbonate in 0 . 5 ml methylene chloride . finally a catalytic amount of dimethylaminopyridine ( 10 mg ) was introduced as a solution in methylene chloride ( 0 . 5 ml ). after stirring at 0 ° c . for 1 . 5 hours , the reaction mixture was quenched by adding a small amount of 1n hydrochloric acid . the organic phase was dried over sodium sulfate and then concentrated to a yellow oil to afford 114 mg of n - cyclopropyl - 6 , 7 - difluoro - 2h - 3 , 1 - benzoxazine - 2 , 4 ( 1h ) dione ( 100 %). the product was crystallized from hot ethanol ; m . p . : 138 °- 139 ° c . to a 15 ml single neck round - bottom flask equipped with magnetic stirrer and under nitrogen atmosphere was added 60 mg ( 0 . 484 mmol ) of the sodium salt of methyl 3 - hydroxyacrylate in 1 . 5 ml of dmf . the resulting solution was stirred in the presence of 4a molecular sieves overnight and then filtered into another reaction vessel fitted with condenser , nitrogen line and a magnetic stirrer . to the mixture was charged 52 μl ( 0 . 467 mmol ) n , n &# 39 ;- dimethylimidazolidinone and the solution was heated to 55 ° c . to this reactor was added a solution of 93 mg ( 0 . 388 mmol ) of n - cyclopropyl - 6 , 7 - difluoro - 2h - 3 , 1 - benzoxazine - 2 , 4 ( 1h ) dione in 1 . 5 ml of dmf . the reaction mixture was stirred at 55 ° c . for 1 hour . the system was allowed to cool to room temperature and was then added to 30 ml of water at ph 4 . 0 . the ph of the resulting suspension was adjusted to 5 . 5 and the mixture was cooled to 0 ° c . and filtered . after drying there was obtained 50 mg ( 46 %) of methyl 1 - cyclopropyl - 6 , 7 - difluoro - 1 , 4 - dihydro - 4 - oxo - 3 - quinolinecarboxylate , m . p . : 223 ° - 224 ° c . the filtrate was extracted with methylene chloride and after drying and evaporation there was obtained an additional 47 mg ( 43 . 5 %, total yield : 89 . 5 %) of the desired product . a suspension of triethyl amine ( 15 ml , 0 . 11 mol ), 2 , 4 - difluoroaniline ( 25 ml , 0 . 24 mol ), copper bronze ( 2 . 7 g ., 0 . 04 mol ), in hot dmf ( 25 ml ) was treated with a solution of 2 - chloro - 4 , 5 - difluorobenzoic acid ( 23 g ., 0 . 12 mol ) in 25 ml of dmf and the temperature was maintained at 85 ° c . for 8 hours . the reaction mixture was allowed to cool to room temperature and was then stirred overnight . the reaction mixture was evaporated in vacuo and the residue was partitioned between ether and aqueous ammonium chloride . the organic phase was washed with 2n hcl and saturated aqueous lithium chloride solution . the ether was dried over sodium sulfate , treated with darco and then filtered and evaporated . the residue was crystallized from hexane - ether to afford 21 . 6 g ( 62 %) of 2 -( 2 , 4 - difluorophenylamino )- 4 , 5 - difluorobenzoic acid ; m . p . : 215 °- 216 ° c . | 2 |
fig1 is a block diagram illustrating an embodiment of a musical key determining device in accordance with the present invention . this musical key determining device , which is adapted for being incorporated into an automatic performance device or an automatic arrangement device , has a function of determining a key of a music piece on the basis of automatic performance data of the music piece . although not described here in detail , once a musical key has been determined , control is made of automatic accompaniment , automatic arrangement etc . to a central processing unit ( cpu ) 10 are connected , via a bus 11 , a program memory 12 , a melody memory 13 , a chord memory 14 , a key memory 15 and a working memory 16 . the program memory 12 has a program stored therein which will be described later using flowcharts . in the melody memory 13 and chord memory 14 , there are stored automatic performance data which comprise melody data and chord data . the musical key memory 15 stores data indicative of a key determined on the basis of the automatic performance data . fig2 a through 2c illustrate memory formats in the memory 13 , chord memory 14 and musical key memory 15 , respectively . fig2 a illustrates the memory format in the melody memory 13 . each tone data of a melody ( melody tone data ) is composed of pitch data mdi and duration data dli , and these melody tone data are sequentially stored in the melody memory 13 in the performance order of the melody . &# 34 ; i &# 34 ; is a suffix that represents the order in which the melody tone changes ( melody tone change order ). fig2 b illustrates the memory format in the chord memory 14 . each chord data is composed of root data tn , chord type data typen and chord duration data cdln . &# 34 ; n &# 34 ; is a suffix that represents the order in which the chord changes ( chord change order ). further , fig2 c illustrates the memory format in the musical key memory 15 . this memory 15 stores key data indicative of keys having been determined on the basis of the automatic performance data , in the order in which the key changes . each key data is composed of tonic data tnlym , major / minor key data modem and key change timing data tmm . &# 34 ; m &# 34 ; is a suffix that represents the order in which the key changes ( key change order ). fig3 is a flowchart illustrating the operation of the musical key determining device . in the illustrated example , a single possible key is nominated on the basis of whether or not a dominant motion is present in a chord progression . when it has been confirmed that the nominated possible key is also not inconsistent with the melody , the possible key is made confirmed key . first , in step s1 , every register is initialized . more specifically , the following procedures are taken for the initialization purposes . root0 which is the first chord data in the chord memory is set into a root register rt provided for a chord in the current section ( current chord ). type0 is set into a type register tp provided for the current chord , and &# 34 ; 1 &# 34 ; is set into a section number register n . further , &# 34 ; ffh &# 34 ; ( which is the maximum value of the hexadecimal number system and represents &# 34 ; undetermined &# 34 ;) is set into a tonic register otn provided for the key of a chord in the last section ( last key ) and into a mode ( major / minor ) register omd provided for the last key . the section number n , which corresponds to the chord change order , is &# 34 ; 1 &# 34 ; at first and then increments its value one by one (&# 34 ; 2 &# 34 ;, &# 34 ; 3 &# 34 ;, . . . ) whenever a chord change occurs . in subsequent steps s2 to s9 , the following procedures are taken to determine a key in section n . first , the contents in the root register rt and type register rt ( root0 , type0 ) are copied into the root register ort and type register otp provided for the chord in the last section ( last chord ) ( step s2 ). next , the root rootn and type typen of the chord in the current section are set into the registers rt and tp for the current chord ( step s3 ). then , in view of the last chord , it is examined whether or not the progression or change to the current chord is a dominant motion ( step s4 ). the dominant motion means a chord progression from the dominant seventh chord to the tonic chord . namely , if the relation between the last and current chords corresponds to that between the dominant seventh and tonic chords , the chord progression is determined as being a dominant motion . for this purpose , the following conditions are confirmed in step s4 : tp = morm ( the current chord is a triad of major or minor key ), ( ort + 12 - rt )= 7 ( the interval between the last and current chords is perfect five degrees ( seven semitones ). if the above conditions are all satisfied , the transfer from the last chord to the current chord can be said to be a dominant motion . when such a dominant motion is detected , the current chord is judged as a tonic chord , and therefore data indicative of this key is set into a provisional new key tonic register tn and a provisional key mode register md , as a provisional new key ( i . e ., possible new key commencing in this section ). in other words , root data of the current chord is set into the register tn as tonic data , and data indicative of the type ( major / minor ) of the current chord is set into the register md as mode data . further , on the basis of the melody in the section , it is confirmed whether the provisional new key is correct or not ( step s6 ). namely , the provisional new key is confirmed as being correct , if note which is among the scale notes of the last key identified by the data stored in a last key tonic register otn and a last key mode register omd but is among the scale notes of the provisional new key identified by the data stored in the provisional key registers tn and md is contained among the melody notes in the current section . once the provisional new key has been confirmed as being correct , various data tnlty , mode , tm are stored into the musical key memory 15 at such addresses designated by order data m ( step s7 ); that is , the chord section number n is set as key change timing data tmm , the data in the register tn is set as tonic data tnltym , and the data in the register md is set as major / minor data modem . in addition , the data in the provisional new key registers tn and md are transferred to the last key registers otn and omd . on the other hand , if the provisional new key has not been confirmed as being correct , it is considered that no key determination has been made this time , and so the last key ( otn and omd ) is set into the provisional registers tn and md ( step s8 ). in step s9 , it is determined whether or not the section number n is now indicative of the last section ( i . e ., the end of automatic performance ). if the determination result is &# 34 ; no &# 34 ;, the program goes to step s10 . in step 10 , the section number n is incremented , and the program goes back to step s2 to repeat the above - mentioned procedures . the order data m for designating storage addresses in the musical key memory 15 is &# 34 ; 1 &# 34 ; ( m = 1 ) at first . further , the last key registers otn and omd are initially set at an undetermined value ffh , and thus , when a first dominant motion is detected , the determination result in step s6 always becomes &# 34 ; yes &# 34 ; so that the program goes to step s7 . accordingly , when the first dominant motion is detected , the data tmm , tnltym and modem corresponding to m = 1 , i . e ., tm , tnlty and mode are stored in step s7 into respective predetermined addresses ( see fig2 c ). in the case where the above - mentioned procedure has been done with respect to m = 1 , condition of m = 0 is resumed , and the same data as tnlty1 and mode1 are stored into the memory as the first tonic data tnlty0 and major / minor data mode0 ( fig2 c ). this means that a key determined when the first dominant motion has been detected represents an original key of the music piece . namely , tnlty0 = tnlty1 and mode0 = mode1 . after that , the order data m is incremented to m = 2 , so that when the procedure of step s7 is done next time , data tm2 , tnlty2 and mode2 will be stored into respective predetermined addresses . subsequently , the order number m increases one by one each time the program takes step s7 . however , in many cases , the value of m remains very small since modulation , i . e ., key transfer generally does not occur so often in one music piece . in the embodiment described above , key determination is carried out by detecting a dominant section in connection with the chord progression and by examining the scale notes of provisional new key and last key in connection with the melody . alternatively , the key determination may be performed taking other factors into consideration . fig4 illustrates another embodiment of the key determining process . this process determines a key only on the basis of chord and melody of a section in question , without taking a chord progression into consideration . first , &# 34 ; 1 &# 34 ; is set as the section number n ( step s21 ), and ffh ( value indicating &# 34 ; undetermined &# 34 ;) is set into tonic register tn and mode register md for a key to be determined ( step s22 ). in subsequent steps s23 to s29 , the following procedures are taken to determine a key in section n . first , the contents in the tonic register tn and mode register md are set into tonic register orn and mode register omd for the key in the last section ( last key ) ( step s23 ). next , root data rootn and type typen of the chord in the current section are set into the root register rt and type register tp ( step s24 ). then , a key having this chord as diatonic chords is nominated as a possible key ( step s25 ). at the greatest , six keys will be nominated as this possible key . for example , c major chord cab be diatonic chords of c major key , f major key , g major key , a minor key , d minor key and e minor key , and thus these keys will be the possible keys . a final possible key is selected on the basis of those of the melody notes corresponding to the section n that are not among the scale notes of the last key but are among the scale notes of specific one of the nominated possible keys ( step s26 ). if more than one possible keys are selected in step s26 , then one specific key is determined as the final key on the basis of some priority order ( for example , related keys ) obtained from the last key , and its tonic and mode are written into the register tn and register md , respectively ( steps s27 and s28 ). the priority order may be stored in , for example , a table in advance . subsequently , while incrementing the section number n , the above - mentioned steps s23 to s28 are repeated until the last section ( steps s29 and s30 ). the repetition of routine passing step s10 or step s30 may be effected at each of predetermined fixed clock timings or in synchronism with automatic performance timings . furthermore , although the foregoing embodiment has been described as determining keys by the use of memory - stored automatic performance data , the key determination may be made by inputting data which are obtained from real - time performance on a keyboard or other suitable input instruments . | 8 |
the disclosed target &# 39 ; s 10 unique implementation of a target border 14 as a containment vessel for a solid amorphous material 12 possessing properties of plasticity and malleability that assure imperviousness to the wear inflicted on a medium used to stop broadhead - tipped arrows provides exponential improvements , many unanticipated , over previously existing art . turning first to fig1 we see a block type target 10 having a solid , clay center core 12 . as seen in the cross section view of fig2 the clay core 12 is integral with and completely surrounded by urethane foam 14 . it is preferred that a good grade of poured - in - place , high density , closed cell , urethane foam 14 be used , having a density of 8 - 10 pounds per cubic foot , thereby providing excellent structural rigidity with a maximum plasticity and tough outer skin . no perimeter frame is required due to the structural integrity of the foam . the foam is poured in a mold having a wood core member , thereby creating a cavity in the foam to allow for insertion of the clay core . however , in some cases , it may be advantageous to pour the foam with the clay core in place . it is anticipated that the foam may be poured in any geometrical configuration , such as the geometric - shaped foam target 20 illustrated in fig4 or take the form of any animal shape , such as the deer 30 depicted in fig3 . the clay core 12 as seen in fig1 may also be shaped in any configuration , for example a square 22 as seen in fig4 . although a number of commercially available clays may be used or formulated for such use , it has been found through trial and error that not all clays have the proper characteristics . such characteristics include : the ability to prevent through penetration of an arrow having a velocity between 200 to 350 feet per second without damage to the shaft or its broadhead tip ; the ability to release the arrow with minimal force and with little or no residue remaining on the arrow and broadhead ; the ability to be relatively easily reformed by compaction and also be economical to construct and maintain . the preferred embodiment as seen in fig7 utilizes high density urethane foam 14 surrounding a clay core 12 considered to be a semi - self - healing type , composed essentially of a special formulation of calcium carbonate and petrolatum and other additives , such as limestone , wax , oils , and talc . such clays are highly malleable , absorbing the impact energy of arrows tends to seal the holes left by the penetration of others previously shot into the target as illustrated in fig5 and 6 . to produce such a quality , the clay core 12 must be non - hardening , even under extreme outdoor weather conditions . it must be of a high density type with good temperature stability . it is also essential that the clay core 12 be highly compacted . therefore , as seen in fig5 when an arrow 16 is removed from the clay core 12 , it leaves a penetration wound 20 , 21 and , when the clay core 12 is then struck by a second arrow 18 in the vicinity of the first wound 20 , 21 , as seen in fig6 the clay material 12 tends to shift , thus closing the previous wound 20 , 21 produced by the first arrow 16 . tamping the clay core 12 periodically by pounding with a two pound maul effectively solidifies the core . the clay core 12 also must be sufficiently dense to prevent deep penetration of the arrows 16 , 18 . therefore , the clay should have a density of 90 - 110 pounds per cubic foot and may be selected from the plasticene group , containing plasticisers which allow the material to be malleable . however , it is obvious that the greater the velocity of the arrow , the greater the penetration . since the diameter and depth of the clay core should be kept to a minimum to remain economical , it is essential that the density be maintained by periodic repacking and compacting . the clay core 12 is generally between 10 and 13 inches deep and between 6 and 8 inches in diameter and should be fully enclosed on all sides by the foam , except for the face . however , there is no limitation as far as size or number of clay cores which may be used in a target . for example , multiple clay cores 32 , 34 of different sizes may be enclosed in a foam body 36 as seen in fig3 . it should be understood that as the clay core 12 is pounded during the compaction process , usually after every 20 to 30 shots , the clay expands diametrically , thus imparting a force on the foam 14 , which tends to help close wounds in the foam , but also reduces the core depth . it should be noted that the foam target may be several inches deeper than the clay core depth , thus serving to provide a rigid , structural backing for the clay core . when the target &# 39 ; s border is penetrated by an arrow , the self - healing foam is compressed radially outward from the center of an arrow shaft . once an arrow has been removed , it &# 39 ; s an intrinsic property of the material to gradually return to its former state , thus sealing the hole . regardless of its position on the target surface , half of any arrow perforation faces the target core ; as the clay core is compressed by the impact of a maul , portions of that energy are directed radially outward through the target and will facilitate the foam returning to its normal state . in the event the border adjacent to the clay core begins to sustain damage , during recommended restoration of the core ( i . e ., laying the target on it &# 39 ; s back and striking the core &# 39 ; s surface with a two pound maul several times to compress the clay ), clay expands into the areas in which the foam has degraded . this procedure not only assures that the core is securely mounted in the target , but because it induces pressure radiating outward from the target &# 39 ; s center , facilitates the self - healing properties of the polyurethane foam , thereby reinforcing the body of the target . if a broadhead tip becomes dislodged in the clay core , it can be retrieved by simply digging the clay from around the tip . when the broadhead has been extracted , the clay can be repacked by returning the extracted clay and compacting the clay by pounding with a two pound maul . it is this reforming process that makes this combination target impervious to wear , thus outlasting all other broadhead targets . the targets described herein have an inestimable product life span , based on clay cores having proven ability to sustain in excess of 10 , 000 broadhead shots without a single arrow pass - through and having no foreseeable point of exhaustion - while enabling the restoration of a like new target surface innumerable times by compressing the clay and making a circular impression therein to serve as a bull &# 39 ; s - eye . it is , therefore , safe to say that the clay core is virtually indestructible as an archery target . clay core targets may also be used with any weapon , provided such targets have adequate encasements surrounding the foam portion and that the foam has sufficient density for the load used . because many varying and different embodiments may be made within the scope of the inventive concept herein taught , and because many modifications may be made in the embodiments herein detailed in accordance with the descriptive requirement of the law , it is to be understood that the details herein are to be interpreted as illustrative and not in any limiting sense . | 5 |
detailed description of the preferred embodiments of the present invention will be made in connection with the drawings . the measurement method for substance surface property parameters of this embodiment includes the following steps : 1 ) performing a saturation treatment to a surface of an object to be measured , comprising the following steps : 11 ) taking 3 - 5 g sample to be measured into a sample container , and using 150 - 250 ml hcl solution of 0 . 1 ml / l to flow though the substance to be measured at a uniform speed of 1 ml / min , to have the surface charges of the object to be measured all saturated by h + and cl − ; and , using hno 3 solution to perform saturation treatment to the sample to be measured ; 12 ) using 150 - 250 ml water to flow though the object to be measured at a uniform speed of 1 ml / min , to wash off redundant h + and cl − ; 13 ) using a constant - flow pump to draw interstitial water out of the object to be measured , until no water flows out . 2 ) adding 50 ml mixed solution of kcl , hcl ( or koh ) and cacl 2 with known concentration into the sample pool , stirring sufficiently , and then disposing and balancing for over 24 hours ; wherein kcl and cacl 2 use as indicator electrolytes , and hcl and koh use for adjusting ph value . concentration of the above individual electrolytes can be determined based on the requirements of the researcher , but it is preferred to control the ionic strength of the system during equilibrium within 0 . 2 mol / l . in this step , other indicator electrolytes can also be used , but there are at least two types of indicator electrolytes , including at least one type of bivalent metallic positive ion , such as ca 2 + , mg 2 + , and one type of monovalent metallic positive ion , such as li + , na + , na + . the negative ion of the indicator electrolytes shall be same as the negative ion of the acid in step 11 ). for example , if using hno 3 solution to perform saturation treatment to the surface of the sample to be measured in step 11 ), then in this step nano 3 and ca ( no 3 ) 2 can be used as indicator electrolytes , and hno 3 and naoh are used to adjust ph value . in the following context , description will be made to the present invention by using hcl solution to perform saturation treatment to the surface of the sample to be measured and using kcl and cacl 2 as indicator electrolytes as an example : 3 ) upon the mixture from step 2 ) reaching ion - exchange equilibrium ( i . e ., balancing for 24 hours under constant stirring ; and , balancing for at least 72 hours under non - stirring condition , in which the balancing time may be vary based on the sample type ), measuring the equilibrium concentration of the indicator electrolyte positive ion and hydrogen ion in the bulk solution of the mixture , comprising the following steps : 31 ) measuring activity values a h , a k and a ca of h + , k + , and ca 2 + in the bulk solution ; 32 ) using the activity values from step 31 ) as initial values of corresponding ion concentration , and performing iteration operation through the following steps to obtain activity coefficients and concentration of k + , ca 2 + and h + ; iterating until to ( i = k + 1 ) th time , when ( i k + 1 − i k )/ i k + 1 & lt ; 0 . 001 , terminating the iteration operation ; 321 ) using the activity values from step 31 ) as initial values , and obtaining ionic strength of the system through the following formula : wherein , i i is the ionic strength of i th iteration , the unit of which is mol / l ; c i h is concentration of h + at i th iteration , c i k is concentration of k + at i th iteration , and c i ca is concentration of ca 2 + at i th iteration . 322 ) based on the ionic strength , activity coefficients of na + , ca 2 + and h + can be calculated through the following formula : wherein , γ i h , γ i k and γ i ca respectively are activity coefficients of h + , k + and ca 2 + at i th iteration , and t is temperature , the unit of which is k . 323 ) base on the activity coefficients from step 322 ), the equilibrium concentration values of k + , ca 2 + and h + can be calculated through the following formula : wherein , c i h , c i k c i ca respectively are the equilibrium ion concentration of h + , k + and ca 2 + at i th iteration ; 4 ) substituting the equilibrium ion concentration of k + and ca 2 + ( equilibrium concentration obtained from last iteration operation ) from step 3 ) into the following formula , to obtain the substance surface potential φ 0 : wherein , φ 0 is substance surface potential , r is gas constant , t is temperature , f is faraday constant , c k 0 is concentration of k + in the system when beginning to add kcl , c ca 0 is concentration of ca 2 + in the system when beginning to add cacl 2 , c k ∞ is equilibrium concentration of k + , c ca ∞ is equilibrium concentration of ca 2 + , β k is the relative effective charge coefficient of k + that associates with k + hydrated radius in the system containing “ k + + ca 2 + ”; and β ca is the relative effective charge coefficient of ca 2 + that associates with ca 2 + hydrated radius in the system containing “ k + + ca 2 + ”. using the final value i of ionic strength in the iteration operation to calculate the effective charge coefficient with the following formula : 5 ) based on the surface potential value from step 4 ), specific surface area of the substance is calculated by the following formula : wherein , v is total volume of water , the unit of which is 1 ; s is specific surface area , the unit of which is dm 2 / g ; κ is debye - hückel parameter , the unit of which is dm − 1 , and κ is calculated by the following formula : wherein , ∈ is medium dielectric constant , in which ∈ of water is ∈= 8 . 9 × 10 − 10 c 2 / jdm . based on the surface potential value from step 4 ), the surface charge density of the substance is calculated by the following formula : wherein , σ 0 is surface charge density , the symbol of which is same as that of the surface potential and the unit of which is c / dm 2 ; 6 ) based on the surface charge density from step 5 ), the surface electric field strength of the substance is calculated by the following formula : wherein , e 0 is surface electric field strength of the substance , the unit of which is v / dm . based on the surface charge density and specific surface area from step 5 ), the surface charge quantity is calculated by the following formula : wherein , t c is the surface charge quantity of the substance , the unit of which is c / g . an analysis system of substance surface property parameter of this embodiment comprises a sample treatment device and a detection system . referring to fig1 , the sample treatment device includes a sample container 11 for containing the sample to be measured ; and a liquid intake pipe 12 and a liquid offtake pipe 13 , wherein the liquid offtake pipe 13 is in communication with a bottom of the sample container 11 , the liquid intake pipe 12 is in communication with the sample container 11 ; and the liquid offtake pipe 13 is connected to a constant - flow pump . a stirring device 15 is provided in the sample container 11 . an ion activity detecting unit for detecting individual ion activity in the solution in the sample container 11 , including a detecting electrode 16 disposed in the sample container 11 , millivoltmeters 22 and an ion activity operator ; the detecting electrode is “ h + — k + — ca 2 + ” combined electrode ; inputs of three millivoltmeters 22 are respectively connected to outputs of h + electrode , k + electrode , and ca 2 + electrode of the “ h + — k + — ca 2 + ” combined electrode ; outputs of the three millivoltmeters 22 are respectively connected to inputs of ph operator 23 , na + activity operator 24 , and ca 2 + activity operator 25 ; the millivoltmeters preferably use high - impedance millivoltmeter ; and a data processing unit which can be programmable processor such as single chip microcomputer , the data processing unit receives detected results from the ion activity detecting unit and analyzes the surface parameters of the sample to be measured , comprising : “ h + , ca 2 + , and k + ” concentration operation module 26 connecting to outputs of the ph operator 23 , k + activity operator 24 , and ca 2 + activity operator 25 , to receive the detected results from the above operators , to calculate ion concentration , and surface parameter operation module 27 for receiving the ion equilibrium concentration from the “ h + , ca 2 + , and k + ” concentration operation module 26 to calculate surface potential , surface charge quantity , surface charge density , surface electric field strength , and specific surface area of the sample to be measured . referring to fig1 and 2 , the analysis system of substance surface property parameter further includes a temperature probe 14 disposed in the sample container 11 ; and an electronic thermometer 21 , input of which is connected to the temperature probe 14 , and output of which is connected to inputs of the ph operator 23 , k + activity operator 24 and ca 2 + activity operator 25 , concentration operator , and surface property parameter operator . the ph operator 23 , k + activity operator 24 and ca 2 + activity operator 25 convert the potential values detected by the millivoltmeters into individual ion activity values through the following method : upon individual ions are standardized by standard solution ( the ph value of which shall be same as that of the solution to be measured ) with known activity , the activity operator calculates individual ion activity values of the solution to be measured by using nernst equation . the “ h + , ca 2 + , and k + ” concentration operation module 26 calculates concentration of k + , ca 2 + , and h + through the following method : using the activity values from the ph operator 23 , k + activity operator 24 , and ca 2 + activity operator 25 as initial values of individual ion concentration , and performing iteration operation through the following steps : a ) obtaining the ionic strength of the solution through operation of the following formula : wherein , i i is ionic strength at i th iteration , the unit of which is mol / l ; c i h is concentration of h + at i th iteration ; c i k is concentration of k + at i th iteration ; and c i ca is concentration of ca 2 + at i th iteration . b ) based on the ionic strength , activity coefficients of k + , ca 2 + and h + at i th iteration can be calculated through the following formula : wherein , γ i h , γ i k and γ i ca respectively are activity coefficients of h + , k + and ca 2 + at i th iteration ; and t is temperature , the unit of which is k . c ) base on the activity coefficients , concentration values of k + , ca 2 + and h + for the next iteration operation can be obtained through the following formula : wherein , c i h , c i k c i ca respectively are concentration of h + , k + and ca 2 + of this iteration . using such concentration values as the concentration for the next iteration , repeating steps a ) to c ) to perform iteration operation until the ( i = k + 1 ) th time , when ( i k + 1 − i k )/ i k + 1 & lt ; 0 . 001 , terminating the iteration operation , and using individual ion concentration from last time iteration as the final output equilibrium ion concentration . the surface parameter operation module 27 receives equilibrium ion concentration ( final value of the iteration operation ) of k + and ca 2 + outputted from the “ h + , ca 2 + , and k + ” concentration operation module 26 to substitute to the following formula , to obtain the substance surface potential φ 0 : wherein , φ 0 is substance surface potential , r is gas constant , t is temperature , f is faraday constant . c k 0 is the initial concentration of k + in the system when beginning to add kcl ; and c ca 0 is the initial concentration of ca 2 + in the system when beginning to add cacl 2 . the two concentration values are calculated based on the total mole number of individual ions added into the system divided by the total volume of water . c k ∞ is equilibrium concentration of k + ; c ca ∞ is equilibrium concentration of ca 2 + ; β k is the relative effective charge coefficient of k + that associates with k + hydrated radius in a system containing “ k + + ca 2 + ”; and , β ca is the relative effective charge coefficient of ca 2 + that associates with ca 2 + hydrated radius in a system containing “ k + + ca 2 + ”. using the final value i of ionic strength from iteration operation , the effective charge coefficient is calculated through the following formula : the surface parameter operation module 27 calculates the specific surface area of the substance through the following formula based on the substance surface potential φ 0 : wherein , v is the total volume of water , the unit of which is 1 ; s is specific surface area , the unit of which is dm 2 / g ; κ is debye - hückel parameter , the unit of which is dm − 1 , and κ is calculated through the following formula : wherein , ∈ is medium dielectric constant , in which ∈ of water is ∈= 8 . 9 × 10 − 10 c 2 / jdm . the surface parameter operation module 27 calculates surface charge density of the substance through the following formula based on the surface potential value : wherein , σ 0 is surface charge density , the symbol of which is same as that of surface potential and the unit of which is c / dm 2 . the surface parameter operation module 27 calculates surface electric field strength of the substance through the following formula based on the surface charge density : wherein , e 0 is substance surface electric field strength , the unit of which is v / dm . the surface parameter operation module 27 calculates surface charge quantity through the following formula based on the surface charge density and specific surface area : wherein , t c is surface charge quantity of a substance , the unit of which is c / g . the above are only preferable embodiments of the present invention , and are not used to limit the present invention . apparently , people skilled in the art can make various modifications and variations to the present invention without departing from the spirit and scope of the present invention . therefore , the present invention intends to include all of the modifications and variations that fall into the appended claims or equivalence thereof . | 6 |
