text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the present invention provides a height and azimuth adjustable container set , utilized for all the purposes embedded containers are utilized , i . e ., to serve as bases for lighting fixtures , as transformer housings , and as junction boxes , but with a major difference from conventional embedded containers . the adjustable container sets of the present invention also are utilized for the precise and simplified , economic mounting and adjusting of the height of the lighting fixture to be mounted upon it . also , the adjustable containers of the present invention provide for precise and simplified , economic aligning of the azimuth of the lighting fixtures and aligning the lights with respect to each other , by virtue of the azimuth alignment . the adjustable container set of the present invention is used to improve existing containers , while being efficiently and economically adjustable . these containers are installed in airport runways , taxiways , and other aircraft ground traffic areas to serve as bases for lighting fixtures , transformer housings , and junction boxes . the adjustments take place when the containers and their lighting fixtures are installed initially , e . g ., when new runway , taxiway , and other aircraft ground traffic areas are first built and every time they are repaved . the present invention provides a height and azimuth alignments adjustments assembly utilized for the more economic , precise , and simplified adjusting of the heights of concrete embedded containers and the azimuth alignment of airport inset lighting fixtures mounted thereon . these containers of the present invention are installed and reused in airport runways and taxiways and other aircraft ground traffic areas to serve as bases for lighting fixtures , transformer housings , and as junction boxes . in the actual testings and installations of the alignments adjustments assembly disclosed and described in u . s . patent application ser . no . 08 / 002 , 014 filed jan . 8 , 1993 and entitled “ alignments adjustments assembly apparatus and method ,” now u . s . pat . no . 5 , 541 , 362 , i have discovered certain aspects which could be modified . one drawback is that airport runway light bolts used to install the airport runway light on or in the airport runway light support can be part of a corrosion problem . corrosive materials such as deicing chemicals used on the aircraft can accelerate corrosive problems between the light bolts and the light support . the airport runway light stainless steel bolts can accelerate corrosive attack by a galvanic action between dissimilar metals . the present invention provides an alignment adjustments assembly which corrects the problem of corrosion . one drawback is that a great number of the existing conventional , fixed - length extensions installed as stacked - on embedded containers have tilted from their vertical axis . this tilting , which at the place of tilting is relatively small , nevertheless increases the angle at which the light beam from an inset lighting fixture is projected , thereby diverting the light beam away from incoming airplanes . at one - half mile ( 1 kilometer ) away from the approach area , it is difficult for the pilot of a landing airplane to see the light because of the very large divergence at that point from the point at which it should otherwise be , when properly height - adjusted . the present invention provides an alignment adjustments assembly which corrects the problem of tilting . another drawback encountered is that the new larger and heavier airplanes , now becoming more common , exert a larger torsional force upon the inset lighting fixtures . tests made to simulate those larger torsional forces on the alignment adjustment assembly disclosed and described in u . s . patent application ser . no . filed jan . 8 , 1993 and entitled “ alignments adjustments assembly apparatus and method ,” now u . s . pat . no . 5 , 541 , 362 , proved that a very slight rotational movement occurs , even though considered relatively insignificant today . nevertheless , even heavier airplanes could provide a more significant rotational movement that would alter the azimuth alignment of the lighting fixture , which in turn would impede the pilot of an incoming airplane from seeing the light . the present invention provides an alignments adjustments assembly which corrects the problem of the rotation of the assembly . yet another drawback encountered is the need to install a separate component called the mud dam , consisting of a flat , three - quarters inch ( 19 mm ) thick spacer ring with a flat , thin steel band welded all around the periphery of the flat spacer ring . this band is about one and a quarter inches ( 3 . 3 cm ) wide . the present invention provides an alignment adjustments assembly that does not require the installation of a separate mud dam . a further drawback encountered is that there are two types of inset light construction with respect to its bottom side . the bottom on one type is short and flat . the bottom on the other is longer and at an angle with respect to the light base vertical axis . the longer , angled bottom does not allow the light to fit properly on the top flange of the apparatus as disclosed and described in u . s . patent application ser . no . 08 / 002 , 014 filed jan . 8 , 1993 and entitled “ alignments adjustments assembly apparatus and method ,” now u . s . pat . no . 5 , 541 , 362 . the present invention provides an alignments adjustments assembly which will allow the longer , angled bottom type inset lights to be installed upon it . yet a further drawback encountered is that , in a great many occasions , an “ o ” ring seal is specified . in such cases , a separate flat , three - quarters inch ( 19 mm ) thick spacer ring , with a groove on its top flat side , is installed between the fixed - length extension and the lighting fixture . the present invention provides an alignment adjustments assembly which does not require installing a separate flat spacer ring with a groove on its top flat side . the invention includes an existing embedded container with an inverted flange on one end onto which an adapter flange bolts . the adapter flange has acme threads in its center aperture . the apparatus and method of the present invention also include an outside acme threaded adjustable extension , which threads down into the adapter flange , to provide the precise height required and the precise alignment of its lighting fixture . the adjustable height extension has a top flange to provide a base upon which the specified lighting fixture can be bolted . the present invention provides height and azimuth light support sets utilized for the more efficient and economic , precise , and simplified adjusting of the heights of exiting art embedded containers and the alignment of their light fixtures . these containers are installed in airport runways and taxiways to serve as bases for lighting fixtures , as transformer housings , and as junction boxes . referring now to fig1 and 2 , a container 1 is represented schematically with three fixed - length extensions 2 , 7 , and 11 bolted together . container 1 is embedded in concrete 25 at the time an airport runway , taxiway , and other aircraft ground traffic areas ( hereinafter aircraft ground traffic areas ) are first built . these ground traffic areas generally are built upon a compacted granular sub - base 26 . steel containers 1 , in addition to serving as bases for mounting airport inset lighting fixtures 95 also serve as transformer housings and junction boxes to bring electrical power to lighting fixture 95 , as shown in fig1 , and 7 . fixed - length extension 2 is bolted to top flange 30 on container 1 , which has 12 threaded bolt holes 136 , as shown in fig1 , by means of its bottom flange 4 and bolts 3 . fixed - length extension 2 is bolted to bottom flange 6 of fixed - length extension 7 by means of its top flange 5 and bolts 8 . fixed - length extension 7 is bolted on top of fixed - length extension 2 . fixed - length extensions have twelve bolt holes in both of their flanges , i . e ., top flange 5 and bottom flange 4 of extension 2 , as shown in fig1 . the bolt holes , not shown , on the top flanges of the extensions are threaded , while the bolt holes , not shown , on the bottom flange are not threaded . nevertheless , the bolt holes in both flanges of the fixed - length extensions are on a bolt hole circle diameter identical to bolt circle diameter 137 , as shown in fig1 , of container 1 . fixed - length extension 7 is bolted to bottom flange 10 of fixed - length extension 11 by means of its top flange 9 and bolts 12 . fixed - length extension 11 is bolted on top of fixed - length extension 7 . fixed - length extensions provide only a gross height adjustment . one or a plurality of flat spacer rings 15 are required for providing the more precise final height adjustment . flat spacer rings 15 are installed on top flange 13 of fixed - length extension 11 , as shown in fig1 , i . e ., the top fixed - length extension , to provide the final height adjustment 17 for inset lighting fixture 95 . flat spacer rings 15 can be one or more . they are fabricated as thin as 1 / 16 inch ( 1 . 6 mm ) and as thick as three - quarters inch ( 19 mm ) or thicker . mud dam 36 , as shown in fig1 and 10 , comes next on top of spacer rings 15 . the inset lighting fixture 95 is bolted together with flat spacer rings 15 and mud dam 36 onto the top flange 13 of the top fixed - length extension 11 by means of bolts 14 . continuing to refer to fig1 and 2 , several layers of pavement 19 , 20 , 21 are shown , to exemplify the fact that fixed - length extensions 2 , 7 , and 11 are utilized for height adjustments every time an aircraft ground traffic area is first built or upgraded by the installation of new pavement , i . e ., each new layer of pavement 19 , 20 , and 21 . the new layers create new surfaces 22 , 23 , and 24 and therefore new heights . these airport aircraft ground traffic area upgrades create the need for heights adjusting devices , with flanges identical to those of the embedded container 1 , in order to adapt the container 1 to the new surface , i . e ., the new height and further in order for the lighting fixture 95 to be installed slightly above the new pavement surface , i . e ., surface 22 , 23 , or 24 , at a close tolerance 17 above new pavement surface 24 , for example . in order to seal pavement layers 19 , 20 , 21 around container 1 , grout 18 is utilized . pavement rings 36 , commonly known in the industry as mud dam 36 , as shown in fig1 and 10 , are installed on top of spacer rings 15 to protect lighting fixture 95 from being splashed by the grout 18 at the time of its application . inset lighting fixture 95 is set inside mud dam protection ring 36 , as shown in fig1 . mud dam 36 consists of a flat ring 38 , as shown in fig1 , generally of ¾ inch ( 19 mm ) in thickness , with a 1 to 1¼ inch ( 2 . 54 to 3 . 27 cm ) wide , flat , thin steel band welded around the periphery of flat ring 38 . flat ring 38 has bolt holes 39 which match bolt holes , not shown , on flat spacer rings 15 , on fixed - length extension 11 as well as on lighting fixture 95 . bolt holes on fixed - length extension 11 are threaded . lighting fixture 95 is bolted onto fixed - length extension 11 , together with mud dam 36 and flat spacer rings 15 by means of bolts 14 . mud dams 36 are generally provided with grooves 43 in order to accept “ o ”- ring gasket 44 . when any one layer of pavement is first placed , it is done by placing it over the entire surface , i . e ., surface 31 . then the pavement 19 is core - drilled at the location of each container 1 to remove the pavement at that location to install fixed - length extension 2 , any flat spacer ring 15 , mud dam 36 , and finally lighting fixture 95 at the new height created by pavement 19 and surface 22 , by way of example . this process is repeated every time a new layer of pavement is added , i . e ., for further layers 20 and 21 . the core drilled hole is larger in diameter than the diameter of container 1 , hence the requirement to utilize grout 18 to fill in the void and therefore the need to install a mud dam 36 , as shown in fig1 , to protect lighting fixture 95 , as shown in fig1 when grout 18 is poured . a new method has been used for a few years already , whenever an aircraft ground traffic area reconstruction takes place , i . e ., resurfacing or repaving . instead of adding a new layer of pavement on top of the last one installed , the last one layer , i . e ., pavement layer 21 , is milled down by large roto - milling machines . this method is extensively explained in my u . s . pat . no . 5 , 431 , 510 entitled “ overlay protection plate apparatus and method .” prior to roto - milling the pavement top layer , i . e ., layer 21 , the lighting fixtures , any spacer rings , the mud ring , and the top , existing fixed - length extensions have to be removed . an overlay protection plate , not shown , is bolted to top flange 30 , on container 1 , to prevent debris from falling into container 1 . after roto - milling , a new layer of pavement is installed , and the new pavement is core - drilled at the location of each container 1 to replace the items removed back to their original position . core drilling at each embedded container location is done to provide access for reinstalling the items previously removed . nevertheless , in a great percentage of the cases , i . e ., at each of the individual container locations , differences of height occur , creating the need for the installation of additional flat spacer rings 15 on top of the ones removed and being reinstalled . referring to fig1 and 2 , lighting fixture 95 is installed at a close tolerance 17 slightly above pavement surface 24 . the optical system , not shown , inside the lighting fixture , projects its light beam 32 through lens 107 in window 108 of lighting fixture 95 at a precise angle 34 from surface 24 to allow a pilot landing aircraft 51 , as shown in fig3 , see light beam 32 , from a distance of about one - half mile ( 1 kilometer ), when landing at night or under other low visibility conditions . lighting fixtures 95 are also known as centerline lights because they are installed on the embedded containers in the center of the aircraft ground traffic areas , i . e ., runways , taxiways , and others . the continuous landing of aircraft , day and night , year after year , on top of these lighting fixtures can provide a slight tilting 41 , as shown in fig2 , of the lighting fixture and fixed - length extension 11 , as represented by 41 ( not to scale ), as shown in fig2 , for the purpose of making this explanation more clearly understood . this tilting 41 will alter the installed height tolerance 17 , as shown in fig1 , which now would be larger as represented by 42 in fig2 . the maximum installed height tolerance 17 is 1 / 16 inch ( 1 . 6 mm ), per f . a . a . ( u . s . federal aviation administration ) specifications . tilting 41 is shown as a separation of flange 10 of fixed - length extension 11 from flange 9 of fixed - length extension 7 . even the slightest tilting of lighting fixture 95 and the associated extension produces an angular deviation , angle 35 , as shown in fig2 and 3 , which is larger than the precise angle 34 obtained by a combination of the precise height adjustment of lighting fixture 95 and the angle at which light beam 32 is emitted from lighting fixture 95 , through its lenses 107 , in windows 108 , as shown in fig1 and 2 . this lighting fixture emitted light beam angle is set at the factory and is precisely established by f . a . a . regulations . an increased angle 35 would project emitted light beam 33 away from a line of sight from the pilot when landing aircraft 51 , as shown in fig3 , as it descends for landing . as a result , the pilot of aircraft 51 would not be able to see light beam 33 when landing at night or during poor visibility conditions . an increase in the height adjustment 17 of lighting fixture 95 would have the same effect , i . e ., the light beam would not be visible to the pilot at landing . in addition , an increased installed height creates the danger of the lighting fixture being plowed - off , during winter time , when snow is regularly plowed off airport ground traffic areas . this creates the danger of lighting fixtures , bolts , rings , and other components , being thrown onto these traffic areas , with the resulting danger to landing aircraft . conventionally , tilting is field - corrected by installing a thick tapered spacer ring , not shown . these tapered rings are custom made , per field measurement , and they are installed after first removing some of the existing flat spacer rings 15 , to correct angular deviation 35 of light beam 33 to the correct angular adjustment 34 of the light beam . tilting of the fixed - length extension is corrected , when the apparatus and methods of the present invention are utilized , because fixed - length extensions , bolted one on top of the other are no longer required . referring to fig7 , and 9 , lighting fixtures today are manufactured with two different types of bottom portions . fig7 shows lighting fixture 95 with six non - threaded , counter sunk bolt holes 109 drilled through mounting flange 106 . bolt holes 109 are set apart at an angle 115 of 60 degrees one from another , in bolt circle 114 . lighting fixture 95 is provided with optical lenses 107 in countersunk windows 108 and with a flat , short , straight down bottom portion 100 . electrical wires 111 and connector 112 are provided for bringing electrical power to lighting fixture 95 from an isolation transformer , not shown , in conventional container 1 , as shown in fig1 and 2 . lighting fixture 105 of fig8 has six non - threaded , countersunk bolt holes 109 drilled through mounting flange 106 . bolt holes 109 are set apart at an angle 115 of 60 degrees one from another , in bolt circle 114 . lighting fixture 105 is provided with optical lenses 107 in countersunk windows 108 and with a long , angled bottom 110 , hence the novel angled 66 opening 67 of adjustable extension 55 , as shown in fig4 . angled 66 opening 67 allows lighting fixture 105 to be installed on flange 62 of the extension , in addition to allowing also the installation of lighting fixture 95 , as shown in fig7 . continuing to refer to fig8 , lighting fixture 105 is also provided with wires 111 and connector 112 for bringing electrical power to lighting fixture 105 from conventional embedded container 1 , as shown in fig1 and 2 . azimuth orientation arrows 113 are engraved on mounting flange 106 in the countersunk windows 108 area . arrows 113 are also engraved in countersunk windows 108 of lighting fixture 95 . the difference between lighting fixture 95 and lighting fixture 105 is in the short , flat bottom portion 100 of fixture 95 versus the longer , angled bottom portion of fixture 105 . engraved azimuth arrows 113 are required for aiding a lighting fixture installer in orienting lenses 107 , on windows 108 , directly to the exact azimuth alignment , to correctly align , in azimuth , the light beam projected through lenses 107 with the aircraft landing direction . the azimuth alignments are required when the lighting fixture is first installed and on every occasion maintenance is performed on the fixture , i . e ., removal for bulb change and others . fig9 is a top view , i . e ., a plan view , of the lighting fixtures of fig7 and 8 . the lighting fixtures 95 , 105 have six countersunk bolt holes 109 each on bolt circle 114 , with a bolt circle diameter identical to the diameter of the bolt circle , not shown , of bolt holes 64 , on top flange 62 , as shown in fig4 . the bolt circle diameter , the number and size of bolts and bolt holes in the lighting fixtures , as well as in the flange where the lighting fixtures are to be installed , i . e ., top flange 62 , as shown in fig4 , or in conventional top flange 13 , as shown in fig1 , are specified by specifications known as circulars , issued by the f . a . a . referring now to fig4 , and 6 , adjustable extension 55 and adapter flange 85 represent the preferred embodiment of the alignments adjustments assembly of the present invention . adjustable extension 55 consists of a tubular , cylindrical section , defined by a non - threaded top portion 58 which has its bottom portion 57 threaded with acme threads 56 , e . g ., by way of example at four threads per inch ( 2 . 54 cm ). top portion 58 and bottom threaded portion 57 are the wall of the cylindrical portion , i . e ., the wall of a tubular cylinder , shown in elevation , partially in section , in fig4 . acme threaded portion 57 is threaded for approximately six inches ( 15 cm ) from bottom end 61 . threaded portion 57 has a minimum of six vertical rows of threaded holes 59 , 60 , i . e ., parallel to its vertical axis 68 , as opposed to three vertical rows of holes at 120 degrees apart , disclosed in u . s . patent application ser . no . 08 / 002 , 014 filed jan . 8 , 1993 entitled “ alignments adjustments assembly apparatus and method ,” now u . s . pat . no . 5 , 541 , 362 . holes 59 are on a horizontal plane different from holes 60 , i . e ., intercalated , i . e ., staggered as shown in fig4 , so that at all times there will be a minimum of four and a maximum of six holes 59 , 60 for threading allen set - screws 81 , as shown in fig5 , through them and for tightening against inside threaded surface 87 of adapter flange 85 , as shown in fig6 . by the method of the present invention , at least one allen set - screw 81 , as shown in fig5 , protruding through holes 59 or 60 , penetrates at least one eighth inch ( 3 . 2 mm ) into a drilled aperture 86 , as shown in fig6 , on inside threaded surface 87 of adapter flange 85 . allen set - screws are threaded through both holes 59 and 60 , shown threaded through hole 59 on fig5 for simplification purposes . allen set - screws are of a minimum ½ inch ( 1 . 3 cm ) nominal diameter . top flange 62 is welded at top portion 71 of the tubular , cylindrical portion of the extension 55 . top flange 62 has 12 threaded bolt holes 64 through it , when seeing it in plan , but shown only in section in fig4 . these threaded bolt holes 64 have a bolt circle diameter , not shown , that coincides with bolt circle diameter 114 , as shown in fig9 , of lighting fixture 95 and 105 , as shown in fig7 and 9 , respectively . the bolt circle and bolt size are mandated by the f . a . a . specifications , i . e ., u . s . federal aviation administration specifications . all features shown on fig9 , a plan view , coincide with a plan view , not shown , of fig7 in all respects , i . e ., they are substantially identical . therefore , either lighting fixtures of fig7 or fig8 can be bolted onto top flange 62 . top flange 62 has opening 67 at an angle 66 of approximately 45 degrees . in addition to accepting lighting fixture 95 , as shown in fig7 , it also accepts lighting fixture 105 , as shown in fig9 . preferably top flange 62 and tubular cylindrical portion 57 are made of stainless steel . the stainless steel assembly 55 of the present invention provides an alignment adjustments assembly which corrects the problem of corrosion from materials such as corrosive deicing chemicals or by a galvanic action between dissimilar metals between the light bolts and the light support . novel mud dam protecting ring 69 , consisting of a 1 to 1¼ inches wide ( 2 . 54 to 3 . 27 cm ), thin , stainless steel band , is built in one piece with top flange 62 , if adjustable extension 55 is built in one piece , which is the preferred method . mud dam protecting ring 69 can also be welded all around the outer periphery of top flange 62 if adjustable extension 55 is built of individual components . mud dam 69 is positioned to protect the lighting fixture and its lenses 107 , as shown in fig7 , and 9 from grout 122 , as shown in fig1 , when grout 122 is poured . groove 65 is provided on surface 63 of top flange 62 in order to accept “ o ”- ring 70 , shown lifted from groove 65 , on fig4 . the adjustable extension of the present invention can be cast , in one piece , e . g ., from stainless steel , comprising the tubular , cylindrical portion as well as the top flange 62 and mud dam protection ring 69 . it can then be machine - finished including groove 65 and mud dam protection ring 69 . acme - threads 56 are cut for a minimum of up to 6 inches ( 15 cm ) or more from bottom end 61 . all holes 59 , 60 , and 64 are then drilled and tapped . preferably , each individual component is made of stainless steel . the adjustable extension can also be made of individual components , i . e ., a tubular piece , to obtain the cylindrical portion and a standard steel plate , machine - finished to obtain the top flange 62 , to which a thin , steel band is welded to make the protection ring 69 . then the flange 62 is welded at 71 , top end of non - threaded portion 58 of the tubular piece , i . e ., the cylindrical portion . any additional machine - finishing then is done , including groove 65 . acme threads 56 are cut for a minimum of 6 inches ( 15 cm ) or more from bottom end 61 . all holes 59 , 60 , and 64 are then drilled and tapped . optionally , acme threads 56 could be cut , and holes 59 and 60 drilled and tapped in the field at the point of use . the order in which the fabrication steps are herein described , i . e ., for casting in one piece or for individual components , is not intended to limit the many variations of manufacturing sequencing , as those skilled in the art would recognize . therefore , all sequencing steps , whether listed or not , are part of the apparatus and method of the present invention . as it can be readily understood by those skilled in the art , the adjustable extension can be made in any overall length , including any length of its threaded portion 57 . this feature provides the design engineers a great advantage in planning for future aircraft ground traffic changes , i . e ., additional layers of pavement or the replacement of existing layers of pavement with new , thicker layers , to upgrade these aircraft traffic areas to new generations of larger , heavier aircraft . fig5 represents the allen set - screw 81 component of the present invention shown threaded - in and protruding through threaded portion 57 of the adjustable extension . fig6 represents the circular adapter flange 85 component part of the present invention shown in elevation . non - threaded aperture 86 is at least ⅛ inch ( 3 . 2 mm ) deep , drilled into acme threaded surface 87 in opening 88 . inside opening 88 is threaded with 4 acme threads per inch ( 2 . 54 cm ) in order to thread extension 55 into it . non - threaded holes 89 are 12 in number ( only two shown ) and are drilled through surface 90 . bolt holes 89 are drilled on a bolt circle , not shown , identical to the bolt circle 137 , as shown in fig1 , on top flange 30 of conventional embedded container 1 , as shown in fig1 and 2 . adapter flange 85 thereby provides the means for the installation of adjustable extension 55 onto embedded stainless steel container 1 a , as shown in fig1 and 12 . for the installation of the alignments adjustments assembly of the present invention on airport runway embedded stainless steel container 1 a , adapter flange 85 is bolted onto top flange 30 , as shown in fig1 , and 12 of embedded container 1 after removing bolts 3 , as shown in fig1 and 2 and all fixed - length extensions 2 , 7 , and 11 . when adapter flange 85 is bolted onto stainless steel container 1 a , the adjustable extension 55 can be threaded into adapter flange 85 , through acme threaded opening 88 , in order to install an airport inset lighting fixture upon top flange 62 , as shown in fig4 and 11 , of adjustable extension 55 . all allen set screws are threaded through holes 59 , 60 of extension 55 and torqued to a minimum of 60 foot - pounds ( 8 kilogram - meters ) against acme threaded surface 87 of adapter flange 85 , one of them , torqued against the inside of drilled aperture 86 . referring now to fig1 , a completed installation of the apparatus of the present invention is represented . aperture 86 on acme threaded surface 87 is drilled as follows . first , adjustable extension 55 with “ o ” ring 70 , in groove 65 and with lighting fixture 105 bolted onto it , as shown in fig1 , is threaded into adapter flange 85 , which has been bolted already onto stainless steel container 1 a by means of bolts 121 . lighting fixture 105 on adjustable extension 55 then is brought to the exact height and azimuth by threading in adjustable extension 55 until aximuth orientation arrows 113 are aligned to the precise azimuth at the required height . prior to any installation , a surveyor provides the necessary centerline marks 138 , as shown in fig1 , on the pavement , i . e ., of a runway , for aiding the installer in finding the correct azimuth line . at this point , the lighting fixture is removed , and all required allen set - screws are installed through holes 59 , 60 of adjustable extension 55 and fully torqued at 60 foot - pounds ( 8 kilogram - meters ) against acme threaded surface 87 to immobilize adjustable extension 55 in place , keeping it at the desired azimuth alignment and height adjustment . then , aperture 86 is drilled approximately ⅛ inch ( 3 . 2 mm ) into surface 87 of adapter flange 85 , through one of threaded holes 59 or 60 of the adjustable extension 55 . immediately after aperture 86 is drilled - in , the remaining allen set - screw 81 is threaded through the respective hole 59 or 60 and fully torqued at 60 foot - pounds ( 8 kilogram - meters ) against the inside of aperture 86 . by making at least one allen set - screw 81 penetrate at least ⅛ inch ( 3 . 2 mm ) into aperture 86 , on surface 87 of adapter flange 85 , by installing six allen set - screws , and by making the set - screw ½ inch ( 12 . 7 mm ) in diameter , the adjustable extension 55 and the lighting fixture mounted thereupon will not be made to turn by the torque tangentially applied by the force of airplane wheels , including those of the newer , heavier airplanes landing upon the lighting fixtures or by the twisting action created by heavy aircraft locked wheels when turning . all holes 59 , 60 not utilized are plugged - in with threaded , plastic plugs , not shown . when holes 59 , 60 are plugged - in , the lighting fixture is connected to electrical power connector 123 from imbedded container 1 by means of cable 111 and connector 112 . then the lighting fixture is re - bolted onto top flange 62 of adjustable extension 55 with its azimuth orientation arrows 113 aligned in azimuth , by means of bolts 120 . “ o ” ring 70 is compressed by the bolting pressure , thereby providing a tight water seal . angled bottom 110 of lighting fixture 105 fits very well in angled 66 opening 67 , as shown in fig4 , of the 25 adjustable extension . at this point , the installation is completed by pouring - in grout 122 all around the alignments adjustments assembly 55 , 85 , of the present invention . it can be seen that the novel protection ring 69 , as shown in fig4 and 11 , prevents grout 122 from getting on the lighting fixture , especially so on its lens 107 through window 108 . it is also readily understood that groove 65 , as shown in fig4 , provided on surface 63 of top flange 62 of adjustable extension 55 eliminates the requirement for installing a separate spacer ring with a groove on it for the i () installation of “ o ” ring 70 . the alignments adjustments assembly of the present invention is reusable . when the alignments adjustments assembly is installed and the airport aircraft ground traffic area is modified , creating a higher or lower surface , i . e ., if surface 24 were made higher or lower , extension 55 can be threaded in or out , after first removing all allen set - screws 81 , to provide a new height adjustment without affecting the azimuth alignment . azimuth is a straight line , i . e ., toward the horizon , in the direction of aircraft landings , with the centerline 138 , as shown in fig1 , of the aircraft ground traffic area runway , taxiway , defining this straight line . thus the embedded containers with their inset lights mounted thereupon all are installed at a specified distance one from another on this centerline for the length of the aircraft ground traffic area . at the time embedded stainless steel container 1 a is first installed , its top flange 30 , as shown in fig1 , is aligned in azimuth , by aligning centerline 138 of the aircraft ground traffic area to pass exactly aligned with two diametrically opposed threaded bolt holes 136 . prior to its installation , a surveyor provides markings on the pavement for aiding in the azimuth alignment of stainless steel container 1 a . bolt holes 136 are at an angle 135 of 30 degrees apart , and they are set on bolt circle 137 with a diameter identical to bolt circle 114 , as shown in fig9 , on the lighting fixtures 95 , 105 . bolt circle diameter 137 on top flange 30 also is identical to the bolt circle diameter , not shown , on adapter flange 85 , which bolts thereupon , by the method of the present invention . adjusting the height of adjustable extension 55 would not affect the azimuth alignment of a lighting fixture installed upon its flange 62 , as shown in fig1 , because extension 55 acme threaded portion 57 is provided with at least four acme threads 56 per inch ( 2 . 54 cm ). at four acme threads per inch ( 2 . 54 cm ), it would take four full , 360 degree turns of adjustable extension 55 , for it to go up or down one inch ( 2 . 54 cm ). therefore the adjustable extension will move up or down only ¼ inch ( 6 . 3 mm ) when rotated 360 degrees about its axis 68 , i . e ., one single , complete rotation . a 30 degree turn of adjustable extension 55 will produce a height change of only 0 . 0208 inches ( 0 . 05 mm ), up or down , i . e ., one twelfth of ¼ inch ( 6 . 3 mm ). the measure of 0 . 0208 inches ( 0 . 05 mm ) is slightly more than 1 / 64 inch ( 1 . 6 mm ). the overall tolerance 17 , as shown in fig1 is 1 / 16 inch ( 1 . 6 mm ). a 30 degree turn equals one twelfth of one full 360 degree rotation . therefore , adjustable extension 55 can be rotated a few degrees about its axis 68 in any direction to obtain a very precise azimuth alignment without negatively affecting its height adjustment . any azimuth alignment adjustment would always be 15 degrees or less because bolt holes 109 , as shown in fig9 , of the lighting fixtures , by faa mandate , are spaced apart 60 degrees , i . e ., only six holes . bolt holes 64 on top flange 62 , as shown in fig4 , are spaced at 30 degrees , exactly the same as bolt holes 136 , as shown in fig1 , on top flange 30 of the embedded container , i . e ., 12 bolt holes , also by faa specifications the diameter of bolt circles 114 , as shown in fig9 , and 137 , as shown in fig1 , are also identical to that of the top flange 62 . accordingly , a 30 degree azimuth alignment adjustment is obtained by properly positioning the lighting fixture upon top flange 62 of adjustable extension 55 , matching its bolt holes 109 with the two bolt holes 64 on flange 62 , positioning arrows 113 closest to the correct azimuth alignment marked on the pavement by a surveyor . the final , precise adjustment of 15 degrees or less is done by simply turning the adjustable extension . from fig9 , it can be seen that windows 108 are centered between two bolts 109 , and , therefore , orientation arrow 113 is at 30 degrees apart from the two adjacent bolt holes 109 . referring now to fig1 and 14 , a universal top adjustable alignment container 255 is shown in elevation in fig1 and in plan view , i . e . top view , in fig1 . the non - corrosive top adjustable alignment container 255 is another preferred embodiment of the present invention . fig1 shows , for the purpose of illustration , an airport inset light 205 , a new type of airport inset lighting fixture , manufactured by hughes phillips . the novel features of the universal top adjustable alignment container 255 allow the installation of any of the three types of lighting fixtures that exist in the u . s . market today , e . g ., lighting fixture 95 , shown in elevations in fig7 and in plan view in fig9 ; lighting fixture 105 , shown in elevation in fig8 and in plan view in fig9 ; and the newest inset lighting fixture 205 , shown in elevation in fig1 . any of the three lighting fixtures 95 , 105 , and 205 can be installed on the universal top adjustable alignment container 255 without requiring its top flange 262 to have an angled opening 66 ( fig4 ), as it is required for the flange 62 of the adjustable extension 55 of fig4 . continuing to refer to fig1 , the novel top flange 262 of the universal top adjustable alignment container 255 has an opening 267 with a straight inside surface 266 instead of an angled inside surface 66 as shown in fig4 . in addition , the top flange 262 is thicker than the top flange 62 of fig4 . this additional thickness allows a stepped bottom 201 of the lighting fixture 205 to be perfectly fit inside the opening 267 of the top flange 262 , with a flange 206 inside the mud dam 269 . the universal top adjustable alignment container 255 of fig1 is preferably cast in one piece , in stainless steel . the casting can then be machined to form the top flange 262 , a flat surface 263 , with a groove 265 in it , the mud dam 269 , and an opening 267 , with its straight surface 266 . twelve threaded holes 264 ( only two shown ) are drilled and tapped through the surface 263 of the flange 262 . then acme threads 256 are cut , at four threads per inch , on a surface 257 for a minimum of six inches from a bottom a 261 of a tubular section 257 . the tubular section 257 is of a required wall thickness 274 to allow for the required strength of the threads to resist shearing forces created by the axial loading forces applied upon the lighting fixtures by landing aircrafts . at this point , holes 259 and 260 are drilled and tapped through the tubular section 257 , through its wall thickness 274 . holes 259 and 260 are intercalated , i . e ., staggered . these holes 259 and 260 , if required , could be drilled and tapped in the field instead of in the factory . nevertheless , drilling and tapping holes 259 and 260 in the field is not the preferred method because it is not cost effective , and it is inefficient . threaded bolt holes 264 of the top flange 262 are a total of twelve , i . e ., at 30 degrees 235 from each other , as shown on fig1 . these holes 264 are drilled and tapped through a surface 263 of the flange 262 on a bolt circle 214 ( fig1 ), which is similar to the bolt circle 114 of fig9 , on the lighting fixtures 95 and 105 of fig7 and 8 , respectively . bolt holes 209 of lighting fixture 205 are drilled through flange 206 on a bolt circle ( not shown ) similar to bolt circle 214 on top flange 262 . lighting fixture 205 has six bolt holes ( only two shown ) spread at sixty degrees apart , similar to the configuration 235 shown of fig9 for lighting fixtures 95 , 105 . the number of holes , sizes , and degrees apart are all mandated by the faa , i . e ., the federal aviation administration , in specifications known as faa circulars . lighting fixture 205 of fig1 has a stepped bottom comprising a portion 201 and a portion 200 . the portion 200 provides electrical wires 211 that bring electrical power to the lighting fixture 205 . flange 206 is utilized to install the lighting fixture upon surface 263 of top flange 262 of universal top adjustable container 255 , inside its mud dam 269 . lighting fixture 205 , when bolted onto top flange 262 , compresses an “ o ” ring 270 in a groove 265 , providing a water tight seal between the lighting fixture 205 and the inside of the universal top adjustable alignment container 255 of fig1 . lighting fixture 209 has two countersunk windows 208 , similar to the countersunk windows 108 on lighting fixtures 95 , 105 of fig9 . the lighting fixture 205 also has one azimuth orientation arrow ( not shown ) engraved in each of countersunk windows 208 . the countersunk windows 208 , engraved azimuth arrows , lighting system , and their angular positioning for all lighting fixtures manufactured in the u . s . are all very similar and they are all mandated by faa regulations , i . e ., faa circulars . engraved azimuth arrows ( not shown ) on the lighting fixture 205 are utilized to aid the installer in aligning the lighting fixture 205 in azimuth , on the runway centerline and in the direction 32 of landing aircraft 51 ( fig3 ). referring now to fig1 , a plan view , i . e ., a top view , of the universal top adjustable alignment container 255 , of fig1 , is shown . fig1 shows the top flange 262 , with its mud dam 269 and twelve threaded holds 264 drilled and tapped on tile bolt circle 214 , at thirty degrees 235 from each other . fig1 also shows groove 265 in surface 263 of top flange 262 . groove 265 is provide for receiving “ o ” ring 270 . in addition , fig1 shows straight surface 266 of inside opening 267 and inside surface 274 of tubular section 257 . the universal top adjustable alignment container of the present invention can also be fabricated of individual components , which can be welded together . by way of an example , top flange 262 can be welded at 271 to the tubular section 257 , and mud dam 269 can be made of a piece of thin steel welded to the outer periphery of top flange 262 . any machining including the cutting of acme threads 256 and the drilling and tapping of holes 259 , 260 , and 264 can be done at the time each component is fabricated or after all or part of the components have been welded together . whether cast in one piece or fabricated of individual components , the universal top adjustable alignment container 255 preferably is made of stainless steel , to provide for corrosion resistance . the alignments adjustments precision makes the apparatus of tile present invention an efficient and economical apparatus and method for the replacement of conventional , existing fixed - length extensions at the time of renovation , i . e ., resurfacing of aircraft ground traffic areas , as well as for new installations of such traffic areas by eliminating the need for installing fixed - length extensions , by eliminating the need for installing several flat spacer rings of various thicknesses , by eliminating the need for installing and angle - correcting , tapered spacer rings , i . e ., leveling rings , and by eliminating the need for installing a separate mud dam . in addition , the installation of alignments adjustments assembly of the present invention saves labor costs , and the assembly is reusable . thus it can be seen that the invention accomplishes all of its objectives . the apparatus and process of the present invention are not limited to the descriptions of specific embodiments presented hereinabove , but rather the apparatus and process of the present invention should be viewed in terms of the claims that follow and equivalents thereof . further , while the invention has been described in conjunction with several such specific embodiments , it is to be understood that many alternatives , modifications , and variations will be apparent to those skilled in the art in light of the foregoing detailed descriptions . accordingly , this invention is intended to embrace all such alternatives , modifications , and variations which fall within the spirit and scope of the appended claims . | 5 |
embodiments of the present invention will be described below with reference to the accompanying drawings . fig2 is a perspective view showing the outer appearance of an embodiment according to the present invention , fig3 a is a sectional view showing a state in which an insertion portion for a memory cartridge as a solid - state memory apparatus is open , and fig3 b is a sectional view showing a state in which the memory cartridge is inserted in the insertion portion and the insertion portion is closed . in these drawings , a camera main body 20 comprises a cover 22 , a cartridge holder 24 which can pivot about a pivot center 24a , a loading detection switch 26 , electric contacts 28 for communicating with the memory cartridge , a release button 30 , a liquid crystal display ( lcd ) device 32 , a cover member 34 , a cover biasing compression coil 36 , a memory cartridge 38 , memory contacts 38a of the memory cartridge 38 , an eject button 40 for the memory cartridge 38 , and a power switch 42 of the camera main body 20 . the operation of each section will be described below . in order to perform photographing , the eject button 40 is operated to set the open state shown in fig3 a , and the memory cartridge 38 is inserted in the holder 24 in a direction indicated by an arrow shown in fig3 a . if a barrier shutter for protecting a contact is provided for the memory cartridge 38 , the barrier shutter is opened by opening means ( not shown ) during insertion . when the memory cartridge 38 reaches a predetermined position deep in the holder 24 , the cartridge 38 is locked by a locking mechanism ( not shown ). thereafter , by closing the cover 22 , the memory contacts 38a are brought into contact with and are electrically connected to the electric contacts 28 of the camera body 20 , as shown in fig3 b . after insertion is completed , the loading detection switch 26 is operated , and the state shown in fig3 b is held by a cover locking mechanism ( not shown ). fig4 is a block diagram showing an arrangement of electric circuits of this embodiment . in fig4 the same reference numerals as in fig2 a , and 3b denote the same parts . referring to fig4 the camera main body 20 includes a photographic lens 50 , a ccd image pickup device 52 , a signal processor 54 , an a / d converter 56 , an interface circuit 58 with respect to the memory cartridge 38 , a controller 60 constituted by a microcomputer for controlling the overall system , and a switch 62 for inputting various commands . the image pickup device 52 converts an optical image of an object photographed by the photographic lens 50 into an electrical signal , and the signal processor 54 perform predetermined image signal processing . the a / d converter 56 digitizes an output from the signal processor 54 . an output from the a / d converter 56 is supplied to and stored in the memory cartridge 38 via the interface circuit 58 and the contacts 28 and 38a . fig5 shows a control operation flow chart for performing checking in the above solid - state camera . referring to fig5 when a power source is switched on by the power switch 42 ( s1 ), the controller 60 checks an open / close state of the loading detection switch 26 ( s2 ). if unloading is detected , the controller 60 performs a warning operation by means of the display device 32 and / or a sound so as to cause the user to load the memory cartridge 38 ( s4 ). if the memory cartridge 38 is already loaded , the controller 60 reads out various pieces of specification information stored beforehand in the loaded memory cartridge 38 ( s5 and s6 ) and displays the readout information on the display device 32 ( s7 ). fig6 shows the format of communication data from the memory circuit 38 to the camera main body 20 . if no memory capacity remains , the controller 60 displays a warning indicating that photographing cannot be performed on the display device 32 ( s9 ), and prohibits photographing ( s10 ). if the necessary memory capacity remains , the controller 60 reads a remaining backup battery capacity of the memory cartridge 38 ( s11 ). if the battery capacity is below a predetermined value , the controller 60 displays information indicating that photographing cannot be performed on the display device 32 and prohibits photographing ( s9 and s10 ). if the battery capacity is over the predetermined value , the controller 60 displays information indicating that photographing can be performed ( s13 ), waits for release ( s14 ), and performs photographing / recording ( i . e ., writes an output from the image pickup device 52 in the memory cartridge 38 ) ( s15 ). after recording ( s15 ), the controller 60 updates information concerning the number of photographed frames , the memory remaining capacity , and the like ( s16 ). the flow then returns to step s6 , and the controller 60 checks the memory capacity and the backup battery capacity and waits for the next release . the flow may be modified such that communication with the memory cartridge 38 is directly performed without checking the open / close state of the loading detection switch 26 immediately after the power source is switched on , and if the communication cannot be performed , the operator is warned of unloading or defective loading of the memory cartridge to prohibit photographing . in the above embodiment , the switch 26 is separately provided to detect loading completion of the memory cartridge 38 . some of the electric contacts 28 of the camera main body 20 , however , may be used to detect loading . in this case , two contacts 28a of a plurality of electric contacts 28 are used for loading detection , and the remaining contacts 28b are used for communication . one of the contacts 28 for loading detection is to be grounded . when loading of the memory cartridge 38 is completed , the memory contacts 38a are electrically connected to the contacts 28 . in accordance with whether an electrical signal ( voltage value or current value ) from the contact 28a is lower or higher than a predetermined level , the controller 60 of the camera main body 20 checks whether loading is completed . it is a matter of course that all the electric contacts 28 can be used for both loading detection and communication in such a manner that loading detection and data communication are performed at different timings . in this manner , the number of contacts 28 and 38a can be reduced . as is apparent from the above description , according to this embodiment , whether an image to be photographed can be recorded in the memory cartridge is automatically checked . therefore , photographing can be performed more reliably and more rapidly . a solid - state camera according to another embodiment of the present invention will be described below with reference to fig7 to 9 . fig7 is a block diagram showing an arrangement of the embodiment in which the present invention is applied to a solid - state camera using a solid - state memory apparatus similar to the memory cartridge 38 of the above embodiment as a still image recording medium . referring to fig7 a solid - state memory apparatus 65 comprising various ic memory devices and a cpu as a controller for controlling the ic memory devices can be detached from a camera main body 64 . the solid - state memory apparatus 65 exchanges various information with the camera main body 64 via a predetermined bus line . the camera main body 64 comprises a photographic lens 66 , a shutter 67 , a solid - state image pickup device 68 such as a ccd , a signal processor 69 , an a / d converter 70 , a driver 71 for the image pickup device 68 , a cpu 72 for controlling the overall system , a timing controller 73 for defining operation timings of the processor 69 , the converter 70 , and the driver 71 of the image pickup device 68 , and a display / switch unit 74 including various switches and a display device . the operation of fig7 will be described below with reference to a flow chart shown in fig8 . when a power switch of the camera main body 64 is turned on ( s1 ), loading of the solid - state memory apparatus 65 is waited ( s2 ). the cpu 72 communicates with the loaded solid - state memory apparatus 65 and detects specification information ( e . g ., memory device classification , the transfer speed upper limit , and the remaining capacity shown in fig6 ) of the solid - state memory apparatus 65 ( s3 ). on the basis of this information , the cpu 72 determines operation speeds of the device 68 , the processor 69 , the converter 70 , and the driver 71 and controls the timing controller 73 . when a user depresses a shutter switch of the display / switch unit 74 , the shutter 67 is opened , and an output from the image pickup device 68 is transferred to and written in the solid - state memory apparatus 65 at the above timings via the signal processor 69 and the a / d converter 70 . since a maximum continuous photographing speed is determined on the basis of the memory information obtained in step s3 , the cpu 72 displays a possible maximum continuous photographing speed ( s4 ), and monitors unloading of the solid - state memory apparatus 65 ( s5 ). fig9 is a block diagram showing an arrangement of still another embodiment of the present invention . in fig9 the same reference numerals as in fig7 denote the same parts . in this embodiment , image data digitized by an a / d converter 70 is temporarily stored in a frame memory 75 . the image data temporarily stored in the frame memory 75 is read out from the frame memory 75 at a speed corresponding to a transfer speed of a memory device of a solid - state memory 75 and written in the solid - state memory apparatus 65 . the above embodiment employs an arrangement in which when the solid - state memory 65 is loaded , the cpu 72 of the camera main body 64 inquires classification of a memory device used as the solid - state memory apparatus 65 . the arrangement , however , may be made such that the above various types of information are mechanically set in the solid - state memory apparatus 65 and detecting means for detecting the mechanically set information may be provided for the camera main body 64 . with this arrangement , the cpu need not communicate with the memory . in this embodiment , the maximum continuous photographing speed of the solid - state camera is limited to a write enable speed of the solid - state memory apparatus 65 and displayed . therefore , operability of the solid - state camera , especially its continuous photographing operability is improved . in the above description , the solid - state camera has been exemplified . the present invention , however , can be generally applied to an apparatus for recording a certain kind of information in a detachable solid - state memory apparatus . as is apparent from the above description , according to this embodiment , information can be reliably recorded even when solid - state memory apparatuses using various types of memory devices are replaced and used . an embodiment of a solid - state memory apparatus according to the present invention will be described below with reference to fig1 to 12 . note that the solid - state memory apparatus according to this embodiment is obtained by applying the present invention to the memory cartridge and the solid - state memory apparatus of the above embodiments . fig1 is a block diagram showing an arrangement of the embodiment of the present invention . referring to fig1 , a solid - state memory apparatus 65 according to this embodiment includes a status output line 76 , an address / control input line 77 , a clock input line 78 , and a data input / output line 79 . in the case of a serial signal , the data input / output line 79 is constituted by one signal line . in the case of a parallel signal , however , the data input / output line is constituted by signal lines in the number corresponding to the number of parallel signals . the solid - state memory apparatus 65 also includes a memory device 80 , an address counter 81 , an address preset circuit 82 , a controller 83 , a recognition code storing circuit 84 , and a buffer 85 . the input lines 77 and 78 and the input / output line 79 are connected to a solid - state camera via electric contacts as shown in fig3 . when the camera sends a predetermined command to the address / control input line 77 , an operation mode of the solid - state memory apparatus 65 is set . that is , a clock signal is supplied to the clock input line 78 and a binary signal is supplied to the address / control input line 77 at timings shown in fig1 . a relationship between binary values at portions a , b , c , and d in fig1 and the operation modes is shown in table 1 below . note that a maximum of 16 commands can be used by using four bits in this embodiment . table 1______________________________________a b c d operation mode______________________________________0 0 0 0 counter clear0 0 0 1 counter up0 0 1 0 counter down0 0 1 1 counter down / load ( followed by e to j ) 0 1 0 0 memory clear0 1 0 1 memory readout0 1 1 0 memory write0 1 1 1 recognition code readout1 x x x system reservation______________________________________ in synchronism with a clock supplied from the clock input line 78 , the controller 83 decodes a command from the address / control input line 77 and operates the respective sections by the designated operation mode . for example , in this embodiment , by storing memory addresses corresponding to the number of photographs in the address preset circuit 82 , image data can be randomly accessed by designating the number of a photograph . that is , when the number of photographs to be read is designated , the address preset circuit 82 loads its start address in the address counter 81 , and the address counter 81 sequentially counts up . in this manner , writing or reading of a storage area corresponding to the designated number can be performed . similarly , a recognition code can be output from the recognition code storing circuit 84 to the camera main body . more specifically , when &# 34 ; 0111 &# 34 ; is supplied from the camera main body to the address / control input line 77 , the controller 83 sends a command to the recognition code storing circuit 84 to output a stored recognition code . this recognition code is output to the camera main body via the output buffer 85 and the data input / output line 79 . note that the recognition code storing circuit 84 stores various types of specification information as shown in fig6 . fig1 is a timing chart for explaining the above operation . a clock signal is normally supplied from the camera main body to the solid - state memory apparatus 65 , and the internal circuit in the solid - state memory apparatus 65 operates in synchronism with this clock . a readout command &# 34 ; 0111 &# 34 ; of memory recognition code is supplied from the camera main body to the address / control input line 77 at the timing shown in fig1 . the first &# 34 ; 0 &# 34 ; is a start bit . the controller 83 interprets this command and sets a status bit at &# 34 ; h &# 34 ;, thereby informing the camera main body that the data is effective . in synchronism with a clock , the controller 83 causes the recognition code storing circuit 84 to output storage data ( in this embodiment , &# 34 ; 00101100 &# 34 ;) to the data input / output line 79 via the buffer 85 . a read - only memory or a combinational logic circuit , e . g ., is used as the recognition code storing circuit 84 . when this recognition code may be determined to include information such as a memory capacity , a transfer rate , and an image size , its length is not limited to 8 bits . in the above embodiment , the recognition code is read out by a command response scheme . an exclusive readout terminal , however , may be used to read out the code . in addition , in the above embodiment , data exchange is performed by four types of signal lines . data exchange , however , may be performed by using a larger or smaller number of signal lines . as is easily understood from the above description , according to the embodiments of the present invention , regardless of an outer shape or standardization of an interface , a new electronic device can be used to achieve a large capacity and a high speed . | 7 |
the figures described above and the written description of specific structures and functions below are not presented to limit the scope of what i have invented or the scope of the appended claims . rather , the figures and written description are provided to teach any person skilled in the art to make and use the inventions for which patent protection is sought . those skilled in the art will appreciate that not all features of a commercial embodiment of the inventions are described or shown for the sake of clarity and understanding . persons of skill in this art will also appreciate that the development of an actual commercial embodiment incorporating aspects of the present inventions will require numerous implementation - specific decisions to achieve the developer &# 39 ; s ultimate goal for the commercial embodiment . such implementation - specific decisions may include , and likely are not limited to , compliance with system - related , business - related , government - related and other constraints , which may vary by specific implementation , location and from time to time . while a developer &# 39 ; s efforts might be complex and time - consuming in an absolute sense , such efforts would be , nevertheless , a routine undertaking for those of skill in this art having benefit of this disclosure . it must be understood that the inventions disclosed and taught herein are susceptible to numerous and various modifications and alternative forms . particular embodiments of the invention may be described below with reference to block diagrams and / or operational illustrations of methods . it will be understood that each block of the block diagrams and / or operational illustrations , and combinations of blocks in the block diagrams and / or operational illustrations , can be implemented by analog and / or digital hardware , and / or computer program instructions . such computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , asic , and / or other programmable data processing system . the executed instructions may create structures and functions for implementing the actions specified in the block diagrams and / or operational illustrations . in some alternate implementations , the functions / actions / structures noted in the figures may occur out of the order noted in the block diagrams and / or operational illustrations . for example , two operations shown as occurring in succession , in fact , may be executed substantially concurrently or the operations may be executed in the reverse order , depending upon the functionality / acts / structure involved . computer programs for use with or by the embodiments disclosed herein may be written in an object - oriented programming language , conventional procedural programming language , or lower - level code , such as assembly language and / or microcode . the program may be executed entirely on a single processor and / or across multiple processors , as a stand - alone software package or as part of another software package . lastly , the use of a singular term , such as , but not limited to , “ a ,” is not intended as limiting of the number of items . also , the use of relational terms , such as , but not limited to , “ top ,” “ bottom ,” “ left ,” “ right ,” “ upper ,” “ lower ,” “ down ,” “ up ,” “ side ,” and the like are used in the written description for clarity in specific reference to the figures and are not intended to limit the scope of the invention or the appended claims . the inventions disclosed and taught herein comprise systems and methods of controlling one or more upss by providing a system bypass circuit in addition to any internal bypass associated with each ups . closing the system bypass circuit allows the one or more upss to be serviced or otherwise taken off line . the systems and methods may comprise placing each ups into internal bypass prior to placing the ups system into system bypass . further , the systems and methods may comprise automatic bypassing and / or restricted bypassing as desired , such as by forcing one or more of the upss to go into internal bypass when one or more covers are removed . additionally or alternately , engaging the system bypass feature may require that one or more of the individual upss is placed in internal bypass first . while there are an infinite number of embodiments that utilize one ore more of these inventions , a few specific embodiments are discussed below . fig1 illustrates a conventional ups 10 comprising a power module having a rectifier section 20 and an inverter section 30 . it will be understood that a primary power source ( not shown ), such as line utility , may supply the ups at primary input 12 . the primary ac power is rectified to dc power , which is communicated , such as by a dc bus 22 , to the inverter section 30 , where the dc power is inverted to a form of ac power . not shown in fig1 is a back up power source , such as one or more batteries , that can feed the inverter section 30 when the primary power source is offline . also illustrated in fig1 is internal bypass 14 , which , as the name implies , bypasses the power module 20 , 30 of the ups . the internal bypass 14 is structured to communicate ac power , such as from the primary power source ( or a secondary power source ), to power output 16 of the ups . also illustrated in fig1 is switch 40 that allows the power output to source from power module 20 , 30 ( as shown in fig1 ) or from the internal bypass 14 . it will be understood the switch 40 may comprise a mechanical switch , such as a breaker , an electronic switch such as an scr , or any number of other devices adapted to transfer power as described herein . turning now to fig2 , a first embodiment of an uninterruptible power supply system 100 utilizing aspects of the present invention is illustrated . a first ups 10 a is shown and another ups 10 n is shown to represent a plurality of paralleled upss 10 a through 10 n . for purposes of this disclosure , upss 10 a through 10 n are illustrated to be identical , but it will be appreciated that non - identical upss can be paralleled with the present invention as well . this embodiment of the ups system 100 shows power input 12 a through 12 n drawing power from a primary power source 50 and the bypass circuits 14 a through 14 n drawing power from a bypass power source 52 . in certain embodiments and / or applications , the primary power source 50 and bypass power source 52 may comprise the same source , such as a line utility . illustrated in fig2 is system or maintenance bypass 60 that connects a power source , such as primary power 50 or bypass power 52 to the load bus 70 . the system bypass 60 comprises a switch 62 , shown in the opened condition . the ups system 100 also comprises load bus switches 64 a through 64 n , which are shown in the closed condition . although the bypass switch 62 , and the load bus switches 64 a through 64 n are illustrated as separate switches , it will be appreciated that a single multi - pole switch , whether mechanical or electronic or a combination thereof , may be used as well . the system of fig2 is shown in the normal operating mode of the ups system in which power from the primary source 50 is passed through the power modules 20 a - n , 30 a - n through the load bus switches 64 a though 64 n and on to the load bus 70 . bypass switch 62 as well as the internal bypass circuits 14 a through 14 n are in the opened condition . fig3 illustrates the ups system 100 in internal bypass mode . as can be seen , ups switches 40 a through 40 n have been activated such that the power modules of the paralleled ups have been bypassed . power from the bypass power source 52 ( which may be the same as primary power source 50 ) is passed through to the load bus 70 via load bus switches 64 a through 64 n . activation of the ups switches 40 a through 40 n may be accomplished by any known means , including wired or wireless activation or mechanical activation , remotely or directly . fig4 illustrates the ups system 100 in system bypass mode . as can be seen , ups switches 40 a through 40 n have been activated such that the power modules of the paralleled ups have been bypassed . thereafter , system switch 62 and load bus switches 64 a through 64 n are closed and opened , respectively , simultaneously or substantially simultaneously so that power on the load bus 70 is substantially uninterrupted . in this condition , power from the bypass power source 52 ( which may be the same as primary power source 50 ) is passed through to the load bus 70 via bypass switch 62 thereby bypassing all of the paralleled upss , including their power modules 20 a - n , 30 a - n . activation of the system switch 62 and the load bus switches 64 a through 64 n may be accomplished by any known means , including wired or wireless activation or mechanical activation , remotely or directly . it will be appreciated that once the ups system illustrated in fig4 is placed in system bypass mode , one or more bypassed upss may be removed or otherwise serviced . it will also be appreciated that by requiring each targeted ups , such as upss 10 a through 10 n , to be placed into internal bypass prior to engaging the system bypass 12 , potentially damaging or harmful back feed is thereby prevented or minimized . fig5 a and 5 b illustrate aspects of a preferred ups for use with the present inventions . ups 80 comprises a power module 82 ( comprising a rectifier section and an inverter section ), an internal bypass 84 and a ups switch 86 , as discussed previously . in addition , ups 80 comprises one or more contacts or switches 88 , such as mechanical micro - switches , adjacent selected covers or panels 90 . the switch 88 communicates with ups switch 86 so that a change in state of switch 88 causes a change in state of ups switch 86 . for example , a switch 88 may be placed adjacent a primary access panel 92 , such that removal of the panel by , for example , a service technician , causes a change in state of switch 88 , such as from opened to closed or vice versa . this change in state is communicated , preferably electronically , to ups switch 86 , which causes switch 86 to change state correspondingly . in a preferred embodiment of ups 80 , removing the panel 92 causes the ups switch to place the ups 80 into bypass mode , as illustrated in fig5 b . fig6 illustrates a preferred ups system 200 comprising a plurality of paralleled upss 80 ( only one shown for clarity ) such as described above with respect to fig5 . fig6 also illustrates system bypass 100 comprising a switch 102 , such as described previously . the system bypass switch 102 may preferably comprise a mechanical breaker switch having multiple poles corresponding to the number of paralleled upss . in this configuration , the system switch 102 also comprises load bus switches 102 a through 102 n ( not shown ). it will be appreciated that the system switch 102 may be adapted such that when switch 102 is open , the load bus switches 102 a - n are closed , and vice versa . also shown in fig6 is system switch interlock 104 , which may comprise a bar , panel , or other physical structure that impedes or prevents actuation of system switch 102 . the system bypass is also disclosed to comprise an interlock switch 106 , such as mechanical micro - switch . when the interlock 104 is moved or removed , the switch 106 changes state and causes the ups switches 86 a through 86 n ( not shown ) to enter the internal bypass condition . thereafter , actuation of the system bypass switch 102 cause the ups to go into system bypass without producing damaging backfeed on the ups power modules . other and further embodiments utilizing one or more aspects of the inventions described above can be devised without departing from the spirit of my invention . for example , a suitable programmed controller can stage the internal bypass functions followed by the system bypass function . further , the various methods and embodiments of the present invention can be included in combination with each other to produce variations of the disclosed methods and embodiments . discussion of singular elements can include plural elements and vice - versa . the order of steps can occur in a variety of sequences unless otherwise specifically limited . the various steps described herein can be combined with other steps , interlineated with the stated steps , and / or split into multiple steps . similarly , elements have been described functionally and can be embodied as separate components or can be combined into components having multiple functions . the inventions have been described in the context of preferred and other embodiments and not every embodiment of the invention has been described . obvious modifications and alterations to the described embodiments are available to those of ordinary skill in the art . the disclosed and undisclosed embodiments are not intended to limit or restrict the scope or applicability of the invention conceived of by me , but rather , in conformity with the patent laws , i intend to fully protect all such modifications and improvements that come within the scope or range of equivalent of the following claims . | 7 |