certain compressed drilling fluid additives used experimentally evidenced difficulty in dispersion . this invention addresses that difficulty by delivering additives in a softened tablet that disperses specifically in a target drilling fluid . the present invention advantageously includes a delivery system for controlling functions , such as lost circulation , seepage , fluid loss , viscosity , lubricity , foaming , shale , and ph in drilling operations . the delivery system preferably includes the soft dispersible tablet , which includes drilling fluid additives and a softening agent . in use , the soft dispersible tablet is deployed within a drilling fluid for carrying the drilling fluid additives to a zone of lost circulation or the like . when the soft dispersible tablet is deployed within the drilling fluid , the drilling fluid advantageously disperses the soft dispersible tablet quickly , allowing delivery of the drilling fluid additives . the drilling fluid transports the drilling fluid additive to within the drilling fluid . the current invention includes a soft tablet to maximize the rate of incorporation of contained additive into the drilling fluid . in preferred embodiments of the present invention , the soft dispersible tablet contains around 85 % to around 95 % of drilling fluid additives and around 5 % to around 15 % of the softening agent delivered in the readily - dispersible system in the form of the soft tablet . the tablet is advantageously deformable due to being soft . water - based drilling fluids , or drilling muds , are generally understood as those in which water or saltwater is the major liquid phase as well as the wetting ( external ) phase . general categories of water - based drilling fluids are freshwater , seawater , salt water , lime , potassium and silicate . if the drilling fluid to be used is water - based , then the softening agent for use in the inventive delivery system can be selected from the following compounds : ethylene oxide adducts of phenol and nonyl phenol , a mixture of ethylene glycol and propylene glycol , high molecular weight water soluble polyethylene glycols , modified water dispersible lecithins , and the like . synthetic - based drilling fluids are known to come in a broad range . popular fluid types include several olefin oligomers of ethylene . esters made from vegetable fatty acid and alcohol were among the first of such type of fluids . ethers and polyethers , made from alcohols and polyalcohols , have been used , along with paraffinic hydrocarbons and linear alkyl benzenes . mixtures of these fluids are also used to make synthetic - based drilling fluids . other examples will be known to those skilled in the art . an oil - based mud is a type of drilling mud with diesel oil as its external phase . diesel - oil mud is the traditional oil mud and has a history of excellent performance for drilling difficult wells . it has been used because the base oil is low - cost and is a widely available motor fuel . in - gauge holes can be drilled through all types of shales , salt , gypsum and other difficult strata using diesel - oil mud systems . diesel - oil mud is often the mud of choice for drilling high - pressure , high - temperature zones . if the drilling fluid to be used is a synthetic or oil based fluid , then the specific softening agent can be selected from at least one of the following compounds : sodium dodecyl benzene sulfonate , fatty acid amides and imidazolines of polyamines , and phospholipids , such as lecithin . the additives useful for the present invention are standard or industry - acceptable materials that perform various functions in the drilling fluid , such as lost circulation and seepage control , fluid loss , viscosity , lubricity , foaming shale , and ph control . as such , the additives are typically standard materials recognized by one of ordinary skill in the art for use in drilling fluid . the tablet can deliver one or more additives , the delivery being triggered by the injection of the soft tablet into the target drilling fluid . among the inorganic materials useful in this invention , mineral components are readily available , such as calcium carbonate , mica , diatomaceous earth , fuller &# 39 ; s earth and other silicates , activated charcoal , bauxite , alumina gel , graphite , gilsonite and the like . such materials are frequently provided in fiber or ground form . carbonate can be used alone or in combination with other desirable additives . the effect of adding carbonate to organic additives is an improved acid solubility . this also results in a tablet of increased density . also useful are plastics such as thermosets , thermoplastics and rubber compounds including melamine , polyvinylchloride ( pvc ) and cellophane . these plastics can be ground into granules or powders . other materials to be delivered to the system useful for managing the rheological characteristics of drilling fluid include the rheological additives of lignites containing calcium hydroxide , leonardite , leonardite with potassium , leonardite with gyp , organophilic leonardite , lignin - based powders , bitumens . also useful are lignosulfonates , including those with chrome or chrome - free , and those containing calcium , iron , tin , zinc and other heavy metals . asphalt and various forms of asphalts are included in as rheological additives , including sodium sulfonate asphalt and potassium sulfonate asphalt . rheological additives also include various clays including organophilic clays , attapulgite clays , montmorillonite clays , kaolinite clays and calcined clays . polyacrylate powders , polyacrylamide homopolymers and copolymers , polyanionic cellulose , cellulosic polymers and the like are also rheological additives useful in the invention . xantham gums , metal silicates , starches ( including corn ), sugarbeet , wood and potato starches , and guar gum are included . fatty acids , including tall , refined , unrefined , and polyaminated are also rheological additives . other rheological additives include amphoterics such as aluminum salts and the like , carboxymethyl cellulose , sodium carboxymethyl cellulose , welan gum , hydrocarbon resins , hydroxyethylcellulose , and polyphosphate . other drilling fluid additives can include barium sulfate , hematite , sodium chloride , calcium chloride , potassium chloride , bromides , sodium , calcium , zinc , gilsonite , graphite , petroleum coke and calcine coke . fibrous insulation material such as rockwool insulation can be used as theological additives . the present invention also advantageously includes a method of delivering a drilling fluid additive to a drilling fluid . in this embodiment of the present invention , drilling fluid additives are supplied or prepared and then the drilling fluid additivies are mixed with the softening agent . any type of mixer can be used that can adequately mix the materials . an example of such a blender is a ribbon blender . once the materials are mixed , the materials are formed into the soft dispersible tablet . the soft dispersible tablet is dispersed into the drilling fluid , which breaks down , or reverts , the drilling fluid additive back into the original particle size distribution prior to placement of the drilling fluid additive in the drilling fluid . the original particle size distribution will be understood to be based upon the size of the particles forming the drilling fluid additive prior to being mixed with the softening agent . the reversion of the drilling fluid additive into the original particle size distribution can occur downhole , or more preferably topside . topside refers to the portion of the well bore prior to the drill string . from the mud pit to the drill string is typically considered to be topside . the softening agent assists tablets included in the inventive delivery system to disperse in various types of drilling fluids , including oil - based and synthetic - based drilling fluids . initial trials with pelletized lost circulation materials generally did not utilize wetting agents , surfactants , or emulsifiers . when these trials were made in hydrocarbon fluids , such as diesel , mineral oil , and low aromatic content alpha olefins as used in many offshore drilling applications or other hostile environments , it was noted that dispersion rate was difficult to predict . it is believed that , since most of the lost circulation materials are produced from natural fibers and granules , these materials are more hydrophilic than oleophilic making dispersion in hydrocarbon fluids less rapid . the present invention advantageously provides rapid dispersion in hydrocarbon fluids through the use of the soft tablet . similarly , wetting agents , surfactants , and emulsifiers aid in the dispersion of the soft tablets in water based fluids . the softening agent of the present invention prevents plugging of well pumps , drill pipe , drill bits , and screens since all of the tablet material is dispersed , leaving no materials that are not dispersed . the particles are small enough to pass through the screens and machinery without damaging them . the use of the proper wetting agent , surfactant , and emulsifier , such as the softening agent , prevents any degradation of the drilling fluid , particularly emulsion stability or viscosity . in one embodiment of the present invention , high concentration slurries of dispersed tablet material can be prepared in the “ slugging pit ” prior to pumping downhole to the affected zone . as another advantage of the present invention , the inventive delivery system delivers lost circulation materials that disperse in oil and / or water based drilling fluids , thereby avoiding reliance on mechanical energy to disperse the tablets throughout the drilling fluids . the present invention &# 39 ; s provision of hydrodynamic or oleodynamic dispersion of the tablet rather than mechanically - aided dispersion avoids high cost mechanical dispersion equipment and extensive mixing time at the rig site . dispersion is generally understood as the act of breaking up large particles into smaller ones and distributing them throughout a liquid or gaseous medium . dispersion is conventionally accomplished by various methods depending upon the type of drilling fluid that is used in an application . in a water - base drilling mud application , dispersion is generally the act of degrading clay materials , starches , carboxymethylcellulose , biopolymer , synthetic polymers or oils into submicroscopic particles . in oil - mud emulsion terminology , dispersion is generally the act of forming a fine - grained emulsion of an aqueous phase into an oil . this is conventionally accomplished by mechanical shearing or heating in the presence of surfactants . as previously described , the present invention &# 39 ; s dynamic dispersion feature eliminates the need for the equipment necessary to mechanically disperse the lost circulation materials within the drilling fluids . the inventive delivery system further includes breaking down the additives into their original particle size distribution , which tends towards effective use of the materials . as noted , if the materials do not revert to their original particle size distribution during dispersal , their effectiveness in eliminating loss of fluids in the well bore is reduced . conventionally , the original particle size distribution is typically optimized by the manufacturer prior to tabletization . this tabletization process compresses and densifies the materials , which , without more , can reduce the effectiveness of the materials to return to their original particle size distribution during dispersal . the present invention avoids such disadvantages . the present invention is particularly effective at delivering cellulostic lost circulation and seepage control materials , although the invention is not limited in this regard . in particular , the invention is particularly effective at delivering one or more of the following cellulostic materials , alone or in combination : ground wood , pine bark , fruit pomace , vegetable pomace , yellow pine , pine bark , corn cobs , peanut hulls , pecan piths , almond shell , corn cob outers , bees wings , cotton burrs , oat hulls , rice hulls , seed shells , sunflower , flax , linseed , cocoa bean , feathers , peat moss , jute , flax , mohair , wool , sugar cane , bagasse , sawdust , bamboo , cork , popcorn , tapioca , and grain sorghum . the invention is also effective at delivering inorganic lost circulation and seepage control materials , although the invention is again not limited in this regard . such inorganic materials include mineral components that are readily available , such as calcium carbonate , mica , diatomaceous earth , fuller &# 39 ; s earth and other silicates , activated charcoal , bauxite , alumina gel , graphite , gilsonite and the like . such inorganic materials are frequently provided in fiber or ground form . carbonate can be used alone or in combination with other desirable additives . the effect of adding carbonate to organic additives is known to improve acid solubility . this also results in a tablet of increased density . the inventive system can also deliver plastics such as thermosets , thermoplastics and rubber compounds including melamine , polyvinylchloride ( pvc ) and cellophane . these plastics can be ground into granules or powders . another advantage of use of the inventive softened dispersible tablet is the reduction of dust during addition to the drilling fluid . traditional powders added through a hopper create volumes of dust that create a hazard to the environment and to the working personnel . certain areas , such as the north sea , have stringent regulations on dust . the use of the inventive delivery system reduces the creation of dust substantially . from the foregoing it will be seen that this invention is one well adapted to attain all of the ends and objects hereinabove set forth , together with other advantages that are obvious and that are inherent to the apparatus and structure . it will be understood that certain features and subcombinations are of utility and can be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . because many possible embodiments can be made of the invention without departing from the scope thereof , it is to be understood that all matter herein set forth is to be interpreted as illustrative and not in a limiting sense . for example , without limitation , the soft dispersible tablets can also include insecticides , biocides or other biological operatives to reduce susceptibility to various types of degradation or to repel pests . | 2 |
the following description is presented to enable a person of ordinary skill in the art to make and use the embodiments of the disclosure . the following detailed description is exemplary in nature and is not intended to limit the disclosure or the application and uses of the embodiments of the disclosure . descriptions of specific devices , techniques , and applications are provided only as examples . modifications to the examples described herein will be readily apparent to those of ordinary skill in the art , and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the disclosure . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding field , background , summary or the following detailed description . the present disclosure should be accorded scope consistent with the claims , and not limited to the examples described and shown herein . embodiments of the disclosure are described herein in the context of one practical non - limiting application , namely , an information device . embodiments of the disclosure , however , are not limited to such mobile information devices , and the techniques described herein may also be utilized in other applications . for example , embodiments may be applicable to mobile phones , digital books , digital cameras , electronic game machines , digital music players , personal digital assistance ( pda ), personal handy phone system ( phs ), lap top computers , and the like . as would be apparent to one of ordinary skill in the art after reading this description , these are merely examples and the embodiments of the disclosure are not limited to operating in accordance with these examples . other embodiments may be utilized and structural changes may be made without departing from the scope of the exemplary embodiments of the present disclosure . when a user engages in an operation related to a call , the mobile terminal apparatus related to the embodiments of the present invention detects the orientation of the mobile terminal apparatus and informs the user , if it is determined to be an incorrect orientation . the embodiments of the present invention are described , referring to fig1 through fig1 . first , the configuration of the mobile terminal apparatus is described , referring to fig1 through fig7 . fig1 is an oblique view of the appearance of a mobile terminal apparatus . the case of the mobile terminal apparatus 100 , as shown in fig1 , comprises a touch panel 105 , an operating part 120 , a light - emitting part 130 , a speaker 140 , a microphone 150 , etc . fig2 is a block diagram of the mobile terminal apparatus 100 . the mobile terminal apparatus 100 shown in fig2 comprises a touch panel 105 , operating part 120 , light - emitting part 130 , speaker 140 , d / a converter 145 , microphone 150 , a / d converter 155 , oscillating part 160 , angle - detecting part 165 , controlling part 170 , rom 180 ( read only memory ), ram 190 ( random access memory ), i / f ( input / output interface ) 200 , external memory 210 , wireless circuit 240 , antenna 250 , imaging part 260 , recording part 270 , and proximity sensor 280 . the touch panel 105 comprises a display control part 106 , display part 110 , and touch panel input part 115 . the display control part 106 causes the display part 110 to display image data stored in any one of rom 180 , ram 190 , or external memory 210 , based on control signals output from the controlling part 170 . furthermore , the display control part 106 causes the display part 110 to display image data after inverting the same based on the operation of the user . herein , the control of inverting the orientation of the image data to be displayed on the display part 110 is described using fig3 . fig3 a is a state in which the speaker 140 of the mobile terminal apparatus 100 is in a position higher than the microphone 150 . in such a state , the display control part 106 causes the display part 110 to display the image data as in the orientation of fig3 a . fig3 b is a state in which the speaker 140 of the mobile terminal apparatus 100 is in a lower position than the microphone 150 . in such a state , the display control part 106 causes the display part 110 to display the image data after inverting the same . that is , as in fig3 b , even if the user is operating the mobile terminal apparatus 100 in an incorrect orientation , because the image to be displayed in the display part has been inverted , the user may operate the mobile terminal apparatus 100 without correcting the orientation . the display part 110 displays various kinds of information required for executing functions provided with the mobile terminal apparatus 100 based on the output from the display control part 106 . the various kinds of information are , for example , function menus , emails , address book , incoming history or outgoing history of calls , sent history or received history of emails , and text data as well as image data , etc ., stored in a data folder . the display part 110 is , for example , a liquid crystal display , organic el ( electroluminescence ) display , plasma display , electronic paper , etc . the display part 110 in the present embodiment is a liquid crystal display . the touch panel input part 115 is a pointing device that detects a position touched by a user using a finger or a pen etc ., and outputs coordinates to the controlling part 170 , according to the position . the touch panel input part 115 is arranged on the upper surface of the display part 110 . the user touches the touch panel input part 115 using a means such as a finger or a pen ; for example , pushing , stroking , drawing on the surface of the touch panel input part 115 using a finger or a pen , etc . that is , the touch panel input part 115 outputs , to the controlling part 170 , the coordinates of the pushed position , the direction of the stroke , and the graphic drawn by the user . the touch panel input part 115 is , for example , a capacitance binding system which detects electric signals by static electricity , a resistance film system , an optical system , etc . the operating part 120 receives operations from a user as inputs . the inputs received at the operating part 120 are output to the controlling part 170 as signals . the operating part 120 is arranged on the side surface of the mobile terminal apparatus 100 in the present embodiment . the light - emitting part 130 emits light to the outside , in accordance with control signals output from the controlling part 170 . the light - emitting part 130 is a light - emitting element , etc ., for example , an led . the light - emitting part 130 informs a user of incoming calls , outgoing calls , received emails , sent emails , replay of music data , advent of an alarm date / time , etc ., by emitting light toward the outside . the speaker 140 has the function of outputting sound toward the outside in accordance with control signals output from the controlling part 170 . the speaker 140 is connected to the controlling part 170 via the d / a converter 145 . the d / a converter 145 converts digital signals output from the controlling part 170 to analog signals . the d / a converter 145 outputs the converted analog signals to the speaker 140 . the microphone 150 has a function to input sound from outside such as voice etc . the microphone 150 outputs the input sound to the a / d converter 155 as analog signals . the microphone 150 is connected to the controlling part 170 via the a / d converter 155 . the a / d converter 155 converts analog voice signals input from the microphone 150 to digital signals so as to be output to the controlling part 170 . the oscillating part 160 generates mechanical oscillations by control signals output from the controlling part 170 . the oscillating part 160 is , for example , a motor etc . the oscillating part 160 informs a user of incoming calls , received emails , advent of alarm date / time , etc ., via mechanical oscillations . the angle - detecting part 165 detects the angle of inclination of the mobile terminal apparatus 100 from a preliminarily prescribed normal state . the preliminarily prescribed normal state means , for example , a state in which the surface where the display part 110 is arranged becomes horizontal with respect to the ground . the angle - detecting part 165 outputs information regarding the detected angle to the controlling part 170 . the angle - detecting part 165 is , for example , an angle sensor or an acceleration sensor , etc . next , the angle of inclination detected by the angle - detecting part 165 is described using fig4 and fig5 . the rotary axis 410 shown in fig4 is perpendicular to the longitudinal direction of the mobile terminal apparatus 100 and is a line passing through the center of the mobile terminal apparatus 100 . fig5 is a simplified drawing of a side view of the mobile terminal apparatus 100 seen from the direction of the arrow shown in fig4 . fig5 a shows a normal state of the mobile terminal apparatus 100 in the present embodiment . in the present embodiment , the normal state of the mobile terminal apparatus 100 is defined as a state in which the surface that comprises the display part 110 becomes horizontal with respect to the ground 515 , as in fig5 a . that is , a surface that becomes horizontal to the ground and comprises the display part 110 is defined as a normal surface 510 . the angle - detecting part 165 detects an angle of inclination when the mobile terminal apparatus 100 is inclined from the normal state when a center axis is a rotary axis 410 . fig5 b , fig5 c , fig5 d , and fig5 e show examples in which the mobile terminal apparatus 100 is inclined . as shown in fig5 b , fig5 c , fig5 d , and fig5 e , a surface that is the same as the display part 110 at the time when the mobile terminal apparatus 100 is inclined is defined as an inclining surface 520 . fig5 b and c are drawings showing a state in which the mobile terminal apparatus 100 is inclined so that the speaker 140 is in a position higher than the normal surface 510 . in such a case , the angle - detecting part 165 detects an angle formed by the normal surface 510 and the inclining surface 520 as shown in fig5 b and c . fig5 d and fig5 e are drawings showing a state in which the mobile terminal apparatus 100 is inclined so that the speaker 140 is in a state lower than the normal surface 510 . in such a case , the angle - detecting part 165 detects an angle formed by the normal surface 510 and the inclining surface 520 as shown in fig5 d and fig5 e . the controlling part 170 controls software and hardware provided for the mobile terminal apparatus 100 . for example , the controlling part 170 executes various kinds of functions provided for the mobile terminal apparatus 100 based on inputs received from the user at the operating part 120 or the touch panel input part 115 . furthermore , the controlling part 170 executes programs stored in the rom 180 , ram 190 , and external memory 210 . configurations provided for the controlling part 170 to execute the programs are described using fig6 . fig6 shows an arrangement of information stored in the ram 190 ( hereinafter referred to as a memory map ). the memorymap comprises a program storage region 610 and data storage region 630 . the program storage region 610 comprises an incoming / outgoing call program 620 etc . the data storage region 630 comprises an address book 640 , angle detection buffer 650 , phone number selection buffer 660 , phone number input buffer 670 , and notification data 680 etc . programs stored in the program storage region 610 are described . the incoming / outgoing call program 620 determines whether or not the mobile terminal apparatus 100 is held in a correct orientation by the user while a call is being made and , when it is determined that the mobile terminal apparatus 100 is being held in an incorrect orientation that may cause a problem for the mobile terminal apparatus 100 in making a call , the user is informed and the process starting the call is carried out when the orientation is corrected . the incoming / outgoing call program 620 is described in detail later , referring to fig8 and fig1 . an email text display program executes a process of displaying an email text on the display part 110 when an operation to display the email text is executed at the time of receiving an email . data stored in the data storage region 630 is described . the data storage region 630 comprises an address book 640 , angle detection buffer 650 , phone number selection buffer 660 , phone number input buffer 670 , and notification data 680 . the address book 640 stores information regarding addresses input by a user and required for outgoing calls , and for sending emails to other communication terminal devices . the information regarding addresses is information that comprises phone numbers and email addresses etc . furthermore , for example , name , memory number , residential address , date of birth and group ( for example , information related to affiliations such as school or work ) are linked to a phone number and an email address , and stored in the information regarding addresses . the angle detection buffer 650 temporarily stores an angle of inclination that is detected by the angle - detecting part 165 from the normal state of the mobile terminal apparatus 100 . the phone number selection buffer 660 temporarily stores a phone number that is selected from the address book 640 via the operating part 120 or the touch panel input part 115 when an outgoing call is made by a user . the phone number input buffer 670 is a buffer for temporarily storing a phone number that is input via the operating part 120 or the touch panel input part 115 by a user . the proximity buffer 675 is a buffer for temporarily storing results detected by the proximity sensor 280 . the notification data 680 stores data to inform a user that the mobile terminal apparatus 100 is not being held in a correct orientation . in addition to those cited above , the program storage region 610 and the data storage region 630 store programs and data required for executing various kinds of functions provided with the mobile terminal apparatus . return to the description of fig2 . the rom 180 stores programs and data for executing functions provided with the mobile terminal apparatus 100 . the ram 190 is accessible from the controlling part 170 , and is used as a temporary storage region for the controlling part 170 to execute various kinds of processes . the i / f 200 is equipped with an external memory 210 that is attachable / detachable . the controlling part 170 is capable of accessing the external memory 210 via the i / f 200 and , for example , reads out and executes programs as well as data etc . that have been stored in the external memory 210 . the external memory 210 is a medium for storing programs or data and , for example , there are memory card , hdd ( hard disk drive ), and sim card ( subscriber identity module card ) etc . furthermore , the above programs and the data are not limited to programs that may directly be read out from the external memory 210 and executed , but may also be coded programs , compression - processed programs , image data , voice data , and text data etc . the wireless circuit 240 converts a prescribed high frequency signal input from the antenna 250 to a digital voice signal via demodulation processing and decoding processing . furthermore , the wireless circuit 240 converts digital voice signals input from the controlling part 170 to high frequency signals via encoding processing and modulation processing . subsequently , the wireless circuit 240 outputs the high frequency signals to the antenna 250 . the antenna 250 receives magnetic waves of a prescribed frequency and outputs the same to the wireless circuit 240 as high frequency signals . furthermore , the high frequency signals output from the wireless circuit 240 are output as magnetic waves of a prescribed frequency . the imaging part 260 comprises camera functions as well as video functions . images or video acquired by the imaging part 260 are stored in the rom 180 , ram 190 , and external memory 210 . the imaging part 260 is , for example , a ccd ( charge coupled device ) camera , or a cmos ( complementary metal oxide semiconductor ) camera etc . the imaging part 260 is arranged in the rear surface of the case of the mobile terminal apparatus 100 shown in fig1 , and thus , is not illustrated in fig1 . the recording part 270 comprises a function to record sound from outside such as sound input from the microphone 150 . furthermore , if a user does not respond to an incoming call from another terminal , the recording part 270 records sound from the other terminal input from the wireless circuit 240 . sound recorded by the recording part 270 is output via the speaker 140 by an input from the touch panel input part 115 and the operating part 120 by a user . the proximity sensor 280 detects that a subject to be detected is in proximity to the mobile terminal apparatus 100 . furthermore , the proximity sensor 280 outputs the detected results to the controlling part 170 as an electric signal . moreover , the results detected by the proximity sensor 280 are stored in the proximity buffer 675 . for example , when a user talks and brings an ear close to the terminal , the proximity sensor 280 detects as in proximity . on the other hand , when a user moves the terminal away from an ear , the proximity sensor 280 detects as not in proximity . the proximity sensor 280 is , for example , an infrared sensor and an ultrasound sensor etc . fig7 is a drawing showing a configuration provided in the controlling part 170 for executing the programs stored in the ram 190 . the controlling part 170 comprises an incoming / outgoing call - processing part 710 , determining part 720 , state - detecting part 730 , and notifying part 740 . the incoming / outgoing call - processing part 710 executes incoming / outgoing call program 620 stored in the ram 190 . the determining part 720 determines what is to be executed by an input received from a user at the operating part 120 or at the touch panel input part 115 . for example , the determining part 720 determines an input received at the operating part 120 or at the touch panel input part 115 from a user is whether or not an input to open the address book 640 , whether or not an input to start talking , whether or not an input to start an incoming call . furthermore , the determining part 720 determines whether or not the mobile terminal apparatus 100 is being held by a user . the determination is made based on whether or not the operating part 120 or the touch panel input part 115 has received an input from the user . the state - detecting part 730 determines whether the orientation of the mobile terminal apparatus 100 is correct or not based on the angle of inclination detected by the angle - detecting part 165 . the correct orientation means an orientation that does not cause a problem for a user to talk using the mobile terminal apparatus 100 while the speaker 140 is in a position higher than the microphone 150 . the incorrect orientation means an orientation that causes a problem for a user to talk using the mobile terminal apparatus 100 while the speaker 140 is in a position lower than the microphone 150 . next , a method of determining the orientation of the mobile terminal apparatus 100 conducted by the state - detecting part 730 is described . a state in which the microphone 150 is on the upper side from the normal surface 510 is defined as an inclining direction of +, and in a case of an angle detected by the angle - detecting part 165 is 1 degree to + 180 degrees , the determining part 720 determines that the mobile terminal apparatus 100 is held in a correct orientation . and a state in which the microphone 150 is on the lower side from the normal surface 510 is defined as an inclining direction of −, and in a case of an angle detected by the angle - detecting part 165 is 0 degree to − 179 degrees , the determining part 720 determines that the mobile terminal apparatus 100 is held in an incorrect orientation . that is , in a state illustrated in fig5 b and fig5 c , because the state of the microphone 150 is in a position lower than the speaker 140 , the determining part 720 determines that the mobile terminal apparatus 100 is held in an orientation that does not cause a problem for a user to talk . on the other hand , in a state illustrated in fig5 d and fig5 e , because the state of the microphone 150 is in a position higher than the speaker 140 , the determining part 720 determines that the mobile terminal apparatus 100 is held in an orientation that causes a problem for a user to talk . the notifying part 740 notifies a user when the state - detecting part 730 determines that the orientation of the mobile terminal apparatus 100 is incorrect . as a notifying method , for example , the notification data 680 stored in the ram 190 is displayed on the display part 110 via the display control part 106 . furthermore , when the state - detecting part 730 determines that the orientation of the mobile terminal apparatus 100 is incorrect , the notifying part 740 notifies the user that the orientation of the mobile terminal apparatus 100 is incorrect by controlling the speaker 140 as well as the light - emitting part 130 via the controlling part 170 . here , one example of the notification data 680 to be displayed on the display part 110 is shown in fig9 and fig1 . fig9 is notification data 680 for a notification when the mobile terminal apparatus 100 had an incoming call . in the image shown in fig9 a , a user is urged to hold the mobile terminal apparatus 100 in a correct orientation by being informed of the position of the microphone 150 and the speaker 140 . in the image shown in fig9 b , the user is urged to hold the mobile terminal apparatus 100 in a correct orientation by being informed of the position of the microphone 150 and the speaker 140 , with a warning to the user that the mobile terminal apparatus 100 is being held in an inverse orientation . while such an image as in fig9 ) is being displayed , if the user holds the mobile terminal apparatus 100 in a correct orientation , a phone call can be started either by selecting “ answer ”, which is displayed on the screen or inputting to start a call on the operating part 120 . the image shown in fig1 is an image to be displayed on the display part 110 when the user makes an outgoing call while the user is holding the mobile terminal apparatus 100 in an incorrect orientation . in the image shown in fig1 a , the user is urged to hold the mobile terminal apparatus 100 in a correct orientation by being informed of the position of the microphone 150 and the speaker 140 . in the image shown in fig1 b , the user is urged to hold the mobile terminal apparatus 100 in a correct orientation by being notified that the mobile terminal apparatus 100 is being held in an inverse orientation . while the notifying part 740 is in the middle of notifying , if there is an input from a user to respond to an incoming call or start an outgoing call at the operating part 120 or the touch panel input part 115 , the operation control part 750 controls to cancel these inputs as invalid . the risk that the user will start talking while in an orientation that could cause a problem for the call may be reduced by controlling the inputs as invalid . next , the incoming / outgoing call program 620 processed by the incoming / outgoing call - processing part 710 is described using fig8 . in the incoming / outgoing call program 620 , first , the determining part 720 determines whether there is an incoming call or not at the mobile terminal apparatus 100 ( s 150 ). if the determining part 720 determines that there is no incoming call at the mobile terminal apparatus 100 , the incoming / outgoing call - processing part 710 moves to a process in the flow chart shown in fig1 . on the other hand , when the controlling part 170 determines that there is an incoming call via the antenna 250 , next , the angle - detecting part 165 detects the angle of inclination of the mobile terminal apparatus 100 ( s 160 ). next , the state - detecting part 730 determines whether or not the mobile terminal apparatus 100 is being held by the user in a correct orientation based on the angle detected by the angle - detecting part 165 ( s 170 ). in s 150 , if the state - detecting part 730 determines that the mobile terminal apparatus 100 is being held in a correct orientation by the user , subsequently , the determining part 720 determines whether there was an input or not by the user to start a call at the operating part 120 or the touch panel input part 115 ( s 180 ). if the determining part 720 determines that there was an input to start a call , next , a talking part starts a call by controlling the wireless circuit 240 ( s 190 ). on the other hand , if the determining part 720 determines that there was no input to start a call , the incoming / outgoing call - processing part 710 again executes a process s 160 . in the process s 170 , if the state - detecting part 730 determines that the mobile terminal apparatus 100 is being held by the user in an incorrect orientation , the incoming / outgoing call - processing part 710 executes the process s 175 . in the process s 175 , the notifying part 740 displays an image as shown in fig9 on the display part 110 via the display control part 106 . displaying such an image as shown in fig9 notifies the user that the mobile terminal apparatus 100 is being held in an incorrect orientation and reduces the risk of starting to talk while the mobile terminal apparatus 100 is being held in an incorrect orientation . after executing the process s 175 , the incoming / outgoing call - processing part 710 again executes the process s 160 . next , a process related to an outgoing call when determined by the controlling part 170 that there is no incoming call in the process s 150 is described using fig1 . in s 150 , when the controlling part 170 determines that there is no incoming call with respect to the mobile terminal apparatus 100 via the antenna 250 , next , the determining part 720 determines whether there was an input or not by the user at the operating part 120 or at the touch panel input part 115 to open the address book 640 ( s 210 ). if the determining part 720 determines that there was an input by the user to open the address book 640 using the operating part 120 or the touch panel input part 115 , the display control part 106 causes the display part 110 to display information regarding address that has been stored in the address book 640 ( s 220 ). next , based on an input by the user using the operating part 120 or the touch panel input part 115 to select a phone number that is included in the information regarding address , the controlling part 170 temporarily stores the selected phone number in the phone number selection buffer 660 ( s 230 ). on the other hand , if the determining part 720 determines that the input by the user to open the address book 640 using the operating part 120 or the touch panel input part 115 has not been received , subsequently , it is determined whether an input of a phone number was received or not ( s 212 ). if the determining part 720 determines that there was an input of a phone number by the user , the display control part 106 displays a phone number display image on the display part 110 ( s 214 ). next , the controlling part 170 temporarily stores , in the phone number input buffer 670 , the phone number that has been input by the user at the operating part 120 or the touch panel input part 115 ( s 216 ). on the other hand , if the determining part 720 determines that there was no input of a phone number , the incoming / outgoing call - processing part 710 again executes the process s 110 in fig8 . after receiving the input to select a phone number by the user using the operating part 120 or the touch panel input part 115 in the process of either s 230 or s 216 , next , the angle - detecting part 165 detects the angle of inclination of the mobile terminal apparatus 100 ( s 240 ). next , the state - detecting part 730 determines whether or not the mobile terminal apparatus 100 is being held by the user in a correct orientation based on the detected angle of inclination ( s 250 ). if the state - detecting part 730 determines that the mobile terminal apparatus 100 is being held in a correct orientation by the user , next , the determining part 720 determines whether or not there was an input at the operating part 120 or the touch panel input part 115 by the user to start a call ( s 260 ). if the determining part 720 determines that there was an input at the operating part 120 or the touch panel input part 115 to start a call by the user , the controlling part 170 controls the wireless circuit 240 and start the call ( s 270 ). on the other hand , if the determining part 720 determines that the operation to start a call was not input by the user at the operating part 120 or the touch panel input part 115 , the incoming / outgoing call - processing part 710 again executes the process s 240 . in the process s 250 , if the state - detecting part 730 determines that the mobile terminal apparatus 100 is being held by the user in an incorrect orientation , the notifying part 740 displays an image as shown in fig1 on the display part 110 via the display control part 106 . by displaying such an image shown in fig1 on the display part 110 , the user is notified that the mobile terminal apparatus 100 is being held in an incorrect orientation , thus , it reduces the risk of starting a call while the mobile terminal apparatus 100 is being held in an incorrect orientation . the embodiment above is one example of the embodiments related to the mobile terminal apparatus 100 in the present invention and may be changed appropriately within the scope according to the aspect of the embodiment of the present invention . for example , the timing for the notifying part 740 to notify may also be a time when a user enters an input at the operating part 120 or the touch panel input part 115 to open the address book 640 . the other timing for the notification may also be a time when a numerical key pad is displayed on the display part 110 that the mobile terminal apparatus 100 comprises and when the user starts entering a phone number at the operating part 120 or the touch panel input part 115 . the other timing for the notification may also be a time when the user completes the input of the phone number at the operating part 120 or the touch panel input part 115 . for example , the method of notification conducted by the notifying part 740 may also be conducted by the display control part 106 as a result of inverting an image to be displayed on the display part 110 . for example , the notifying part 740 notifies the user that the orientation of the mobile terminal apparatus 100 is incorrect by controlling the speaker 140 as well as the light - emitting part 130 via the controlling part 170 , but the notification may also be conducted by the controlling part 170 by controlling the speaker 140 and the light - emitting part 130 without intervention by the notifying part 740 . for example , the notification method conducted by the notifying part 740 may also be conducted by the display control part 106 , by not displaying a button on the display part 110 to start a call . specifically , it is also possible to not display the “ answer ” on the display part 110 in the images shown in fig9 a and b . furthermore , it is also possible not to display a “ call ” button on the display part 110 in the images shown in fig1 a and b . as described above , the risk of the user being in a situation where a call becomes difficult is reduced by not displaying the “ answer ” for a response to an incoming call and the “ call ” to start an outgoing call . for example , the operating part may also be provided on the same plane as the display part 110 that is provided with the mobile terminal apparatus 100 . for example , as for the incoming / outgoing call program 620 , if there is an input by a user to interrupt the incoming / outgoing call program 620 either at the operating part 120 or the touch panel input part 115 , the incoming / outgoing call program 620 may be interrupted even in a case when any of processes is being executed . for example , in the present embodiment , while the notifying part 740 is notifying , if the operating part 120 or the touch panel input part 115 receives an input from the user to respond to an incoming call or receives an input to start an outgoing call , the operation control part 750 controls to cancel these inputs as invalid . however , as another example , it is also possible to start a call , regarding an input from the user to start a call as valid without controlling , by the operation control part 750 , the input operation from the user as invalid . for example , if a user is holding the mobile terminal apparatus 100 in an inverse orientation , images or video acquired by the imaging part 260 are stored in the rom 180 , ram 190 , or the external memory 210 after inverting the orientation . in such a case , in the event of displaying the stored images and the video on the display part 110 , the notifying part 740 may also notify that the orientation has been inverted for the display . for example , if the user is holding the mobile terminal apparatus 100 in an inverse orientation , operations related to functions that could cause a problem for the use are cancelled as invalid by the operation control part 750 . specifically , if the user is holding the mobile terminal apparatus 100 in an inverse orientation , operations related to the imaging part 260 are cancelled as invalid by the operation control part 750 . and the notifying part 740 may also