as seen in fig1 a and 1b , wire line a is attached to the top of the well sealing device b by being preferably threadedly attached to cable head 100 . cable head 100 is attached to upper housing 200 by means of shear pin 120 . more than one such shear pin 120 can be used , and it will typically be a solid brass pin . cable head 100 extends downwardly into the upper end of pressure cylinder 300 in a relatively close sliding fit with the walls of ignition chamber 320 in pressure cylinder 300 . the lower end of cable head 100 has circumferential sealing grooves 102 in which conventional rubber seals 104 can be used . the upper end 306 of cylinder 300 abuts shoulder 106 on cable head 100 . the lower end of pressure cylinder 300 contains setting pressure chamber 310 which is connected to ignition chamber 320 by means of channel 430 in mandrel 400 . a conventional ignitor 114 can be housed in cable head 100 connected to an electric lead 116 run with wire line a by known means . leading from the ignitor 114 is primary ignition channel 130 which communicates with setting pressure chamber 310 by way of ignition chamber 320 and channel 430 . propellant 362 , preferably gun powder or equivalent gas producing material , fills setting pressure chamber 310 . the outer surface of pressure cylinder 300 has downwardly angled ratchet threads 390 which mesh with upwardly angled ratchet threads 930 in the inner surface of ratchet ring 900 . ratchet threads 390 and 930 are left hand threads in order to insure continued tightening of the plug during drilling if it becomes necessary to drill the plug out . ratchet ring 900 is slotted to allow the passage of shear pin 120 . pressure cylinder 300 is slidably mounted within pressure chamber 210 of upper housing 200 . the upper end of the inner surface of upper housing 200 has downwardly angled threads 290 which mesh with upwardly angled threads 920 on the outer surface of ratchet ring 900 . threads 290 and 920 are also left hand threads . mandrel 400 is threaded into pressure cylinder 300 by means of threads 350 and 450 . mandrel 400 extends downwardly through the lower end of upper housing 200 in a slidable fashion . the lower end of upper housing 200 is sealed against mandrel 400 by internal circumferential grooves 202 which can contain known rubber seals 204 . the lower end of mandrel 400 is fixedly attached to lower housing 500 by means of being threaded directly into lower housing 500 by means of threads 460 and 560 . slidably mounted along mandrel 400 between upper housing 200 and lower housing 500 are slip segments 600 held in place by conventional means , spreader elements 700 and sealing member 800 . the lower end of upper housing 200 has slip drive surface 250 which bears downwardly against the upper end of upper slip segment 600 . on the inner surface of slip segments 600 are frusto - conical surfaces 630 and on the outer surface are slip teeth 610 which face upwardly on upper segments 600 and which face downwardly on lower segments 600 . immediately below upper slip segment 600 and immediately above lower slip segment 600 are spreader elements 700 which have outwardly facing frusto - conical surfaces 710 which mate with inwardly facing frusto - conical surfaces 630 on the slip segments 600 . spreader elements 700 also have flat surfaces 730 which mate with flat surfaces 810 on sealing member 800 . sealing member 800 is a resilient three piece sealing member such as rubber or neoprene which slidably engages mandrel 400 in its inner bore and which is designed to expand until its outer surfaces 830 seal against the well casing c . upper element 802 has inner frusto - conical surface 803 which mates with outer frusto - conical surface 805 on center element 804 , leaving a concealed gap between upper end 807 of center element 804 and inner face 809 of upper element 802 . similarly , lower element 806 and center element 804 have a concealed gap therebetween and similar matching frusto - conical surfaces . the operation of well sealing device b will now be described . well sealing device b is lowered into casing c to the desired point by means of wire line a . an electrical signal from the surface causes the ignitor 114 to ignite propellant 362 which initially drives pressure cylinder 300 upwardly , pushing cable head 100 upwardly , relative to upper housing 200 , shearing shear pin 120 between cable head 100 and ratchet ring 900 . continued expansion sets the slip segments 600 immediately thereafter . propellant 362 burns , generating an expanding gas causing upper housing 200 to be driven downwardly relative to pressure cylinder 300 because of the opposing pressures exerted on pressure cylinder 300 and reaction surface 230 at the lower end of pressure chamber 210 . mandrel 400 is attached in a rigid fashion to lower housing 500 , so as upper housing 200 is driven downwardly , the slip segments 600 and sealing member 800 between upper housing 200 and lower housing 500 are subjected to a vertical compressive force . upper housing 200 presses downwardly on upper slip segments 600 which are driven outwardly by upper spreader element 700 and at the same time lower slip segments 600 are driven outwardly by lower spreader element 700 as upper and lower spreader elements 700 are driven toward each other by the compressive force . as the spreader elements 700 are driven toward each other , they also compress sealing element 800 , causing center element 804 to expand upper and lower elements 802 and 806 outwardly until outer surfaces 830 of upper element 802 and lower element 806 contact well casing c . as upper housing 200 is driven downwardly relative to pressure cylinder 300 , ratchet threads 390 and 930 maintain the final relative axial position of upper housing 200 and pressure cylinder 300 . this prevents any subsequent slackening of the compressive force on slip segments 600 and sealing member 800 . spreader elements 700 are tapered at a shallow angle so as to allow cylinder 300 to move sufficiently to shear the shear pin 120 before slip segments 600 contact securely with well casing c . therefore , wire line a is positively released from the well sealing device b by the early expansion of propellant 362 which causes the upward movement of cable head 100 relative to housing 200 . wire line a can then be removed from the well bore . any subsequent pressure differential across the well sealing device b will result in a pressure being exerted from the high pressure side against sealing member 800 which will in turn press against spreader element 700 on the low pressure side of the seal , which will , in turn , exert further pressure on slip segments 600 on the low pressure side , insuring that slip segment teeth 610 maintain their engagement with well casing c . increased pressure differential will result in increased sealing pressure at sealing member 800 and increased holding pressure at slip segment teeth 610 . the description given here is intended to illustrate the preferred embodiment of this invention . one skilled in the art will be able to devise variations on this invention which will be essentially equivalent to this embodiment . to the extent that any variations are equivalent , it is intended that they be encompassed by the following claims . | 4 |
in the following preferred examples , the molar ratio of the ethylene to propylene group in the backbone structure of the ppt / pet copolyester is preferably in the range of 60 / 40 to 99 / 1 , and more preferably 70 / 30 to 95 / 5 . the ppt / pte copolyester used to prepare the polyester fiber of the present invention preferably has an intrinsic viscosity [ η ] of 0 . 5 - 1 . 5 dl / g determined at 25 ± 0 . 2 ° c . using phenol / tetrachloroethane ( 3 / 2 , w / w ) as the solvent . according to a first preferred embodiment of the present invention , the ppt / pet copolyester can be prepared by the following steps . first , bis ( 3 - hydroxypropyl ) terephthalate ( bhpt ), terephthalic acid , and ethylene glycol are reacted together in an esterification reaction . then , the esterified product is subjected to undergo a polycondensation reaction . in the above process , ethylene glycol and terephthalic acid can be fed in a molar ratio of 1 . 0 to 4 . 0 and preferably 1 . 1 to 1 . 5 . further , terephthalic acid and bhpt can be fed in a molar ratio of from 99 / 1 to 1 / 99 , whereas the molar ratio is preferably of from 60 / 40 to 99 / 1 and more preferably from 70 / 30 to 95 / 5 . the bis ( 3 - hydroxypropyl ) terephthalate suitable for use in the present invention can be either a monomer or an oligomer obtained from reacting terephthalic acid and 1 , 3 - propanediol via an esterification reaction . 1 , 3 - propanediol and terepthalic acid can be fed in a molar ratio of from 1 . 0 to 4 . 0 , and preferably from 1 . 1 to 1 . 5 . alternatively , bis ( 3 - hydroxypropyl ) terephthalate used can be either a monomer or an oligomer obtained from reacting dimethyl terephthalate ( dmt ) and 1 , 3 - propanediol via an ester exchange reaction . according to a second preferred embodiment of the present invention , the ppt / pet copolyester can be prepared via the following steps . first , terephthalic acid , ethylene glycol , and 1 , 3 - propanediol are reacted together in an esterification reaction . then , the esterified product is subjected to undergo a polycondensation reaction . in the above process , ethylene glycol and 1 , 3 - propanediol can be fed in a molar ratio of from 99 / 1 to 1 / 99 , whereas the molar ratio is preferably of from 60 / 40 to 99 / 1 and more preferably from 70 / 30 to 95 / 5 . the esterification reaction in the present invention can be conducted at a room temperature up to a temperature of 280 ° c ., preferably 200 ° c . to 260 ° c ., and the esterification ratio is preferably controlled to 90 % to 99 %. the polycondesation can be conducted at a temperature of 200 ° c . to 280 ° c . according to the present invention , by controlling the corresponding usage amounts of bhpt , terephthalic acid , and ethylene glycol , the ppt / pet copolyester fiber containing a desired ethylene / propylene molar ratio can be obtained . the main difference between ppt and pet resides in their structural units . in ppt , the soft chain is of the more flexible ( ch 2 ) 3 group with an odd carbon number . in pet , the soft chain is of the more rigid ( ch 2 ) 2 group with an even carbon number . with such structural differences , ppt has indeed a superior dyeability than pet . the present invention incorporates an appropriate amount of ( ch 2 ) 3 chain of ppt into the main chain of pet , so the ppt / pet copolyester having both ( ch 2 ) 2 and ( ch 2 ) 3 groups can be formed accordingly . further , the ppt / pet copolyester fiber can also be produced by using the conventional fiber process . the fiber of the ppt / pet copolyester with both ( ch 2 ) 2 and ( ch 2 ) 3 groups has a dyeability superior than that of the pet , and it can even be better than that of the ppt . in addition , the ppt / pet copolyester of the present invention can be prepared by directly adapting conventional polyester apparatuses . the following examples are intended to illustrate the process and the advantages of the present invention more fully without limiting its scope , since numerous modifications and variations will be apparent to those skilled in the art . 50 . 6 kg of terephthalic acid ( tpa ) and 30 . 2 kg of 1 , 3 - propanediol ( pdo ) were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of an esterification catalyst . nitrogen was then introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was increased to 245 ° c . during the esterification process , the byproducts water and 1 , 3 - pdo were separated by using a separation tower such that 1 , 3 - pdo was introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which is then cooled and recovered . the total esterification reaction time was 3 . 5 hours . the esterified product bhpt was cooled and crushed , by which the saponification value can be determined , and the saponification value was then converted to have a calculated esterification conversion of 98 . 1 %. the reaction conditions are summarized in table 1 . 55 kg of tpa , 27 kg of ethylene glycol ( eg ), and 4 . 5 kg of bhpt ( obtained from example 1 ) were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of the sb 2 o 3 catalyst . the molar ratio of eg and tpa was 1 . 3 , whereas the molar ratio of tpa and bhpt was 95 : 5 . in addition , nitrogen was introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was increased to 255 ° c . during the esterification process , the byproducts water and 1 , 3 - pdo were separated by using a separation tower such that 1 , 3 - pdo was introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which is then cooled and recovered . the total esterification reaction time was 3 . 3 hours . the esterified product was then moved into a polymerization vessel to proceed the polymerization reaction . the vacuum was equal to or less than 1 torr . furthermore , the polymerization temperature was controlled to 255 ° c .- 270 ° c ., and the stirring rate was first 60 rpm and then decreased to 30 rpm during the reaction . the total polymerization time was 3 . 5 hours . finally , the ppt / pet copolyester product in molten form was extruded into filaments , cooled in a cool water vessel , and then cut into ppt / pet copolyester chips having an intrinsic viscosity ( iv ) of 0 . 62 dl / g . the reaction conditions are summarized in table 1 . the composition , intrinsic viscosity , and thermal properties of the ppt / pet copolyester are shown in table 2 . 50 kg of tpa , 24 . 3 kg of eg , and 19 . 1 kg of bhpt ( obtained from example 1 ) were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of the sb 2 o 3 catalyst . the molar ratio of eg and tpa was 1 . 3 , whereas the molar ratio of tpa and bhpt was 82 : 18 . nitrogen was introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was increased to 245 ° c . during the esterification process , the byproducts water and 1 , 3 - pdo were separated by using a separation tower such that 1 , 3 - pdo was introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which was then cooled and recovered . the total esterification reaction time was 3 . 5 hours . the esterified product was then moved into a polymerization vessel to proceed the polymerization reaction . the vacuum was equal to or less than 1 torr . furthermore , the polymerization temperature was controlled to 245 ° c .- 255 ° c ., and the stirring rate was first 60 rpm and then decreased to 30 rpm during the reaction . the total polymerization time was 4 hours . finally , the ppt / pet copolyester product in molten form was extruded into filaments , cooled in a cool water vessel , and then cut into ppt / pet copolyester chips having an intrinsic viscosity ( iv ) of 0 . 66 dl / g . the reaction conditions are summarized in table 1 . the composition , intrinsic viscosity , and thermal properties of the ppt / pet copolyester are shown in table 2 . 30 kg of tpa , 7 . 3 kg of eg , and 8 . 9 kg of 1 , 3 - pdo were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of the sb 2 o 3 catalyst . the molar ratio of eg and 1 , 3 - pdo was 50 : 50 . nitrogen was introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was gradually increased to 240 ° c . during the esterification process , the byproducts water , eg and 1 , 3 - pdo were separated by using a separation tower such that eg and 1 , 3 - pdo were introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which was then cooled and recovered . the total esterification reaction time was 3 hours . the esterified product was then moved into a polymerization vessel to proceed the polymerization reaction . the vacuum was equal to or less than 1 torr , and the polymerization temperature was controlled to 245 ° c .- 255 ° c . the total polymerization time was 2 . 5 hours . finally , the ppt / pet copolyester product in molten form was extruded into filaments , cooled in a cool water vessel , and then cut into ppt / pet copolyester chips having an intrinsic viscosity ( iv ) of 0 . 55 dl / g . the reaction conditions are summarized in table 1 . the composition , intrinsic viscosity , and thermal properties of the ppt / pet copolyester are shown in table 2 . the ppt / pet copolyester was determined for dma and the obtained tg curve has only one peak , indicating that the ppt / pet copolyester is a homogeneous phase , not a mixture of ppt and pet . 50 . 6 kg of tpa and 30 . 2 kg of 1 , 3 - pdo were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of the sb 2 o 3 catalyst . nitrogen was introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was gradually increased to 245 ° c . during the esterification process , the byproducts water and 1 , 3 - pdo were separated by using a separation tower such that 1 , 3 - pdo were introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which was then cooled and recovered . the total esterification reaction time was 3 . 5 hours . the esterified product was then moved into a polymerization vessel to proceed the polymerization reaction . the vacuum was equal to or less than 1 torr , the polymerization temperature was controlled to about 255 ° c . and the stirring rate was first 60 rpm and then decreased to 30 rpm during the reaction . the total polymerization time was 4 hours . finally , the ppt product in molten form was extruded into filaments , cooled in a cool water vessel , and then cut into ppt chips having an intrinsic viscosity ( iv ) of 0 . 8 dl / g . the reaction conditions are summarized in table 1 . the ppt / pet copolyester chips obtained from example 2 and example 3 , and the ppt chips obtained from example 5 were melt spun in a spinning machine at a spinning temperature of 200 ° c . to 260 ° c . and at a spinning rate of 3000 m / min into partially oriented yarns ( poy ) having a fineness of 1 . 3 dpf ( deniers per filament ), a strength of 2 . 3 g / d , and an elongation of higher than 100 %. the poy of polyester was then spun by a textured machine into draw - textured yarns ( dty ) of 0 . 9 dpf . the strength of the ppt / pet copolyester dty prepared from the chips of example 2 was higher than 2 . 9 g / d , and the strength of the ppt / pet copolyester dty prepared from the chips of example 3 was higher than 3 . 4 g / d . further , the pet fiber from hualon corporation ( tradename : p - dty 75d / 72f ) and the above three kinds of ppt / pet copolyester dty fibers were made into circular knits and then dyed . the dyed samples were measured for color strength ( the total k / s reflectivity ), washing fastness , and light fastness to compare their dyeability . the results are shown in table 3 . the washing fastness and light fastness were expressed by ratings . rating 4 indicates excellent while rating 2 indicates fair . the color strength was expressed by the total k / s reflectivity . larger k / s value indicates that the sample was dyed deeper . it can be seen from table 3 that the pet textile and the ppt / pet copolyester textile have a better dyeability than the pet textile . the ppt / pet copolyester textile with an ethylene to propylene molar ratio of 74 : 26 ( from example 3 ) has a even better dyeability than the ppt textile . the foregoing description of the preferred embodiments of this invention has been presented for purposes of illustration and description . obvious modifications or variations are possible in light of the above teaching . the embodiments were chosen and described to provide the best illustration of the principles of this invention and its practical application to thereby enable those skilled in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . all such modifications and variations are within the scope of the present invention as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly , legally , and equitably entitled . | 3 |
while the present disclosure is described with reference to several illustrative embodiments described herein , it should be clear that the present disclosure should not be limited to such embodiments . therefore , the description of the embodiments provided herein and the references to magnetic resonance imaging ( mri ) systems are examples of the systems utilizing superconducting magnets and are merely illustrative of the present disclosure and should not limit the scope of the disclosure as claimed . it will be appreciated by those skilled in the art that the disclosed methods are applicable to many other systems using superconducting magnets . briefly described , a method and a system are disclosed for saving energy in keeping many superconducting magnets appropriately cold , while a superconducting magnet is not being used , by discharging the magnet and keeping it in temperatures between the critical temperature of the magnet and the ambient temperature . traditionally , even if a superconducting magnet system is not being actively used for a while , whether a weekend or a month , the temperature of the “ cold mass ,” which is defined as the coils and structure components that operate at below critical temperature of the coils , is not allowed to rise above critical temperature of the superconducting coils of the superconducting magnet system . mri scanners are used for biomedical research and diagnosis of human disease and disorder . imaging by an mri scanner requires a very uniform , constant , and stable magnetic field over a specific volume . conventionally , such a magnetic field , often referred to as a b 0 field , is produced by a permanent or superconducting magnet . for human applications , mri devices that use permanent magnets typically generate b 0 magnetic fields of less than 0 . 5 t , and for research on animals they generate less than 1 . 5 t . for higher resolution imaging , superconducting magnets need to produce higher magnetic fields . superconducting b 0 magnets use coils which must be maintained at cryogenic temperatures that are lower than the critical temperature of the superconducting coils . conventionally , to achieve this , the coils of a superconducting mri magnet operate in a pool / bath of boiling liquid helium under close to 1 atmosphere of pressure that keeps the coils at about 4 . 2k . typically , the liquid helium fills parts of the helium vessel and the rest is helium vapor that is allowed to vent to ambient atmosphere . as shown in fig1 , the helium vessel is surrounded by a radiation shield and both , the helium vessel and the surrounding radiation shield , are placed inside an exterior vessel . the exterior vessel includes certain vacuum space . the vessel , the radiation shield , the liquid helium vessel , and certain other parts are called a “ cryostat .” the cryostat reduces and minimizes heat transfer to the helium vessel . but inevitably there is heat transfer to helium vessel and eventually to the liquid helium bath by : 1 ) conduction through structural members of the cryostat , radiation shield , and the helium vessel ; 2 ) radiation ; and 3 ) residual partial pressure in the vacuum space . the heat transferred to the liquid helium bath naturally keeps the liquid helium in boiling condition and , therefore , in continuous generation of helium vapor , which vents to the atmosphere . in certain superconducting magnets , called zero - boil - off systems , the vaporized helium gas is re - condensed to liquid helium by a cryocooler and returned to the liquid helium bath . contrary to its name , zero - boil - off , the re - condensing is not 100 % and some helium vapor vents to the atmosphere . in a superconducting magnet where the coils are placed in a liquid helium bath , whether the magnet is of zero - boil - off type or not , the temperature of the liquid helium is essentially constant because the liquid helium bath is at its boiling point , and the temperature can only change if all or most of the liquid helium vaporizes . for superconducting magnets that use liquid helium , the goal of the cryostat is to maintain the liquid helium in its vessel with the least amount of loss to the atmosphere . there is no incentive to have the coils at any temperature appreciably above that of the boiling liquid helium . because if the temperature increases , no liquid helium will remain in the vessel and superconducting coils will need to be discharged or be allowed to quench . in such a case , to revert back to the operating conditions , one needs to refill the helium vessel with liquid helium , which requires a significant effort . also , since superconducting magnets in conventional mri systems operate in persistent mode and stay charged , there is no benefit in discharging them at any time . the mri superconducting magnets are only discharged to service the magnet . the charge and discharge of these magnets require significant time and effort and are typically avoided for as long as possible . in order to achieve a constant magnetic field , superconducting magnets of mri systems operate in the so called persistent mode , where the current circulates through a set of superconducting coils that are connected in series by superconducting joints to form a superconducting loop . additionally , to reach persistent mode , the set of coils need to have a persistent switch . principles of persistent mode operation are described , for example , in superconducting magnets , m . n . wilson , oxford university press , new york , n . y . ( 1983 ), chapter 11 . there are many other superconducting magnets that operate in a direct current ( dc ) mode such as those used in nuclear magnetic resonance ( nmr ) spectroscopy or particle accelerators , which preferably operate in persistent mode . in conclusion , the conventional superconducting magnets , such as mri superconducting magnets , stay charged with their coils in a pool of liquid helium . again , there is no incentive to increase the temperature of the coils and discharge these systems because there is a significant penalty for increasing the temperature of these coils and discharging these magnets . even in the zero - boil - off systems there is no incentive to slow down the cryocooler , because doing so will increase the rate of helium vapor venting through the cryostat . and if venting is restricted , the pressure inside the helium vessel will increase and will have serious implications . therefore , customarily , the users of such systems leave their systems on , even when their systems stay idle . an alternative to the class of liquid helium cooled superconducting magnets discussed above is the class of cryogen - free ( cf ) superconducting magnets . cf superconducting magnets are cooled to very low temperatures by one or more two - stage cryocoolers ( also known as cryo - refrigerator ) that make physical contact with selected parts of the magnet system and extract heat by conduction . this method of cooling is commonly referred to as cryogen free or conduction cooling . the amount of cooling ( removal of heat ) that is provided by a two - stage cryocooler can be a few tens of watts for the first stage to reach , for example , a temperature of 30 ° to 60 ° k ., and a few watts for the second stage to reach , for example , 3 ° to 10 ° k . if the desired temperature is to be maintained , the amount of heat transferred ( also known as heat leak ) to the superconducting magnet from the environment should be reduced to or be lower than the cooling capacity of the cryocooler . typically , a cf superconducting magnet includes several parts including a vacuum vessel , radiation shield , mechanical support structure , electrical connection , various sensors , valves , and coils made from superconducting wires . fig2 shows a schematic diagram of a cryogen - free superconducting magnet . for the superconducting magnet to operate properly and produce the required magnetic field , the temperature of the coils made from superconducting wires ( superconducting coils ), the structure , the connections that keep the coils together , need to be kept below the critical temperature of the superconducting coils . similar to the liquid helium cooled superconducting magnet , in a cf superconducting magnets the superconducting coils , the structure , and the connections which keep the coils together may be referred to as “ cold - mass .” the convection heat transfer to the cold - mass is reduced by removing the gases , such as air , which may surround the cold - mass . air may be removed by housing the cold - mass inside a vacuum chamber . radiation heat transfer is reduced by housing the cold - mass inside a radiation shield , which in turn is housed within the vacuum chamber . the radiation shield is cooled by the first stage of the cryocooler to a temperature of , for example , 30 ° to 60 ° k ., and is usually covered on the side facing the vacuum chamber with several layers of reflective insulation , often referred to as “ super - insulation .” a conduction cooled systems is distinguished from a liquid helium cooled system by the fact that the cold - mass of the conduction cooled system and , therefore , its superconducting coils , operate in vacuum and that the temperature of the coils of the conduction cooled system can be allowed to increase without the penalties associated with handling of liquid helium or helium vapor . according to the methods disclosed in this application , cf superconducting magnets , for example those in mri systems , do not need to remain at a given temperature or stay charged even when they are not being used . to reach an “ idle mode ,” these magnets are discharged and the temperature of their cold - masses is permitted to increase by making the cryocooler work at lower cooling capacity or even stop for periods of time , which in turn saves some energy that otherwise will be used by the cryocooler . to prepare for the idling mode according to the present disclosure , the superconducting magnet is discharged by transferring its stored energy to heat exchangers outside of the magnet and by running the cryocooler at a lower cooling capacity . in the disclosed idling mode the temperature of the coils , while higher than the superconducting critical temperature , is not allowed to rise as high as the room temperature . however , during this process the temperatures of the first and the second stage of the magnet system reach higher values . for example , the temperature of the first stage parts , such as the radiation shield , may increase by 10 ° to 30 ° k ., and the temperature of the second stage parts , such as coils , may also increase by 10 ° to 40 ° k . in the disclosed idling mode , the cryocooler power consumption will be significantly lower than it is during the superconducting mode . according to this disclosure , an mri magnet is shifted to idling mode when the magnet is not going to be used for an extended period of time , such as for days or weeks . in anticipation of the magnet reuse , the cooling system is switched from idling mode to full cooling mode , where the magnet cools to a superconducting state and is recharged . recooling the first stage and the second stage by 10 ° to 40 ° k . can be achieved in a few hours rather than a few days that are required to cool a magnet down from room temperature . one of the key advantages of the disclosed idling mode , compared to keeping the magnet in superconducting state , is that a great amount of energy , which actually would have been wasted during an inactive time interval , is saved . as previously mentioned , the disclosed idling method may be applied to persistent mode superconducting magnets used in nuclear magnetic resonance ( nmr ) spectroscopy applications as well . this method may also be applied to the so called driven superconducting magnets where the coils of the superconducting magnet are connected to a current power supply that charges the coils and keeps them charged . those skilled in the art will recognize that many known means and methods may be adopted to control the cold - mass temperature and keep the cold - mass at any desired temperature between the room temperature and cryogenic temperatures , during the idling mode . for example a programmable or a preprogrammed idling switch may be included in the disclosed superconducting magnet system which can be turned on to initiate the lowering of the cooling capacity of the first and the second stages of the cryocooler and maintain the cold - mass at a programmed temperature , and which can be turned off to cool down the cold - mass to a desired cryogenic temperature . a preprogrammed idling switch may have used software or be hardwired . in another example , a user of the system may manually , using a control mechanism , set the first and the second stage temperature increases of the cold - mass based on the planned idling time . in yet another example , a calibrated control component such as a knob , a dial , or a slide switch may be used to set the idling mode temperature based on tabulated energy savings . those skilled in the art will recognize that the cold - mass of a conduction cooled superconducting magnet system may include modules of materials that increase the heat capacity of the cold - mass so that during interruption to the cooling system the temperature of the cold - mass rises slower than otherwise . these modules may include metals , polymers , and ceramics . also these modules may include hermetically sealed containers that contain gases such as neon , nitrogen , or helium . clearly the higher the idling temperature for the first stage and second stage of the cryocooler is the more energy is saved ; however , more time will be needed to re - cool the system back to superconducting and therefore the operating mode ( up - time ). therefore the overall operation of a cf superconducting magnet being able to switch to an idling mode may be such that to optimize the energy savings and the up - time of the magnet system . for example if the system is to be in idling mode just for a weekend , the first stage and the second stage of the magnet system may be set to idle at 20 k , and 50 k respectively , but if the system is to be idling for a week or more , the first stage and the second stage of the magnet system may be set to idle at 40 k , and 60 k . in the former case , re - cooling time or up - time is shorter than in the latter case , but the extra energy savings may justify the extra cooling time of the latter case . in various methods of controlling and or programming the idling temperatures the user of the cf superconducting magnet can decide on what are the optimum parameters for idling mode . changes can be made to the claimed invention in light of the above detailed description . while the above description details certain embodiments of the invention and describes the best mode contemplated , no matter how detailed the above appears in text , the claimed invention can be practiced in many ways . details of the system may vary considerably in its implementation details , while still being encompassed by the claimed invention disclosed herein . particular terminology used when describing certain features or aspects of the invention should not be taken to imply that the terminology is being redefined herein to be restricted to any specific characteristics , features , or aspects of the invention with which that terminology is associated . in general , the terms used in the following claims should not be construed to limit the claimed invention to the specific embodiments disclosed in the specification , unless the above detailed description section explicitly defines such terms . accordingly , the actual scope of the claimed invention encompasses not only the disclosed embodiments , but also all equivalent ways of practicing or implementing the claimed invention . the above specification , examples , and data provide a complete description of the manufacture and use of the composition of the invention . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended . it is further understood that this disclosure is not limited to the disclosed embodiments , but is intended to cover various arrangements included within the spirit and scope of the broadest interpretation so as to encompass all such modifications and equivalent arrangements . it will also be understood by those skilled in the art that single - stage coolers and / or multiple coolers may be adopted in various embodiments to achieve the same results discussed in this disclosure . it will be understood by those within the art that , in general , terms used herein , and especially in the appended claims ( e . g ., bodies of the appended claims ) are generally intended as “ open ” terms ( e . g ., the term “ including ” should be interpreted as “ including but not limited to ,” the term “ having ” should be interpreted as “ having at least ,” the term “ includes ” should be interpreted as “ includes but is not limited to ,” etc .). it will be further understood by those within the art that if a specific number of an introduced claim recitation is intended , such an intent will be explicitly recited in the claim , and in the absence of such recitation no such intent is present . for example , as an aid to understanding , the following appended claims may contain usage of the introductory phrases “ at least one ” and “ one or more ” to introduce claim recitations . however , the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “ a ” or “ an ” limits any particular claim containing such introduced claim recitation to inventions containing only one such recitation , even when the same claim includes the introductory phrases “ one or more ” or “ at least one ” and indefinite articles such as “ a ” or “ an ” ( e . g ., “ a ” and / or “ an ” should typically be interpreted to mean “ at least one ” or “ one or more ”); the same holds true for the use of definite articles used to introduce claim recitations . in addition , even if a specific number of an introduced claim recitation is explicitly recited , those skilled in the art will recognize that such recitation should typically be interpreted to mean at least the recited number ( e . g ., the bare recitation of “ two recitations ,” without other modifiers , typically means at least two recitations , or two or more recitations ). furthermore , in those instances where a convention analogous to “ at least one of a , b , and c , etc .” is used , in general such a construction is intended in the sense one having skill in the art would understand the convention ( e . g ., “ a system having at least one of a , b , and c ” would include but not be limited to systems that have a alone , b alone , c alone , a and b together , a and c together , b and c together , and / or a , b , and c together , etc .). it will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms , whether in the description , claims , or drawings , should be understood to contemplate the possibilities of including one of the terms , either of the terms , or both terms . for example , the phrase “ a or b ” will be understood to include the possibilities of “ a ” or “ b ” or “ a and b .” while the present disclosure has been described in connection with what is considered the most practical and preferred embodiment , it is understood that this disclosure is not limited to the disclosed embodiments , but is intended to cover various arrangements included within the spirit and scope of the broadest interpretation so as to encompass all such modifications and equivalent arrangements . | 7 |
the surfaces of the two bones at the joint are covered in cartilage . articular cartilage is multi - layered . a thin superficial layer provides a smooth surface for the two bones to slide against each other . cartilage is composed of cells called condrocytes which are dispersed in a firm gel - like ground substance , called the matrix . the main purpose of cartilage is to provide a framework upon which bone deposition could begin . another important purpose of cartilage is to provide smooth surfaces for the movement of articulating bones . in order to illustrate the invention , the following examples are included . however , it is to be understood that these examples do not limit the invention and are only meant to suggest a method of practicing the invention . the following examples used hyaluronan prepared by the methods disclosed in japan patents 1284023 and 1353027 ( publication of examined application number : s60 - 009042 , title : separating method for acidic polysaccharides from connective tissues ; and patent number 1353027 , publication of examined application number : s61 - 021241 , title : separating method for acidic polysaccharides from connective tissues ), which concluding : hyaluronan of 6 , 000 , 000 dalton ( synvisc , biomatrix , usa ), of 600 , 000 - 1 , 200 , 000 dalton ( artzdispo , seikagaku , japan ), of 600 , 000 - 1 , 200 , 000 dalton ( hikamilon dispo , taisho pharmaceutical co ., ltd ., japan ), of 600 , 000 - 1 , 200 , 000 dalton ( lumisteron dispo , nissin , japan ), of 600 , 000 - 1 , 200 , 000 dalton ( unihylon dispo , uji , japan ), of 500 , 000 - 730 , 000 dalton ( hyalgan , fidia , italy ), and of 500 , 000 - 730 , 000 dalton ( suplasyn , bioniche , ireland ) hyaluronan reduced amounts of h 2 o 2 and inflammatory factors for demonstrating the effects of hyaluronan injected into patient &# 39 ; s articulation on the production of h 2 o 2 in synovial , we firstly drew the synovial from hyaluronan - treated patient and analyzed the content of free radical . the method for free radical analysis followed the method described in american journal of transplantation 2005 , 5 : 1194 - 1203 , which is incorporated herein by reference . briefly , the sampled synovial was colded on ice . 200 μl of the cold synovial was placed on iron plate , and then put into the detecting cell of chemiluminescence detector ( cla - fs1 , tohoku electronic ind . co ., sendai , japan ). after turning on the detector and measuring the backgroung for 50 sec , 500 μl of luminol ( from sigma corp ., usa , as 0 . 1 mm solution prepared by disolving the powder in phosphate buffer slution ( pbs ), stored at 4 ° c .) or lucigenin ( from sigma corp ., usa , as 0 . 1 mm solution prepared by disolving the powder in pbs , stored at 4 ° c . was added , and then the content of free radicals was measured in 300 sec , with one respective accumulative value obtained at the interval of 10 sec . the background integration in 300 sec was calculated by : ( average integration of time - count in 50 sec )× 30 . the average free radical count for each sample at the interval of 10 sec was calculated as follow : ( total area integration under time - count curve − background integration in 300 sec )÷ 25 . as showed in fig1 , hyaluronans with molecular weight of 500 , 000 to 8 , 000 , 000 dalton exhibited an effect on reducing the production of h 2 o 2 in synovial fluid . among the hyaluronans tested in this experiment , the effectiveness thereof in reducing the production of h2o 2 is 600 , 000 - 1 , 200 , 000 dalton & gt ; 500 , 000 - 730 , 000 dalton & gt ; 6 , 000 , 000 dalton . we also used the synovial fluid sampled f synovial fluid from untreated patient as a control . by the results showed in fig2 , the content of was significantly reduced in the synovial fluid from the hyaluronan - treated patients as compared to the control synovial fluid , which contained high level of free radicals such as o 2 −. , h 2 o 2 . the production of free radicals and mortality of chondrocytes were deminished by hyaluronan in vitro in order to realize the in vitro effects of hyaluronan on the reactivity of free radicals , such as h 2 o 2 , we took 200 μl of h 2 o 2 at various concentrations ( 0 , 100 , 200 , and 400 μm ) for analysing the presence of free radicals by chemiluminescence detector . additionally , 20 μl of hyaluronan was provided at the presence of 200 μm h 2 o 2 . the content of free radical was measured as described above . results were showed in fig3 a . the level of free radical was increased as the increasing concentrations of h 2 o 2 . however , the production of free radical was inhibited at the presence of hyaluronan ( with 200 μm h 2 o 2 ), which was almost at the same level in the h 2 o 2 - untreated group ( i . e ., the group at the presence of 0 μm h 2 o 2 ). for knowing that the increased contents of free radical will cause cell death , we also investigated effects of hyaluronan on the mortality caused by free radicals . the cartilage tissue was collected from a patient older than 60 years old . the primary chondrocytes were isolated and cultured in appropriate medium and conditions described as follow . the collected cartilage tissue was weighed in a centrifuge tube , and then washed with 10 ml pbs twice . the washed cartilage tissue was transferred onto a 10 cm cell culture dish by a blunt forceps and washed with 10 ml pbs once again . the soft tissue and bone tissue attaching to the cartilage were excised with a scalpel . the separated white cartilage tissue was transferred onto a 10 cm cell culture dish , and then divided into pieces having volume less than 1 mm 3 by using a scalpel . to the cell culture dish containing cartilage pieces 60 μl of typr ii cellulose ( 100mg / ml ) was added , and then shaken on a shaker ( 50 rpm ) at 37 ° c ., 5 % co 2 for 4 hr . the digested cartilage tissue was washed with 5 ml of culture medium . the separated cells were transferred into a sterile 15 ml centrifuge tube , and washed with 10 ml pbs twice . the cells were resuspended in 10 ml of culture medium . 50 μl of the cell culture was sampled for counting viable chondrocytes . 40 μl pbs and 10 μl of 10 × trypan blue were added to the sampled cell culture , mixed thoroughly and 10 μl of the mixture was dropped into hemocytometer . the cell density was calculated as follow : total counted cell no in 9 lattices x 2 × 10 4 / 9 = cell no ./ ml . chondrocytes were inoculated into a flask at the density of 1 × 10 4 / ml , and cultured at 37 ° c ., 5 % co 2 , with changing fresh medium every three days . for the displacement of fresh medium , the culture medium was drawn off by a disposable pipette , and 10 ml pbs was carefully added along the wall of flask . after shaking the culture flask gently , pbs was drawn off and 12 ml of fresh medium was added , and then the culture flask was incubated at 37 ° c ., 5 % co 2 . for the in vivo test , various concentrations ( 0 , 100 , 200 , and 400 μm ) of h 2 o 2 were added to the cell culture respectively , with the two additional groups added 0 and 200 μm h 2 o 2 each plus 20 μl of hyaluronan . the chondrocytes were cultured for one day under the h 2 o 2 treatment , and then collected for detecting their viability . as shown in fig3 b , the viability of chondrocyte was decreased with the increasing concentrations of h 2 o 2 . on the contrary , however , the viability of chondrocyte was increased at the presence of hyaluronan . accordingly , it is suggested that hyaluronan possesses the ability to inhibit the production of free radicals , decrease the mortality of chondrocytes , and further improve the proliferation of chondrocytes . this experiment is provided to evaluate the effects of hyaluronan on the growth of chondrocytes in old patient &# 39 ; s joint . the chondrocytes from old patient were isolated and cultured as described in example 2 . chondrocytes were cultured to 80 % confluence and plated in 60 mm dish ( each contained about 8 × 10 4 cells ), then further cultured over night . the culture medium was replaced with fresh medium containing 1 mg / ml hyaluronan ( ha group ) or fresh medium only ( control group ), and the cultivation was continued till 12 days , with a replacement of culture medium ( with or without hyaluronan ) at day 5 . the initial cell number was counted at day 0 , and taken a count every 2 days . the growth curves of cultured cells were shown in fig4 . in day 2 to day 4 , the cell number of chondrocytes grew at the presence of hyaluronan ( ha group ) was significantly greater than control group of about 1 . 7 - fold . the cell number in ha group was greater than control group of above twofold at day 6 . hyaluronan promoted the growth of chondrocytes by controlling their cell cycle the chondrocytes from old patient were isolated and cultured as described in example 2 . chondrocytes were cultured to 80 % confluence and plated in 100 mm dish ( each contained about 3 × 10 5 cells ). the culture medium was replaced with medium containing 1 mg / ml hyaluronan ( ha group ) or fresh medium ( control group ) on next day , and the cultivation was continued till 8 days . cell sampling was begun at day 0 and kept at intervals of 2 days . the harvested cells were treated as described below for the analysis of cell cycle by a flow cytometery . the cultured chondrocytes were washed with pbs , trypsinized and suspended in 5 ml of culture medium containing 5 % fetal calf serum ( fcs ). the cells were washed with 5 ml cold pbs , and then fixed in 1 ml of 70 % alcohol at − 20 ° c . for more than 1 hr . the fixed cells were washed with 5 ml pbs and spun at low speed ( 1200 rpm / min ), then stained with 1 ml of propidium iodide ( pi )/ triton x - 100 solution ( which containg 0 . 1 % triton x - 100 , 0 . 2 mg / ml rnase a , and 20 μg / ml pi at final concentration , respectively ) at room temperature in the dark for 30 min . the sample was mixed throughly and filtered through 35 - μm nylon membrane before run on the flow cytometery ( fl2 - a ) for detecting the fluorescence expressed on cells . the results were shown in fig5 . referring to the detection of g0 / g1 phase in cell cycle ( fig5 a ), the % of cells in g0 / g1 phase in the control group was higher than those in ha group at day 4 , otherwise , there is no significant difference between those two groups . by the results in s phase detection ( fig5 b ), there is no statistical difference between ha and control groups from day 0 to day 8 . on the other hand , it was found that the % of cells in g2 / m phase in the ha group was much higher than those in control group at day 4 , but showed no difference after day 6 ( see , fig5 c ). hyaluronan promoted the growth of chondrocyte by up - regulating the expression of cyclin b1 ( g2 / m ) for further understanding the mechanism of hyaluronan action in modulating the cell cycle of chondrocyte , we investigated the expression of various cell cycle regulating factors at the prescence of hyaluronan ( 1 mg / ml ). the chondrocytes cultured and treated as described in example 2 were harvested at day 2 , 4 , 6 , and 8 and prepared for western blotting as follow . the harvested cells were washed with 1 × pbs three times , and ripa buffer ( containing 50 mm tris ( ph7 . 5 ), 150 mm nacl , 1 % np40 , 0 . 1 % sds , 0 . 5 % sodium deoxycholic acid , and proteinase inhibitor ) was added to lyse cell and release proteins . the cell lysate was collected in an eppendorf tube and spun at 12 , 000 rpm , at 4 ° c . for 30 min . the quantified supernatant containing 20 μg protein was mixed with sampling buffer ( with glycerin ) at the rate of 1 : 4 , and boiled in 100 ° c . water bath for 5 min . the prepared protein sample was loaded on sds - polyacrylamide gel for electrophoresis , and then transferred onto a nylon paper . the nylon paper was blocked with 5 % skimed milk in tris buffer at room temperature for 1 hr . the nylon paper was washed with tris buffer three times , each for 5 min . the primary antibody was added and the mixture was shaked at room temperature for 1 hr or at 4 ° c . over night . the nylon paper was washed with tris buffer five times , each for 5 min . the secondary antibody was added and the mixture was shaked at room temperature for 40 min . the nylon paper was washed with tris buffer as described above . the chemiluminescence detecting kit ( ecl kit ) was added and reacted at room temperature for 1 min , and then developed in dark room . as shown in fig6 , the expression of g0 / g1 phase regulating proteins , such as cyclin d1 , cdk4 , and cdk6 , exhibited no difference between the control and ha groups . however , the g2 / m phase regulating protein , cyclin b1 , exhibited higher expression level in ha - treated cells than those in control group . furthermore , the expression of cyclin b13 - associated protein cdc2 was unchanged . the present invention has been illustrated by the embodiments and examples described above . the skilled in the art will appreciate that any modification or change can be made as if not depart from the spirit and scope of the invention . the present invention was encompassed in the appended claims . | 0 |
the smpte control time code for a single frame and part of two adjacent frames is shown in fig1 to which reference is now made . for each frame the control time code comprises 80 binary bits . bits 0 to 63 provide the time and frame codes as well as spare bits for use by the user if desired . bits 64 to 79 comprise a sync word . the control time code is conventionally recorded in a linear track as a phase - modulated serial code , usually referred to as a biphase mark . the control time code is selfcontained and self - clocking and is immune to 180 ° phase reversals . since it is a square wave , it can be recorded using a saturated or unsaturated recording method . each sync word is the same as shown at the bottom of fig1 . the 16 - bit pattern of the sync word is unique , in the sense that it cannot occur elsewhere in the control time code , and it provides both an indication of the direction in which the video tape is being transported , that is , in the forward or reverse direction of transport ( marked f and r in fig1 ), and also identifies the beginning and / or ending of the set of 80 bits corresponding to a frame , so that the 64 bits providing the time and frame codes can be extracted for processing . the 64 bits providing the time and frame codes include , as shown from right to left in fig1 bits for tens of hours , 4 bits for units of hours , 4 bits for tens of minutes , 4 bits for units of minutes , 4 bits for tens of seconds , 4 bits for units of seconds , 4 bits for tens of frames and 4 bits for units of frames . each of these groups of 4 bits is preceded by a respective group of 4 bits which the user can use for his own purposes if desired . in the example shown , the binary digits indicated show that the particular frame is identified by a time code of 23 hours , 59 minutes , 59 seconds and is frame number 29 within that second . although there are further refinements to the smpte control time code , since they are not material to the present invention , they are omitted . full details can be found in the journal of the smpte vol . 79 , dec . 1970 , pp . 1086 to 1088 . the ebu control time code is very similar to the smpte control time code , the differences in form and content between them are not significant to the present invention , except as concerns frame frequency . the smpte control time code is normally used for video signals with a frame frequency of 30 frames per second and the ebu control time code is normally used for video signals with a frame frequency of 25 frames per second . when using a vtr , each frame , or alternatively each field of a video signal is recorded in a respective track of a video magnetic tape , the tracks being disposed obliquely relative to the direction of transport of the video tape , and in recording and reproduction a rotary magnetic head arrangement scans the video tape . during reproduction , the scanning is under the control of a control signal which is derived from a control signal track running lengthwise along the edge of the video tape . the video tape also carries at least a number 1 and a number 2 or cue audio tracks , also running lengthwise along the video tape . the control time code may be recorded in the number 2 audio track or in the oblique tracks during the vertical blanking intervals of the video signal . the present invention derives the control time code from the video tape , determines the direction of tape transport from the sync word , and extracts the 64 bits providing the time and frame codes . the embodiments of the invention make use of the fact that the control time code for recorded video signals in which the frame frequency is 30 frames per second contains frame numbers which do not occur with recorded signals in which the frame frequency is 25 frames per second . in the following description it is assumed that , when there are 30 frames per second , the 30 frames in a second are numbered 00 to 29 , and when there are 25 frames per second , the 25 frames are numbered 00 to 24 , as is the usual practice . where the frame frequency is 30 frames per second , therefore , there exist frame numbers 25 , 26 , 27 , 28 and 29 which do not exist when the frame frequency is 25 frames per second . it will be clear to those skilled in the art how the present invention may be modified if the frames are numbered 1 to 30 and 1 to 25 . detection based on the frame numbers can be done independently of the direction of tape transport and of the speed of tape transport , and no modification of the control time code is required to enable the frame frequency to be detected . the first embodiment of the invention is described with reference to fig2 . the control time code derived from a video tape ( not shown ) may be supplied to an input terminal 1 connected to a code reader 2 , or alternatively , code reader 2 may extract the control time code from a reproduced signal derived from the video tape and supplied to input terminal 1 . code reader 2 detects the direction of tape transport from the sync word , and in dependence thereon supplies a signal pd which is high or &# 34 ; 1 &# 34 ; for tape transport in the forward direction and low or &# 34 ; 0 &# 34 ; for tape transport in the reverse direction . signal pd is supplied to one input of each of and gates 10 and 11 , and via respective inverters 24 and 25 to one input of each of and gates 9 and 12 . the signal pd may be used by indicating apparatus ( not shown ) to provide a visual indication of the tape transport direction . code reader 2 also develops a clock pulse signal cp1 synchronized to the frame frequency of the control time code , and supplies clock signal cp1 to a memory 3 , a delay 15 , and one input of an and gate 16 . code reader 2 also extracts the 64 bits providing the time and frame codes and supplies them to memory 3 for storage therein . an output 4 is optionally connected from memory 3 , for supplying the time and frame codes to a display 22 or a television picture monitor 23 . display 22 , or the monitor 23 , if provided , may incorporate decoding means to decode the time and frame codes and to provide a visual display of the time and frame number either alone or in association with a television picture , respectively . memory 3 also derives a frame code signal sf , suitably of 8 bits , comprising 4 bits for the tens of frames and 4 bits for the units of frames , which is supplied to respective frame code detectors 5 , 6 , 7 and 8 . frame code detector 5 supplies an output signal s00 which is &# 34 ; 1 &# 34 ; when the frame code signal sf represents frame 00 , and is &# 34 ; 0 &# 34 ; at all other times . likewise , frame code detectors 6 , 7 and 8 respectively supply output signals s24 , s35 and s29 which are &# 34 ; 1 &# 34 ; when frame code signal sf represents frames 24 , 25 and 29 respectively , and are &# 34 ; 0 &# 34 ; at all other times . the outputs of frame code detectors 5 , 6 , 7 and 8 are supplied to second inputs of and gates 9 , 10 , 11 and 12 , respectively . the outputs of and gates 9 and 10 are connected to two inputs respectively of an or gate 13 . the two outputs of and gates 11 and 12 are connected to two inputs of an or gate 14 . the output of or gate 13 is connected by way of delay 15 to the other input of and gate 16 . the output of and gate 16 supplies a gated clock pulse signal cp2 which is applied to the clock input ck of a jk flip - flop 17 . the output of or gate 14 is connected directly to the j input of flip - flop 17 , and by way of an inverter 26 to the k input flip - flop 17 . an output signal is derived at an output terminal 18 connected to the q output of flip - flop 17 . for reasons which will be explained below this output signal is &# 34 ; 1 &# 34 ; when the input control time code corresponds to a frame frequency of 30 frames per second and is &# 34 ; 0 &# 34 ; when the input control time code corresponds to a frame frequency of 25 frames per second . this output signal can therefore be used to provide an indication and / or effect a control , for example in a dual - standard vtr . in particular , in a dual - standard vtr , the output signal can be used to ensure reproduction of a recorded video signal at the appropriate frame frequency , and on the assumption that a recorded signal with a frame frequency of 30 frames per second is an ntsc system signal , and a recorded signal with a frame frequency of 25 frames per second is a ccir system signal , can condition the vtr to effect appropriate decoding . the way in which the embodiment of fig2 derives the appropriate output signal will now be explained with reference to fig3 a to 3f which show waveforms of signals produced when the control time code supplied to input terminal 1 is an smpte control time code associated with a video signal having a frame frequency of 30 frames per second reproduced from a video tape running in the forward tape transport direction . clock signal cp1 ( fig3 a ), derived by code reader 2 , comprises short pulses with a repetition frequency synchronized with the frame frequency of the control time code . the precise value of this frequency varies depending on the speed at which the video tape is being transported . since the tape transport direction is forward , signal pd enables and gates 10 and 11 , but signal pd , inverted in inverters 24 and 25 inhibits , or makes nonconductive , and gates 9 and 12 . when the frame code for frame 24 is supplied to frame code detector 6 , the output signal s24 thereof changes from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ; ( fig3 b ). the resulting pulse passes and gate 10 and , after being delayed by one frame period by delay 15 , is supplied to and gate 16 . this delayed pulse , ( fig3 c ) acts as a gating pulse for clock signal cp1 at and gate 16 , to allow one short pulse from clock signal cp1 to pass in order to form the gated clock pulse signal cp2 ( fig3 d ). when the frame code for frame 25 is supplied to frame code detector 7 , the output signal s25 thereof changes from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ; ( fig3 e ), and the resulting pulse passes and gate 11 and or gate 14 , to be applied to the j and k inputs of flip - flop 17 directly and after inversion respectively . in coincidence with this , the short gated clock pulse cp2 is supplied to flip - flop 17 . as is conventional , when a clock signal is applied to the clock input ck of jk flip - flop 17 , its set output q is forced to agree with the signal at its j input . thus , a &# 34 ; 1 &# 34 ; output signal is developed at the q output of flip - flop 17 ( fig3 f ). if the q output of flip - flop 17 was originally &# 34 ; 1 &# 34 ;, it remains &# 34 ; 1 &# 34 ;. this condition indicates 30 frames per second . reference is now made to fig4 a to 4f , which show waveforms developed when the control time code supplied to the input terminal 1 is an ebu control time code associated with a video signal having a frame frequency of 25 frames per second and which are reproduced from a video tape operating in the forward tape transport direction . the signals cp1 , s24 , s24 delayed one frame period and gated clock pulse signal cp2 ( fig4 a , 4b , 4c , and 4d ) are similar to those described above with reference to fig3 a to 3d . it will , however , be noticed that in this case the delayed pulse ( fig4 c ) coincides with the first frame period , that is the frame 00 , in the next second . moreover , since no frame numbered 25 exists in this code , no frame code for a frame 25 is supplied to frame code detector 7 . therefore , the output signal s25 of frame code detector 7 remains &# 34 ; 0 &# 34 ; ( fig4 e ). the short gated clock pulse signal cp2 is therefore supplied to the clock input ck of flip - flop 17 while a &# 34 ; 0 &# 34 ; is supplied to its j input . the output signal at the q output of flip - flop 17 becomes &# 34 ; 0 &# 34 ; ( fig4 f ), or , alternatively , if the q output of flip - flop 17 was already &# 34 ; 0 &# 34 ;, it remains &# 34 ; 0 &# 34 ;. this condition indicates 25 frames per second . although is no reason to believe that the embodiment in fig2 should fail to provide the correct output at output terminal 18 at the first transition from one second to the next , if such a failure should occur ; as the operation described above is repeated every second . thus , any failure to provide the correct output as the first transition is very quickly rectified . it will also be noticed that once flip - flop 17 is in the appropriate condition , no further switching of flip - flop 17 occurs . the output signal an output terminal 18 thus remains steady at &# 34 ; 1 &# 34 ; or &# 34 ; o &# 34 ; as appropriate . the following paragraphs describe the operation when the video tape is transported in the reverse tape transport direction . fig5 a to 5f show waveforms developed when the control time code supplied to the input terminal 1 is an smpte control time code associated with a video signal having a frame frequency at 30 frames per second , derived from a reverse direction of tape transport . since the tape transport direction is reversed signal pd enables and gates 9 and 12 , but not and gates 10 and 11 . when the frame code for frame 00 is supplied to frame code detector 5 , the output signal s00 thereof changes from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ; ( fig5 b ). the resulting pulse passes and gate 9 and , after being delayed one frame period by delay 15 , is supplied to and gate 16 . this delayed pulse ( fig5 c ) acts as a gating pulse for clock signal cp1 at and gate 16 to allow one short gated clock pulse cp2 to pass and gate 16 ( fig5 d ). when the frame code for frame 29 is supplied to frame code detector 8 , the output signal s29 thereof changes from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ; ( fig5 e ), and the resulting pulse passes and gate 12 and or gate 14 , to be applied to the j and k inputs of flip - flop 18 directly and after inversion respectively . in coincidence with this , the short gated clock pulse cp2 is supplied to flip - flop 17 . the output signal developed at the q output of the flip - flop 17 becomes &# 34 ; 1 &# 34 ; ( fig4 f ), or alternatively , if it is already &# 34 ; 1 &# 34 ;, it remains &# 34 ; 1 &# 34 ;. this signal applied to output terminal 18 indicates 30 frames per second , just as in the case when the tape transport direction was forward . fig6 a to 6g show waveforms developed when the control time code supplied to the input terminal 1 is an ebu control time code associated with a video signal having a frame frequency of 25 frames per second , derived from tape transport in the reverse direction . the signals cp1 , s00 , s00 delayed one frame period and cp2 , the waveforms of which are shown in fig6 a , 6b , 6c and 6d are generally similar to those described above with reference to fig5 a to 5d . it will , however , be noticed that the delayed pulse shown in fig6 c which originated in the first frame period 00 , is applied to and gate 16 during frame 24 of the adjacent second because of the reverse direction of tape transport . moreover , since there is no frame 29 in the ebu time code , no frame code for a frame 29 is supplied to frame code detector 8 , and there is therefore no pulse produced in output signal s29 ( fig6 e ). the short gated clock pulse signal cp2 is therefore supplied to the clock input ck of jk flip - flop 17 while a &# 34 ; 0 &# 34 ; exists at its j input . the output at the q output of flip - flop 17 therefore becomes &# 34 ; 0 &# 34 ; ( fig6 f ), or , alternatively , if already &# 34 ; 0 &# 34 ;, it remains &# 34 ; 0 &# 34 ;. this condition indicates 25 frames per second , just as in the case where the tape transport direction was forward . although the embodiment of fig2 includes memory 3 , this is merely a convenient means of storing the control time code and extracting the required parts from it . such extraction can be carried out without a memory 3 to store the control time code . also , delay 15 may provide a delay of more than one frame period , without departing from the scope of the invention . conforming modifications of a type which would be clear to one skilled in the art must be made to the embodiment to accommodate these differences . a second embodiment of the invention is described with reference to fig7 which illustrates only those parts of the embodiment necessary to describe how it differs from the first embodiment shown in fig2 . the second embodiment omits frame code detectors 7 and 8 of the first embodiment for detecting frames 25 and 29 . and gates 19 and 20 are provided with input signals s00 and s24 from frame code detectors 5 and 6 respectively . signal pd is supplied directly to one input of and gate 19 , and by way of an inverter 26 to one input of and gate 20 . the outputs of and gates 19 and 20 are respectively connected to two inputs of an or gate 21 , the output of which is connected to the j and k inputs of flip - flop 17 directly and by way of inverter 21 , respectively . the operation of the second embodiment is very similar to that of the first embodiment , and will therefore only be described briefly . when the control time code supplied to input terminal 1 is an smpte control time code corresponding to a frame frequency of 30 frames per second , signals are developed as shown in fig3 a to 3d . in particular the short gated clock pulse signal cp2 is supplied to flip - flop 17 . however , following frame 24 there is no &# 34 ; 1 &# 34 ; in signal s24 from frame code detector 6 ( fig3 b ). there is thus no output from or gate 21 . the output signal developed at the q output of flip - flop 17 becomes or remains &# 34 ; 0 &# 34 ; indicating 30 frames per second . when the control time code supplied to input terminal 1 is an ebu control time code corresponding to a frame frequency of 24 frames per second , signals will be developed as shown in fig4 a to 4d . the short gated clock signal cp2 is supplied to flip - flop 17 during frame 24 . signal singal s00 from the frame code detector 5 is &# 34 ; 1 &# 34 ; at this time , a &# 34 ; 1 &# 34 ; is applied from or gate 21 to the j input of flip - flop 17 . the output signal at the q output of flip - flop 17 becomes or remains &# 34 ; 1 &# 34 ; indicating 25 frames per second . generally similar operations occur when the tape transport direction is reversed , waveforms corresponding to fig5 a to 5d and 6a to 6d , respectively , being developed in response to smpte and ebu control time codes . again the output signal developed at the q output of the flip - flop 17 is , in this embodiment , &# 34 ; 0 &# 34 ; indicating 30 frames per second , or &# 34 ; 1 &# 34 ; indicating 25 frames per second . having described specific preferred embodiments of the invention with reference to the accompanying drawings , it is to be understood that the invention is not limited to these precise embodiments , and that various changes and modifications can be effected therein by one skilled in the art without departing from the scope and spirit of the invention as defined by the appended claims . | 6 |
embodiments of the present invention provide for a method and system for automatically rerouting data from an overbalanced logical circuit in a data network . when an overbalanced condition in a logical circuit is detected , the data in the overbalanced circuit may be rerouted to a “ logical failover network ,” thereby minimizing lost data until the overbalanced condition in the logical circuit is cleared . in the following detailed description , references are made to the accompanying drawings that form a part hereof , and in which are shown by way of illustration specific embodiments or examples . referring now to the drawings , in which like numerals represent like elements through the several figures , aspects of the present invention and the exemplary operating environment will be described . embodiments of the present invention may be generally employed in a data network 2 as shown in fig1 . the data network 2 includes local access and transport areas (“ latas ”) 5 and 15 which are connected by an inter - exchange carrier (“ iec ”) 10 . it should be understood that the latas 5 and 15 may be data networks operated by a commonly owned local exchange carrier (“ lec ”). it should be further understood that the iec 10 may include one or more data networks which may be operated by a commonly owned iec . it will be appreciated by those skilled in the art that the data network 2 may be a frame relay network , asynchronous transfer mode (“ atm ”) network , or any other network capable of communicating data conforming to layers 2 - 4 of the open systems interconnection (“ osi ”) model developed by the international standards organization , incorporated herein by reference . it will be appreciated that these networks may include , but are not limited to , communications protocols conforming to the multiprotocol label switching standard (“ mpls ”) networks and the transmission control protocol / internet protocol (“ tcp / ip ”), which are known to those skilled in the art . the data network 2 includes a network circuit which channels data between a host device 112 and a remote device 114 through the lata 5 , the iec 10 , and the lata 15 . it will be appreciated by those skilled in the art that the host and remote devices 112 and 114 may be local area network (“ lan ”) routers , lan bridges , hosts , front end processors , frame relay access devices (“ frads ”), or any other device with a frame relay , atm , or network interface . it will be further appreciated that in the data network 2 , the latas 5 and 15 and the iec 10 may include network elements ( not shown ) which support interworking to enable communications between host and remote devices supporting dissimilar protocols . network elements in a data network supporting interworking may translate frame relay data packets or frames sent from a host frad to atm data packets or cells so that a host device may communicate with a remote device having an atm interface . the latas 5 and 15 and the iec 10 may further include one or more interconnected network elements , such as switches ( not shown ), for transmitting data . an illustrative lec data network will be discussed in greater detail in the description of fig2 below . the network circuit between the host device 112 and the remote device 114 in the data network 2 includes a physical circuit and a logical circuit . as used in the foregoing description and the appended claims , a physical circuit is defined as the physical path that connects the end point of a network circuit to a network device . for example , the physical circuit of the network circuit between the host device 112 and the remote device 114 includes the physical connection 121 between the host device 112 and the lata 5 , the physical connection 106 between the lata 5 and the iec 10 , the physical connection 108 between the iec 10 and the lata 15 , and the physical connection 123 between the lata 15 and the remote device 114 . routers and switches within the latas 5 and 15 and the iec 10 carry the physical signal between the host and remote end devices 112 and 114 through the physical circuit . it should be understood that the host and remote devices may be connected to the physical circuit described above using user - to - network interfaces (“ unis ”). as is known to those skilled in the art , an uni is the physical demarcation point between a user device ( e . g ., a host device ) and a public data network . it will further be understood by those skilled in the art that the physical connections 106 and 108 may include trunk circuits for carrying the data between the latas 5 and 15 and the iec 10 . it will be further understood by those skilled in the art that the connections 121 and 123 may be any of various physical communications media for communicating data such as a 56 kbps line or a t1 line carried over a four - wire shielded cable or over a fiber optic cable . as used in the foregoing description and the appended claims , a logical circuit is defined as a portion of the network circuit wherein data is sent over variable communication data paths or logical connections established between the first and last network devices within a lata or iec network and over fixed communication data paths or logical connections between latas ( or between iecs ). thus , no matter what path the data takes within each lata or iec , the beginning and end of each logical connection between networks will not change . for example , the logical circuit of the network circuit in the data network 2 may include a variable communication path within the lata 5 and a fixed communication path ( i . e ., the logical connection 102 ) between the lata 5 and the iec 10 . it will be understood by those skilled in the art that the logical connections 102 and 104 in the data network 2 may include network - to - network interfaces (“ nnis ”) between the last sending switch in a lata and the first receiving switch in an iec . as is known to those skilled in the art , each logical circuit in a data network may be identified by a unique logical identifier . in frame relay networks , the logical identifier is called a data link connection identifier (“ dlci ”) while in atm networks the logical identifier is called a virtual path identifier / virtual circuit identifier (“ vpi / vci ”). in frame relay networks , the dlci is a 10 - bit address field contained in the header of each data frame and contains identifying information for the logical circuit as well as information relating to the destination of the data in the frame and service parameters for handling network congestion . for example , in the data network 2 implemented as a frame relay network , the designation dlci 100 may be used to identify the logical circuit between the host device 112 and the remote device 114 . it will be appreciated that in data networks in which logical circuit data is communicated through more than one carrier ( e . g ., an lec and an iec ) the dlci designation for the logical circuit may change in a specific carrier &# 39 ; s network . for example , in the data network 2 , the designation dlci 100 may identify the logical circuit in the lata 5 and lata 15 but the designation dlci 800 may identify the logical circuit in the iec 10 . illustrative service parameters which may be included in the dlci include a committed information rate (“ cir ”) parameter and a committed burst size (“ bc ”) parameter . as is known to those skilled in the art , the cir represents the average capacity of the logical circuit and the bc represents the maximum amount of data that may be transmitted . it will be appreciated that the logical circuit may be provisioned such that when the cir or the bc is exceeded , the receiving switch in the data network will discard the frame . it should be understood that the logical circuit parameters are not limited to cir and bc and that other parameters known to those skilled in the art may also be provisioned , including , but not limited to , burst excess size (“ be ”) and committed rate measurement interval (“ tc ”). in atm networks , the vpi / vci is an address field contained in the header of each atm data cell and contains identifying information for the logical circuit as well as information specifying a data cell &# 39 ; s destination and specific bits which may indicate , for example , the existence of congestion in the network and a threshold for discarding cells . it should be understood that the logical circuit in the data network 2 may be a permanent virtual circuit (“ pvc ”) available to the network at all times or a temporary or a switched virtual circuit (“ svc ”) available to the network only as long as data is being transmitted . it should be understood that the data network 2 may further include additional switches or other interconnected network elements ( not shown ) creating multiple paths within each lata and iec for defining each pvc or svc in the data network . it will be appreciated that the data communicated over the logical connections 102 and 104 may be physically carried by the physical connections 106 and 108 . the data network 2 may also include a failover network 17 for rerouting logical circuit data , according to an embodiment of the invention . the failover network 17 may include a network failover circuit including physical connections 134 and 144 and logical connections 122 and 132 for rerouting logical circuit data in the event of a failure in the network circuit between the host device 112 and the remote device 114 . the failover network 17 will be described in greater detail in the description of fig4 below . the data network 2 may also include a network management system 175 in communication with the lata 5 , the lata 15 , and the failover network 17 . the network management system 175 may be utilized to obtain status information for the logical and physical circuit between the host device 112 and the remote device 114 . the network management system 175 may also be utilized for rerouting logical data in the data network 2 between the host device 112 and the remote device 114 . the network management system 175 will be discussed in greater detail in the description of fig3 below . fig2 illustrates the lata 5 in the data network 2 described in fig1 above , according to an embodiment of the present invention . as shown in fig2 , the lata 5 includes interconnected network devices such as switches 186 , 187 , and 188 . it will be appreciated that the data network 2 may also contain other interconnected network devices and elements ( not shown ) such as digital access and cross connect switches (“ dacs ”), channel service units (“ csus ”), and data service units (“ dsus ”). as discussed above in the description of fig1 , the connection data paths of a logical circuit within a data network may vary between the first and last network devices in a data network . for example , as shown in fig2 , the logical circuit in the lata 5 may include the communication path 185 between the switches 186 and 188 or the communication path 184 between the switches 186 , 187 , and 188 . as discussed above , it should be understood that the actual path taken by data through the lata 5 is not fixed and may vary from time to time , such as when automatic rerouting takes place . it will be appreciated that the switches 186 , 187 , and 188 may include a signaling mechanism for monitoring and signaling the status of the logical circuit in the data network 2 . each time a change in the status of the logical circuit is detected ( e . g ., a receiving switch begins dropping frames ), the switch generates an alarm or “ trap ” which may then be communicated to a management station , such as a logical element module ( described in detail in the description of fig3 below ), in the network management system 175 . the trap may include , for example , status information indicating network congestion . the status information may include forward and backward explicit congestion notifications (“ fecns ” and “ becns ”). as is known to those skilled in the art , a fecn is a frame relay message that notifies a receiving switch that there is congestion in the network . a fecn bit is sent in the same direction in which the frame was traveling , toward its destination . a becn is a frame relay message that notifies a sending switch that there is congestion in the network . a becn bit is sent in the opposite direction in which the frame is traveling , toward its transmission source . in one embodiment , the signaling mechanism may be in accord with a local management interface (“ lmi ”) specification , which provides for the sending and receiving of “ status inquiries ” between a data network and a host or remote device . the lmi specification includes obtaining status information through the use of special management frames ( in frame relay networks ) or cells ( in atm networks ). in frame relay networks , for example , the special management frames monitor the status of logical connections and provide information regarding the health of the network . in the data network 2 , the host and remote devices 112 and 114 receive status information from the switches in the individual latas they are connected to in response to a status request sent in a special management frame or cell . the lmi status information may include , for example , whether or not the logical circuit is congested or whether or not the logical circuit has failed . it should be understood that the parameters and the signaling mechanism discussed above are optional and that other parameters and mechanisms may also be utilized to obtain connection status information for a logical circuit . fig3 illustrates the network management system 175 which may be utilized to automatically reroute logical circuit data from a failed logical circuit in the data network of fig1 , according to an embodiment of the invention . the network management system 175 includes a service order system 160 , a network database 170 , a logical element module 153 , a physical element module 155 , a network management module 176 , and a test module 180 . the service order system 160 is utilized in the data network 2 for receiving service orders for provisioning network circuits . the service order includes information defining the transmission characteristics ( i . e ., the logical circuit ) of the network circuit . the service order also contains the access speed , cir , burst rates , and excess burst rates . the service order system 160 communicates the service order information to a network database 170 over management trunk 172 . the network database 170 assigns and stores the parameters for the physical circuit portion of the network circuit such as a port number on the switch 186 for transmitting data over the physical connection 121 to and from the host device 112 . the network database 170 may also be in communication with an operations support system ( not shown ) for assigning physical equipment to the network circuit and for maintaining an inventory of the physical assignments for the network circuit . an illustrative operations support system is “ tirks ”® ( trunks integrated records keeping system ) marketed by telecordia ™ technologies , inc . of morristown , n . j . the network database 170 may also be in communication with a work force administration and control system (“ wfa / c ”) ( not shown ) used to assign resources ( i . e ., technicians ) to work on installing the physical circuit . the network management system 175 also includes the logical element module 153 which is in communication with the switches in the data network 2 through management trunks 183 . the logical element module 153 runs a network management application program to monitor the operation of logical circuits which includes receiving trap data generated by the switches which indicate the status of logical connections . the trap data may be stored in the logical element module 153 for later analysis and review . the logical element module 153 is also in communication with the network database 170 via management trunks 172 for accessing information regarding logical circuits such as the logical identifier data . the logical identifier data may include , for example , the dlci or vpi / vci header information for each data frame or cell in the logical circuit including the circuit &# 39 ; s destination and service parameters . the logical element module 153 may consist of terminals ( not shown ) that display a map - based graphical user interface (“ gui ”) of the logical connections in the data network . an illustrative logical element module is the naviscore ™ system marketed by lucent technologies , inc . of murray hill , n . j . the network management system 175 further includes the physical element module 155 in communication with the physical connections of the network circuit via management trunks ( not shown ). the physical element module 155 runs a network management application program to monitor the operation and retrieve data regarding the operation of the physical circuit . the physical element module 155 is also in communication with the network database 170 via management trunks 172 for accessing information regarding physical circuits , such as line speed . similar to the logical element module 153 , the physical logical element module 155 may also consist of terminals ( not shown ) that display a map - based gui of the physical connections in the lata 5 . an illustrative physical element module is the integrated testing and analysis system (“ intas ”), marketed by telecordia ™ technologies , inc . of morristown , n . j ., which provides flow - through testing and analysis of telephony services . the physical element module 155 troubleshoots the physical connections for a physical circuit by communicating with test module 180 , which interfaces with the physical connections via test access point 156 . the test module 180 obtains the status of the physical circuit by transmitting “ clean ” test signals to test access point 156 ( shown in fig2 ) which “ loops back ” the signals for detection by the test module 180 . it should be understood that there may be multiple test access points on each of the physical connections for the physical circuit . the network management system 175 further includes the network management module 176 which is in communication with the service order system 160 , the network database 170 , the logical element module 153 , and the physical element module 155 through communications channels 172 . it should be understood that in one embodiment , the network management system 175 may also be in communication with the lata 15 , the iec 10 , and the failover network 17 . the communications channels 172 may be on a lan . the network management module 176 may consist of terminals ( not shown ), which may be part of a general - purpose computer system that displays a map - based gui of the logical connections in data networks . the network management module 176 may communicate with the logical element module 153 and the physical element module 155 using a common object request broker architecture (“ corba ”). as is known to those skilled in the art , corba is an open , vendor - independent architecture and infrastructure which allows different computer applications to work together over one or more networks using a basic set of commands and responses . the network management module 176 may also serve as an interface for implementing logical operations to provision and maintain network circuits . the logical operations may be implemented as machine instructions stored locally or as instructions retrieved from the logical and physical element modules 153 and 155 . an illustrative method detailing the provisioning and maintenance of network circuits in a data network is presented in u . s . patent application ser . no . 10 / 348 , 592 , entitled “ method and system for provisioning and maintaining a circuit in a data network ,” filed on jan . 23 , 2003 , and assigned to the same assignee as this application , which is expressly incorporated herein by reference . an illustrative network management module is the broadband network management system ® (“ bbnms ”) marketed by telecordia ™ technologies , inc . of morristown , n . j . fig4 illustrates an illustrative failover data network for rerouting logical circuit data , according to one embodiment of the present invention . as shown in fig4 , the failover network 17 includes an iec 20 , a lata 25 , and an iec 30 . the failover network further includes a network failover circuit which includes a physical failover circuit and a logical fail over circuit . the physical failover circuit includes the physical connection 134 between the lata 5 ( shown in fig1 ) and the iec 20 , the physical connection 136 between the iec 20 and the lata 25 , the physical connection 138 between the lata 25 and the iec 30 , and the physical connection 144 between the iec 30 and the lata 15 ( shown in fig1 ). similarly , the logical failover circuit may include the logical connection 122 between the lata 5 ( shown in fig1 ) and the iec 20 , the logical connection 124 between the iec 20 and the lata 25 , the logical connection 126 between the lata 25 and the iec 30 , and the logical connection 132 between the iec 30 and the lata 15 ( shown in fig1 ). it should be understood that in one embodiment , the network failover circuit illustrated in the failover network 17 may include a dedicated physical circuit and a dedicated logical circuit provisioned by a network service provider serving the latas 5 , 15 , and 25 and the iecs 20 and 30 , for rerouting logical data from a failed logical circuit . fig5 illustrates a flowchart describing logical operations 500 for automatically rerouting data from an overbalanced logical circuit in a data network , according to an embodiment of the invention . it will be appreciated that the logical operations 500 may be initiated when a customer report of a network circuit failure is received in the data network 2 . for example , a customer at the remote device 114 may determine that the remote device 114 is dropping frames or cells sent from the host device 112 ( e . g ., by reviewing lmi status information in the host device ). after receiving the customer report , the network service provider providing the network circuit may open a trouble ticket in the service order system 160 to troubleshoot the logical circuit . the logical operations 500 begin at operation 505 where the network management module 176 receives status information for a logical circuit in the data network 2 . it will be appreciated that in one embodiment , the status information may be received by communicating with the logical element module 153 to request trap data generated by one or more switches in the data network 2 which indicate the status of one or more logical connections making up the logical circuit . it will be appreciated that in one embodiment of the present invention , the communication of the status information for the logical circuit may be manually initiated by a technician from a terminal in the network management module 176 . in another embodiment of the present invention , the network management module 176 may be configured to automatically monitor the logical circuits for trap data to identify logical circuit congestion in the data network 2 . after receiving the status information for the logical circuit at operation 505 , the logical operations 500 continue at operation 510 where the network management module 176 determines whether the logical circuit is overbalanced ( i . e ., congested ) based on the received status information . it should be understood that a logical circuit is overbalanced when one or more logical connections in a logical circuit are overbalanced . as discussed above in the description of fig2 , trap data indicating an overbalanced logical connection may include fecns and becns from a sending switch and a receiving switch indicating dropped frames or cells in the data network 2 . these traps may be generated , for example , when the maximum cir or bc ( as specified in the dlci of a frame in a frame relay network , for example ) is exceeded . for example , in the data network 2 shown in fig1 , the “ x ” marking the logical connections 102 and 104 indicate that both connections are dropping frames or cells for the logical circuit in the lata data networks 5 and 15 . in this example , such a condition may indicate that a receiving switch in the iec 10 is sending a becn to a sending switch in the lata 5 over the logical connection 102 while a sending switch in the iec 10 is sending a fecn to a receiving switch in the lata 15 over the logical connection 104 . it will be appreciated that in this example , the logical circuit congestion lies in the iec data network 10 . if at operation 510 , it is determined that the logical circuit is not overbalanced , the logical operations 500 then return to operation 505 where the network management module 176 again receives status information for the logical circuit . if , however , at operation 510 it is determined that the logical circuit is overbalanced , the logical operations continue to operation 515 . at operation 515 , the network management module 176 identifies a logical failover circuit for rerouting the data from the logical circuit in the data network . for example , if as shown in fig1 , it is determined that the congestion in the overbalanced logical circuit in the data network 2 has been isolated to the iec data network 10 , a logical failover circuit in the failover network 17 may be automatically selected to reroute the logical data such that it bypasses the iec data network 10 . for example , the logical failover circuit may be selected including the logical connections 122 , 124 , 126 , and 132 ( as shown in fig4 ) to reroute the logical data from the host device 112 , through the lata 5 , the iec 20 , the lata 25 , the iec 30 , the lata 15 , and finally to the remote device 114 . it should be understood that the network management module 176 may select the logical failover circuit by identifying a logical connection or nni in the overbalanced logical circuit . information related to each logical connection in a logical circuit may be stored in the database 170 including the first and second ends of the logical circuit to which the logical connection belongs . once the ends of a logical circuit are determined by accessing the database 170 , the network management module 176 may select a logical failover circuit having a communication path including the first and second ends of the overbalanced logical circuit for rerouting data . it will be appreciated that in one embodiment , the logical failover circuit selected may be a dedicated circuit which is only utilized for rerouting logical data from the overbalanced logical circuit ( i . e ., the failover circuit does not normally communicate data traffic ). in another embodiment , the logical failover circuit may be an existing logical circuit which is normally utilized for communicating data traffic in the data network 2 . in this embodiment , the selection of the logical failover circuit may also include determining whether one or more logical connections in the logical circuit are currently communicating data traffic or are currently unused . if currently unused , the logical connections may be selected for rerouting logical data . for example , a technician at the logical element module 153 or the network management module 176 may utilize a map - based gui displaying the logical connections in the lata data networks 5 and 15 and their status . a dedicated logical failover circuit ( or a currently unused logical circuit with available logical connections ) may then be selected as a logical failover circuit for communicating logical data from a failed logical circuit . the logical operations 500 then continue from operation 515 to operation 520 . as discussed above , the logical circuits in a data network are identified by a logical circuit identifier ( id ). at operation 520 , the network management module 176 compares the identifier ( e . g ., the dlci or vpi / vci ) of the logical circuit to the identifier of the selected logical failover circuit . if at operation 520 , it is determined that the identifier &# 39 ; s of the failed logical circuit and the logical failover circuit are the same , the logical operations 500 then continue from operation 520 to operation 530 . if , however , at operation 520 it is determined that logical circuit identifiers of the failed logical circuit and the logical failover circuit are not the same , the logical operations 500 then continue from operation 520 to operation 525 where the network management module 176 renames the logical circuit id of the logical failover circuit to the id of the failed logical circuit . the logical operations 500 then continue from operation 525 to operation 530 . it will be appreciated that in the failover network 17 , a dedicated failover logical circuit may be assigned to an existing logical circuit in a data network and identified with the same id as the existing logical circuit . however , a logical failover circuit which is already an existing logical circuit ( i . e ., normally communicates data traffic in a data network ) is already assigned a unique logical circuit id . thus , in the presently described embodiment of the invention , the logical identifier of a logical failover circuit may be renamed so that it is in accord with a current logical identifier of a logical circuit . for example , in a frame relay data network , a logical circuit may be identified as dlci 100 while a logical failover circuit may be identified as dlci 250 . the logical failover circuit may be renamed from dlci 250 to dlci 100 . it will further be appreciated that the network management module 176 may store the changes to logical circuit identifiers as reroute data in the database 170 . this reroute data may then be accessed to restore the original logical identifiers to the logical failover circuit once the trouble in the failed logical circuit has been repaired . at operation 530 the network management module 176 reroutes the data from the overbalanced logical circuit to the logical failover circuit . it will be appreciated that the reroute of the data may be accomplished from the logical management module 153 or the network management module 176 which , in communication with the switches in the data network 2 ( and the failover network 17 ), sends instructions to reroute the logical data from the nnis or logical connections 102 and 104 to the failover nnis or logical connections 122 , 124 , 126 , and 132 in the logical failover circuit . the logical operations 500 then continue from operation 530 to operation 535 . at operation 535 , the network management module 176 determines the failed logical circuit has been restored . this determination may be made , for example , by receiving a confirmation from the iec data network 10 that the failed logical connections 102 and 104 have been restored or from continuous or periodic logical circuit monitoring performed by the logical element module 153 in communication with the network management module 176 , to establish that the logical connections are successfully communicating data . if at operation 535 it is determined that the overbalanced logical circuit has not been restored , the logical operations 500 return to operation 530 where the rerouting of the data is maintained on the logical failover circuit . if however , at operation 535 , it is determined that the overbalanced logical circuit has been restored , then the logical operations 535 continue to operation 540 where the data on the network failover circuit is rerouted back to the restored logical circuit . similar to the rerouting of the logical data onto the logical failover circuit , the rerouting of the logical data back onto the restored logical circuit may be accomplished from the network management module 176 which , in communication with the switches in the data network 2 ( and the failover network 17 ) sends instructions to reroute the data from the failover nnis or logical connections 122 , 124 , 126 , and 132 to the restored nnis or logical connections 102 and 104 in the restored logical circuit . the logical operations 500 then end . it will be appreciated that in one embodiment , the logical circuit failover procedure may be initiated as a service offering by a local exchange carrier ( lec ) to an inter - exchange carriers ( iec ) for rerouting congested or overbalanced logical circuits . thus , an iec may utilize a lec &# 39 ; s data network for relieving overbalanced logical circuits . in another embodiment , the logical circuit failover procedure may be initiated as part of a customer subscription service offered by the network service provider . the subscription service may include use of the logical failover circuit for a predetermined time period after the customer &# 39 ; s data has been rerouted . for example , a customer subscribing to the failover service would automatically have the logical circuit failover procedure initiated and the customer &# 39 ; s data would be rerouted for up to two hours over the logical failover circuit after a determination that the customer &# 39 ; s network circuit has failed . if a customer is not a subscriber , the failover service may still be initiated and the customer may be billed based on the length of time the failover service was in service . in another embodiment , the customer may be offered the failover service by the service provider in real - time ( i . e ., upon determining a logical circuit 5 failure ). it will be appreciated that the embodiments of the invention described above provide for a method and system for automatically rerouting data from an overbalanced logical circuit in a data network . when an overbalanced condition in a logical circuit is detected , the data in the overbalanced circuit may be rerouted to a “ logical failover network ,” thereby minimizing lost data until the overbalanced condition in the logical circuit is cleared . the various embodiments described above are provided by way of illustration only and should not be construed to limit the invention . those skilled in the art will readily recognize various modifications and changes that may be made to the present invention without following the example embodiments and applications illustrated and described herein , and without departing from the true spirit and scope of the present invention , which is set forth in the following claims . fig6 illustrates a flowchart describing logical operations 600 for prioritized rerouting of logical circuit data in the data network 2 of fig1 , according to an embodiment of the invention . it will be appreciated that the logical operations 600 may be initiated when a customer report of a network circuit failure is received in the data network 2 . for example , a customer at the remote device 114 may determine that the remote device 114 is dropping frames or cells sent from the host device 112 ( e . g ., by reviewing lmi status information in the host device ). after receiving the customer report , the network service provider providing the network circuit may open a trouble ticket in the service order system 160 to troubleshoot the logical circuit . the logical operations 600 begin at operation 605 where the network management module 176 identifies a failed logical circuit in the data network 2 . it will be appreciated that a logical circuit failure may be based on status information received in communications with the logical element module 153 to request trap data generated by one or more switches in the data network 2 . the trap data indicates the status of one or more logical connections making up the logical circuit . for example , in the data network 2 shown in fig1 , the “ x ” marking the logical connections 102 and 104 indicates that both connections are “ down beyond ” the logical connections in the lata data networks 5 and 15 . it will be appreciated that in this example , the logical circuit failure lies in the iec data network 10 . an illustrative method detailing the identification of logical circuit failures in a data network is presented in co - pending u . s . patent application ser . no . 10 / 745 , 170 , entitled “ method and system for automatically identifying a logical circuit failure in a data network ,”, filed on dec . 23 , 2003 , and assigned to the same assignee as this application , which is expressly incorporated herein by reference . after identifying a failed logical circuit at operation 605 , the logical operations 600 continue at operation 610 where the network management module 176 determines the quality of service (“ qos ”) parameter for the communication of data in the failed logical circuit . as discussed above in the description of fig1 , the qos parameters for a logical circuit are contained within the dlci ( for frame relay circuits ) or the vpi / vci ( for atm circuits ). the qos parameters for logical circuits may also be stored in the network database 170 after the circuits are provisioned in the data network . thus , in one embodiment of the present invention , the network management module 176 may determine the logical identifier for the failed logical circuit from the trap data received from the logical element module 153 and then access the database 170 to determine the qos parameter for the circuit . the logical operations then continue from operation 610 to operation 615 . at operation 615 , the network management module 176 identifies a logical failover circuit for communicating failed logical circuit data over an alternate communication in the data network 2 . for example , if as shown in fig1 , it is determined that the failure in the logical circuit in the data network 2 has been isolated to the iec data network 10 , a logical failover circuit in the failover network 17 may be automatically selected to reroute the logical data such that it bypasses the iec data network 10 . for example , the logical failover circuit may be selected including the logical connections 122 , 124 , 126 , and 132 ( as shown in fig4 ) to reroute the logical data from the host device 112 , through the lata 5 , the iec 20 , the lata 25 , the iec 30 , the lata 15 , and finally to the remote device 114 . it should be understood that the network management module 176 may select the logical failover circuit by identifying a logical connection or nni in the overbalanced logical circuit . information related to each logical connection in a logical circuit may be stored in the database 170 including the first and second ends of the logical circuit to which the logical connection belongs . once the ends of a logical circuit are determined by accessing the database 170 , the network management module 176 may select a logical failover circuit having a communication path including the first and second ends of the overbalanced logical circuit for rerouting data . it will be appreciated that in one embodiment , the logical failover circuit selected may be a dedicated circuit which is only utilized for rerouting logical data from the failed logical circuit ( i . e ., the failover circuit does not normally communicate data traffic ). in this embodiment , the logical failover circuit may be provisioned with the same qos parameter as the logical circuit to which it is assigned . in another embodiment , the logical failover circuit may be an existing logical circuit which is normally utilized for communicating data traffic in the data network 2 . in this embodiment , the selection of the logical failover circuit may also include determining whether one or more logical connections in the logical circuit are currently communicating data traffic or are currently unused . if currently unused , the logical connections may be selected for rerouting logical data . for example , a technician at the logical element module 153 or the network management module 176 may utilize a map - based gui displaying the logical connections in the lata data networks 5 and 15 and their status . a dedicated logical failover circuit ( or a currently unused logical circuit with available logical connections ) may then be selected as a logical failover circuit for communicating logical data from a failed logical circuit . the logical operations 600 then continue from operation 615 to operation 620 . at operation 620 , the network management module 176 determines the qos parameter for the previously identified logical failover circuit . it will be appreciated that the identification of the qos parameter for the logical failover circuit may be made by identifying the logical circuit id for the logical failover circuit and then accessing the network database 170 to retrieve the qos parameter for the circuit . the logical operations 600 then continue from operation 620 to operation 625 . at operation 625 , the network management module 176 compares the qos parameters for the failed logical circuit and the logical failover circuit to determine if they are the same . if the qos parameters are the same , the logical operations continue to operation 635 where the failed logical circuit data is rerouted over the logical failover circuit . an illustrative method detailing the rerouting of failed logical circuits in a data network is presented in co - pending u . s . patent application ser . no . 10 / 744 , 921 , entitled “ method and system for automatically rerouting logical circuit data in a data network ,”, filed on dec . 23 , 2003 , and assigned to the same assignee as this application , which is expressly incorporated herein by reference . for example , if the network management module 176 determines that the qos for the failed logical circuit and the logical failover circuit is constant bit rate (“ cbr ”), then the failed logical circuit data is rerouted over the logical failover circuit while maintaining the same quality of service . it will be appreciated that in data networks supporting interworking ( i . e ., both frame relay and atm devices ), the network management module 176 may be configured to reroute logical circuit data based on similar qos parameters from each protocol . for example , if the failed logical circuit has a frame relay qos parameter of variable frame relay (“ vfr ”) real time , the network management module 176 may reroute the data to an atm logical failover circuit having a qos parameter of variable bit rate (“ vbr ”) real time , since these quality of service parameters are defined to tolerate only small variations in transmission rates . similarly , a failed logical circuit having an atm qos parameter of unspecified bit rate (“ ubr ”) may be rerouted over a frame relay logical failover circuit having a qos of vfr non - real time since both of these parameters are tolerant of delay and variable transmission rates . if , however , at operation 625 , the network management module 176 determines that the qos parameters for the failed logical circuit and the logical failover circuit are not the same , then the logical operations continue from operation 625 to operation 630 where the network management module 176 obtains authorization to reroute the logical circuit data . once authorization is received , the logical operations 630 then continue to operation 635 where the failed logical circuit data is rerouted over the logical failover circuit . it will be appreciated that authorization may be obtained if the logical failover circuit is provisioned for a lower quality of service than the failed logical circuit . for example , authorization may be obtained from an atm circuit customer with a qos parameter of cbr to reroute logical circuit data to a failover logical circuit with a qos parameter of vbr real time . it will be appreciated that in some instances , a customer unwilling to accept delay and variable transmission rates for high priority data ( such as voice ) may not wish data to be rerouted over a lower priority circuit . the logical operations 600 then end . | 7 |
some preferred embodiments of the present control method of a power source of a forestry machine are described in the following by referring to the above - mentioned figures . thus , parts used for implementing the method are indicated in the figures with reference numerals that correspond to the reference numerals in this description . fig1 thus shows a diagram in which a power source 1 of a forestry machine 20 utilizes directly or indirectly one or more work and / or handling devices controlled by a control means 2 and denoted with reference numerals 3 and 4 . the control means gives , in a conventional manner , a control command to one or more work devices or handling devices , which control command starts , for instance , the desired operation in the forestry machine . the control command of the control means given to one or more work devices and / or handling devices is , however , transmitted substantially simultaneously to the power source of the forestry machine as well , conventionally to the control unit controlling it , for example to an electronic control unit ( ecu ). thus , there is time to predict the power or torque request presented to the power source by the work device and / or handling device function started by the control command in the required control parameters to be transmitted to the power source . the work device consists of , for example , a boom system 30 , such as a crane or a loader . the control parameters of the power source 1 can also be affected by taking into account the power or torque request presented to the power source by several simultaneous functions of a work and / or handling device . when the requests exceed a preset limit value , the effect on control parameters according to the invention is started . on the other hand , solutions are known where the operation of the power source is actively monitored for this purpose with a means arranged on it . when the means gives information on the load of the power source , a change in the control parameters directed at the power source by the method is arrangeable to be started only when the load level of the power source exceeds a preset limit value . also the duration of a power change to be provided for the power source can be adjusted separately . a control command provides for the power source 1 a momentary change in the productivity of the previous power or , for instance , torque . thus , there is time to raise for example the power production of the power source even before the function of the work and / or handling device 3 and 4 in question begins to require of the power source of the forestry machine power that is greater than the usual power production availability . in practice , this control may manifest itself for instance as an increase in the injection amount of fuel for a short time just before the expected power demand higher than usual occurs . in this way , for example in diesel engines the speeding up and sufficiency of the increase in the boost pressure of a supercharged engine can be ensured , guaranteeing the power or torque level of the power source in each particular case . typically there will be , after the arrival of the control command , some dozens or hundreds of milliseconds for the power source 1 of the forestry machine to prepare for the increasing power demand that the power source is subjected to . this is possible because the delays of an electronically controlled hydraulic system , for example , can be utilized in the control . such delays are generated for instance in hydraulically precontrolled control valves used in forestry machines . fig2 and 3 show such precontrol and control valves 5 and 6 . further , if required , a given delay can be deliberately added to a given activated function to enable better predictability , to the extent to which this can be done without the usability of the forestry machine suffering . preferably , such a delay can be implemented by software in a control means , for instance . the control parameter of the power source to be affected may be , for example , the power source &# 39 ; s rotative speed , injection advance of fuel mentioned above , torque of the power source or any other control parameter controllable with known means . the present method is particularly useful when applying it to be used in connection with the start of the trunk feeding or sawing function , shown schematically in fig2 , to momentarily raise the power level of the power source 1 . in this way , the fuel consumption and exhaust gas emissions of a diesel engine , for example , can be minimized . in particular , the advantages of such a solution become apparent in the case of a hydraulic system utilizing a harvester head 25 of a harvester , whereby the power demands vary a great deal , particularly when the feeding function 7 and the sawing function 8 alternate in trunk handling . the present method for controlling a power source can be used to control power sources other than the primary power source 1 of a forestry machine . fig3 thus shows a solution in which power generated by the primary power source of a forestry machine is stored at least partly in , for instance , a set of accumulators or other energy - storing means 9 . if required , the power can be taken into use from the storing means in the form of electric or other kind of power transmission , whereby the control steps are directed at this power source 10 that thus forms a secondary power source . analogically , pressure accumulators or the like solutions known as such for storing hydraulic energy can be considered instead of storing electric energy . thus , instead of a generator arrangement 11 and a control means 12 controlling it , for example a hydraulic pump should be attached to the primary power source in a manner known as such . in such an embodiment , the pressure accumulator itself could function as a secondary power source , whereby the control of the secondary power source could be considered to encompass the control of the flow and pressure of the pressure medium discharging from the pressure accumulator . the present method can be applied to controlling this secondary power source in also such a case where the energy - storing means essentially belonging to the above arrangement could generate powers greater than those generated by the primary power source of the forestry machine . in the exemplary case presented above , electric energy charged in the set of accumulators 9 , for instance , is used in an electric engine 13 for running a hydraulic pump 14 , for instance , the electric motor constituting in this case the secondary power source 10 . thus , the rotative speed of this electric engine , for example , can be momentarily or for a longer time controlled to be higher to achieve greater power production availability . on the other hand , with an electric system an analogic arrangement can be implemented hydraulically . in such a case , the primary power source 1 of the forestry machine would utilize a large hydraulic pump 14 pressurizing and filling a pressure accumulator , whereby the secondary power source 10 would be a hydraulic engine that would take the pressurized medium into use from this pressure accumulator . a hydraulic engine could also in this case be controlled to predict variations in the power demand . on the other hand , in the case of hydraulic implementation , the pressure accumulator itself could function as said secondary power source , whereby the control of the secondary power source could be considered to encompass the control of the flow and pressure of the pressure medium discharging from the pressure accumulator . it is to be understood that the above description and the associated figures are only intended to illustrate the present solution . the solution is thus not restricted only to the embodiment presented above or defined in the claims , but many different variations and modifications possible within the idea defined in the attached claims will be obvious to those skilled in the art . | 5 |
the present invention will be further described in reference to the following drawing figure diagrams which teach all that is depicted therein and anticipations thereof . although , the diagrams are representative embodiments of the present invention , it will be obvious to those skilled in the art that deviations from the figures are also beneficial , and such deviations are also within the scope and spirit of the present invention . fig1 is a cross - section diagram of a prior art can assembly . can assemblies are generally cylinders closed on one end and open on the other . the can assembly 13 is such a cylinder . inside the can assembly 13 is the superhard materials mixture 14 , comprising a composite of superhard particles for sintering . the can assembly is closed by lid 15 , having a sealant material 16 arranged between the lid 15 and superhard material mixture 14 . openings 17 and 18 are provided between the superhard mixture and the can assembly to promote ventilation of contaminants and capillary flow of the meltable sealant 16 , in this case copper . the hpht assembly is heated in a vacuum furnace that produces an environment which cleanses the components of unwanted contaminants and hermetically seals the container in preparation for further hpht processing . fig2 is a cross - section diagram of a prior art can assembly employing an outer can 20 and an inner can 21 . the double can assembly contains the superhard materials mixture comprising a substrate 22 and a layer of superhard particles 23 . the assembly is closed by a lid 24 having a meltable sealant 25 . once again an opening 26 is provided between the inner and outer can assembly and the superhard materials mixture in order to allow the flow of contaminants from the can assembly and to promote the capillary flow of the sealant , in this case a copper braze , around the mixture 22 and 23 . although the purpose of the inner and outer can assembly is to provide a better seal from contamination , the figure fails to provide a sealant barrier in the opening 26 to prevent the sealant &# 39 ; s access to the mixture . contamination from undesirable impurities is the leading cause of low quality products and low production yields in the art of hpht superhard products such as polycrystalline diamond and cubic boron nitride . fig3 is a perspective diagram of an embodiment of the can assembly of the present invention comprising a cylindrical can 30 and a cap 31 . line aa describes the plane of the cross section in subsequent figures . fig4 is a perspective diagram of an embodiment of the can assembly of the present invention comprising a cylindrical can 40 having a convex , or conical , region 42 and an end cap 41 . those skilled in the art will understand that the conical region produces a superhard element having a similar shape . fig5 is a cross - section diagram of an embodiment of the present invention depicting a can assembly comprising a can 50 having an extended side wall length 51 . the can contains a superhard substrate 53 and a layer 54 comprising superhard particles such as diamond or cubic boron nitride . the extended side wall length 51 of the can 50 is formed over the surface of substrate 51 in aid of assembly and compaction of the superhard mixture and to promote sealing of the mixture . the can assembly is closed by end cap 52 which is fitted onto the can . a meltable sealant material 55 is interposed between the end cap and the can with access to narrow opening 57 . opening 57 is of sufficient width , say between about 0 . 0005 to 0 . 050 inches , to promote the outflow of contamination and yet produce the surface energy necessary to drive the capillary flow of the meltable sealant 55 . a sealant barrier 56 is provided around the circumference of the substrate 53 intermediate the meltable sealant 35 and the superhard mixture comprising 53 and 54 . when the can assembly of fig5 is placed in the vacuum chamber of a high temperature furnace and placed under high vacuum and high temperature sufficient to ventilate contaminates from the assembly , the assembly is cleansed of undesirable contamination . the temperature of the furnace is then increased sufficiently to melt the sealant . by capillary action , the sealant flows into the opening 57 and hermetically seals the can assembly . the flow of the sealant is stopped by the sealant barrier 56 , thereby protecting the cleansed hpht mixture from further contamination from the sealant itself . the can is then retrieved from the furnace in preparation for further hpht processing . the sealant barrier 56 comprises a material that inhibits the surface tension between mating surfaces and interrupts the flow of the sealant melt under the cleansing environment of the vacuum furnace and under the further conditions of hpht processing . such materials are commonly known as : stop - off , stop - off compound , solder / braze stop , solder mask , and sealant flow control . one such material is marketed under the name of “ green stop - off type 1 ” by nicrobraz , wall colmondy corporation , madison hts ., mi . such sealant barriers comprise refractory materials of inert oxides , graphite , silica , magnesia , yttria , boron nitride , or alumina and are applied by coating , etching , brushing , dipping , spraying , silk screen painting , plating , baking , and chemical or physical vapor deposition techniques . in the embodiment of fig5 , the sealant barrier was applied as a paint using a brush . it may be applied to the surface of anyone of the assembly components where it would be desirable to prevent the flow of the liquid sealant . fig6 is a cross - section diagram of an embodiment of the present invention similar to that depicted in fig5 comprising at can 61 containing a substrate 64 and a superhard mixture 67 . the can is closed by end cap 62 . the sealant 65 is depicted as melted filling the opening 66 and stopped by the sealant barrier 63 so that it does not flow into the region of the superhard mixture 64 and 67 . fig7 is a cross - section diagram of an embodiment of the present invention similar to that depicted in fig5 comprising a can 70 and an end cap 71 containing a substrate 72 and superhard particles 73 . the assembly comprises the addition of a lid 75 as a further protection for the superhard mixture comprising a substrate 72 and superhard particles 73 . the sealant 76 and the sealant barrier 77 are contained within the opening 74 so that when the sealant is melted it flows within the opening 74 around the lid 75 and is stopped by the sealant barrier 77 . the can assembly will thereby be hermetically sealed from contamination during further hpht processing . fig8 is a cross - section diagram of a double can assembly embodiment of the present invention . the assembly comprises an inner can 80 and an outer can 81 containing a substrate 82 and a mixture of superhard particles 83 . within the space 84 are positioned the lid 85 , the sealant 86 , and the sealant barrier 87 . the assembly also comprises an additional sealant barrier 88 . the additional sealant barrier 88 serves to prevent the sealant from escaping the assembly during processing . when the sealant is melted , it flows within the opening 84 to surround the open portion of the can and is confined between the two regions of sealant barrier 87 and 88 . fig9 is a cross - section diagram of a sealable assembly comprising a can 90 containing a substrate 91 and superhard particles 92 . the assembly further comprises an opening 95 for positioning a sealant sleeve 94 and a sealant barrier 96 , which may be a sleeve or a coating . the can 90 further comprises a recess 93 for cooperating with the insertion of the sealant sleeve 94 . the assembly may be swaged together so that the components of the assembly are tightly fit together prior to sealing in a vacuum furnace . as noted in the other figures , the sealant barrier is positioned intermediate the sealant and the superhard particles . in this manner , the superhard particles are protected from undesirable contamination during hpht processing . fig1 is a cross - section diagram of a sealed embodiment of the present invention comprising a can 90 and an end cap 93 containing a substrate 91 and superhard particles 92 . within the space 94 are located the lid 95 , the sealant 96 , and the sealant barrier 97 and 100 . in cooperation with the sealant , the assembly comprises a circumferential groove 101 around the substrate 91 and a cooperating indentation 98 in the wall of the can 90 . the end cap 93 also comprises cooperating indentations 99 and 100 that may be used in connection with the sealant barrier . when the can assembly is assembled , it may be swaged together so that the components are in tight fit with each other . the cooperating indentations , when used in association with the sealant barrier , provide a mechanical and a chemical stop for the flow for the sealant . surprisingly , the applicants have found that regardless of the fit between the components , the heat and vacuum of the furnace are sufficient to drive off contaminants within the assembly . it is believed that the during high temperature processing the superhard mixture expands less than the metal can components thereby providing sufficient opening for the escape of contaminants during the vacuum cycle . by maintaining a tight fit between the components , the applicants believe that higher surface tension is achieved to drive the capillary action of the melting sealant . the applicants have found , also , that smooth surface finishes between the can and the superhard components is beneficial for achieving a competent seal . | 1 |