display such an image as shown in fig9 b on the display part 110 . in the above embodiment , if the user corrects the way of holding the mobile terminal apparatus 100 in a correct orientation , it is also possible to regard input operations from the user with respect to the imaging part 260 as valid . for example , the present invention may also be implemented when an input is received from the user using the operating part 120 or the touch panel input part 115 to replay sound recorded in the recording part 260 , or when an input is received to start recording sound in the recording part 260 . that is , if the mobile terminal apparatus 100 detects the orientation in a case of replaying the recorded sound by an operation from the user and in a case of recording sound by the user , and if it is determined that the mobile terminal apparatus 100 is being held by the user in an incorrect orientation , a notification may also be provided . such a process executed by the mobile terminal apparatus 100 reduces the risk of generating a problem in the event when the recording function is used by the user . for example , while a user is holding the mobile terminal apparatus 100 in an incorrect orientation and if an incoming call is received at the mobile terminal apparatus 100 , it is also possible not to display a button for responding to the incoming call on the display part 110 as shown in fig1 a . furthermore , as shown in the dotted line in fig1 b , a button related to a response to be displayed on the display part 110 may also be displayed with a lower luminance . such a display on the display part 110 by the mobile terminal apparatus 100 reduces the risk of creating a state in which a phone call becomes difficult when a user responds to the incoming call . furthermore , also when a user makes an outgoing call , screens as shown in fig1 a and 13b may be displayed on the display part 110 by the mobile terminal apparatus 100 . such a display on the display part 110 by the mobile terminal apparatus 100 reduces the risk of creating a state in which a phone call becomes difficult when a user talks . for example , when the proximity sensor 280 detects a subject to be detected is in proximity during a call , the mobile terminal apparatus 100 switches off the display of the display part 110 . furthermore , the mobile terminal apparatus 100 may also switch off a back - light arranged at a liquid crystal display constituting the display part 110 . that is , while a user is using the mobile terminal apparatus 100 against an ear , it is also possible for the mobile terminal apparatus 100 to not display an image on the display part 110 for the purpose of saving power . moreover , after the proximity is detected by the proximity sensor 280 during a call , when the proximity is no longer detected , such processes in s 160 to 5175 shown in fig8 or s 240 to s 255 shown in fig1 may also be executed again . that is , while a user is on the phone with an ear against the mobile terminal apparatus 100 , after placing the mobile terminal apparatus 100 on the desk etc . when the same is held in a hand again , the mobile terminal apparatus 100 detects the orientation of being held . and if the mobile terminal apparatus 100 is being held in an incorrect orientation and such is detected , the matter of the incorrect orientation may also be notified to the user . such a process executed by the mobile terminal apparatus 100 reduces the risk of the user causing a problem in talking . while at least one exemplary embodiment is presented in the foregoing detailed description , the present disclosure is not limited to the above - described embodiment or embodiments . variations may be apparent to those skilled in the art . in carrying out the present disclosure , various modifications , combinations , sub - combinations and alterations may occur in regard to the elements of the above - described embodiment insofar as they are within the technical scope of the present disclosure or the equivalents thereof . the exemplary embodiment or exemplary embodiments are examples , and are not intended to limit the scope , applicability , or configuration of the disclosure in any way . rather , the foregoing detailed description will provide those skilled in the art with a template for implementing the exemplary embodiment or exemplary embodiments . it should be understood that various changes can be made in the function and arrangement of elements without departing from the scope of the disclosure as set forth in the appended claims and the legal equivalents thereof . furthermore , although embodiments of the present disclosure have been described with reference to the accompanying drawings , it is to be noted that changes and modifications may be apparent to those skilled in the art . such changes and modifications are to be understood as being comprised within the scope of the present disclosure as defined by the claims . terms and phrases used in this document , and variations hereof , unless otherwise expressly stated , should be construed as open ended as opposed to limiting . as examples of the foregoing : the term “ including ” should be read as mean “ including , without limitation ” or the like ; the term “ example ” is used to provide exemplary instances of the item in discussion , not an exhaustive or limiting list thereof ; and adjectives such as “ conventional ,” “ traditional ,” “ normal ,” “ standard ” “ known ” and terms of similar meaning should not be construed as limiting the item described to a given time period or to an item available as of a given time , but instead should be read to encompass conventional , traditional , normal , or standard technologies that may be available or known now or at any time in the future . likewise , a group of items linked with the conjunction “ and ” should not be read as requiring that each and everyone of those items be present in the grouping , but rather should be read as “ and / or ” unless expressly stated otherwise . similarly , a group of items linked with the conjunction “ or ” should not be read as requiring mutual exclusivity among that group , but rather should also be read as “ and / or ” unless expressly stated otherwise . furthermore , although items , elements or components of the present disclosure may be described or claimed in the singular , the plural is contemplated to be within the scope thereof unless limitation to the singular is explicitly stated . the presence of broadening words and phrases such as “ one or more ,” “ at least ,” “ but not limited to ” or other like phrases in some instances shall not be read to mean that the narrower case is intended or required in instances where such broadening phrases may be absent . the term “ about ” when referring to a numerical value or range is intended to encompass values resulting from experimental error that can occur when taking measurements . | 7 |
description will now be given in detail of the present invention , with reference to the accompanying drawings . the present invention can be implemented in a supl network . however , the present invention may be employed to radio ( wireless ) communication systems which are operated based upon different specifications . hereinafter , the preferred embodiments of the present invention will be explained . the present invention proposes a periodic positioning method in a supl based position information ( positioning ) system . especially , the present invention proposes a method for performing a periodic positioning by allowing each of server and terminal to manage a trigger generating the periodic positioning . in general , location services provided in a supl based positioning system may classified into a service by a network ( i . e ., network - initiated case ) and a service by a set ( i . e ., set - initiated case ). the location services may be classified into a proxy mode that the set performs positioning by directly exchanging messages with a h - slp of a home network , and a non - proxy mode that the set performs positioning by exchanging messages with a supl location center ( slp ) and a supl positioning center ( spc ) within the h - slp . in the present invention , a periodic positioning is divided into a network - trigged case or a set - trigged case according to a subject which manages trigger information . the divided cases will be re - classified into a service by a network ( i . e ., network - initiated case and a service by the set ( i . e ., set - initiated case ) to thusly be explained . fig1 is a view illustrating a periodic positioning procedure in accordance with a first embodiment of the present invention . the first embodiment of the present invention illustrates a network - trigged case and a network - initiated case for a non - roaming proxy mode . here , the slp corresponds to a network side , while a target set ( referred to as set hereafter ) corresponds to a terminal side . when an outer lcs client requests a periodic positioning , a supl agent requests the positioning from the slp using a mobile location protocol ( mlp ) trigged location reporting request ( tlrr ) message ( s 10 ). the mlp tlrr message may include parameters such as ms - id , client - id , qop , and tlrr_event which is a positioning related trigger parameter . here , ms - id denotes a positioning target ( set ), qop denotes an accuracy ( e . g ., a time delay and a spatial accuracy ) of a result for the positioning ( location tracking ) desired by the client , and tlrr_event denotes a definition of the ‘ periodic ’, namely , a starting time and ending time of the periodic positioning ( e . g ., 8 am to 10 am ) and a request period for the periodic positioning ( e . g ., a one - hour interval ). the mlp tlrr message may further include parameters related to types of the positioning values ( which , for example , represent a current value or a value obtained in the latest time when it is difficult to tracking the current value ), and parameters for setting priorities with respect to each positioning request for several positioning requests . the slp having received the mlp tlrr message checks whether the set can supports the supl by using a lookup table , and then checks whether the target set is currently supl roaming using routing information ( s 11 ). if it is checked that the set supports the supl and is not roaming , the slp sends a supl initiating message supl init to the set to start a supl procedure with the set ( s 12 ). the supl init message may include session - id , slp mode , supl mode , positioning method ( posmethod ) to be used , and the like . here , the slp mode denotes an operation mode of the slp ( i . e ., a proxy mode or a non - proxy mode ), the supl mode denotes types of positioning ( e . g ., immediate , periodic , deferred ), namely , trigger type information . here , the supl mode denotes a periodic service type positioning . also , the slp confirms a privacy of the set prior to performing the step s 11 . if the user requires a notification related to location ( position ) information , the slp further includes a notification parameter in the mlp tlrr message . hence , the slp sends the supl init message by including periodic trigger information therein . this parameter may be used to inform of information related to the periodic positioning and of the corresponding positioning being executed by the slp ( i . e ., network - trigged case ). here , the supl init message may be sent in forms of a wireless application protocol ( wap ) push , a short message service ( sms ) trigger , a session initiation protocol ( sip ) push , or the like , for example . the set having received the supl init message requests a data connection from a packet data network ( i . e ., 3gpp or 3gpp2 ) when any data connection is not currently set between the set itself and a certain network ( s 13 ). once setting the data connection , the set stores the trigger information sent by the supl init message , and then sends a supl start message to the slp ( s 14 ). here , the set sends set capability information by including it in the supl start message . the slp sends acknowledgement ( i . e ., whether the positioning can be performed ) with respect to the corresponding positioning request to the supl agent by using a mlp trigged location reporting answer ( tlra ) message exchanged ( s 15 ). thereafter , the slp sends a supl response message to the set in response to the supl start message ( s 16 ). here , the supl response message may be replaced with a supl trigger message . in this case , the step s 16 is not performed . afterwards , when a particular event is generated ( for every certain period ) based upon the stored trigger information , the slp sends the supl trigger message to the set to start a positioning procedure ( s 17 ). the set then sends a supl position initiating message ( i . e ., supl pos init ) to the slp so as to start a trigger session with the slp ( s 18 ). the supl pos init message may include at least location identifiers lid indicating a session id , a base station id , or the like , versions , set capabilities , and the like . accordingly , the slp and the set exchange ( send and receive ) consecutive messages to execute an actual positioning , and then the slp or set calculates a position of the set by virtue of the consecutive messages ( s 19 ). preferably , the messages exchanged between the slp and the set may include a session id , protocols to be used for the positioning ( e . g ., rrlp , rrc or tia - 801 ), etc . here , the positioning for the set may be performed by the slp based upon a positioning measurement value received from the set ( i . e ., set - assisted mode ), or be performed by the set based upon assistance obtained from the slp ( i . e ., set - based mode ). fig1 illustrates an example that the positioning is performed in the set - assisted mode . however , if the positioning is performed in the set - based mode , the set sends the calculated position value ( i . e ., posresult ) to the slp using a supl report message ( s 20 ). therefore , the slp sends the position value , which is calculated by the slp itself or transferred from the set , to the supl agent using a tlrep message ( s 21 ). afterwards , in the succeeding positioning period , the slp and the set perform the positioning for the corresponding period by using the supl trigger message , the supl pos init message , the supl pos procedure , the supl report message , the mlp tlrep message , and thereafter send a calculated position value of the set to the supl agent ( s 22 ˜ s 26 ). then , when the series of periodic positioning procedures are all terminated ( ended ) ( i . e ., when a positioning ending time arrives ), the slp sends a supl end message to inform the set of the termination of the supl procedure ( or supl session ) ( s 27 ). the set then releases an ip connection with the slp and releases all of the resources related to the positioning session . on the other hand , in fig1 , the supl start and supl response may be omitted . in this case , the mlp tlra message may be sent following the supl pos init message . fig2 is a view illustrating a periodic positioning procedure in accordance with a second embodiment of the present invention , which illustrates an example that a period for the periodic positioning is relatively longer than that in the first embodiment . as illustrated in fig2 , for a long period for the periodic positioning , the slp terminates ( ends ) the positioning for one period at the end of every period using a supl end message ( here , the supl connection other than the supl session is released ( disconnected )) ( s 41 ). the slp then executes the positioning for the succeeding period at a starting point of the succeeding period by using the supl trigger again ( s 43 ). here , the steps ( s 30 ˜ s 40 ) are the same as the steps ( s 10 ˜ s 20 ) of fig1 except their numerals , detailed explanation for which will not be repeated accordingly . that is , when the periodic positioning procedure with respect to one period is terminated ( ended ) ( s 39 ), the slp sends a supl end message to the set to release the supl pos connection with respect to one period ( s 41 ). the slp then sends a corresponding periodic positioning value to the supl agent using the mlp tlrep message ( s 42 ). afterwards , the slp connects ( opens ) the released supl pos connection using the supl trigger message , and informs the set of the performance of the positioning with respect to the succeeding period ( s 43 ). accordingly , when the corresponding event is generated , the slp and the set execute the positioning for the corresponding period using the supl pos init message , the supl pos procedure , and the supl report and mlp tlrep messages , and then sends the corresponding position value to the supl agent ( s 44 ˜ s 47 ). when the series of the periodic positioning procedures are all terminated ( ended ), the slp sends the supl end message to the set to inform of the termination of the supl procedure ( s 48 ). fig3 is a view illustrating a periodic positioning procedure in accordance with a third embodiment of the present invention . the third embodiment of the present invention illustrates a network - trigged case and a set - initiated case for a non - roaming proxy mode . here , the slp corresponds to a home network side , while a target set ( referred to as set hereafter ) corresponds to a terminal side . first , when a supl agent requests a periodic positioning , the set requests a data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ) when any data connection is not currently set between the set itself and a certain network ( s 50 ). once setting the data connection , the set sends a supl start message to the slp to start a periodic positioning request procedure ( s 51 ). the set includes a report_criteria parameter in the supl start message so as to set a period , a starting time and an ending time of the periodic positioning request . the set then sends the set information to the slp . the slp having received the supl start message stores the periodic positioning information , and checks whether the set is currently supl roaming using routing information ( s 52 ). if it is checked that the set is not supl roaming , the slp sends a supl response message in response to the supl start message ( s 53 ). afterwards , when the corresponding event is generated , the slp sends a supl trigger message to the set to start the periodic positioning procedure ( s 54 ). the set sends the supl pos init message to the slp so as to start a trigger session with the slp ( s 55 ). here , for the initial period positioning generated , the supl trigger message may be replaced with the supl response message of the step ( s 53 ), or the supl response message may be replaced with the supl trigger message of the step ( s 54 ). accordingly , the slp consecutively exchanges ( sends and receives ) positioning protocols ( e . g ., rrlp , rrc , tia - 801 , etc .) with the set using the supl pos message for performing the positioning , thereby calculating the position of the set ( s 56 ). here , the positioning for the set can be performed by the slp based upon a positioning measurement value received from the set ( i . e ., set - assisted mode ), or be performed by the set based upon assistance obtained from the slp ( i . e ., set - based mode ). if the positioning is performed in the set - assisted mode , the slp sends the calculated position value ( i . e ., posresult ) to the set using a supl report message ( s 57 ). if the positioning is performed in the set - based mode , the slp does not send the supl report message to the set hence , the set sends the position value calculated by the set itself or the position value received from the slp to the supl agent . afterwards , in the succeeding positioning period , as aforementioned , the slp and the set performs the positioning for the corresponding period using the supl trigger message , the supl pos init message , the supl pos procedure , and the supl report message to thereafter send the calculated position value of the set to the set ( s 58 ˜ s 61 ). then , when the entire periodic positioning procedures are terminated ( ended ), the slp sends the supl end message to the set to inform the set of the termination of the supl procedure ( or the supl session ) ( s 62 ). the set then releases the ip connection with the sip and releases all of the resources related to the positioning session . fig4 is a view illustrating a periodic positioning procedure in accordance with a fourth embodiment of the present invention , which illustrates an example that a period for the periodic positioning is relatively longer than that in the third embodiment . as illustrated in fig4 , for a long period for the period positioning , the slp terminates ( ends ) the positioning with respect to one period at the end of every period using the supl end message ( i . e ., releases or disconnects the supl connection ) ( s 78 ). the slp then performs the positioning for the succeeding period at the starting point of the succeeding period by using the supl trigger again ( s 79 ). here , the steps ( s 70 ˜ s 77 ) are the same as the steps ( s 50 ˜ s 57 ) except their reference numerals , detailed explanation for which will not be repeated accordingly . that is , when the periodic positioning procedure for one period is terminated ( ended ) ( s 76 ), the slp sends the supl end message to the set and then releases the supl pos connection ( or trigger connection ) with respect to one period ( s 78 ). afterwards , the slp sends the supl trigger message to the set to inform the set of the performance of the positioning with respect to the succeeding period ( s 79 ). here , when any data connection is set between the set itself and a certain network , the set can request the data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ). accordingly , when the corresponding event is generated , the slp and the set perform the positioning for the corresponding period using the supl pos init message , the supl pos procedure , and the supl report message , and , in some cases , send the corresponding position value to the set ( s 80 ˜ s 82 ). when the series of the periodic positioning procedures are terminated ( ended ), the slp sends the supl end message to the set to inform the set of the termination of the entire supl procedure ( or the trigger session ) ( s 83 ). fig5 is a view illustrating a periodic positioning procedure in accordance with a fifth embodiment of the present invention . the fifth embodiment of the present invention illustrates a set - trigged case and a network - initiated case for a non - roaming proxy mode . here , the slp corresponds to a home network side , while a target set ( referred to as set hereafter ) corresponds to a terminal side . first , when an outer lcs client requests a periodic positioning , the supl agent requests the positioning from the slp using a mlp tlrr message ( s 90 ). the mlp tlrr message , as aforementioned , may include parameters such as ms - id , client - id , qop , tlrr_event , and the like . tlrr_event denotes a definition of the ‘ periodic ’, namely , a starting time and ending time of the periodic positioning ( e . g ., 8 am to 10 am ) and a request period for the periodic positioning ( e . g ., a one - hour interval ). the mlp tlrr message may further include parameters related to types of the positioning values ( which , for example , represent a current value or a value obtained in the latest time when it is difficult to tracking the current value ), and parameters for setting priorities with respect to each positioning request for several positioning requests . upon receiving the mlp tlrr message , the slp checks whether the set can support the supl using a lookup table , and checks whether the target set is currently supl roaming using routing information ( s 91 ). if it is checked that the set supports the supl and not roaming , the slp sends a supl init message to the set to start a supl procedure ( s 92 ). the supl init message must at least include parameters such as session - id , posmethod , slp mode , supl mode , and the like . the supl mode denotes trigger type information , which indicates a periodic service type in the fifth embodiment of the present invention . the slp checks a privacy of the set prior to performing the step s 91 . if a user requires a notification related to position information , a notification parameter is additionally included in the mlp tlrr message . the slp includes a report_criteria parameter which is a trigger parameter ( or trigger information ) in the supl init message for sending . the slp uses the report_criteria parameter to send trigger information related to the periodic positioning received from the outer lcs client to the set . that is , the slp forwards the trigger information which generates the periodic positioning to the set ( i . e ., set - trigged case ) so as to allow a performance of an actual positioning procedure when the corresponding event is generated in the set . for example , the report_criteria may include a period , a starting time and an ending time for requiring the periodic positioning request . when any data connection is not set between the set itself and a certain network , the set having received the supl init message requests the data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ) ( s 93 ). upon setting the data connection , the set stores the trigger information sent through the supl init message and thereafter sends a supl start message to the slp ( s 94 ). here , the set sends set capability information by including it in the supl start message . the slp sends acknowledgement with respect to the corresponding positioning request to the supl agent by using a mlp tlra message ( s 95 ). the slp then sends a supl response message in response to the supl start message to allow the set to start the positioning procedure when the corresponding event is generated ( s 96 ). afterwards , when the corresponding event is generated based upon the stored trigger information ( i . e ., per period for the periodic positioning ), the set sends the supl pos init message to the slp to start the positioning procedure with the slp ( s 97 ). here , if a tcp / ip connection set between the slp and the set is terminated ( released ) after sending the supl response message , the set must reset the data connection prior to sending the supl pos init message . accordingly , the set consecutively exchanges messages for performing an actual positioning with the slp to calculate the position of the set ( s 98 ). here , the positioning for the set may be performed by the slp based upon a positioning measurement value received from the set ( i . e ., set - assisted mode ), or be performed by the slp based upon assistance obtained from the slp . upon performing the positioning in the set - based mode , the set sends the calculated position value ( i . e ., posresult ) to the slp using the supl report message ( s 99 ). upon performing the positioning in the set - assisted mode , the slp does not send the supl report message . accordingly , the slp sends the corresponding positioning value to the supl agent using the tlrep message ( s 100 ). in the succeeding positioning period , the slp and the set perform the positioning of the corresponding period by using the supl pos init message , the supl pos procedure , the supl report message , and the mlp tlrep message , and thereafter send a calculated position value of the set to the supl agent ( s 101 ˜ s 104 ). afterwards , when the series of the periodic positioning procedures are terminated ( ended ) ( i . e ., at the positioning ending time ), the slp sends a supl end message to the set to inform the set of the termination of the supl procedure ( or supl session ). the set then releases the ip connection with the slp and releases all of the resources related to the positioning session . in fig5 , on the other hand , the supl start and supl report messages may be omitted . in this case , the mlp tlra message may be sent after sending the supl pos init message . fig6 a view illustrating a periodic positioning procedure in accordance with a sixth embodiment of the present invention , which illustrates an example that a set can open or connect a supl session for every period when a period for the periodic positioning is relatively longer than that in the fifth embodiment . as illustrated in fig6 , for a long period for the periodic positioning , the slp terminates ( ends ) the positioning for one period at the end of every period using a supl end message ( here , the supl connection is released ( disconnected )) ( s 120 ). the set then re - sends the supl start message to the slp at a starting point of the succeeding period to perform the positioning for the succeeding period ( s 122 ). here , the steps ( s 110 ˜ s 119 ) are the same as the steps ( s 90 ˜ s 99 ) except their reference numerals , detailed explanation for which will not be repeated accordingly . that is , when the periodic positioning procedure for one period is terminated ( s 118 ), the slp sends the supl end message to the set to release a supl pos connection for the one period ( s 120 ). the slp thereafter sends the corresponding periodic positioning value to the supl agent using the mlp tlrep message ( s 121 ). then , in the succeeding positioning period , the set performs the positioning for the corresponding period using the supl start , supl reponse , supl pos init messages , the supl pos procedure , and the supl report and mlp tlrep messages , and thereafter sends the corresponding position value to the supl agent ( s 122 ˜ s 127 ). here , the supl start message may be used for informing the slp of the starting of the positioning for the succeeding period . when the series of the periodic positioning procedures are terminated ( ended ), the slp sends the supl end message to the set to inform the set of the termination of the supl procedure ( s 128 ). fig7 is a view illustrating a periodic positioning procedure in accordance with a seventh embodiment of the present invention . the seventh embodiment illustrates an example that the slp sends the report_criteria using a new supl trigger request message when the slp can not send the report_criteria using the supl init message due to a limitation on the size of the supl init message . that is , the seventh embodiment of the present invention is different from the fifth embodiment in view of the addition of supl trigger request and supl trigger response message , and also in view of the addition of a supl mode ( which is a parameter for identifying immediate , periodic , or deferred positioning ) to the supl init message . other steps are the same as those in the fifth embodiment except their reference numerals . hence , upon performing the aforementioned steps ( s 130 ˜ s 134 ), the slp sends information related to the periodic positioning to the set using a supl trigger request message ( s 135 ), so as to make the set arrange the periodic positioning according to the corresponding information and to allow the set to separately perform a user confirmation . the set stores the periodic trigger information sent by the supl trigger request message and thereafter sends a supl trigger response message in response to the supl trigger request message ( 136 ). however , unlike fig5 , as illustrated in fig7 , the slp receives the supl trigger response message from the set and then sends a mlp tlra message to the supl agent ( s 137 ). since the slp sends to the set the supl trigger request message which includes the trigger information related to the periodic positioning , and then receives from the set the supl trigger response message in response to the supl trigger request message , only the reception of the supl trigger response message can inform that the trigger information related to the periodic positioning has completely sent to the set . however , the supl trigger response message can be omitted . in this case , the slp sends the supl trigger request message and then immediately sends the mlp tlra message to the supl agent . the supl init message can be sent in a sms sending manner . accordingly , when the report_criteria parameter can not be all included in the sms , the supl trigger request message may denote a message for separately sending the report_criteria parameter , and the supl trigger response message corresponds to a message in response to the supl trigger request message . therefore , both the supl start message and the supl response message can be omitted in fig5 . in fig7 , however , for sending the trigger information related to the periodic positioning by the supl trigger request message and receiving the supl trigger response , the set must first send the supl start message to the slp to obtain an acceptance from the slp with respect to the periodic positioning included in the supl init . accordingly , only the supl response message may be omitted . even in the seventh embodiment of the present invention , for the long period for the periodic positioning , a procedure can be changed so as to be able to open ( connect ) the supl session by the set per every period . in this case , the supl start message and the supl response message are added for every positioning period prior to sending the supl pos init message . if the supl report message is not used ( required ), the supl end message is added following the supl pos procedure . if the supl report message is used , the supl end message is added following the supl report message . fig8 is a view illustrating a periodic positioning procedure in accordance with an eighth embodiment of the present invention . the eighth embodiment illustrates a set - trigged case and a set - initiated case for a non - roaming proxy mode . first , when a supl agent requests a periodic positioning , if any data connection is not set between the set and a certain network , the set requests the data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ) ( s 150 ). upon setting the data connection , the set sends a supl start message to the slp to start a periodic positioning request procedure ( s 151 ). here , the set includes a tlrr_event parameter in the supl start message to set a period , a starting time and an ending time of the periodic positioning request , thereby sending the supl start message to the slp . that is , the set is performing the periodic supl procedure with managing trigger information , and accordingly the set may not send the tlrr_event parameter to the slp . however , the sending of the tlrr_event to the slp is to previously inform the slp of information related to resource management and the periodic positioning . the slp having received the supl start message checks whether the set is currently supl roaming using routing information ( s 152 ). if the set is not roaming , the slp sends a supl response message in response to the supl start message ( s 153 ). afterwards , when a certain event is generated based upon pre - stored trigger information ( at the positioning period ), the set sends a supl pos init message to the slp to start the periodic positioning procedure ( s 154 ). here , the set can inform the slp using an event_trigger parameter that the periodic positioning period has currently arrived and also can inform the slp of the remaining period of the entire positioning period using the event_trigger parameter . here , if a tcp / ip connection between the slp and the set is terminated after sending the supl response message , the set must reset the data connection prior to sending the supl pos init message . therefore , the set consecutively exchanges messages for performing an actual positioning with the slp to calculate the position of the set ( s 155 ). here , the positioning for the set may be performed by the slp based upon a positioning measurement value received from the set ( i . e ., set - assisted mode ), or be performed by the set based upon assistance obtained from the slp ( i . e ., set - based mode ). fig8 illustrates the positioning performed in the set - based mode . however , if the positioning is performed in the set - assisted mode , the slp sends the calculated position value ( i . e ., posresult ) to the set using the supl report message ( s 156 ). accordingly , the set sends the position value calculated by the set itself or the position value received from the slp to the supl agent . afterwards , in the succeeding positioning period , the slp and the set , as described above , perform the positioning for the corresponding period using the supl pos init message , the supl pos procedure , and the supl report message to thusly calculate the position value of the set ( s 157 ˜ s 159 ). then , when the series of periodic positioning procedures are all terminated ( ended ), the slp sends the supl end message to the set to inform the set of the termination of the supl procedure ( s 160 ). the set then releases the ip connection with the slp and also releases all of the resources related to the positioning procedure . fig9 is a view illustrating a periodic positioning procedure in accordance with a ninth embodiment of the present invention , which illustrates an example that a period for the periodic positioning is relatively longer than that in the eighth embodiment . as illustrated in fig9 , for a long period for the periodic positioning , the slp terminates ( ends ) the positioning for one period at the end of every period using the supl end message ( i . e ., releases or disconnects the supl connection ) ( s 176 ). the set re - sends the supl start message to the slp at the starting point of the succeeding period to perform the positioning for the succeeding period ( s 177 ). here , the steps ( s 170 ˜ s 175 ) are the same as the steps ( s 150 ˜ s 155 ) except their reference numerals , detailed explanation for which will not be repeated accordingly . that is , when the periodic positioning procedure for one period is terminated ( ended ) ( s 175 ), the slp sends the supl end message to the set and terminates ( ends ) the supl pos session for the one period ( s 176 ). afterwards , in the succeeding positioning period , the set re - performs the positioning for the corresponding period using the supl start , supl response , supl pos init , and supl pos procedure messages ( s 177 ˜ s 180 ). in this case , the tlrr_event of the supl start message includes a decreased period value . if any data connection is not set between the set itself and a certain network , the set requests the data connection from a packet data network ( e . g ., 3gpp or 3gpp2 ) prior to sending the supl start message . accordingly , when the series of periodic positioning procedure is terminated , the slp sends the supl end message to the set to inform the set of the termination of the supl procedure ( s 181 ). as described above , in the present invention , the periodic positioning method in the supl based position information system can be provided so as to enable a provisioning of various positioning methods to a user . as the present invention may be embodied in several forms without departing from the spirit or essential characteristics thereof , it should also be understood that the above - described embodiments are not limited by any of the details of the foregoing description , unless otherwise specified , but rather should be construed broadly within its spirit and scope as defined in the appended claims , and therefore all changes and modifications that fall within the metes and bounds of the claims , or equivalents of such metes and bounds are therefore intended to be embraced by the appended claims . | 6 |
the present invention may be employed in detecting and / or quantifying targeted analytes present in chemical or biological substances . generally any analyte interaction that is stable under chemiluminescence activation conditions may be prepared in this assay system . although various types of chemiluminescent compounds having an acridinium , benzacridinium , or acridan type of heterocyclic ring systems are preferred labels , use of equivalent chemiluminescent compounds and means for activating the labels do not depart from the scope of this invention . acridinium and benzacridinium esters are currently the more preferred chemiluminescent compounds , with preferred acridinium esters including those compounds having heterocyclic rings or ring systems that contain the heteroatom in a positive oxidation state including such ring systems as acridinium , benz a ! acridinium , benz b ! acridinium , benz c ! acridinium , a benzimidazole cation , quinolinium , isoquinolinium , quinolizinium , a cyclic substituted quinolinium , phenanthridinium , and quinoxalinium , as are well - known in the art . the tracer may be prepared by attaching the selected binding conjugate either directly or indirectly with a reactive functional group present on the acridinium or benzacridinium ester , as is well known to those skilled in the art , e . g . weeks et al ., clinical chemistry , 29 ( 8 ), 1474 - 1479 , 1983 . particularly preferred compounds are acridinium and benzacridinium esters with an aryl ring leaving group and the reactive functional group present in either the para or the meta position of the aryl ring . particularly stable acridinium and benzacridinium esters are those having an aryl ring leaving group , with the aryl ring having an electron donating species ( preferably c 1 - c 4 alkyl or alkoxy group , most preferably methyl ) present in both ortho positions of the aryl ring and having the reactive functional group ( preferably a -- cooh which is converted to a n - succinimidyloxycarbonyl group prior to the attachment of the binding partner ) in the meta or para position ( most preferably para ), as described in u . s . pat . no . 4 , 745 , 181 and wo 94 / 21823 , both of which are incorporated by reference . the solid phase is preferably a metal oxide material preferably chromium oxide , iron oxide , nickel oxide , or any mixture thereof . the solid phase should be water insoluble and maintain structural integrity when exposed to water or biological fluids and may be particulate in nature ( varying from a finely divided material , such as that in a magnetic ferrofluid , to a coarse granular material ), or a shaped article ( such as beads , test tube trays , microtiter plate , membrane , film , filter paper , discs , and so on ). more preferably the solid phase particles comprise a core of iron oxide as described in u . s . pat . no . 4 , 554 , 088 , issued to whitehead , et al ., 1985 ( hereby incorporated by reference ). to assist in the attachment of the binding conjugate , preferably the metal oxide solid phase has present a bioaffinity substance present thereon . silane polymeric coatings are particularly preferred bioaffinity substances and generally may be defined as organofunctional and silicon - functional compounds that are characterized in that the silicon portion of the molecule has an affinity for inorganic materials while the organic portion of the molecule is tailored to combine with organics . preferably chemical reactions to attach the binding conjugate to the solid phase include , but are not limited to , diazotization , carbodiimide and glutaraldehyde couplings . coupling techniques that may be used are described in method of enzy ., 70 , p . 159 - 165 ( 1980 ), and groman , e . v ., et al , in bio techniques , vol . 3 , pp . 156 ( 1985 ), and u . s . pat . no . 4 , 672 , 040 , issued to josephson in 1987 ( each of which are hereby incorporated by reference ). if the present invention is practiced with gene probes , nucleic acid hybridization may be accomplished using the metal oxide solid phase where the hybridizations are carried out by dispersing a nucleic acid - coupled solid phase ( most preferably a dna oligomer ) in a reaction mixture containing molecules to be isolated , allowing the nucleic acid - coupled solid phase to hybridize to a complementary target sequence . chemiluminescent light emission of the acridinium ester compounds may be triggered by known activating reagents , typically a base and h 2 o 2 ( including h 2 o 2 producing compounds ) or o 2 present in a solvent ( s ) including water , ethers , esters , alcohols , and ketones , and mixtures thereof . according to the invention , the activating reagent ( s ) is contacted with the entire reaction mixture after the binding reaction has occurred ( i . e . the specific binding complex bound to the solid phase is not separated from the free fraction ). preferably , the activating agent is actually two separate reagents as described below as the &# 34 ; first &# 34 ; reagent ( added first to the reaction mixture ) and the &# 34 ; second &# 34 ; reagent ( added to the reaction mixture promptly after the first reagent ). the first reagent is an aqueous acidic hydrogen peroxide solution and the second reagent is a basic aqueous reagent and the chemiluminescent light is measured promptly (&# 34 ; promptly &# 34 ; defined herein as a time period not to exceed several minutes , more preferably less than one minute , most preferably about 0 . 1 second or so after the second reagent is added to the reaction mixture ). the acid of the first reagent may be any suitable acid including nitric acid , hydrochloric acid , sulfuric acid , and mixtures thereof , and the like . most preferably the acid in the first reagent is nitric acid present in a concentration from about 0 . 05n to about 0 . 5n ( most preferably about 0 . 1n ) in an aqueous solution having from about 0 . 1 % to about 10 % ( v / v ) hydrogen peroxide present , said % based on the total volume of aqueous solution . the base present in the second reagent is any suitable base , including sodium hydroxide , potassium hydroxide , lithium hydroxide , and mixtures thereof , and the like . generally , sodium hydroxide is preferred as the base in the second reagent , and may be used in a concentration level of from about 0 . 25n to about 1 . 25 n , ( most preferably about 0 . 25n ). additionally , the usual constituents known to those skilled in the art may be included in the activating reagent ( s ), such as , buffer substances ( including phosphate buffer , citrate buffer , borate buffer , and so on ), various surfactants and / or preservatives ( such as described in u . s . pat . no . 4 , 927 , 769 and pending u . s . pat . no . 08 / 339 , 870 , filed nov . 14 , 1994 , both commonly assigned to ciba corning diagnostics corp . ), and proteins ( including bovine serum albumin , gelatin , casein , and so on ). the most preferred activating reagents are : first reagent : aqueous solution of nitric acid ( preferably 0 . 1n ) in from about 0 . 1 % to about 10 % ( preferably from 0 . 5 % to 1 %) of hydrogen peroxide ; and second reagent : aqueous solution of from about 0 . 25n to about 1 . 25n of naoh ( preferably 0 . 25n ) in water containing from about 0 . 1 to about 1 % ( v / v ) surfactant ( most preferably n - alkyl trimethyl ammonium chloride ), with said % based on the total volume of the aqueous reagent solution . as used herein , the modulated chemiluminescent signal is inclusive of the total chemiluminescent signal provided by the reaction mixture . this includes the quenched chemiluminescent signal provided by tracer bound to the solid phase as well as any tracer that is left in the free fraction solution once the specific binding reaction on the solid phase has transpired . the percent quenching of the chemiluminescent signal is calculated by the following equation : ## equ1 ## the unquenched signal counts are the counts measured from the chemiluminescent flash of a given amount of the unbound tracer taken in the absence of solid phase . the given amount is defined as the same quantity of tracer as is added to the assay . the % quench calculation may then be associated with a reference ( including , for example , a synthetic target sequence dna and so on ) to determine the amount or presence of the analyte in the sample . it has been observed that chemiluminescence is quenched in proportion to the mass of solid phase present during flashing when the solid phase is coated with an irrelevant binding partner . the signal modulation described here is in addition to and of greater magnitude than quenching due to solid phase mass , and is due to the specific binding reaction of the acridinium ester labeled analyte and the binding partner covalently attached to the solid phase . the evaluation and measurement of the light emission generated by the activation ( e . g . flashing ) of the chemiluminescent label in all embodiments may be accomplished by techniques known to those skilled in the art . for example , luminometer instruments that may be utilized in measuring the chemiluminescence signals are commercially available , such as the magic ® lite analyzer ( mla i ) instrument manufactured by ciba corning diagnostic corp ., medfield , mass . the assay may also be prepared for usage in an automated system that includes a luminometer , with one or more photomultiplier tubes , with multiple photomultiplier tubes described in wo 94 / 22002 , priority filed mar . 19 1993 , commonly assigned and hereby incorporated by reference . the inventive method may be practiced with various assay systems and formats by techniques known to those skilled in the art . both competitive and non - competitive ( e . g . sandwich ) assay formats may be practiced with immunological binding , chemical binding , complementary binding , and combinations thereof . according to the invention , the following are illustrative of immunological formats that may be used . labeled antigen - competitive : in this format , the sample containing the targeted antigen to be measured is incubated with a solution comprising ( 1 ) a limited amount of antibody coupled to metal oxide solid phase and ( 2 ) a tracer comprising an antigen or antigen analogue having attached thereto an acridinium ester label . during an incubation of the reaction solution , the antigen in the sample competes with the labeled antigen ( or antigen analogue ) for binding to the antibody attached to the solid phase . after the incubation period there may be up to three components left in the reaction solution : ( 1 ) a complex comprising the sample antigen bound with the antibody attached to the solid phase ( yielding no signal upon activation ); ( 2 ) a complex comprising the tracer antigen ( or antigen analogue ) bound with the antibody attached to the solid phase ( yielding a quenched signal upon activation ); and , possibly , ( 3 ) unreacted tracer ( yielding an unquenched signal ). the amount of labeled antigen ( or antigen analogue ) bound to the solid phase is inversely proportional to the amount of antigen in the sample . labeled antibody - competitive : in this format , the sample containing the targeted antigen to be measured is incubated with a solution comprising : ( 1 ) a limited amount of antigen ( or antigen analogue ) coupled to metal oxide solid phase and ( 2 ) a tracer comprising an antibody having attached thereto an acridinium ester label . during an incubation of the reaction solution , the antigen in the sample competes with the solid phase antigen ( or antigen analogue ) for binding to the tracer antibody . after the incubation period there may be up to three components left in the reaction solution : ( 1 ) a complex comprising the sample antigen bound with the tracer antibody ( yielding an unquenched signal upon activation ); ( 2 ) a complex comprising the tracer antibody bound with the antigen ( or antigen analogue ) attached to the solid phase ( yielding a quenched signal upon activation ); and , possibly , ( 3 ) unreacted tracer antibody ( yielding an unquenched signal ). the antigen in the sample and the antigen ( or analogue ) on the solid phase compete for the labeled antibody . the amount of labeled antibody that becomes bound to the solid phase is inversely proportional to the amount of antigen there is in the sample . labeled antibody - sandwich : in this format , which is typically done on antigens which are large enough to bind two antibodies ( the same or different ) simultaneously , the sample is incubated with an excess of one antibody attached to solid phase together with an excess of another tracer antibody that is labeled with an acridinium ester . the antigen becomes attached to the solid phase via one of its antigenic determinants , and the labeled antibody in turn becomes bound to the antigen via a different determinant . the complex formed on the solid phase ( i . e . solid phase antibody - antigen - tracer antibody ) yields a quenched chemiluminescent signal upon activation and the unreacted tracer yields an unquenched signal . the amount of labeled antibody that becomes bound to the solid phase is directly proportional to the amount of antigen in the sample . with regard to hybridization assays ( e . g . gene probe assays ), the competitive and sandwich formats may be practiced . when employed with hybridization assays , the inventive assay may take advantage of solid phase already present in the assay from the initial hybridization - capture step . for the hybridization quenching phenomenon to be utilized for an assay for specific nucleic sequences , preferably the quenching effect is modulated by partitioning of the labeled oligomer probe between the immobilized and solution phase sequences . in the competitive format , the immobilized oligomer and target sequence therefore preferably share a substantially common sequence that is capable of hybridizing to at least a portion of the labeled oligomer probe . when practicing the invention in gene probe assays , the acridinium ester may be placed on any desired position of the oligomer , but most preferably the label is placed at the 5 &# 39 ; terminus of the molecule . the gene probe assays preferably incorporate an amplification step utilizing a dna or rna replicase to generate dna or rna copies for each target nucleic acid sequence in the sample by techniques well known to those skilled in the art , such as for example , those described in ep - a - 0 481 704 ( commonly assigned and incorporated herein by reference ). after or during this amplification step , an acridinium ester labeled oligomer is added to the sample . the polynucleotide sequence permits it to hybridize specifically to a portion of the sequence which is being amplified as well as the same sequence immobilized to a metal oxide solid phase which has been added earlier in the assay procedure . the amount of labeled oligomer that will be captured upon the solid phase will depend upon the relative amounts of the complementary sequence present in solution or immobilized on the solid phase . the amount of amplified target sequence produced from the replicase reaction is expected to be in excess over that immobilized upon the solid phase . using the non - separation chemiluminescent detection method , samples containing no or lower than a threshold amount of target will result in a quench of the light emission of the labeled oligomer while for samples containing targets , the chemiluminescence of the labeled oligomer will remain unquenched . the percent quenching of the labeled oligomer chemiluminescence that occurs upon hybridization to an oligomer attached to the solid phase may be calculated by the following formula : ## equ2 ## where q represents quenching and rlu represents relative light units . as shown in the calculation , the hybridization reaction and control reaction are preferably incubated under substantially the same conditions , as the chemiluminescence of the labeled oligomer may generally vary with time , temperature , and buffer conditions . according to the invention , hybridization of the labeled oligomer to the oligomer attached to the solid phase will result in maximum reduction of the chemiluminescent signal when the solid phase capacity is in excess of the input labeled oligomer . additionally , an excess labeled oligomer relative to the solid phase will result in less quenching ( i . e . excess labeled oligomer that is not hybridized will be detected with higher efficiency by generating more chemiluminescence relative to the control ). the invention may be practiced using complementary substances attached to the tracer and solid phase conjugate . preferred complementary substances include biotin and avidin . exemplary biotin compounds include , for example , biocytin ( i . e . biotinε - n - lysine ), biocytin hydrazide , amine or sulfhydryl derivatives of 2 - imminobiotin and biotinyl - ε - aminocaprioic acid hydrazide and derivatives of biotin , including , for example , biotin - n - hydroxysuccinimide ester , biotinyl - ε - aminocaprioic acid - n - hydroxysuccinimide ester , sulfosuccinimidyl 6 -( biotin amido )- bromoacetylhydrazide , p - diazobenzoyl biocytin and 3 -( n - maleimidopropoionyl ) biocytin , which can be attached to linking proteins ( preferably attached to the solid phase polymeric coating ), as is well known to those skilled in the art . avidin compounds that may be used include streptavidin , succinylated avidin , monomeric avidin , and so on . the method of attaching the avidin and biotin ( or derivative of either ) either directly or indirectly to the specified tracer or solid phase conjugate may be accomplished through techniques known to those skilled in the art , e . g . through reacting the amino or sulfhydryl groups of the avidin or biotin . with regard to immunological assays , the invention is particularly useful for detecting or quantifying theophylline and dinitrophenol ( dnp ) protein and derivatives thereof . with regard to hybridization assays , the invention is particularly effective in detecting or quantifying enteric pathogens , such as , for example , salmonella and campylobacter species . it is to be understood that various modifications to the invention will be apparent to and can readily be made by those skilled in the art , given the disclosure herein , without departing from the scope and materials of this invention . it is noted that the following examples given herein are intended to illustrate and not to limit the invention thereto . the solid phase in all examples consisted of paramagnetic particles ( pmp ) having a silane polymeric coating around the iron oxide core ( purchased from advanced magnetics inc ., cambridge , mass ). the pmp were activated by glutaraldehyde and conjugated with the various specific binding partners according to the two - step procedure as described by groman , e . v ., et al . ( bio techniques , 70 , p . 159 - 165 ). the acridinium ester ( ae ) used in the examples was of the following structure : ## str1 ## wherein x is ch 3 so 4 , r 1 is methyl ; r 2 , r 3 , r 5 and r 7 are hydrogen ; r 4 and r 8 are methyl , r 6 = is an cooh converted to a n - succinimidyloxycarbonyl group to assist in attachment of a specific binding partner . a description of a technique that was used in attaching acridinium esters with binding conjugates is as found in weeks et al ., clinical chemistry , 29 ( 8 ), 1474 - 1479 ( 1983 ) and ep - a - 0 537 994 ( each of which are hereby incorporated by reference ). the assays were flashed with two reagents , as follows : flash reagent 1 = about 0 . 3 ml of 0 . 1n hno 3 in approx . 0 . 5 % aqueous solution of h 2 o 2 . flash reagent 2 = about 0 . 3 ml of 0 . 25n naoh in a approx . 0 . 5 % aqueous solution of arquad ® 16 - 50n - alkyl trimethyl ammonium chloride ( 50 % active purchased from akzo chemical inc ., chicago , ill .). flash reagent 1 was added to the reaction mixture first , followed immediately with flash reagent 2 . relative light units ( rlu &# 39 ; s ) were measured over a 2 second interval after injection of flash reagents 1 and 2 using a luminometer ( magic ® lite analyzer &# 34 ; mla i &# 34 ;, ciba corning diagnostics corp ., medfield , mass .). the % quench was calculated by the following equation : ## equ3 ## the modulated signal counts were a measurement of the total signal provided by the reaction mixture after the reaction between specific binding partners transpired . the unquenched signal counts were a measurement of the light emitted from an amount of tracer added to the assay , as flashed in the absence of solid phase . monoclonal antibodies to 2 , 4 - dinitrophenol ( dnp ) were prepared by standard methods , after immunizing mice with a conjugate of dnp with thyroglobulin ( dnp - tg ). this conjugate was prepared by reaction of equal weights of thyroglobulin and 2 , 4 - dinitrobenzenesulfonic acid in 0 . 15m na 2 co 3 solution for 18 hours , followed by exhaustive dialysis against 0 . 001m sodium phosphate buffer , ph 7 . 4 . the antibody ( anti - dnp ) was purified from ascites fluid by precipitation of unwanted protein with caprylic acid , followed by dialysis of the supernatant against 0 . 1m sodium phosphate buffer , ph 7 . 4 . for immobilization of the antibody , 10 mg of pmp were activated with 6 . 25 % glutaraldehyde in 0 . 1m phosphate , ph 7 . 4 , for 2 hours . after washing to remove excess glutaraldehyde , the pmp were mixed with 1 ml of a solution of antibody ( diluted to 1 . 5 mg / ml ), and let stand overnight . the particles were then washed several times in phosphate buffer , and finally resuspended to a concentration of 10 mg / ml in 0 . 05m sodium phosphate , ph 7 . 4 , 0 . 15m nacl , 1 mg / ml bovine serum albumin ( pbs / bsa ). dnp - tg ( prepared as above ) and a conjugate of fluorescein isothiocyanate with bovine serum albumin ( fitc - bsa ) ( purchased from sigma chemical co ., st . louis , mo .) were labeled with the acridinium ester ( ae ) as follows : 2 mg of conjugate in 1 ml of 0 . 1m sodium phosphate , 0 . 15m nacl , ph 8 . 0 , was mixed with 80 μl of ae ( 1 mg / ml in dimethylformamide ) and incubated for 1 hr at room temp . the mixture was then added to 0 . 5 ml of a 10 mg / ml solution of dl - lysine and incubated for 15 minutes . the labeled conjugate was then purified by gel filtration on a 20 cm column of sephadex g 25 . dnp - β - alanine was prepared as follow : one gram of β - alanine was dissolved in 50 ml of 1m nahco 3 . seven milliliters of 2 , 4 - dinitrofluorobenzene ( dnfb ) was added to 100 ml of ethanol , and this was added to the β - alanine and stirred at room temperature for two hours . the ethanol was removed by rotary evaporation and the remainder extracted with ether to remove excess dnfb . normal hcl was added to the aqueous part until a precipitate formed . the latter was recovered by filtration , washed with ether , and air dried . the material was recrystallized twice : first from water with the addition of 1n hcl , then from nahco 3 / na 2 co 3 , ph = 9 , washed with ether , and dried . one hundred microliters of the anti - dnp pmp ( diluted 1 : 30 with pbs / bsa ) was incubated with either 100 μl of ae - dnp - tg ( diluted with 1 : 15000 with pba / bsa ) or with 100 μl of ae - fitc - bsa ( diluted 1 : 60000 with pba / bsa ). after one hour , the chemiluminescent light emission of each mixture was measured and compared to that of the same amount of each ae - labeled conjugate in the absence of the anti - dnp pmp . for the ae - dnp - tg conjugate , 52 % of the light output was quenched by the particles carrying the specific anti - dnp antibody . for the ae - fitc - bsa conjugate , which is not bound by this antibody , only 26 % of the light was quenched by the particles . these data support that quenching is increased upon the formation of the specific binding reaction complex on the solid phase . these findings are contrary to the expectation that the amount of quenching of light emission from a given amount of labeled tracer by a given mass of solid phase would be the same . the following example illustrates the effect of addition of a dnp derivative ( not labeled with acridinium ester ) to the system described in example 1 . one hundred microliters of anti - dnp - pmp ( diluted 1 : 30 with pbs / bsa ) was incubated with 50 μl of ae - dnp - tg ( diluted 1 : 7500 with pbs / bsa ) and with 50 μl of a solution of dnp - β - alanine at concentrations of 50 to 500 ng / ml . after one hour , the chemiluminescence of each mixture was measured . the results are shown in table 1 below and graphically represented in fig1 . table 1______________________________________effect of addition of a dnp derivativednp - β - alanine ( ng / ml ) chemiluminescence ( rlu ) ______________________________________0 545 , 00050 566 , 000100 802 , 000250 983 , 000500 1 , 040 , 000______________________________________ the data show that addition of increasing concentrations of an unlabeled dnp derivative resulted in a progressive increase in light output . this effect is presumably due to the unlabelled dnp competing for the immobilized antibody &# 39 ; s available binding sites , resulting in less of the ae - labeled dnp binding to the particles , and thus diminishing the quenching of chemiluminescent light emission . monoclonal antibodies to theophylline and lutenizing hormone ( lh ) were generated by standard techniques after immunization of mice with 8 - carboxypropyltheophylline - thyroglobulin and lh respectively . polyclonal antibody to theophylline was produced by immunization of rabbits with 8 - carboxypropyltheophylline - thyroglobulin . monoclonal and polyclonal antibody ( anti - lh ) were purified as described above for examples 1 and 2 except that activation and coupling were done in 0 . 01m sodium acetate buffer ( ph 5 . 5 ). particles were finally resuspended at 25 mg / ml in pbs / bsa buffer . theophylline standards were prepared by diluting a stock solution of theophylline ( sigma ) into pbs / bsa for buffer based standards or drug - free human serum for serum standards . standards from a theophylline ria kit obtained from clinical assays were also used . pmp immobilized with either theophylline monoclonal antibody ( theo ) or lh monoclonal antibody was serially diluted from 2 . 5 mg / ml to 0 . 156 mg / ml in pbs / bsa buffer . five hundred microliters of pmp was dispensed to test tubes , the buffer was removed after magnetic separation of the particles and 100 μl of water was added to resuspend the particles . ae - theo ( 0 . 4 million rlu / tube ) diluted in pbs / bsa was added to each tube . the chemiluminescent light emission was immediately measured using the mla i . the rlu observed for the solution of ae - theo with the anti - theophylline pmp and the anti - lh pmp ( modulated signal total counts ) were compared to the rlu measured in the absence of pmp ( unquenched total counts ). the results are summarized in table 2 as follows . table 2______________________________________quenching of ae - theophylline in the presence of anti - theophylline antibody pmp ( anti - theo ) andanti - luteotropic hormone antibody pmp ( anti - lh ) antibodyon pmp ( pmp ) mg / tube rlu quench % ______________________________________ 0 335937 ( utc ) 0anti - lh 0 . 075 294570 13anti - lh 0 . 156 244583 27anti - lh 0 . 312 215243 36anti - lh 0 . 625 157693 53anti - lh 1 . 25 105153 69 0 412450 ( utc ) 0anti - theo 0 . 075 39865 90anti - theo 0 . 156 30915 92anti - theo 0 . 312 24900 94anti - theo 0 . 625 19635 95anti - theo 1 . 25 13255 97______________________________________ non - separation theophylline assays were run as follows . standards , controls or patient samples were incubated with ae - theophylline and monoclonal anti - theophylline pmp at room temperature for 10 minutes . chemiluminescence was measured in the mla i without further manipulation of the tubes . at low analyte concentration , most of the tracer was bound to the solid phase and did not flash , thus giving low counts . as the analyte concentration increased , more tracer remained unbound , thus giving a higher signal . a sample standard curve is shown in fig3 . the results of an assay of 14 patient samples are given in table 3 . a commercially available theophylline assay ( tdx assay purchased from abbott ) was used as the control , with the control data shown in table 3 . table 3______________________________________non - separation theophylline assay theophylline , μg / ml control non - separation assay tdx inventionpatient ( μg / ml ) ( μg / ml ) ______________________________________1 5 . 2 8 . 32 16 . 0 13 . 03 7 . 1 6 . 84 11 . 1 12 . 95 13 . 2 9 . 36 4 . 6 4 . 87 23 . 2 19 . 88 14 . 6 14 . 69 5 . 0 6 . 410 15 . 9 10 . 511 8 . 7 6 . 812 5 . 6 6 . 113 11 . 4 7 . 714 14 . 4 9 . 0______________________________________ correlation : non separation assay = 2 . 42 + 0 . 656 tdx r = 0 . 874 the nucleic acid sequences used in the hybridization assays described in examples 5 - 7 are provided in sequence listing herewith , where the following abbreviations are used in presenting the hybridization assays : adenine ( a ); thymine ( t ); uracil ( u ); guanine ( g ); cytosine ( c ). pm979 : shown as seq . no . 1 , where bases 1 - 10 constitute a spacer arm , bases 11 - 46 consist of the 5 &# 39 ; sequence of the nanovariant (+) template , and bases 47 - 70 are complementary to a salmonella specific target sequence . masa5 : shown as seq . no . 2 , where bases 1 - 10 constitute a spacer arm , bases 11 - 71 consist of the 5 &# 39 ; sequence of the midivariant (+) template , and bases 72 - 95 are complementary to a salmonella specific target sequence . pm1076 : shown as seq . no . 3 , where half of the salmonella target , complementary to pm979 and masa5 was employed . pm2058 : shown as seq . no . 4 , where the salmonella target , complementary to pm979 and masa5 was employed . some versions of this sequence have a 5 &# 39 ;- amino group for conjugation with acridinium ester , as described herein . md24 : shown as seq . no . 6 , where a probe complementary to bases 34 - 57 of the midivariant (+) template ; i . e . bases 44 - 67 of masa5 was used . some versions of this sequence have a 5 &# 39 ; amino group for conjugation with acridinium ester , as described herein . mdv - sa2 rna transcript : shown as seq . no . 7 , where bases 1 - 61 consist of the 5 &# 39 ; end of the midivariant (+) template , bases 62 - 69 and 118 - 123 are plasmid linker sequences , bases 70 - 117 are complementary to a salmonella specific target sequence , and bases 124 - 282 consist of the 3 &# 39 ; end of the midivariant (+) template . the solid phases consisted of pmp to which one of the amplification oligomer probes was covalently attached ( via a 5 &# 39 ;- terminal amino group using a hetero - bifunctional coupling reagent for pm979 , or by glutaraldehyde activation of the pmp for masa5 ). the ae - pm1076 and 5 &# 39 ; 32 p - pm2058 sequences are complementary to the anti - target portion of the immobilized probes ( therefore hybridization and capture occur simultaneously ). the pm979 - pmp was prepared using pm 979 oligomer ( obtained from promega corp ., madison , wis .) and a thio - terminated pmp ( purchased from advanced magnetics , cambridge , mass ). the ae labeled pm1076 ( ae - oligomer ) was prepared using the dimethyl acridinium ester label and pm1076 oligomer obtained from promega corp . the masa5 - pmp was prepared using masa5 oligomer ( obtained from promega corp .) and a thio - terminated pmp purchased from advanced magnetics . the pm 2058 oligomer was also obtained from promega corp . the sodium citrate was purchased from mallinckrodt , inc ., st . louis , mo . the nacl , tris edta and tween - 20 were all purchased from sigma chemical , co ., st . louis , mo .) and the bsa ( fraction v ) from miles , inc . this example illustrates the quenching of ae - oligomer chemiluminescence by hybridization to oligomer - pmp . hybridization reactions containing pm979 immobilized on pmp ( pm979 - pmp ) and ae - pm1076 ( ae - oligomer ) were set up on ice by adding 40 μl of 60 mm sodium citrate , 600 mm sodium chloride , 10 mm tris -( hydroxymethyl ) aminomethane ( tris ) hcl , 1 mm ethylene diaminetetraacetic acid ( edta ), 0 . 1 % ( w / v ) bsa , and 0 . 02 % ( v / v ) polyoxyethylene ( 20 ) sorbitan monolaurate ( tween - 20 ) at ph 7 . 5 ( hereinafter &# 34 ; buffer &# 34 ;) to ten tubes . secondly , 5 μl of buffer containing 50 μg of pm979 - pmp was added to five of the ten tubes , and 5 μl of buffer alone was added to the remaining five tubes for control reactions . finally , 5 μl of buffer containing 10 , 32 , 100 , 320 , and 1000 femtomoles ( 1 fmol = 1 × 10 - 15 moles ) of ae - pm1076 was added to pairs of tubes , one group containing pmp and one control group without pmp ( control for ae decomposition during hybridization ). all reactions were incubated at 56 ° c . and 5 μl samples were removed at 0 , 75 , 120 , and 180 minutes , added to 100 μl of water , flashed with reagents 1 and 2 in a luminometer to determine the chemiluminescent activity . the % quench was calculated from the signals measured from the various tubes and are presented in fig4 . as shown in fig4 the chemiluminescence of all reactions containing oligomer - pmp decreased dramatically relative to the corresponding control without oligomer - pmp , up to a maximum of 74 %, upon hybridization . also the data demonstrate conditions where the relative input of ae - oligomer and oligomer - pmp generated significant quenching . the conditions of the reaction having 100 fmol input of the ae - oligomer , where the solid phase capacity is five - times the input of ae - oligomer , were chosen to test the feasibility of the competitive assay of example 6 . hybridization reactions were set up on ice by adding 10 μl of buffer ( described in example 5 ) alone or 10 μl of buffer containing 100 μg of pm979 - pmp to each of five tubes . next , 10 μl of buffer containing 0 , 10 - 14 , 10 - 13 , 10 - 12 , and 10 - 11 moles of standard , pm979 ( the oligomer that was immobilized on the pmp ), was added to one of the tubes containing pm979 - pmp and one control tube without pmp for each amount of added standard . finally , 80 μl of buffer containing 200 fmol of ae - pm1076 was added to all reactions . all tubes were incubated at 56 ° c . duplicate 10 μl samples were removed from each reaction at the indicated times ( 0 , 20 , 40 , and 60 minutes ), added to 100 μl of water and processed in a luminometer to determine chemiluminescent activity . results are shown in tables 4 ( fig5 ) and 5 . table 5 shows data derived from the 20 minute data from table 4 . the results shown are consistent with theoretical expectations , i . e . the same maximum extent of quenching was achieved in all hybridizations except where the input of pm979 in solution exceeds the solid phase capacity . table 4______________________________________competitive hybridization quenching assay standard hybrid . total signal input . sup . 1 . time ( rlu × 10 . sup .- 5 ) reaction ( moles ) ( min ) (+) pmp (-) pmp quench %. sup . 2 . ______________________________________a 10 . sup .- 11 0 8 . 27 8 . 66 4 20 4 . 61 5 . 65 18 40 4 . 78 5 . 78 17 60 4 . 38 5 . 30 17b 10 . sup .- 12 0 7 . 82 8 . 60 9 20 2 . 60 5 . 28 51 40 2 . 71 5 . 31 49 60 2 . 63 5 . 39 51c 10 . sup .- 13 0 7 . 62 9 . 36 19 20 1 . 43 5 . 43 74 40 1 . 48 5 . 56 73 60 1 . 51 5 . 21 71d 10 . sup .- 14 0 8 . 05 8 . 57 6 20 1 . 21 5 . 21 77 40 1 . 28 5 . 26 76 60 1 . 26 5 . 11 75e 0 8 . 00 8 . 45 5 1 . 15 5 . 41 79 1 . 26 5 . 27 76 1 . 24 4 . 82 74______________________________________ . sup . 1 . standard was added pm979 . . sup . 2 . 1 - (+ pmp rlu ) ÷ (- pmp rlu )! × 100 % = % quenching table 5______________________________________competitive hybridization quenching assay20 minute data point - standard (+) pmp net (+) pmp input signal signalreaction ( moles ) ( rlu ). sup . 1 . ( rlu ). sup . 2 . ______________________________________a 10 . sup .- 11 461 , 480 346 , 830b 10 . sup .- 12 259 , 560 144 , 910c 10 . sup .- 13 142 , 860 28 , 210d 10 . sup .- 14 120 , 720 6 , 070e 0 114 , 650 0______________________________________ . sup . 1 : derived from the 20 minute data point of table 4 . . sup . 2 : (+ pmp rlu ). sub . i ÷ (+ pmp rlu ). sub . e . i = &# 34 ;+ pmp rlu &# 34 ; value e = &# 34 ; reaction e &# 34 ; value as shown by the data above , this example demonstrates a hybridization competition assay for synthetic dna oligomer . varying amounts of the same oligomer that had been immobilized on the pmp were added in solution to compete with the solid phase immobilized oligomer for hybridization of the ae - oligomer , i . e . the added oligomer functioned as a competitive standard . this mimics the competition that would take place due to the presence of amplified probe in the proposed assay of example 7 . amplification reactions that had started with 0 , 10 - 16 , 10 - 18 , 10 - 19 , and 10 - 20 moles of midivariant template , respectively , were terminated by addition of edta and put on ice . hybridization reactions were set up on ice by adding 5 , 20 , 70 , or 75 μl of buffer to 12 tubes , so that the final volume would be 100 μl after addition of all other components , as described above . next 50 μl of buffer containing 5 of pm979 - pmp was added to six tubes . then 5 μl of buffer or one of the five replication reactions was added to pairs of tubes , one with and one without pmp . finally , 25 μl of buffer containing 10 fmol of ae - md24 was added to all tubes . all tubes were incubated for 20 minutes at 56 ° c . then flashed with reagents 1 and 2 in a luminometer to determine the chemiluminescent activity . the results , shown in table 6 , do not reflect the presence of abundant replicated midivariant rna ( estimated to be on the order of 5 pmol per reaction ). the failure of the assay to detect the presence of midivariant sequence was not due to reagent quality , since reagents had been validated by titration and mock assays with synthetic target . additional trials , with heat denaturation of the target prior to addition and increased input of ae - oligomer , also failed . subsequent experiments using 32 p - labeled md24 suggest that the failure is due to inefficient hybridization of the probe to the target , presumably due to higher stability of a midivariant duplex . this hypothesis is supported by the results of a quench assay for transcribed single stranded midivariant target , which produced a standard curve with quench values consistent with theoretical expectations with respect to the molar ratio of target and ae - probe . table 6______________________________________hybridization quench assayfor replication products + pmp added template orreaction ( mol ) - pmp mean rlu % quench . sup . 1 . ______________________________________a buffer only - 235 , 545 70 + 71 , 325b 0 - 190 , 240 65 ( mock + 66 , 690 reaction ) c 10 . sup .- 16 - 190 , 055 65 + 66 , 570d 10 . sup .- 18 - 189 , 950 64 + 67 , 820e 10 . sup .- 19 - 178 , 270 64 + 63 , 780f 10 . sup .- 20 - 164 , 590 63 + 60 , 190______________________________________ . sup . 1 . % q = 1 - (+ pmp value )/(- pmp value )! × 100 __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 7 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 70 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , pm979 , having a portion complementary to a salmonella specifictarget sequence , where bases 1 - 10 constitute a spacerarm , bases 11 - 46 consist of the 5 &# 39 ; sequence of thenanovariant (+) template , and bases 47 - 70 arecomplementary to the salmonella specific targetsequence . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 1 : cctagtccaaggggaaatcctgttaccaggataacggggt40tttctcataagcgccattgatgttgtcgcc70 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 95 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , masa5 , having aportion complementary to a salmonella specific targetsequence , where bases 1 - 10 constitute a spacer arm , bases 11 - 71 consist of the 5 &# 39 ; sequence of the midivariant (+) template , and bases 72 - 95 are complementary to thesalmonella specific target sequence . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 2 : cctagtccaaggggaccccccggaaggggggacgaggtgc40gggcacctcgtacgggagttcgaccgtgacaggtcaactg80aacgccctgagcttt95 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 24 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , pm1076 , half of thesalmonella target , complementary to pm979 and masa5 , defined herein . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 3 : ggcgacaacatcaatggcgcttat24 ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 48 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , pm2058 , a salmonellatarget , complementary to pm979 and masa5 , defined herein . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 4 : ggcgacaacatcaatggcgcttataaagctcagggcgttc40agttgacc48 ( 2 ) information for seq id no : 5 :( i ) sequence characteristics :( a ) length : 48 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , sa7 , an anti - salmonellatarget . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 5 : ggtcaactgaacgccctgagctttataagcgccattgatg40ttgtcgcc48 ( 2 ) information for seq id no : 6 :( i ) sequence characteristics :( a ) length : 24 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , md24 , complementary tobases 34 - 57 of the midivariant (+) template ; i . e . bases44 - 67 of masa5 , defined herein . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 6 : acggtcgaactcccgtacgaggtg24 ( 2 ) information for seq id no : 7 :( i ) sequence characteristics :( a ) length : 282 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : nucleic acid probe , mdv - sa2 rna transcript , where bases 1 - 61 consist of the 5 &# 39 ; end of themidivariant (+) template , bases 62 - 69 and 118 - 123 areplasmid linker sequences , bases 70 - 117 are complementaryto a salmonella specific target sequence , and bases124 - 282 consist of the 3 &# 39 ; end of the midivariant (+) template . ( iii ) hypothetical : no ( iv ) anti - sense : no ( v ) sequence description : seq id no : 7 : ggggaccccccggaaggggggacgaggugcgggcaccucg40uacgggaguucgaccgugacgagccucgaggcgacaacau80caauggcgcuuauaaagcucagggcguucaguugaccucg120aggagucacgggcugcgcuuucgcgcaucucccaggugac160gccucgagaagaggcgcgaccuucgugcguuucggcgacg200cacgagaaccgccacgcugcuucgcagcguggccccuucg240cgcagcccgcugcgcgaggugacccccgaagggggguucc280cc282__________________________________________________________________________ | 6 |