fig1 is a schematic diagram of an embodiment of a scanning photoelectron microscope according to the present invention . in fig1 a beam of light 1a from a light source 1 is caused to pass through an aperture 3 by a condenser lens 2 , is caused to enter a scanningmirror 4 by a drive unit 16 and is introduced into a sample chamber 6 into which gas has been introduced , by the reflection of the scanning mirror 4 through a window 5 . the beam of light introduced into the sample chamber 6is condensed on a sample on a stage 8 by an objective lens 7 . the beam of light is caused to scan the surface of the sample two - dimensionally ( in x - direction and y - direction ) by the scanning mirror 4 , as required . two scanning mirrors 4 for x - direction and y - direction , respectively , for thus scanning the beam of light are usually prepared , but such construction is well known and therefore , in fig1 for the sakeof convenience , only one mirror 4 is shown . for example , of course , x - direction may be scanned by the scanning mirror and in y - direction , the surface of the sample may be moved , or the surface of the sample may be moved two - dimensionally . a photoelectron emitted from the sample by the application of the light thereto ionizes the gas in the sample chamber 6 , whereby the multiplied electron is captured by a detector 9 ( electrode ) of positive potential relative to the sample . that is , the detector 9 is maintained at positive potential by a power source 10 ( the sample is earthed ), and such a distance and voltage that no discharging will take place between the detector and the sample are determined . the sample chamber 6 is kept at predetermined pressure by controlling a gas introduction unit 11 and an evacuation unit 12 by a gas control unit 13 . a photoelectron signal is displayed on a monitor 15 through an amplifier 14in synchronism with the mirror scanning . with such a construction , the sample interchange door , not shown , of the sample chamber 6 is opened , andthen the sample is placed onto the stage 8 and the sample interchange door is closed , whereafter the gas control unit 13 is operated to control the gas introduction unit 11 and the evacuation unit 12 , thereby keeping the interior of the sample chamber 6 at predetermined pressure . thereafter , the light from the light source 1 is emitted ( this is accomplished by the changeover from the turn - off to the turn - on of the light source , or by thechangeover from the closing to the opening of a shutter , not shown ). the beam of light 1a on the sample is caused to scan two - dimensionally by the drive unit 16 , whereby the photoelectron emitted from the sample travels toward the detector 9 , but is captured by the detector 9 with an electron created as a result of the photoelectron colliding with the gas to thereby ionize the gas , and is amplified by the amplifier 14 , whereafter it is inputted to the monitor 15 and becomes the calescence point signal of the monitor 15 , whereby the two - dimensional photoelectron image of the sample is displayed on the monitor 15 . fig2 shows a modification comprising a combination of the scanning photoelectron microscope shown in fig1 and a scanning optical microscope , and in fig2 the same members as those in fig1 are given the same reference numerals and need not be described . the scanning mirror4 in fig1 is constructed as a half - transmitting scanning mirror 4 &# 39 ; using a half mirror , and the reflected light from the sample is passed through an aperture 30 and a condenser lens 17 and is detected by a photodetector 18 . the detection signal is amplified by an amplifier 19 , whereafter it enters the monitor 15 and is displayed as a sample image on the monitor 15in synchronism with the scanning of the half - transmitting scanning mirror 4 &# 39 ;. the outputs of the amplifiers 14 and 19 are superposed one upon the other , whereby an optical image and a photoelectron image are obtained at a time . of course , the output of the amplifier 14 and the output of the amplifier 19 may be selected by a changeover switch , not shown , which is provided in the monitor 15 , and the optical image and the photoelectron image may be alternatively displayed . fig3 shows a second modification in which the beam of light 1a is not scanned , but the stage 8 is driven two - dimensionally by a stage drive unit20 and the sample is scanned relative to the beam of light 1a and the sample is disposed in the atmosphere , the photoelectron signal is capturedby the detector 9 , is amplified by the amplifier 14 and is displayed on themonitor 15 in synchronism with the scanning of the sample . in fig3 the beam of light 1a from the light source is a beam of light difficult to scan by a mirror , for example , x - rays from synchrotron radiation or the like , and the mirror 7 is a toroidal x - ray mirror or a freznel zone plate . a beryllium x - ray window is used as the window 5 . also , in the above - described embodiments , the sample is placed in the sample chamber 6 , but it is known that photoelectrons are also obtained inthe atmosphere , and it is not requisite to confine the sample in the pressure - controlled sample chamber 6 . fig4 is a schematic diagram of a scanning photoelectron microscope according to a second embodiment of the present invention . in fig4 the same members as those in fig1 are given the same referencenumerals and need not be described . in fig4 a synchrotron light source 1 &# 39 ; is a light source capable of emitting lights of wavelengths from the infrared range to the ultraviolet range . a wavelength selection spectroscope 22 selects only the light of necessary wavelength from the beam of light 1a from the synchrotron light source 1 &# 39 ; and causes it to enter the condenser lens 2 . in the second embodiment , the wavelength selection spectroscope 22 causes only x - rays ofwavelength 1 nm to enter the condenser lens 2 . a reflecting mirror 4a reflects the beam of light 1a and causes it to pass through an x - ray transmitting window 5a of thin diamond film , and introduces it into the sample chamber 6 into which gas has been introduced . in the present embodiment , the sample chamber 6 has a volume of 1 m 3 . also , the arrangement of the optical system takes the absorption of x - rays by the gas into consideration . the stage 8 is movable two - dimensionally ( in x - direction and y - direction infig4 ), and in the second embodiment , by the two - dimensional movement of the stage 8 , the beam of light 1a condensed on the sample 21 is caused to scan two - dimensionally on the sample 21 . photoelectrons created from the sample 21 by this scanning enter an electron energy analyzer 23 . the electron energy analyzer 23 passes therethrough only those of photoelectrons created from the sample 21 whichhave necessary energy , and can be adjusted in z - direction in fig4 so thatit can be disposed at a location whereat the energy of the photoelectrons is not lost ( amplified ) by the gas atmosphere in the sample chamber 6 ( thedetails of this will be described later ). also , in the present embodiment , an electron energy analyzer of the retarding field type is used as the electron energy analyzer 23 . fig5 shows the details of the electron energy analyzer 23 of fig4 and the electron energy analyzer 23 is comprised of a grid 23a , a grid 23b anda power source 23c . the power source 23c gives a voltage to the grid 23a . the grid 23b drops photoelectrons not enough to satisfy necessary energy to the earth . turning back to fig4 the photoelectrons passed through the electron energy analyzer 23 collide with gas molecules in the sample chamber 6 , andare detected by a detector 9a which is at positive potential relative to the sample 21 . the detector 9a uses a ring - like metal ( in the present embodiment , copper ) and is disposed so as not to intercept the beam of light 1a , and is given a voltage so that the potential difference thereof from the grid 23a may not exceed 400 v . a cpu 24 effects the adjustment of the electron energy analyzer 23 in z - direction through a motor , not shown , and controls the gas introduction unit 11 , the evacuation unit 12 and a stage controller 25 . the evacuation unit 12 evacuates the sample chamber 6 . the gas introductionunit 11 introduces gas into the sample chamber 6 , and in this second embodiment it introduces helium ( he ). the stage controller 25 moves the stage 8 two - dimensionally through a motor , not shown , as previously described . in the second embodiment , x - rays of wavelength 1 nm is used and therefore , the synchrotron light source 1 &# 39 ; to the reflecting mirror 4a are covered with a cover 26 of lead . the observing operation of the scanning photoelectron microscope constructed as described above will hereinafter be described . fig6 is a flow chart for the observation of the sample 21 , and description will hereinafter be continued with reference to this flow chart . the cpu 24 controls the pressure in the sample chamber 6 to the pressure indicated by the operator ( step 101 ). for example , when the sample chamber 6 is to be set to 500 pa , the cpu 24 evacuates the sample chamber 6 rendered into the atmospheric pressure by the interchange of the sample 21 to the order of 100 pa by the evacuation unit 12 . the cpu 24 introduces helium by the gas introduction unit 11 until the pressure in the sample chamber 6 becomes 500 pa . thereby , the cpu 24 can render the interior of the sample chamber 6 into a helium atmosphere of 500 pa . the cpu 24 calculates the position of the electron energy analyzer 23 on the basis of the set pressure ( step 102 ). the cpu 24 first finds the molecule number density ( number / m 3 ) of the helium ( he ) gas . the state equation of the gas is expressed by the following equation : where p is the pressure ( pa ), v is the volume ( m 3 ) of the sample chamber 6 , n is the molecule number of the gas in the sample chamber 6 , isboltzman &# 39 ; s constant ( jk - 1 ), and t is temperature ( k ). since the molecule number density n ( number / m 3 ) is n / v , the above equation can be modified as follows . ( the molecule number density of the gas does not depend on the kind of the gas .) if the temperature in the sample chamber 6 is 300 k . ( 27 ° c . ), as previously described , the volume of the sample chamber 6 is 1 m 3 and boltzman &# 39 ; s constant is 1 . 380662 × 10 - 23 ( jk - 1 ) and therefore , these numerical values are substituted for the above equation to thereby calculate the cpu 24 then calculates the position of the electron energy analyzer 23 from the equation below . the equation below is for finding the distance bywhich the photoelectron advances its energy without losing ( amplifying ) theenergy . where σ is the ionization and excitation cross section ( m 2 ) of the gas by the electron , and when the gas is helium gas in the required photoelectron energy area , σ is 3 . 6 × 10 - 21 ( m 2 ) at maximum and therefore , the cpu 24 adjusts the position of the electron energy analyzer 23 in the direction of the optical axis ( step 103 ). the cpu 24 adjusts the grid 23a of the electron energy analyzer 23 so as toassume a position spaced apart by 2 . 3 ( mm ) from the sample 21 along the optical axis ( z - direction ). the grid 23b is adjusted so as to not to contact with the sample 21 . the cpu 24 moves the stage 8 two - dimensionally and scans the sample 21 withx - rays ( step 104 ). the wavelength selection spectroscope 22 passes therethough only x - rays of wavelength 1 nm of the beam of light 1a emitted from the synchrotron lightsource 1 &# 39 ; and therefore , the x - rays of wavelength 1 nm are condensed on thesample 21 . when the x - rays are condensed on the sample 21 , the cpu 24 moves the stage 8 two - dimensionally through the stage controller 25 . by the two - dimensional movement of the stage 8 , the sample 21 is scanned with thebeam of light 1a ( step 105 ). a photoelectron corresponding to this scanningposition is created from the sample 21 . the cpu 24 makes the detector 9a detect the photoelectron created from the sample 21 ( step 106 ). the grid 23a of the electron energy analyzer 23 , as previously described , is at a location spaced apart by 2 . 3 ( mm ) from the sample 21 along the optical axis ( z - direction ). therefore , the photoelectrons created from thesample 21 enter the electron energy analyzer 23 without losing ( amplifying ) their energy . the electron energy analyzer 23 selects and passes therethrough only those of the photoelectrons which have necessary energy . in the second embodiment , an electron energy analyzer of the retarding field type is used as the electron energy analyzer 23 and thus , when as described above , the grid 23a is at a location spaced apart by 2 . 3 ( mm ) from the sample 21 , a voltage of the order of - 400 v is applied with a discharge voltage taken into account . the photoelectrons passed through the electron energy analyzer 23 collide with the molecules of helium in the sample chamber 6 and the thereby amplified . these photoelectrons are detected by the detector 9a . the cpu 24 makes the amplifier 14 amplify the photoelectrons detected by the detector 9a as previously described , and causes them to be inputted asan image signal to the monitor 15 . thus , the monitor 15 displays the photoelectron image of the sample 21 . also , when it is desired to change the pressure in the sample chamber 6 andthe kind of the gas , return can be made to the step 101 . in the second embodiment , the photoelectrons are amplified by helium , any gas such as steam or nitrogen can be applied . in the following , the position of the electron energy analyzer 23 when nitrogen ( n 2 ) is used as a modification of the second embodiment is found . in this modification , the pressure in the sample chamber 6 is 100 pa . from the aforementioned state equation of the gas , the molecule density number n when the pressure in the sample chamber 6 is 100 pa is n = 2 . 41 × 10 22 ( number / m 3 ). the maximum value of the ionization and excitation cross section σ of nitrogen ( n 2 ) by photoelectron is from this , the grid 23a can be adjusted to a location distant by 1 . 60 ( mm ) from the sample 21 . in the present embodiment , x - rays of wavelength 1 nm is used as the light source , but x - rays of other wavelength or ultraviolet rays of a wavelengthof the order of 200 nm may also be used . also , in the present embodiment the stage 8 is moved two - dimensionally to thereby scan the beam of light 1a condensed on the sample 21 and the sample 21 , but alternatively , the reflecting mirror 4a may be caused to scan two - dimensionally . that is , as is well known , two mirrors for x - direction and y - direction , respectively , can be used and design can be made such that the respective mirrors are caused to scan . also , where the sample 21 is electrically conductive , photoelectrons not enough to satisfy the necessary energy can be dropped to the earth throughthe sample 21 and therefore , the grid 23b can be eliminated . | 7 |
detailed embodiments of the methods and structures of the present disclosure are described herein ; however , it is to be understood that the disclosed embodiments are merely illustrative of the described methods and structures that can be embodied in various forms . in addition , each of the examples given in connection with the various embodiments of the disclosure is intended to be illustrative , and not restrictive . further , the figures are not necessarily to scale , some features can be exaggerated to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the methods and structures of the present disclosure . for purposes of the description hereinafter , the terms “ upper ”, “ lower ”, “ top ”, “ bottom ”, and derivatives thereof shall relate to the disclosed structures , as they are oriented in the drawings . referring to fig2 , an illustrative structure and a method for forming semiconductor fet devices on a semiconductor - on - insulator ( soi ) substrate are described . fig2 shows a substrate [ 100 ], presently silicon - on - insulator ( soi ). the soi layer [ 102 ] is located above the buried - oxide layer ( box ) [ 101 ] and the substrate [ 100 ]. the buried oxide ( box ) layer [ 101 ] on the substrate [ 100 ] can be made as a silicon oxide , a nitride , a silicon nitride , and / or an oxynitride , e . g ., silicon oxynitride , having a thickness ranging from 5 nm to 1000 nm , or preferably , from 10 nm to 200 nm , and still more preferably , from 10 nm to 25 nm . the semiconductor - on - insulator ( soi ) substrate can be employed as the semiconductor substrate . when employed , the soi substrate includes a handle substrate superimposed by a buried insulator layer located on an upper surface of the handle substrate , and a semiconductor device layer located on an upper surface of the buried insulator layer . the handle substrate and the semiconductor device layer of the soi substrate can include the same or different semiconductor material . the term “ semiconductor ” as used herein in connection with the semiconductor material of the handle substrate and the semiconductor device layer denotes any semiconducting material including , for example , si , ge , sige , sic , sigec , inas , gaas , inp or other like iii / v compound semiconductors . multilayers of these semiconductor materials can also be used as the semiconductor material of the handle substrate and a semiconductor device layer [ 102 ]. in one embodiment , the handle substrate [ 100 ] and the semiconductor device layer are both made of si . the handle substrate and the semiconductor device layer can have the same or different crystal orientation . for example , the crystal orientation of the handle substrate and / or the semiconductor device layer can be { 100 }, { 110 }, or { 111 }. other crystallographic orientations besides those specifically mentioned can also be used in the present disclosure . the handle substrate of the soi substrate can be a single crystalline semiconductor material , a polycrystalline material , or an amorphous material . the semiconductor device layer of the soi substrate is a single crystalline semiconductor material . a single crystalline semiconductor material ( or monocrystalline semiconductor material ) is a semiconductor material in which the crystal lattice of the entire sample is continuous and unbroken to the edges of the sample , with no grain boundaries . the buried insulator layer of the soi substrate can be a crystalline or non - crystalline oxide or nitride . in one embodiment , the buried insulator layer is made of oxide . the buried insulator layer 101 can be continuous or it can be discontinuous . when a discontinuous buried insulator region is present , the buried insulator region exists as an isolated island that is surrounded by semiconductor material . the soi substrate can be formed utilizing standard processes including for example , simox ( separation by ion implantation of oxygen ) or layer transfer . when a layer transfer process is employed , an optional thinning step can follow the bonding of two semiconductor wafers together . the optional thinning step reduces the thickness of the semiconductor layer to a layer having a thickness that is more desirable . the thickness of the semiconductor device layer of the soi substrate is typically from 100 å to 1000 å , with a thickness from 500 å to 700 å being more typical . in some embodiments , and when an etsoi ( extremely thin semiconductor - on - insulator ) substrate is employed , the semiconductor device layer of the soi has a thickness of less than 100 å . if the thickness of the semiconductor device layer is not within one of the above mentioned ranges , a thinning step such as , for example , planarization or etching can be used to reduce the thickness of the semiconductor device layer to a value within one of the ranges mentioned above . referring to fig3 , a shallow trench isolation ( sti ) [ 103 ] created by a fabrication sequence is shown including trench etching , dielectric deposition such as oxide , followed by planarization such as cmp . the isolation formed by the sti process includes patterning ( e . g ., deposition a sacrificial pad layer ( e . g ., pad oxide and pad nitride ), patterning ( e . g ., by lithography ) and etching sti trenches , preferably by reactive ion etch ( rie ), filling the trenches with one or multiple insulators including but not limited to oxide , nitride , oxynitride , high - k dielectric , or any suitable combination of those materials . the planarization process , such as chemical - mechanical polishing ( cmp ), can be used to provide a planar structure . besides sti [ 103 ] other isolation such as mesa isolation , local oxidation of silicon ( locos ) can also be used . the sacrificial pad oxide and pad nitride can then be stripped . fig4 shows ion implantation into different regions to form n - well [ 104 ] and p - well [ 105 ] regions . the n - well ion implantation can be n - type dopant elements including arsenic or phosphorus . the p - well ion implantation preferably uses a p - type dopant material , including boron or indium . referring to fig5 , forming a gate stack is illustrated including a gate dielectric [ 106 ], a gate electrode [ 107 ], and a hardmask [ 108 ]. the gate dielectric [ 106 ] can be selected from silicon oxide , silicon oxynitride , nitride , high - k materials such as hafnium oxide or stacked combinations thereof . gate electrode [ 107 ] is a conductor or semiconductor , e . g ., polysilicon or metal , e . g ., tin , or stacked combinations thereof . the polysilicon layer can be doped by way of ion implantation or in - situ doped during the deposition . the hardmask [ 108 ] is typically a dielectric , e . g ., silicon oxide , silicon nitride or a stacked combination thereof . referring to fig6 , gate patterning is shown preferably using photoresist , a mask exposure using optical source , and photoresist development leaving the photoresist in desired areas [ 109 ]. fig7 shows the resulting structure after etching the hardmask , preferably using a rie process , and transferring the photoresist pattern into the hardmask . referring to fig8 , the structure is shown following the removal of the photoresist by way of a stripping process , leaving the etched hardmask in the desired pattern . fig9 shows the structure after etching the gate electrode [ 107 ] and gate dielectric [ 106 ], preferably using a directional rie , forming gates in the desired pattern . fig1 shows the structure following the deposition of a conformal spacer layer [ 110 ]. the spacer material is preferably a dielectric such as silicon nitride or silicon oxide that can be deposited by way of chemical vapor deposition ( cvd ), atomic layer deposition ( ald ) or molecular layer deposition ( mld ). fig1 illustrates the resulting structure after etching the spacer material , preferably using a directional reactive ion etch ( rie ) tot remove the spacer material from the horizontal surfaces but keeping it on the vertical sidewalls . fig1 shows a photoresist masking [ 111 ] that opens areas that are to receive n + doping by ion implantation [ 112 ]. n - dopant materials preferably include arsenic or phosphorus . the n + region serves as the source drain region of an nfet or as the n - well contact of the diode . alternatively , the n + region could be formed by etching a trench and filling it with epitaxially deposited semiconductor , such as n - doped sic . fig1 shows a photoresist masking step [ 113 ] that opens areas set to receive p + doping by ion implantation [ 114 ]. p - dopant materials may include boron . the p + region serves as the p + portion of the diode or the source drain region of the pfet ( not shown ). the photoresist is then removed , resulting in the structure shown in fig1 . alternatively , the p + region can be formed by etching a trench and filling it with epitaxially deposited semiconductor , such as p - doped sige . fig1 illustrates the photoresist step which covers and protects the diode , while exposing the fet region to etching that removes the hardmask [ 108 ] over the fet gate . the hardmask etch is preferably performed by rie etching . the rie etching can result in damaging the exposed regions as will be illustrated with reference to fig1 . referring to fig1 , the structure is shown following rie etching , illustrating the resulting damaged regions [ 116 ]. because the photoresist [ 115 ] covers the diode region , it protects the diode from hardmask rie damage , and preserves not only the diode , but it also avoids degradation of the diode ideality . fig1 shows a cross - section view of the structure after silicide [ 117 ] formation . the silicide can be selected from nickel silicide , titanium silicide , cobalt silicide , or any other silicide material . the nickel , titanium , cobalt or other similar metal is deposited on the entire structure . during at heating of the wafer , preferably by rapid thermal annealing ( rta ), the silicide forms as a reaction between the metal and the silicon on the exposed n + or p + regions including gate regions not covered by spacer [ 110 ] or the hardmask [ 108 ]. the fet gate is silicided leaving the diode gate unsilicided as a result of the hardmask still remaining in place . the unreacted metal on the spacer or the hardmask is etched away , preferably by aqueous chemistry . still referring to fig1 , in one embodiment , the gated - diode shown is devoid of any damage resulting from the absence of siliciding the gate , and is further formed alongside the fet having a silicided gate that allows it to achieve a high - performance caused by the reduced gate resistance . fig1 shows an embodiment wherein the gated - diode with its non - silicided gate is formed alongside the nfet and pfet having a silicided gate . it should be noted that while the gated - diode is shown as a p +/ n diode , an embodiment of the inventive structure could be equally applicable to a n +/ p diode . fig2 shows a plan view of the structure illustrated in fig1 depicting additional details of the structure . the non - silicided gate [ 123 ] of the gated - diode is shown in the region on top of the active region of the device , leaving the cap layer in place within the active region , thereby avoiding rie damage to the active region of the diode . the gate [ 121 ] of the gated - diode is silicided outside the active region to the diode , over the sti , by removing the cap layer in the stated region that allows silicide to form . the silicide within the region enables a good contact between the contact [ 120 ] and the gate [ 121 ] of the gated - diode . removing the cap layer in the region outside of the active area of the gated - diode does not create damage near the active region of the diode . shown in fig2 , the gate of the fet is silicided [ 122 ]. fig2 shows a plan view of the structure from fig1 , illustrating an embodiment of the gated - diode with a non - silicided gate [ 124 ] and nfet [ 125 ] and pfet [ 126 ] with a silicided gate . the gate of the gated - diode is not silicided [ 124 ] in the region above the active region of the device , and leaving the cap layer in place within this region , making it possible to avoid rie damage in the active region of the diode . the gate of the gated - diode is silicided outside the diode active region [ 122 ], over the sti , by removing the cap layer in this region , thus enabling silicide to be formed . the silicide in this region provides good contact between the contact [ 120 ] and the gate of the gated - diode . removing the cap layer in the region outside of the active area of the gated - diode does not create damage near the active region of the diode . the gate of the fets [ 125 , 126 ] is silicided . fig2 shows a plan view of an embodiment of an alternate diode structure illustrating other plan - view designs of the gated - diode ( nfet and pfet not shown ). in an embodiment , the diode is formed within the perimeter of the gate . as previously described , the gate of the gated - diode is not silicided [ 128 ] in the region located above the active region of the device by leaving the cap layer in place in this region , to avoid rie damage within the active region of the diode . the gate of the gated - diode is silicided [ 127 ] in an area beyond the diode active region and spanning over the sti , and removing the cap layer from the region , thereby permitting the formation of silicide . while the present disclosure has been particularly shown and described with respect to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in forms and details can be made without departing from the spirit and scope of the present disclosure . in one therefore intended that the present disclosure not be limited to the exact forms and details described and illustrated , but fall within the scope of the appended claims . | 7 |
the present invention is described below with reference to the embodiments shown in the drawings . fig1 is a block diagram schematically illustrating the general structure of a digital camera to which an embodiment of the present invention is applied . the digital camera 10 , for example , is a digital single - lens reflex camera . light made incident to a lens system 11 forms an image on an imaging surface of an image sensor 14 ( e . g ., a cmos image sensor ) through an aperture 12 and a color filter array 13 . the image sensor 14 may be controlled by drive signals from an image sensor driver 15 . image signals obtained by the image sensor 14 may be fed to an image signal processor 16 to be subjected to various types of image signal processing that are well known in the art , and in turn , the image may be displayed on a monitor 17 . an af controller 19 may control the positions of the lenses in the lens system 11 to carry out the autofocus operation . further , an aperture controller 20 may control the size of the aperture 12 . note that the image sensor driver 15 , the af controller 19 and the aperture controller 20 are controlled by instructions from a controller 21 , and the controller 21 may perform various types of processes , including the autofocus operation ( detailed later ), based on the manipulation of switches in a switch group 22 . the switch group 22 may include a release switch , af button , dial switches , a touch panel , etc . with references to fig2 a , 2 b and 3 , an outline of a focusing - image display verification method for the present embodiment will be explained . note that in the present embodiment a contrast - detect autofocus ( caf ) operation is applied . fig2 a and 2b represent captured images of two dissimilar types of objects having different spatial frequencies . in fig2 a and 2b , caf areas a 2 and a 3 are indicated within an actual pixel area ( or an effective pixel area ) a 1 , and are used in a caf operation to compare the contrast between them . in fig2 a , a person &# 39 ; s face in large scale is positioned at the center of the image . on the other hand , in fig2 b , three people are imaged with distant background view . in general , images of the type in fig2 b have higher spatial frequency compared to images of the type in fig2 a , which makes it relatively difficult to verify the focusing degree of an image having a high spatial frequency like the one in fig2 b . therefore , in the present embodiment a focusing image within the caf area is magnified with the focus point at its center and displayed on the monitor 17 ( see fig1 ) after the caf operation is completed , with the magnification being controlled in accordance to the spatial frequency within the caf area . the relationship between the spatial frequency and the magnitude of the present embodiment is represented in the graph of fig3 . namely , in the present embodiment , a focusing image is enlarged by a greater magnification as the spatial frequency is increased for display on the monitor 17 . note that as in the example indicated in fig3 , in a lower spatial frequency band the magnification linearly increases as the spatial frequency increases until it surpasses a predetermined spatial frequency , at which point the magnification is sustained at a constant ( the maximum magnification ). however , the relationship between the spatial frequency and the magnification is not restricted to the present example . further , the focusing image may be larger than the caf area , such that an area surrounding the caf area may be included . next with reference to the flowchart of fig4 , a focusing - image display operation of the present embodiment will be explained . note that the focusing - image display operation is carried out mainly by the controller 21 ( see fig1 ). the operations indicated in fig4 are carried out when a through - the - lens image ( live preview ) is displayed on the monitor . when an af request is detected in step s 100 , a caf operation is initiated in step s 102 . namely , a caf operation is carried out in cooperation with the af controller 19 by comparing the contrast between images captured successively within the caf area ( see fig1 ). when the caf operation of step s 102 is completed , whether or not a request for a focus - verification assist has been detected is determined in step s 104 . the focus - verification assist request designates whether or not to perform the above - mentioned magnifying control while a focusing image is displayed . for example , whether the request exists is determined by whether or not the focus - verification assist mode has been preset by a user . when it is determined that the focus - verification assist request does not exist , this process is immediately terminated and the normal through - the - lens operation or live preview starts . however when it is determined that the focus - verification assist request exists , the last image within the caf area during the caf operation of step s 102 is stored in memory ( not shown ) at step s 106 . the spatial frequency of the image stored in memory is then calculated and , for example , a magnification to the size of the through - the - lens image is determined with reference to a lookup table that corresponds to the graph in fig3 in step s 108 . in step s 110 the resolution of an image of the caf area , which is stored in the memory , is modified based on the magnification obtained in step s 108 and , in turn , the image is magnified and displayed on the monitor 17 ( see fig1 ). in step s 112 , a determination is made as to whether or not either the display of the focusing image on the monitor 17 has been canceled or a predetermined time has elapsed from the beginning of the display of the focusing image . the representation may be cancelled by the manipulation of a predetermined button ( not shown ) included in the switch group 22 and , for example , the predetermined time may be preset to approximately 2 seconds . the determination of step s 112 is repeated until either the display of the focusing image has been cancelled or the predetermined time has elapsed . when either one of these events occurs the focusing - image display operation is completed and the normal through - the - lens image display or live preview resumes . as described above , according to the present embodiment , a focusing image can be enlarged at an appropriate magnification associated with the spatial frequency of an object image and displayed on a monitor . note that only the pixel signals from the caf area within the effective pixel area may be read out to perform an accelerated caf operation . further , this caf operation and method of displaying the focusing - image in this invention may be combined , such that the size of a focusing - image displayed on the monitor may be determined from the spatial frequency of the caf area . further , although the present embodiment has been described for a single - lens reflex camera , the present invention is not restricted to a digital camera and may also be applied to a device , including a cell phone and the like , which is provided with a digital camera . although the embodiment of the present invention has been described herein with reference to the accompanying drawings , obviously many modifications and changes may be made by those skilled in this art without departing from the scope of the invention . the present disclosure relates to subject matter contained in japanese patent application no . 2010 - 200880 ( filed on sep . 8 , 2010 ), which is expressly incorporated herein , by reference , in its entirety . | 6 |
the aforementioned ingredients of the nonaqueous component of the dental bleaching composition of the present invention is critical to the performance of the present invention . hydrogen peroxide is available to dentists in a thirty to thirty - five percent ( 30 %- 35 %) aqueous solution . the nonaqueous component of the composition of the present invention permits the dentist to prepare an active bleaching composition in a solid form , either as a paste or gel , for direct application to the teeth to be bleached , with the period of treatment initiated photo - optically for activating the composition and terminated by removal of the paste or gel from the treated teeth upon a visual color transformation after a fixed time period . the color transformation will occur only if hydrogen peroxide dissociates to a concentration of nascent oxygen sufficient to cause color transformation of the color indicator in the composition within that time frame the color indicator is , accordingly , for practical purposes , a critical component which must be compatible with the other components and yet provide a distinct , uniform color to the gel or paste composition , which will oxidize and transform to another color or become colorless in response to the level of activity , corresponding to the dissociation of concentrated hydrogen peroxide over a fixed time period . only guinea green and , to a lesser extent , phenolphthalin , has been found to satisfy this requirement of the invention . the concentration of guinea green in the gel or paste has little effect on its color transformation characteristic . it is thus a direct indicator of hydrogen peroxide activity . if the hydrogen peroxide used in forming the gel or paste was of a low concentration due to aging , no significant color change will occur in the time frame set for treating the patient , independent of the concentration of the color indicator in the gel . guinea green is a commercially available dye sold by the aldrich chemical company , having the chemical identity : ethyl [ 4 -( p -[ ethyl ( m - sulfobenzyl ) amino ]- alpha - phenylbenzylidene - 2 , 5 - cyclohexadien - 1 - ylidene ) ( m - sulfobenzyl ) ammonium hydroxide inner salt sodium salt . guinea green colors the composite material green and provides an identity of the activity level of the material by becoming colorless when sufficiently oxidized . if the hydrogen peroxide component has deteriorated due to age , insufficient oxidation will occur to neutralize the green color . it is at present difficult for a practicing dentist to know if the hydrogen peroxide supply in the dental office is active , since its activity is dependent upon storage time and temperature . it is also important to permit the hydrogen peroxide to penetrate the enamel in order to lighten the enamel of he teeth . the guinea green will neutralize to provide the total absence of color over a total treatment time period of from about five ( 5 ) to fifteen ( 15 ) minutes for the composition of the present invention . phenolphthalin is a colorless crystal derived from phenolphthalein which converts to a reddish color when sufficiently oxidized . this is a less preferred redox indicator . the concentration level of the color indicator is not a critical factor and , in fact , only a minor percent , of between 0 . 01 and 0 . 3 percent by volume , is all that is necessary to produce an intense color . the preferred ratio of the aqueous hydrogen peroxide component to the nonaqueous component is 50 to 100 parts by volume , with a more preferred ratio of 50 to 70 parts by volume , with 60 parts being optimum . stated otherwise , the preferred ratio is five parts of the nonaqueous powder to three parts hydrogen peroxide . the inert silica gelling agent in the nonaqueous component is preferably an amorphous fumed silica . fumed silica are silicon dioxide particles of extremely small size , substantially below one ( 1 ) micron . the preferred concentration of the silica gelling agent in the nonaqueous component is between fifty to eighty percent ( 50 %- 80 %) by volume , and is the major ingredient of this component , as well as of the gel or paste . another essential ingredient of the nonaqueous component is the incorporation of an accelerator for controlling the breakdown of hydrogen time period . the preferred accelerator is manganese sulfate monohydrate . &# 34 ; oxone ,&# 34 ; a potassium persulphinate product of the du pont corporation may also be used in combination , in instance the oxone functions as a co - catalyst . the range for use of each component of the accelerator is indicated in the table of examples . the dissociation of hydrogen peroxide is initiated , in accordance with the invention , by the use of a dental curing light . the optical energy accelerates the catalyst for activating and promoting the acceleration of free radical polymerization of hydrogen peroxide , and by use of a redox color indicator , as discussed heretofore , for timing the duration of the bleaching operation after it is initiated . preferably light energy in the visible spectrum of between 400 and 700 nanometers should be used to initiate the breakdown of hydrogen peroxide . the application of light energy may be maintained for the entire treatment period , but preferably at least about three minutes . the color indicator , as explained heretofore serves as a critical component for providing a visual indication of the completion of treatment , and as an indicator that the hydrogen peroxide was , in fact , active during treatment . as an alternative to manganese sulfate , ferrous sulfate may be used as the catalytic activator and at essentially the same concentration level . in fact , using ferrous sulfate , it is possible to activate the composition at room temperature without the application of visible light . however , in such case a quiescent period of at least about five to seven minutes is necessary before catalytic activity begins to become meaningful . thus , the ability to control the initiation of the operation is lost and much more time is necessary to complete treatment . accordingly , it is preferred to operate with the application of light energy which provides a more effective control over catalytic activity . manganese sulfate is preferred when applying light and has been found to be responsive to light energy , thereby accelerating catalytic activity during the application of light energy to provide a complete treatment in under ten to fifteen minutes . the remainder of the nonaqueous formulation is provided by a polymethylvinyl ether maleate potassium salt polymeric compound or cellulosics , preferably selected from the class consisting of carboxymethyl cellulose , hydroxyethyl cellulose and sodium cellulose sulfate . the preferred compound is sold under the trademark name gantrez ( ms - 955 ) by the gaf corporation of new jersey . the polymethylvinyl ether maleate potassium salt or celulosic ether compound is also essential to the nonaqueous formulation , and provides thermoplasticity and thickening properties to the paste or gel composition formed with hydrogen peroxide , so as to permit the paste to be built up upon the teeth to be bleached and remain essentially erect , i . e ., the material does not sag or slump during the treatment period . it also slows drying of the composition to maintain the level of activity on the tooth surface throughout the treatment time period . it is important that the gel or paste remain aqueous for the entire treating period and yet remain physically stationary and in place on the tooth surface to permit maximum surface interaction and prevent gingival damage . it is postulated that the hydrogen peroxide must penetrate the enamel of the tooth while dissociating to maximize bleaching . the combination of the silica gelling agent and the cellulose ether compound represents the major constituents of the nonaqueous formulation , and preferably should equal at least about eighty percent ( 80 %) of such composition . the following table indicates the preferred range for each constituent in the nonaqueous component and illustrates eight ( 8 ) examples of varying concentrations for the constituents , with example number ( 1 ) being the preferred composition . in the other seven examples , one element is eliminated or modified , with the other constituents adjusted relative to example number ( 1 ) functioning as the control for comparison purposes : table______________________________________constituent range ( percent ) ______________________________________ ( a ) silica absorbent gelling agent 50 - 75 ( b ) ( 1 ) manganese sulfate monohydrate 2 - 10 ( 2 ) oxone 0 - 10 ( 3 ) ferrous sulfate 2 - 10 ( c ) gantrez remainder to 25 ( d ) guinea green 0 . 01 - 0 . 3______________________________________ ______________________________________consti - examplestuent ( 1 ) ( 2 ) ( 3 ) ( 4 ) ( 5 ) ( 6 ) ( 7 ) ( 8 ) ( 9 ) ______________________________________ ( a ) 70 70 70 70 30 100 70 70 70 ( b - 1 ) 4 . 8 1 . 8 4 . 8 0 4 . 8 4 . 8 4 . 8 4 . 8 --( b - 2 ) 5 . 75 0 5 . 75 5 . 75 5 . 75 5 . 75 5 . 75 15 . 0 --( b - 3 ) -- -- -- -- -- -- -- -- 4 ( c ) 19 . 24 19 . 24 0 19 . 24 19 . 24 19 . 24 30 19 . 24 19 . 24 ( d ) 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1______________________________________ the formulation of example one ( 1 ) was the easiest to mix and apply . the composition did not dry out during bleaching . the process required three ( 3 ) to five ( 5 ) minutes of light activation and a total of about ten ( 10 ) minutes until the color changed from green to white . the formulation was applied to a stained tooth with the stain appreciably reduced upon completion of the process . examples three ( 3 ), six ( 6 ), and seven ( 7 ) were failures in that the material dried too quickly and did not appear to bleach as well . example five ( 5 ) did not form a satisfactory paste or gel and , accordingly , was too difficult to apply . examples two ( 2 ) and four ( 4 ) provided results similar to example one ( 1 ), but took almost twice the time , indicating insufficient accelerator . example eight ( 8 ) appeared unstable during storage , indicating the presence of an excess of oxone . example nine ( 9 ) used no light and at room temperature ( 23 ° c .) began bubbling in six ( 6 ) minutes and turned light brown ( from green ) after nine minutes . | 0 |
referring now to the figures of the drawing in detail and first , particularly , to fig1 thereof , there is shown schematically a scale 1 that is provided in an instrument cluster of a vehicle which has an internal combustion engine and is equipped with a coasting function , and it serves to indicate a current load condition of the internal combustion engine . the indication range of the scale 1 extends from a left - hand scale edge 2 , which is associated with the “ overrun ” operating condition of the internal combustion engine , and a right - hand scale edge 2 ′, which is associated with the “ full load ” operating condition of the internal combustion engine . a range of the scale 1 which is bounded by a left - hand limiting value gl and a right - hand limiting value gr defines a load condition range of the internal combustion engine which is preferred for entry to the coasting phase . a field 3 in the bar graph is filled in accordance with the current value of a parameter which characterizes the load condition of the internal combustion engine . the limiting values gl , gr are specified or determined in such a way that the adoption of the “ coasting ” driving condition , e . g . for reasons of economy or , for example , for technical reasons , so as to avoid load jumps when entering / emerging from the coasting function and hence to avoid exposing the drive train to excessive loads , is advantageous and / or necessary when the current value of the parameter which characterizes the load condition of the internal combustion engine is within the range between the limiting values gl , gr . an application can be used to provide a freely selectable graduation of the scale 1 . fig2 to 5 show the scale 1 from fig1 in the condition where it is indicating various different load conditions of the internal combustion engine . in all of fig1 to 7 , the operating point is indicated symbolically by a stylized cursor 5 . in particular , fig2 shows the scale 1 in the condition where it is indicating the “ full load in traction ” load condition of the internal combustion engine , fig3 shows the scale 1 in the condition where it is indicating the “ partial load in traction ” load condition of the internal combustion engine , fig4 shows the scale 1 in the condition where it is indicating the “ slight overrun ” load condition of the internal combustion engine , while fig5 shows the scale 1 in the condition where it is indicating the “ maximum overrun ” load condition of the internal combustion engine . to summarize , the driver can thus see at any time how close he is to the operating point or operating range of coasting , and can take this information into account in the deliberate selection of coasting operation . fig6 shows the scale 1 in the condition where it is indicating that the “ coasting ” function can be activated , i . e . the load condition of the internal combustion engine at that moment has a value at which the “ coasting ” function can be activated . a variable bar does not now appear on the scale 1 ; instead , the area of the field 3 between the left - hand scale edge 2 and the left - hand limiting value gl is filled in order in this way to indicate to the driver that the “ coasting ” function can be activated at this time . fig7 shows the scale 1 in the condition where it is indicating that the “ coasting ” function is active . again , a variable bar does not appear on the scale 1 ; instead , the area of the field 3 between the limiting values is now filled in order in this way to indicate to the driver that the “ coasting ” function is active . indication of the load condition can be activated and / or deactivated automatically in response to a user instruction or in a manner dependent on particular preconditions . | 8 |
fig1 provides an overview of the processing completed by the system for the collaborative , on - line development and delivery of customized risk transfer programs . in accordance with the present invention , an automated method of and system ( 100 ) for collaborative , on - line development and delivery of customized risk transfer programs is provided . processing starts in this system ( 100 ) with the specification of system settings and the initialization and activation of software data “ bots ” ( 200 ) that extract , aggregate , manipulate and store the internal data , external data , customer ( 20 ) input and a customer financial model required for completing system processing . the data from external databases is used to analyze generic event risks and prices on investments for the asset classes and contingent liabilities specified by the system operator ( 21 ). in the preferred embodiment , the customer financial model is created using the system described in the cross referenced application ser . no . 10 / 747 , 471 as required to identify the impact of the different elements of value , external factors and risks on customer financial performance and value . however , any other method or system for developing this data could be used to the same effect . all required data is extracted via a network ( 45 ) from a basic financial system database ( 5 ), an external database ( 25 ), an advanced finance system database ( 30 ) and a customer database ( 35 ). these information extractions and aggregations may be influenced by a system operator ( 21 ) through interaction with a user - interface portion of the application software ( 700 ) that mediates the display , transmission and receipt of all information to and from browser software ( 800 ) such as the microsoft internet explorer or netscape navigator in an access device ( 90 ) such as a phone or personal computer that the customer ( 20 ) or system operator interact with . while only one basic financial system database ( 5 ), external database ( 25 ), advanced finance system database ( 30 ) and customer database ( 35 ) is shown in fig1 , it is to be understood that the system ( 100 ) can extract data from an unlimited number of databases and customers via the network ( 45 ). it also to be understood that the customer ( 20 ) and the system operator ( 21 ) can operate separate access devices ( 90 ). it should also be understood that it is possible to complete a bulk extraction of data from each database ( 5 , 25 , 30 and 35 ) via the network ( 45 ) using data extraction applications before initializing the data bots . the data extracted in bulk could be stored in a single datamart or data warehouse where the data bots could operate on the aggregated data . all extracted information is stored in a file or table ( hereinafter , table ) within an application database ( 50 ) as shown in fig2 . the application database ( 50 ) contains tables for storing input , extracted information and system calculations including an xml profile table ( 140 ), a bot date table ( 141 ), a customer table ( 142 ), a risk products table ( 143 ), a swaps table ( 144 ), a customer profile table ( 145 ), an exchange payout history table ( 146 ), an generic risk table ( 147 ), a liability scenario table ( 148 ), an asset position table ( 149 ), an external database table ( 150 ), an asset forecasts table ( 151 ), an asset correlation table ( 152 ), an scenario table ( 153 ), an exchange simulation table ( 154 ), a contingent capital table ( 155 ), an optimal exchange mix table ( 156 ) and an exchange premium history table ( 157 ) a system settings table ( 158 ), a metadata mapping table ( 159 ), a conversion rules table ( 160 ), a basic financial system table ( 161 ) and an advanced finance system table ( 162 ). other combinations of tables and files can be used to the same effect . the application database ( 50 ) can optionally exist on a hard drive , a datamart , data warehouse or departmental warehouse . the system described herein has the ability to accept and store supplemental or primary data directly from user input , a data warehouse or other electronic files in addition to receiving data from the customer databases described previously . as shown in fig3 , the preferred embodiment described herein is a computer system ( 100 ) illustratively comprised of a user - interface personal computer ( 110 ) connected to an application - server personal computer ( 120 ) via a network ( 45 ). the application server personal computer ( 120 ) is in turn connected via the network ( 45 ) to a database - server personal computer ( 130 ). the user interface personal computer ( 110 ) is also connected via the network ( 45 ) to an internet browser appliance ( 90 ) that contains browser software ( 800 ) such as microsoft internet explorer or netscape navigator . the database - server personal computer ( 130 ) has a read / write random access memory ( 131 ), a hard drive ( 132 ) for storage of the application database ( 50 ), a keyboard ( 133 ), a communications bus card containing all required adapters and bridges ( 134 ), a display ( 135 ), a mouse ( 136 ) and a cpu ( 137 ). the application - server personal computer ( 120 ) has a read / write random access memory ( 121 ), a hard drive ( 122 ) for storage of the non - user - interface portion of the enterprise portion of the application software ( 200 and 300 ) described herein , a keyboard ( 123 ), a communications bus containing all required adapters and bridges ( 124 ), a display ( 125 ), a mouse ( 126 ), a cpu ( 127 ) and a printer ( 128 ). while only one client personal computer is shown in fig3 , it is to be understood that the application - server personal computer ( 120 ) can be networked to fifty or more client personal computers ( 110 ) via the network ( 45 ). the application - server personal computer ( 120 ) can also be networked to fifty or more server , personal computers ( 130 ) via the network ( 45 ). it is to be understood that the diagram of fig3 is merely illustrative of one embodiment described herein as the system ( 100 ) and application software ( 200 , 300 and 700 ) could reside on a single computer or any number of computers that are linked together using a network . in a similar manner the system operator ( 21 ) and / or the customer ( 20 ) could interface directly with one or more of the computers in the system ( 100 ) instead of using an access device ( 90 ) with a browser ( 800 ) as described in the preferred embodiment . the user - interface personal computer ( 110 ) has a read / write random access memory ( 111 ), a hard drive ( 112 ) for storage of a client data - base ( 49 ) and the user - interface portion of the application software ( 700 ), a keyboard ( 113 ), a communications bus containing all required adapters and bridges ( 114 ), a display ( 115 ), a mouse ( 116 ), a cpu ( 117 ) and a printer ( 118 ). the application software ( 200 , 300 and 700 ) controls the performance of the central processing unit ( 127 ) as it completes the calculations required to support the collaborative development and implementation of a risk transfer program . in the embodiment illustrated herein , the application software program ( 200 , 300 and 700 ) is written in a combination of c ++ and visual basic ® although other languages can be used to the same effect . the application software ( 200 , 300 and 700 ) can use structured query language ( sql ) for extracting data from the different databases ( 5 , 25 , 30 and 35 ). the customer ( 20 ) and system operator ( 21 ) can optionally interact with the user - interface portion of the application software ( 700 ) using the browser software ( 800 ) in the browser appliance ( 90 ) to provide information to the application software ( 200 , 300 and 700 ) for use in determining which data will be extracted and transferred to the application database ( 50 ) by the data bots . user input is initially saved to the client database ( 49 ) before being transmitted to the communication bus card ( 124 ) and on to the hard drive ( 122 ) of the application - server computer via the network ( 45 ). following the program instructions of the application software , the central processing unit ( 127 ) accesses the extracted data and user input by retrieving it from the hard drive ( 122 ) using the random access memory ( 121 ) as computation workspace in a manner that is well known . the computers ( 110 , 120 and 130 ) shown in fig3 illustratively are ibm pcs or clones or any of the more powerful computers ( such as mainframe computers ) or workstations that are widely available . typical memory configurations for client personal computers ( 110 ) used with the present invention should include at least 512 megabytes of semiconductor random access memory ( 111 ) and at least a 100 gigabyte hard drive ( 112 ). typical memory configurations for the application - server personal computer ( 120 ) used with the present invention should include at least 2056 megabytes of semiconductor random access memory ( 121 ) and at least a 250 gigabyte hard drive ( 122 ). typical memory configurations for the database - server personal computer ( 130 ) used with the present invention should include at least 4112 megabytes of semiconductor random access memory ( 131 ) and at least a 500 gigabyte hard drive ( 132 ). using the system described above , customer financial data is analyzed before a comprehensive risk management program is developed and implemented for each customer . the risk reduction program development is completed in two stages . as shown in fig5 the first stage of processing ( block 200 from fig1 ) programs bots to continually extract , aggregate , manipulate and store the data from user input , external databases ( 25 ) and customer databases ( 30 ) as required . bots are independent components of the application that have specific tasks to perform . as shown in fig6 the second stage of processing ( block 300 from fig1 ) analyzes customer risk profiles , determines the optimal risk transfer program for each customer , sets prices and communicates with each customer as required to complete risk reduction program development and implementation . the processing described in this application for identifying the optimal risk transfer program for each customer can optionally be completed at the enterprise level ( as shown in the cross referenced application ser . no . 09 / 688 , 983 ) before data is transmitted to the system of the present invention . the flow diagrams in fig5 details the processing that is completed by the portion of the application software ( 200 ) that obtains systems settings from the system operator ( 21 ) before extracting , aggregating and storing the information required for system operation from a basic financial system database , an external database ( 25 ), and advanced finance system database ( 30 ) and a customer database ( 35 ). system processing starts in a block 201 , fig5 a , which immediately passes processing to a software block 202 . the software in block 202 prompts the system operator ( 21 ) via the system settings data window ( 701 ) to provide system setting information . the system setting information entered by the system operator ( 21 ) is transmitted via the network ( 45 ) back to the application server ( 120 ) where it is stored in the system settings table ( 158 ) in the application database ( 50 ) in a manner that is well known . the specific inputs the system operator ( 21 ) is asked to provide at this point in processing are shown in table 1 . the software in block 202 uses the current system date to determine the time periods ( months ) that require data to complete the development of risk transfer programs . after the date range is calculated , it is stored in the system settings table ( 158 ). in the preferred embodiment data is obtained for the three year period before and the three year forecast period after the current date . the system operator ( 21 ) also has the option of specifying the data periods that will be used for completing system calculations . after the storage of system setting data is complete , processing advances to a software block 203 . the software in block 203 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to map metadata using the standard previously specified by the system operator ( 21 ) ( xml , microsoft open information model or the metadata coalitions specification ) from the basic financial system database ( 5 ), the external database ( 25 ), the advanced financial system database ( 30 ) and the customer database ( 35 ) to the enterprise hierarchy stored in the system settings table ( 158 ) and to the pre - specified fields in the metadata mapping table ( 159 ). pre - specified fields in the metadata mapping table include , the revenue , expense and capital components and sub - components for the exchange and pre - specified fields for expected value drivers . because the bulk of the information being extracted is financial information , the metadata mapping often takes the form of specifying the account number ranges that correspond to the different fields in the metadata mapping table ( 159 ). table 2 shows the base account number structure that the account numbers in the other systems must align with . for example , using the structure shown below , the revenue component for the enterprise could be specified as enterprise 01 , any department number , accounts 400 to 499 ( the revenue account range ) with any sub - account . as part of the metadata mapping process , any database fields that are not mapped to pre - specified fields are defined by the system operator ( 21 ) as component of value , elements of value or non - relevant attributes and “ mapped ” in the metadata mapping table ( 159 ) to the corresponding fields in each database in a manner identical to that described above for the pre - specified fields . after all fields have been mapped to the metadata mapping table ( 159 ), the software in block 203 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide conversion rules for each metadata field for each data source . conversion rules will include information regarding currency conversions and conversion for units of measure that may be required to accurately and consistently analyze the data . the inputs from the system operator ( 21 ) regarding conversion rules are stored in the conversion rules table ( 160 ) in the application database ( 50 ). when conversion rules have been stored for all fields from every data source , then processing advances to a software block 204 . the software in block 204 checks the bot date table ( 141 ) and deactivates any basic financial system data bots with creation dates before the current system date and retrieves information from the system settings table ( 158 ), metadata mapping table ( 159 ), conversion rules table ( 160 ), the asset position table ( 149 ) and the basic financial system table ( 161 ). the software in block 204 then initializes data bots for each field in the metadata mapping table ( 159 ) that mapped to the basic financial system database ( 5 ) in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). bots are independent components of the application that have specific tasks to perform . in the case of data acquisition bots , their tasks are to extract and convert data from a specified source and then store it in a specified location . each data bot initialized by software block 204 will store its data in the asset position table ( 149 ) or the basic financial system table ( 161 ). every data acquisition bot for every data source contains the information shown in table 3 . after the software in block 204 initializes all the bots for the basic financial system database , the bots extract and convert data in accordance with their preprogrammed instructions in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). as each bot extracts and converts data from the basic financial system database ( 5 ), processing advances to a software block 209 before the bot completes data storage . the software in block 209 checks the basic financial system metadata to see if all data for all fields have been extracted and that there are metadata assignments for all extracted data . if the software in block 209 finds no unmapped data fields , then the extracted , converted data are stored in the asset position table ( 149 ) or the basic financial system table ( 161 ). alternatively , if there are unmapped data fields , then processing advances to a block 211 . the software in block 211 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide metadata and conversion rules for each new field . the information regarding the new metadata and conversion rules is stored in the metadata mapping table ( 159 ) and conversion rules table ( 160 ) while the extracted , converted data are stored in the asset position table ( 149 ) or the basic financial system table ( 161 ). it is worth noting at this point that the activation and operation of bots where all the fields have been mapped to the application database ( 50 ) continues . only bots with unmapped fields “ wait ” for user input before completing data storage . the new metadata and conversion rule information will be used the next time bots are initialized in accordance with the frequency established by the system operator ( 21 ). in either event , system processing passes on to a software block 221 . the software in block 221 checks the bot date table ( 141 ) and deactivates any external database data bots with creation dates before the current system date and retrieves information from the generic risk table ( 147 ), external database table ( 150 ), system settings table ( 158 ), metadata mapping table ( 159 ) and conversion rules table ( 160 ). the software in block 221 then initializes data bots for each field in the metadata mapping table ( 159 ) that mapped to the external database ( 25 ) in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). bots are independent components of the application that have specific tasks to perform . in the case of data acquisition bots , their tasks are to extract and convert data from a specified source and then store it in a specified location . each data bot initialized by software block 221 will store its data in the generic risk table ( 147 ) or the external database table ( 150 ). after the software in block 221 initializes all the bots for the advanced finance system database , the bots extract and convert data in accordance with their preprogrammed instructions in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). as each bot extracts and converts data from the external database ( 25 ), processing advances to a software block 209 before the bot completes data storage . the software in block 209 checks the advanced finance system metadata to see if all data for all fields have been extracted and that there are metadata assignments for all extracted data . if the software in block 209 finds no unmapped data fields , then the extracted , converted data are stored in the generic risk table ( 147 ) or external database table ( 150 ). alternatively , if there are unmapped data fields , then processing advances to a block 211 . the software in block 211 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide metadata and conversion rules for each new field . the information regarding the new metadata and conversion rules is stored in the metadata mapping table ( 159 ) and conversion rules table ( 160 ) while the extracted , converted data are stored in the generic risk table ( 147 ) or external database table ( 150 ). it is worth noting at this point that the activation and operation of bots where all the fields have been mapped to the application database ( 50 ) continues . only bots with unmapped fields “ wait ” for user input before completing data storage . the new metadata and conversion rule information will be used the next time bots are initialized in accordance with the frequency established by the system operator ( 21 ). in either event , system processing passes on to a software block 225 . the software in block 225 checks the bot date table ( 141 ) and deactivates any advanced finance system data bots with creation dates before the current system date and retrieves information from the system settings table ( 158 ), metadata mapping table ( 159 ), conversion rules table ( 160 ) and advanced finance system table ( 162 ). the software in block 225 then initializes data bots for each field in the metadata mapping table ( 159 ) that mapped to the advanced finance system database ( 30 ) in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). bots are independent components of the application that have specific tasks to perform . in the case of data acquisition bots , their tasks are to extract and convert data from a specified source and then store it in a specified location . each data bot initialized by software block 225 will store its data in the asset position table ( 149 ) or the advanced finance system table ( 162 ). after the software in block 225 initializes all the bots for the advanced finance system database , the bots extract and convert data in accordance with their preprogrammed instructions in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). as each bot extracts and converts data from the basic financial system database ( 5 ), processing advances to a software block 209 before the bot completes data storage . the software in block 209 checks the advanced finance system metadata to see if all data for all fields have been extracted and that there are metadata assignments for all extracted data . if the software in block 209 finds no unmapped data fields , then the extracted , converted data are stored in the asset position table ( 149 ) or the advanced finance system table ( 162 ). alternatively , if there are unmapped data fields , then processing advances to a block 211 . the software in block 211 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide metadata and conversion rules for each new field . the information regarding the new metadata and conversion rules is stored in the metadata mapping table ( 159 ) and conversion rules table ( 160 ) while the extracted , converted data are stored in asset position table ( 149 ) or the advanced finance system table ( 162 ). it is worth noting at this point that the activation and operation of bots where all the fields have been mapped to the application database ( 50 ) continues . only bots with unmapped fields “ wait ” for user input before completing data storage . the new metadata and conversion rule information will be used the next time bots are initialized in accordance with the frequency established by the system operator ( 21 ). in either event , system processing passes on to a software block 226 . the software in block 226 checks the bot date table ( 141 ) and deactivates any customer database data bots with creation dates before the current system date and retrieves information from the system settings table ( 158 ), metadata mapping table ( 159 ), conversion rules table ( 160 ) and customer table ( 142 ). the software in block 226 then initializes data bots for each field in the metadata mapping table ( 159 ) that mapped to the customer database ( 35 ) in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). bots are independent components of the application that have specific tasks to perform . in the case of data acquisition bots , their tasks are to extract and convert data from a specified source and then store it in a specified location . each data bot initialized by software block 226 will extract the model of customer financial performance by element of value , factor and risk and the confidence interval for risk reduction programs specified by the customer . the bot will then store this data in the customer profile table ( 145 ). after the software in block 226 initializes all the bots for the advanced finance system database , the bots extract and convert data in accordance with their preprogrammed instructions in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). as each bot extracts and converts data from the customer database ( 25 ), processing advances to a software block 209 before the bot completes data storage . the software in block 209 checks the advanced finance system metadata to see if all data for all fields have been extracted and that there are metadata assignments for all extracted data . if the software in block 209 finds no unmapped data fields , then the extracted , converted data are stored in the customer profile table ( 145 ). alternatively , if there are unmapped data fields , then processing advances to a block 211 . the software in block 211 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide metadata and conversion rules for each new field . the information regarding the new metadata and conversion rules is stored in the metadata mapping table ( 159 ) and conversion rules table ( 160 ) while the extracted , converted data are stored in the customer profile table ( 145 ). it is worth noting at this point that the activation and operation of bots where all the fields have been mapped to the application database ( 50 ) continues . only bots with unmapped fields “ wait ” for user input before completing data storage . the new metadata and conversion rule information will be used the next time bots are initialized in accordance with the frequency established by the system operator ( 21 ). in either event , system processing passes on to software block 301 . the flow diagram in fig6 details the processing that is completed by the portion of the application software ( 300 ) that analyzes information from a number of customers and arranges for risk “ swaps ” and / or the sale of risk transfer products to each customer at a price that meets the profit goals and reserve requirements of the company operating the risk exchange . the description below will follow the processing and activities of the system described herein when one new customer profile is transmitted to the exchange . system processing in this portion of the application software ( 300 ) begins in a block 302 . the software in block 302 checks the bot date table ( 141 ) and deactivates any transfer bots with creation dates before the current system date for the customer transmitting data to the exchange . the software in block 302 then retrieves the information from the xml profile table ( 140 ), the customer table ( 142 ), the risk products table ( 143 ), the swaps table ( 144 ) and the customer profile table ( 145 ) as required to initialize transfer bots for the customer transmitting a summary profile to the exchange . bots are independent components of the application that have specific tasks to perform . in the case of transfer bots , their primary tasks are to identify swaps , existing product and new products that can be used to satisfy the risk transfer needs of the customer transmitting data to the exchange . for example , if one customer has a significant risk from oil prices dropping ( a heating oil company , for example ) and another customer faces a significant risk when oil prices rise ( a trucking company , for example ), then the transfer bot will identify the offsetting risk factors and record a swap . if the risk transfer can be completed by both an existing risk transfer product and a swap , then preference is given to the swap . every transfer bot contains the information shown in table 4 . after the transfer bot identifies the swaps , existing products and new products that will satisfy the needs of the enterprise for risk transfer the results are saved to the application database ( 50 ). information on swaps is saved on the swaps table ( 144 ) and the customer profile table ( 145 ) and information on new products is saved in the risk products table ( 143 ) without a price . the price for new products will be established later in the processing . after data storage is complete , processing advances to a software block 305 . the software in block 305 checks the bot date table ( 141 ) and deactivates any liability scenario bots with creation dates before the current system date . the software in block 305 then retrieves the information from the xml profile table ( 140 ), the customer table ( 142 ), the risk products table ( 143 ), the swaps table ( 144 ), the customer profile table ( 145 ), the exchange payout history table ( 146 ), the generic risk table ( 147 ) and the exchange premium history table ( 156 ) as required to initialize new liability scenario bots . bots are independent components of the application that have specific tasks to perform . in the case of liability scenario bots , their primary tasks are to create a series of scenarios estimating the net payout ( premiums minus payout = net payout ) associated the risks that may be transferred via swaps or insurance from all customers . there are two types of scenarios developed at this stage of processing , normal scenarios and extreme scenarios . the scenarios are developed by combining the information and statistics from summary profiles transmitted by the customers of the exchange with the exchange payout history , the exchange premium history and generic risk information obtained from the external database ( 25 ). every liability scenario bot activated in this block contains the information shown in table 5 . after the liability scenario bots are initialized , they retrieve the required information from the xml profile table ( 140 ), the customer table ( 142 ), the risk products table ( 143 ), the swaps table ( 144 ), the customer profile table ( 145 ), the exchange payout history table ( 146 ), the generic risk table ( 147 ), the external database table ( 150 ), the basic financial system table ( 161 ), the advanced finance system table ( 162 ) and the exchange premium history ( 156 ) before generating a series of net payout scenarios that are appropriate for the type of analysis being completed — extreme or normal . the bot saves the scenarios in the liability scenario table ( 148 ) in the application database ( 50 ) and processing advances to a block 309 . the software in block 309 continually completes analyses similar to those completed by the analysis bots in the enterprise portion of the cross referenced application ser . no . 10 / 747 , 471 . the software in this block uses the publicly available information stored in the external database table ( 150 ) to complete the analyses shown in table 6 for each equity investment listed in the asset position table ( 149 ) and described in data obtained from the external database ( 25 ). the results of the first three forecasts ( items 2 , 3 and 4 from table 6 ) are saved in the asset forecasts table ( 151 ) in the application database ( 50 ) and the market value factors ( item 1 from table 6 ) are saved with the appropriate equity in the asset position table ( 149 ). the software in this block uses the publicly available information stored in the external database table ( 150 ) to complete the analyses shown in table 6 for each income generating investments ( i . e . bonds or real estate ) listed in the asset position table ( 149 ) and described in data obtained from the external database ( 25 ). the software in block 309 then analyzes the covariance between the causal factors for each of the assets to determine the covariance between these assets under both normal and extreme conditions . the results of these analyses are then stored in the asset correlation table ( 152 ) before processing advances to a block 310 . the software in block 310 checks the bot date table ( 141 ) and deactivates any scenario bots with creation dates before the current system date . the software in block 310 then retrieves the information from the asset position table ( 149 ), the external database table ( 150 ) and the asset correlation table ( 152 ) as required to initialize the scenario bots . bots are independent components of the application that have specific tasks to perform . in the case of scenario bots , their primary task is to identify likely scenarios for the evolution of the causal market value factors . the scenario bots use information from the external databases to obtain forecasts for individual causal factors before using the covariance information stored in the asset correlation table ( 152 ) to develop scenarios for the other causal factors under normal and extreme conditions . every scenario bot activated in this block contains the information shown in table 7 . after the scenario bots are initialized , they retrieve the required information and develop a variety of normal and extreme scenarios as described previously . after the scenario bots complete their calculations they save the resulting scenarios in the scenario table ( 153 ) in the application database ( 50 ) and processing advances to a block 311 . the software in block 311 checks the bot date table ( 141 ) and deactivates any net capital scenario bots with creation dates before the current system date . the software in block 311 then retrieves the information from the liability scenario table ( 148 ), and the scenario table ( 153 ) as required to initialize net capital scenarios bots . bots are independent components of the application that have specific tasks to perform . in the case of net capital scenario bots , their primary task is to run four different types of simulations for the exchange . the net capital scenario bots run monte carlo simulations of the exchange financial performance using the two types of scenarios generated by the asset and liability scenario bots — normal and extreme . the net capital scenario bots also run an unconstrained genetic algorithm simulation that evolves to the most negative scenario and simulations specified by regulatory agencies . every net capital scenario bot activated in this block contains the information shown in table 8 . after the net capital scenario bots are initialized , they retrieve the required information and simulate the financial performance of the risk exchange under the different scenarios . after the net capital scenarios complete their calculations , the resulting forecasts are saved in the exchange simulation table ( 154 ) in the application database ( 50 ) and processing advances to a block 312 . the software in block 312 checks the bot date table ( 141 ) and deactivates any asset optimization bots with creation dates before the current system date . the software in block 312 then retrieves the information from the asset position table ( 149 ), the external database table ( 150 ), the asset forecasts table ( 151 ), the asset correlation table ( 152 ), the scenario table ( 153 ), the exchange simulation table ( 154 ) and the advanced finance systems table ( 162 ) as required to initialize asset optimization bots . bots are independent components of the application that have specific tasks to perform . in the case of asset optimization bots , their primary task is to determine the optimal mix of assets and contingent capital purchases ( purchase reinsurance and / or other contingent capital purchases , etc .) for the exchange under each scenario using a linear programming optimization algorithm that is constrained by any limitations imposed by regulatory requirements . a multi - criteria optimization is also run at this stage to determine the best mix for maximizing value under combined normal and extreme scenarios . a penalty function for asset liability mismatch can be added as required to minimize the difference between asset and liability lives . other optimization algorithms can be used at this point to achieve the same result . every asset optimization bot activated in this block contains the information shown in table 9 . after the asset optimization bots complete their analyses , the resulting asset and contingent capital mix for each set of scenarios and the combined analysis is saved in the optimal exchange mix table ( 156 ) in the application database ( 50 ) and the revised simulations are saved in the exchange simulation table ( 154 ) before processing passes to a software block 313 . the software in block 313 prepares and displays the optimal mix of asset purchases , asset sales and contingent capital purchases for the normal , extreme and combined scenario analysis using the optimal mix review window ( 703 ). the optimal mix for the normal and extreme scenarios are determined by calculating the weighted average sum of the different scenarios where the weighting is determined by the relative likelihood of the scenario . the display identifies the optimal mix from the combined analysis as the recommended solution for exchange value maximization . at this point , the system operator ( 21 ) is given the option of : 1 ) editing ( adding or deleting products and activities ) from the recommended solution ; 3 ) selecting and then editing the optimal mix from the normal scenarios ; 5 ) selecting and then editing the optimal mix from the extreme scenarios ; or after the system operator ( 21 ) has finished the review and the optional edit of the selected mix , any changes are saved in the optimal exchange mix table ( 156 ) in the application database ( 50 ) before processing advances to a software block 314 . the software in block 314 compares the new optimal mix to the existing asset position stored in the asset position table ( 149 ) and orders are generated to purchase assets , sell assets and / or purchase contingent capital as required to bring the current asset position in line with the new optimal mix . these orders are then transmitted via a network ( 45 ) to other institutions and exchanges on the internet ( 40 ). when the order confirmations are received , the asset position table ( 149 ) is updated with the new information and processing advances to a block 315 . it is worth noting at this point that the processing described for the previous blocks in this section ( 302 , 305 , 109 , 310 , 311 , 312 , 313 and 314 ) could also be used to manage an investment portfolio on a stand alone basis . the software in block 315 prepares and displays the proposed prices for the risk transfer products and the swaps that are going to be offered to the customer using the price review window ( 704 ). the list prices from the risk products table ( 143 ) are used for the existing risk products . pricing for swaps are calculated by marking up the cost of the swap by a standard percentage . the software in block 315 marks up the calculated breakeven price for any new risk transfer products that were proposed by the bots in block 302 . at this point , the system operator ( 21 ) is given the option of : 1 ) editing the recommended prices for any and all of the risk transfers — swaps , existing products and new products ; 3 ) removing some of swaps and / or risk transfer products from the list . after the system operator ( 21 ) completes the review , all price changes and the prices for any new risk transfer products are saved in the risk products table ( 143 ) before processing advances to a block 316 . the software in block 316 continually runs an analysis to define the optimal risk reduction strategy for the normal and extreme scenarios for each customer . it does this by first retrieving data from the xml profile table ( 140 ), the customer table ( 142 ), the risk products table ( 143 ), the swaps table ( 144 ), the customer profile table ( 145 ), the exchange payout history table ( 146 ), the generic risk table ( 147 ), the external database table ( 150 ) and the scenario table ( 153 )— the information required to initialize the optimization algorithm . the software in the block uses a linear program that uses the financial model for each customer under the range of conditions expected for each scenario to determine the optimal risk transfer program ( swaps , derivative purchases , insurance purchases , etc .) within the specified confidence interval ( the confidence interval specified by the system operator ( 21 ) is used if the customer has not specified a confidence interval ). a multi criteria optimization determines the best mix for reducing the risk under a combined normal and extreme scenario . other optimization algorithms and simulations can be used at this point to the same effect . the optimizations consider the effect of changes in the cost of capital on the optimal risk transfer solution . the resulting mix of product purchases and swaps for each scenario ( normal and extreme ) and the combined analysis is saved in the customer profile table ( 145 ) in the application database ( 50 ) before processing passes to a software block 317 . the shadow prices from these optimizations are also stored in the risk products table ( 143 ) for use in identifying new risk reduction products that the system operator ( 21 ) may choose to offer at a later date . this information can also be used to modify pricing by customer . the software in block 317 uses the customer interface window ( 705 ) to display the information regarding the optimal risk transfer program for the customer and the pricing for the products and swaps that will be used to transfer the risks identified in the optimal risk transfer program . this information could optionally be transmitted to the customer in a summary xml format that is similar to the one initially transmitted to the exchange by the customer . the customer ( 20 ) can reject , edit and / or accept the proposed mix of products and swaps that are displayed . the software in block 317 accepts and confirms orders , updates the information contained in the risk products table ( 143 ), the swaps table ( 144 ), the customer profile table ( 145 ) and the exchange premium history table ( 157 ) to reflect the accepted and confirmed orders . the software in block 317 also accepts input from the customer ( 20 ) regarding any new losses that the customer may have experienced . the software in block 317 verifies the loss is for an insured risk , updates the customer profile table ( 145 ), updates the exchange payout history table ( 146 ) and arranges for payment of the claim in a manner that is well known . this processing is continues until the customer ( 20 ) indicates that the session is complete . system processing advances to a software block 318 . the software in block 318 checks the system settings table ( 158 ) to determine if the system ( 100 ) is operating in continuous mode . if the system is operating in a continuous mode , then processing returns to block 205 and the processing described above is repeated . alternatively , if the system is not operating in continuous mode , then processing advances to a software block 320 and stops . thus , the reader will see that the system and method described above transforms extracted transaction data , corporate information , information from external databases and information from the internet into detailed risk analyses and risk transfer programs specifically tailored to each customer using the system . the level of detail , breadth and speed of the risk analysis allows customers and managers of the system to manage their risks in a fashion that is superior to the method currently available to users of existing risk analysis systems and traditional insurance products . because the profiles used in the system ( 100 ) provide a comprehensive picture of the financial status of the companies transferring risk through the exchange , the system and method described herein can be used with essentially no modifications to provide an on - line transfer system for : the system described herein could be used to manage transfers of ownership rights alone or in combination with foreign exchange , liquidity and risk . while the above description contains many specificity &# 39 ; s , these should not be construed as limitations on the scope of the invention , but rather as an exemplification of one preferred embodiment thereof . accordingly , the scope of the invention should be determined not by the embodiment illustrated , but by the appended claims and their legal equivalents . | 6 |
dipropylene glycol mono ( c 1 - 6 - alkyl ) ethers have a high thermal expansion coefficient , which substantially facilitates the adjustment of the floating bodies . the ethers according to the invention are environmentally compatible , non - toxic or non - skin - irritant ( the structurally very similar free dipropylene glycols are used as components of cosmetic compositions ; the compatibility of the ethers according to the invention is very similar to that of free dipropylene glycol ). due to the mixability of the ether compounds according to the invention with water , the flash point may be decreased or completely eliminated . in their broadest configuration , the solution proposed by the invention is a buoyancy liquid for a galilean thermometer which comprises at least one dipropylene glycol mono ( c 1 - 6 - alkyl ) ether . the present invention also provides a galilean thermometer comprising a buoyancy liquid which comprises at least one dipropylene glycol mono ( c 1 - 6 - alkyl ) ether . likewise , the present invention provides a method of preparing a galilean thermometer , comprising utilizing at least one dipropylene glycol mono ( c 1 - 6 - alkyl ) ether . in one embodiment the buoyancy liquid has the following structure wherein r is a c 1 - 6 - alkyl group : the dipropylene glycol mono ( c 1 - 6 - alkyl ) ether comprised by the present invention may be a single compound or a mixture of a plurality of compounds . the c 1 - 6 - alkyl group comprises the substituents methyl , ethyl , propyl , butyl , pentyl and hexyl , with all constitutional isomer groups being contained , such as e . g . : n - propyl , isopropyl , n - butyl , i - butyl , t - butyl and correspondingly branched embodiments of the c 5 and c 6 alkyl groups . the invention further comprises the possible constitutional isomers of the dipropylene glycol structure . dipropylene glycol is formed by condensation of two molecules of propylene glycol being present in two constitutional isomers , namely 1 , 2 - propylene glycol and 1 , 3 - propylene glycol . according to the invention , the ether may comprise the derivatives of dipropylene glycol of two identical propylene glycol units , as well as also mixture derivatives obtained from , for example , 1 , 2 - propylene glycol and 1 , 3 - propylene glycol . the latter may in turn be divided in two structural subgroups depending on which of the two hydroxyl groups , remaining in the propylene glycol dimmer , is etherified by the c 1 - 6 - alkyl group . preferred , according to the invention , are mono alkyl ethers of di ( 1 , 2 - propylene glycol ). also preferred are compounds in which the c 1 - 6 - alkyl group represents a methyl or a butyl group . especially preferred are the di ( 1 , 2 - propylene glycol ) mono methyl ethers and butyl ethers . these may be used as an individual chemical compound or as an isomer mixture of the above - described kind . an especially preferred example for practical application is di ( 1 , 2 - propylene glycol ) monomethyl ether which is available on the market as a mixture of constitutional isomers , for example under the trade name dowanol dpm ® of dow chemical ( available in germany from the company brenntag gmbh , 34250 lohfelden ). according to a further preferred embodiment of the invention , the ether is used in the form of a mixture with water . the addition of water increases the flash point of the buoyancy liquid , thereby decreasing the hazard of fire when it is handled or when it is unintentionally released from the thermometer . the amount of water is preferably of from about 3 to about 50 parts by weight ( in the following pbw ), relative to 100 pbw of the ether component . within this range , a satisfying increase of the flash temperature is obtained , on the one hand , and the thermal extension coefficient is maintained on a sufficiently high level for a simple adjustment of the floating bodies , on the other hand . the water amount is preferably of from about 5 to about 20 pbw , more preferably of from about 7 to about 15 pbw , relative to 100 pbw of the ether component . the optimum ratio between ether and water , with respect to the increase of the flash temperature , depends in each case on the ether selected . the optimum water amount for dipropylene glycol mono methyl ether is in the range of 9 weight - parts , approximately from 8 to 10 wt .-%. with these and higher amounts of water , the flash point completely disappears , i . e . when the flash point of pure ether at 73 ° c . is reached , as much water vapour appears together with the ether vapour that an ignition of the gaseous mixture in the common test procedure according to pensky - martens is no longer obtained . the test procedure according to pensky - martens is described in detail in the regulation en 22719 , european committee of standardization ( and iso 2719 , which are incorporated by reference herein ). thus , water proportions of approximately from 8 to 10 pbw are especially preferred . the above - defined dipropylene glycol ethers have the tendency to become slowly decomposed by irradiation with light in the visible and / or ultraviolet range . for this reason , the buoyancy liquid of the galilean thermometer according to the invention advantageously comprises a stabilizer . the character of the stabilizer is not specially limited as long as it is dissolvable in the buoyancy liquid and effectively prevents its decomposition . the amount of the stabilizer is not particularly limited either . practically , the stabilizer amount is advantageously from about 30 to about 80 parts per million ( ppm ) ( by weight , relative to the weight of the ether component ), more preferably from about 40 to about 70 ppm , and most preferably from about 50 to about 60 ppm . for example , in one particular example , the buoyancy liquid of the present invention comprises 100 parts by weight of a mixture of at least one isomer of diproplylene glycol monomethyl ether , from about 8 to about 12 parts by weight of water , and bht as a stabilizer . in the following , examples of buoyancy liquids according to the present invention are indicated , which are most preferred : the buoyancy liquid of the galilean thermometer according to the invention may further contain other additives in usual amounts , such as e . g . dyes , wetting agents , or density modifying agents . | 6 |
fig1 shows a double - skin building panel of this invention including facing sheet 11 , a liner sheet 12 and structural thermal insulation 13 which is adhesively secured to the inner surfaces of the facing sheet 11 and liner sheet 12 . each panel 10 has a first edge 14 and a second edge 15 . in general , the liner sheets 12 and facing sheets 11 are fabricated from metals such as painted steel , aluminum , aluminized steel , stainless steel and the like in gauges of 26 gauge to about 14 gauge . most building panels have a metal thickness of 18 to 22 gauge . panels customarily have a width of 60 to 90 cm and are supplied in lengths from about 1 / 2 meter to about 12 meters . the panel thickness ranges from about 35 to 100 mm . customarily the liner sheet 12 has a flat surface as shown in fig1 except for the joint - forming features along each side of the liner sheet 12 . the liner sheet 12 may have small corrugations or other deformations for aesthetic or strengthening purposes . customarily the facing sheet 11 is a flat surface between the joint forming side edges as shown in fig1 . however , the facing sheet 11 may be suitably profiled for aesthetic purposes and to reduce the volume of each panel and thereby to reduce the amount of thermal insulation 13 which is required to complete the panel . a typical profiling pattern 11 &# 39 ; is shown in fig1 . the structural insulating material 13 preferably is foamed - in - place polyurethane foam having a density of 2 to 5 pcf . polyurethane foam provides excellent thermal insulation properties and also provides , when properly applied , excellent adhesion to the liner sheet 12 and the facing sheet 11 . it will be observed that the structural insulation terminates in a gap 16 , 17 at each edge of the panel 10 between the liner sheet 12 and the facing sheet 11 . other foamed substances may be employed to produce the present panel , for example , polyisocyanurate foam , preformed batts of thermal insulation such as polyurethane foam batts , polyisocyanurate batts , phenolic foam batts , expanded polystyrene batts , which are secured to the facing sheet 11 and liner sheet 12 by appropriate adhesive substances . a further type of structural thermal insulation which may be employed is honeycomb filler which is secured between the facing sheet 11 and liner sheet 12 by means of a suitable adhesive and wherein the first edge 14 and second edge 15 of the panel are filled with preformed , shaped insulating spacers or foamed - in - place plastics . the first edge 14 of the facing sheet 11 includes a first lateral corner 18 , a first sloping wall surface 19 , a first gutter 20 and a free edge 21 . the angle of the sloping wall surface 19 with respect to the plane of the facing sheet 11 is between 30 and 60 degrees , and is preferably determined by the geometry of the resulting joint which will permit the second panel to be connected to a first secured panel . the second edge 15 of the liner sheet 11 has a second lateral corner 22 , a second sloping wall surface 23 which is essentially parallel to the first sloping wall surface 19 . the second sloping wall surface 23 connects with a first shoulder 24 having a shoulder surface facing away from the facing sheet 11 . the first shoulder 24 connects with a first groove forming surface 25 which is essentially parallel with the facing sheet 11 and which connects to a first normal wall surface 26 which in turn connects to a first outboard flange 27 having a free edge 28 . the first outboard flange 27 is essentially parallel to the facing sheet 11 . the shoulder 24 , first groove forming surface 25 and a portion of the first normal wall surface 26 define a first groove 29 . it will be observed that the free edge 28 is located outboard from the second lateral corner 22 . the first edge 14 of the liner sheet 12 ends in a third lateral corner 30 from which a third normal surface 31 extends toward a second shoulder 32 having a shoulder surface facing away from the liner sheet 12 . the third shoulder connects to a second groove forming surface 33 which is essentially parallel to the liner sheet 12 . the second groove forming surface 33 connects to a fourth normal surface 34 which connects to a third groove forming surface 35 which is essentially parallel to the liner sheet 12 . the third groove forming surface 35 connects to a fifth normal surface 36 , a third shoulder 37 and a sixth normal surface 38 . the third shoulder faces the liner sheet 12 . the sixth normal surface 38 joins a second outboard flange 39 having a free edge 40 . the second outboard flange 39 is essentially parallel to the liner sheet 12 . it will be observed that the free edge 40 extends outboard beyond the third lateral corner 30 of the liner sheet 12 . a second groove 41 is formed by the second groove forming surface 33 , the fourth normal surface 34 , and the combination of the third groove forming surface 35 , the fifth normal surface 36 , and the third shoulder 37 . a third groove 42 is formed by the fourth normal surface 34 , the third groove forming surface 35 and the fifth normal surface 36 . the second edge 15 of the liner sheet 12 has a fourth lateral corner 43 and a seventh normal wall surface 44 which connects with a third outboard flange 45 terminating with a third sloping wall surface 46 and a hook - shaped cross - section member 47 having a free edge 48 . the first gap 16 and the second gap 17 preferably have a width of 3 to 12 mm to provide a thermal break between the liner sheet 12 and the facing sheet 11 . multiple panels of this invention are secured to a building framework by means of fasteners such as screws and associated bracket members of the type shown in fig3 . as shown in fig2 a first panel 10a is initially secured to a building framework designated generally by the numeral 49 which , in a typical building , would be a horizontal beam , girder or subgirt to which a threaded fastener 50 can be secured . the panels of this invention are particularly adapted to being assembled horizontally in which assembly the building structural element 49 is a column or vertical mullion . the first panel 10a is secured to the building framework 49 at its first edge ( not shown in fig2 ) and its second edge 15a is secured to the building framework 49 by means of the threaded fastener 50 which has an enlarged head portion 51 . the fastener 50 extends through a bracket 52 ( shown in fig3 ), the first groove forming surface 27 , a portion of the structural thermal insulation and thence through the liner sheet 12 into the building structure 49 . the bracket 52 as shown in fig3 is a rectangular plate having plural fastener receiving openings 53 and having at least one bent tab 54 which penetrates the structural thermal insulation through the second gap 17 and engages the inner surface of the liner sheet 12 adjacent to the fourth lateral corner 43 . the flat plate portion of the bracket 52 overlies the first outboard flange 27 and the third outboard flange 45 which are coplanar in the assembled panel . the secured bracket 52 provides a mechanical connection for both the facing sheet 11 and the liner sheet 12 with the building structure 49 . the first panel 10a is thus secured by means of a sufficient number of fasteners 50 and brackets 52 , spaced in accordance with the structural requirements of the building . typically fastening brackets are provided along the length of the panel connecting joint every one - to - five meters . the second panel 10b is next secured by introducing the second panel 10b at an angle to the plane of the building structure 49 whereby the shoulder 32 slides between the third outboard flange 45 and the building structure 49 . the panel 10b is pivoted until its liner sheet 12b engages the building structure 49 . the sloping wall surfaces 19 , 23 are in engagement and the lateral corners 18 , 22 are aligned . the seventh normal wall surface 44 is in confronting relation with the third normal wall surface 31 ; the lateral corners 30 , 43 are aligned . the second shoulder 32 bears against the inboard surface of the third outboard flange 45 ; the hook - shaped cross - section member 47 fits in the third groove 42 . the first end of the second panel 10b is thus secured . the installer proceeds to the second end of the panel 10b ( not shown ) and secures it in a similar fashion . a bead 55 of weather - resistant caulking material is provided in the gutter 20 before the panels are assembled . the bead 55 of weather - resistant caulking material forms a weathertight seal between the facing sheets 11a , 11b . a similar bead 56 of caulking material may be provided in the third groove 42 to provide a weathertight seal with the hook - shaped cross - section member 47 . it will be observed that any stresses which may be applied to the resulting building wall tending to cause disengagement of the joint or to cause opening of the joint will be mechanically resisted . separation of the facing sheets 11a , 11b is opposed by the overlapping connection of the gutter 20 with the first shoulder 24 . separation of the liner sheets 12a , 12b is resisted by the engagement of the hook - shaped surface 47 with the fifth normal surface 36 which defines the third groove 42 . because of the sloping surfaces 19 , 23 , any panel disengagement stresses tend to increase the engagement of the gutter 21 with the shoulder 24 and the engagement of the hook - shaped cross - section member 47 in the third groove 42 . the benefits of this invention may be achieved by eliminating the cross - section hook - shaped member 47 , the third sloping surface 46 and their functions . in this alternative construction , the panel disengaging stresses will be resisted by the engagement of the gutter 20 with the shoulder 24 . any outwardly applied disengaging stresses will be transferred in a direction which increases the engagement between the interlocking gutter 20 and shoulder 24 . the panels of this invention may be assembled horizontally to great advantage . as shown in fig1 the panels are assembled from top - to - bottom with the first edge 14 being the uppermost edge and the second edge 15 being the bottom edge . the sloping wall surfaces 19 , 23 are thereby arranged to minimize water entry into the joint assembly . | 4 |
as previously mentioned , certain characteristic property requirements must be met for permanent soft liners to be successful . these properties include permanent resiliency , high dimensional stability , adequate adhesion to the denture base material , adequate wettability in the oral environment and compatibility with oral tissues . resiliency is the ability of a material to spring back to its original shape after the removal of applied stress . resiliency may be defined as the energy required to deform the material to the elastic limit , and is usually determined by measuring the area under a stress - strain curve up to the elastic limit e in a well - known manner . the elastic limit , of course , is the point beyond which strain is no longer directly proportional to stress , and beyond which strains are not fully recovered . a high performance soft denture liner must have high resiliency to enable it to absorb large amount of energy without being permanently deformed . high resiliency is an important characteristic of the elastomers of the invention . high dimensional stability is also essential to the good fitting of the denture . poor dimensional stability is often associated with significant swelling of the material , or the dissolution of the material , or the leaching of the additives such as plasticizer in the oral environment . in some cases , the degradation reactions such as hydrolysis will also help destroy dimensional stability . adequate adhesion to the denture base is essential . adhesion has been defined as the state in which two surfaces are held together by interfacial forces of attraction , owing to the interactions of atoms and molecules . adhesion may be chemical , or mechanical , or both . chemical adhesion involves bonding at the i0 atomic or molecular level . mechanical adhesion involves the retention by the interlocking or penetration of one phase into the surface of the other . in general , materials which are similar in chemical structures have better adhesion properties than materials which are dissimilar . it is clear that the liners should adhere well to the denture base for long usage . most current denture materials are based on the polymer pmma ; therefore , the soft denture liners of the present invention should adhere well to that base polymer . adequate wettability in the oral environment is also desirable . wetting is the process in which a liquid spontaneously adheres to and spreads on a solid surface . adequate wetting of denture liners by water and saliva is necessary to the retention of the denture . wettability is often characterized by measuring the contact angle , the angle between substrate plane and free surface of a liquid droplet at the line of the contact with the substrate . the greater the tendency for a liquid to wet the surface , the smaller the contact angle . for example , the contact angle of water on the denture base acrylic polymer pmma is 74 , while the contact angle of water on the non - wetting polytetrafluoroethylene is 110 . denture liners are in direct contact with oral tissue and should be compatible with the tissue . they should be non - toxic , non - irritant , and incapable of sustaining bacterial growth . organosilicon polymers have been increasingly used in many areas of applications . polysiloxanes are desirable because of their high degree of chemical inertness , low degree of toxicity , and high degree of thermal and oxidative stability . the chemical and physical properties of polysiloxanes are significantly dependent on the substituents r and r &# 39 ; in the polymers ( i ). polysiloxanes can be either hydrophobic or hydrophilic depending on the nature of the substituents . for example , polydimethylsiloxane ( and polydialkylsiloxanes in general ) is a hydrophobic polymer which can be used as a water repellant . the uniqueness of polysiloxanes is that siloxane bonds si -- o -- si in the main chains , as well as si -- c bonds where side groups are bonded to silicon , are extremely flexible with a great freedom of motion . this is reflected in lower melting points , lower glass transition temperatures , lower viscosity , and lower surface tension , and is responsible for the elastomeric behaviors of many polysiloxanes . in general , crosslinking of polysiloxanes can be achieved by several methods . one such method involves free radical crosslinking of linear polysiloxanes through the use of organic peroxides , e . g ., benzoyl peroxide , at elevated temperature . the method is applicable to both polysiloxanes with unreactive end groups and polysiloxanes with reactive group , e . g ., vinyl groups ( called vinyl - terminated polysiloxanes ). if vinyl groups are present , crosslinking can be achieved at lower temperature or with less active peroxide . a second method involves cross - linking of linear polysiloxane or lightly branched polysiloxanes with reactive end groups such as silanols ( hydroxyl - terminated polysiloxanes ). the crosslinking requires a cross - linking agent , e . g ., tetraethyl silicate , and a catalyst , e . g ., dibutyl tin dilaurate , and is a condensation reaction by nature which may be characterized as follows : ## str7 ## a third method involves cross - linking of polysiloxane by addition reactions . the reactions generally involve the addition of silyl hydride groups (-- sih ) to vinyl groups ( ch 2 ═ ch --) attached to silicon with the aid of a platinum containing catalyst as shown in ( ix ). ## str8 ## the importance of polysiloxane - based permanent soft denture liners of the invention are unique polysiloxane materials which possess more of the desired characteristics than any previous materials . the permanent soft denture liners of the invention , based on polysiloxanes ( iv ) or ( v ), offer many advantages . the polysiloxanes possess dimethacrylate or diacrylate groups which undergo free radical polymerization and crosslinking upon application of heat , light or chemicals . the curing of the polysiloxanes ( iv ) and ( v ) can be accomplished by photo - crosslinking using a visible light photoinitiator , e . g . camphorquinone , and an accelerator , e . g ., dimethylaminophenethanol , or by thermal crosslinking with aid of benzoyl peroxide . photo - crosslinking offers the possibility of chairside replacement of permanent soft liners , not heretofore possible . specifically , the embodiments of the invention are directed to high performance permanent soft denture liners based on crosslinking of the acryloxyalkyl - terminated or methacryloxyalkyl - terminated polydialkylsiloxanes of ( iv ) ( the most preferred of which are ( v )) with the crosslinking agent dimethacrylate siloxane monomer ( vi ), or the crosslinking agent diacrylate siloxane monomer ( vii ). the curing of the liners can be conducted both by photo - crosslinking and thermal - crosslinking . the new liners should exhibit high and permanent resiliency , high dimensional stability , low in water sorption and water solubility , and have good adhesion to denture base polymer pmma , good wettability and are compatible to oral tissues . although the linear polysiloxanes ( iv ) and ( v ) can be crosslinked by a suitable initiator with or without a crosslinking agent , use of a crosslinking agent which itself is siloxane monomer chain , such as 1 , 3 - bis ( 3 - methacryloxypropyl ) tetramethyldisiloxane mptds ( vi ) or 1 , 3 - bis [( p - acryloxymethyl ) phenethyl ] tetramethyldisiloxane ( vii ), would offer more advantage . both polysiloxanes ( iv ) or ( v ) and the crosslinking agents ( vi ) and ( vii ) possess either methacrylate groups or acrylate groups which are chemically similar to that of pmma , the wettability and adhesion of the new liners to denture base polymer pmma would be expected to be excellent . the crosslinked bonds , unlike those produced by the condensation reactions , should be more stable and resistant to degradation reactions such as hydrolysis . in addition , the crosslinking agents ( vi ) and ( vii ) are themselves highly flexible siloxane monomers possessing flexible si - 0 - si bonds which are expected to further improve and modify the elasticity and resilience of the liners . with two phenyl groups in the monomer chain , the siloxane monomer ( vii ) would be expected to be stiffer than the monomer ( vi ). thus , the firmness of the liners can be changed by choosing either monomer ( vi ) or ( vii ), or by varying the monomer concentration . the siloxane polymer methacryloxypropyl - terminated polydimethylsiloxane ( v ) ( viscosity = 1500 - 2000 centistokes ), and the two siloxane monomers , 1 , 3 - bis ( 3 - methacryloxypropyl ) tetramethyldisiloxane ( vi ) and 1 , 3 - bis [( p - acryloxymethyl ) phenethyl ] tetramethyldisiloxane ( vii ), are available from hules america , inc . of bristol , pa . with respect to photo - curing of the permanent soft denture liners , a photoinitiator and an activator should be selected which initiate the crosslinking upon exposure to visible light . the photoinitiator and the activator must be miscible with the monomers . camphorquinone and tertiary amines such as 2 - dimethylamino ethyl methacrylate , 4 - ethyl , n , n - dimethylaminobenzoate and dialkylamino phenethanols are candidates for the photoinitiator / activator systems . crosslinking of the polysiloxane ( iv ) without the presence of the crosslinking agents is also believed to be feasible . a filler , such as fume silica , can be added to the polysiloxane to enhance the mechanical properties and the ease of handling . the filler is preferably radiopaque , e . g ., barium sulfate , or barium alumino borosilicate . the filler can be treated with an organosilane coupling agent to increase the bonding between the polymer and the filler . possible coupling agents include vinyltriethoxysilane , hexamethyldisilazane or r - methacryloxypropyl trimethoxysilane , which are commercially available . the first two are more hydrophobic , while the third one is more polar . coupling agents can be applied in organic solvents . it is contemplated that the composites contain approximately 10 - 30 weight % of the filler . in accordance with the above criteria and in furtherance of demonstrating the soft denture liners of the invention , the following examples are offered . the examples verify the above discussion regarding properties of the liner . 11 . 0561 gm of compound ( v )-- methacryloxypropyl - terminated polydimethylsiloxane ( weight average molecular weight , m w = 22 , 500 ) obtained from huls america of bristol , pennsylvania , was mixed with 11 . 1 mg of benzoyl peroxide , and stirred until benzoyl peroxide was homogeneously dispersed in the polymer . a glass mold having a dimension of 2 mm × 9 mm × 75 mm was filled with the polymer mixture , and the mixture cured at 75 ° c . for 6 hours . the curing transformed the clear , viscous liquid polymer into a clear , soft and resilient elastomer . the percent elongation of the elastomer is more than 150 % when stretched . the methacryloxypropyl - terminated polydimethylsiloxane and benzoyl peroxide mixture was prepared according to example 1 . 10 weight % of fumed silica filler aerosil ox50 ( degussa corp .) was added to the polymer mixture and mixed homogeneously . the viscous polymer composite paste was introduced into the glass mold and cured at 75 ° c . for 6 hours . the cured specimen was a white , soft resilient elastomer having more than 150 % elongation when stretched . the hardness of the cured specimen was higher than that of the cured specimen obtained in example 1 . the methacryloxypropyl - terminated polydimethylsiloxane and benzoyl peroxide mixture was prepared according to example 1 . 20 weight % of fumed silica filler aerosil ox50 ( degussa corp .) was added to the polymer mixture and mixed homogeneously . the viscous polymer composite paste was filled into the glass mold and cured at 75 ° c . for 6 hours . the cured specimen was a white , soft resilient elastomer having more than 150 % elongation when stretched . the hardness of the cured specimen was higher than the cured specimen obtained in example 2 . dumbbell shaped specimens were fabricated 15 and the tensile strength of the specimens was measured using comten tensile tester according to the astm designation : d412 - 87 , standard test method for rubber properties in tension . the dimension of the neck in the specimen was 3 mm ( thick )× 25 mm ( wide ). the tensile strength of the specimen was found to be greater than 174 psi ( 1 . 2 mpa ). 2 . 1411 g of methacryloxypropyl - terminated polydimethylsiloxane was mixed with of 1 , 3 - bis ( 3 - methacryloxypropyl ) tetramethyldisiloxane ( mptds ) ( obtained from huls america of bristol , pa . ), and 2 . 1 mg of benzoyl peroxide , and stirred until a homogeneous mixture was obtained . the glass mold was filled with the mixture , and the mixture cured at 75 ° c . for 6 hours . the thermal cure transformed the clear viscous polymer - monomer liquid into a clear , soft and resilient elastomer having more than 150 % elongation when stretched . the specimen prepared in this example differed from the one prepared in example 1 in that this specimen contained 5 weight % of the monomer mptds which acted as the crosslinking agent . 10 weight % of fumed silica filler aerosil ox50 ( degussa corp .) was added to the polymer - monomer - benzoyl peroxide mixture prepared according to example 4 , and mixed homogeneously to obtain polymer composite paste . the glass mold was filled with the viscous polymer paste and cured at 75 ° c . for 6 hours . the thermal cure transformed the composite paste into a white , soft and resilient elastomer having more than 150 % elongation when stretched . the hardness of the specimen was higher than the elastomer obtained in example 4 . 1 . 2010 g of methacryloxypropyl - terminated polydimethylsiloxane was mixed with 12 . 1 mg of camphorquinone and 5 . 8 mg of 2 - dimethylamino ethyl methacrylate , and stirred until a homogeneous mixture was obtained . 0 . 8925 g of the polymer mixture was then mixed homogeneously with 0 . 1780 g of fumed silica filler aerosil ox50 ( degussa corp .) to obtain a polymer composite paste . the polymer composite paste was used to fill a stainless steel mold with a dimension of 6 mm ( diameter )× 3 mm ( height ) having both sides covered with 1 mm thick glass plates . a visible light cure unit , visilux 2 of 3m co . of st . paul , minnesota , was used to expose the polymer composite specimen through the top glass plate . the exposure time was 3 minutes . the photocuring transformed the yellow polymer composite paste into a white , soft , rubbery and flexible elastomer . this invention has been described in this application in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles and to construct and use such specialized components as are required . however , it is to be further understood that the invention can be carried out by specifically different formulations and that various modifications both as to equipment and procedure details can be accomplished without departing from the scope of the invention itself . | 8 |
it should be understood that the description of the preferred embodiment is illustrative and that it should not be taken in a limiting sense . embodiments of this invention will be explained in conjunction with the drawings . this preferred embodiment according to the present invention will describe an apparatus and method for carrying out a semiconductor baking process . however , other equipment including a susceptor on which a wafer is mounted may be practiced in accordance with the present invention . in this embodiment , “ displacement position ” of guiding blocks means the position of the guiding blocks during a baking process . “ awaiting position ” of the guiding blocks is the position apart from the center of a susceptor , more spaced than the displacement position therefrom , to provide a sufficient margin for loading a wafer on the susceptor . “ normal position ” of a wafer means the predetermined position proper to conduct a process ( e . g ., a baking process ). the guiding blocks at the displacement position and the awaiting position are referred by the solid and broken lines in fig2 and 300 ′, respectively . [ 0031 ] fig1 illustrates a schematic view of an apparatus 10 which can be employed in a semiconductor fabrication process wherein a wafer is subjected to a baking operation . fig2 and 3 show the plane and sectional features in the area where a wafer is positioned . the apparatus 10 includes a susceptor 100 , a lift pin assembly 200 , guiding blocks 300 , a guide block mover 400 , and a tester 500 . the susceptor 100 , which is provided to accommodate a semiconductor substrate , such as a wafer w , comprises a plate 120 and spacers 140 . the plate 120 includes heating elements ( not shown ) such as heating coils to warm up a wafer to a proper temperature for processing . the top of the plate 120 is round and flattened . the spacers 140 are installed at the top edges of the plate 120 to support the wafer w , contacting with the edges of the wafer w . the spacers 140 may be provided at regular intervals and may be from three to six in number . the wafer w is separated from the plate 120 , so that it is not in contact with the plate 120 that is heated up to a high temperature during a process . at the top of the susceptor 100 , a cover 160 is provided to facilitate an airtight condition during processing of the semiconductor substrate . the cover 160 is cylinder - shaped and includes an upper plate 162 , and a sidewall 164 which extends downwardly from the edge of the upper plate 162 . the lift pin assembly 200 ( fig3 ), driven by a robot arm ( not shown ), moves the wafer w above and onto the susceptor 100 . assembly 200 comprises lift pins 220 , a support plate 240 for the pins 220 , and an elevator device 260 . the lift pins 220 , which are joined to the upholding plate 240 in a square arrangement , receiving the wafers w from the robot arm . the support plate 240 is connected to the elevator device 260 , such as a hydraulic / pneumatic cylinder , and is movable to a plurality of positions in an upward and downward direction . the lift pins 220 are inserted into openings 122 in the support plate 120 for vertically movement within the openings 122 . the wafer w is transferred to the lift pins 220 by means of the robot arm when the lift pins 220 ascend to protrude above the top of the plate 120 and then mounted on the susceptor 100 when the lift pins 200 descend under the top of the plate 120 by way of the openings 122 . the guiding blocks 300 lead the wafer w to be positioned on an accurate position within the susceptor 100 . the guiding blocks 300 are disposed on the spacers 140 , each including slopes 320 formed inside from the top surface thereof . the wafer w slips down along the slope 320 to be positioned on the accurate position when it strays from the accurate position to result its edges to be partially laid on the tops of the guiding blocks . the baking apparatus 10 also includes a guiding block transfer unit 400 for moving the guiding blocks 300 in a predetermined distance to the displacement position or the awaiting position . it is desirable to render the guiding blocks 300 to be moved linearly along guiding lanes 142 within the range of the radius of the plate 120 . the guiding lanes 142 are formed in the spacers 140 to facilitate the linear movement of the guiding blocks 300 . the guiding lanes 142 are shaped in the form of apertures ( or openings ) or trenches . the guiding blocks 300 may include underlying projections ( not shown ) which are movably inserted into the guiding lanes 142 . referring to fig4 the guiding block transfer unit 400 is constructed of a driver 420 , a shaft 440 , supporting rods 460 , and transfer rods 480 . the shaft 440 is vertically connected to the driver 420 such as a stepping motor , hydraulic or pneumatic cylinder , or an actuator , and is rotated on its axis by the driver 420 . the topside of the shaft 440 is horizontally combined with the supporting rods 460 at constant intervals , and in the same number as that of the guiding blocks 300 . the other ends of the supporting rods 460 are joined with the transfer rods 480 which are each connected to the guiding blocks 300 . the supporting rods 460 and the transfer rods 480 are pivotally joined one to the other . the transfer rods 480 move in a range of angles when the supporting rods 460 are rotated . this enables the guiding blocks 300 to be linearly movable along the guiding lanes 142 . each of the transfer rods 480 is composed of a horizontal portion 482 , a vertical portion 484 , and a connection portion 486 , respectively . the horizontal portion 462 is linearly connected to the supporting rod 460 by means of a pivotable section on the same plane . the vertical portion 484 perpendicularly extends upwardly from the end of the horizontal portion 482 . the connection portion 486 is disposed parallel to the horizontal portion 482 , and is pivotally attached to the end of the vertical portion 484 . while the horizontal and vertical portions , 482 and 484 , may comprise a single body portion , they may also be combined by attachment devices such as screws . [ 0040 ] fig5 depicts a feature of combining a guiding block and a transfer rod , utilizing , for example , guiding block 300 , spacer 140 , and transfer rod 480 , respectively . referring to fig5 a and 6 b , the connection portions 386 of the transfer rods 480 are inserted into hollows 124 formed in the sidewalls of the plate 120 under the spacers 140 . in each illustrative structure , the guiding block 300 and the transfer rod 480 are combined by means of , for example , a bolt 722 and a nut 724 , through openings 302 and 487 , to penetrate the center of the guiding block 300 and the end of the connection portion 486 . the bolt 722 is coupled to the nut 724 through the opening in the guiding block 300 , the holed guiding lane 142 in the spacer 140 , and the opening in the connection portion 486 of the transfer rod 480 . the wafer w expands with heat during a baking process . this narrows the distance between the wafer w and the guiding blocks 300 at the displacement positions . at high processing temperature , the wafer w abuts against the guiding blocks 300 . such abutting action can be overcome by adjusting the displacement position of the guiding blocks 300 in accordance with the processing temperature in the baking apparatus 10 . in the present baking apparatus 10 , the opening 487 in the connection portion 486 of the transfer rod 480 is elongated along the span of the connection portion 486 , as in the case of the guiding lane 142 . preferably , the length of the elongate opening is larger than the diameter of the bolt 722 . thus , the elongate opening 487 enables a combinable position between the guiding block 300 and the transfer rod 480 to be varied , which adjusts the displacement position of the guiding block 300 . fig6 a and 6b exemplarily show available features of the displacement positions for the guiding block 300 combined with the transfer rod 480 . the location of the guiding block is dependent on whether relatively lower or high processing temperatures is employed . in a lower temperature scenario , as shown in fig6 a , the bolt 722 is fixed by the nut 724 at a position adjacent to one end 487 a of the opening 487 , establishing the displacement position of the guiding block 300 in a location inward on the spacer 140 . in a higher temperature scenario , as shown in fig6 b , the bolt 722 is fixed by the nut 724 at a location adjacent to the other end 487 b of the opening 487 , establishing the displacement position of the guiding block 300 in a location outward on the spacer 140 . for instance , the relative location may set about 0 . 5 mm for a distance between the wafer ( e . g ., in diameter of 300 mm ) and the guiding block 300 at the locating position of them , about 2 . 0 mm for the length of the opening 487 in the transfer rod 480 ( i . e ., a distance between both ends 487 a and 487 b ). as shown in fig7 a resilient element 740 , such as a spring or coil , may be inserted into the hollow 124 formed in the sidewall of the plate 120 , for preventing a heating process from continuing to operate even when the guiding block 300 is positioned at the displacement position in the condition of an abnormal operation of the guiding block transfer unit 400 . the resilient element 740 surrounds the connection portion 486 of the transfer rod 480 , both ends of which attach onto a link 488 embedded at the connection portion 486 and a link 125 embedded in the hollow 124 , respectively . the resilient element 740 maintains its equilibrium , neither compressed nor stretched , when the guiding block 300 is set on the displacement position . the resilient element 740 also has a modulus of elasticity designed to minimize vibration when it is relieved from a compressed state . [ 0045 ] fig8 a and 8b illustrate a procedure of positioning the wafer w in a normal position by means of the guiding blocks 300 . in fig8 a , the solid circle referred to as w denotes a wafer which is out of the normal position . the broken line referred to as w ′ denotes the normal position on which the wafer should be placed for processing . when the wafer is loaded onto the susceptor , the guiding blocks 300 are moved to their aligning positions before the lift pins 220 descend . this pre - alignment operation permits sufficient spacing of the wafers and prevents the wafer edges from being partially laid onto the guiding blocks 300 . thereafter , if the top ends of the lift pins 220 are inserted into the openings 122 , the guiding blocks 300 will move to their displacement positions to correct the positional error of the wafer . as a result , the wafer w will be positioned in their normal position as shown in fig8 b . [ 0046 ] fig9 a , 9b , and 9 c illustrate sequential changes of positioning the guiding blocks 300 to fit the wafer w on the normal position . first , as shown in fig9 a , the lift pins 220 on which the wafer w is mounted go down after the guiding blocks 300 have moved into the displacement positions . when the top ends of the lift pins 220 are inserted into the openings 122 by elevating the lift pins 220 , the guiding blocks 300 move to the awaiting positions , and are then returned to the displacement positions , as shown by the arrows in fig9 a and 9b . even when the edges of the wafer w are initially laid on the guiding blocks 300 , the realignment of the guiding blocks 300 enables the wafer w to be set in the normal position as shown in fig9 c . returning to fig1 the apparatus 10 is associated with a testing unit 500 for monitoring whether or not the wafer w is positioned in the normal position on the susceptor 100 to avoid adversely affecting the baking process due to the misaligned placement of the wafer edges on the guiding blocks 300 which makes the wafer slant . the testing unit 500 is constructed of a vacuum pump 510 , a vacuum line 520 extending from the vacuum pump 510 , a sensor 540 for gauging pressure in the vacuum line 520 , and a display panel 560 showing a value of pressure calibrated by the sensor 540 . the vacuum line 520 extends into the space between the rear of the wafer w and the plate 120 . the pressure in the vacuum line 520 is detected by the sensor 540 when the vacuum pump 510 is started before the baking process begins . the sensor 540 can be a digital vacuum sensor , and the amount of pressure in the vacuum line may be more accurately established without damaging the wafer w . if , however , a pressure value measured by the sensor 540 becomes out of a predetermined range due to the positional error of the wafer w ( i . e ., the wafer w is laid on the guiding blocks 300 ), an alarm can be generated to inform an operator of the misalignment of the wafer w . alternatively , vacuum holes may be provided in the spacer 140 around which the edges of the wafer w can be mounted in the normal position , connected to the vacuum line 520 . [ 0048 ] fig1 summarizes a sequential flow of positioning the wafer w onto the susceptor 100 . first , the displacement positions of the guiding blocks 300 are adjusted wherein the bolt 722 is inserted into the openings 302 and 487 respectively formed at the guiding block 300 and the connection portion 486 of the transfer rod 480 . the transfer rod 480 moves within a predetermined range to set the combining position of the guiding block 300 and the transfer rod 480 . then , the bolt 722 is joined with the nut 724 to fix the guiding block 300 on the transfer rod 480 ( step s 10 ). next , the cover 160 is elevated from the plate 120 so that the lift pins 220 protrude above the top surface of the plate 120 . the wafer w is transferred to the upper work space of the plate 120 by a robot arm to which it is adhered . the wafer w is then laid onto the lift pins 220 by the robot arm ( step s 20 ). the lift pins 220 are lowered , and the cover 160 is closed ( step s 30 ). if the lift pins 220 descend under the upper surface of the plate 120 through the openings 122 , the driver 420 makes the guiding blocks 300 move from the displacement position to the awaiting position and then back to the displacement position ( step s 40 ). the realigning of the guiding blocks 300 causes the wafer w to be positioned on the normal position of the susceptor 100 even when the wafer w is misaligned with respect to the normal position or is mounted on the guiding blocks 300 . thereafter , the testing unit 500 checks whether the wafer w is positioned at the normal position on the susceptor 100 ( step s 50 ). the vacuum pump is actuated and the sensor 540 detects the pressure in the vacuum line 520 . if the measured value of the pressure in the line 520 is under the predetermined range , the baking process is carried out . on the other hand , if the pressure in line 520 is outside of the predetermined range of pressure , an audible signal is generated to inform an operator of misaligned status of the wafer w . in the embodiments described so far , while the guiding blocks 300 are linearly movable by the single driver , it may also be possible for the guiding blocks 300 to be continuously moved in a generally circular path . it is also possible to transfer each guiding block by each driver . according to the baking apparatus and method of the present invention , it is possible to prevent a misaligned placement of a wafer in which the wafer is positioned away from the normal position or the wafer edges are locally mounted on the guiding blocks . moreover , a wafer can be transferred to the normal position anyway even when the guiding block driver operates abnormally , because the guiding blocks can be returned to a predetermined displacement position for carrying out the process using a resilient element . further , there is provided of an inspecting function by the testing unit to check out whether a wafer is safely laid on the upper surface of the susceptor before continuing the baking process . this prevents carrying out the process with misaligned placement of the wafer on the susceptor . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as described in the accompanying claims | 7 |