it is evident from fig1 that a transport device 4 , which conveys specimen slides to the various processing stations 9 , is provided in stainer 1 . also provided is a charging station 6 for loading specimens to be treated or racks 5 carrying specimens to be treated . for removing racks 5 from the stainer , a removal station 7 is provided from which racks 5 can be manually conveyed by a user into a downstream element . both charging station 6 and removal station 7 are charged by way of transport device 4 . the specimen slides present in charging station 6 can thus be removed and delivered to the actual processing stations 9 using transport device 4 . after the last processing station 9 , racks 5 are conveyed into removal station 7 so that they are ( together ) removable therefrom . removal is accomplished once again automatically by way of the transport device , or the specimen slides can be conveyed directly from a processing station 9 into a transfer position 30 ( fig3 ) of the downstream further element of the system . in the exemplary embodiment selected here , transport device 4 is embodied as a robot arm 8 . an opening 33 , through which racks 5 with specimen slides 5 a can be conveyed to a downstream station or into transfer position 30 , is configured in a side wall 32 of stainer 1 . fig2 schematically depicts an exemplary embodiment of a coverslipper 3 . coverslipper 3 comprises a housing 11 that has on one side wall 13 multiple attachment elements 13 a that coact with attachment elements on the corresponding side wall 22 of transfer device 2 . side wall 13 also comprises an opening 14 through which specimen slides are conveyed by transfer device 2 into coverslipper 3 . the individual specimen slides are arranged in special racks ( not depicted ). the interior of coverslipper 3 is covered by a pivotable hood 15 . front wall 16 of the coverslipper comprises a first drawer 17 in which is configured a further opening 17 a into which a user interface ( not depicted ) can be inserted . provided next to first drawer 17 for the user interface and the access to the electronics of coverslipper 3 is a detachable panel 18 through which the user once again gains access to the interior of coverslipper 3 . an output tray 19 for specimen slides equipped with coverslips is also provided on coverslipper 3 . coverslipper 3 can be switched on with a switch 12 . fig3 discloses an element ( transfer device 2 ) of the system according to the present invention that creates communication between stainer 1 and coverslipper 3 . transfer device 2 is provided between stainer 1 and coverslipper 3 , and thus connects stainer 1 to coverslipper 3 . transport device 4 of stainer 1 places rack 5 with the stained specimen slides 5 a onto a transfer position 30 of transfer device 2 . for that purpose , transfer device 2 has a passage 20 that is defined by a cutout 21 in first side wall 22 and a cutout 23 in second side wall 24 . transfer device 2 possesses a front panel 25 through which access to the interior of transfer device 2 is possible . transfer device 2 is followed by coverslipper 3 . opening 14 , in a side wall 13 of coverslipper 3 opposite second side wall 24 of transfer device 2 , is configured so that transfer device 2 can transfer racks 5 with specimen slides 5 a into coverslipper 3 and can remove racks 5 without specimen slides from coverslipper 3 . communication between coverslipper 3 and stainer 1 occurs as follows : stainer 1 queries whether it can place a rack 5 in coverslipper 3 . the response from coverslipper 3 can be “ yes ” or “ no .” if “ no ,” the query is repeated at periodic intervals . if “ yes ,” the rack is put in place and a “ rack transferred ” message is generated . coverslipper 3 responds “ rack received .” this procedure eliminates long waiting times for the rack in the transfer position . a quick transfer is advantageous because the specimen slides usually sit in a bath of solvent ( often xylene ), and wet specimen slides that were just recently stored in solvent exhibit considerably better flow behavior for the coverslip adhesive . fig4 is a side view of transfer device 2 , which is connected to one side wall 32 of stainer 1 . for simplicity &# 39 ; s sake , only side wall 32 of stainer 1 is depicted . attachment elements 26 , which are provided with corresponding attachment elements ( not depicted ) on side wall 32 of stainer 1 , are again provided on first side wall 22 of transfer device 2 . attachment elements 26 , which coact with attachment elements 13 a on side wall 13 of coverslipper 3 , are also provided in second side wall 24 of transfer device 2 . transfer device 2 comprises a housing 27 that has a bottom 28 , a front panel 25 , a back wall 29 opposite front panel 25 , and the first and the second mutually opposite side wall 22 and 24 already mentioned . also configured in transfer device 2 is a passage 20 that is defined substantially by a first and a second cutout 21 and 23 in first and second side wall 22 and 24 . transfer position 30 for racks 5 is provided in the region of first cutout 21 in first side wall 22 . cutout 21 in first side wall 22 is arranged opposite an opening 33 in side wall 32 of stainer 1 . through the opening in side wall 32 of stainer 1 , racks with specimen slides are transferred out of stainer 1 to the transfer device . the transfer once again occurs through cutout 21 in first side wall 22 of transfer device 2 . transfer device 2 is additionally equipped with a covering hood 34 so as thereby to offer protection against contamination . as depicted in fig5 the elements of the system are shown separated from one another for better clarity . in operation , stainer 1 ( only one side wall 32 shown here ), transfer device 2 , and coverslipper 3 are connected to one another . stainer 1 possesses lateral opening 33 , through which transport device 4 of the stainer can pass . specifically , transport device 4 is used on the one hand to accept racks with specimen slides from other processing stations and to transfer racks with specimen slides for transfer to transfer device 2 . transfer device 2 comprises passage 20 , which is constituted by a cutout 21 in first side wall 22 and a cutout 23 in second side wall 24 . a transport apparatus 35 , which passes out through cutout 23 in second side wall 24 and extends into coverslipper 3 , is provided in transfer device 2 . transport apparatus 35 extends through opening 14 in side wall 13 of coverslipper 3 . fig6 schematically depicts the system according to the present invention in which the individual elements are assembled . stainer 1 , transfer device 2 , and coverslipper 3 are here connected to one another and form a system substantially closed off externally . the invention has been described with reference to a particular exemplary embodiment . it is nevertheless self - evident that changes and modifications can be made without thereby leaving the range of protection of the claims below . | 6 |
the present invention will be described in detail hereinafter with reference to the illustrated embodiments . fig1 is a sectional view showing the arrangement of a principal part of a camera when a line of sight detection apparatus is applied to a single - lens reflex camera according to the first embodiment of the present invention , and fig3 shows the finder field of the single - lens reflex camera shown in fig1 . referring to fig1 a phototaking lens 1 is constituted by two lenses 1a and 1b for the sake of simplicity . however , in practice , the lens 1 is constituted by a larger number of lenses . a main mirror 2 is obliquely inserted into or retracted from a phototaking optical path in correspondence with the observation state and the phototaking state . a sub mirror 3 reflects downward a light beam transmitted through the main mirror 2 . a shutter 4 is arranged behind these mirrors . a photosensitive member 5 comprises a silver halide film or a solid - state image pick - up element such as a ccd , a mos type element , or the like . a focus detection device 6 adopts a known phase difference method , and is constituted by a field lens 6a disposed in the vicinity of the imaging surface , reflection mirrors 6b and 6b , a secondary imaging lens 6d , an aperture 6e , a line sensor 6f consisting of a plurality of ccds ( to be described later ), and the like . the focus detection device 6 shown in fig1 can perform focus detection on a plurality of areas ( three distance measurement point marks 200 to 202 ) in a finder field ( observation screen ) 213 , as shown in fig3 . a focusing plate 7 is disposed on a prospective imaging surface of the phototaking lens 1 , and a pentagonal prism 8 is used for bending the finder optical path . an imaging lens 9 and a photometric sensor 10 are used for measuring the object luminance in the observation screen . the imaging lens 9 defines a conjugate relationship between the focusing plate 7 and the photometric sensor 10 via the reflection optical path in the pentagonal prism 8 . an eyepiece lens 11 is disposed behind the exit surface of the pentagonal prism 8 , and is used for observing the focusing plate 7 by an eye 15 of a photographer . the eyepiece lens 11 comprises , e . g ., a beam splitter 11a comprising a dichroic mirror which transmits visible light therethrough and reflects infrared light . a light - receiving lens 12 is arranged above the eyepiece lens 11 . an area sensor 14 is constituted by two - dimensionally arranging photoelectric conversion element arrays such as ccds . the area sensor 14 is disposed to be conjugate with a position in the vicinity of the iris of the eye 15 of the photographer , which is located at a predetermined position , with respect to the light - receiving lens . the detailed circuit arrangement of the area sensor 14 will be described later . ireds 13 ( 13a to 13d = ired1 to ired4 ) serve as illumination light sources for illuminating the eyeball 15 of the photographer . high - luminance superimposed leds 21 can be visually confirmed even in a bright object . light emitted by each superimposed led 21 is reflected by the main mirror 2 via a light projection prism 22 , and is bent in the vertical direction by micro - prism arrays 7a formed on a display portion of the focusing plate 7 . then , the light reaches the eye 15 of the photographer via the pentagonal roof prism 8 and the eyepiece lens 11 . thus , the micro - prism arrays 7a are formed in frame patterns at positions corresponding to the focus detection areas on the focusing plate 7 , and are respectively illuminated with the corresponding superimposed leds 21 ( led - l1 , led - l2 , led - c , led - r1 , and led - r2 ). as can be seen from the finder field shown in fig3 the distance measurement point marks 200 , 201 , and 202 shine in the finder field 213 to display the focus detection areas ( distance measurement points ) ( this display will be referred to as a superimposed display hereinafter ). a field mask 23 forms the finder field area . an lcd 24 in the finder is used for displaying phototaking information on a portion outside the finder field , and is illuminated with an illumination led ( f - led ) 25 . light transmitted through the lcd 24 in the finder is guided into the finder via a triangular prism 26 , and is displayed on a portion 207 outside the finder field shown in fig3 . the photographer can observe the displayed phototaking information . the phototaking lens 1 includes an aperture 31 , an aperture driving device 32 including an aperture driving circuit 114 ( to be described later ), a lens driving motor 33 , and a lens driving member 34 consisting of , e . g ., a driving gear and - the like . a photocoupler 35 detects the rotation of a pulse plate 36 interlocked with the lens driving member 34 , and supplies the rotation information to a lens focus adjustment circuit 113 . the lens focus adjustment circuit 113 drives the lens driving motor 33 by a predetermined amount on the basis of this rotation information and information of a lens driving amount supplied from the camera side , thereby moving a focusing lens la of the phototaking lens 1 to an in - focus position . mount contacts 37 serve as a known interface between the camera and the lens . fig2 is a block diagram showing the electrical arrangement of the single - lens reflex camera with the above - mentioned arrangement , and the same reference numerals in fig2 denote the same parts as in fig1 . a central processing device ( to be referred to as an mpu hereinafter ) 100 comprises a microcomputer serving as a built - in camera control means of the camera main body . the mpu 100 performs its internal operations on the basis of clocks generated by an oscillator 101 . a clock control circuit 100a determines the operation frequency of the mpu 100 by &# 34 ; not frequency - dividing &# 34 ;, &# 34 ; frequency - dividing to 1 / 2 &# 34 ;, or &# 34 ; frequency - dividing to 1 / 16 &# 34 ; the original oscillation frequency generated by the oscillator 101 in accordance with an internal signal of the mpu 100 . an eeprom 100b is a memory which can store a film counter and other phototaking information . an a / d converter 100c a / d - converts analog signals from a line of sight detection circuit 104 , a focus detection circuit 105 , and the multi - split photometric sensor 10 ( photometric circuit 106 ), as will be described later . the mpu 100 is connected to an led driving circuit 102 , an ired driving circuit 103 , the line of sight detection circuit 104 , the focus detection circuit 105 , the photometric circuit 106 , a shutter control circuit 107 , a motor control circuit 108 , a film running detection circuit 109 , a switch sense circuit 110 , and a liquid crystal display circuit 111 . the mpu 100 exchanges signals with a lens control circuit 112 arranged in the phototaking lens via the mount contacts 37 shown in fig1 . the led driving circuit 102 turns on the superimposed leds 21 in accordance with a signal from the mpu 100 . the ired driving circuit 102 turns on the ireds 13 in accordance with a signal from the mpu 100 . the line of sight detection circuit 104 performs an accumulation operation and a read operation of the area sensor 14 in accordance with a signal from the mpu 100 , and supplies picture element output analog signals of respective picture elements to the mpu 100 . note that the line of sight detection circuit 104 will be described in detail later . the mpu 100 a / d - converts these analog signals using the a / d converter 100c , extracts the respective feature points of the eyeball image required for line of sight detection in accordance with a predetermined algorithm on the basis of each picture element information , as will be described later , and calculates the rotation angle of the eyeball of the photographer on the basis of the positions of the feature points . in the single - lens reflex camera to which this embodiment is applied , the line of sight ( gazing point ), on the finder , of the photographer is extracted by the calculations , one of the three distance measurement points 200 to 202 is selected , and automatic focus detection is performed using the selected distance measurement point . a regulator 115 supplies a power supply voltage to the line of sight detection circuit 104 in accordance with a signal from the mpu 100 , and is controlled to supply the power supply voltage only when the line of sight detection operation is performed . the line sensor 6f comprises a ccd line sensor constituted by three line sensors line - l , line - c , and line - r corresponding to the three distance measurement points 200 to 202 in the screen , as described above . the focus detection circuit 105 performs accumulation control and read control of these sensor portions of the line sensor 6f , and outputs each picture element information to the mpu 100 . the mpu 100 a / d - converts this information , and performs focus detection based on the phase difference detection method . then , the mpu 100 performs focus adjustment of the lens by exchanging signals with the lens control circuit 112 . the photometric circuit 106 outputs the output signal from the photometric sensor 10 to the mpu 100 as a luminance signal in each area in the screen . the mpu 100 a / d - converts the luminance signal , and adjusts an exposure amount of a phototaking operation . the shutter control circuit 107 runs forward and rearward shutter curtains ( mg - 1 and mg - 2 ) in accordance with a signal from the mpu 100 , thus performing an exposure operation . the motor control circuit 108 controls a motor in accordance with a signal from the mpu 100 , thus performing an up / down operation of the main mirror 2 , a shutter charging operation , and a film feeding operation . the film running detection circuit 109 detects if the film is wound up by one frame in a film feeding operation , and supplies a signal to the mpu 100 . a switch sw1 is turned on at the first stroke position of a release button ( not shown ), and is used for starting photometric , af , and line of sight detection operations . a switch sw2 is turned on at the second stroke position of the release button , and is used for starting an exposure operation . signals from these switches sw1 and sw2 , and other operation members ( not shown ) of the camera are detected by the switch sense circuit 110 , and are then supplied to the mpu 100 . the liquid crystal display circuit 111 controls the lcd 24 in the finder and a monitor lcd 42 in accordance with a signal from the mpu 100 . the lens control circuit 112 communicates with the mpu 100 via the lens mount contacts 37 to operate the lens focus detection circuit 113 and the aperture control circuit 114 , thereby controlling the focus adjustment and aperture of the lens . the detailed circuit arrangement and operation of the line of sight detection circuit 104 will be described below with reference to fig4 . the area sensor is assumed to have a size of 150 picture elements in the horizontal direction × 100 picture elements in the vertical direction . however , for the sake of simplicity in the description of the circuit , the area sensor illustrated in fig4 has a size of four picture elements in the horizontal direction × four picture elements in the vertical direction . in addition to a function of reading the respective picture element outputs of the sensor , the line of sight detection circuit has a function of reading a picture element output maximum value ( peak output ) of a block as one horizontal line of the sensor , and a function of analyzing image information by performing analog processing of the peak output . one photoelectric conversion element comprises a bipolar transistor 203 which accumulates a light charge on its base , and has double emitters . the first emitter of the bipolar transistor is connected to an output line 201 , and the second emitter is connected to an output line 202 . in each element , a capacitor 204 controls the base potential of the bipolar transistor 203 , and a pmos transistor 205 resets the base . mos transistors 206 are used for connecting the corresponding vertical output lines 201 to the ground potential , and a terminal 207 is used for applying a pulse to the gates of the mos transistors 206 . horizontal driving lines 208 control the base potentials of the bipolar transistors 203 via the capacitors 204 to perform a reset / read operation of the picture elements . buffer mos transistors 209 are enabled when an output from a vertical shift register 232 is applied to their gates , and select picture element rows to be driven . a terminal 210 is used for applying a picture element driving pulse . a wiring line 211 is connected to the drains of the pmos transistors 205 at the right and left ends . an emitter follower circuit 212 has an output connected to the wiring line 211 . amos transistor 213 controls the base potential of the emitter follower circuit 212 . a power supply terminal 214 is connected to the drain terminal of the mos transistor 213 . a terminal 215 is used for applying a pulse to the gate of the mos transistor 213 . each of pmos transistors 216 has a drain fixed at a positive potential . a terminal 217 is used for applying a pulse to the gates of the transistors 216 . capacitors c11 , c21 , . . . , c14 , c24 accumulate picture element output potentials output via the vertical output lines 201 , and mos transistors m11 , m21 , . . . , m14 , m24 are used for performing switching operations between the output lines 201 and the capacitors c11 , c21 , . . . , c14 , c24 . terminals 234 and 235 are used for applying pulses to the gates of the transistors m11 , m21 , . . . , m14 , m24 . a horizontal output line 221 has a parasitic capacitance c2 . switch mos transistors m41 , . . . , m44 electrically connect the capacitors c11 , c21 , . . . , c14 , c24 to the horizontal output line 221 when they are selected by an output from a horizontal shift register 231 . a mos transistor m5 is used for connecting the horizontal output line 221 to the ground potential . a terminal 222 is used for applying a pulse to the gate of the transistor m5 . the transistor m5 is connected to a ground level 223 . an amplifier 224 receives the potential on the output line 221 , and has an output terminal 220 . capacitors 225 accumulate picture element output potentials output via the output lines 202 . mos transistors 226 are used for performing switching operations between the output lines 202 and the capacitors 225 . a terminal 227 is used for applying a pulse to the gates of the transistors 226 . an output line 228 supplies the potentials from the capacitors 225 , and has an output terminal 229 . switch mos transistors 230 are selected by an output from a vertical shift register 233 , and sequentially electrically connect the capacitors 225 and the output line 228 . the vertical shift register 232 receives a driving pulse via a terminal 238 . the vertical shift register 233 receives a driving pulse via a terminal 239 . the horizontal shift register 231 receives a driving pulse via a terminal 237 . mos transistors m31 , . . . , m16 directly connect the capacitors c11 , c21 , . . . , c14 , c24 in units of blocks , and a terminal 236 is used for applying a pulse to the gates of these mos transistors . a comparator 241 compares the output from the amplifier 224 with a reference potential vref1 , and the output from the comparator 241 is output from an output terminal 242 . a mos transistor m6 is used for clamping the input to a comparator 243 to the output from the amplifier 224 in response to a pulse signal 240 input to its gate . after application of the pulse signal 240 , a capacitor c3 inputs the potential difference between the clamped output potential of amplifier 224 and that after clamping to the comparator 243 . the potential difference is compared with a reference voltage vref2 , and a comparison result is output from a terminal 244 . the operation of the single - lens reflex camera according to the embodiment of the present invention will be described below with reference to fig5 a to 9 . referring to fig5 a and 5b , when the operation of the camera is started , the mpu 100 detects the state of the switch sw1 , which is turned on at the first stroke position of the release button , in step (# 01 ). as a result , if the switch sw1 is on , the operation frequency of the mpu 100 is set to be 1 / 1 in step (# 02 ), and a &# 34 ; line of sight detection &# 34 ; subroutine is called to the line of sight detection circuit 104 in step (# 03 ). at this time , since the operation frequency is 1 / 1 , the consumption current becomes maximum . the &# 34 ; line of sight detection &# 34 ; subroutine will be described below with reference to fig7 . when the line of sight detection operation is started in step (# 000 ), data are initialized in step (# 001 ). a variable edgcnt is used for counting the number of extracted edges of the boundary between the iris and pupil . variables ip1 , ip2 , jp1 , and jp2 represent the positions of cornea reflection images ( p images ) of the ireds 13a to 13d , and two p images are present in an area of an eyeball reflection image surrounded by a range from ip1 to ip2 in the horizontal direction ( x - axis ) and a range from jp1 to jp2 in the vertical direction ( y - axis ). the area sensor 14 is assumed to have a size of 150 picture elements in the horizontal direction × 100 picture elements in the vertical direction . thus , the variables ip1 , ip2 , jp1 , and jp2 respectively store central positions ( 75 , 50 ) of the entire sensor as initial values . in step (# 002 ), the ireds 13 for illuminating the eye of the photographer are turned on , and the accumulation operation of the area sensor 14 is performed . fig1 and 11 are timing charts showing the operation of the line of sight detection circuit 104 including the area sensor 14 . the accumulation operation of the area sensor 14 in step (# 002 ) will be described below with reference to fig1 . first , a pulse φp ( 215 ) changes to low level to set the emitter follower circuit 212 to have a positive output potential . at this time , the potential of the driving line 208 connected to the bases of the pmos transistors 205 is at low level , and the pmos transistors 205 are turned on , thus setting the base potentials of the bipolar transistors 203 in all the picture elements to be equal to the output potential of the emitter follower circuit 212 . the pulse φp ( 215 ) changes to high level to set the emitter follower circuit 212 to have a gnd ( ground ) output potential , and thereafter , a pulse φvc ( 207 ) changes to high level to ground the vertical output lines 201 . with this operation , the emitter potentials of the first emitters are supplied to the bipolar transistors 203 of the respective picture elements , thereby lowering their base potentials . furthermore , the vertical shift register 232 is activated by a driving pulse φv1 ( 238 ) to apply a pulse φr ( 210 ) to the horizontal driving lines 208 in units of rows . the base potential of each picture element in a row corresponding to the driving line 208 which changes to high level is temporarily raised by capacitor coupling of the capacitor 204 , but lowers since the emitter current of the first emitter flows . when the potential of the line 208 goes low , the base potential of each picture element becomes a minus potential due to the capacitor coupling , and the first emitter - base path is set in a reverse bias state . at the time of the reverse bias state , the ireds 13 are turned on , and the eyeball image of the photographer is projected onto the area sensor 14 . in each picture element , a charge generated by incident light is accumulated on its base , and the base potential rises in correspondence with the accumulated charge amount . after an elapse of a predetermined accumulation time , the ireds 13 are turned off , thus completing the accumulation . referring back to fig7 upon completion of sensor accumulation in step (# 002 ), the flow advances to step (# 003 ) to perform a pre - read operation . the pre - read operation is the important point of this embodiment , and will be described below in two embodiments . the pre - read operation according to the first embodiment of the present invention will be described below with reference to the timing chart of fig1 showing the operation of the line of sight detection circuit 104 . a pulse φrc ( 217 ) changes to low level to turn on the pmos transistors 216 , thus setting all the horizontal driving lines 208 at high level . at this time , the base potential of each picture element is raised by the capacitor coupling , and its base - emitter potential is set in a forward bias state . as a result , the output values from maximum output picture elements in the respective row appear on the corresponding output lines 202 , and the potentials on the output lines 202 are accumulated on the accumulation capacitors 225 via the mos transistors 226 in response to a pulse φvt ( 227 ). then , the vertical shift register 233 is activated in response to a pulse φv2 ( 239 ) to sequentially output the potentials on the capacitors 225 from the output terminal 229 . these signals are a / d - converted by the internal a / d converter 100c of the mpu 100 , and the mpu 100 compares the a / d - converted output values of the maximum output picture elements in the respective horizontal lines with a predetermined discrimination level . referring back to fig7 if at least one a / d - converted value exceeds the predetermined level , it is determined in step (# 004 ) that p images based on the eyeball images of the photographer are present on the area sensor 14 , and the flow advances to step (# 009 ) and the subsequent steps . on the other hand , if none of the a / d - converted values exceed the predetermined level , no eyeball image is present on the area sensor 14 . that is , it is determined that the photographer does not look into the finder , and the flow advances to step (# 018 ), thus ending the line of sight detection operation . in step (# 009 ), so - called &# 34 ; loop processing &# 34 ; is executed , i . e ., the processing steps in the frame are executed while counting up a loop variable j from 0 to 99 . if it is determined in step (# 010 ) that the y - coordinate falls outside the range from 0 to 99 , it is determined that the loop processing in step (# 009 ) ends , and the flow advances to step (# 015 ). on the other hand , if the y - coordinate falls within the range from 0 to 99 , the flow advances to step (# 011 ), and photoelectric conversion signals in one line in the horizontal direction ( x - axis ) of the area sensor 14 are read . the read operation ( main read ) will be described below with reference to the timing chart in fig1 . the vertical shift register 232 is activated in response to a driving pulse φv1 ( 238 ), and the first horizontal driving line 208 ( v1 ) changes to high level in response to a pulse φr ( 210 ). at the same time , the respective picture element outputs of the first line are accumulated on the capacitors c11 , . . . , c14 via the transistors m11 , . . . , m14 in response to a pulse φt1 ( 234 ). the horizontal shift register 231 is activated by a driving pulse φh ( 237 ), and the respective picture element outputs of the first line accumulated on the capacitors c11 , . . . , c14 are read from the output terminal 220 by the mpu 100 via the amplifier 224 . upon completion of the processing for the first line , the second horizontal driving line 208 ( v2 ) changes to high level in response to a driving pulse φ1 ( 238 ), and respective picture element outputs of the second line are read by the mpu 100 by the similar operations . the same applies to the third and fourth lines . the one - line read operation is executed in the form of a subroutine , and fig8 is a flow chart showing the &# 34 ; one - line read &# 34 ; subroutine . referring to fig8 when this &# 34 ; one - line read &# 34 ; subroutine is called in step (# 100 ), step (# 101 ) is executed . step (# 101 ) and step (# 102 ) in the frame of step (# 101 ) execute the same loop processing as that in step (# 006 ) described above . processing in the frame is executed in step (# 101 ) while counting up a variable k from 0 to 3 , and processing in the frame is executed in step (# 102 ) while counting up a variable i from 0 to 149 . therefore , steps (# 101 ) and (# 102 ) execute so - called &# 34 ; nested &# 34 ; loop processing of the variables k and i . in step (# 103 ) in the loop processing in step (# 102 ), a re - storage operation of array variables im ( i , k ) is performed . in this embodiment , the mpu 100 executes signal processing . in general , the storage capacity of an internal ram ( random access memory ) of a microcomputer is not large enough to simultaneously store all the pieces of picture element information from the area sensor . thus , in this embodiment , only the latest image signals corresponding to five lines in the horizontal direction ( x - axis ) are stored in the internal ram of the microcomputer , and processing for line of sight detection is executed each time signals for one line are read . the execution contents of the double loop processing from steps (# 101 ) to (# 103 ) include an operation for the updating stored image signal data for last five lines so as to read image signals for one new line . more specifically , of the array variables im ( i , k ), the variables im ( i , 0 ) i = 0 to 149 ! represent image data for the oldest line , and the variables im ( i , 4 ) i = 0 to 149 ! represent image data for the latest line . then , data are updated as follows to prepare for storing image signals for a new line in the variables im ( i , 4 ) i = 0 to 149 !. upon completion of the loop processing for updating data in steps (# 101 ) to (# 103 ), loop processing in step (# 104 ) is executed . in the loop processing in step (# 104 ), only signals in a limited area are a / d - converted and stored in the ram , and a minimum value of these image signals is detected while outputting image signals for one line ( 150 picture elements ) in the horizontal direction ( x - axis ) of the area sensor . if it is determined in step (# 105 ) that the value i ( x - coordinate ) falls outside the range from 0 to 149 , the loop processing in step (# 104 ) ends . on the other hand , when the value of the variable i falls within the range from 0 to 149 , the flow advances to step (# 106 ), and the mpu 100 temporarily stores an a / d - converted value adc of each image signal in a variable eyedt . in step (# 107 ), the value eyedt is stored in the corresponding array variable im ( i , 4 ). the variable i is counted up from 0 to 149 in outer loop processing step (# 104 ). steps (# 108 ) and (# 109 ) execute minimum value detection processing of image signals . a variable eyemin holds a minimum value of image signals . if it is determined in step (# 108 ) that eyedt is smaller than eyemin , the flow branches to step (# 109 ), and eyemin is updated by the smaller value eyedt . upon completion of the loop processing in steps (# 104 ) to (# 109 ), i . e ., upon completion of the storage operation of image signals for one new line and the detection operation of the minimum value , the control returns from the &# 34 ; one - line read &# 34 ; subroutine to the main routine in step (# 110 ). referring back to the flow chart in fig7 when the &# 34 ; one - line read &# 34 ; subroutine ends in step (# 011 ), the flow advances to step (# 012 ) to check if the loop variable j in the outer loop processing step (# 009 ) is equal to or larger than 5 . the loop variable j represents the picture element line in the vertical direction ( y - axis ) of the area sensor . in this embodiment , since the number of picture elements of the area sensor is assumed to be &# 34 ; 150 × 100 &# 34 ;, j is counted up from 0 to 99 . if it is determined in step (# 012 ) that the loop variable j is equal to or larger than 5 , the flow branches to step (# 013 ). this is because when the number of lines of the read image signals becomes equal to or larger than 5 , processing in the vertical direction ( y - axis ) of the area sensor is allowed . in step (# 013 ) as the branch destination , a &# 34 ; p image detection &# 34 ; subroutine is executed . the &# 34 ; p image detection &# 34 ; subroutine is the above - mentioned processing for detecting the positions of the p images , and is executed each time one line in the horizontal direction ( x - axis ) of the area sensor is read . fig9 is a flow chart showing the &# 34 ; p image detection &# 34 ; subroutine . referring to fig9 when the &# 34 ; p image detection &# 34 ; subroutine is called in step (# 200 ), loop processing in step (# 201 ) is executed . in this step , loop processing is performed within the range from i = 0 to 149 . in the loop processing , the position of a p image in image data stored in the array variables im ( i , k )! is searched . if the position of a p image is found , the position on the area sensor is stored . in this embodiment , since two p images are generated , two pieces of position information are stored . in first step (# 202 ) in the loop , it is checked if image data at a predetermined position satisfies a condition as a p image . the condition is as follows : the condition is defined in two directions , i . e ., the horizontal and vertical directions ( x - and y - axes ) while paying attention to the fact that the p image is like a spot image , as has been described above with reference to fig1 . if this condition is satisfied , it is determined that a p image is present at a position ( i , 2 ). as described above , the array variables im ( i , k ) are updated each time one line in the horizontal direction ( x - axis ) of the area sensor is read , and data for a line at the position j in the vertical direction ( y - axis ) are stored in im ( i , 4 ) i = 1 to 149 !. therefore , an address ( i , 2 ) with respect to the variable im corresponds to a position ( i , j - 2 ) on the area sensor . if image data satisfying the p image condition is found in step (# 202 ), the flow branches to step (# 203 ) and the subsequent steps ; otherwise , the outer loop variable i is counted up . in step (# 203 ) and the subsequent steps , processing for determining the presence range ( the range ip1 to ip2 ! in the x - axis direction and the range jp1 to jp2 ! in the y - axis direction of the two p images is performed . in step (# 203 ), the variable i representing the position , in the horizontal direction ( x - axis ), of the area sensor is compared with the variable ip1 . if &# 34 ; i & lt ; ip1 &# 34 ;, the flow branches to step (# 204 ). more specifically , if the position of the variable i is present on the left side of the left p image position ip1 in the horizontal direction , in the presence range of the p image , ip1 is rewritten . in step (# 204 ), the value of the variable i is stored in the variable ip1 , and the position ( j - 2 ) in the vertical direction at that time is stored in the variable jp1 . in steps (# 205 ) and (# 206 ), the right p image position ip2 in the horizontal direction and the position jp2 in the vertical direction in the p image presence range are updated . as described above , in the loop processing in step (# 201 ), upon completion of the processing for one line corresponding to the position i = 0 to 149 in the horizontal direction , the flow advances to step (# 207 ). in step (# 207 ), variables xp1 , xp2 , yp1 , and yp2 to be looked up in image processing are calculated using formulas shown in fig9 . these variables are used for removing pupil edge information generated around the p image positions upon detection of the center of the pupil . upon completion of the processing in step (# 207 ), the control returns from the &# 34 ; p image detection &# 34 ; subroutine to the main routine in step (# 208 ). a description will be continued with reference to the flow chart in fig7 again . upon completion of the &# 34 ; p image detection &# 34 ; subroutine in step (# 013 ), a &# 34 ; pupil edge detection &# 34 ; subroutine is executed in step (# 014 ). the &# 34 ; pupil edge detection &# 34 ; subroutine detects the position of the pupil edge ( the boundary between the iris and pupil ) in the eyeball reflection image . the pupil edge is detected by a predetermined algorithm . however , since this algorithm is not directly related to the gist of this embodiment , a detailed description thereof will be omitted . upon completion of the &# 34 ; pupil edge detection &# 34 ; subroutine in step (# 014 ), the loop variable j ( representing the position in the vertical direction , i . e ., the y - coordinate of the area sensor ) in the outer loop processing step (# 009 ) is counted up , and the processing in step (# 010 ) and the subsequent steps is executed until j reaches 99 . if the loop variable j has reached 99 and the read processing of all the picture elements of the area sensor has ended , the flow advances from step (# 009 ) to step (# 015 ). in step (# 015 ), a &# 34 ; pupil designation range setting &# 34 ; subroutine is executed . this subroutine removes false edge points which are generated by various noise components and included in a plurality of edge points detected in the &# 34 ; pupil edge detection &# 34 ; subroutine in step (# 104 ) in addition to those representing the pupil circle ( a circle defined by the boundary between the iris and pupil ). in this subroutine , the coordinates of probable edge points are limited based on the p image position information . however , a detailed description of this subroutine will be omitted here . in step (# 016 ), a &# 34 ; pupil center detection &# 34 ; subroutine is executed . this subroutine estimates the shape of the pupil circle on the basis of the probable pupil edge points so as to obtain the central coordinate , and uses the &# 34 ; method of least squares &# 34 ;. a detailed description of this subroutine will be omitted here . in step (# 017 ), a &# 34 ; line of sight detection &# 34 ; subroutine is executed . the &# 34 ; line of sight detection &# 34 ; subroutine detects the line of sight ( gazing point ) on the basis of the p images and the central position of the pupil circle detected in the above - mentioned processing . basically , as in the above - mentioned prior art , the rotation angle θ of the eyeball optical axis can be calculated in accordance with formula ( 2 ). referring back to fig5 upon completion of the line of sight detection subroutine in step (# 03 ), the flow advances to step (# 04 ). in step (# 04 ), the power supply of the line of sight detection circuit is turned on , and the operation frequency of the mpu 100 is decreased to 1 / 2 , thus suppressing the consumption current in the subsequent routines . in step (# 03 ) for performing the line of sight detection operation , since a very large amount of calculation processing is generated , a very long time is required for line of sight detection unless the operation frequency of the mpu 100 is maximized . however , since a step other than the line of sight detection operation , e . g ., step (# 05 ) for performing a focus detection operation does not require a large calculation processing amount , unlike in the line of sight detection processing , the operation frequency of the mpu 100 can be lowered to attain power saving . in step (# 05 ), the focus detection operation is performed . this operation is performed based on the known phase difference detection method using the focus detection circuit 105 , as described above . in step (# 06 ), the mpu 100 controls the lens control circuit in accordance with the focusing state detected by the focus detection operation , thus attaining focus adjustment of the lens . in step (# 07 ), since a photometric operation to be executed in the next step (# 08 ) requires a further smaller amount of calculation processing , the operation frequency is decreased to be 1 / 16 . in step (# 08 ), the mpu 100 determines an exposure amount on the basis of luminance information of an object from the photometric circuit 106 . in step (# 09 ), a feeding finish flag indicating whether or not the camera is in a film feeding state is checked . if the flag is 0 , since a continuous feeding operation is being performed currently , the flow returns to step (# 01 ) to repeat the operations in steps (# 01 ) to (# 09 ). on the other hand , if the feeding finish flag is 1 , the flow advances to step (# 10 ) to check if the switch sw2 , which is turned on at the second stroke position of the release button , is on . if the switch sw2 is off , the flow returns to step (# 01 ) to repeat the operations in steps (# 01 ) to (# 10 ). if the feeding finish flag is 1 and the switch sw2 is on , a series of &# 34 ; exposure operations &# 34 ; in steps (# 11 ) to (# 15 ) are started . in step (# 11 ), the main mirror 2 is moved upward prior to the exposure operation , and is retracted from the phototaking optical path . in step (# 12 ), the aperture 31 in the lens 1 is driven via the lens control circuit 112 to have an aperture value based on the determined exposure amount . in step (# 13 ), the shutter is controlled by the shutter control circuit 107 to have a shutter release time ( shutter speed ) based on the determined exposure amount . in step (# 14 ), the main mirror 2 , which was retracted from the phototaking optical path , is moved downward , and is obliquely inserted in the phototaking optical path again . in step (# 15 ), the motor control circuit 108 starts a film feeding operation to wind up the film by one frame , and the feeding finish flag is set to be 0 , thus setting interruption processing . thereafter , the control waits for a film feeding finish signal from the film running detection circuit 109 , and returns to step (# 01 ). the feeding finish interruption routine will be described below with reference to fig6 . when the camera operation is in any one of steps (# 01 ) to (# 09 ), if the film running detection circuit 109 generates a film feeding finish interruption , the flow advances from step (# 20 ) to step (# 21 ). in step (# 21 ), the mpu 100 supplies a signal to the motor control circuit 108 to stop the feeding operation , thus ending the wind - up operation of the film by one frame . in step (# 22 ), the feeding finish flag is set to be 1 , and the flow returns to the main routine in step (# 23 ). as has been described above with reference to the flow charts , when the on state of the release button is held at its first stroke position , the &# 34 ; line of sight detection operation &# 34 ;, &# 34 ; focus detection operation &# 34 ;, and &# 34 ; photometric operation &# 34 ; are repetitively performed . on the other hand , when the on state of the release button is held at its second stroke position , the &# 34 ; line of sight detection operation &# 34 ;, &# 34 ; focus detection operation &# 34 ;, &# 34 ; photometric operation &# 34 ;, and &# 34 ; exposure operation &# 34 ; are performed . fig1 a and 12b show a change in consumption current when the on state of the release button is held at its first stroke position in the camera operation of this embodiment . when the photographer looks into the finder and p images for line of sight detection exist ( see fig1 a ), since the line of sight detection operation continues for a long period of time and the consumption current is large , the average consumption current in the entire sequence has a value close to the consumption current in the line of sight detection operation . however , when the photographer does not look into the finder , and no p images for line of sight detection exist ( see fig1 b ), since the line of sight detection operation finishes within a short period of time , the average consumption current in the entire sequence lowers very much . as described above , in the first embodiment , prior to the calculations of the gazing point ( line of sight ) of the observer by a / d - converting respective picture element outputs from the area sensor 14 and executing sequential processing of the a / d - converted values , the area sensor 14 is divided into blocks in units of horizontal lines , and the output values from maximum output picture elements in the respective lines ( blocks ) are a / d - converted to detect the presence / absence of p images . in this case , if it is detected that the observer does not look into the finder , the line of sight detection operation is suspended . as a result , the time required for operating the mpu 100 at the maximum operation frequency 1 / 1 can be shortened , and the consumption current can be greatly reduced in the entire camera operation . the second embodiment of the pre - read operation in step (# 003 ) will be described below with reference to the timing chart in fig1 . in fig1 , the & lt ; base clamp & gt ;, & lt ; sequential reset & gt ;, and & lt ; accumulation & gt ; operations are the same as those in fig1 . the pre - read operation in fig1 is the same as the main read operation in fig1 in a hardware manner , and signals are read from a terminal 220 in turn by an mpu 100 from the first line . at this time , a comparator 241 compares the picture element of interest with a reference potential vref1 , and if the picture element output is equal to or higher than a predetermined level , an output c1 ( 242 ) generates a signal &# 34 ; 1 &# 34 ; in association with the picture element of interest . when a pulse φcl ( 240 ) is enabled , the picture element output of the previous picture element is clamped at one terminal of the capacitor c3 , and thereafter , the pulse φcl ( 240 ) is disabled to read the next picture element output , thereby inputting the difference output from the previous picture element to a comparator 243 . the comparator 243 compares the input difference with a reference potential vref2 , and if a difference picture element output equal to or higher than a predetermined level is found , an output c2 ( 244 ) generates a signal &# 34 ; 1 &# 34 ; in association with the picture element of interest . if both the outputs c1 ( 242 ) and c2 ( 244 ) are &# 34 ; 1 &# 34 ; for the picture element of interest , the picture element is considered to be a p image candidate , since it satisfies the p image detection condition that a picture element is like a spot image having a predetermined luminance level or higher . the method of searching p image candidates on the basis of the output signals c1 ( 242 ) and c2 ( 244 ) from the mpu 100 can be completed within a shorter period of time than the method of obtaining the p images by calculations of the a / d - converted values , as has been described above with reference to fig9 . if it is determined in step (# 004 ) in fig7 that two or more p image candidates are obtained , it is determined that p images exist , and the photographer looks into the finder , and the flow advances to step (# 009 ) and the subsequent steps . on the other hand , if the number of p image candidates is one or fewer , it is determined that the photographer does not look into the finder , and the line of sight detection operation ends in step (# 018 ). the operations in step (# 009 ) and the subsequent steps are the same as those in the first embodiment , and a detailed description thereof will be omitted . as described above , according to the second embodiment , prior to the calculations of the gazing point ( line of sight ) of the observer by a / d - converting respective picture element outputs from an area sensor 14 and executing sequential processing of the a / d - converted values , the feature points of the eyeball image are detected by analog processing simultaneously with the high - speed read operation of the area sensor 14 . if it is detected based on the presence / absence of the feature points that the observer does not look into the finder , the line of sight detection operation is suspended immediately . the first embodiment may erroneously detect that the observer looks into the finder when an image on the area sensor simply has a predetermined luminance level , even through the observer does not actually look into the finder . however , in the second embodiment , although the time required for the pre - read operation is not much shorter than that in the first embodiment , a discrimination probability increases in consideration of the feature point indicating that a p image is a spot image , thus realizing further power saving . the third embodiment of the line of sight detection operation in step (# 03 ) will be described below with reference to the flow chart in fig1 . the same step numbers denote steps that execute the same operations as in fig7 . in the third embodiment , after sensor accumulation (# 002 ), the loop processing in step (# 009 ) and the subsequent steps are executed without performing the pre - read operation (# 003 ) and p image discrimination (# 004 ). upon completion of this loop processing , p image discrimination in step (# 004 ) is performed . if it is determined that no p images formed by the eyeball image of the photographer exist on an area sensor 14 , i . e ., if variables ip1 , ip2 , jp1 , and jp2 indicating the positions of the p images remain set in initial values , since the subsequent line of sight detection operation need not be performed , the flow advances to step (# 018 ), thus ending the line of sight detection subroutine . if the variables ip1 , ip2 , jp1 , and jp2 are updated from the initial values , and it is determined that p images exist , the flow advances to step (# 015 ) and the subsequent steps . as described above , since the third embodiment has a larger number of steps than in the first and second embodiments before discrimination of the presence / absence of p images , the effect of reducing the consumption current and increasing the processing speed slightly lowers . however , since this embodiment does not require any new hardware circuits for the pre - read operation , the effect of the present invention can be attained by modifying only software programs of the conventional circuit , thus providing a merit of a simple arrangement . according to each of the above embodiments , after a line of sight detection sensor , which detects the line of sight by accumulating and reading an eyeball image of the observer , a / d - converting picture element information , and executing sequential processing of the a / d - converted values , and accumulates the eyeball image , the pre - read operation which is completed in a short period of time as compared to the sequential processing is performed , and it is discriminated if the eyeball image of the observer is present . therefore , a line of sight detection apparatus which can systematically attain power saving , e . g ., when the observer does not look into an observation unit in a mode for continuously performing line of sight detection , can be realized . in this embodiment , the ireds 13a to 13d correspond to an illumination means of the present invention , the area sensor 14 corresponds to a light - receiving means of the present invention , a portion for performing the main read operation attained by the mpu 100 and the line of sight detection circuit 104 corresponds to a first signal read processing means of the present invention , and a portion for performing a / d conversion , p image detection , pupil edge detection , and the like attained by the mpu 100 corresponds to a feature point extraction means . a portion for performing the pre - read operation attained by the mpu 100 and the line of sight detection circuit 104 corresponds to a second read processing means of the present invention , and a portion for performing p image discrimination in step (# 004 ) in fig7 by the mpu 100 corresponds to a discrimination means of the present invention . a portion for performing the pre - read operation of the first embodiment corresponds to a means for reading and processing signals associated with respective blocks in claim 4 , and a portion for performing the pre - read operation of the second embodiment corresponds to a means for reading and processing analog - processed second signals in claim 6 . in each of the above embodiments , the present invention is applied to a single - lens reflex camera . however , the present invention may be applied to other cameras such as a lens - shutter camera , a video camera , and the like . furthermore , the present invention may be applied to other optical equipment , other apparatuses , and a constituting unit of other equipment . furthermore , the present invention may be applied to an arrangement as an appropriate combination of the above embodiments or their techniques . as described above , according to the present invention , a peak signal read by a peak read processing means before a line of sight detection operation is a / d - converted , and it is checked based on the a / d - converted value if a purkinje image associated with an eyeball image of an observer is present on a light - receiving means , or the peak signal is analog - processed , and it is checked based on the analog value if a purkinje image associated with an eyeball image of an observer is present on the light - receiving means . if the purkinje image is present on the light - receiving means , since the observer looks into the finder with a high possibility , read processing in units of picture elements of the area sensor is performed , image information associated with the eyeball image of the observer is extracted from the read processing result , and the line of sight of the observer is detected based on the image information . if the purkinje image is not present on the light - receiving means , since the observer does not look into the finder with a high possibility , the line of sight detection operation is suspended . therefore , when the observer does not look into an eyepiece portion with a high possibility , the line of sight detection operation is suspended , thus reducing the consumption power . | 6 |
previous efforts to improve the wear rates of c — c composites have attempted to do so by adding particulates such as ceramics or by changing the type of fiber and matrix carbons or their heat treatments . however , the present invention focuses on taking advantage of the lubricating effect of graphite in the presence of moisture to lower wear rates and increase the life of the brake material through controlled use of carbon additives . this invention describes a method of processing c — c composites that incorporates specific carbon additives that selectively and preferentially interact with the moisture in the atmosphere to reduce the wear rates of the friction material and increase the life of c — c composites while maintaining good stable friction performance . in one embodiment , this invention provides a method of manufacturing a carbon - carbon composite brake disc that has improved wear rates and consistent friction performance . the method of this invention includes several sequential steps , as follows . first , an annular carbon fiber preform is provided . the carbon fiber preform may be , for instance , a nonwoven preform or a preform that consists of chopped fibers which are randomly oriented or a preform that consists of chopped fibers which are oriented to provide strength and thermal and friction and wear performance . then , the carbon fiber preform is infiltrated with carbon using pitch , resin , or cvi / cvd processing to increase the density of the preform . in the case of pitch densification , the pitch - infiltrated preform is optionally stabilized to rigidize it and prevent pitch exudation from the preform during subsequent carbonization . an oxidative stabilization step may be carried out , e . g ., at a temperature between about 150 and 250 ° c . in the case of pitch and resin densification , the pitch and / or resin infiltrated preform is carbonized between 900 - 2540 ° c ., generally in an inert ( nitrogen or vacuum ) atmosphere . between densification cycles , the surfaces of the preform are optionally machined to open surface porosity after carbonization or cvi / cvd processing , thereby facilitating weight increases in the preform during subsequent densification steps . any of the foregoing infiltration ( densification ) steps is repeated sufficient times to achieve a final density in the preform of approximately 1 . 6 to 1 . 85 g / cc . in accordance with the present invention , a step of infiltrating the carbon fiber preform with 0 . 1 to 5 weight -% ( preferably 1 to 2 weight -%) based on the weight of the preform , of a carbon additive which adsorbs moisture from the atmosphere is performed prior to one or more of the foregoing infiltration ( densification ) steps . the maximum particle size of the carbon additive is normally between 1 and 10 microns . the carbon additive may be , for instance , an activated carbon powder with high surface area or a carbon black with high surface area or a combination of activated carbon with carbon black . the additive may be introduced into the composite through vacuum infiltration of a suspension of the carbon particles held in a solvent such as water or acetone . the solvent would then typically be removed , e . g . by drying the additive - infiltrated composite at 110 ° c . for 24 hrs or by heating it to 110 ° c . for 24 hrs under vacuum . alternatively , the solvent may be allowed to evaporate without heating , or the solvent may be dried out of the composite by subjecting the preform to vacuum . often , a final heat - treatment step is carried out at a temperature between about 1200 and 2540 ° c . in an inert ( nitrogen or vacuum ) atmosphere . in another embodiment , the present invention provides a carbon - carbon composite brake disc produced by the process described above . preferred additives in accordance with the present invention include : ( 1 ) carbon black ; and ( 2 ) activated carbon , including but not limited to fibers , powders , and activated carbon black . this invention provides a c — c composite that can be used as a friction material in braking application for automobiles and aircraft and that overcomes some of the difficulties associated with changes in the moisture level of the brake &# 39 ; s environment . this invention adds carbon black or activated carbon to the c — c composite . this additional carbon adsorbs available humidity and retains the moisture within the micropores of the additive . the chemically adsorbed water is retained within the carbon structure , and helps to provide low wear rates by allowing the lubrication properties of the 3 rd body friction films to be realized for an extend period . this process continues through the life of the brake . the method of the present invention includes several sequential steps . first , an annular carbon fiber preform is provided . this carbon fiber preform may be made from nonwoven fabric or may be made up with randomly oriented chopped fibers . this carbon fiber preform is carbonized or heat - treated at 1200 - 2540 ° c ., preferably between about 1200 and 2200 ° c . in an inert nitrogen atmosphere ( nitrogen or vacuum ). the carbon fiber preform is then infiltrated with gaseous carbon using cvi / cvd processing or with pitch or resin . the pitch / resin infiltrated or gaseous carbon infiltrated preform is carbonized between 1200 - 2540 ° c . carbonization may be preceded by an optional stabilization step , for instance oxidative stabilization carried out at 150 - 250 ° c ., to rigidize the pitch and prevent exudation from the preform during carbonization . carbonization may be followed by an optional machining step to “ clean ” the surfaces of the preform and open surface porosity . since cvi / cvd processing is normally performed above 1000 ° c ., there is usually no need to perform a separate carbonization step following a cvi / cvd densification . thus , in the context of the present invention , cvi / cvd processing may be considered to include a carbonization step . the infiltration and subsequent carbonization steps as described above are repeated at least once , to achieve a density in the carbon fiber preform of approximately 1 . 5 - 1 . 7 g / cc . prior to one or more of the densification steps , the carbon fiber preform is infiltrated with a carbon additive designed to adsorb moisture from the atmosphere . the carbon additive particles used in accordance with this invention will typically have sizes ranging from 1 to 10 microns . the additive may be introduced into the preform through vacuum infiltration of a suspension of the carbon particles in a solvent such as water or acetone . the solvent can be dried out of the additive - infiltrated preform by drying . drying may be accomplished by heating to a suitable temperature ( e . g ., 110 ° c . for 24 hours ), with or without the use of vacuum . alternatively , the solvent may be allowed to evaporate out of the preform without a specific heating step , with or without vacuum assistance . the inventive processing described above may be followed by additional steps . for instance , one may conduct an optional final heat treatment of the densified c — c composite to 1200 - 2540 ° c ., typically in an inert nitrogen or vacuum atmosphere . the composite will generally be machined to its final dimensions , and then will typically have anti - oxidant coating applied to it to protect the carbon from oxidation . the present invention makes use of carbon - carbon composite densification techniques which are , in general , well known to persons skilled in the art of manufacturing carbon - carbon composite friction materials for use in such applications as high performance brake discs . outlines of such techniques follow . cvd / cvi . chemical vapor deposition ( cvd ) of carbon is also known as chemical vapor infiltration ( cvi ). in a cvd / cvi process , carbonized , and optionally heat treated , preforms are heated in a retort under the cover of inert gas , typically at a pressure below 100 torr . when the parts reach a temperature of 900 ° to 1200 ° c ., the inert gas is replaced with a carbon - bearing gas such as methane , ethane , propane , butane , propylene , or acetylene , or combinations of these gases . when the hydrocarbon gas mixture flows around and through the porous structures , a complex set of dehydrogenation , condensation , and polymerization reactions occur , thereby depositing the carbon atoms within the interior and onto the surface of the porous structures . over time , as more and more of the carbon atoms are deposited onto the structures , the porous structures become more dense . this process is sometimes referred to as densification , because the open spaces in the porous structures are eventually filled with a carbon matrix until generally solid carbon parts are formed . depending upon the pressure , temperature , and gas composition , the crystallographic structure and order of the deposited carbon can be controlled , yielding anything from an isotropic carbon to a highly anisotropic , ordered carbon . us 2006 / 0046059 a1 ( arico et al . ), the disclosure of which is incorporated herein by reference , provides an overview of cvd / cvi processing . vpi . vacuum pressure infiltration (“ vpi ”) is a well known method for impregnating a resin or pitch into a preform . the preform is heated under inert conditions to well above the melting point of the impregnating pitch . then , the gas in the pores is removed by evacuating the preform . finally , molten pitch is allowed to infiltrate the part , as the overall pressure is returned to one atmosphere or above . in the vpi process a volume of resin or pitch is melted in one vessel while the porous preforms are contained in a second vessel under vacuum . the molten resin or pitch is transferred from vessel one into the porous preforms contained in the second vessel using a combination of vacuum and pressure . the vpi process typically employs resin and pitches which possess low to medium viscosity . such pitches provide lower carbon yields than do mesophase pitches . accordingly , at least one additional cycle of pitch infiltration of low or medium char - yield pitch ( with vpi or rtm processing ) is usually required to achieve a final density of 1 . 7 g / cc or higher . rtm . resin transfer molding (“ rtm ”) is an alternative to the use of vpi for the production of polymer - based composites . in resin transfer molding , a fibrous preform or mat is placed into a mold matching the desired part geometry . typically , a relatively low viscosity thermoset resin is injected at low temperature ( 50 to 150 ° c .) using pressure or induced under vacuum , into the porous body contained within a mold . the resin is cured within the mold before being removed from the mold . u . s . pat . no . 6 , 537 , 470 b1 ( wood et al .) describes a more flexible rtm process that can make use of high viscosity resin or pitch . the disclosure of u . s . pat . no . 6 , 537 , 470 b1 is incorporated herein by reference . carbonization . the carbonization process is generally well known to those skilled in the art . the cvd / resin / pitch - infiltrated fiber preforms are heated in a retort under inert or reducing conditions to remove the non - carbon constituents ( hydrogen , nitrogen , oxygen , etc .) from the fibers and matrix carbons . this process may be performed , for instance , by burying the foam preforms in a bed of activated carbon , enclosed in a superalloy retort with a sand seal . carbonization of the infiltrated pitch can be carried out either in a furnace , a hot isostatic press , an autoclave , or in a uniaxial hot press . in each of these techniques , the impregnated part is heated to the range of 600 ° to about 1000 ° c ., while maintaining an inert atmosphere in the pressure range of 1 to 1000 atmospheres . in one approach , for instance , the retort is purged gently with nitrogen for approximately 1 hour , then it is heated to 900 ° c . in 10 - 20 hours , and thence to 1050 ° c . in 1 - 2 hours . the retort is held at 1050 ° c . for 3 - 6 hours , then allowed to cool overnight . carbonization can be carried out up to 1800 ° c . the higher the pressure , the higher the carbon yield achieved , although the biggest gains in carbon yield are achieved at moderate pressures up to 5000 psi . stabilization / carbonization . carbonization refers to the heating of carbon materials in an inert atmosphere to temperatures typically between 700 and 1600 ° c . the purpose of carbonization in the manufacture of carbon - carbon composites from fibers , pitches , etc . is to remove non - carbon elements such as h , n , o , s , and other impurities from the pitch matrices to form a solid , carbon rich matrix . during carbonization , the volatiles from the pitch are released on porosity is generated in the composite , which has to be filled with pitch during subsequent pitch densification cycles . a stabilization step may be conducted to rigidize the pitch and prevent exudation from the preform during subsequent carbonization processing . the stabilization step may be oxidative stabilization carried out at a temperature of about 150 - 250 ° c . to rigidize the pitch and prevent its exudation during carbonization . alternatively , mechanical or gaseous pressure can be used during carbonization , with or without a containment vessel , to prevent the preform from bloating and to limit the amount of pitch exudate . in some instance , the pitch - densified preforms do not require stabilization prior to carbonization . in such cases , the preforms are typically restrained and / or contained to limit the amount of pitch exudate . heat treatment . intermediate and / or final heat treatment of the preforms is usually applied to modify the crystal structure of the carbon . heat treatment is employed to modify the mechanical , thermal , and chemical properties of the carbon in the preform . heat treatment of the preforms is typically conducted in the range of 1400 ° to 2800 ° c . the effect of such a treatment on graphitizable materials is well known . higher temperatures increase the degree of crystalline order in the carbon material , as measured by such analytical techniques as x - ray diffraction or raman spectroscopy . higher temperatures also increase the thermal conductivity of the carbon in the products , as well as the elastic modulus , and typically result in lower wear rates . machining the surfaces of the preform . standard machining processes , well know to persons skilled in the art of manufacturing carbon - carbon composite brake discs , are used in the manufacture of the carbon - carbon composite friction discs provided by the present invention . between densification processing steps , the surfaces of the annular discs are ground down to expose porosity in the surfaces . once the final density is achieved , the annular discs are ground to their final thickness using standard grinding equipment to provide parallel flat surfaces , and then the inside diameter and outside diameter regions are machined , typically using a cnc ( computer numerical control ) mill to provide the final brake disc geometry , including such features as rivet holes and drive lugs . a nonwoven carbon fiber preform is carbonized at 1600 - 2400 ° c . the carbonized preform is densified by cvi / cvd , and / or pitch ( using vpi ), and / or resin ( using rtm ) to a density in the range of about 1 . 1 g / cc to about 1 . 5 g / cc . the densified preform is infiltrated with a solution containing carbon black or with a solution containing activated carbon . this infiltration is continued until the preform achieves a weight increase of from 0 . 1 % to 2 %. the preform is then densified by cvi / cvd to a final density of at least 1 . 7 g / cc . the fully densified preform is subjected to a final heat treatment at 1600 - 2400 ° c . the preform is then machined to its final dimensions for use as a brake disc . anti - oxidant paint is applied thereto , and the anti - oxidant coated brake disc is charred to prepare it for use , for instance in an aircraft landing system . in a preferred embodiment of the invention , a pan fiber preform is first densified by cvi ( pitch / or resin can also be used ). further densification is performed with either cvi , pitch or resin to achieve a density of approx 1 . 6 - 1 . 7 g / cc . prior to the final densification cycle the selective additive suspended in water or solvent is infiltrated into the composite to form a uniform distribution throughout the bulk of the composite . the additive contained within the open porosity of the carbon composite is then dried to remove the solution / solvent and then the composite densified a final time to bind the carbon additive into the composite . infiltration with the moisture - adsorbing carbon additive may be performed prior to the final carbon densification process and the final heat treatment , since the carbon additive is not adversely impacted by the heat treatment processing . alternatively , the carbon additive may be infiltrated into the carbon preform prior to any one or more of the cvi / cvd densification steps . the present invention has been described herein in terms of preferred embodiments . however , obvious modifications and additions to the invention will become apparent to those skilled in the relevant arts upon a reading and understanding of the foregoing description . it is intended that all such modifications and additions form a part of the present invention to the extent that they fall within the scope of the several claims appended hereto . | 2 |
the present invention will now be described in detail with reference to the accompanying drawings , which are provided as illustrative examples of preferred embodiments of the present invention . notably , the figures and examples provided below are not meant to limit the scope of the present invention . moreover , where certain elements of the present invention can be partially or fully implemented using known components , only those portions of such known components that are necessary for an understanding of the present invention will be described , and detailed descriptions of other portions of such known components will be omitted so as not to obscure the invention . further , the present invention encompasses present and future known equivalents to the known components referred to herein by way of illustration . fig5 illustrates an example implementation of the present invention . this example implementation is based on the texas instruments tms320c6x ( ti &# 39 ; c6x ) architecture . although described in detail in connection with the ti &# 39 ; c6x architecture , those of skill in the art will understand how to adapt the implementation described herein to other processor architecture such as x86 , pentium , sparc , powerpc , mips , sharc , lsi logic , starcore , mcore , and itanium . accordingly , the example implementation described herein is intended as illustrative rather than limiting . for example , although fig5 illustrates an example implementation in an architecture including decode stage registers , it should be apparent that other architectures not including decode stage registers may be adapted for use with present invention , as will be understood by those skilled in the art after being taught by the present disclosure . in such a case , the instructions issued from the dispatch stage to the functional units , rather than being unencoded instructions will be decoded instructions in the form of functional unit control signals . as is known , in the ti &# 39 ; c6x architecture , the dispatch stage of the pipeline consists of a network that routes instructions in the fetch packet ( eight aligned instructions ) to their correct functional units . see , for example , the “ tms320c6000 cpu and instruction set reference guide ,” tech . rep . spru1691 , texas instruments , march 1999 , the contents of which are incorporated herein by reference . dispatch stage 502 of the present invention shown in fig5 , as in the conventional architecture , includes a routing network 512 from each instruction dispatch register 504 - 0 to 504 - 7 to each instruction decode register 506 - 0 to 506 - 7 ( beginning of the path to each associated functional unit fu 0 to fu 7 ). also , as in the conventional architecture and as illustrated in fig4 b , the assembler insures that there is only a single instruction in each execute packet ( subset of the instructions in the fetch packet that can be issued in parallel ) for any functional unit ; i . e . there is no hardware contention for the routing wires or the functional units in a given cycle . this is because in the &# 39 ; c6x hardware , there must be a dispatch register for each instruction in an execute packet , while there must at least as many decoders and functional units as there are instructions in an execute packet . in other words , some implementations may have more decoders and function units than possible instructions in an execute packet , but there must be at least enough decoders and function units to accommodate every possible allowed combination of instructions in the packet . initially , the &# 39 ; c6x hardware and algorithms were designed to function correctly on unroll - based scheduled loops as well as modulo scheduled loops , but explicit prologue and epilogue code were required for the latter . as will be discussed in more detail below , rather than needing to specify each of the prologue , kernel , and epilogue in the user code provided to the hardware , the present invention allows only a single copy of the loop to be specified in the code and uses special hardware to collect the instructions , thereby allowing the prologue , kernel , and epilogue to be formed at runtime . as will be explained in more detail below , the compiler understand that the execution of the loop iterations will overlap and properly schedules and inserts any necessary no operation instructions ( nops ) to prevent resource contention . in accordance with the present invention and in contrast with the prior art , therefore , as shown in fig5 the dispatch pipeline stage 502 further includes modulo schedule buffers ( msbs ) 510 - 0 to 510 - 7 and associated control logic ( not shown ) that collect the fetched instructions for selective and subsequent issue to the functional units . each msb 510 consists of an array of entries indexed by the current cycle of the executing stage of the modulo scheduled loop . the number of entries in the buffer 510 is a design choice , for example 32 , with the choice of entries limiting the modulo scheduled loops that can use the msbs to those which have equal or fewer cycles per stage than the number of entries . as shown in fig6 , each buffer entry 602 in msb 510 consists of an instruction 604 and a stage bit mask field 606 indicating the stage to which the instruction belongs ( e . g . as shown in fig6 a “ 1 ” in the second significant bit position indicates that the instruction is active in stage 1 of the loop , and a “ 0 ” in the first significant bit position indicates that the instruction is inactive in stage 0 of the loop ). during the first iteration of the loop , all instructions to be executed by the functional unit associated with msb 510 during the loop are both issued to the functional unit and inserted into the instruction portion 604 of different entries 602 in msb 510 and tagged with their appropriate stage of execution via bit mask field 606 for subsequent issue to the functional unit . the different entries 602 correspond to the n different cycles within a stage of the modulo scheduled loop . for example , if the loop body for one iteration of the loop consists of four stages and there are two cycles per stage , only the first 2 entries 602 in msb 510 will be needed for executing the loop ( although certain of the entries may include nop instructions ), and only the first 4 bits ( representing stages 0 through 3 ) of the stage bit mask 606 . the specific cycle of an instruction within the first iteration can be computed by multiplying the stage number by the number of cycles per stage and then adding the cycle number . as should be apparent from this example , the number of loop stages that can be implemented is directly proportional to the number of bit positions in the stage bit mask field 606 , for example , 16 . as subsequent iterations of the loop are started , instructions for those iterations are issued from msb 510 , even as instructions for the first iteration may be inserted into buffers 510 associated with other functional units for successive stages . there is never any contention for a functional unit or a buffer entry 602 in a particular cycle because the standard modulo scheduling algorithm already insures that a particular resource used in a particular cycle in a particular stage is never used in that same cycle in any other stage . as will be explained in more detail below , in addition to loading the instructions and associated stage fields in the msbs , three pieces of information must be passed to the control logic associated with the msbs to correctly setup execution of the loop . first , the initiation interval ( ii ) is needed so that new iterations of the loops may be started every ii cycles . second , the number of loop iterations ( loop iters ) to be executed must be supplied . third , the number of cycles ( loop cycles ) required to execute a loop iteration must be supplied . these set up requirements are for traditional ‘ for ’ loops where the iteration count is known prior to execution of the loop . however , ‘ while ’ loops , where it is not known until the end of an iteration whether or not the next iteration will execute , can also be implemented . these loops are supported in the standard modulo scheduling algorithms through the use of control speculated instructions . fig7 depicts a more detailed view of a portion of the dispatch stage 502 of the processor pipeline . as shown , in addition to msb 510 , the dispatch stage includes control logic 700 . in this example of the invention , there is only one set of control logic 700 for the dispatch stage of the processor , whereas the other components of the dispatch stage 502 shown in fig7 , such as buffer 510 , are respectively provided for each functional unit . control logic 700 includes an initiation interval register 702 for storing the ii for the loop , a loop iteration register 704 for storing the number of loop iterations ( loop iters ) to be executed , and a loop cycles register 706 for storing the number of cycles for each iteration in the loop ( loop cycles ). a global counter 708 is used to track the current cycle of the executing stages . whenever this counter increments to the ii ( as determined by comparator 714 that compares the contents of counter 708 with the contents of initiation iteration register 702 ), it is reset to zero , and an active signal from comparator 714 that indicates the end of the current stage is generated . the initiation interval specifies how often a new iteration is started . this is also , then , inherently the number of cycles per stage . the new iteration begins at the first cycle of the first stage , counts cycles until ii is reached , at which time the current iteration enters cycle 0 of the second stage and the new iteration beings at the first cycle of the first stage . because the ii is variable across a variety of loops , extra buffer entries in msb 510 not containing instructions for execution during the loop may exist . thus , the comparison and reset of this counter is necessary rather than a simple modulo table indexing approach . a first iteration stage counter 710 is used to track the current executing stage of the first loop iteration . this counter is used to tag the instructions being added to msb 510 . each time that comparator 714 indicates the end of the current stage , this counter 710 is incremented . this counter may be implemented as a traditional counter or as a bit mask . if implemented as a traditional counter , the value must be converted into the correct bit mask when written into the tag field of an instruction entry , where the first stage has the first bit set , the second stage has the second bit set , the third stage the third bit set , etc . otherwise , the counter may be implemented as a bit mask which is initialized to all 0s with a 1 in the first bit position indicating the first stage , and simply left shifted entering a zero in the vacated position each time the global counter 708 indicates the end of the current stage . loop cycles register 706 is initialized with the number of cycles required to execute one iteration of the loop . this register is used to control the writing of instructions into msb 510 . register 706 is decremented each clock cycle , and when non - zero ( as determined by comparator 718 ), the “ accumulate first iter instructions ” signal from comparator 718 is active , allowing for the insertion of instructions into msb 510 from the dispatch registers 504 . some cycles may contain nop instructions for particular functional units , requiring nothing to be written into that cycle for that functional unit . however , a later stage may write an instruction into that entry later in the iteration . likewise , later stages are required to have nops for a particular cycle and functional unit when the functional unit is used by an earlier stage of another iteration . such later stage nops must not write over earlier stage actual instructions . when register 706 reaches 0 , there are no more instructions in the first iteration of the loop , and the accumulate signal from comparator 718 is inactive . in fact , the next instruction waiting in the instruction dispatch registers is the first instruction after execution of the entire loop . at this point , the fetch unit may be disabled , saving power , until all iterations ( all of which are completely dispatched from the msbs 510 ) are complete . the active stages bit vector register 712 contains a bit for each active loop stage . the register is initialized to 0 . . . 