fig1 shows an applicator top 1 with a neck 3 which connects with a container body 5 . the applicator top has a wall 7 with a thinner section 9 , which allows the user to flex the area inward , pushing a portion of the contents out of the container . the contact surface 11 of a lip applicator may be constructed with a one - piece or two - shot construction so that the actual raised lip - contacting surface 13 may be constructed of a compliant material . fig2 shows the structure of fig1 with a cap 15 formed on a living hinge 17 on an extension 19 from the applicator top 1 . in an alternate form of applicator top 21 shown in fig3 a flow channel 23 is exposed between a base 25 and a sloping wall 27 . at the top of the sloping wall 27 a double hinge spacer 29 with two living hinges 31 and 33 supports a cap 53 , which covers the applicator surface . as shown in fig4 when the head 21 is flexed , the contents of the body 5 are squeezed outward through hollow channel 23 to spread across the applicator . a flexing area 37 allows the downward flexing of the head 21 . as shown in fig5 the base 25 and sloping wall 27 may be enlarged into a wall 7 similar to that shown in fig1 with the flex area 37 sufficient to flex when pressure is placed on the applicator 11 or applicator pad 13 . a central opening 39 allows the contents of the body to spread radially outwardly across the annular applicator . in fig6 the head 41 has a cap 53 mounted on a double hinge 29 . the base 25 has a snap 43 which may either be a recess as shown or a projection which cooperates with a projection or recess on the free end 45 of the cap 53 . a large central valve 47 within the annular applicator surface 13 radially supplies materials from the body 5 to the annular applicator surface 13 . a preferred projecting complementary snap 48 , which cooperates with the recess 43 , is shown in fig7 . the double hinge 29 has two living hinges 31 and 33 . the valve 47 is a compliant valve that dispenses the contents of the container 5 as a ring on the compliant annular applicator surface 13 . fig8 shows a side view of the applicator head 41 , showing how the cap 53 is attached to the wall 7 with the double hinge 29 . windows 49 promote the flexibility of the wall and allow molding of the flexing area 37 . fig9 is an enlarged detail of the dispenser head . fig1 shows the cap 53 folded downward against the head 41 and container 5 as it would be when the applicator surface 13 is in use . the compliant material which is molded on structural material in the applicator 13 also is flowed downward 50 over the top of the container 5 to provide a non - slip surface . as shown in fig1 , the compliant surface on the applicator 13 extends onto the body 5 as a non - slip surface . an applicator head 51 with a modified cap 53 is shown in fig1 . the cap has a base 25 , a wall 7 and a valve 47 which flows the material over the annular compliant applicator surface 13 , the same as the other applicator heads . cap 53 has clasps 55 which are inwardly curved and which grip the wall 7 , holding the cap closed . the double hinge attachment 29 is identical . in the molded position of the cap 53 and applicator head 51 , as shown in fig1 , the double hinge 29 is horizontal , as is the top 57 of the cap . the clasps 55 are molded in a continuation of the cylindrical surface of the cap 53 . as shown in fig1 , the flat top 57 provides an area for lenticular lenses 59 to selectively reveal multiple image graphics below the lenticular lens 59 . as shown in fig1 , the cylindrical clasp wings 55 grip the cylindrical wall 7 , holding the cap 53 closed . as shown in fig1 , the cap 53 is closed on the wall 7 of the applicator head 51 . the lower end 60 of the body 5 is crimped and sealed after the body has been filled with the contents . fig1 shows the cap 53 closed on the cylindrical surface 7 . the applicator head 61 is enlarged to cylindrically align with the cap 53 . as shown in detail of fig1 , the double hinge 29 allows the cap 53 to swing rearward . the lower living hinge 31 allows the center zone 63 of the double hinge 29 to fold within the relieved area 65 so that the center zone lies along the cap neck 61 . as shown in fig1 , a plug post 67 with reinforcement 69 is formed on the inside of top 57 of the cap 53 to plug the exit hole 39 in the center of the annular applicator surface 11 . fig1 and 19 show the cap 53 and the post 67 in the molded position . the front view shown in fig2 shows the alignment of the plug post 67 with the product release opening 39 . fig2 shows an applicator head 21 with a modified cap 35 , which has a flat top 70 on which lenticular lenses may be mounted parallel to the applicator surface . the wall 7 has base 25 and upper wall 27 portion . the end 71 of the cap is shortened to provide easy lifting of the cap . fig2 - 43 show caps with connector blades 73 . the cap necks 7 are provided with receivers 75 which receive the blades in snap - in condition . the connector blades 73 are connected to the living hinges 31 , which are part of the double hinge 29 fig2 shows a cap 53 mounted with a connector blade 73 . fig2 shows a cap 35 molded with a connector blade 73 for fitting within a recess 75 on a rearward extension at the rear of dispenser head 81 , which is similar to the dispenser head 21 shown in fig3 and 4 . the flex area 37 permits flexing the end 81 to cause material to flow from opening 39 . the extension 77 at the rear of the cap prevents overflexing of the cap . another view of the dispenser head is shown in fig2 . a side view is shown for clarity in fig2 with the cap 35 open , and in fig2 with the cap 35 closed . a front view of the container showing the flat end 71 of the cap 35 is shown in fig2 . a front view with the cap open is shown in fig2 . fig2 shows the dispenser head 81 and container body 5 in molded condition after the cap has been connected with the cap blade 73 inserted in the receiver 77 , and before the molded body 5 is filled with contents and sealed . fig3 shows the applicator shown in fig2 after the container body 5 is filled and sealed . fig3 shows the unfilled container on which the cap is assembled . the body 5 , wall 7 and wall 27 , and the parts underlying the applicator surfaces 11 and 13 are made of structural material . the applicator surfaces 11 and 13 are coated with compliant material which is soft to the touch . fig3 is a side view of the structure shown in fig3 showing the layers of compliant material 11 and 13 which form the applicator surface . fig3 is a rear view showing how the separately molded cap 35 is connected with the connector blade 73 mounted in the recess 75 on the rear downward extension 77 of the applicator head . the applicator head and body 5 are molded in one piece with side actions forming the rear of the wall 7 . the flex area 37 , the flow channel 23 which may be solid or compliant , and the openings in the extension 77 are molded with side actions . fig3 is a top view showing the receiver 75 and the recess 79 for receiving the connector blade of the cap . fig3 shows the apparatus formed in the mold with the first shot of structural material in which the container 5 , the flow channel 23 , the upper wall 27 , the rear extension 77 and the receiver 75 are formed with a first shot of material . fig3 shows the structure formed in the mold in the first shot with the cored out areas 83 and 85 at the rear of the applicator head , and the cored out recess 79 in the receiver 75 . fig3 is a side view of the apparatus in the mold with a core 87 positioned within the container 5 and the flow channel 23 , with the upper part 88 representing the front half of the mold and the lower part 89 representing the back half of the mold . fig3 shows how a second shot of compliant material is added to form the applicator surfaces 11 and 13 . fig3 is a detail of the molding of the cap 53 with the plug post 67 and reinforcements 69 connected to the top 57 of the cap , and the double hinge piece 29 molded with living hinges 33 and 31 which connect the cap to the connector blade 73 . fig4 shows the cap 35 with modified snap side extensions 91 to hold the cap closed . the relief 71 on the end of the cap allows the compliant material 11 to be seen , and also allows the user to open the cap . fig4 is an inverted detail of the cap 35 showing the snap extensions 91 held in the complementary snap receivers 93 formed on the back of wall 7 . fig4 is a detail of the cap snap 91 and the receiver 93 on the dispenser head . as shown in fig4 , the cap extension 91 locks and snaps past the dispenser head wall 7 to hold the cap 35 closed . as shown in fig4 , one of the inward cap extensions 95 , which extends inward from the cap snap 91 , fits in the recess 93 formed in the wall 7 of the dispenser head . fig4 shows rotating the cap 35 downward to snap the inward extensions 95 in the recesses 93 . fig4 shows the inward extending snaps 95 in the cap 35 , which fit within the recesses 93 on sides of the wall 7 . fig4 - 50 show details of a preferred compliant valve , such as shown in fig6 , 9 and 11 - 13 , that can be used with any dispenser head . as shown in fig4 , the applicator head 51 is made of structural material . that includes the color 3 , the wall 7 , the flow tube 23 , the base 25 and the upper part 27 . compliant material 11 and 3 is added in an annular ring . central stepped recesses 101 and 103 are formed in the applicators 11 and 13 . valve 47 is made out of compliant material . a stem 105 of the valve 107 is pressed within the flow tube 23 . longitudinal ridges on the stem provide flow channels 107 around the stem on the inside of the flow tube 23 . material 109 flows through the channels 107 . the valve 47 is made of a compliant disc . a central 111 is thick and fits within the recess 101 . a thinner outer portion 113 rests against the ledge 103 . in fig4 the valve 47 is shown not fully pushed into the recesses for clarity on the distinctions between the parts . the valve 47 is also shown in dash lines to show the flexibility of the upper disc . in fig4 the valve 47 is shown seated with outer thin area 113 , seated against the ledge 103 . the rounded wall 115 helps to distribute the material outwardly on the applicator surfaces 11 and 13 . the side view in fig4 shows that the valve is completely recessed below the applicator surfaces 11 and 13 . fig5 shows the thin outer flange 113 of valve 47 resting on the recess surface 103 to close the valve until pressure is exerted on the material to flow the material outward across the curved surface 115 onto the applicator surfaces 11 and 13 . welded areas 117 in two or more places around the valve stem maintain the flow channel 107 while holding the valve stem 105 fixed within the flow tube 23 . fig5 shows a flat head embodiment 118 with the cap 119 and applicator head section 121 in the closed position using snap 123 . the applicator head 121 is fused , or concurrently formed with the content section 5 . the lower end 60 of the body 5 is welded , fused , or crimped and sealed after the body has been filled with the contents . fig5 shows the applicator 118 and head section 121 with the cap 119 in the open position . the snap portion 125 of cap 119 clips onto the snap projection 124 . the contents from the container body 5 are distributed onto the flexible contact surface 129 through the dispenser hole 39 . double hinge 127 allows the cap 119 to be positioned away from the contact surface during use . the application contact surface 129 and the rim 130 are formed of an elastic plastimer with a similar base formulation to the polypropylene or polyethylene container 5 and cap 119 . as shown in fig5 , the applicator head section 121 is formed from two shots of material . the first shot of material forms the tube 5 , the head 121 , the cap 119 and snap 125 , and the central applicator support area 131 . a second shot of compliant material laminates on the applicator area 131 to form the contact surface 129 and the surrounding support 132 . fig5 depicts the applicator area 131 suspended within the head section 121 by connector elements 133 , which form flow paths 132 for flowing material to laminate the applicator support area 131 . the second shot of material fills flow paths 132 to form a compliant membrane 134 . in fig5 the applicator area 131 is shown suspended inside the head section 121 by a compliant membrane 134 between the applicator area 131 and the head section 121 . the first shot molds the applicator head 121 and floating applicator support area 131 . the applicator support area 131 is connected by one or more straps 133 to the applicator head section 121 . the second shot forms a contact surface 129 that is compliant . the second shot also forms an unsupported membrane 134 between the applicator support area 131 and the head section 121 . fig5 and 57 show the conformable floating contact surface 129 and membrane 134 flexing in response to a force 135 applied to the contact surface 129 . because the contact surface 129 created by the second shot is compliant and unsupported around the outer edge of the head section 121 created by the first shot , the applicator surface 129 can conform to forces presented to its surface . while the invention has been described with reference to specific embodiments , modifications and variations of the invention may be constructed without departing from the scope of the invention . | 1 |
as used in the specification and claims , the singular form “ a ”, “ an ” and “ the ” include plural references unless the context clearly dictates otherwise . for example , the term “ a bacterium ” includes a plurality of unicellular microorganisms of the same species . as used herein , “ monogastric ” is intended to encompass any animal having one stomach . examples of monogastric animals include , but are not limited to , horses , emu , ostrich , dog , cat , swine , bear , turkey , chickens , ducks , quail , pheasants , reptiles , and humans . pre - ruminant animals such as young cattle , buffalo , bison , and elk are also encompassed by the term monogastric as these animals are born monogastric and then develop into true ruminants as adults . in a preferred embodiment of the invention , the fibro - biotic is administered to livestock that are fed a fiber diet . as used herein the term fiber refers to the soluble and insoluble components of feed that are not digested by enzymes in the livestock gastrointestinal tract . the primary sources of fiber include such cell wall materials as cellulose , hemicelluloses , lignin , and pectins , along with gums and mucilages from plant material . the term “ crude fiber ” is defined as loss on ignition of dried residue remaining after digestion of sample with 1 . 25 percent sulfuric acid and 1 . 25 percent sodium hydroxide under specific conditions . typical conditions and methods are described in the official method of analysis of the association of official analytical chemists . the undissolved residue is rinsed with dilute sulfuric acid , deionized water , and ethanol , then reduced to ash . the crude fiber value includes the amount of cellulose and some indigestible lignins but does not distinguish between digestible and indigestible fiber . “ neutral detergent fiber ” and “ acid detergent fiber ” as used herein are analyses that involve the solubilization of non - fiber components of the feed in boiling detergent solution , with the residual material described as neutral detergent fiber or acid detergent fiber depending on the solution used . neutral detergent fiber ( ndf ) analysis and acid detergent fiber ( adf ) analysis originally described by p . j . van soest ( agricultural handbook no . 379 entitled forage fiber analyses ( apparatus , reagents , procedures , and some applications ); pages 1 - 20 ; by h . k . goering and p . j . van soest ; agricultural research service of the united states department of agriculture ) is incorporated herein by reference . typically , acid detergent fiber is measured by boiling the sample in an acid detergent solution . the mash is filtered . the residue contains wall fiber , primarily cellulose , lignin and silica . neutral detergent fiber is typically measured by boiling the sample in a neutral detergent solution . the wash is filtered . the residue contains all of the structural plant parts , including cellulose , hemicellulose , and lignin . as used herein the term “ fibro - biotic ” refers to live bacteria when fed to a livestock , increases fiber digestion for said livestock . as used herein the term “ isolated bacterium strain ” means that the strain might be cultivated in vitro in a culture comprising said strain . as used herein the term “ suitable nutrient medium ” means a medium , such as lab broth , mrs broth , or wilkens - calgren broth in which bacteria might be cultivated . initially , 122 bacteria isolates from human excrement was provided from natick soldier center ( natick , mass .). the 122 isolates were initially sequenced for approximately half of a 16s rrna gene allowing for grouping by sequence similarity . the isolates were then characterized by api anaerobe identification system ( biomérieux , inc ., lombard , ill .) and bbl crystal anaerobe identification system ( bd diagnostics , eden prairie , minn .) for their ability to grow on cellulose and xylan . six bacterial strains ( isolates sd cmc 3f , rf cell 1b2 , sd cc 2c , sd cc 1c , sd cc 1b , and rf cell 1b1 ) were capable of growing on cellulose or xylan and were identified as bacteroides ovatus strains . more particularly , strains sd cmc 3f , rf cell 1b2 , sd cc 1c , and sd cc 1b grew on cellulose and sd cc 2c and rf cell 1b1 grew on xylan . bacterial strain sd cc2a was characterized as a bacteroides xylanisolvens strain and also grew on cellulose . to determine the effectiveness of the six selected bacterial stains , forty - eight female pic ( pig improvement corporation , lexington , ky .) grower sus scrofa scrofa livestock were used to establish the effects feeding fiber utilizing bacteria with standard and high fiber diets . treatments were arranged as a 2 × 4 factorial with 2 diets and 4 bacterial treatments . sus scrofa scrofa ( having an initial average body weight of 61 . 1 kg ) were randomly assigned to experimental treatments and housed in two rooms with individual pens at the iowa state university swine nutrition farm . the sus scrofa scrofa were fed diet compositions presented in table 1 and consisted of control ( 3331 kcal / kg metabolizable energy , 14 % crude protein , 6 . 3 % hemicellulose and 2 . 7 % cellulose ) and high fiber ( 3300 kcal / kg metabolizable energy , 14 % crude protein , 10 . 4 % hemicellulose and 7 . 7 % cellulose ). the livestock were fed ad libitum and had free access to water and were adapted to the pens and diets for a period of seven days . all procedures involving animal handling and testing were reviewed and approved by the iowa state university committee on animal care ( approval # 9 - 06 - 6207 - s ). while distiller &# 39 ; s dried grains with solubles and soybean hulls constitute fiber addition to the animal feed , it is contemplated that other fiber sources such as corn germ meal , wheat middlings , bran from any grain , alfalfa , corn gluten feed , brewer &# 39 ; s grain , dried apple pomace , dried citrus pulp , dried citrus peel , sugar beet pulp , soya bean hulls , pectin residue , and other fiber - added sources would be more readily digested with the fibro - biotic . the bacterial feed treatments consisted of either no bacteria supplement ( a ) or one of three bacteroides isolates ( b , c , and d ) ( table 2 ). prior to bacterial treatment and after adaptation , livestock were acclimated to take 20 ml of a 50 : 50 mixture of food grade glycerol ( sigma ) and wilkens - chalgren broth orally via a syringe at 0900 daily for two weeks . it is contemplated that other carriers would be suitable to orally deliver the fibro - bacterial . a suitable carrier would encourage the livestock to ingest the carrier with the fibro - bacteria . ideally , the carrier would be of a viscosity wherein the fibro - bacteria would confer even mixture . in one embodiment of the invention the fibro - biotic is administered with a glycerol carrier . the fibro - bacteria were grown anaerobically in 100 ml of wilkens - calgren broth ( fisher scientific , inc , pittsburg , pa .) ( 1 ml of overnight bacterial growth inoculated into 100 ml of broth ) for 24 h at 38 ° c . ( final concentration was 1 × 10 9 bacterial cells / ml broth ). bacterial doses were prepared each morning by mixing 10 ml of the bacterial culture with 10 ml of sterile anaerobic glycerol ( feed grade , fisher scientific ), dose of bacteria was 1 × 10 10 bacterial cells . the treatment with no bacteria had broth processed the same way as described above without inoculation of initial broth . thus control livestock receive the same volume dose but with no bacterial cells in it . in a coy anaerobic chamber ( coy laboratory products , grass lake , mich .) the glycerol - bacteria mixture was placed in sterile 20 ml syringes . filled syringes were placed , by treatment , into mitsubishi anaeropak boxes , without gas generator , ( fisher scientific ) and seal prior to transport to the farm . sus scrofa scrofa livestock were dosed orally at in the morning , daily throughout the experiment . prior to sampling , three weeks post treatment initiation ; 24 pigs at a time were moved into metabolism crates ( 1 . 2 × 2 . 4 m ) for 11 days . on days 7 to 11 total dietary intake , fecal output , and urinary output were measured . on these five days samples were taken of feed and feed refusals and 10 % of the fecal output of each pig was pooled in order to determine nutrient digestibilities . blood was collected from the jugular vein into vacuum containers containing sodium heparin ( becton dickinson , franklin lakes , n . j .) on days 1 and 11 and the resulting plasma was stored at − 20 ° c . until analyzed for plasma energy metabolites and insulin . feed , feed refusals , and fecal samples were dried prior to chemical analysis . carbon , nitrogen and sulfur were analyzed using a variomax cns analyzer ( elementar analysensysteme gmbh , hanau , germany ). other nutrients were analyzed on feed , feed refusals , and feces by minnesota valley testing laboratories ( new ulm , minn .) using aoac approved methods for ash , crude fiber , acid detergent lignin and crude protein . data were analyzed as a 2 × 2 × 4 randomized block design with 2 groups of pigs , 2 dietary treatments and 4 bacterial treatments . statistics were performed using proc glm of sas ; no interactions were significant ( two - way − group × diet , group × bacteria , diet × bacteria and three way , group × diet × bacteria ) so they were removed from the final model . as detail supra , pigs were fed a fibro - biotic supplement detailed in table 2 for a period of 36 days . digestibility of nutrients was determined on feed and pooled fecal sample for each subject . digestibility of neutral detergent fiber and acid detergent fiber were examined daily . culture effluent subsamples and feed and inoculum samples were dried overnight in pre - weighed aluminum pans for dry fecal matter determination as is known in the art . ndf and adf on the feed , inoculum and dried effluents from each culture were determined as detailed supra . digestibilities ( dm , ndf and adf ) were estimated for each culture by calculating total dm , ndf and adf input and output from total feed weight and total inoculum and effluent volumes . calculations of percentage of fiber digestibility were calculated as follows : intake nutrient was calculated as the percentage of nutrient in the feed multiplied by the grams of feed per day . fecal fiber was calculated by percentage of nutrient in the feces multiplied by grams of feces per day . plasma glucose concentrations were determined using an enzymatic kit ( gahk20 , sigma chemical ) based on hexokinase activity . plasma cholesterol and triglycerides were quantified using enzymatic kits ( c7510 and t7531 , respectively , pointe scientific , canton , mich .). the intra - and interassay cv for the cholesterol assay were 0 . 8 % and 1 . 1 %, respectively , and the intra - and interassay cv for the triglyceride assay were 1 . 0 % and 2 . 9 %, respectively . serum insulin concentrations were determined using a porcine - specific insulin elisa kit ( 10 - 1129 - 01 , alpco , windham , n . h .). the insulin elisa has a range of detection of 0 . 02 to 1 . 5 ng / ml and intra - and interassay cv less than 10 %. as detailed in fig2 , and table 3 , administering bacteroides strain sd cmc 3f as a feed supplement to sus scrofa scrofa on a control diet increased digestibility percentage of crude fiber by 4 . 3 percent when compared to no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , neutral detergent fiber digestibility increased by 7 . 29 percent when compared against no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , acid detergent fiber digestibility increased by 3 . 38 percent when compared against no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , lignin digestibility increased by 12 . 43 percent when compared against no fibro - biotic supplement . as detailed in fig4 , and table 4 , administering bacteroides strain sd cmc 3f as a feed supplement to sus scrofa scrofa on a control diet increased digestibility percentage of crude fiber by 3 . 56 percent when compared to no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , neutral detergent fiber digestibility increased by 1 . 76 percent when compared against no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , acid detergent fiber digestibility increased by 5 . 08 percent when compared against no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , surprisingly lignin digestibility decreased by 1 . 05 percent when compared against no fibro - biotic supplement . as detail supra , sus scrofa scrofa were fed fibro - biotics detailed in table 2 for a period of 11 days . digestibility of neutral detergent fiber and acid detergent fiber were examined daily . culture effluent subsamples and feed and inoculum samples were dried overnight in pre - weighed aluminum pans for dry fecal matter determination as is known in the art . ndf and adf on the feed , inoculum and dried effluents from each culture were determined using analytic methods listed supra . digestibilities ( dm , ndf and adf ) were estimated for each culture by calculating total dm , ndf and adf input and output from total feed weight and total inoculum and effluent volumes . as detailed in fig1 and table 3 and 4 , average fecal output of sus scrofa scrofa on a control diet supplemented with fibro - biotic b had a decrease in 199 . 71 grams of daily fecal output compared to those fed only a control diet . with the fibro - biotic b supplement , this was an approximate 39 % decrease in daily fecal output when the livestock was on a control diet . similarly , the average fecal output of sus scrofa scrofa on a high fiber diet supplemented with fibro - biotic b had a decrease in 130 . 5 grams of daily fecal output compared to those fed only a high fiber diet . with the fibro - biotic b supplement , this was an approximate 18 % decrease in daily fecal output when the livestock was on a high fiber diet . while the invention has been described with reference to details of the illustrated embodiment , these details are not intended to limit the scope of the invention as defined in the appended claims . the embodiment of the invention in which exclusive property or privilege is claimed is defined as follows : | 2 |
in accordance with the instant invention there is provided a process for depressing non - sulfide minerals in a flotation system by adding to the flotation system an effective amount of crosslinked starch . starches , or starch - containing natural substances , which can be utilized in the instant invention include , but are not limited to , corn , waxy corn , waxy maize , tapioca , potato , sorghum , wheat , rice , sago , amylomaize , arrowroot and the like . additionally , starches , such as those listed above , which have been modified may be utilized . examples of various modifications include starches which have been acidified , oxidized , fluidized , enzyme converted , dextrinized , esterified , etherified , grafted , block polymerized and the like . what is meant by these terms is , in esterification for example , the starch is reacted with acetic anhydride or maleic anhydride to become esterified . the starch or modified starch is crosslinked with an appropriate bifunctional crosslinking agent . suitable crosslinking agents able to react with two or more hydroxyl groups include phosphorus oxychloride , trimetaphosphates , epichlorohydrin , dicarboxylic acid anhydride , n , n &# 39 ;- methylenebisacrylamide ; 2 , 4 , 6 - trichloro - s - triazine and the like . the degree of crosslinking should be such that there are 500 to 10 , 000 anhydroglucose units ( agu ) per crosslink . to obtain this level of crosslinking about 0 . 001 to 0 . 15 percent , based on the starch , of crosslinking reagent should be employed , preferably 0 . 01 to 0 . 15 percent . the crosslinking agent is added to a granular starch suspension generally having a solids content on the order of 35 to 45 %. the crosslinking reaction lasts from one to twenty - four hours at a temperature within the range of 10 ° to 110 ° c . with the ph controlled between ph 7 to 12 . if the suspension is a swelling one , such as an aqueous suspension , the swelling under strongly alkaline conditions can be controlled by the presence of high concentrations ( 10 to 30 %) of sodium chloride or sulfate . the swelling of the starch results from the alkali hydroxide , ammonium hydroxide , amine or alkali carbonate generally employed to maintain the ph . conditions under this reaction are generally chosen to prevent gelatinization so that the reaction product can be isolated in granule form . to obtain a higher degree of substitution , the crosslinking reaction may be carried out in a non - swelling suspension , such as isopropanol , or by blending the reagents with a starch having a 5 to 20 % moisture content without any suspending medium . additionally , the crosslinking reaction can occur in a cooked aqueous starch solution where the starch has gelatinized ; in this reaction the temperature must be maintained between 60 ° and 100 ° c ., and the gelatinized starch can also be dried on a heated drum . although the effective amount of the crosslinked starch necessary to obtain effective depression may vary depending upon the mineral to be treated , the degree of substitution and similar variables , generally an effective amount will be 0 . 25 to 2 . 5 pounds of crosslinked starch per ton of ore and preferably 0 . 5 to 1 . 5 pounds per ton of ore . the ores which can be treated are believed to be all non - sulfide ores with special emphasis being given to the separation of siliceous gangue particles from oxidic iron values , of copper minerals from molybdenite , of galena from chalcopyrite and sphalerite , of apatite from ilmenite , of fluorspar from calcite and of sylvite from halite in the presence of clays . the following specific examples illustrate certain aspects of the present invention and , more particularly , point out methods of evaluating the process for depressing non - sulfide minerals in a flotation system . however , the examples are set forth for illustration only and are not to be construed as limitations on the present invention except as set forth in the appended claims . all parts and percentages are by weight unless otherwise specified . 600 parts of crude iron ore having a particle size of minus 10 mesh are mixed with 400 ml . of deionized water , 5 . 0 ml . of a 2 % sodium silicate &# 34 ; n &# 34 ; solution and 1 . 8 ml . of a 25 % naoh solution . the resulting mixture is subjected to grinding in a rod mill for 50 minutes and thereafter is transferred into a 8 liter cylinder . to this cylinder there are added 200 ml . of 0 . 05 % ca ( oh ) 2 solution and an amount of deionized water sufficient to fill the cylinder to the 8 liter mark . the cylinder mixture is subjected to mechanical stirring for 1 minute during which time there is added 6 . 9 parts of a 1 % causticized corn starch solution ( 0 . 011 naoh based on starch ) as the desliming aid . the stirring is then stopped and the mixture is allowed to settle for 12 minutes , after which approximately 7 liters of the supernatant layer is syphoned off and filtered , resulting in the slime product . the remaining 1 liter underflow is transferred to a flotation bowl and water containing 17 ppm of calcium as caco 3 is added to the bowl until the level reaches the lip . the pulp is briefly agitated at 1200 rpm and thereafter the ph is adjusted to approximately 10 . 6 through the addition of 5 - 10 drops of 10 % naoh . 27 . 3 parts of a 1 % causticized starch solution is then added as a depressant and a two - minute conditioning time is allowed . 4 . 9 parts of a 1 % solution of a commercially available collector is added , 30 seconds of conditioning is allowed followed by a four - minute float . after the float , 3 . 3 parts of a 1 % solution of a commercially available collector is added , 30 seconds of conditioning is allowed followed by a four - minute float . after the float , 3 . 3 parts of a 1 % solution of a commercially available collector is again added , 30 seconds of conditioning is allowed and then followed by a second four - minute float . the froth collected from the first and second floats is labeled the rougher float and the remainder in the flotation bowl is labeled the rougher concentrate . the rougher float is transferred to a second flotation bowl to which there is added 13 . 6 parts of a 1 % causticized corn starch solution as a depressant . two minutes of conditioning is allowed before air is introduced into this bowl for 3 - 4 minutes . the froth collected is labeled the final froth . the underflow from the scavenger float is further conditioned for 30 seconds with 1 . 4 parts of a 1 % solution of a commercially available collector and thereafter floated for 3 minutes . the middling float sequence is repeated a second time and the combined froth from these two float is labeled the middling froth . the underflow remaining is combined with the rougher concentrate and labeled the concentrate . the experimental procedure set forth above is followed in every material detail employing as the depressant 1 . 5 pounds of causticized starch per long ton of iron ore in the flotation steps . test results are set forth in table i . the experimental procedure set forth above is followed in every material detail employing as the depressant 0 . 75 pound of causticized starch per long ton of iron ore in the flotation steps . test results are set forth in table i . the experimental procedure set forth above is followed in every material detail employing as the depressant 1 . 5 pounds of crosslinked starch per long ton of iron ore in the flotation steps wherein the crosslinked starch is an ethoxylated cornstarch crosslinked with epichlorohydrin and mixed with 7 . 7 % naoh in a blender for 15 seconds . test results are set forth in table i . the procedure of example 1 is followed in every material detail except that 0 . 75 pound of crosslinked starch is employed as the depressant are set forth in table i . the experimental procedure set forth above is followed in every material detail employing as the depressant 1 . 5 pounds of ethoxylated corn starch mixed with 7 . 7 % naoh in a blender for 15 seconds per long ton of iron ore in the flotation steps . test results are set forth in table i . the procedure of example 1 is followed in every material detail except that 1 . 0 pound of crosslinked starch is employed as the depressant per long ton of iron ore . test results are set forth in table ii . the procedure of example 3 is followed in every material detail except that the crosslinked cornstarch is mixed with 2 % naoh and blended for 5 seconds . test results are set forth in table ii . table i__________________________________________________________________________desliming - flotation performance of oxidized iron ore weight % calcu - % fe assaydose concen - final middl . lated final middl . examplelb / lt slime trate froth froth head slime conc . froth froth__________________________________________________________________________comp . a1 . 5 21 . 56 41 . 89 32 . 51 4 . 03 35 . 52 10 . 8 66 . 5 12 . 2 34 . 51 1 . 5 18 . 22 44 . 68 32 . 95 4 . 14 36 . 40 9 . 0 65 . 8 12 . 4 30 . 9comp . c1 . 5 18 . 02 38 . 04 36 . 25 7 . 69 36 . 54 9 . 4 67 . 8 14 . 3 51 . 1comp . b 0 . 75 18 . 37 39 . 22 37 . 54 4 . 85 36 . 68 9 . 1 67 . 7 16 . 2 49 . 22 0 . 75 21 . 46 41 . 19 32 . 87 4 . 47 36 . 23 10 . 1 67 . 7 14 . 3 39 . 6__________________________________________________________________________ fe distributioninsol final middl . type of causti - % naoh basedexampleconc . slime conc . froth froth cized starch on starch__________________________________________________________________________comp . a4 . 21 6 . 53 78 . 40 11 . 5 3 . 91 corn starch 0 . 0111 5 . 67 4 . 50 80 . 77 11 . 21 3 . 50 ethoxylated corn 7 . 7 crosslinkedcomp . c3 . 51 4 . 62 70 . 58 14 . 17 10 . 62 ethoxylated corn 7 . 7 non - crosslinkedcomp . b3 . 83 4 . 55 72 . 38 16 . 57 6 . 49 corn starch 0 . 0112 4 . 45 5 . 96 76 . 18 12 . 47 4 . 88 ethoxylated cross - 7 . 7 linked starch__________________________________________________________________________ table ii__________________________________________________________________________desliming - flotation performance of oxidized iron ore weight % calcu - % fe assaydose concen - final middl . lated final middl . examplelb / lt slime trate froth froth head slime conc . froth froth__________________________________________________________________________3 1 . 0 20 . 6 35 . 9 36 . 5 7 . 0 36 . 43 10 . 0 67 . 0 19 . 3 46 . 94 1 . 0 22 . 5 31 . 4 37 . 8 8 . 3 36 . 62 9 . 9 67 . 8 23 . 0 53 . 1__________________________________________________________________________ fe distributioninsol final middl . type of causti - % naoh basedexampleconc . slime conc . froth froth cized starch on starch__________________________________________________________________________3 3 . 35 5 . 65 66 . 01 19 . 32 9 . 00 ethoxylated cross - 7 . 7 linked corn4 2 . 85 6 . 09 58 . 14 23 . 76 12 . 01 ethoxylated cross - 2 . 0 linked corn__________________________________________________________________________ when the experimental procedure set forth above is employed in the flotation process wherein copper is separated from molybdenite , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing a n , n &# 39 ;- methylenebisacrylamide crosslinked amylomaize starch . when the experimental procedure set forth above is employed in the flotation process wherein galena is separated from chalcopyrite and sphalerite , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing an epichlorohydrin crosslinked dextrinized potato starch . when the experimental procedure set forth above is employed in the flotation process wherein apatite is separated from ilmenite , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing a trimetaphosphate crosslinked sorghum starch . when the experimental procedure set forth above is employed in the flotation process wherein fluorspar is separated from calcite , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing an epichlorohydrin crosslinked etherified rice starch . when the experimental procedure set forth above is employed in the flotation process wherein sylvite is separated from halite and clay , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing a n , n &# 39 ;- methylenebisacrylamide crosslinked tapioca starch . | 1 |
this invention relates to a new soluble form of amphotericin b which is believed to be a complex of amphotericin b comprising amphotericin b and the anion of an organic mono - or polycarboxylic acid of up to 20 carbon atoms . examples of such acids are acetic , oxalic , propanoic , malonic , 2 - methylpropanoic , butanoic , succinic , 2 , 2 - dimethylbutanoic , fumaric , citric , malic , glutaric , pentanoic , hexanoic , octanoic , nonoic , decanoic , hendecanoic , dodecanoic , palmitic , ricinoleic , oleic , stearic , or ethylenediaminetetraacettic acid . this type of aphotericin b may be prepared by adding the organic carboxylic acid to a substantially anhydrous ( not over about 1 % water ) alcoholic solution of amphotericin . methanol is a preferred alcohol although any water soluble or partially water miscible alcohol may be used , such as ethanol , propanol or butanol . the mixture of amphotericin b and the organic carboxylic acid ( containing excess acid , typically from about 0 . 5 to about 20 mols of acid per mol of amphotericin b ) is agitated for a short time , typically from about 2 minutes to about 30 minutes , and the ph then adjusted to neutral . the mixture is then heated moderately to from about 35 ° c to about 65 ° c while mixing for a period of from about 0 . 5 to about 2 hours . the ph is then readjusted to neutral and the mixture cooled slowly over a period of from about 0 . 5 to about 4 hours . the solid is filtered and dried . the amphotericin b complex of the present invention is soluble in water under both strongly acid and strongly alkaline conditions while exhibiting diminished solubility at neutral or near neutral ph . maximum solubility of the amphotericin b complexes of the present invention occur at about ph 2 and at about ph 10 . the complexes of the present invention are less soluble in methanol than amphotericin b . forty mg of the complexes of the present invention are soluble in 750 ml of methanol whereas 100 mg of amphotericin b are soluble in 750 ml of methanol . the following example illustrates the present invention without , however , limiting the same thereto . all temperatures in this application are expressed in degrees centigrade unless otherwise indicated . 42 . 64 g of amphotericin b containing 40 . 0 g activity are solubilized in 10 . 0 l of methanol by means of 7 . 0 ml of 5 . 8 n hcl . the solution is filtered . to this solution is added a solution of 400 ml of methanol containing 40 g of succinic acid . the ph drops to 4 . 05 and is adjusted to 7 . 0 with 29 . 6 ml of concentrated ammonia . the crystal suspension which forms is heated to 45 °- 50 ° c , slurried for 60 minutes , cooled to room temperature over a 2 - hour period , filtered and dried overnight at 45 °- 50 ° c . the resulting crystalline complex weighs 34 . 2 g . this complex has a solubility in water of 28 . 0 g / l at ph 2 . amphotericin b , on the other hand , has a solubility in water of less than 1 gram / l at ph 2 . the complex has an x - ray pattern and u . v . absorption at 405 millimicrons ( e 1 1 ) in methanol of 1649 ; pure amphotericin b dissolved in methanol has a e 1 1 u . v . absorption value of 1800 at 405 millimicrons . one hundred mg of this complex when added to 80 ml of methanol and the ph adjusted to 9 . 5 ( with triethylamine ) are soluble to the extent of 35 %, whereas 100 mg of amphotericin b are completely soluble in 80 ml of methanol . the above amphotericin b - succinic acid complex of the present invention has a biological activity of 1000 - 1250γ / mg while amphotericin b has a bioloiical activity of 920γ / mg . the test method used in establishing the biological activity is that described by platt et al ., analytical microbiology , volume ii , academic press , 1972 , editor f . kavangh , 4 . 2 iv , pp . 163 - 170 . the assay organism is candida tropicalis , atcc no . 13803 . | 2 |
( 1 ) the difference between the refractive index of the lens and the refractive index of the adhesive agent is made smaller than 0 . 1 . ( 2 ) the finish roughness of the cemented surface of the lens in the smoothing step is made higher than mesh # 1400 . and , without performing the polishing step that usually follows the smoothing step , the lens surface is put into adhesion with the polished surface of another lens . it is to be noted that the use of resin pellets of mesh # 1500 gives a surface roughness of 0 . 2 to 0 . 3 microns . in a case where no adhesive agent of proper refractive index can be obtained , an adhesive layer may be formed on the target surface by evaporating a material of intermediate refractive index between the refractive indices of the material of the lens element and the adhesive agent . even in this case , an equivalent result is effected . the surface is usually polished to a roughness on a dimensional order that is less than the wavelength , for example , 0 . 5 microns or less . if the adhesive agent and the lens on which the adhesive agent is applied have exactly the same refractive index , however , their boundary does not cause light to refract at all . even if the lens surface has minute concave and convex portions , therefore , they do not optically give any influence to the cemented refracting surface between the adhesive agent layer and the polished surface of the target lens . but , because , in reality , the available adhesive agent is few in number of kinds , in a case where the coincidence of the refractive indices is insufficient , it is important to limit the surface roughness to less than a certain level . from the experiments , it has been found that , in the actual practice , the above - cited conditions ( 1 ) and ( 2 ) in combination suffice for a satisfactory result . it is to be noted that this example is applicable to all optical instruments of the type in which a plurality of objects of different refractive indices are cemented together and the light rays passing through the cemented portions are utilized . therefore , it is not confined to the shape of the object to be cemented . it will be appreciated that the subject is solved by relying only on the correlation of the refractive indices of the two substances on either side of the cemented surface as the boundary , and the finish roughness of the cemented surface . by the way , the photographic zoom lenses used in bench tests of the invention were for a video camera , each comprising twelve or fourteen component lenses , of which two or three are in the cemented form . however , the test result depends on the state in which light passes through the cemented lens , in other words , the position at which the cemented lens is used in the photographic lens . some of the photographic lenses for the ordinary monitor camera have showed a good result with a finish roughness of mesh # 1200 or even # 1000 . fig1 ( a ) shows a step prior to the cementing , and fig1 ( b ) shows a step subsequent to the cementing . reference numeral 1 denotes a negative meniscus - shaped glass lens of which the outer surface 1a and the cemented surface 1b undergo the polishing step . reference numeral 2 denotes a positive glass lens having a refractive index different from that of the lens 1 . though its outer surface 2a undergoes up to the polishing step , its cemented surface 2b does not go beyond the smoothing step . in the ordinary cemented lenses , the refractive index of the positive lens is lower than that of the negative lens , while the adhesive agent of high refractive index is hardly available . therefore , the positive lens is chosen to be made as the rough surface . this surface has to be finished to a roughness of at least mesh # 1400 . in some cases , a higher number in mesh has to be chosen depending on the performance of the lens . reference numeral 3 denotes the adhesive agent . what is used here is of the ultraviolet ray setting type as is sold under the trade name : hard lock op , type no . op - 1045k from denki kagaku kogyo k . k . in fig1 ( b ), the axial thickness of the adhesive agent layer is depicted in exaggerated scale . as has been described above , limitations have been laid on the refractive index and the finish roughness . if these conditions are not satisfied , a deterioration of the image quality is found , which originates from the cemented surface . this is caused to appear by the extraordinary scattering and a decrease of transmittance in the treated surface . the cementing operation may be carried out without the necessity of altering the conventional way . so , the concave surface is put beneath , then coated with an adhesive agent layer , then the convex surface is gradually pressed against it , then centering is carried out , and then the adhesive agent is hardened by exposing to ultraviolet rays . the thus - made cemented lens is used as the component lens y or z or both in the zoom lens of fig3 . in reality , the refractive indices of the glass materials and adhesive agents sold in the market fall in a somewhat limited range . to satisfy the condition ( 1 ) at all times , therefore , a measure may be taken that the smoothed surface of the lens is further treated to form an intermediate layer by applying a coating of another material 4 ( for example , cerium fluoride ) thereon . in this case , as shown in fig2 ( a ), the cemented surface 2b of the lens element 2 is first smoothed to a finish of mesh # 1400 or more , and then a coating of such a material 4 that the difference from the refractive index n of the adhesive agent 3 is reduced to 0 . 1 or less is applied to the cemented surface 2b . it is after this that the two lenses 1 and 2 are brought into cementing contact as shown in fig2 ( b ). the invention is applicable also to cemented triplets or higher , and can be utilized in manufacturing cemented prisms . furthermore , it can be utilized in manufacturing replica type aspheric lenses and filters . according to the invention described above , one of the steps of the process for manufacturing cemented lenses or like other optics can be omitted , thereby giving an advantage that the production cost can be reduced by a significant amount , while nevertheless not involving such a problem that the image quality is caused to deteriorate . in turn , the decrease of the production cost provides a possibility of making a lens design with the use of a positively increased number of cemented lens members . also , when mounting all the lens elements in fixedly secured relation to the lens barrel , since any of the cemented members has substantially two elements , to keep hold of only one element is sufficient . even this can contribute to a reduction of the cost . | 8 |
the implementation of the present invention is described below through specific embodiments , and those skilled in the art can easily understand other advantages and efficacy of the present invention based on the disclosure of the specification . referring to fig1 , fig2 , and fig3 , the present invention provides an adjustable coolant quick coupler , which includes a coolant supplier seat 1 , an intubation device 2 , a transmission seat 3 , a connecting device 4 , and a regulator assembly 5 . an end of the coolant supplier seat 1 is provided with a tank 10 and two holes 11 . the two holes 11 are respectively located at two opposite angles of the tank 10 , and each hole 11 has a positioning pillar 12 . referring to fig4 , an other end of the coolant supplier seat 1 is provided with a flow - in channel 13 and a flow - out channel 14 , which are respectively communicated with the tank 10 . a side of the coolant supplier seat 1 has a flow - in hole 15 and a flow - out hole 16 , in which the flow - in hole 15 is communicated with the flow - in channel 13 , and the flow - out hole 16 is communicated with the flow - out channel 14 . an other end of the coolant supplier seat 1 further has a flow - in quantity adjusting hole 17 and a flow - out quantity adjusting hole 18 , in which the flow - in quantity adjusting hole 17 is communicated with the flow - in channel 13 , and the flow - out quantity adjusting hole 18 is communicated with the flow - out channel 14 . the intubation device 2 has a stopper 20 , a flow - in tube 21 , a flow - out tube 22 , an elastic 23 , and a stop pillar 24 . the stopper 20 is disposed between the tank 10 and the flow - in channel 13 and the flow - out channel 14 . the stopper 20 has a first through hole 200 and a second through hole 201 respectively corresponding to the flow - in channel 13 and the flow - out channel 14 . an end of the flow - in tube 21 is disposed in the flow - in channel 13 and has an inlet hole 210 . an other end of the flow - in tube 21 passes through the first through hole 200 , extends into the tank 10 , and has a plurality of outlet holes 211 . the outlet holes 211 are communicated with the inlet hole 210 . the flow - in tube 21 is sleeved with a plurality of leak - proof washers 212 . an end of the flow - out tube 22 is disposed in the flow - out channel 14 and has an outlet hole 220 . an other end of the flow - out tube 22 passes through the second through hole 201 , extends into the tank 10 , and has a plurality of inlet holes 221 . the inlet holes 221 are communicated with the outlet hole 220 . the flow - out tube 22 is sleeved with a plurality of leak - proof washers 222 . the elastic 23 and the stop pillar 24 are disposed in the tank 10 . the elastic 23 may be a spring . an end of the elastic 23 pushes against the stopper 20 , and an other end of the elastic 23 pushes against the stop pillar 24 . the stop pillar 24 has a first stop hole 240 and a second stop hole 241 . the first stop hole 240 is provided for the end of the flow - in tube 21 having the outlet holes 211 to extend therein , so that the stop pillar 24 can optionally seal the outlet holes 211 . the leak - proof washers 212 generate a better sealing effect between the first stop hole 240 and the flow - in tube 21 . the second stop hole 241 is provided for the end of the flow - out tube 22 having the inlet holes 221 to extend therein , so that the stop pillar 24 can optionally seal the inlet holes 221 . the leak - proof washers 222 generate a better sealing effect between the second stop hole 241 and the flow - out tube 22 . an end of the transmission seat 3 has a recess 30 and two positioning holes 31 . the positioning holes 31 are located at two opposite angles of the recess 30 , and each positioning hole 31 can be optionally inserted by the corresponding positioning pillar 12 , so as to connect and position the coolant supplier seat 1 and the transmission seat 3 . a side of the transmission seat 3 has a fluid outlet hole 32 and a fluid inlet hole 33 , which are respectively communicated with the recess 30 . the side of the transmission seat 3 further has a switching part 34 , in which the switching part 34 has a fluid inlet tube 340 communicated with the fluid inlet hole 33 and a fluid outlet tube 341 communicated with the fluid outlet hole 32 . the connecting device 4 has a washer 40 , two elastics 41 , two flow retaining pillars 42 , and a bearing pillar 43 . the washer 40 , the elastics 41 , the flow retaining pillars 42 , and the bearing pillar 43 are disposed in the recess 30 . the bearing pillar 43 has a first hole 430 and a second hole 431 at positions respectively corresponding to the fluid outlet hole 32 and the fluid inlet hole 33 . the bearing pillar 43 has a liquid flow - out hole 432 and a liquid flow - in hole 433 in a periphery thereof at positions corresponding to the fluid outlet hole 32 and the fluid inlet hole 33 . the liquid flow - out hole 432 is communicated with the first hole 430 , and the liquid flow - in hole 433 is communicated with the second hole 431 . the bearing pillar 43 is sleeved with a leak - proof washer 434 , so as to generate a better sealing effect between the bearing pillar 43 and the recess 30 . the two flow retaining pillars 42 are respectively disposed in the first hole 430 and the second hole 431 , and used for optionally sealing the first hole 430 , the second hole 431 , the liquid flow - out hole 432 , and the liquid flow - in hole 433 . an end of each elastic 41 pushes against the washer 40 , and an other end of the elastic 41 pushes against the corresponding flow retaining pillar 42 . the elastic 41 may be a spring . the flow retaining pillars 42 are sleeved with leak - proof washers 420 , so as to generate a better sealing effect between the flow retaining pillars 42 and the first hole 430 and the second hole 431 . the regulator assembly 5 has a flow - in quantity adjusting button 50 and a flow - out quantity adjusting button 51 . an end of the flow - in quantity adjusting button 50 is disposed in the flow - in quantity adjusting hole 17 , corresponds to the flow - in hole 15 , and has a flow guiding end 501 . an other end of the flow - in quantity adjusting button 50 has an adjusting portion 500 . the flow - in quantity adjusting button 50 is sleeved with a leak - proof washer 502 , so as to avoid leakage at the flow - in quantity adjusting hole 17 . an end of the flow - out quantity adjusting button 51 is disposed in the flow - out quantity adjusting hole 18 , corresponds to the flow - out hole 16 . an other end of the flow - out quantity adjusting button 51 has an adjusting portion 510 . the flow - out quantity adjusting button 51 is sleeved with the leak - proof washer 510 , so as to avoid leakage at the flow - out quantity adjusting hole 18 . referring to fig4 , the coolant supplier seat 1 may be connected to one coolant supplier , and the transmission seat 3 may be connected to a rack having electronic components that need heat dissipation . when the coolant supplier seat 1 is connected to the transmission seat 3 , the positioning pillar 12 is inserted into the positioning hole 31 , so that the transmission seat 3 and the coolant supplier seat 1 are well positioned and connected with each other . an end portion of the stop pillar 24 is pushed against by the bearing pillar 43 , so that the stop pillar 24 is withdrawn into the tank 10 , and compresses the elastic 23 . an end of the flow - in tube 21 having the outlet holes 211 is inserted into the first hole 430 , so that the flow retaining pillar 42 located in the first hole 430 is withdrawn into the recess 30 , and compress the elastic 41 , so that the outlet holes 211 are communicated with the fluid outlet hole 32 . similarly , the end of the flow - out tube 22 having the inlet holes 221 is inserted into the second hole 431 , so that the stop pillar 24 is withdrawn into the recess , and the inlet holes 221 are communicated with the fluid inlet hole 33 . coolant at a low temperature from the coolant supplier flows through the flow - in hole 15 , the inlet hole 210 , the flow - in tube 21 , the outlet holes 211 , the liquid flow - out hole 432 , the fluid outlet hole 32 , and the fluid outlet tube 341 , so as to reach the electronic components that need heat dissipation , so that heat exchange occurs between the coolant and the electronic components . thus , the electronic components dissipate heats and are cooled down , and then after the heat exchange , the coolant turns into coolant at a high temperature . the coolant at a high temperature flows through the fluid inlet tube 340 , the fluid inlet hole 33 , the liquid flow - in hole 433 , the inlet holes 221 , the flow - out tube 22 , the outlet hole 220 , and the flow - out hole 16 , so as to flow back to the coolant supplier , so that the coolant at a high temperature is cooled down to become coolant at a low temperature , which is used for a next heat exchange cycle . when the rack needs to be disconnected from the coolant supplier , the coolant supplier seat 1 and the transmission seat 3 are directly disconnected from each other , and then the compressed elastics 23 and 41 respectively force the stop pillar 24 and the flow retaining pillars 42 to return to the initial positions , and the stop pillar 24 seals the outlet holes 211 of the flow - in tube 21 and the inlet holes 221 of the flow - out tube 22 , and the flow retaining pillars 42 seal the first hole 430 , the second hole 431 , the liquid flow - out hole 432 , and the liquid flow - in hole 433 , thereby stopping the flowing of the coolant , and preventing leakage of the coolant when the rack is disconnected from the coolant supplier . in addition , referring to fig5 , when the coolant flows in the coolant supplier seat 1 and the transmission seat 3 , by using certain tools to combine with the adjusting portions 500 and 510 , the position of the flow guiding end 501 in the flow - in channel 13 can be adjusted , so as to further control the opening of the flow - in hole 15 , or the position of the flow - out quantity adjusting button 51 in the flow - out channel 14 can be adjusted , so as to further control the opening of the flow - out hole 16 , thereby controlling and changing the quantity of flow - out coolant and the quantity of flow - in coolant , and achieving a better effect of heat dissipation for the electronic components . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims . | 8 |
the description of the present invention is further provided as follows with reference to the specific embodiments , and features and advantages of the present invention will become more apparent from the following description . however , these embodiments are only exemplary , but not forming any limitation to the scope of the present invention . it should be understood by a person skilled in the art that modifications or alternatives to details and forms of the technical solution of the present invention without deviation from the spirit and scope of the present invention will be allowed , while those modification and alternatives should all fall within the scope of the present invention . in the invention , the term “ per pig ” refers to the amount of vaccine each pig injected . in the invention , the term “ tcid 50 ” refers to 50 % tissue culture infective dose , a way to represent viral infectivity . minimum essential medium ( mem ) liquid medium is prepared with mem dry powdered medium purchased from life technologies , corp . according to the instruction . dulbecco &# 39 ; s modified eagle &# 39 ; s medium ( dmem ) in the present invention is prepared with reference to the preparation method from appendix a of gb / t18641 - 2002 diagnostic techniques for aujeszk &# 39 ; s disease . in the present invention , the term “ pbs ” is the abbreviation for phosphate buffer saline , and 0 . 01 mm ph 7 . 4 pbs as used in the present invention is prepared as described in molecular cloning : laboratory manuals , 3 rd edition . the prv hn1201 strain ( pseudorabies virus , strain hn1201 ) used in the embodiments is deposited in the china center for type culture collection on may 20 , 2013 , of which the accession number is cctcc no . v 201311 and the address is wuhan university , wuhan , china . the prv hn1202 strain ( pseudorabies virus , strain hn1202 ) used in the embodiments is deposited in the china center for type culture collection on aug . 26 , 2013 , of which the accession number is cctcc no . v 201335 and the address is wuhan university , wuhan , china . in the following specific embodiments , the description of the present invention is further provided with examples of prv hn1201 strain , nvdc - prv - bj strain , nvdcprv - heb strain , nvdc - prv - sd strain and hn1202 strain . 1 . 1 construction of a transfer vector for recombinant prv hn1201gfp virus according to the sequence of us segment ( gi / ge / 11k / 28k ) to be deleted , the homologous arms were designed at its two ends , called usa and usb , respectively . usa and usb were cloned into puc19 vector and named pucusab . then gfp gene was cloned into pucusab , to obtain a transfer vector for recombinant virus which was called pucusa - gfp - b . the homologous arms in the transfer vector are sequences of two sides of us , therefore the recombinant virus obtained after recombination , was us segment deleted , which comprised gi / ge / 11k / 28k . fig1 is a schematic diagram showing construction of the transfer vector , and fig2 shows the location of the homologous arms , usa and usb in the genome . two pairs of primers were designed for amplifying the homologous arms at two sides of segment to be deleted according to the gene sequence of hn1201 virus : the upstream and downstream primers for the homologous arm usa at the left side are , respectively : the upstream and downstream primers for the homologous arm usb at the right side are , respectively : vero cells were transfected with prv hn1201 , and part of supernatant was harvested when the cytopathic effect of cells reached to 80 %, for extracting genomic dna of virus by using geneaid viral nucleic acid extraction kit as the template for amplification of the homologous arms . usa and usb were amplified through pcr method by using takara primestar , of which the system and condition is as follows : usa and usb fragments amplified by pcr were separated by electrophoresis on agarose gel , and the target fragments were recovered with tiangen gel recovery kit . usa fragment and puc19 vector was digested by both of ecor i and xbai , and the target fragments were recovered , connected by t4 dna ligase , and the product was transformed into dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified using enzyme digestion , and the correct plasmid after identification was named pucusa . pucusa and usb was digested by both of sali and hindiii , and the target fragments were recovered , linked by t4 dna ligase , and the product was transformed into dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion , and the correct plasmid after identification was named pucusab . the pacgfp - c1 plasmid ( purchased from clontech , catalog no . 632470 ) was digested by bgl ii and sma i , and the linearized vector was recovered , linked by t4 dna ligase after filling - in with dna polymerase i large ( klenow ) fragment , and transformed into the competent cell dh5α to obtain mcs deleted gfp plasmid , named pacgfpδmcs . the primers for amplifying gfp were designed according to the sequence of pacgfp - c 1 vector . gfp gene was amplified with pacgfpδmcs plasmid as the template , of which the system and condition is as follows : a target band was recovered by electrophoresis on agarose gel for further linking . gfp was digested with both of sal and sph i , and the target fragments were recovered , linked to pucusb plasmid which had been through the same double enzyme digestion , and the product was transformed into the competent cell dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion , and the correct plasmid after identification was named pucusa - gfp - b . 1 . 2 . 1 acquisition of recombinant virus through co - transfection of vero cells with the transfer vector and hn1201 dna co - transfection of vero cells was conducted by using lipofectin technique , wherein 3 μg prv - hn1201 viral genomic dna and 5 μg the transfer vector pucusa - gfp - b was transfected , in accordance with procedures of lipofectamine 2000 protocol ( invitrogen , catalog no . 11668030 ). cells were incubated at 37 ° c . in an incubator containing 5 % co 2 . the supernatant of cell culture , i . e . p0 recombinant virus , named rprv - gfp - us −, was collected 36 - 48 h after transfection , or until the cytopathic effect was visible and infected cells exhibited fluorescence . when infected with the obtained p0 recombinant virus rprv - gfp - us −, vero cells infected were covered with 2 % agarose with low melting point . after 48 h when the cytopathic effect became apparent and infected cells exhibited obvious fluorescence , a plaque with a green fluorescence was picked and freeze - thawed 3 times in − 70 ° c ., inoculated at 10 - fold serial dilutions into vero cells previously laid in six - well plates . such plaque with a green fluorescence was continued to be picked for purification . after 8 rounds of plaques purification , a purified recombinant virus rprv - gfp - us − which was free of wild - type virus hn1201 and with deletion of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) was obtained . 1 . 3 deletion of gfp label gene in the gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment - deleted recombinant virus pbs185 plasmid expressing cre enzyme ( purchased from addgene , cre enzyme recognizes loxp sites at downstream of usa and upstream of usb , wherein usa and usb are homology arms , and deletes sequence between two loxp sites ) and genomic dna of recombinant virus rprv - gfp - us − was co - transfected into vero cells , with the results showing relatively obvious cytopathic effect and more single fluorescence 24 h after transfection . after serial dilution , p0 virus harvested was inoculated for plaque screening ; fluorescence - negative plaque was picked for the next round of purification . after 2 rounds of screening and purification , a fluorescence - negative virus was obtained , and named vprv - us −. pcr identification result after extraction and purification of viral genomic dna , showed deletion of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment , and indicated that gfp label gene had been deleted . the result showed a successful purification of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment - deleted virus containing no gfp label gene . the viral genome of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment - deleted virus and wild - type virus , was extracted and identified by pcr , with the following primers : the size of pcr amplification product of the wild - type virus was 6286 bp , the size of pcr amplification fragment of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment - deleted virus was 1960 bp . pcr assay result confirmed that orf of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment had been completely missing . 2 . 1 construction of a transfer vector for recombinant prv hn1201gfp virus according to the sequence of tk gene to be deleted , the homologous arms at its two ends were designed , called tka and tkb , respectively . tka and tkb were cloned into puc19 vector and named puctkab . then gfp gene was cloned into puctkab , to obtain a transfer vector for recombinant virus which was called puctka - gfp - b . the homologous arms in the transfer vector are sequences of two sides of tk , therefore the recombinant virus obtained after recombination , was tk gene deleted . fig4 shows the location of homologous arms , tka and tkb in the genome . two pairs of primers were designed for amplifying the homologous arms at two sides of tk gene according to the gene sequence of hn1201 virus : the upstream and downstream primers for the homologous arm tka at the left side are , respectively : tkaf : ccg gaattc gtagtgccggttgcccacgtaca ( the underline portion refers to the ecor i cutting site ) tkar : ctag tctaga ataacttcgtatagtacacattatacgaagttat cgctcaggctgccgttctgc ( the underline portion refers to the xba i cutting site , lowercase letters refer to the loxp site ) the upstream and downstream primers for the homologous arm tkb at the right side are , respectively : vero cells were transfected with prv hn1201 , and part of supernatant was harvested when the cytopathic effect of cells reached to 80 %, for extracting genomic dna of virus by using geneaid viral nucleic acid extraction kit as the template for amplification of the homologous arms . tka and tkb were amplified through pcr method by using takara primestar , of which the system and condition is as follows : tka and tkb fragments amplified by pcr were separated by electrophoresis on agarose gel , and the target fragments were recovered with tiangen gel recovery kit . tka fragment and puc19 vector was digested with both of ecor i and xbai , and the target fragments were recovered , linked by t4 dna ligase , and the product transformed into dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified after enzyme digestion , and the correct plasmid after identification was named puctka . puctka and tkb was digested with both of sali and hindiii , and the target fragments were recovered , linked by t4 dna ligase , and the product transformed into dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion , and the correct plasmid after identification was named puctkab . the pacgfp - c1 plasmid ( purchased from clontech , catalog no . 632470 ) was digested with bgl ii and sma i , and the linearized vector was recovered , linked by t4 dna ligase after filling - in with dna polymerase i large ( klenow ) fragment , and the product was transformed into the competent cell dh5α to obtain mcs deleted gfp plasmid , named pacgfpδmcs . the primers for amplifying gfp were designed according to the sequence of pacgfp - c 1 vector . gfp gene was amplified with the template of pacgfpδmcs plasmid , of which the system and condition is as follows : a target band was recovered by electrophoresis on agarose gel for further linking . gfp was digested with both of sal and sph i , and the target fragments were recovered , linked to puctkab plasmid which had been through the same double enzyme digestion , and the linked product was transformed into the competent cell dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion , and the correct plasmid after identification was named puctka - gfp - b . 2 . 2 . 1 acquisition of recombinant virus through co - transfection of vero cells with the transfer vector and vprv - gi - ge - 11k - 28k − dna co - transfection of vero cells was conducted by using lipofectin technique , wherein 3 μg vprv - gi - ge - 11k - 28k − viral genomic dna and 5 μg the transfer vector puctka - gfp - b was transfected , in accordance with procedures of lipofectamine 2000 protocol ( invitrogen , catalog no . 11668030 ). cells were incubated at 37 ° c . in an incubator containing 5 % co 2 . the supernatant of cell culture , i . e . p0 recombinant virus , named rprv - gfp - gi - ge - 11k - 28k - tk −, was collected 36 - 48 h after transfection , or until the cytopathic effect was visible and infected cells exhibited fluorescence . when infected with the obtained p0 recombinant virus rprv - gfp - gi - ge - 11k - 28k - tk −, vero cells infected were covered with 2 % agarose with low melting point . after 48 h when the cytopathic effect became apparent and infected cells exhibited obvious fluorescence , a plaque with a green fluorescence was picked and freeze - thawed 3 times in − 70 ° c ., inoculated at 10 - fold serial dilutions into vero cells previously laid in six - well plates . such plaque with a green fluorescence was continued to be picked for purification . after 11 rounds of plaques purification , a purified recombinant virus rprv - gfp - gi - ge - 11k - 28k - tk − which was free of prv - gi - ge - 11k - 28k - tk − and with deletion of five genes was obtained . 2 . 3 deletion of gfp label gene in gi / ge / 11k / 28k / tk deleted recombinant virus the pbs185 plasmid expressing cre enzyme ( purchased from addgene , cre enzyme recognizes mutated loxp sites at downstream of tka and upstream of tkb , wherein tka and tkb are homology arms , and deletes sequence between two loxp sites ) and genomic dna of recombinant virus rprv - gfp - gi - ge - 11k - 28k - tk − was co - transfected into vero cells , with the results showing relatively obvious cytopathic effect and more single fluorescence 24 h after transfection . after serial dilution , p0 virus harvested was inoculated for plaque screening ; fluorescence - negative plaque was picked for the next round of purification . after 2 rounds of screening and purification , a fluorescence - negative virus was obtained , and named prv - gi - ge - 11k - 28k - tk −. pcr identification result after extraction and purification of viral genomic dna , showed deletion of tk gene , and also indicated that gfp label gene had been deleted . the result showed a successful purification of gi - ge - 11k - 28k - tk − deleted virus containing no gfp label gene . the primers used for identifying deletion of gi / ge / 11k / 28k were the same as above . the viral genome of gi / ge / 11k / 28k / tk − deleted virus and wild - type virus , was extracted and identified by pcr , with the following primers : the size of pcr amplification product of the wild - type virus was 1566 bp , the size of pcr amplification fragment of tk deleted virus was 742 bp ( refer to fig5 ). prv hn1201 strain with deletion of gi / ge was prepared by reference to the method in example 1 of cn103756977a . 25 7 - day - old piglets which were negative for pseudorabies antibodies and pseudorabies antigen were randomly divided into 5 groups ( a , b , c , d and blank control group ), each with 5 piglets . grouping conditions and challenge conditions are shown in table 1 . after inoculation of virus , the temperature of piglets was determined daily , and clinical signs and death status were observed . the results are shown in table 2 . it showed in the results that inoculation with prv hn1201 strain in 7 - day - old piglets could lead to 100 % death ( 5 / 5 ) of inoculated piglets , while the virulence of prv hn1201 strain with deletion of gi / ge / 11k / 28k was significantly decreased , which could only make the temperature of 2 piglets increased , without any clinical signs . inoculation with prv hn1201 strain with deletion of gi / ge in 7 - day - old piglets could still lead to common clinical signs such as increased body temperature and depression etc ., indicating remaining virulence ; while prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk gene had completely lost its virulence . the virus seed of prv hn1201 strain with deletion of gi / ge / 11k / 28k prepared in example 1 , prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk prepared in example 2 and prv hn1201 strain with deletion of gi / ge prepared in example 3 was diluted at 5 × 10 4 fold , and then inoculated into a monolayer of st cell . after 1 h adhesion , 1000 ml of dmem medium containing 2 % fetal calf serum was added into st cell , which was then placed at 37 ° c . in a roller bottle with a rotation speed of 6 rph . the cell medium containing viruses was harvested when the cytopathic effect of cells reached to 80 %; the viruses were harvested after 2 times of freezing - thawing the medium and the virus titer was assessed . the virus solution was preserved at low temperature . 40 g of sucrose and 8 g of gelatin was added into every 100 ml of deionized water , and the solution was autoclaved ( under 121 ° c . for 30 min ) after fully melted . the virus solution prepared and preserved in example 5 . 1 was mixed with the protective agent prepared and preserved in example 5 . 2 at a volume ratio of 1 : 1 , distributed into sterilized bottles , each of which containing 2 . 6 ml and the mixed virus solution was freeze - dried . the vaccine was tested and determined to be free of contamination of bacterium and exogenous viruses and the content of virus was consistent with that before freeze - drying . the batch number of prv hn1201 strain with deletion of gi / ge / 11k / 28k prepared in example 1 , prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk prepared in example 2 and prv hn1201 strain with deletion of gi / ge prepared in example 3 were 20140501 , 20140502 and 20140503 , respectively . 12 9 - day - old piglets which were negative for prv antibodies and prv antigens were randomly divided into 5 groups , each with 5 piglets , and the piglets were injected with the vaccines prepared in example 5 according to table 3 . the vaccine control group was inoculated with the live prv vaccine , bartha k - 61 strain purchased from hipra , spain , batch no . 42rh , at the dosage from the protocol . the blank control group was inoculated with 1 ml / piglet of dmem medium . the piglets were challenged with 1 × 10 7 . 0 tcid 50 / piglet of prv hn1201 strain on day 28 after immunization . after challenge , the body temperature of piglets was determined daily , and in the meanwhile clinical signs and death status were observed ( the results are shown in table 3 ), the blood of piglets in all the experimental groups and control groups was collected respectively before challenge . the piglets were challenged with 1 × 10 7 . 0 tcid 50 / piglet ( 1 ml piglet ) of prv hn1201 strain on day 28 after immunization . after challenge , the body temperature of piglets was determined daily , and in the meanwhile clinical signs and death status were observed ( the results are shown in table 5 ). the result from table 5 indicated that immunizing piglets with the gene - deleted prv vaccines prepared in example 5 can blocked virus infection ( i . e . displaying clinical signs ), and provide 100 % ( 5 / 5 ) protection rate for piglets , while all the piglets in the blank control group died by day 5 after challenge , therefore the prv vaccines in three experimental groups can provide excellent protection , showing excellent immune protection and safety ; meanwhile it indicated that either deletion of gi / ge / 11k / 28k or deletion of gi / ge / 11k / 28k / tk for prv strain would not affect the immunogenicity . for the vaccine group with only deletion of gi / ge , the clinical signs such as increased body temperature could not be avoided , while the vaccine still possessed good immunogenicity . whereas the commercial vaccines in the prior art cannot provide a full protection to pigs . construction of gene - deleted variant strains of nvdc - prv - bj strain , nvdcprv - heb strain and nvdc - prv - sd strain , hn1202 prv variant strain gi / ge / 11k / 28k genes and gi / ge / 11k / 28k / tk genes were deleted from the parent strains , nvdc - prv - bj strain , nvdc - prv - heb strain and nvdc - prv - sd strain ( xiuling yu , zhi zhou , dongmei hu , et al . pathogenic pseudorabies virus , china , 2012 emerging infectious diseases , www . cdc . gov / eid ol . 20 , no . 1 , january 2014 ) ( the applicant promises to open it to public for 20 year from the patent application date according to provisions of guidelines for patent examination ), hn1202 strain ( deposited in the china center for type culture collection on aug . 26 , 2013 , of which the accession number is cctcc no . v 201335 and the address is wuhan university , wuhan , china ), according to methods in example 1 and 2 . the names of the attenuated strains obtained were nvdc - prv - bj with deletion of gi / ge / 11k / 28k / tk , nvdcprv - heb with deletion of gi / ge / 11k / 28k / tk , nvdc - prv - sd with deletion of gi / ge / 11k / 28k / tk , and prvhn1202 with deletion of gi / ge / 11k / 28k / tk . the deletion of genes was verified through comparison of pcr results with that of parent strains respectively . preparation of vaccine compositions of the attenuated variant strains of nvdc - prv - bj strain , nvdc - prv - heb strain and nvdc - prv - sd strain , hn1202 prv strain each attenuated vaccine strains prepared in example 7 was proliferated according to the method from example 5 . 1 , mixed with the protective agent ( prepared by adding 40 g of sucrose and 8 g of gelatin into every 100 ml of deionized water , and autoclaved ( under 121 ° c . for 30 min ) after fully melted ) at a volume ratio of 1 : 1 and the mixed vaccine compositions were freeze - dried . the batch numbers of nvdc - prv - bj strain with deletion of gi / ge / 11k / 28k / tk , nvdcprv - heb strain with deletion of gi / ge / 11k / 28k / tk , nvdc - prv - sd strain with deletion of gi / ge / 11k / 28k / tk and prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk were q01 , q02 , q03 and q04 , respectively . pathogenicity test was conducted according to the method in example 4 , in which the piglets were randomly divided into 5 groups , each with 5 piglets , inoculated with 1 ml ( 10 7 . 0 tcid 50 / ml ) of nvdc - prv - bj strain with deletion of gi / ge / 11k / 28k / tk , nvdc - prv - heb strain with deletion of gi / ge / 11k / 28k / tk , nvdc - prv - sd strain with deletion of gi / ge / 11k / 28k / tk , and prv hn1202 strain with deletion of gi / ge / 11k / 28k / tk by intranasal instillation , respectively . the results showed that all the piglets were alive in each group , with normal body temperature and no clinical signs . it proved that the virulence of mutated prv strain was reduced through deletion of gi / ge / 11k / 28k / tk genes . immunogenicity assay of the vaccines prepared in example 8 was conducted according to the method and dose in example 6 , in the meanwhile the piglets in the vaccine control group were inoculated with the live prv vaccine , hb - 98 strain batch no . 1308011 - 1 ( purchased from china animal husbandry industry co ., ltd . chengdu medical equipments factory ). the piglets were challenged with 1 × 10 7 . 0 tcid 50 / piglet of prv hn1201 strain on day 28 after immunization . after challenge , the body temperature of piglets was determined daily , and in the meanwhile clinical signs and death status were observed ( the results are shown in table 6 ). the result from table 6 indicated that immunizing piglets with the prv vaccines prepared in example 8 can block virus infection ( i . e . displaying clinical signs ), and provide 100 % ( 5 / 5 ) protection rate for piglets , while the vaccine control group can only provide 80 % ( 4 / 5 ) protection rate for piglets , and all the piglets in the blank control group died by day 5 after challenge , therefore the prv vaccines of the present invention can provide excellent protection . in addition , the piglets exhibited substantially no clinical signs , indicating excellent immune protection of the prv vaccines relative to live vaccines in the prior art . 15 piglets at the age of around 13 days which were negative for prv antigens and prv antibodies were randomly divided into 5 groups , each with 5 piglets . groups 1 - 3 were injected with the vaccine prepared in example 5 , which is prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk , with batch no . 20140502 , the live prv vaccine bartha k - 61 strain , with batch no . 66kr , purchased from hipra , spain , and the live prv vaccine , k - 61 , with batch no . 195 - b59b purchased from boehringer ingelheim ( us ) respectively . all the dose for immunization is 1 ml / piglet ( for commercial vaccine , 1 piglet dosage / piglet , according to protocols ; the prv hn1201 with deletion of gi / ge / 11k / 28k / tk vaccine , 10 6 . 0 tcid 50 / piglet ). the blank control group was inoculated with 1 ml / piglet of dmem medium . the blood of piglets was collected on day 8 , 10 , 12 , 14 and 21 after immunization , and gb antibody was determined according to the protocol of gb elisa antibody detection kit ( purchased from biochek , batch no . fs5763 , expiry date : jan . 7 , 2015 ) after the serum was separated . the detailed results of detection are shown in table 7 below . in conclusion , the antibody test results showed that , all gb antibodies turned positive on day 12 after immunization with prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk , while not all the gb antibodies had turned positive on day 21 after immunization with the two control vaccine . it showed that prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk could provide earlier immune protection . monitoring of ge antibodies after immunization with four genes deleted strain vaccine and challenge . 15 piglets at the age of around 13 days which were negative for prv antigens and prv antibodies were randomly divided into 3 groups , each with 5 piglets . groups 1 - 3 were injected with the vaccine prepared in example 5 , which is prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk , with batch no . 20140502 , the live prv vaccine , bartha k - 61 strain , with batch no . 66kr , purchased from hipra , spain , and the live prv vaccine , k - 61 , with batch no . 195 - b59b purchased from boehringer ingelheim ( us ). all the dose for immunization is 1 ml / piglet ( for commercial vaccine , 1 piglet dosage / piglet , according to protocols ; the prv hn1201 with deletion of gi / ge / 11k / 28k / tk vaccine , 10 6 . 0 tcid 50 / piglet ). the piglets were challenged with 10 7 . 0 tcid 50 / piglet , 1 ml / piglet of prv hn1201 strain on day 21 after immunization . the blood of piglets was collected daily continuously from day 7 to day 14 after challenge , and ge antibody was determined according to the protocol of ge elisa antibody detection kit ( purchased from idexx co ., batch no . ak650 , expiry date : jun . 13 , 2015 ) after the serum was separated . the results showed that ge antibody was still negative ( if the value of s / n is less or equal to 0 . 60 , the sample should be determined as prv ge antibody positive ) on day 14 after challenge when the piglets were immunized with the vaccine prepared in example 5 , prv hn1201 with deletion of gi / ge / 11k / 28k / tk with batch no . 20140502 , while ge antibody became positive at different level when the piglets were immunized with the two commercial vaccines . the detailed results of deletion are shown in table 8 below . the above results indicated that the vaccine strains in the present invention has a better immunogenicity than commercial vaccine in the prior art , and after immunization therewith a faster generation of the antibody can be achieved , and the effective amplification of virus in the body of pigs can be blocked , and ge antibody is negative . those are only preferred embodiments of the present invention as described above , which cannot be used to limit the present invention . any change , substitution or modification etc ., which are within the spirit and principle of the invention , should be included within the scope of protection of the present invention . | 0 |
fig2 illustrates a cross - sectional side elevation view of one embodiment of the present spar platform 200 . although the present embodiments are described herein with reference to a truss spar platform , those of ordinary skill in the art will appreciate that the present embodiments encompass any floating production and / or drilling platform or vessel having an open centerwell configuration . as shown in fig2 , the spar platform 200 includes a hull 202 having a centerwell 204 . the centerwell 204 has an upper end that is open to the atmosphere , and a lower end that is open to the sea . a plurality of airtight and watertight barriers 206 , 208 , 210 extend substantially horizontally across the centerwell 204 . in a specific embodiment , one or more of the barriers 206 , 208 , 210 may be in the form of a non - airtight / watertight deck . for simplicity , in the description below the barriers 206 , 208 , 210 will be referred to as decks , even though in certain embodiments one or more of these barriers 206 , 208 , 210 may not be airtight or watertight . the first and second decks 206 , 208 define a first airtight and watertight fixed buoyancy chamber 216 between them . the second and third decks 208 , 210 define a second airtight and watertight fixed buoyancy chamber 218 between them . one or more support or guide frames 214 may be provided across the centerwell 204 below the third deck 210 . in the illustrated embodiment , two support or guide frames 214 are provided , with the lowermost frame 214 being located near the lower end of the centerwell 204 , as shown in fig2 and 4 . those of ordinary skill in the art will appreciate that fewer or more support or guide frames 214 may be provided . the function of the support or guide frames 214 is discussed in detail below . a plurality of sleeves 224 extend in a substantially vertical ( axial ) direction through the centerwell 204 , from the uppermost deck 206 to the bottom of the centerwell 204 . in the illustrated embodiment , five sleeves 224 are shown , but it will be appreciated that fewer or more sleeves 224 could be provided . one of the sleeves 224 , preferably near the center of the centerwell 204 , may be a moon pool sleeve 224 a ( see fig3 and 4 ), and it may be larger in diameter than the other sleeves 224 so as to provide a moon pool 225 that extends downwardly from the uppermost deck 206 to the lower end of the centerwell 204 . the sleeves 224 , 224 a are supported by the support or guide frames 214 as the sleeves extend through the centerwell 204 below the decks 206 , 208 , 210 . the sleeves 224 are advantageously dimensioned to receive and accommodate risers 227 , which may be top - tensioned risers ( ttrs ), bottom - tensioned risers ( btrs ), or steel catenary risers ( scrs ), either with or without riser casings ( not shown ). the ttrs may be supported by a top - tensioned riser support frame 229 with associated conventional riser tensioners ( not shown ), as is well - known in the art . other containment tubes and / or pull tubes ( not shown ), such as those for catenary risers , umbilicals , moon pools and / or caissons , may also be provided in the centerwell 204 . the hull 202 includes a plurality of buoyancy tanks or hard tanks 226 surrounding the centerwell 204 . the buoyancy tanks 226 may be selectively and controllable filled with air or water , by conventional means , to provide varying degrees of buoyancy to the platform 200 . the buoyancy tanks 226 extend down to a truss structure 230 , which extends down to a ballasted keel 232 . the ballasted keel 232 at the bottom of the truss structure 230 lowers the center of gravity of the platform 200 and improves the stability of the platform 200 . one or more mooring lines ( not shown ) may be used to keep the platform 200 over its station . those of ordinary skill in the art will appreciate that certain embodiments of the present spar platform may not include a truss structure or a ballasted keel . as described above , the decks 206 , 208 , 210 are airtight and watertight . accordingly , the intersections of the sleeves 224 , 224 a with the decks 206 , 208 , 210 are similarly airtight and watertight . for example , the sleeves 224 , 224 a may be welded to the decks 206 , 208 , 210 in an airtight and watertight fashion . those of ordinary skill in the art will appreciate that as used herein the term “ sleeve ” encompasses both continuous and segmented structures . thus , each sleeve 224 , 224 a may comprise a single unitary length of material extending from the uppermost deck 206 to the lowermost support or guide frame 214 , or each sleeve 224 , 224 a may be constructed of a plurality of shorter segments that may be connected together and / or connected to the decks 206 , 208 , 210 and guide frames 214 . in embodiments where the sleeve ( s ) 224 , 224 a are constructed of a plurality of shorter segments , openings in the deck ( s ) 206 , 208 , 210 may be considered to be part of the sleeves . in certain embodiments , the airtight and watertight buoyancy chambers 216 , 218 are filled with air , thus adding buoyancy to the spar platform 200 . because the sleeves 224 , 224 a passing through the fixed buoyancy chambers 216 , 218 are likewise airtight and watertight , as are the junctures between the sleeves 224 , 224 a and the decks 206 , 208 , 210 , any water in the sleeves 224 will not seep into the fixed buoyancy chambers 216 , 218 and interfere with their buoyancy contribution to the spar platform 200 . furthermore , the sleeves 224 have open upper ends in the uppermost deck 206 , so that any water accumulating on the uppermost deck 206 is drained through the sleeves 224 and into the sea . a variable buoyancy compartment 220 , defined below the lowermost deck 210 , has an open bottom coinciding with the open bottom of the centerwell 204 . because this variable buoyancy compartment 220 , also referred to as a compressed air over water chamber , is open to the sea , seawater 222 may move in and out of the compartment 220 naturally . the amount of air and water in the variable buoyancy compartment 220 may be adjusted by adding air from a source of compressed air ( not shown ) or by bleeding air from the compartment 220 to the sea or to the atmosphere . the provision of compressed air and the bleeding of air may be performed by conventional mechanisms that are well - known in the art , and therefore need not be described in this specification . by controllably changing the ratio of air to water within the compartment 220 , the buoyancy contribution of the variable buoyancy compartment 220 to the platform 200 may be controllably adjusted . because the sleeves 224 passing through the variable buoyancy compartment 220 are airtight and watertight , any air and / or water in the sleeves 224 will not seep into the variable buoyancy open bottom compartment 220 and interfere with its buoyancy contribution to the spar platform 200 . in certain embodiments the sleeves 224 are open at both ends . the sleeves 224 are thus at least partially filled with seawater that enters through the lower end of each sleeve 224 . as mentioned above , the sleeves 224 also advantageously act as drains for the uppermost deck 206 . water or other liquids collecting on the deck 206 may drain through the open upper ends of the sleeves 224 and drain down through the sleeves 224 to the level of seawater contained in each sleeve 224 . the drainage advantageously prevents excessive accumulation of liquids on the deck 206 , which could increase the weight at the upper end of the platform 200 and possibly upset the balance of the platform 200 , or cause sloshing or other detrimental effects . the embodiments described above advantageously provide watertight compartments 216 , 218 in the centerwell 204 that increase the buoyancy of the spar platform 200 . sealing off the lower part of the centerwell 204 by at least one watertight and airtight transverse barrier or deck also advantageously helps to reduce the diameter and size of the spar platform 200 , thereby generating weight savings . the reduction in weight and volume also enhances the ability for the spar platform 200 to be built and transported in one piece using existing heavy lift vessels . the embodiments described above also advantageously provide the variable buoyancy or compressed air over water compartment 220 . the adjustable buoyancy of the variable buoyancy compartment 220 provides a simple and effective means for adjusting the buoyancy of the spar platform 200 as conditions aboard the platform 200 change . for example , as risers and / or topside equipment is added or removed over the life of the platform 200 , the buoyancy of the variable buoyancy compartment 220 may be adjusted to maintain the balance of the platform 200 . the compressed air buoyancy system is also advantageously simpler than a water ballast system using marine ballast pumps . although the illustrated embodiment includes three airtight and watertight decks 206 , 208 , 210 and two airtight and watertight compartments 216 , 218 in the centerwell 204 , those of ordinary skill in the art will appreciate that the present embodiments encompass a centerwell having any number of airtight and watertight decks and compartments . specifically , the advantages of the present spar platform , as described above , may be realized by employing only a single airtight and watertight transverse barrier or deck ( e . g . the deck 206 shown in the drawings ). in such an embodiment , the single barrier divides the centerwell into an upper portion that is open to the atmosphere , and a lower portion , open to the sea , that provides the variable buoyancy compartment 220 , and there are no buoyancy chambers defined between two or more decks . similarly , if only two airtight and watertight barriers or decks are provided , there will be a single buoyancy chamber defined between them . in another embodiment , three or more such barriers or decks may be provided , with a buoyancy chamber defined between each adjacent pair of barriers or decks . in an alternative embodiment of the present spar platform a lower end of the centerwell may be sealed by an airtight and watertight barrier . the airtight and watertight barrier may be substantially identical to the decks 206 , 208 , 210 described above and illustrated in fig2 and 3 . in this embodiment seawater may not flow in and out of the centerwell naturally as in the embodiment of fig2 - 4 . however , in certain embodiments having a closed lower end seawater may be added to and / or removed from the centerwell to adjust the buoyancy of the platform . the seawater may be added and / or removed using , for example , pumps ( not shown ). as in the embodiment of fig2 , airtight and watertight sleeves may extend through the centerwell , and in certain embodiments the sleeves may extend from the uppermost barrier or deck to the lowermost barrier or deck . the above description presents the best mode contemplated for carrying out the present invention , and of the manner and process of making and using it , in such full , clear , concise , and exact terms as to enable any person skilled in the art to which it pertains to make and use this spar platform . the present invention is , however , susceptible to modifications and alternate constructions , in addition to those discussed above , that are fully equivalent . consequently , the present invention is not limited to the particular embodiments disclosed herein . on the contrary , the present invention encompasses all modifications and alternate constructions coming within the spirit and scope of the invention , as generally expressed by the following claims , which particularly point out and distinctly claim the subject matter of the invention . | 1 |
the first embodiment of the invention relates to the formation of an improved metal contact to a doped thin polysilicon layer , such as used on the p - channel thin film transistor ( tft ) of a sram cell . part of the contact structure is formed at the same time as the p - channel thin film transistors ( tft ) is formed on the sram cell . however , it should be well understood by those skilled in the art that the method can be equally applied to other semiconductor integrated circuits requiring good low resistance contact to thin polysilicon films . it should also be noted that although the process relates to making a contact to a tft , that to simplify the drawings only the contact portion of the substrate is shown in the figs . however , to fully understand the meaning of the various layer present in the contact structure , reference will be made from time to time to the method of using the various layers in the thin film transistor structure that also are present in the figs . it should also be noted that the tft and the contacts are usually formed on the sram chip after first forming the array of n - channel fet and the word and bit lines from an earlier use of a first and second polysilicon layer . to better understand the invention for making the reduced area metal contact to a thin polysilicon layer , a brief description is given of the fabrication of the initial sram device process . however , since these structures are not critical to understanding the invention , they are also not depicted in any of the drawing . the process for making a sram circuit starts by providing a semiconductor substrate , such as on a p - doped single crystal silicon substrate . device areas are formed and electrically isolated by forming a field oxide . typically , the electrically isolated device areas are formed by selectively oxidizing the regions around the device areas , for example , by using a conventional local oxidation of silicon ( locos ) process . the n - channel fets , usually referred to as pass transistors , are formed by growing a gate oxide on the device areas and then using a patterned first polysilicon layer to form the field effect transistor gate electrodes and the word lines . the source and drain areas are formed adjacent to the gate electrodes usually by ion implantation . a first insulating layer is deposited to electrically insulate the n - fets and word lines from the next level of patterned second polysilicon layer , which is used to form the bit lines that contact some of the source / drain areas on the n - channel fet . however , it should be noted that when the second polysilicon layer is patterned , a portion of the second polysilicon is used in the sram cell areas as a buffer layer whereon the metal contact , of this invention , are made to the thin polysilicon layer of the tft . this buffer layer 14 , shown in fig4 b in cross section , and labeled 14 in the top view of fig3 is formed at the same time and from the same patterned second polysilicon layer 14 shown in fig4 a that forms the bit line 14 for the fet . the completed contact in fig6 is through region 6 -- 6 &# 39 ; in fig3 . referring now to fig4 b , a partially completed contact structure is shown on a portion of the substrate 10 . shown is the first insulating layer 12 , which is typically deposited by low pressure chemical vapor deposition ( cvd ) in a reactor , for example , by the dissociation of a tetraethosiloxane ( teos ) at a temperature of between about 700 ° to 850 ° c . the preferred thickness of layer 12 is between about 700 to 3500 angstroms . the buffer layer 14 , on which the metal contact will be formed , is patterned from the second polysilicon layer 14 , as shown in fig4 b and is also indicated in the elevational view of fig3 . the preferred thickness of the buffer layer 14 is between about 1500 to 3000 angstroms . the second insulating layer 16 , over the buffer layer 14 is also shown in fig4 b . the insulating layer 16 is usually a cvd silicon oxide and deposited by cvd , for example , by using reactant gas mixture containing silane ( sih 4 ) or teos and the preferred thickness of insulating layer 16 is between about 700 to 3000 angstroms . a third polysilicon layer is deposited and patterned to form the gate electrode of the tft , but is not shown in the figs because the layer is not directly used in making the metal contact . however , the third polysilicon layer is important for forming an n + dopant gate electrodes for the p - channel thin film transistor ( tft ). a third insulating layer 18 is then deposited to form a relatively thin gate oxide on the tft gate electrode . this gate oxide layer , however , extends over the buffer layer 14 , and is shown in fig4 b . typically the gate oxide 18 is formed by a high temperature ( 800 ° c .) low pressure chemical vapor deposition ( lpcvd ) using a gas mixture of dichlorosilane ( sicl 2 h 2 ) and nitrous oxide ( n 2 o ), and the preferred thickness of layer 18 is between about 50 to 500 angstroms . now important to the invention , a first contact opening 3 is anisotropically and selectively plasma etched in the third and second insulating layer 18 and 16 to the n + polysilicon buffer layer 14 . for example , the opening can be in a reactive ion etcher using a etch gas mixture containing carbon tetrafluoride ( cf 4 ) and hydrogen ( h 2 ). alternatively , a trifluoromethane ( chf 3 ) gas can also be used . however , the etch stop is not critical to the invention , since the buffer layer 14 is relatively thick . still referring to fig4 b , a blanket thin fourth polysilicon layer 20 is deposited to form the channel layer for the thin film transistor ( tft ). typically , layer 20 is deposited at a low temperature to form a thin amorphous silicon layer , but for the purpose of this invention is simply referred to as a thin polysilicon layer . this thin polysilicon layer 20 also extends over the second insulating layer 16 and in the first contact opening 3 , and makes contact to buffer layer 14 in the opening . the preferred thickness of layer 20 is between about 50 to 700 angstroms and is usually lightly doped n - type ( e . g . 1 . 0 e 16 to 1 . 0 e 18 atoms / cm 3 ) for the channel region over the tft gate electrode regions ( not shown in the figs ). the fourth polysilicon layer 20 is then doped selectively by forming a photoresist implant mask and ion implanting with a p type dopant , such as boron 11 ( b 11 ) isotopes . the implant mask prevents implantation of b 11 in the channel regions of the tft , but forms a p + electrically conductive layer 20 elsewhere on the substrate , and in particular over and in the first contact opening 3 , as shown in fig4 b . typically , the p + / n + junction formed between layers 20 and 14 forms a poor ( non - ohmic ) electrical contact , as described and used in the prior art and shown in fig2 . as will become apparent soon , this invention eliminates the p + / n + junction problem while reducing the metal contact area on the integrated circuit . the fourth polysilicon layer 20 is patterned using conventional photolithographic techniques and plasma etching to define the channel width over the tft gate electrode ( not shown ) and to form the tft source / drain areas ( also not shown ) and to form the p + conducting stripe that connect the source of the tft to the metal contact area over the first opening 3 , as shown in fig4 b . the portion of layer 20 that connects to the tft source is designated 20 &# 39 ; on the left of the contact opening 3 to indicate the direction of the conducting stripe that connects to the source area of the tft that is out of view in fig4 . referring next to fig5 a fourth insulating layer 22 is deposited over the patterned fourth polysilicon layer and elsewhere on the substrate surface . the layer 22 is preferably composed of a borophoshosilicate glass ( bpsg ), and is deposited , for example , by chemical vapor deposition ( cvd ) using a reactant gas mixture , such as , silane ( sih 4 ) and oxygen ( o 2 ) or silane nitrous oxide ( n 2 o ) while adding dopant gases , such as phosphine ( ph 3 ) and a diborane ( 6 ) ( b 2 h 6 ). the preferred thickness of layer 22 is between about 8000 to 13000 angstroms . the bpsg has a low flow temperature and can be annealed to provide a leveling effect that forms a more planar surface of the insulating layer 22 . this generally improve the photoresist image and provides a better process etch step that is now performed . however , this annealing step is not essential to the success of the invention . now an important feature of the invention is the formation of a second contact opening 5 in the bpsg layer that is aligned to and over the first contact opening 3 , as shown in fig5 and in the elevational view of fig3 . the second contact opening 5 is smaller in size ( width ) than the first contact opening 3 and is anisotropically etched to the surface of the of the buffer layer 14 , as shown in fig5 . the etching is preferably done in a reactive ion etcher ( rie ) or in a high plasma density etcher . the etch gas having a good etch selectivity of silicon oxide to silicon is preferred . for example , a gas mixture containing carbon tetrafluoride ( cf 4 ) and hydrogen ( h 2 ) or alternatively , a trifluoromethane ( chf 3 ) gas can also be used . however , the etch step is not very critical because of the buffer layer 14 which provides a barrier to over - etching into the first insulating layer 12 . the remaining p + polysilicon layer 20 on the bottom surface of layer 14 or the exposed portions of polysilicon layer 20 on the sidewall of opening 5 can be easily contacted for making good electrical connections . referring now to fig6 a first metal layer 30 is deposited on the fourth insulating layer 22 and in the contact opening 5 , and thereby making electrical contact directly to the thin polysilicon layer 20 . the first metal layer 30 is preferably aluminium ( al ) metal or an aluminium copper alloy , and preferably the al is deposited after first forming a penetration barrier layer on the surface in the contact opening 5 . for example a refractory metal , such as tungsten ( w ), titanium ( ti ), can be used . alternatively , a tungsten plug can be formed in the opening 5 to serve as a contact and a barrier layer . for example , the tungsten can be deposited by chemical vapor deposition using a reactant gas mixture containing tungsten hexafluoride ( wf 6 ). the tungsten is then etched back to the surface of insulating layer 22 to form w plugs . an aluminium layer can then be deposited and patterned by conventional means to form the interconnecting first level of wiring . the aluminium can be deposited by any one of several means , such as by sputtering deposition or physical vapor evaporation . as mentioned earlier , the first metal layer 30 contacts directly the thin p + fourth polysilicon layer 20 in the contact opening 5 ( fig5 ). this result in a very low ohmic contact resistance compared to the method of the prior art . by way of example , a current / voltage ( i - v ) trace is shown in fig1 between two contacts built by the prior art . as clearly seen in fig1 the i - v trace 50 is very non ohmic and shows the p + / n + diode characteristics of the back to back diodes formed from the two contacts . the break down voltage being about 3 . 0 to 4 . 0 volts . on the other hand , a current - voltage trace between two contacts built by the method of this invention is shown in fig1 . as is clearly seen in fig1 the i - v trace 60 has ohmic characteristics . also the current scale on the vertical axis in fig1 , for the prior art , is in nanoamperes ( 1 × 10 - 9 amps . ), while the current scale in fig1 for the current invention is in micoamperes ( 1 × 10 - 6 amps .). the dramatic improvement in current characteristics is best illustrated by plotting the i - v trace of fig1 on the plot in fig1 , as shown labeled 70 in fig1 . the trace 70 for the present invention is essentially vertical in fig1 showing the much lower contact resistance for similar sheet resistance p + films . the measurements were made between two contacts similar to the contacts shown in fig1 and 7 for the conventional and contact of this invention , respectively . the patterned polysilicon layer between contacts was about 1 . 0 micrometer in width and about 100 micrometers in length . the polysilicon layer was about 300 angstroms thick and was implanted with bf 2 ions at a dose of 1 . 0 e 15 / cm 2 and an implant energy of about 25 . 0 kev . the resultant sheet resistance ( r s ) was 3500 to 5000 ohms / square . a second important contribution of the invention is the area reduction of the metal contact which substantially increases the packing density of devices on the integrated circuit . given the same design ground rules for the prior art contact structure , shown in fig1 and the metal contact structure of the present invention , shown in fig3 the invention result in about a 28 percent reduction in area . referring now more specifically to fig7 through 10 , a second embodiment is shown for forming a self - aligning contact that further reduces the area of the metal contact . many of the process steps in the second embodiment are the same as the process in the first embodiment , and their discussion are not repeated in the same detail . similar structures and layer in both embodiments are also consistently labeled the same . referring now to fig7 an elevational view is shown of the self - aligned metal contact for the completed structure shown in fig1 . the series of partially completed structures shown in fig8 through 10 are for cross sectional view through the region 10 -- 10 &# 39 ; as depicted in fig7 . the method for making the self - aligned reduced area metal contact of this second embodiment is the same as the first embodiment up to but not including the step for forming the first contact opening 5 in fig4 . briefly , the process up to the first contact opening consist of forming a first insulating layer 12 on a p - silicon substrate 10 . a buffer layer 14 is then formed from an n + doped second polysilicon layer 14 , as shown in fig8 . the buffer layer 14 is then insulated by a second insulating layer 16 and an n + doped third polysilicon ( not shown ) is patterned to form a gate electrode for the thin film transistor , which is also not shown in the fig . a thin gate oxide is formed on the tft gate electrode by depositing a third insulating layer 18 , which is also formed over the second insulating layer 16 and over the buffer layer 14 , as shown in fig8 . now as shown in fig8 the first contact opening 5 in fig4 b of the first embodiment is omitted in the insulating layers 18 and 16 of the second embodiment . instead the channel layer is formed by the method of the first embodiment by depositing a fourth polysilicon layer 20 , and similar to the first embodiment , the layer is selectively ion implanted with p + dopant ( b 11 ) to from the p + source / drain areas of the p - channel tft , and the p + doped regions over the buffer layer 14 . the fourth polysilicon layer is then patterned to define the channel layer over the tft , the source / drain areas and the connecting p + stripe 20 &# 39 ; from the tft source ( not shown ) to the buffer layer 14 . a fourth insulating layer 22 composed of bpsg is deposited next , as shown in fig9 . the layer thickness and deposition methods are the same as in the first embodiment . now as shown in fig1 , a single contact opening 7 is formed in layer 22 by conventional photoresist masking and anisotropic etching . the opening 7 is aligned over the buffer layer 14 , and is etched through layers 22 , 20 , 18 and 16 to the surface of the buffer layer 14 . the etch stop is not critical because of the relatively thick buffer layer . a metal layer 30 is deposited over the insulating layer 22 and in the contact opening 7 and then patterned by conventional means to form the first metal wiring level and complete the self - aligned metal contact having reduce area . the preferred metal is an aluminium or aluminium copper alloy with a barrier layer such a tungsten or a tungsten plug process , as in the first embodiment . also , the metal layer 30 can be composed of titanium and titanium nitride ( ti and tin ) or aluminum - silicon - copper ( alsicu ) alloy and tin , and is deposited to a thickness of between about 4000 and 6000 angstroms . several important features relating to the second embodiment are discussed . the p + connecting stripe 20 &# 39 ; is self - aligned to the metal in the opening 7 at the sidewall region location labeled c in fig1 . this contact has a low ohmic resistance , comparable in value to the metal contact of the first embodiment . because a single contact is used the layout design ground rules can be even tighter than in the first embodiment , thereby reducing further the area required for making the contact . for example , the reduction in area of the buffer layer 14 of fig1 is further reduced over the prior art design layout of fig1 by about 43 percent . still another important feature is the elevation of the p + connect layer 20 &# 39 ; above the surface of the buffer layer 14 by at least the thickness of layer 16 and 18 . this provides considerable latitude in over or under etching the contact opening 7 and still provide good contacts , and thereby makes the process very manufacturable . while the invention has been particularly shown and described with reference to the preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of the invention . for example , while the invention was direct at making good low resistance ohmic contacts for p - channel thin film transistor commonly used on sram cells , the process is equally applicable to other thin film structure where a good contact between p + and n + polysilicon layers are required . | 7 |
i . obtaining and expressing cdnas for the human gm - csf receptor β chain the term &# 34 ; effectively homologous &# 34 ; as used herein means that the nucleotide sequence is capable of being detected by a hybridization probe derived from a cdna clone of the invention . the exact numerical measure of homology necessary to detect nucleic acids coding for a receptor β chain depends on several factors including ( 1 ) the homology of the probe to non - β chain coding sequences associated with the target nucleic acids , ( 2 ) the stringency of the hydridization conditions , ( 3 ) whether single stranded or double stranded probes are employed , ( 4 ) whether rna or dna probes are employed , ( 5 ) the measures taken to reduce nonspecific binding of the probe , ( 6 ) the nature of the method used to label the probe , ( 7 ) the fraction of guanidine and cytosine bases in the probe , ( 8 ) the distribution of mismatches between probe and target , ( 9 ) the size of the probe , and the like . preferably , an effectively homologous nucleic acid sequence is at least seventy percent ( 70 %) homologous to the cdna of the invention . more preferably , an effectively homologous nucleic acid is at least ninety percent ( 90 %) homologous to the cdna of the invention . most particularly , an effectively homologous nucleic acid sequence is one whose cdna can be isolated by a probe based on the nucleic acid sequence of fig1 using a standard hybridization protocol with no more than a few false positive signals , e . g . less than a hundred . there is an extensive literature that provides guidance in selecting conditions for such hybridizations , e . g . hames et al , nucleic acid hybridization : a practical approach ( irl press , washington , d . c ., 1985 ); gray et al , proc . natl . acad . sci ., vol . 80 , pgs . 5842 - 5846 ( 1983 ); kafatos et al , nucleic acids research , vol . 7 , pgs . 1541 - 1552 ( 1979 ); and williams , genetic engineering , vol . 1 , pgs . 1 - 59 ( 1981 ), to name a few . by way of example , the nucleic acid of fig1 can be used as a probe in colony hybridization assays as described by benton and davis , science , vol . 196 , pg . 180 ( 1977 ). preferably , low stringency conditions are employed for the probe employed ( dissociation temperature depends on probe length ). for example , for a probe of about 20 - 40 bases a typical prehybridization , hybridization , and wash protocol is as follows : ( 1 ) prehybridization : incubate nitrocellulose filters containing the denatured target dna for 3 - 4 hours at 55 ° c . in 5 × denhardt &# 39 ; s solution , 5 × sspe ( 20 × sspe consists of 174 g nacl , 27 , 6 g nah 2 po 4 -- h 2 o , and 7 . 4 g edta in 800 ml h 2 o adjusted to ph 7 . 4 with 10n naoh ), 0 . 1 % sds , and 100 μg / ml denatured salmon sperm dna , ( 2 ) hybridization : incubate filters in prehybridization solution plus probe at 55 ° c . for 2 hours , ( 3 ) wash : three 15 minute washes in 300 - 500 ml volumes of 6 × ssc and 0 . 1 % sds at room temperature , followed by a final 1 - 1 . 5 minute wash in 300 - 500 ml of 1 × ssc and 0 . 1 % sds at 55 ° c . other equivalent procedures , e . g . employing organic solvents such as formamide , are well known in the art . homology as the term is used herein is a measure of similarity between two nucleotide ( or amino acid ) sequences . homology is expressed as the fraction or percentage of matching bases ( or amino acids ) after two sequences ( possibly of unequal length ) have been aligned . the term alignment is used in the sense defined by sankoff and kruskal in chapter one of time warps , string edits , and macromolecules : the theory and practice of sequence comparison ( addison - wesley , reading , ma , 1983 ). roughly , two sequences are aligned by maximizing the number of matching bases ( or amino acids ) between the two sequences with the insertion of a minimal number of &# 34 ; blank &# 34 ; or &# 34 ; null &# 34 ; bases into either sequence to bring about the maximum overlap . given two sequences , algorithms are available for computing their homology , e . g . needleham and wunsch , j . mol . biol ., vol . 48 , pgs . 443 - 453 ( 1970 ); and sankoff and kruskal ( cited above ) pgs . 23 - 29 . also , commercial services and software packages are available for performing such comparisons , e . g . intelligenetics , inc . ( mountain view , ca ); and university of wisconsin genetics computer group ( madison , wis .). probes based on the nucleic acid sequence of fig1 can be synthesized on commercially available dna synthesizers , e . g . applied biosystems model 381a , using standard techniques , e . g . gait , oligonucleotide synthesis : a practical approach , ( irl press , washington d . c ., 1984 ). it is preferable that the probe be at least 18 - 30 bases long . more preferably , the probe is at least 100 - 200 bases long . probes of the invention can be labeled in a variety of ways standard in the art , e . g . radioactive labels , berent et al , biotechniques , pgs . 208 - 220 ( may / june 1985 ), meinkoth et al , anal . biochem ., vol . 138 , pgs . 267 - 284 ( 1984 ), szostak et al , meth . enzymol ., vol . 68 , pgs . 419 - 429 ( 1979 ), and the like , and non - radioactive labels , chu et al , dna , vol . 4 , pgs . 327 - 331 ( 1985 ), jablonski et al , nucleic acids research , vol . 14 , pgs . 6115 - 6128 ( 1986 ), and the like . hybridization probes can also be used to screen candidate sources of β chain mrna prior to library construction , e . g . by rna blotting , maniatis et al , molecular cloning : a laboratory manual , pgs . 202 - 203 ( cold spring harbor laboratory , n . y ., 1982 ); or hames and higgins , eds ., pgs . 139 - 143 in nucleic acids hybridization ( irl press , washington d . c ., 1985 ). sources of mrna encoding the desired polypeptides include cell populations or cell lines that express , or can be induced to express , large numbers of gm - csf receptors on their surfaces , e . g . in excess of 3 - 5000 . preferably , the α and β chains of the gm - csf receptor are co - transfected into a mammalian expression system ( i . e . host - expression vector combination ). many reviews are available which provide guidance for making choices and / or modifications of specific mammalian expression systems , e . g . to name a few , kucherlapati et al ., critical reviews in biochemistry , vol . 16 , issue 4 , pgs . 349 - 379 ( 1984 ), and banerji et al ., genetic engineering , vol . 5 , pgs . 19 - 31 ( 1983 ) review methods for transfecting and transforming mammalian cells ; reznikoff and gold , eds ., maximizing gene expression ( butterworths , boston , 1986 ) review selected topics in gene expression in e . coli , yeast , and mammalian cells ; and thilly , mammalian cell technology ( butterworths , boston , 1986 ) reviews mammalian expression systems . likewise , many reviews are available which describe techniques and conditions for linking and / or manipulating specific cdnas and expression control sequences to create and / or modify expression vectors suitable for use with the present invention , e . g . maniatis et al ., molecular cloning : a laboratory manual ( cold spring harbor laboratory , n . y ., 1982 ); glover , dna cloning : a practical approach , vol . i and ii ( irl press , oxford , 1985 ), and perbal , a practical guide to molecular cloning ( john wiley & amp ; sons , n . y . 1984 ), to name only a few . several dna tumor viruses have been used as vectors for mammalian hosts . particularly important are the numerous vectors which comprise sv40 replication , transcription , and / or translation control sequences coupled to bacterial replication control sequences , e . g . the pcd vectors developed by okayama and berg , disclosed in mol . cell . biol ., vol . 2 , pgs . 161 - 170 ( 1982 ) and mol . cell . biol ., vol . 3 , pgs . 280 - 289 ( 1983 ), both of which are incorporated herein by reference ; the sv40 vectors disclosed by hamer in genetic engineering , vol . 2 , pgs . 83 - 100 ( 1980 ), and u . s . pat . no . 4 , 599 , 308 , both of which are incorporated herein by reference ; and the vectors additionally containing adenovirus regulatory elements , disclosed by kaufman and sharp , in mol . cell . biol ., vol . 2 , pgs . 1304 - 1319 ( 1982 ), and clark et al ., in u . s . pat . no . 4 , 675 , 285 , both of which are incorporated herein by reference . cos7 monkey cells , described by gluzman , cell , vol . 23 , pgs . 175 - 182 ( 1981 ) and available from the atcc ( accession no . crl 1651 ), are usually the preferred hosts for the above vectors . sv40 - based vectors suitable for mammalian receptor expression have been developed by aruffo and seed , proc . natl . acad . sci ., vol . 84 , pgs . 3365 - 3369 and 8573 - 8577 ( 1987 ). binding assays are accomplished by letting a ligand of unknown specificity or affinity compete with a known amount or concentration of labeled human gm - csf for receptor binding sites of a sample of cells transfected or transformed with pkh97 and pkh125 , or their equivalents . preferably , the gm - csf is labeled by radioiodianation using standard protocols , e . g . reaction with 1 , 3 , 4 , 6 - tetrachloro - 3α , 6α - diphenylglycouril described by fraker et al , biochem biophys . res . commun ., vol . 80 , pgs . 849 - 857 ( 1978 )( and available from pierce chemical co . as iodogen ). generally , the binding assay is conducted as described by lowenthal et al , j . immunol ., vol 140 , pgs . 456 - 464 ( 1988 ), which is incorporated by reference . briefly , aliquots of cells are incubated in the presence of 125 i - labeled human gm - csf in a final volume of 200 μl culture medium in microfuge tubes at 4 ° c . cell - bound 125 i - labeled gm - csf was separated from non - bound 125 i - labeled gm - csf by centrifugation through an oil gradient ( 10 , 000 × g for 2 min ). nonspecific binding is measured in the presence of a 100 - fold excess of partially purified unlabeled human gm - csf . example i . construction of cdna library from tf - 1 cells and isolation of pkh97 and pkh125 poly ( a ) + rna isolated from tf - 1 cells ( kitamura et al , j . cell . physiol ., vol . 140 , pgs . 323 - 334 ( 1989 )) by the guanidium isothianate method ( chirgwin et al , biochemistry , vol . 18 , pgs . 5294 - 5299 ( 1978 )) was converted to double - stranded cdna using oligo ( dt ) primers . after bst xi linkers were ligated to both ends of the cdnas , the cdnas were digested with xba i ( the 3 &# 39 ; region fortuitously containing a unique xba i site ) and re - cloned into bst xi / xba i - digested pme18 , an sv40 - based mammalian expression vector ( see fig3 ). pkh97 was isolated by using probes constructed from initially isolated truncated cdnas . the trucated cdnas were isolated using a 32 p - labeled mouse interleukin - 3 receptor cdna fragment ( described in itoh et al , science , vol . 247 , pgs . 324 - 334 ( 1990 )) as a hybridization probe under low stringency conditions ( hybridization at 42 ° c . with 6xsspe in the presence of 20 % formamide and washing at 50 ° c . with 2xsspe ). pkh97 was transfected into cos 7 cell by a standard protocol , e . g . as described by yokota et al , proc . natl . acad . sci ., vol . 84 , pgs . 7388 - 7392 ( 1987 ) ( 5 μg of plasmid dna were transfected into semi - confluent cos 7 cells by the deae - dextran method ; 72 hours after transfection , the cells were harvested for binding assays , using iodinated cytokines as described below ). no specific binding was displayed by any of the following human cytokines at the following concentrations : il - 2 ( 1 nm ), il - 3 ( 20 nm ), il - 4 ( 1 nm ), il - 5 ( 5 nm ), gm - csf ( 20 nm ), and epo ( 10 nm ). a cdna encoding the α chain of the human gm - csf receptor was isolated from the same library using the polymerase chain reaction with specific oligonucleotide primers corresponding to the 5 &# 39 ;- untranslated and the 3 &# 39 ;- untranslated regions of the cdna described by gearing et al , embo j ., vol . 8 , pgs . 3667 - 3676 ( 1989 ). the isolated cdna was inserted into pme18 to give pkh125 . a total of 5 μg of equal amounts of pkh97 and pkh125 plasmid dna was transfected into semi - confluent cos 7 cells by the deae - dextran method . 72 hours after transfection , the cells were harvested and analyzed in gm - csf binding assays . duplicates of 2 × 10 5 cos 7 cells in 0 . 1 ml of rpmi 1640 containing 10 % fetal calf serum , 2 mm edta , 0 . 02 % sodium azide and 20 mm hepes ( ph 7 . 4 ) were incubated for 3 h at 4 ° c . with various concentrations of 125 i - labeled human gm - csf with or without an excess amount of non - labeled human gm - csf . the cell - bound radioactivity was measured by separating the cells from free ligand by centrifugation through an oil layer , as described by schreurs et al , growth factors , vol . 2 , pgs . 221 - 233 ( 1990 ). gm - csf was iodinated by a standard protocol , chiba et al , leukemia , vol . 4 , pgs . 22 - 36 ( 1990 ). briefly , 5 μg of e . coli - produced human gm - csf was incubated in 30 - 50 μl of 50 mm sodium borate buffer ( ph 8 . 0 ) with 1 mci of the dried bolton and hunter reagent for 12 - 16 h at 4 ° c . glycine was added to 2 . 5 mg / ml to stop the reaction and the iodinated gm - csf was separated from the free bolton and hunter reagent by a pd - 10 column . the iodinated human gm - csf had a specific radioactivity of 4 - 8 × 10 7 cpm / μg and was stable for about two months in hepes - buffered hank &# 39 ; s balanced salt solution containing 0 . 1 % gelatin , 0 . 1 % bovine serum albumin , and 0 . 02 % sodium azide . fig2 a shows the receptor binding data . open circles correspond cos 7 cells ( controls ) transfected with pkh125 and pme18 ( same vector as pkh97 , but without the cdna insert ). closed circles correspond to cos 7 cells transfected with pkh125 and pkh97 . the scatchard plots of the binding data are shown . the inserted graphs show equilibrium binding profiles . as can be seen from the data both high ( k d = 120 pm ) and low ( k d = 6 . 6 nm ) affinity binding sites are indicated ( the k d values being computed by the ligand program , de lean et al , mol . pharmacol ., vol . 21 , pgs . 5 - 16 ( 1982 )). a dna fragment containing the neomycin - resistance gene , neo , was inserted into pkh97 to form pkh97neo . nih3t3 cells were stably transfected with pkh97neo and pkh125 by the calcium - phosphate procedure , described by chen and okayama , mol . cell . biol ., vol . 7 , pgs . 2745 - 2752 ( 1987 ), which reference is incorporated by reference . stable transfectants were selected by 1 mg / ml of g418 . fig2 b shows the binding data for the transfected nih3t3 cells . as above , the open circles correspond to to control nih3t3 cells transfected with pkh97neo and pme18 . closed circles correspond to nih3t3 cells transfected with pkh97neo and pkh125 . the latter displayed high affinity binding with a k d of 170 pm . labeled gm - csf association and dissociation rates were also examined in the transfected nih3t3 cells . fig3 a and 3b illustrates the data . open circles correspond to nih3t3 cells expressing only the α chain . closed circles correspond to nih 3t3 cells expressing both the α chain and β chain of the gm - csf receptor . the latter displayed a much slower rate of dissociation ( t 1 / 2 = 2 min versus t 1 / 2 = 360 min ). example iv . use of co - transfected cos 7 cells to screen for gm - csf antagonists aliquots of cos 7 cells co - transfected with pkh97 and pkh125 as described above are distributed to wells of microtiter plates in 200 μl of medium containing 125 i - labeled human gm - csf at concentrations of 100 pm , 500 pm , and 1 nm . 100 μl samples of microbial supernatants free of cells are added to the transfected cos 7 cells at each of the different concentrations of 125 i - labeled gm - csf . after incubating for 3 hours the cos 7 cells are harvested and assayed for bound radioactivity . cos 7 cells with low counts of bound radioactivity correspond microbial samples containing candidate antagonists or agonists of human gm - csf . the descriptions of the foregoing embodiments of the invention have been presented for purpose of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . the embodiments were chosen and described in order to best explain the principles of the invention to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto . applicants have deposited pkh97 and pkh125 with the american type culture collection , rockville , md , usa ( atcc ), under accession numbers 40847 and 40848 , respectively . these deposits were made under conditions as provided under atcc &# 39 ; s agreement for culture deposit for patent purposes , which assures that the deposit will be made available to the us commissioner of patents and trademarks pursuant to 35 usc 122 and 37 cfr 1 . 14 , and will be made available to the public upon issue of a u . s . patent , which requires that the deposit be maintained . availability of the deposited plasmids is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws . | 2 |