01 ( binary ). the number of bits in the vector is a design choice , for example 16 , which should be the same number of bits as the bit mask field 606 . the initialized value of the vector indicates that only the first stage is ready to execute , in this case for the first iteration . each time the current cycle counter 708 resets ( end of stage signal from comparator 714 is active ), a bit is left shifted into the register . a 1 is shifted in if the loop iteration register 704 indicates that more iterations remain to be executed , i . e . the contents of loop iteration register 704 is greater than zero ( indicated by an active signal from comparator 716 ), otherwise a 0 is shifted in . the loop iteration register 704 is then decremented . as the bits are shifted to the left , the 1 - valued bit representing an iteration executing in a particular stage proceeds to the next stage . generally , when this bit register contains all zeros ( i . e . each bit representing a stage is set to zero ) for the bit positions associated with the stages for the particular loop , all iterations have completed , and execution continues after the loop with the code waiting in the dispatch registers . in an alternative implementation that also supports while loops , an evaluation of a conditional expression in the loop determines whether or not another iteration will begin . this conditional expression can not typically be evaluated until late in the iteration . the standard modulo scheduling algorithm for while loops likely begins successive iterations of the loop before knowing if they should be executed ( speculatively ). for these loops , a conditional evaluation that causes another iteration to execute would cause the shift of a 1 into the active stages bit register 712 rather than the iteration count register 704 . when the conditional evaluates to false , a 0 is shifted in . the proposed design currently requires that the loop back branch to the next iteration be the last instruction in the modulo scheduled loop ( last cycle of the last stage ), as is common with many modulo schedulers . when this is the case , the loop has complete execution when the first zero is shifted into the active stages register 712 . even though portions of other iterations may be currently executing out of the msbs , they are speculative iterations that should not be completed , and execution can proceed with the post - loop code waiting in the dispatch registers . as shown in the example of fig7 , there is additional control circuitry that is provided for each functional unit in addition to msb 510 . decoder 724 provides the index into the msb 510 in accordance with the current cycle stored in counter 708 . comparator 720 compares the contents of the indexed stage bit mask field for the instruction with the contents of the active stage register 712 . if the 1 bit ( indicating the instruction &# 39 ; s active stage ) is also set to 1 in the active stages bit mask ( which contains 1 bits for all active stages ), an active (“ 1 ”) signal is generated , and the indexed instruction corresponding to the indexed bit mask is provided to the instruction decode register 506 ( by operation of or gate 722 and register 728 ). otherwise , a nop instruction is provided . selector 726 selects between instructions issued to decode register 506 from the msb 510 or directly from the dispatch stage . selector 726 thus allows instructions to issue to the decode register 506 from the dispatch stage when processing instructions that are not using the msbs . furthermore , when the first iteration is executing , those instructions are written into the msbs and passed through to the decode register 506 . when instructions from other iterations are executing out of the msbs 510 , these instructions should be passed to the decode register 506 . however , it should be noted that there should never be contention for a particular functional unit . when a non - nop is issued from the dispatch registers , it must be issued to the decode register , and optionally written to the appropriate msb when handling modulo scheduled code . otherwise , when in modulo scheduled code and an instruction with an active stage is in an msb , it must be issued to the decode register . a contention indicates that the compiler incorrectly modulo scheduled two instructions from different stages into the same functional unit in the same cycle . the following describes an example operation of a processor implementing the modulo scheduling buffer scheme of the present invention , as further illustrated in fig8 a and 8b . the example depicts three iterations of a loop on a 4 - issue machine with fully pipelined load ( lat . 2 ), multiply ( lat . 2 ), add ( lat . 1 ), and shift ( lat . 1 ) units . the loop body , as illustrated at the upper right corner of fig8 , consists of two loads , one multiply , one add , and one shift instruction . the loop is modulo scheduled into three stages . thus , each iteration requires 6 cycles to execute , with a throughput of one iteration per two cycles ( i . e ., ii = 2 ). also , assume that all register and memory dependences have been satisfied for the modulo schedule by the scheduler . dashed lines indicate instructions that are dispatched from the dispatch unit to the decoders and simultaneously stored into the appropriate msb 510 . solid lines indicate stored instructions that are issued from the msbs 510 . pre - loop ) initialize the ii (= 2 ), loop cycles (= 6 ), and loop iterations (= 3 for three iterations of the loop ) registers , all as detailed above . this happens in the s units on the ti &# 39 ; c6x and the registers can be written in the exi stage , like other 1 - cycle instructions . at this time , the instructions following the values for the loop initialization registers are already in the dispatch registers and therefore cannot be routed into the msbs 510 . thus , another instruction , possibly a nop , must fill the slot immediately after the initialization instructions before the first loop instructions . the loop iters register is decremented by 1 as the first iteration is about to issue . the active stages bit register 712 is initialized to 0 . . . 01 to indicate that the first stage is active . cycle 0 ) the first instruction execute packet ( containing the first load ) in the loop is sitting in the dispatch registers ready to be routed to its decode instruction registers ( functional unit ). this packet may maintain from one instruction up to the issue width , or even no instructions . all instructions in this execute packet are routed and issued to the dispatch registers 504 , and simultaneously inserted into their appropriate functional unit msb 510 . in this case , the load is issued and stored in the cycle 0 entry of msb 510 - 0 and given a stage bit mask indicating the first stage . the current cycle counter 708 is incremented to the second cycle . the loop cycles register 706 ( remaining cycles for the first iteration ) is decremented to 5 more cycles . cycle 1 ) the second instruction is also a load . this is inserted into the cycle 1 entry of msb 510 - 0 . at the end of this cycle , the current cycle register 708 is reset to 0 . because the loop iters register 704 indicates that more loop iterations remain to be executed , a 1 bit is left shifted into the active stages register 712 , the result of which can be seen in the cycle 2 . the loop iters register 704 is then decremented . the first iter stage register 710 is incremented to 1 . cycle 2 ) no instruction is added to any of the msbs 510 because of the nop in the schedule . however , the load instruction for the stage 0 of the second loop iteration is automatically issued by msb 510 - 0 . cycle 3 ) the mul instruction is issued and added to the second cycle entry of msb 510 - 1 , and the load instruction is automatically issued from msb 510 - 0 . the third loop iteration is ready to be initiated after this cycle . cycle 4 ) the load instruction for the third loop iteration is automatically issued from msb 510 - 0 . cycle 5 ) the add and shift instructions are issued from the dispatch registers and added to msbs 510 - 2 and 510 - 3 from the dispatch , and the second load instruction for the third iteration and the mul instruction for the second loop iteration are automatically issued from msbs 510 - 0 and 510 - 1 , respectively . there are no more iterations left to initiate as the loop iters register 704 is at 0 . shift a 0 into the active stages register 712 . any instructions tagged with the first stage will no longer be issued ; i . e . no load instruction will be issued from msb 510 - 0 in cycle 6 and thus no new iterations will be performed . the loop cycles register 706 is decremented to zero , indicating there are no more instructions in the first iteration . cycle 6 ) the loop cycles register 706 has now reached zero so no more instructions will be issued or added from the dispatch unit . the fetch unit can be powered down . no instructions are issued from the msbs 510 since no active stages have instructions in cycle 0 . cycle 7 ) the mul instruction for the third loop iteration , and the add , and shift instruction for the second loop iteration are issued from msbs 510 - 1 , 510 - 2 and 510 - 3 , respectively . no new iterations are to be started , so another 0 is left shifted into the active stages register 712 . cycle 9 ) the add and shl instructions for the third loop iteration are issued from msbs 510 - 2 and 510 - 3 . a zero is left shifted into active stages register 712 . this register is now all zeroes . the modulo scheduled loop has completed , and the dispatch and fetch units are re - enabled to begin post - loop code execution . further advantages and aspects of the present invention will now be described with reference to fig9 to 14 . as is known , two primary scheduling models exist for non - unit assumed latency ( nual ) architectures . the ti &# 39 ; c6x is an example of the equals model ( eq ), where each operation executes for exactly its specified latency , and writes back the result exactly after that latency has expired . consider the example in fig9 . in cycle 0 , register r 1 is initialized to a value of 1 . in cycle 1 , the multiply operation begins using the value of 1 for r 1 . because the latency of the multiply is 3 cycles , the result of the multiple will not be written back to r 1 until the end of cycle 4 . meanwhile , in cycle 2 , the value of r 1 is guaranteed to still be 1 , and the add completes writing a value of 9 to r 1 . the store of r 1 in cycle 3 is also guaranteed to be unaffected by the multiply and will correctly write to memory a value of 9 . as can be seen in this example , registers can effectively be reused during long latency operations , often resulting in fewer register needed for a computation . ti calls this particular type of reuse multiple assignment . the other model is called the less than or equal model ( le ). under this model , the result latency is specified as the maximum time that a particular operation may take to complete and write back its result . in other words , the result may be written back at any time up until and including the cycle at which its latency expires . coding for this model disallows the register reuse allowed in the equals model . fig1 a , 10 b and 10 c show the execution of the example code as executed on an eq machine and on an le machine where the actual multiply latency varies from three , two , to one , respectively . ti calls this type of register allocation single assignment . while registers cannot be reused during long latency operations , interrupt handling in code scheduled for the le model is much simpler . whenever an interrupt is taken , several instructions are already in the execute pipeline . precise interrupts are maintained by completing execution of code already in the functional units and squashing code in the fetch or decode units . after processing the interrupt , execution can continue from a single program counter value . from the vantage point of the first instruction after resumption , all instructions scheduled prior to it have completed , even though some may have had a maximum latency well beyond the first instruction after resumption . clearly , when scheduling and register allocating for an le machine , a single assignment methodology must be used . if an instruction finishes early and overwrites a register , another usage of that register might read the new value rather than the old value . however , for an eq machine , either single assignment or multiple assignment scheduling and allocation may be used . if the instruction is guaranteed to take a certain number of cycles , assuming that it can finished early is a safe , conservative assumption . correctly handling interrupts in the le model is simple , as all instructions that have started executing are allowed to finish . these instructions may finish early ( before their maximum latency ) relative to instructions that execute after the interrupt is processed . however , scheduling for the le model required that the code be scheduled with this uncertainty in mind . likewise , correctly handling interrupts in the eq model under single assignment it simple , as all instructions prior to the interrupt can be allowed to finish . since the schedule assumed that they may finish early , the computation will be correct . however , interrupt handling in the eq model under multiple assignment is more difficult . consider the situation when an interrupt is taken immediately after instruction 1 in the example in third column of fig9 . a precise interrupt cannot be taken because there is no single program counter value where all instructions prior to the pc have been executed and all after have not . the multiply was issued prior to the interrupt and has not yet completed . furthermore , if that instruction is allowed to complete before the interrupt is actually taken , then the value of r 1 would be prematurely overwritten with the result of the multiply . the results of the total computation would be as shown in the last column of fig9 . therefore , in the ti processors , interrupts must be disabled for any portion of the code that use multiple assignment . this is of particular concern for long - running modulo scheduled loops that use multiple assignment . all interrupts must wait until the modulo scheduled loop has completed all iterations . this could significantly delay processing of the interrupts . however , by using the modulo schedule buffers of the present invention , interrupts will only have to wait until the end of the current loop iteration before they can be processed . this is a benefit of having the control logic actually issuing iterations of the loop . when an interrupt occurs , iterations will stop being issued from the modulo schedule buffers , just like when the last iteration of the loop has been issued , as shown in fig1 . this means that the loop counter 704 will no longer be decremented , and zeroes will be shifted into the active stages bit register 712 until all previously issued iterations have completed . at this point , the interrupt can be taken . note that the current loop counter register 704 contains the number of iterations that remain in the loop and will need to be saved across context switches . upon return from the interrupt , the modulo schedule buffers 510 are cleared , and filling and issue resumes just like when the first iteration was begun , only now with the saved loop counter value in register 704 . when a loop is modulo scheduled , the ii is chosen to be as small as possible , thus starting successive iterations as early as possible . the limiting factor in choosing an ii is often a cross - iteration flow dependence , otherwise known as a recurrence . such a dependence often consists of a producer operation late in the loop body that feeds a value to an earlier operation in that loop body but in the next iteration . a simple example is an accumulator operation , where the accumulate instruction feeds the result to itself in the next iteration . therefore , beginning a successive loop iteration before the minimum recurrence ii will result in incorrect results because the cross - iteration flow dependence would not have been met . however , one can start the next iteration at any time later than the recurrence ii , such as after the prior iteration has completed . at the end of each iteration of the loop body , a set of registers and memory locations exist that communicate state to the next iteration . in general practice , these physical registers are not reused for other temporary values , and thus will be live until the next iteration consumes them . consider the loop body depicted in fig1 a . in this example , two virtual registers are used in the loop body , where virtual register 1 is live across the end of the first iteration into the next iteration . when register allocating this loop , two different physical registers are required , as the lifetimes of the two virtual registers overlap . however , a register allocator that understands the effects of modulo scheduling may see the register lifetimes as depicted in fig1 b and allocate a single physical register for them both . such a register optimization must be avoided to properly handle interrupts in the present invention because the values which are live into the next iteration must be preserved . normally , the ii is small enough that no opportunities exist for such a register optimization . similarly , modern machines that use modulo scheduling generally have enough registers where such an optimization is not necessary . consider an example loop , depicted in fig1 , from table 6 - 7 of the ti programmer &# 39 ; s guide ( texas instruments , “ tms320c62x / c67x programmer &# 39 ; s guide ,” tech . rep . spru198c , texas instruments , texas , may 1999 .) this loop executes a dot product , two terms per cycle , with an ii of 1 cycle , and uses multiple assignment . the loop body consists of two loads that feed 2 multiplies 5 cycles later . the multiplies take two cycles to complete before the results are fed to the adds . note also the cross - iteration dependences : each load is a post - increment load where the address operand is automatically incremented and passed on to the load in the next iteration ; each add is an accumulator which passes its result on to the add in the next iteration . at the end of cycle zero , the two loads for the first iteration have been executed , there are n − 1 iterations which remain to be started , and the active stages bit register 712 shows that only the first stage ( one cycle per stage in this example ) is active . in the second cycle , cycle one , the two loads are issued from the modulo scheduling buffers 510 for iteration two , and no instructions are issued for the first iteration . even though there are no instructions for stage two of the first iteration , the active stages bit register 712 indicates that the stage is active . in cycle seven , an interrupt request is received . as described earlier , the complexity with multiple assignment is that there are five different outstanding result values for each of the load instructions , values for iterations three through seven . processing an interrupt at this point would require that all five values be saved along with the timing information in order to switch context , a functionality not present in most architectures . the iterations that have begun executing must be allowed to finish with proper timing in order to obtain the correct results . however , with traditional modulo scheduling , as iterations are allowed to finish , new iterations are begun which also must be allowed to finish , resulting in the rule that such loops must totally complete before processing an interrupt . or , normal epilogue code could be entered and completed , but then program flow would not be able to restart the loop to finish the iterations without the additional overhead of an encapsulating outer loop to catch this case . the present invention allows for the ability to execute the epilogue code when needed and then to resume later . the loop state is held in the cross - iteration values , as previously mentioned , along with the loop control state maintained by the loop hardware . one potential drawback to using the modulo schedule buffers scheme of the present invention concerns the execution of loop initialization code . when the instructions for the prologue are completely inserted into the binary , it may be possible to also schedule initialization code in parallel with those prologue instructions . it may also be possible to execute post - loop code in parallel with the epilogue . these optimizations may reduce the total number of cycles required to execute the loop . in the hardware scheme of the present invention , however , such overlap is not possible . the reduction in cycles due to the aforementioned overlap is generally small compared to the cycles spent executing the loop itself . many loops have iteration counts that are not determined until run - time . however , the compiler , by using heuristics and profile information , may decide to modulo schedule such loops anyway . provided that the loop iterates at least as many times as the number of overlapped iterations in the kernel , the fully generated code will work correctly . however , in some code generation schemes , the entire prologue and at least one copy of the kernel must be executed , thus beginning a minimum number of iterations . there are two primary methods for allowing for the short iteration count loops . first , by adding some extra branching instructions to the prologue and possibly some specialized copies of the epilogue , the kernel may be skipped . however , this may significantly increase the code size . second , rather than execute the modulo scheduled version of the loop at all , another piece of code is branched to that handles short iterations , such as one with a traditional loop structure ( called pre - or post - loop conditioning ). this , too , increases code size . unlike either of these two methodologies , the modulo schedule buffer hardware scheme of the present invention automatically handles short iteration count loops , by simply initiating the correct number of iterations . in many loop bodies , some temporary values must be stored longer than the ii . this poses a problem as the write to the register in the second iteration will be completed before the read in first iteration is executed . one method for solving this problem is to require that writes in the overlapped loop iterations actually use different registers , which is called modulo variable expansion ( mve ). see , for example , m . s . lam , “ software pipelining : an effective scheduling technique for vliw machines ,” in proceedings of the acm sigplan 1988 conference on programming language design and implementation , pp . 318 - 328 , june 1988 ; b . r . rau , m . s . schlansker , and p . tirumalai , “ code generation schemas for modulo scheduled do - loops and while - loops ,” tech . rep . hpl - 92 - 47 , hewlett packard labs , april 1992 ; and d . m . lavery , modulo scheduling for control - intensive general - purpose programs . ph . d . thesis , department of electrical and computer engineering , university of illinois , urbana , ill ., 1997 . this requires that the several copies of the kernel , one for each different version , execute in round robin fashion . the hardware scheme of the present invention may be extended to handle mve code . the simplest method is to combine the original with the altered iterations into a single code sequence that performs the work of multiple iterations . fig1 a shows the loop body , iter a , with two mve copies , iters b and c . the combined loop body is shown in fig1 b , along with the new issue pattern and ii in fig1 c . this scheme requires no clean up code , as the last iteration is always a type c iteration , but does require pre - or post - conditioning if the total number of loop iterations is not divisible by the amount of overlap in the combined loop body . as mentioned earlier , heavy use of predication can also be used to reduce code size . see j . c . dehnert , p . y . hsu , and j . p . bratt , “ overlapped loop support in the cydra 5 ,” in proceedings of the third international conference on architectural support for programming languages and operating systems , pp . 26 - 38 , april 1989 . predication allows any instruction to be conditionally executed depending on the value of a predicate , or condition , bit . predication is often used to eliminate branching by instead setting a predicate bit based on a comparison , then conditionally executing the otherwise branched - to code when that predicate is true . predication can also be used in a clever way to support modulo scheduling . with kernel - only modulo scheduling , only the kernel itself need be inserted into the program code , without any prologue or epilogue . the key is to maintain a predicate register for each stage of the modulo schedule , which allows or prevents execution of the instructions for that stage depending on the predicates . in essence , the active stages bit vector 712 is a set of predicate registers that do exactly the same thing . in kernel - only modulo scheduling , it is the programmer / compiler &# 39 ; s responsibility to correctly assign the predicate registers and maintain them at runtime . the architecture does provide assistance in the form of a rotating register file . each time a new iteration is initiated ( ii cycles ), the names of the registers are shifted by one . thus the active stages bit register in our scheme is maintained in the predicate register file in the kernel - only scheme , where the shifting happens automatically . although the present invention has been particularly described with reference to the preferred embodiments , it should be readily apparent to those of ordinary skill in the art that changes and modifications in the form and details may be made without departing from the spirit and scope of the invention . it is intended that the appended claims include such changes and modifications . | 6 |
a pre - bunking apparatus usable according to principles of the present invention is depicted in fig1 and 2 schematically . fig1 is an end planar view of pre - bunking apparatus 10 , showing portable bunk 14 and chain and cord assembly 16 . chain and cord assembly 16 is connected at one end to cord tie loop 20 and wrapped around a load of logs 12 . once wrapped around load of logs 12 , chain and cord assembly 16 is connected to a hand winch 18 and pulled tightly around the load of logs 12 to contain the load of logs 12 within portable bunk 14 . the portable bunk 14 is explained in greater detail with reference to fig5 - 7 . generally , portable bunk 14 is of a similar configuration to bunks mounted on prior art truck trailers , having generally a u - shape cradle and a width from one end of the u to the other that is about the same distance as the width of a regular trailer bed for hauling freight . in the embodiment depicted by fig1 - 3 , there are at least two portable bunks 14 and 15 . the portable bunks 14 and 15 depicted in fig1 - 3 are generally of the same configuration . portable bunk 14 includes a bunk base member 24 upon which the load of logs 12 rests . the bunk base member 24 rests on top of a portable skid 21 which is comprised generally of first and second sledding members 22 and cross - members 26 . portable bunks 14 and 15 are detachable from portable skid 21 . in the depicted embodiment , as seen best in fig3 , bunk base member 24 may be hollow creating a bunk tube 65 wherein a lifting surface 30 can be received . as shown in fig3 , a tractor 28 is used to lift the portable bunk 14 from the portable skid 21 once the load of logs to be transported 12 is secured by way of chain and cord assembly 16 through hand winch 18 . one of skill in the art will recognize that there are a variety of ways to securely hold a load of logs to be transported 12 within portable bunk 14 and that chain and cord assembly 16 along with hand winch 18 are but one . referring now to fig4 , portable bunks 14 and 15 including a load of logs to be transported 12 are loaded by tractor 28 into trailer 32 which has been adapted to receive and securely fasten portable bunks 14 and 15 through the use of bunking hardware ( not depicted ). suitable bunking hardware is explained below with reference to fig9 a - 9c . with continuing reference to fig4 , trailer 32 may be of the kind disclosed by u . s . pat . no . 4 , 700 , 985 granted to whitehead . trailer 32 includes a retractable side wall disposed between a first end wall 35 and second end wall 37 and opposite a first side wall 39 . logs to be transported 12 , being securely fastened to portable bunks 14 and 15 through the use of chain and cord assemblies 16 and 17 , are loaded through the retractable side wall and securely fastened to the trailer bed 36 through the use of bunking hardware described below with reference to fig9 a - 9c . it is important to note that the invention is not limited to use of a trailer as disclosed by u . s . pat . no . 4 , 700 , 985 . any trailer adapted to carry both portable bunks 14 and 15 and a load such as wood residuals is usable with the present invention . for example , any trailer that has been adapted to secure portable bunks 14 and 15 and subsequently adapted to carry a load is within the spirit and scope of the invention . by way of example only , trailer 32 is adapted to carry wood residuals or any other load by extending the retractable side wall ( not depicted ) through the use of vertical straps 34 . according to the depicted embodiment , trailer 32 has a soft retractable side wall that rolls up around a torque roller through the use of a winch ( not depicted ). the invention is not limited to the use of a trailer with walls ; a flatbed trailer adapted to secure portable bunks 14 and 15 is also usable with apparatuses and methods of the invention . through the use of trailer 32 and portable bunks 14 and 15 as depicted in fig1 - 4 , the depicted embodiment permits hauling of cut timber as well as pick - up and hauling of wood residuals or any other load . a load may be contained within trailer 32 by affixing into place the retractable side wall . alternatively , trailer 32 could have four hard walls and an open top through which portable bunks 14 and 15 are top - loaded and thereafter secured to the bed through bunking hardware . one of ordinary skill in the art will recognize that trailer 32 could be configured in a variety of other ways to permit both the fastening of portable bunks 14 and 15 and the ability to carry a load . for example , trailer 32 could be loaded with portable bunks secured with logs to be transported 12 by first removing first end wall 35 or second end wall 37 . with continued reference to the embodiment depicted by fig1 - 4 , pre - bunking apparatus 10 can be connected to a scale ( not shown ) providing gross weight of logs to be transported after the same have been loaded onto portable bunks 14 and 15 and portable skid 21 . a suitable scale is available from structural instrumentation , inc ., seattle , wash ., model no . 91 - 00910 . the scale usable with the invention can also be connected to a remote display , model no . 9400rmd also available from structural instrumentation , inc ., seattle , wash . the remote display provides an accurate readout of gross weight of logs to be transported after the same have been loaded onto pre - bunking apparatus 10 . methods of the present invention permit the operator or operators to adjust the load of logs to be transported 12 according to predetermined trailer or truck capacities . one of the benefits of the present invention permits operators to maximize value of the load of logs to be transported by accurately pre - bunking logs to be transported that are of varying sizes and species . referring now to fig1 and 12 where a pre - bunking apparatus utilizing principles of the present invention is depicted . fig1 shows a portable skid 21 fully laden with long logs to be transported 122 . fig1 shows a portable skid 21 fully laden with logs of varying lengths and sizes 124 . through reference to fig1 and 12 , one aspect of the invention incorporating removable bunking hardware 72 is further described . suitable removable bunking hardware 72 is explained in greater detail with reference below to fig9 a - 9c . in general , bunking hardware 72 is comprised of a plurality of guide members and locking means mounted width - wise on either the trailer bed 36 or portable skid 21 . bunking hardware 72 generally includes a receiving end 84 and a shoe end 90 ( in fig9 b ), both of which include locking means and a plurality of gusseted guide members extending vertically from either trailer bed 36 or portable skid 21 and adapted generally to guide portable bunk 14 into place and securely fasten portable bunk 14 on either portable skid 21 or trailer bed 36 . according to the embodiment depicted by fig1 and 12 , removable bunking hardware 72 can be alternately switched and secured into a plurality of bunking hardware stations 132 , 134 , 136 , 138 , 140 , and 142 , respectively . suitable bunking hardware stations usable with the depicted embodiment are described in greater detail with reference to fig1 below ; however , in general they are comprised of fixed assemblies , built into either portable skid 21 or on trailer bed 36 at various positions , underneath bunking hardware 72 . the bunking hardware stations generally include a bored hole adapted to receive a locking member mounted to the underside of removable bunking hardware 72 at each end . locking pins may engage a locking member mounted to the underside of bunking hardware 72 in a manner suitable to securely hold bunking hardware 72 onto the bunking stations . trailer bed 36 as well as portable skid 21 include a plurality of bunking hardware stations 132 , 134 136 , 138 , 140 , 142 equipped with bored holes 131 adapted to receive locking members from the bunking hardware 72 . according to the depicted embodiment , pre - bunking hardware 72 can be moved to any pre - bunking hardware station 132 , 134 , 136 , 138 , 140 , or 142 . in the case of the trailer 32 ( as seen in fig4 ), where it is desirable to carry a load of wood residuals or other material , the ability to remove the bunking hardware 72 provides the added benefit of providing a flat bed whereupon a load may slide freely , aiding methods of loading and unloading trailer 32 . with reference now to fig5 a , portable bunk 14 will be described in greater detail . portable bunk 14 is generally comprised of u - shaped bunk cradle 38 and bunk base member 24 . according to one embodiment , bunk base member 24 is an elongated hollow member disposed lengthwise at the base of u - shaped bunk cradle 38 . a u - shaped bunk cradle 38 is comprised of a first collapsible member 40 that extends vertically from one end of bunk base member 24 , terminating with a tapered edge 43 . at the other end of base bunk member 24 , a second collapsible member 41 is disposed vertically from the end of base bunk member 24 opposite first collapsible member 40 and ending with a tapered edge 47 . both second collapsible member 41 and first collapsible member 40 are rotatably attached to either end of bunk base member 24 through pin assemblies 70 and 58 , respectively . in operation , second collapsible member 41 may be collapsed through rotation of approximately 90 ° from vertical such that second collapsible member 41 is ultimately laid at rest substantially parallel to bunk base member 24 . additionally , first collapsible member 40 is also rotatable approximately 90 ° from vertical such that it rests substantially parallel to bunk base member 24 . with continuing reference to fig5 a , portable bunk 14 includes both a heel end 61 and a toe end 52 . heel end 61 is located at the base of second collapsible member 41 while toe end 52 is located at the base of first collapsible member 40 . the portable bunk &# 39 ; s toe end 52 is referred to as such because it is at this end that the portable bunk 14 is slid securely into the bunking hardware 72 which is described in greater detail with reference to fig9 a - 9c . in general , bunking hardware 72 includes a plurality of vertically extending gusseted guide members that form a “ shoe ” adapted to receive and lock into place toe end 52 . furthermore , bunking hardware 72 includes a receiving end opposite that of the “ shoe ” end and also comprised of a plurality of gusseted guiding members and at least one locking surface wherein the heel end 61 of portable bunk 14 is guided and locked into place as described in further detail below with reference to fig9 a - 9c . heel end 61 includes a container lock 44 which in fig5 a is partially covered by container lock housing 42 . container lock 44 is described in greater detail below , however , in general it includes a rotatable locking member 46 that is adapted to engage a locking surface located on bunking hardware 72 . on either side of bunk base member 24 welded into place are cradle side plates 55 and 51 . cradle side plates 55 and 51 are welded onto the heel end 61 and toe end 52 respectively . container lock housing 42 is welded on cradle side plate 55 located at the heel end 61 of bunk base member 24 . with reference now to fig5 b , container lock 44 is mounted to the heel end 61 of portable bunk 14 . container lock 44 can be any locking mechanism suitable for securely fastening portable bunk 14 to suitable bunking hardware 72 , such as that described below . in the disclosed embodiment , container lock 44 is an off - the - shelf item available from buffers usa inc ., saf - t - loc ® model no . 3133 - 1 . container lock 44 is mounted on cradle side plate 55 at the heel end 61 of portable bunk 14 . as seen best in fig8 , container lock 44 includes a locking member 46 which is generally rectangular in shape with both a short end 66 and a long end 68 . in operation , locking member 46 is rotatably retractable within housing 42 through opening 64 . opening 64 is sized slightly larger than locking member 46 to permit the upward retraction of locking member 46 within housing 42 , once locking member 46 has been rotated to match an orientation permitting its retraction through opening 64 . once portable bunk 14 has been loaded with logs to be transported 12 , it is unlocked from the portable skid 21 through rotation of the container lock 44 and especially the locking member 46 , through a twisting and lifting manipulation of handle 60 in a manner that orients the locking member 46 in alignment with the opening 64 of the housing 42 , thereby permitting locking member 46 to retract up and inside of housing 42 , freeing portable bunk 14 and permitting its removal from portable skid . once the portable bunks 14 and 15 have been lifted and removed from the portable skid 21 , they are transported to the trailer 32 whereupon they are slid into bunking hardware 72 with toe end 52 being slid in first . subsequently , container lock 44 is again rotated such that locking member 46 is in alignment with the opening 64 of housing 42 sufficient to permit locking member 46 to protrude from housing 42 and be rotatably engaged with a locking surface upon bunking hardware 72 , thereby locking portable bunk 14 securely into place on the trailer 32 . fig6 a shows a side planar view of heel end 61 of bunk base member 24 . as discussed above , heel end 61 is hingedly connected to a second collapsible member 41 which extends essentially vertically from bunk base member 24 . second collapsible member 41 is rotatably collapsible about pin assembly 70 which is transversely mounted through cradle side plate 55 . cradle side plate 55 is welded at heel end 61 and flush with bunk tube opening 63 . bunk tube opening 63 is a rectangular space at the heel end 61 of bunk base member 24 . bunk tube opening 63 is an entrance space for bunk tube 65 , which extends through the length of bunk base member 24 . in this particular embodiment , bunk tube 65 and especially bunk tube opening 63 are of a size sufficient to receive a lifting surface such as the fork of a forklift or tractor which can be slid through the length of bunk tube 65 . with reference now to fig6 b and 7 , toe end 52 of portable bunk 14 is described in greater detail . as discussed briefly above , toe end 52 is hingedly connected to a first collapsible member 40 extending essentially vertically from the toe end of bunk base member 24 . first collapsible member 40 is hingedly connected by way of pin assembly 58 which is transversely interposed through cradle side plates 51 . welded on the side of cradle side plate 51 is chain link fastener 48 which is used in this particular embodiment to secure chain and cord assembly 16 ( not depicted ). toe end 52 includes gusseted sides 56 and toe end plate 54 . gusseted sides 56 extend away from the terminus of the toe end 52 of bunk base member 24 such that toe end side plate is disposed in a plane slightly beyond the terminus of bunk base member 24 . toe end plate 54 thus protrudes away from a vertical plane in which bunk base member 24 ends . the protruding nature of toe end 52 and especially toe end plate 54 permits the engagement of a locking pin through end hole 50 . a suitable locking pin is rotatably connected to bunking hardware 72 which is described in greater detail with reference to fig9 a - 9c . with reference now to fig9 b , bunking hardware 72 is described in greater detail . bunking hardware 72 does not differ in configuration when mounted on either trailer bed 36 or portable skid 21 . fig9 b is a top view of bunking hardware 72 showing receiving end 84 and shoe end 90 ; these respective ends are disposed opposite one another at locations along the width of either trailer bed 36 or portable skid 21 . receiving end 84 , when mounted on trailer bed 36 is preferably located on the side of trailer bed 36 where portable bunks 14 and 15 , after having been secured to a load of logs to be transported 12 are loaded . as discussed previously , a trailer usable with the invention has a retractable sidewall through which portable bunks 14 and 15 are loaded . accordingly , receiving end 84 is preferably mounted on the side of trailer bed 36 that will receive a load of logs to be transported 12 after the same have been securely mounted to portable bunks 14 and 15 . disposed opposite of receiving end 84 is shoe end 90 and the distance between shoe end 90 and receiving end 84 is about equal to the width of trailer bed 36 , or the width of portable skid 21 . receiving end 84 includes a first guide block 74 and a second guide block 78 . first guide block 74 and second guide block 78 are generally of the same configuration and each are comprised of elongated , vertically extending , rectangular box - like members welded at their respective bases onto a bunking hardware plate 89 . extending from second guide block 78 and towards receiving end 84 is a gusseted catch 80 which is generally configured as an angled plate welded at one end to bunking hardware plate 89 and extending to the length of bunking hardware plate at its terminus at receiving end 84 . gusseted catch 80 as best seen in fig9 c is bent at its top end along an acute angle away from a position normal to the plane containing bunking hardware plate 89 . through the use of an acute angle away from a normal position perpendicular to bunking hardware plate 89 , gusseted catch 80 serves to guide bunk base member 24 when the same is loaded into bunking hardware 72 along a direction 91 . in operation , portable bunks 14 and 15 are loaded into bunking hardware 72 along a direction 91 from both a distance away from receiving end 84 and above bunking hardware plate 89 such that it is preferable to use a gusseted catch 80 , in case the alignment of bunk base member 24 is slightly off from the mid - point of bunking hardware plate 89 . with continuing reference to fig9 b , first guide block 74 is disposed opposite second guide block 78 at a width substantially equal to the width of bunk base member 24 such that when bunk base member 24 sits between first guide block 74 and second guide block 78 it is substantially prevented from sliding laterally . as best seen in fig9 c and 9b , extending towards receiving end 84 at a level lower than the top of first guide block 74 , locking surface 76 is disposed in a horizontal plane . locking surface 76 includes a space 82 for receiving rotatable locking member 46 . receiving space 82 and locking surface 76 permit the passage therethrough of rotatable locking member 46 ( as seen in fig8 ). thus , locking surface 76 may securely hold portable bunk 14 at receiving end 84 of bunking hardware 72 through rotation of rotatable locking member 46 after portable bunk 14 has been loaded into bunking hardware 72 along direction 91 . extending from the horizontal plane in which locking surface 76 is disposed , and at a gradually decreasing downward angle , slide 81 is positioned . slide 81 has a width no greater than the width of receiving space 82 and preferably , slide 81 is tapered , as best seen in fig9 b . slide 81 serves to prevent the abrupt catch , or “ snag ” of rotatable locking member 46 when during operation , rotatable locking member may extend below bunk base member 24 if it has not been retracted up inside container lock housing 42 . with continuing reference to fig9 a and 9b , shoe assembly 86 is described in greater detail . shoe assembly 86 is disposed at the shoe end 90 of bunking hardware plate 89 and it is generally adapted to receive the toe end 52 of portable bunk 14 . shoe assembly 86 is comprised of a first gusseted guide member 92 and a second gusseted guide member 94 . first gusseted guide member 92 is generally constructed from a plate rectangular in construction and bent at an acute angle away from a position normal to toe end surface 102 . as best seen in fig9 b , both first gusseted guide member 92 and second gusseted guide member 94 are constructed to angle laterally away from one another such that distance 99 is greater than distance 101 . greater distance 99 permits guiding of the toe end 52 of portable bunk 14 as the same is loaded into bunking hardware 72 along direction 91 . with continuing reference to fig9 a and 9b , shoe assembly 86 includes locking pin 88 which is sized to be inserted into end hole 50 which is bored through toe end plate 54 . shoe assembly 86 further includes a latch 100 and locking pin handle 98 both of which are affixed to the outside of toe end surface 102 and adapted to rotate locking pin 88 into place . with reference now to fig1 , bunking hardware 72 and bunking station assembly 108 are described in greater detail . fig1 shows the bunking hardware 72 locked into bunking station assembly 108 . bunking station assemblies 108 are disposed generally at locations opposite one another on either the trailer bed 36 or the portable skid 21 . the bunking station assemblies 108 have a recessed area 107 which in this particular embodiment takes the form of a bored hole , sized to receive a hardware locking member 110 . locking member 110 can take the form of a pen that extends downward from the underside of the bunking hardware 72 adjacent the heel and toe ends . if the locking station assembly 108 is located on the portable skid 21 , the recessed area 107 could take the form of a hole through the sledding members 22 with a tube through which hardware locking member 110 could be slidably engaged and thereby locked with a first transverse locking pin 112 . with continuing reference to fig1 , first transverse locking pin 112 is connected securely to the bunking hardware stations through the use of a first retention chain 116 . as seen in fig1 , element 120 represents either the trailer bed 36 or the skid cross - member 26 , depending upon whether the bunking station assembly 108 is located on the portable skid 21 or the trailer 32 . in this particular embodiment , bunking hardware 72 is mounted above bunking station assemblies 108 and a space 105 is created by spacers 104 and 106 . spacers 104 and 106 are disposed beneath bunking hardware plate 89 and are physically connected to hardware locking members 110 providing a point of rest for bunking hardware 72 on the top of bunking station assembly 108 . spacers 104 and 106 can optionally be load cells for measuring gross weight . spacers 104 and 106 can vary in size to increase or alternatively decrease space 105 as desired . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention . | 1 |
fig1 illustrates the current detection head 70 of a first example . the reference symbol 22 denotes a fixing member , integrally molded using a resin ; a magneto - optical element 28 , lens 24 , the lower end of an incidence optical fiber 14 which guides light to the lens 24 , and the lower end of an emission optical fiber 16 which guides light from the lens 24 , are fixed to the fixing member 22 . further , mounting holes 30 and 32 are formed at prescribed positions in the fixing member 22 , and mounting holes 36 and 38 are also formed at prescribed positions in the conducting plate 34 . if a bolt 18 is passed through the mounting holes 30 and 36 and tightened with a nut 40 , and a bolt 20 is passed through the mounting holes 32 and 38 and lightened with a nut 42 , the fixing member 22 is fixed to the conducting plate 34 . using the mounting hole 30 of the fixing member 22 , the mounting hole 36 of the conducting plate 34 , and the bolt 18 , the position of the mounting hole 30 relative to the conducting plate 34 is fixed , and using the mounting hole 32 of the fixing member 22 , the mounting hole 38 of the conducting plate 34 and the bolt 20 , the position of the mounting hole 32 relative to the conducting plate 34 is fixed . because two places of the fixing member 22 are positioned relative to the conducting plate 34 , the position and direction of the fixing member 22 are positioned constantly relative to the conducting plate 34 . through use of the mounting holes 30 and 32 in the fixing member 22 and the mounting holes 36 and 38 in the conducting plate 34 , the relative positional relationship between the fixing member 22 and the conducting plate 34 is positioned in a constant position . the mounting holes 30 and 32 formed in the fixing member 22 and the flange portion in which the mounting holes 30 and 32 are formed serve as a fixing portion which fixes the fixing member 22 to the conducting plate 34 . because the lower end of the incidence optical fiber 14 , the lens 24 , the magneto - optical element 28 , the lower end of the emission optical fiber 16 , and the conducting plate 34 are all positioned and fixed by the fixing member 22 , the relative positional relations between all of the lower end of the incidence optical fiber 14 , the lens 24 , the magneto - optical element 28 , the lower end of the emission optical fiber 16 , and the conducting plate 34 are always adjusted to be constant and fixed . the base plate 6 is disposed in a position facing the conducting plate 34 . penetrating holes 8 and 10 are formed in the base plate 6 ; the upper end of the incidence optical fiber 14 is inserted into the penetrating hole 8 and fixed , and the upper end of the emission optical fiber 16 is inserted into the penetrating hole 10 and fixed . the reference symbol 12 denotes the fixing member which fixes the upper end of the incidence optical fiber 14 and the upper end of the emission optical fiber 16 , and is positioned on the base plate 6 . the light source 2 , which makes polarized light incident on the upper end of the incidence optical fiber 14 , is fixed at the upper portion of the penetrating hole 8 . the light - receiving device 4 , which receives polarized light emitted from the upper end of the emission optical fiber 16 , is fixed at the upper portion of the penetrating hole 10 . the light source 2 and light - receiving device 4 are fixed by the base plate 6 . details of the light source 2 are illustrated in fig3 . the light source 2 comprises a semiconductor laser 52 , a polarizing prism 54 and a lens 56 ; laser light polarized by the polarizing prism 54 is input to the incidence optical fiber 14 . the light - receiving device 4 comprises a lens 58 , beam splitter 60 , first photodiode 62 , second photodiode 64 , and op - amp 66 . the beam splitter 60 is provided with a function to divide light into two depending on the polarization direction , and the polarization plane of light incident on the first photodiode 62 and the polarization plane of light incident on the second photodiode 64 are orthogonal . the value of the difference in the intensity of light with the first plane of polarization and the intensity of light with the second plane of polarization , amplified by the op - amp 66 , changes corresponding to the rotation angle of the plane of polarization . in the structure of fig1 , the conducting plate 34 with the current detection head 70 fixed is mass - produced . optical fibers 14 and 16 extend from the current detection head 70 . the upper ends of these optical fibers 14 and 16 are fixed to the base plate 6 . the optical fiber 14 connects the light source 2 and magneto - optical element 28 , and the optical fiber 16 connects the magneto - optical element 28 and the light - receiving device 4 , to complete the current detection device . action of the current detection device of fig1 is explained . the semiconductor laser 52 emits laser light . this laser light passes through the polarizing prism 54 , and consequently only a light component polarized in a specific plane of polarization passes through the lens 56 and is incident on the optical fiber 14 . as illustrated in fig2 , the optical path of the polarized light reaching the lower end of the optical fiber 14 is changed to an oblique direction by the lens 24 , and the polarized light reaches the upper face of the magneto - optical element 28 . having reached the upper face of the magneto - optical element 28 , the polarized light is reflected by the upper face of the magneto - optical element 28 . the conducting plate of fig1 is long in the direction perpendicular to the plane of the paper , and current i flows in a direction perpendicular to the plane of the paper . fig1 corresponds to a cross - sectional view along line a - a in fig4 . hence the magnetic field h in the left - right direction in fig1 and fig2 acts on the magneto - optical element 28 . when polarized light is reflected by the upper face of the magneto - optical element 28 on which the magnetic field h is acting , a magnetic kerr effect ( in this case , the longitudinal kerr effect ) occurs . a crystal which exhibits the magnetic kerr effect is selected for the magneto - optical element 28 . because the magnetic kerr effect occurs , the plane of polarization of the polarized light reflected by the upper face of the magneto - optical element 28 rotates . that is , the plane of polarization of the incident light 46 is not the same as the plane of polarization of the reflected light 48 , and rotation occurs . light reflected by the upper face of the magneto - optical element 28 passes through the lens 24 , emission optical fiber 16 , lens 58 , and beam splitter 60 , and is incident on the first photodiode 62 and second photodiode 64 . the amplitude value of the difference in the intensity of light with a first polarization plane detected by the first photodiode 62 and the intensity of light with a second polarization plane ( orthogonal to the first polarization plane ) detected by the second photodiode 64 changes depending on the rotation angle of the polarization plane occurring due to the magnetic kerr effect . from the output of the op - amp 66 , the angle of rotation of the polarization plane occurring due to the magnetic kerr effect , the intensity of the magnetic field h acting on the magneto - optical element 28 which caused the rotation angle , and the magnitude of the current i which caused the magnetic field intensity , are detected . when mass - producing the conducting plate 34 with a current detection head 70 of fig1 to fig3 , in order to mass - produce the conducting plate 34 with a stabilized relation between detection value and current value , it is important that the relative positional relationships and the relative directional relationships between members contributing to current detection be adjusted and fixed in constant relations . as illustrated in fig4 , the intensity of the magnetic field h metalling when a current i is flowing in the conducting plate 34 changes with the position relative to the conducting plate 34 . hence the relative positional relationship between the conducting plate 34 and the magneto - optical element 28 is important . the magneto - optical element 28 is provided with an easy magnetization axis j . the angle of rotation of the polarization plane occurring due to the magnetic kerr effect is also affected by the angle θ 1 made by the easy magnetization axis i and the magnetic field h . hence the angle θ 1 made by the easy magnetization axis i of the magneto - optical element 28 and the conducting plate 34 is also important . the angle of rotation of the polarization plane occurring due to the magnetic kerr effect is also affected by the angles made by the easy magnetization axis j and the incident light 46 ( the horizontal - direction angle θ 2 and the perpendicular - direction angle θ 3 ). the relative positional relationships between the optical fiber 14 , the lens 24 , the magneto - optical element 28 , and the optical fiber 16 are important . in the current detection device of fig1 to fig3 , the optical fiber 14 , lens 24 , magneto - optical element 28 , optical fiber 16 , and conducting plate 34 are respectively fixed to the fixing member 22 , so that the relative positional relationships and relative directional relationships of the optical fiber 14 , lens 24 , magneto - optical element 28 , optical fiber 16 , and conducting plate 34 are adjusted in constant relationships and fixed . in this example , all of the members 14 , 24 , 28 , 16 and 34 contributing to current detection are fixed to the fixing member 22 , so that the relative positional relationships and relative directional relationships ( angular relationships ) of all of the members 14 , 24 , 28 , 16 and 34 contributing to current detection are adjusted in constant relationships and fixed . by using the current detection device of fig1 to fig3 , conducting plates 34 with current detection heads 70 with a stabilized relation between detection value and current value can be mass - produced . further , using the base plate 6 the relative positional relationships and relative angular relationships between the upper end of the optical fiber 14 , the semiconductor laser 52 , the polarizing prism 54 , and the lens 56 are adjusted in constant relationships and fixed . moreover , using the base plate 6 , the relative positional relationships and relative angular relationships of the upper end of the optical fiber 16 , lens 58 , beam splitter 60 , first photodiode 62 , and second photodiode 64 are adjusted in constant relationships and fixed . these elements also contribute to mass production of conducting plates 34 with current detection devices in which the relation between detection value and current value is stabilized . the fixing member 22 may be formed as a single physical object , as illustrated in fig1 , or may be formed using two physical objects , as illustrated in fig5 . in the case of fig5 , an example is illustrated in which the optical fibers 14 and 16 are fixed to a first fixing member 22 a , and the lens 24 and magneto - optical element 28 are fixed to a second fixing member 22 f . a pair of concavities 22 b and 22 e is formed in the first fixing member 22 a , and a pair of engaging claws 22 d and 22 e is formed on the second fixing member 22 f when the first fixing member 22 a and the second fixing member 22 f are combined , in a state in which the engaging claw 22 d meshes with the concavity 22 b and the engaging claw 22 e meshes with the concavity 22 c , the first fixing member 22 a and second fixing member 22 f are fixed . in this state , the relative positional relationship of the first fixing member 22 a and second fixing member 22 f is adjusted in a constant relationship and fixed . upon combining the first fixing member 22 b and second fixing member 221 , the relative positional relationship of the first fixing member 22 a and second fixing member 22 f is stabilized , and the relative positional relationships and relative angular relationships of the lower end of the optical fiber 14 , lens 24 , magneto - optical element 28 , and lower end of the optical fiber 16 are adjusted in constant relationships and fixed . on the second fixing member 22 f are formed a flange 22 g for positioning and fixing to the conducting plate 34 , and mounting holes 30 and 32 . the flange 22 g and mounting holes 30 and 32 formed on the second fixing member 22 f serve as a fixing portion to fix the second fixing member 22 f to the conducting plate 34 . if a bolt 18 is passed through the mounting hole 30 and the mounting hole 36 and is tightened with a nut 40 , and a bolt 20 is passed through the mounting hole 32 and the mounting hole 38 and is tightened with a nut 42 , then the relative positional relationships and relative angular relationships of the lower end of the optical fiber 14 , the lens 24 , the magneto - optical element 28 , the lower end of the optical fiber 16 , and the conducting plate 34 are adjusted in constant relationships and fixed . in this example , a concavity 34 a is formed in the conducting plate 34 , and the magneto - optical element 28 is accommodated within the range of the thickness of the conducting plate 34 . the intensity of the magnetic field acting on the magneto - optical element 28 is increased , and the current detection sensitivity is increased . as illustrated in the examples of fig1 and fig5 , the shape of the lens 24 is selected according to the characteristics . fig6 indicates the range of variation in the relation between detection values ( the values of the op - amp 66 ) and true current values when the conducting plate 34 to which the current detection head 72 of fig5 is fixed is mass - produced . the range of variation is small . fig7 indicates the range of variation in the relation between detection values and current values when conducting plates with current detection heads are mass - produced using a method in which a magneto - optical element is fixed to a conducting plate , a lens is positioned relative to the magnetic - optical element , and an optical fiber is positioned relative to the lens . the range of variation is large . when conducting plates with current detection heads are mass - produced using techniques of the prior art , the relation between detection values and current values varies widely among mass - produced items . fig8 illustrates a third example . optical fibers 14 and 16 and a lens 24 are fixed to a first fixing member 22 j , and a magneto - optical element 28 is fixed to a second fixing member 22 o . the lens 24 may be fixed to the first fixing member 22 j as illustrated in fig8 , or may be fixed to a second fixing member 22 f as illustrated in fig5 . fig9 illustrates an example in which a conducting plate 34 , magneto - optical element 28 , lens 24 , and lower end of an optical fiber 15 are insert - molded using a resin material and manufactured . the relative positional relationships of all of the conducting plate 34 , magneto - optical element 28 , lens 24 , and lower end of the optical fiber 15 are fixed in a state of adjustment to be constant by a fixing member 22 r . the conducting plate 34 can be mass - produced with a stabilized relationship between detection values and current values . an opening 34 b is formed in the conducting plate 34 , and there is no separation of the fixing member 22 r from the conducting plate 34 . in the case of fig9 , a core ( first core ) 14 a which guides light toward the magneto - optical element 28 , and a core ( second core ) 16 a which guides light reflected by the magneto - optical element 28 , are accommodated within a single optical fiber 15 . because only a single optical fiber 15 is used , connection tasks and similar are simplified . fig1 illustrates an example in which a fixing member 22 s , magneto - optical element 28 , lens 24 , lower end of an optical fiber 14 , and lower end of an optical fiber 16 are insert - molded using a resin material on one face of the conducting plate 34 and manufactured . if grooves 34 c and 34 d extending diagonally are formed in the conducting plate 34 , there is no separation of the fixing member 22 s from the conducting plate 34 . fig1 illustrates an example in which a fixing member 22 t , manufactured by insert - molding a magneto - optical element 28 , lens 24 , lower end of an optical fiber 14 , and lower end of an optical fiber 16 are insert - molded , is fixed to a conducting plate 34 and manufactured . in this example , the diameter of a hole 34 e formed in advance in the conducting plate 34 and the diameter of a cylindrical portion provided in advance in the lower face of the fixing member 22 t are managed in a relationship such that the two fit closely . by inserting the cylindrical portion of the fixing member 22 t into the hole 34 e of the conducting plate 34 , the position of the fixing member 22 t relative to the conducting plate 34 can be accurately positioned . further , screws 18 a and 20 a are used to accurately adjust to a constant angle the mounting angle of the fixing member 22 t relative to the conducting plate 34 . in the above , specific examples of the invention have been explained in detail ; but the above are merely exemplifications , and do not limit the scope of claims . the technique disclosed in the scope of claims includes various modifications and alterations of the above - presented specific examples . the technical elements explained in the specification or drawings exhibit technical utility whether independently or in various combinations , and are not limited to combinations disclosed in the claims at the time of filing . further , techniques exemplified in the specification or the drawings can attain a plurality of objects simultaneously , and technical utility is attained by the attainment itself of one among these objects . | 6 |
fig4 shows the front portion of the section of intake lip 50 at the keel position of a nacelle on a longitudinal cross - section containing the engine axis . the intake lip 50 has inner 50 a and outer 50 b surfaces , which meet at a highlight h at the front of the nacelle . the highlight h lies in a curved highlight surface s which , in fig4 , is viewed edge - on . in fig4 , the highlight surface s is curved in the vertical direction of the page and is uncurved in the direction perpendicular to the page , i . e . it is curved in only one principle direction . however , in other examples , the highlight surface s may simply be planar . the inner 50 a and outer 50 b surfaces are tangency matched at the highlight h , and indeed are tangential to the highlight surface s at the highlight h . the inner 50 a and outer 50 b surfaces also have their maximum curvatures at the highlight h . however , these curvatures are different for the inner 50 a and outer 50 b surfaces , whereby there is a discontinuity in curvature across the highlight . the intake lip axis a lying in the plane of the drawing of fig4 extends from the highlight h parallel to the engine axis , or to the intake droop axis in the case of a drooped intake . the intake lip shown in fig4 represents a geometry for the nacelle , resulting , for example , from an initial nacelle design procedure . a next step in the design procedure is to pivot , in the plane of the respective longitudinal section , the front portion of the intake lip about the highlight h in a direction which rotates axis a either towards the engine axis (+ θ , dot - dashed lines ) or away from the engine axis (− θ , dotted lines ), as shown in fig5 , and in more detail in fig6 , which is a close - up view of the forwardmost part of the rotated intake lip . the tangent t to the highlight surface s at the highlight h is indicated with a dashed line in fig6 . of course , if the highlight surface s is planar , the tangent t to the highlight surface s will be coincident with that surface . because the inner 50 a and outer 50 b surfaces of the intake lip 50 are tangential to the highlight surface s at the highlight h in the initial geometry of fig4 , the + θ rotation has the effect of causing the inner surface 50 a to cross the tangent t inwards of axis a , whereas the − θ rotation has the effect of causing the outer surface 50 b to cross the tangent t outwards of axis a . having rotated the part of the front portion of the intake lip at the keel position , the next step in the design procedure is to adjust the surfaces of neighbouring parts of the intake to smoothly blend the surfaces of the rotated front keel part with the surfaces of unadjusted parts of the intake further removed from the rotated part . this blending can be performed by methods known to the skilled person . if the intake lip is rotated at just one position , such as the keel section discussed above , the adjustment procedure effectively results in an altered nacelle geometry in which the angle of rotation of the intake lip reduces around the highlight from a maximum amount at that section down to zero at a circumferential distance from the section , those parts of the intake lip having some rotation defining a transitional sector . thus , for example , lip rotation can be by an appropriate angle ± θ at a specific circumferential location to locally address a specific aerodynamic performance issue ( e . g . high incidence at the keel , or crosswind at the sidelines ), with θ smoothly transitioning to zero away from that circumferential location . the extent of the transition can be varied and the variation of θ within the transitional sector can be linear or controlled by an appropriate non - linear expression as a function of circumferential location . however , more complicated adjustments can be effected . for example , lip rotation can be by an appropriate angle ± θ at a specific circumferential location to locally address a specific aerodynamic performance issue , with θ smoothly transitioning to a different ± θ elsewhere on the intake , itself transitioning to another ± θ at yet another part of the intake and so on , such that the θ variation is determined by respective rotations on multiple control sections . the variation of θ within each transitional sector can be linear or controlled by an appropriate non - linear expression as a function of circumferential location . the external frontal area of the nacelle may be altered as a result of the altered geometry . in the case of a − θ rotation the pivoting results in a shift of the local throat forwards , whereas in the case of a + θ rotation the pivoting results in a shift of the local throat rearwards . in general , care should be taken to ensure that the throat area does not become too small as a result of rotations . typical rotation angles are between 1 ° and 2 . 5 °. however , even small rotations , for example around 0 . 25 ° or even 0 . 1 °, can have significant aerodynamic impacts . some situations may call for rotation angles of up to about 5 °. pivoting the intake lip at specific positions around the highlight allows intake lip profiles to be de - coupled and individually optimised to locally address specific aerodynamic performance issues . for example : higher angles of attack can be produced by rotating lip sections in the lower half of the intake towards the engine axis (+ θ ). for a negatively scarfed intake , more aggressive diffusion can be generated at the keel without dropping the intake bottom line by rotating the keel intake lip towards the engine axis (+ θ ). the larger diffuser angles further rearward in the duct which can then be produced can provide benefits in terms of reduced diffuser length , increased nacelle ground clearance and reduced fan face pressure distortion . for a positively scarfed intake , less diffusion at the keel may be beneficial and can be generated by rotating the keel intake lip away from the engine axis (− θ ). enhanced crosswind capabilities can be obtained by rotating the sideline lips towards the engine axis (+ θ ). elimination or reduction of shock buzz noise during ground static operation can be obtained by rotating the crown lip axis to better align the intake lip with the bulk flow . external drag benefits may also be produced due to resulting changes in the shape of the external nacelle top surface . the rotation at the crown can be towards (+ θ ) or away from (− θ ) the engine axis , depending on local flow conditions . more generally , locally pivoting the intake lip can also provide the following benefits : lip profiles , throat area and local throat positions can be redistributed without changing the highlight shape . the greater control over lip geometry enables nacelle designs in which asymmetries in the flow entering the intake duct are minimised , resulting in noise benefits due to reduced flow asymmetry around the intake lip and / or benefits associated with reduced fan forcing or fan face pressure distribution further downstream . intake lip rotation can enhance the design of negatively scarfed intakes , such that duct flow asymmetry downstream of the lip is reduced while tolerance to off - design external flows is maintained . while the invention has been described in conjunction with the exemplary embodiments described above , many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure . for example , although the procedures of pivoting a part of the front of the intake lip and then adjusting neighbouring surfaces are described above in relation to a nacelle having a highlight surface which is a plane or is curved in only one principle direction and having inner and outer surfaces which are tangential to the highlight surface at the highlight , they may also be applied to nacelles having highlights which do not lie in such highlight surfaces , and / or having inner and outer surfaces which are not tangential to the highlight surface at the highlight . for example , a nacelle which has undergone the pivoting and adjusting procedures will have inner and outer surfaces which are not tangential to the highlight surface at the highlight . however , the procedures can nonetheless be reapplied to this nacelle . accordingly , the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting . various changes to the described embodiments may be made without departing from the spirit and scope of the invention . | 8 |
referring now to fig1 , a prior - art system is depicted , which uses two lenses and sensors to span the desired range of ambient illumination . daylight operation is accomplished using daylight lens 2 and color image sensor 4 . nighttime scenes are captured by lens 6 and image sensor 8 , which is a monochrome area sensor optimized for high sensitivity . typically , the overall ambient illumination is detected by , as an example , a photodiode 3 . the resulting signal is buffered by buffer 9 , compared with a reference value by comparator 5 , and used to drive a video source selection relay 7 . the disadvantages of such a typical system are readily apparent . the overall size , weight and cost are dramatically increased by the inclusion of the additional lens . an enhanced system , subject of the present invention , is depicted in fig2 . a single lens 10 is used to direct a desired scene onto the sensor optics , consisting of beamsplitting mirror 12 , sensitive monochrome sensor 16 and color sensor 14 . the relative positions of the respective sensors 14 and 16 may be exchanged , if necessary , without departing from the spirit and scope of the invention . the beamsplitting mirror 12 is partially reflective , in some proportion designed to optimize the desired optical behavior . for example , if absolute nighttime sensitivity is the highest goal of the design , then the beamsplitter may be 5 percent reflective and 95 percent transmissive , so as to maximize the amount of optical flux that reaches the nighttime sensor . the appropriate sensor output is selected by switch 18 . note that switch 18 could be automated as sensor output signal 22 is optionally displayed on viewfinder 20 . in fig3 , the basic system of fig2 is enhanced with a driven iris , which serves to limit the amount of incident light that arrives at the monochrome sensor 16 or , indeed , at the color sensor 14 . the overall output video signal 22 is sampled by diode 72 , filtered by capacitor 68 , given a time constant via resistor 70 , and applied to iris driver 66 . the iris driver , in turn , drives the iris actuator 64 and the iris 60 , so as to limit the output signal 22 if it increases to some predetermined level . this serves to limit and stabilize the amount of light incident on the sensors 14 and 16 . fig4 depicts the basic system of fig2 , as supplemented by the inclusion of an image intensifier 24 . since the image on the rear surface of the image intensifier is a simple planar image , a relay lens system 26 may be necessary to transfer the image from the rear surface of the intensifier 24 to the monochrome sensor 16 . other techniques may also be employed to transfer the image , such as the fusion of fiber optic bundles between the intensifier and imager , or direct bonding of the intensifier to the imager . fig5 depicts an enhancement to the system of fig4 . in fig5 , a second iris 80 is added , immediately in front of the monochrome sensor 16 . this second iris is used to limit the amount of illumination reaching the sensitive monochrome sensor 16 , preventing it from suffering from saturation when the intensifier output image is bright . the output signal from the monochrome sensor 16 is sampled by diode 90 , filtered by capacitor 86 , given a time constant by resistor 88 , buffered by buffer 84 , and drives the iris 80 via actuator 82 . this effectively stabilizes and limits the output signal from the monochrome sensor 16 . this approach frees the first iris 60 to control the overall output from the system , as depicted earlier in fig3 . fig6 depicts a multiple - imager version of the system . multiple digital imagers 100 , 102 , and 104 , share a common address bus 108 and data bus 106 . a camera selection signal 110 is applied to multiplexer 112 , which thereupon selects one of the sensors via enable lines 114 , 116 , and 118 . this method allows the selection of a desired camera . the individual cameras 100 , 102 , and 104 may share a common optical path , as in previous examples which use a two - way beamsplitting mirror . the individual cameras 100 , 102 , and 104 may seperately optimized for different purposes , such as day vs . night , 1 × zoom vs . 2 × zoom , etc . fig7 depicts an enhancement to the basic system of fig2 , wherein the analog sensors are replaced with high - resolution digital sensors 14 ( color ) and 16 ( monochrome ). as before , a image sensors 14 and 16 . images captured by these digital sensors are transferred to a suitable signal processor 30 with associated program / data memory 32 . the processor 30 , among other tasks , controls the scanning of the selected image sensor 14 or 16 , and produces a corresponding output signal 22 in a desired signal format , such as ntsc , pal , or a digital format such as d - 1 . a pair of orthogonal gyroscopic accelerometers 34 and 36 is disposed in a plane parallel to the image plane of the monochrome sensor 16 . angular accelerations detected by sensors 34 and 36 are twice - integrated by processor 30 , to derive a knowledge of the instantaneous angular position of the device . this information is then used to temporally offset the image sensor scanning signals produced by the processor 30 , effectively stabilizing the image position . alternatively , the instantaneous position information previously described may be used to variably offset the read addresses driven to the imager or it &# 39 ; s bugger , again effectively stabilizing the image . a variety of user input pushbuttons 38 are provided to allow user control of various camera parameters , for instance brightness , stabilization on / off , day / night mode , power on / off , etc . an additional benefit of the dual - digital - sensor system of fig7 is the ability to scan the imager in reverse - pixel or reverse - line order . this ability overcomes the optical problem imposed by the inclusion of the mirror ; images that have been reversed vertically or horizontally by the mirror may be “ re - reversed ” electronically . an additional benefit of the dual - digital - sensor system of fig7 is the ability to ‘ fuse ’ the two images . the monochrome sensor 16 is used to provide scene luminance information , while the color sensor 14 is used to provide chrominance information . note that , since luminance information is provided by camera 16 , it is possible to use non - traditional color filters on color sensor 14 to increase its resolution and sensitivity . for example , a simple crcb filter could be used on color sensor 14 , with no pixels wasted for detecting luminance . this effectively increases the color resolution by one - third . the processor 30 may be used to scale and merge the two information streams into one signal . this method is not possible in prior - art systems , which used movable mirrors . fig8 depicts an enhancement to the digital system of fig7 , wherein the dual - iris arrangement of fig5 is used to optimize the dynamic range of the system . as before , incident light reaching monochrome sensor 16 is controlled by iris 80 , as driven by actuator 82 under processor control . this effectively prevents the sensitive monochrome imager from suffering saturation or overload . the intensifier 24 is protected by iris 60 , driven by actuator 64 , also under processor control . this iris serves to protect the intensifier device from excessive illumination . the dynamic range of both imagers may also be improved by the inclusion of automatic gain control , used in conjunction with the irises . without moving optical parts and without reduction of image resolution . while the example in fig9 depicts a pair of digital imagers , analog imagers could be used to the same effect . a lens captures a desired scene and passes it to an optional image intensifier 24 . the image thereupon passes to a beamsplitting mirror 12 , thence to a pair of imagers 140 and 146 via relay lenses 142 and 144 respectively . the relay lenses are selected to have differing magnification ratios . in the example shown , relay lens 142 exhibits a magnification of 1 : 1 , while relay lens 144 exhibits a magnification of 2 : 1 . imager 140 or imager 146 may be selected via cam select signal 152 and inverter 148 . this effectively allows selection of a desired image , or selection of the same image with different magnification . as an example , lens 140 and imager 142 may render a scene 154 , of some given angular field of view . when lens 144 and imager 146 are selected , a smaller field of view 156 is rendered , but at the same resolution as the previous , larger image . fig1 depicts a preferred embodiment a handheld version of the device . a housing 46 10 contains a lens 10 , user controls 38 , eyepiece 42 , battery compartment access panel 46 , and carrying strap 44 . while certain features and embodiments of the invention have been described in detail herein it should be understood that the invention includes all improvements , modifications | 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.