a first embodiment of an electronic system according to the present invention is illustrated in fig1 . an vehicle alternator 10 generates electrical energy at a nominal voltage of approximately 12 volts dc . emitter 12 of first n - p - n bipolar junction transistor ( bjt ) 14 is connected to the output of alternator 10 . preferably , bjt 14 is the parallel combination of seven d44vh7 power transistors from general electric corporation . collector 16 of bjt 14 is connected to one side of electrically - heated catalyst ( ehc ) 18 . the other side of ehc 18 is connected to ground . base 20 of bjt 14 is connected to source 22 of p - channel insulated - gate field - effect transistor ( fet ) 24 . fet 24 is preferably one or more power mosfets such as the si9407dy from siliconix , connected in parallel as necessary to provide adequate base drive to bjt 14 . gate 28 of fet 24 is connected to collector 32 of a second n - p - n bjt 30 . bjt 30 is preferably a common signal transistor such as a 2n2222 or equivalent . gate 28 of fet 24 is also connected via resistor 38 to both drain 26 of fet 24 and the output of alternator 10 . emitter 36 of bjt 30 is connected to ground . base 34 of bjt 30 is disposed to receive an electrical command representing a desire for current to be provided to ehc 18 . preferably , base 34 is connected to an engine controller 39 , which has responsibility for controlling emissions on the vehicle . as bjt 30 is configured in this embodiment of the present invention , a &# 34 ; high &# 34 ; level signal at base 34 will represent a command for current to be provided to ehc 18 . on the other hand , a &# 34 ; low &# 34 ; level signal will represent that current is not to be provided to ehc 18 . a diode 42 is connected between the output of alternator 10 and 12 - volt battery 40 and other loads 41 . 12 - volt battery 40 is a standard component on almost all automobiles . other loads 41 include a rear - window defroster grid , headlamps , and all other electrical loads on the vehicle . preferably , diode 42 is a schottky diode such as a 84cnq045 from international rectifier . the system illustrated in fig1 operates as follows . alternator 10 generates electrical energy for a vehicle . alternator 10 is the electrical energy source for all loads on the vehicle , including ehc 18 , 12 - volt battery 40 and other loads 41 . as has previously been discussed , ehc 18 can draw over 100 amperes . as a result , the total demand for electrical current by ehc 18 , 12 - volt battery 40 and other loads 41 can easily outstrip the current - generating capacity of alternator 10 . the present invention allows current to be diverted to ehc 18 for as long as needed , then provided to 12 - volt battery 40 and other loads 41 . a command signal to cause current to be diverted to ehc 18 is provided at base 34 of bjt 30 by engine controller 39 . if engine controller 39 wishes current to be diverted to ehc 18 , engine controller 39 will provide a &# 34 ; high &# 34 ; signal at base 34 . that signal causes bjt 30 to conduct , causing current flow into collector 32 and out of emitter 36 to ground . this current flow causes collector 32 to assume a &# 34 ; low &# 34 ; voltage of near zero volts . when collector 32 assumes the low voltage just described , gate 28 of fet 24 also assumes this low voltage , being connected to collector 32 . because gate 28 has assumed a low voltage , fet 24 conducts . thus , current flows into drain 26 and out of source 22 . this current has only one path to take , namely into base 20 of bjt 14 . as a result , bjt 14 conducts . it should be noted that bjt 14 is configured in &# 34 ; inverted mode &# 34 ;. when bjt 14 is supplied a large amount of base current while connected in inverted mode , current flows into emitter 12 and out of collector 16 with a very low voltage drop across the junction between emitter 12 and collector 16 . the voltage drop can be on the order of 0 . 1 volt . the very low voltage drop is advantageous because of the high current which will flow through ehc 18 when bjt 14 conducts . the low voltage drop helps assure that a minimum of power is dissipated as the high current flows through the junction between emitter 12 and collector 16 . diode 42 assures that current flows predominantly to ehc 18 and not to 12 - volt battery 40 or other loads 41 . current will flow through diode 42 only if anode 44 is one diode drop higher in voltage than cathode 46 . therefore , current will flow to battery 40 and other loads 41 only to the extent that alternator 10 can generate all of the current drawn by ehc 18 and continue to maintain a voltage at least one diode drop higher than 12 - volt battery 40 . thus , only excess current not required by ehc 18 goes to 12 - volt battery 40 and other loads 41 . thus , it can be seen that when engine controller 39 causes base 34 of bjt 30 to go high , all or almost all of the current generated by alternator 10 is diverted through ehc 18 . only excess current goes to 12 - volt battery 40 and other loads 41 . when engine controller 39 no longer wishes current to flow through ehc 18 ( i . e , when ehc 18 is warm ), engine controller 39 will cause base 34 of bjt 30 to go &# 34 ; low &# 34 ;. this turns off bjt 30 . collector 32 of bjt 30 and gate 28 of fet 24 then go &# 34 ; high &# 34 ;. fet 24 therefore turns off , stopping current flow into base 20 of bjt 14 . bjt 14 therefore turns off , stopping current flow to ehc 18 . now , assuming that alternator 10 is generating voltage at least one diode drop greater than the voltage of 12 - volt battery 40 and other loads 41 , all of alternator 10 &# 39 ; s current will flow to 12 - volt battery 40 and other loads 41 . it should be noted that in fig1 drain 26 of fet 24 can be connected to 12 - volt battery 40 and other loads 41 , rather than to the output of alternator 10 . however , connecting the circuit in this fashion entails the possibility that when the entire system is turned off , current will leak from 12 - volt battery 40 through bjt 30 . in such an event , 12 - volt battery 40 can inadvertently be run down , a disadvantageous situation in a vehicle . a second embodiment of the present invention is illustrated in fig2 . alternator 50 can be a device with a nominal 12 volt output or with an output which can range from 12 volts to a higher voltage such as 35 volts . one side of ehc 52 is connected to the output of alternator 50 . drain 56 of n - channel field - effect transistor ( fet ) 54 is connected to a second side of ehc 52 . source 58 of fet 54 is connected to ground . fet 54 is preferably a power mosfet with a very low &# 34 ; on &# 34 ; resistance between drain 56 and source 58 . examples of such mosfets are high cell density mosfets ( such as two motorola mtp75n05hd mosfets connected in parallel ) and so - called &# 34 ; trench - mosfets &# 34 ; ( such as two siliconix smp60n06 - 08 mosfets connected in parallel ). gate 60 of fet 54 is coupled to output 66 of a pair of bipolar junction transistors ( bjts ) 62 and 64 configured in a push - pull configuration . preferably , bjt 62 is a common n - p - n signal transistor such as a 2n2222 or equivalent . bjt 64 is preferably a common p - n - p signal transistor such as a 2n2907 or equivalent . input 68 of the push - pull configuration is preferably connected to engine controller 71 , which has responsibility for controlling emissions from the vehicle . a resistor 72 couples output 66 of the push - pull configuration of bjts 62 and 6 . 4 also with gate 76 of a p - channel field - effect transistor ( fet ) 74 . gate 76 is the input of a hybrid darlington combination of fet 74 and an n - p - n bipolar junction transistor ( bjt ) 82 . bjt 82 is preferably selected to be a power transistor with a very low collector - to - emitter voltage drop when bjt 82 is in saturation . for example , bjt 82 could be a parallel combination of seven d44vh7 power transistors from general electric . collector 88 of bjt 82 is connected to the output of alternator 50 , while emitter 86 of bjt 82 is connected to electrical loads comprising 12 - volt battery 90 and other loads 92 . source 80 of fet 74 is connected to the output of alternator 50 and drain 78 of fet 74 is connected to base 84 of bjt 82 . a zener diode 94 , preferably having a rating of 15 volts , is connected between the output of alternator 50 and gate 76 of fet 74 . zener diode 94 protects the darlington combination of fet 74 and bjt 82 in the event that alternator 50 puts out a voltage above about 18 volts . operation of this embodiment of the present invention is as follows . alternator 50 is the source for electrical power for ehc 52 , 12 - volt battery 90 and other loads 92 . when engine controller 71 desires current to flow to ehc 52 instead of to 12 - volt battery 90 and other loads 92 , engine controller 71 causes a &# 34 ; high &# 34 ; signal to be generated at input 68 of the push - pull combination of bjts 62 and 64 . this causes bjt 62 to turn &# 34 ; on &# 34 ;. thus , a &# 34 ; high &# 34 ; voltage is applied to gate 60 of fet 54 . fet 54 turns on , allowing current flow from alternator 50 through ehc 52 . because bjt 62 is on , a high voltage is also applied to gate 76 of fet 74 . fet 74 , being a p - channel fet , is thus off . because fet 74 is off , bjt 82 is also off . as a result , alternator 50 is isolated from 12 - volt battery 90 and other loads 92 . therefore , it can be seen that when engine controller 71 supplies a high signal at input 68 , current from alternator 50 is diverted to ehc 52 . furthermore , 12 - volt battery 90 and other loads 92 are isolated from alternator 50 . once ehc 52 is warm , engine controller 71 will force input 68 of the push - pull combination of bjts 62 and 64 to go low . bjt 62 thus will stop conducting and bjt 64 will start conducting . bjt 64 will draw current through zener diode 94 and resistor 72 . one consequence of bjt 64 conducting is that gate 60 of fet 54 will be at a low voltage . as a result , fet 54 will be off , and will therefore draw essentially no current through ehc 52 . another consequence of bjt 64 conducting is that the current drawn through zener diode 94 will cause gate 76 of fet 74 to be at a substantially lower voltage than source 80 . fet 74 , being a p - channel device , will therefore turn on . this will provide base current for bjt 82 , preferably enough to drive bjt 82 deeply into saturation . with bjt 82 deeply in saturation , current can flow from alternator 50 to 12 - volt battery 90 and other loads 92 with little power dissipation across the junction between collector 88 and emitter 86 of bjt 82 . it can therefore be seen that when engine controller 71 causes input 68 of the push - pull combination of bjts 62 and 64 to go low , current can flow from alternator 50 to 12 - volt battery 90 and other loads 92 . furthermore , essentially no current flows through ehc 52 . it was noted that in this embodiment of the present invention , alternator 50 can be a device with a nominal 12 - volt output or a device with an output which can range from 12 volts to a higher voltage , say 35 volts . the higher voltage can be invoked while diversion of current to ehc 52 occurs , for faster heating of ehc 52 . a third embodiment of the present invention is illustrated in fig3 . here , one side of ehc 118 is connected to the output of a nominal 12 - volt alternator 110 . the other side of ehc 118 is connected to collector 112 of n - p - n bipolar junction transistor ( bjt ) 114 . preferably , bjt 114 is a parallel combination of seven d44vh7 power transistors from general electric corporation . base 120 of bjt 114 is coupled via base resistor 119 to source 122 of p - channel field effect transistor ( fet ) 124 . fet 124 is preferably one or more power mosfets such as the si9407dy from siliconix , connected in parallel as necessary to provide adequate base drive to bjt 114 . drain 126 of fet 124 is connected to anode 144 of diode 142 . diode 142 is preferably a schottky diode , such as the 84cnq045 from international rectifier . cathode 146 of diode 142 is connected to 12 - volt battery 140 and other loads 141 . drain 126 of fet 124 is further coupled via resistor 138 to gate 128 of fet 124 and to collector 132 of n - p - n bipolar junction transistor ( bjt ) 130 . bjt 130 is preferably a common signal transistor such as a 2n2222 or equivalent . base 134 of bjt 130 is connected to engine controller 139 , which has responsibility for controlling emissions on the vehicle . when engine controller 139 desires current to be diverted to ehc 118 , engine controller 139 causes base 134 of bjt 130 to go &# 34 ; high &# 34 ;. bjt 130 is thus turned on , further turning on fet 124 and bjt 114 . current therefore flows through ehc 118 . further , unless alternator 110 can supply all of ehc 118 &# 39 ; s current requirements and maintain a voltage at least one diode drop above the voltage of 12 - volt battery 140 , no current will flow from alternator 110 to 12 - volt battery 140 and other loads 141 . thus , only excess current not required by ehc 118 is supplied to 12 - volt battery 140 and other loads 141 . when engine controller 139 instead no longer requires current to be diverted to ehc 118 , engine controller 139 causes base 134 of bjt 130 to go &# 34 ; low &# 34 ;. bjt 130 , fet 124 , and bjt 114 are thus turned off . current no longer flows through ehc 118 , but instead through diode 142 to 12 - volt battery 140 and other loads 141 . various other modifications and variations will no doubt occur to those skilled in the arts to which this invention pertains . such variations which generally rely on the teachings through which this disclosure has advanced the art are properly considered within the scope of this invention . this disclosure should thus be considered illustrative , not limiting ; the scope of the invention is instead defined by the following claims . | 8 |
turning now to fig1 and 2 , a system for ultrasound therapy comprising an ultrasound therapy transducer head 10 coupled to an external controller 11 is shown . as can be seen , ultrasound transducer head 10 comprises a housing 12 that physically supports and protects internal ultrasound therapy source components . an acoustically transparent membrane 13 is provided at one end of the housing 12 . an ultrasound source 14 that emits ultrasonic radiation 15 ( i . e . acoustic signals or sound waves ) that pass through the membrane 13 for application to a target region 16 of a subject selected for ultrasound therapy is mounted within the housing 12 . the ultrasound source 14 comprises an array of piezoelectric transducer elements 20 , only a small number of which are shown for illustrative purposes only . each transducer element 20 has an impedance backing 21 thereon comprised of material with different impedance properties than the ultrasonic impendence properties of the associated transducer element 20 . a connection layer 22 in the form of a flex circuit or circuit board provides a mechanical mount for the transducer elements 20 and the impendance backing 21 as well as electrical connections between driving electronics 24 and the transducer elements 20 . the driving electronics 24 also communicate with temperature sensing electronics 26 and a heat exchanger 28 disposed within the housing 20 as well as with the external controller 11 . a coupling fluid reservoir 32 filled with a coupling fluid 34 is provided in the housing 12 adjacent the membrane 13 . a temperature sensor 36 is positioned within the coupling fluid reservoir 32 and communicates with the temperature sensing electronics 26 . the distal end of each transducer element 20 extends into the coupling fluid reservoir 32 and is immersed in the coupling fluid 34 . an acoustic power sensing arrangement 38 spaced from the array of transducer elements 20 is also disposed in the coupling fluid reservoir 32 and is positioned so that ultrasonic radiation emitted by the transducer elements 20 passes through the acoustic power sensing arrangement 38 before exiting the housing 12 via the membrane 13 . the acoustic power sensing arrangement 38 is connected to a switching circuit 42 which in turn is connected to a voltage measuring circuit 44 . the voltage measuring circuit 44 communicates with the external controller 11 . turning now to fig1 to 4 , the acoustic power sensing arrangement 38 , switching circuit 42 and voltage measuring circuit 44 are better illustrated . in this embodiment , the acoustic power sensing arrangement 38 comprises a polarized piezoelectric membrane 40 formed of polyvinylidene fluoride ( pvdf ). as is known , membranes of this nature are commonly used in hydrophones to measure ultrasound pressure waves in a medium such as water . a set of upper electrodes 40 a in the form of generally parallel , laterally spaced strips and a set of lower electrodes 40 b similarly in the form of generally parallel , laterally spaced strips are provided on opposite sides of the piezoelectric membrane 40 . the electrode strips 40 a of the upper set are generally orthogonal to the electrode strips 40 b of the lower set . the upper electrode strips 40 a and the lower electrode strips 40 b overlap to form electrode pairs , with each electrode pair being aligned with a respective one of the transducer elements 20 . switching circuit 42 comprises a pair of multiplexers 42 a and 42 b . each channel of multiplexer 42 a is connected to a respective one of the upper electrode strips 40 a and each channel of the multiplexer 42 b is connected to a respective one of the lower electrode strips 40 b . the multiplexers 42 a and 42 b receive address data from the external controller 11 allowing the voltage developed between each electrode pair to be readout . the voltage measuring circuit 44 comprises an amplifier 44 a receiving input from the multiplexers 42 a and 42 b . the amplifier 44 a provides output to an analog - to - digital converter 44 b which in turn provides output to a memory 44 c . memory 44 c communicates with the external controller 11 . in this embodiment , the transducer elements 20 are arranged in groups with each group comprising forty - eight ( 48 ) transducer elements 20 although this number may be increased or decreased as desired . the driving electronics 24 in this embodiment are formed of discrete components and comprise a digital circuit 50 and an analog circuit 52 for each group of transducer elements 20 . fig5 better illustrates one of the digital circuits 50 and one of the analog circuits 52 . the digital circuit 50 comprises an address counter 60 , an address counter memory 62 , forty - eight ( 48 ) digital waveform memories 64 ( only one of which is shown ), forty - eight ( 48 ) waveform digital - to - analog converters ( dacs ) 66 ( only one of which is shown ) and a reference voltage dac 68 . the address counter memory 62 , the digital waveform memories 64 and the reference voltage dac 68 are connected to the external controller 11 via a 16 - bit high speed data bus 70 . the address counter 60 and the waveform dacs 66 are connected to the external controller 11 via or logic 72 that is driven by a run clock 74 . the address counter 60 , address counter memory 62 , digital waveform memories 64 , waveform dacs 66 and reference voltage dac 68 also communicate with the external controller 11 via control lines 76 . each digital waveform memory 64 in this embodiment comprises 64k × 10 bit static random access memory ( ram ) that stores a digital waveform received from the external controller 11 via the high speed data bus 70 . the digital values of the digital waveform at sampled time points are directly and serially loaded into each digital waveform memory 66 via the high speed data bus 70 . the frequencies , amplitudes and phases of digital waveforms loaded into the digital waveform memories 66 by the external controller are selected so that the ultrasonic radiation 15 output by the ultrasound therapy transducer head 10 provides the desired therapeutic ultrasound to the subject . parallel loading of the digital waveform into each digital waveform memory 64 is also feasible and will reduce the time required for the digital waveform loading procedure . the address counter memory 62 supplies rolling memory addresses to the address counter 60 at 20 mhz as the external controller 11 outputs data onto the high speed data bus 70 which in turn enables the digital waveform memories 64 so that the digital waveform data is stored in the proper digital waveform memories 64 . each digital waveform memory 64 is also addressed by the address counter 60 to ensure synchronization during output of digital waveforms by the digital waveform memories . once the digital waveform memories 64 have been loaded with the desired digital waveforms , each digital waveform memory is used to provide 10 - bit digital waveform data to its associated waveform dac 66 during the sonication . each waveform dac 66 converts the 10 - bit digital waveform seen at its input to an analog signal with a dynamic range of 0 to 1 volt . the waveform dac 66 is fast enough to allow adequate time resolution . during the sonication , the run clock 74 to the address counter 60 and the waveform dacs 66 is switched to a higher frequency oscillator ( for example 65 mhz ) to allow for adequate time resolution . each waveform dac 66 may also have additional features such as power down lines to allow individual channels to be disabled in the event of a channel down condition . such a channel down condition occurs for example if the channel driving line becomes disconnected from its associated transducer element 20 or if the transducer element 20 is damaged . the reference voltage dac 68 and its associated latch ( not shown ) are used to set the reference voltage for all the waveform dacs 66 . this allows the total power level of the ultrasound source 14 to be adjusted in real time during sonication without requiring reloading of the digital waveform memories 66 . the analog circuit 52 comprises forty - eight ( 48 ) amplication circuits ( only one of which is shown ), each of which receives the analog signal output of an associated waveform dac 66 and outputs a corresponding analog radio frequency ( rf ) signal that is applied to the channel driving line extending to an associated transducer element 20 . the advantages of having each transducer element 20 connected to its own driving line include the reduction of the driving system size , cost , and power loss when the energy is transmitted from the driving electronics to the transducer element array . one of the amplification circuits is better illustrated in fig6 and comprises a first op - amp stage 80 that provides a voltage gain to the analog signal , and a second op - amp stage 82 that provides a high current analog signal output . in this embodiment , the first op - amp stage 80 applies a voltage gain of eleven ( 11 ) to the dac analog output signal augmenting the voltage swing from 0 to 11 volts . the op - amp stage 80 cuts out high frequencies and can be used to cut the quantization noise frequency . the signal output by the op - amp stage 80 is high - pass filtered with a first order resistor - capacitor ( rc ) circuit 84 to remove dc offset . the second op - amp stage 82 employs a high power op - amp to amplify the voltage , in this embodiment by a gain of two ( 2 ), and provide a high current analog output signal with a maximum peak - to - peak voltage swing of 22 volts . the components shown in the shaded region of fig5 represent the circuitry of the digital and analog circuits 50 and 52 that is repeated for each of the forty - eight ( 48 ) channels . the digital and analog circuits 50 and 52 can be constructed from discrete components or can be constructed using application specific integrated circuit ( asic ) chips . the digital circuit 50 can be combined on one asic chip 90 and the analog circuit 52 on another asic chip 92 as shown in fig7 . alternatively , both the digital and analog circuits 50 and 52 can be combined on one chip 96 using a multiple - chip package ( mcp ) process as shown in fig8 . the op - amp stages 80 and 82 can be embedded in the module by integrating semiconductor intellectual property ( sip ) blocks with asic / memories . the chip 90 or 96 may include a line that allows the status of the digital waveform memories 64 to be monitored to assure that each digital waveform is properly loaded . the external controller 11 in this embodiment comprises a computing device such as for example , a microsoft windows based personal computer ( pc ) with a ni pci - 6534 ( national instruments , austin , tex . ), an 80 mbytes / second data transfer rate , and a 32 - bit digital i / o board . the i / o board is controlled through a program executing on the computing device that uses the dynamic link library ( dll ) supplied by the i / o board manufacturer . binary data on thirty - two ( 32 ) data lines can be simultaneously transmitted for example at 20 mhz if an 80 mbytes / s transfer rate is desired . of the 32 data lines , 16 data lines form the high speed data bus 70 for transmitting digital waveform values , etc . to the driving electronics 24 . the other 16 data lines are used as the control lines 76 for selecting , programming and manipulating different components of the driving electronics 24 and for higher level functions such as powering on and off individual digital circuits 50 and / or individual channels of the digital circuits 50 . the analog circuits 52 can be controlled by the external controller 11 for example through a parallel port . the external controller 11 can control electronic components of the ultrasound transducer head 10 via a serial port , universal serial bus ( usb ) or other suitable communications protocol . each operation or instruction issued by the external controller 11 is coded with a specific 16 - bit word that is used to directly control the appropriate component elements . 16 - bit data arguments can be sent by the electronic components to the external controller 11 when required . during operation , when the ultrasound transducer head 10 is conditioned to output ultrasonic radiation 15 , the digital waveform data in each digital waveform memory 64 is output to its associated digital waveform dac 66 and converted into an analog signal . each analog signal is input to its associated amplification circuit resulting in an output rf signal that is fed to its associated transducer element 20 . in response , each transducer element 20 outputs a beam of ultrasonic radiation corresponding to the digital waveform . the ultrasound beam transmitted by each transducer element 20 passes through the acoustic power sensing arrangement 38 before exiting the transducer head 10 via the membrane 13 . as each ultrasound beam passes through the acoustic power sensing arrangement , a varying voltage is formed in the piezoelectric membrane 40 between the electrode pair aligned with the transducer element 20 that is outputting the ultrasound beam as a result of the pressure variation created across the piezoelectric membrane 40 . when the controller 11 addresses an electrode pair by enabling the multiplexers 42 a and 42 b connected to the upper and lower electrode strips 40 a and 40 b forming the electrode pair , the voltage across the piezoelectric membrane 40 between the electrode pair is sensed by the amplifier 44 a . amplifier 44 a in turn outputs a voltage signal to the analog - to - digital converter 44 b which converts the voltage signal to a digital value for storage in the memory 44 c . since the sensed voltage is proportional to the ultrasound pressure wave , the acoustic power delivered by each transducer element 20 can be measured . these measurements can be relative or they can be calibrated to provide absolute power measurements . the generated voltage measurement signal output from the memory 44 c by the voltage measuring circuit 44 is used by the external controller 11 to assure the proper operation of the transducer elements 20 and / or the driving electronics 24 allowing the ultrasonic radiation 15 output by the ultrasound therapy transducer head 10 to be precisely controlled . the generated voltage measurement signal may also be used to assure proper operation of the software executed by the external controller 11 during generation and loading of digital waveforms , to measure , display and / or control the amplitude of the emitted ultrasound beams , to measure , display and / or control the phase of the emitted ultrasound beams , and as a feedback signal to assure desired operation of the ultrasound therapy transducer head 10 such as by adjusting ultrasound beam amplitudes to stabilize power output . the temperature sensing electronics 26 in this embodiment monitor the temperature of the coupling fluid 34 via temperature sensor 36 and the temperature of the driving electronics 24 via another temperature sensor ( not shown ) and provide output to the heat exchanger 28 . in response to output from the temperature sensing electronics 26 , the heat exchanger cools the coupling fluid 34 and / or the driving electronics 24 by circulating coolant through the housing 12 thereby to control temperature within the housing 12 and assure stable and reliable operation of the ultrasound therapy transducer head 10 . the temperature sensing electronics 26 can signal the heat exchanger 28 so that it operates generally continuously to maintain a desired temperature within the housing or can cycle the heat exchanger 28 . if desired , the temperature sensing electronics 26 may store temperature measurement and control data for transfer to the external controller 11 . if desired , the ultrasound therapy transducer head 10 may further comprise a controller to maintain and control the performance of the ultrasound therapy transducer head . memory may be provided to store sonication , control and / or safety limit data as well as other data generated during ultrasound therapy transducer head monitoring . additional electronics to enable automatic control and provide enhanced safety may also be included . by integrating the array of transducer elements 20 with driving electronics 24 using custom integrated circuits in the transducer housing 12 and by using piezoelectric film technology integrated into the transducer housing 12 to monitor acoustic power output , the manufacturing costs of the ultrasound therapy transducer head 10 are significantly reduced providing for the ability to make ultrasound therapy systems that are not feasible with the current approaches . although the driving electronics 24 are described above as being connected to the array of transducer elements 20 via the connection layer 22 , if desired , the driving electronics 24 may be directly connected to the transducer elements 20 obviating the need for the connection layer . if the connection layer does not provide the mechanical mounting then additional material is used to provide the mechanical mounting for the transducer elements 20 . also , if desired , the acoustic power sensing arrangement 38 can be positioned directly on the transducer element array face rather than being spaced from it as shown . the form of the driving electronics 24 can of course vary from the examples described above and illustrated in the drawings . for example , if desired the amplification circuits may only include the high power op - amps . the analog output provided to the amplification circuits may be generated by individual waveform generators . in the example of fig7 , it is possible to realize only the digital circuits 50 in asics while using discrete components for the analog circuits 52 . although embodiments have been described above with reference to the drawings , those of skill in the art will appreciate that variation and modifications may be made without departing from the spirit and scope thereof as defined by the appended claims . | 0 |
as shown in fig1 - 4 , a container 10 is made up of a neck portion 12 and a body portion 24 . the neck 12 is provided with an open mouth 16 and an opposed opening into the body portion 24 . circumscribing the neck portion 12 is a helical thread 14 which is defined by a slot 26 which receives the thread of a closure or container cap ( not shown ). disposed within the thread 14 is a pair of recesses 20 a and 20 b which are spaced from each other a total of 180 °. the recesses 20 a and 20 b are in alignment with and formed by the fingers 32 a , 32 b , 32 c , and 32 d as shown in fig5 a . a latching lug 22 may also be provided for engagement with a mating latching lug on a closure ( not shown ). as shown in fig5 and 5 a , a mold 30 of the preferred embodiment is comprised of only two sections which are , in fact , halves , one half is identifiable as 30 a and the other as 30 b . molds 30 a and 30 b are horizontally movable by virtue of the fact that there are but two sections . when three or more sections are used , the mold sections move apart axially instead of horizontally . when the molds are in a closed position , as shown in fig5 they define a cavity ( not shown ) for the mold of the body portion 24 of the container 10 and grasp the neck portion 12 therein and form the helical threads 14 . helical thread 14 has a pitch in the range of 0 to 8 threads per inch . as shown in fig5 a , the recessed portions 20 a and 20 b in the helical thread 14 are formed by the fingers 32 a , 32 b , 32 c and 32 d of the mold halves 30 a and 30 b , respectively . the horizontal recess formed by recessed portions 20 a and 20 b comprise a first notch disposed on a first side of the slot and a second notch disposed on a second side of the slot with the first notch juxtaposed relative to the second notch so as to horizontally traverse the slot . in the preferred embodiment , a container 10 with a neck finish 12 of the present invention is formed by placing a parison of a selected moldable material , such as , for example polyethylene terephthalate ( pet ), or high density polyethylene ( hdpe ), within a cavity of the mold . the preferred embodiment also creates the mold cavity upon the bringing together of the mold halves 30 a and 30 b , as shown in fig5 . alternate embodiments using more than two mold sections create a mold cavity when their mold sections are brought together axially . a vertically molded core ( not shown ) of a molding device is inserted into the cavity thereby engaging with the parison . in a form of compression - molding , the parison is next formed into a preselected configuration defined by the spatial relationship of the core and the cavity in the mold 30 resulting in the formation of a container 10 . additionally , a blow - molding process can be used to create the container 10 . after the container 10 has been formed , the mold halves 30 a and 30 b are then horizontally separated as the mold halves 30 a and 30 b move horizontally away from the container . furthermore , at the initial separation of the mold halves , the fingers 32 a , 32 b , 32 c and 32 d form the recesses 20 a and 20 b in the helical thread 14 in order to allow clearance of the mold from the neck finish and avoid distortion of the helical thread 14 , even if the helical threads 14 are of a steep pitch , as the halves 30 a and 30 b separate . the foregoing detailed description is given primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom for modifications will become obvious to those skilled in the art upon reading this disclosure and may be made without departing from the spirit of the invention and scope of the appended claims . | 1 |
fig1 shows a mill constructed according to the principles of the invention with a lower housing 10 , a supply chamber 12 surmounting the lower housing , and a cover 14 for the supply chamber . the cover 14 is shaped in a downward cone and its surface is pierced by openings in the form of circular segments interrupted by spoke - like gussets . the openings are used to charge feedstock into the supply chamber 12 whose bottom acts as a filling funnel for the mill . the gussets of the cover 14 carry a central portion 16 which bears , in a manner to be more fully described below , the driveshaft of the mill . the lower housing 10 sits , with its lower edge 11 , upon a receiving container for the flour ; the container is not shown for the sake of clarity of illustration . the housing 10 also bears integral flying buttresses 18 which secure an upper millstone 20 , cast in situ , against rotation . the upper millstone closes off the lower face of the funnel - like supply chamber 12 . the upper surface of the millstone 20 is also shaped in the form of a funnel and angles off into a supply orifice 22 centrally disposed in the millstone . two feed slots 24 are formed in the wall of the supply orifice 22 . the feedslots 24 start at the upper end of the orifice 22 and have an initial cross - section which corresponds to the largest possible kernal size of the grain to be milled . from the upper end of the orifice 22 the feedslots 24 run downwardly in a spiral in the inner periphery of the orifice 22 . the cross - section of the feedslots 24 narrows as they proceed downward until the feedslots 24 completely disappear at the lower end of the orifice 22 . this characteristic of the feedslots 24 is shown in fig1 and 2 . a lower millstone 30 is borne on a crosspin 28 passing through driveshaft 26 ; the crosspin secures the shaft and the millstone 30 into a jointly rotating assembly . the driveshaft 26 rises through the supply orifice 22 of the upper millstone 20 and through an opening in the central cover portion 16 . that portion of the shaft 26 above the cover 16 is threaded and engaged by an adjusting nut 32 ; the nut 32 bears on a thrust bearing plate 34 supported on the cover portion 16 . by relative rotation of the nut 32 and the shaft 26 the spacing between the upper and nether millstones 20 and 30 may be adjusted to provide a desired milling gap 21 . in the region of the supply orifice 22 of the upper millstone 20 , a hob 36 is formed on the driveshaft 26 ; the length of the hob 36 corresponding substantially to the thickness of the millstone 20 . the hob comprises a large number of teeth 38 jutting peripherally from the surface of the driveshaft in parallel planes orthogonal to the centerline of the shaft 26 . the individual cutters , or teeth , 38 are each separated from the adjoining teeth by gaps ; these gaps are aligned in the several planes in which the teeth are located in such a manner that they form a plurality of grooves 40 along lines parallel to the shaft centerline . in the upper surface of the lower millstone 30 , the surface turned toward the milling face of the upper millstone in the assembly , a spiral groove 42 is provided in the central portion of the surface . this spiral groove 42 leads from the outer edge of a supply cavity 44 , into which the orifice 22 discharges , into a circular depression 46 intermediate between the center and the outer perimeter of the millstone 30 , as shown in fig3 . opposite the spiral groove 42 a number of flutes 48 are provided in the lower face of the upper millstone 20 , running from the supply cavity 44 toward a circular depression 47 coincident with the depression 46 of the lower millstone . the flutes 48 run substantially radially , but are , as shown in fig2 slightly angled with respect to the true radii , so that they oppose the spiral of the groove 42 . the circular depression 46 in the midrange of the lower millstone 30 is adjoined by the fine - milling region with a large number of outwardly spiralling furrows 50 . the furrows 50 become shallower as they approach the outer perimeter of the millstone . in a similar fashion , a plurality of spiral furrows 51 radiate from the circular depression 47 of the upper millstone 20 ; the furrows 51 are formed identically to the furrows 50 but their curvature runs counter in sense to the latter . exterior to the regions of the furrows 50 and 51 , the lower and upper millstones 30 and 20 are also provided with superimposed flat surfaces 52 , the spacing between which determines the milling gap 21 of the milling apparatus and which is adjustible by means of the nut 32 . the milling apparatus of fig1 described above , operates in the following fashion : the feedstock , which is to be reduced to flour , is poured through the openings provided in cover 14 into the funnel - like interior of the supply chamber 12 . the sloping bottom of the chamber 12 guides the feedstock into the supply orifice 22 in the upper millstone 20 . the kernels of the feed are fed down the spiralling supply grooves 24 in the wall of the orifice 22 until they are arrested by the narrowing gap between the grooves and the hob 36 . the kernels so arrested drop into the next axial groove 40 in the hob , as it rotates into the appropriate alignment , and are broken by the advancing teeth 38 and reduced in size until they can fall through between the teeth 38 and the sidewalls of the feed slots 24 . one , or more , reductions in the size of the kernels produce pieces small enough to pass through the annulus between the outer periphery of the hob 36 and the orifice 22 , into the supply cavity 44 . the pre - milled feedstock lands in the spiral groove 42 of the lower , rotating millstone and is conveyed radially outwardly as they are further reduced in size by shearing between the edges of the groove 42 and of the flutes 48 in the upper millstone 20 , above . the , now much smaller , feed passes into the furrows 50 and 51 via the circular depressions 46 and 47 which form a toroidal chamber in the interface between the two millstones . the feed is further reduced in size by the action of the furrows 50 and 51 and passes into the region of the milling space defined by flat portions 52 of the millstones , where it is finally reduced to a size corresponding to the milling gap 21 . the milled flour exits radially into a circular chamber 54 defined by the lower housing 10 , whence it falls into a receptacle upon which the housing 10 is supported . upwardly directed vents 56 allow for the unrestricted discharge of air retained in the flour ; they are inwardly protected by a deflector ring 58 , so that the flour cannot escape via the vents 56 . the deflector ring 58 sits at the inner edge of the vents 56 , and does , thereby , prevent the flour existing at the periphery of the millstones from passing through the vents 56 . in the commonly utilized speed range , the flour leaves the gap 21 between the millstones with a very low velocity . the flour inpacting on the deflector ring 58 , therefore , falls downward . should a small proportion of the flour be deflected upward , it will strike the inner surface of the housing 10 adjoining the deflector ring 58 , and will not , again , escape through the vents 56 . the vents 56 serve only to equalize the pressure difference which may arise during the milling process . another embodiment of the millstones of the invention is shown in the illustrating of fig4 and 5 , incorporating a metering mechanism for the control of the amount of feed supplied to the fine - milling region of the millstones . while they are not directly illustrated , pre - milling devices , such as the hob 36 or the spiral groove 42 and its cooperating flutes 48 may also be provided with this embodiment but are omitted for clarity . the assembly of fig4 comprises a lower millstone 130 and an upper millstone 120 , with the stone 130 rigidly affixed to a driveshaft 126 , by means of which it rotated against the upper stone , which is stationary in a housing not shown . a supply orifice 122 pierces the center of the upper millstone 120 , the diameter of this orifice is indicated by broken outline in the view of fig5 which shows the upper face of the lower millstone 130 . feedstock passes from a housing , through the orifice 122 , and into the milling space between the superposed millstones . the lower millstone 130 , as shown in fig5 differs from millstones of the prior art through its lack of a central supply cavity ; a supply cavity 144 is provided , in the form of an annular depression in the upper surface of the stone , adjacent to a substantially flat surface portion underlying the orifice 122 . the depressed supply cavity 144 is sufficiently removed from the driveshaft 126 , that it is completely covered by the upper millstone 120 in the assembly . a pair of metering channels 160 interconnect the base of the supply orifice 122 and the cavity 144 and control the transfer of grain . these metering channels begin in the flat surface portion underlying the orifice and spiral outwardly , discharging into the cavity 144 . the curvature of the channels 160 is so chosen that , with the millstone 130 rotating in its normal sense , the grains falling thereinto are forced radially outward by their inertia and the frictional forces in the channels . exterior to the cavity 144 , a number of spiral furrows 150 interrupt the surface of the millstone 130 ; their depth decreasing toward the outer edge of the stone . these furrows 150 are formed in a manner similar to furrows 50 of fig3 but differ from those in branching into paired furrows 150 &# 39 ; midway between the cavity 144 and the stone periphery . during the rotation of the millstone 130 , opposite the stationary upper millstone 120 , the cereal grains are fed from the cavity 144 into the furrows 150 where they are broken by shear forces exerted by the co - operating millstones , as the grain size is reduced the particles travel outwardly until they enter the furrows 150 &# 39 ; whose function is to evenly distribute the already ground feed over the perimeter of the millstones . in the stationary , upper millstone 120 corresponding furrows 151 are provided , also with reducing depth at increased radial distances . these furrows are formed with their curvature counter to the curvature of the furrows 150 in the lower millstone 130 , whereby the milling action between the two bodies is improved , through the encounter by the partly milled grains of a large number of intersecting edges . beyond the outer limits of the spiralling furrows 150 and 151 , the almost completely milled feedgrains pass through a fine - milling region defined by parallel , flat surface portions 152 , prior to exiting from milling gap 121 at the outer perimeter . many variations are possible in the design of the above embodiment of the invention . in particular , the number and depth of the metering channels 160 can be adapted to the type and desired feedrate of the cereal . the metering channels may also be formed without the spiral alignment , though this promotes the transport of the feed into the supply cavity . it is also possible to provide the metering channels in the lower face of the upper millstone 120 , opening directly from the sidewall of supply orifice 122 , with the motion of the grain impelled by the rotation of the nether millstone . the form and arrangement of the metering channels 160 , as shown in fig4 and 5 is preferred , due to the gravitational assist in admitting the grain thereto . in fig6 through 10 additional embodiments of the millstones of the invention are illustrated . these embodiments show differing developments of the spiral furrows located in the finish milling region of the apparatus . it is understood that the pre - milling components of fig1 through 3 , as well as the metering channels shown in fig4 and 5 , may be equally adapted to the embodiments described below . while the furrows 50 and 51 , and corresponding furrows 150 and 151 , of the previously described embodiments show only a negligible curvature of such furrows , and are present in large numbers , those furrows shown in fig6 through 11 show substantially greater curvature , and are present in much smaller numbers . some of these embodiments incorporate furrows which describe a number of revolutions around the rotational axis of the mill , while others show only a single furrow in the fine - milling region , in particular in the embodiment shown in fig6 , 8 , 10 and 11 ; the embodiment of fig9 shows three furrows in each of the two millstones . turning now to fig6 we see a millstone 220 with a peripheral , flat milling surface 252 and a central cavity 244 . a supply orifice 222 leads directly into the cavity 244 . a spiral furrow 251 extends -- with constant incremental curvature -- from the cavity 244 to the region 252 of the millstone 220 . preferably the depth and / or the slope of the furrow 251 reduces toward the edge of the millstone 220 . a lower millstone 230 is provided to mate with the stone 220 of fig6 ; the features of the lower millstone are , generally , the same as the upper millstone , but the direction of curvature of its furrows 250 is reversed in relation to the curvature of furrows 251 . fig7 is a transverse section through the millstones 220 and 230 and indicates the counter - rotational direction of their respective furrows 251 and 250 with respect to one another . the relative position of the two millstones , as illustrated in fig8 arises from a rotational displacement of the millstone 230 with respect to the position shown in fig7 . fig9 illustrates a further development of a millstone which , in contrast to the millstone 220 shown in fig6 encompasses three concentrically spiralling furrows 251 , 251 &# 39 ; and 251 &# 34 ;. the furrows 251 , 251 &# 39 ; and 251 &# 34 ; also lead from the supply cavity 244 and extend to the outer perimeter of the millstone 220 . the slope and / or the depth of the furrows may be reduced toward the perimeter -- from the inside to the outside -- as in the embodiment of fig6 . in principle the mating millstone 230 also shows a similar form , but with the furrows spiralling counter to the furrows in the millstone 220 of fig9 . the millstones of the embodiment of fig9 are also provided with a peripheral , flat fine - milling surface 252 , as well as an orifice 222 in the upper stone leading to a central cavity 144 . fig1 and 11 illustrate the manner in which the crossings , or intersections , a , b , c , and d , of the co - operating furrows 250 and 251 travel outward when one of the stones is rotated in the direction of the arrow . in fig1 the millstones 220 and 230 have been rotated , relative to one another , by 45 °. the spiral furrows 250 and 251 may be provided with a variety of cross - sections , including , for example , square , triangular , or trapezoidal sections . in all embodiments of the invention the millstones may be manufactured by any of the methods of the prior art . a particularly simple and economical method applicable to the strongly sculptured milling faces of the stones of the invention , is the casting of ceramically bound abrasives into molds . the invention has been described above with reference to its preferred embodiments , minor changes in the arrangement , spacing and forming of the several features of the milling apparatus of the invention shall be deemed to be encompassed by the disclosure herein : the scope of the invention being delimited only by the appended claims . for example , it is possible to provide the opposing milling surfaces of the paired millstones with shapes other than planar , in particular they may be formed in conical shapes . in such an embodiment one millstone would have a conically convex milling face , while the mating stone would be provided with a milling face in the form of a funnel . | 1 |
embodiments of the invention are discussed in detail below . in describing embodiments , specific terminology is employed for the sake of clarity . however , the invention is not intended to be limited to the specific terminology so selected . while specific embodiments are discussed , it should be understood that this is done for illustration purposes only . a person skilled in the relevant art will recognize that other components and configurations can be used without departing from the spirit and scope of the invention . the invention described herein differs from that described in the parent application primarily in that whereas the latter requires a puzzle board , the former does not referring to fig1 - 2 , embodiments of puzzles 10 according to the present invention are shown . as shown in fig1 , the shape may be pentagonal and consist of pieces 21 , 22 , 23 , 24 , 25 , 26 or it may assume any of the shapes depicted in fig2 . each of the pieces 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 can have a different geometric shape , for example , with different amounts of “ sides ” or edges defining the geometric shape ; e . g ., hexagon , heptagon , octagon , nonagon , and decagon , among many others . each of the puzzle pieces can have a different geometric shape from each other , for example , with different amounts of “ sides ” or edges defining the geometric shape . the number of sides or edges of the puzzle piece is equal to the number of sides of the geometric shape to be formed with the puzzle pieces . the number of sides of the shape should at least be five . when the puzzle pieces are manipulated and arranged together , they form the corresponding geometric shape with the same number of sides of each of the puzzle pieces that form the geometric shape . one of ordinary skill in the art will understand based on this disclosure that the invention is not limited to any specific shape or configuration of puzzle , or number , shape , and appearance of puzzle pieces . the puzzle pieces are adapted such that they are not required to fit into a cutout . rather , each puzzle piece can define an outer periphery that has the same , or substantially the same , shape as the outer periphery of the corresponding geometric shape . for example , as shown in fig2 , the geometric shape is a pentagon , 10 . puzzle pieces 21 , 22 , 23 , 24 , 25 and 26 , individually , do not mirror the specific shape of the pentagon , 10 . rather , the pieces 21 , 22 , 23 , 24 , 25 and 26 have the same number of sides as the geometric shape , 10 . the user , after recognizing puzzle pieces with the same number of sides as the geometric shape 10 , can manipulate the pieces 21 , 22 , 23 , 24 , 25 and 26 to form the geometric shape , as shown in fig2 . the pieces fit together or mate with one another . the puzzle pieces have a different shape from the geometric shape to the formed but have the same number of sides as the corresponding geometric shape . the invention provides that any equilateral polygon of n sides , where n is greater than or equal to five , can be deconstructed into k polygons of n sides , where k is greater than or equal to 1 . n and k are integers . the puzzle and its various parts can be constructed using any number of techniques in the art . for example , embodiments can be constructed from paper , cardboard , plastic , or wood . alternatively , embodiments can be implemented in electronic form , such as an internet - based format , a smartphone app , or a computer program , where the various parts of the puzzle are depicted on the screen of a computer , tablet , smartphone , or other device . accordingly , the invention should not be limited to embodiment in any specific form or media . the various mathematical relationships described above can be used to guide the players in assembling the puzzle . for example , the players can count the number of sides or points on each puzzle piece to determine which puzzle the piece fits into . other mathematical relationships may be used to correlate the puzzle pieces and the corresponding geometric shape . for example , and without limitation , the pieces may have an image of a bug , animal , number , object , or other item that includes the same number of certain parts ( e . g ., legs ) as the sides of the geometric shape to be formed . one of ordinary skill in the art will appreciate based on this disclosure that a variety of different shapes or images can be used to correlate the puzzle pieces with the corresponding geometric shape . the various mathematical relationships described above can be used to guide the players in assembling the puzzle or geometrical shape 10 . for example , the players can count the number of sides or points on each puzzle piece to determine which geometric shape is to be formed . the shape alone of the geometric shape and puzzle pieces can also be used to guide the player in assembling the puzzle 10 . the embodiments illustrated and discussed in this specification are intended only to teach those skilled in the art the best way known to the inventors to make and use the invention . nothing in this specification should be considered as limiting the scope of the present invention . all examples presented are representative and non - limiting . the above - described embodiments of the invention may be modified or varied , without departing from the invention , as appreciated by those skilled in the art in light of the above teachings . it is therefore to be understood that , within the scope of the claims and their equivalents , the invention may be practiced otherwise than as specifically described . | 6 |
when referred to hereafter , the terminology “ wireless transmit / receive unit ( wtru )” includes but is not limited to a user equipment ( ue ), a mobile station , a fixed or mobile subscriber unit , a pager , a cellular telephone , a personal digital assistant ( pda ), a computer , or any other type of user device capable of operating in a wireless environment . when referred to hereafter , the terminology “ base station ” includes but is not limited to a node - b , a site controller , an access point ( ap ), or any other type of interfacing device capable of operating in a wireless environment . the term computer or pc may be any device capable of supporting a voice call . such devices include , but are not limited to , laptop computers , pda &# 39 ; s , cellular telephones , mobile internet devices ( mids ), ultra mobile pcs ( umpc ), automobiles and any other device that may interface with a pc card . referring to fig3 , a functional block diagram of an enhanced cellular pc card 300 is shown . here , the soft mobile phone client 101 functionality is included with wireless connectivity 309 . the soft mobile phone client 101 no longer requires a non - access stratum ( nas ) 111 because this functionality is already included in the wireless connectivity 309 . instead , a software interface 313 is introduced to allow the soft mobile phone client 101 to access nas 111 functionality in the wireless connectivity 309 as shown . the soft mobile phone client 101 now comprises a reduced set of functions that will , at a minimum , include unlicensed mobile access / generic access network ( uma / gan ) 113 and voice over internet protocol ( voip ) client functions 305 . additionally , the soft mobile phone client 101 may use the sim card 103 included with the wireless connectivity 309 . for this purpose a software interface 311 may be provided . alternatively , if the sim card 103 is remotely located , for example in a computer , then an external interface 301 , for example , a low pin count ( lpc ) bus , direct connection with the sim or pci bus , may be provided . additionally , a sim may not be a physical device such as a card , but rather sim functionality implemented in machine readable instructions that is executed on a trusted processor in the pc card 300 or the computer . while an external or software sim 103 is not shown for the sake of simplicity , such configurations and the communications between the enhanced cellular pc card 300 and the sim card 103 via the computer bus or other internal or external pc card interfaces falls within the intended scope of this specification . a policy 315 may interface with both the soft mobile phone client 101 as well as the wireless connectivity 309 through software 319 , 317 , respectively . the policy 315 may be included in the enhanced cellular pc card 300 provided via the sim card 103 , provided by the operator or in any other configuration that enables the policy to be utilized by the wireless connectivity 309 and the soft mobile phone client 101 . the policy may be initially configured or modified by the operator using , for example , a firmware over the air ( fota ) process . the purpose of this policy 315 is to define a set of rules and provide coordination between the two points of connectivity 101 , 309 . for example , the policy 315 may dictate that when the soft mobile phone client 101 sees wifi ® internet connectivity , voice and data calls should be established through this path and the wireless connectivity 309 component should be put into an idle or sleep state . in another embodiment , the policy configuration may be to let the network set the default configuration , but include options for the user to set preferences including , but not limited to , uma / gan off , default to cellular even when alternative ip connectivity is available ( or vice versa ), alert the user of the network being used , remember settings for each network , ( for example , when a traveler returns to a hotel with poor wifi reception , not to try connecting again or alert the user to the previous settings ), recognize other voip services on the computer , for example , through vonage ™ or skype ™ and , when detected , alert or allow the user to change the preferred connection to the cellular operator . the connection manager 413 may be used to provide user defined aspects of the policy configuration . in one embodiment , the wireless connectivity 309 and soft mobile phone client 101 combination in the pc card 300 do not include any other connectivity mechanism other than the rf module 205 . in this embodiment , alternate ip connectivity , for example , via a hard - wired internet connection , wifi ®, wimax , bluetooth ®, and the like , require such capabilities to be provided via the computer . for example , this functionality may be embedded in the computer or it may be available via another peripheral device inserted into the computer . in general , a pc card may be a multi - mode device that includes other wired or wireless ip connectivity ( i . e . wimax or wifi ® may be implemented on the same pc card as the soft mobile phone client and wireless connectivity utilizing the rf 205 , as 203 , and nas 111 ). in such a case , the pc card will have internal hardware or software interfaces to the other ip connectivity as well as , if required , hardware and software interfaces to the pc platform . thus the ip connectivity may be through the computer or the pc card . similarly , part or all of the connection manager 413 software may reside on the pc card and other subsystems ( e . g . audio ) may also reside on the pc card . for simplicity , the description treats a pc card that does not include other wired or wireless ip connectivity , any part of the connection manager , or other subsystems , but such configurations fall within the scope of this specification . fig4 shows a functional block diagram utilizing this arrangement in a phone system 400 , where the enhanced cellular pc card 300 , in concert with a personal computer 409 into which it is inserted , may offer a complete voice service to the end user . typical pc operating systems 411 , such as windows ®, provide well defined application programming interfaces ( apis ) 403 that enable access to internet connectivity , audio subsystems , wifi ®, wimax as well as other subsystems within the computer . these subsystems may be accessed directly via the soft mobile phone client 101 in the enhanced cellular pc card 300 or via a connection manager 413 or driver function through connections 415 . similarly communications 417 may be enabled between wireless connectivity 309 , policy 315 and the soft mobile phone client 101 in the enhanced pc card 300 and the apis 403 , and the operating system 411 in the computer 409 . the enhanced cellular pc card 300 provides the voip client 305 , which may optionally include a phone graphical user interface ( gui ) implemented in a software module 401 a , and uma / gan 113 functionality . the pc 409 provides key i / o functions 407 required to complete a phone system 400 . optionally , the connection manager 413 may include a gui implemented in software 401 b that is capable of generating a gui interface on the pc 409 display . from an end user perspective , the system 400 would operate as follows : upon connection of the enhanced cellular pc card , the gui functionality would automatically be launched . typically , if the gui 401 a is in the enhanced cellular pc card 300 , this would be the case . by way of example , the gui 401 a may be a graphical representation of a cellular phone . this may automatically appear on the pc 409 display or may be discretely concealed in an icon on a toolbar that must be clicked to launch . alternatively , if the gui 401 b is part of the connection manager 413 , for example , as an application running on the os 411 in the pc 409 then a manual action by the end user may be required to launch the gui 401 b . with the gui 401 b launched and internet connectivity available ( wired or wireless ) via the pc 409 , the end user may proceed to make phone calls utilizing the method described below . while aforementioned gui is provided by way of example , one skilled in the art will recognize that other means for initiating or terminating a call may be used , such as text entry , software configured to automatically dial , or a handset or other peripheral that allows dialing or initiation and / or termination of a phone call . referring to fig5 , a method of making a voip phone call utilizing an enhanced cellular pc card 500 is described . the enhanced cellular pc card is first connected to the computer through a compatible interface ( block 501 ). the compatible interface may be usb , express card , mini card , or any interface capable of supporting data communications between the enhanced cellular pc card and the computer . when the enhanced cellular pc card is connected to the computer , the gui interface is launched in block 503 . the graphical user interface enables the user to operate the computer as if it were a phone . the graphical user interface may be a representation on the computer display of a cellular phone , or simply a dial pad , voice dialer or other type of display for placing or receiving a call . the graphical user interface may reside on the enhanced cellular pc card , in which case the act of connecting the card to the computer may automatically launch the gui . alternatively , the gui may reside within the connection manager software of the computer &# 39 ; s operating system , in which case the graphical user interface may be launched manually by the user at the computer . the voip client then checks to see if there is internet connectivity ( block 505 ). internet connectivity may be provided by the enhanced pc modem card &# 39 ; s radio frequency ( rf ) wireless capabilities , or alternatively , may be provided through another connection to which the computer has access , such as a hard wired network , or a wifi ® connection to which the computer has access by a wireless transceiver located somewhere other than the enhanced cellular pc modem card . if internet connectivity is available , the existing connection to the internet is used ( block 506 ). if no internet connectivity is detected , the cellular wireless capability of the enhanced cellular pc card is activated and a connection with the internet is established . once internet connectivity is established , the soft mobile client establishes the voip communication through the internet connection and provides voice calling via the soft mobile phone client , and the internet connection ( block 509 ). fig5 is an example of a selected policy , but other policies may result in different options , such as using a traditional switched circuit voice connection if one is available . although a uma / gan based soft mobile phone client approach may be used , additional approaches may be utilized . for example , a soft mobile phone client based upon the ieee 802 . 21 standard may be used . alternatively , the mobile phone soft client may use information associated with the policy to utilize aspects of the 802 . 21 standard . other protocols that enable voip , for example , session initiation protocol ( sip ) may be used . this configuration of wireless connectivity , soft mobile client , and policy may present a compelling offering to cellular operators as it provides the ability to market a single pc product , and maintain a good degree of control and manage the use of all wireless connectivity means collectively available in the enhanced cellular pc card and the computer into which the enhanced cellular pc card is inserted . although features and elements are described above in particular combinations , each feature or element can be used alone without the other features and elements or in various combinations with or without other features and elements . the methods or flow charts provided herein may be implemented in a computer program , software , or firmware incorporated in a computer - readable storage medium for execution by a general purpose computer or a processor . examples of computer - readable storage mediums include a read only memory ( rom ), a random access memory ( ram ), a register , cache memory , semiconductor memory devices , magnetic media such as internal hard disks and removable disks , magneto - optical media , and optical media such as cd - rom disks , and digital versatile disks ( dvds ). suitable processors include , by way of example , a general purpose processor , a special purpose processor , a conventional processor , a digital signal processor ( dsp ), a plurality of microprocessors , one or more microprocessors in association with a dsp core , a controller , a microcontroller , application specific integrated circuits ( asics ), field programmable gate arrays ( fpgas ) circuits , any other type of integrated circuit ( ic ), and / or a state machine . a processor in association with software may be used to implement a radio frequency transceiver for use in a wireless transmit receive unit ( wtru ), user equipment ( ue ), terminal , base station , radio network controller ( rnc ), or any host computer . the wtru may be used in conjunction with modules , implemented in hardware and / or software , such as a camera , a video camera module , a videophone , a speakerphone , a vibration device , a speaker , a microphone , a television transceiver , a hands free headset , a keyboard , a bluetooth ® module , a frequency modulated ( fm ) radio unit , a liquid crystal display ( lcd ) display unit , an organic light - emitting diode ( oled ) display unit , a digital music player , a media player , a video game player module , an internet browser , and / or any wireless local area network ( wlan ) or ultra wide band ( uwb ) module . | 7 |
fig1 a shows a non - limiting , exemplary fishing lure embodiment in accordance with the present invention . more specifically , fishing lure 1000 may comprise of a lip 1100 , a leading portion 1200 , a body portion 1300 , a trailing portion 1400 and at least one hook 1450 . each of said components being directly and / or indirectly engageable in such a way so as to provide a customizable fishing lure . for example , a first connection mechanism 1710 may be provided so as to engage lip 1100 to the leading portion 1200 . similarly , a second connection mechanism 1720 may be used to engage trailing portion 1400 to body portion 1300 . as may be appreciated by one skilled in the art , fishing lure 1000 may be constructed in a variety of ways when a variety of said components are provided . fig1 b shows an exploded view of fishing lure 1000 from fig1 a . as can be seen , first connection mechanism 1710 may comprise of a male connection portion 1710 a and a female connection portion 1710 b . similarly , said second connection mechanism 1720 may comprise of a male connection portion 1720 b and a female connection portion 1720 b . fig1 c shows the underneath view of fig1 a and fig1 d shows the underneath said of fig1 b . fig2 a shows another non - limiting , exemplary fishing lure embodiment in accordance with the present invention . more specifically , fishing lure 2000 may comprise of a lip 2100 , a leading portion 2200 , a body portion 2300 , a trailing portion 2400 and at least one hook 2452 . each of said components being directly and / or indirectly engageable in such a way so as to provide a customizable fishing lure . for example , a first connection mechanism 2710 which may allow lip 2100 to be engaged to leading portion 2200 , second connection mechanism 2720 may allow body portion 2300 to be engaged to trailing portion 2400 and a third connection mechanism 2730 which may allow leading portion 2200 to be engaged to body portion 2300 . accordingly , fishing lure 2000 provides yet an additional variable ( i . e ., third connections mechanism 2300 ) to give the fishing angler additional customizable configurations . additionally , fishing lure 2000 is shown with an optional second hook 2450 to provide yet another optional configuration . fig2 b shows an underneath perspective view of fishing lure 2000 from fig2 a . fig2 c - 2 f provide exploded views of fishing lure 2000 . fig3 a shows yet another non - limiting , exemplary fishing lure embodiment in accordance with the present invention . more specifically , fishing lure 3000 may comprise of a lip 3100 , a leading portion 3200 , a body 3300 , and a trailing portion 3400 . each of said components being directly and / or indirectly engageable in such a way so as to provide a customizable fishing lure . said lip 3100 may comprise a male connection 3710 a which is adapted to mate with a female connection portion 3710 b ; of course , one skilled in the art would appreciate that obvious variations of such mating connections may be incorporated . in addition , fishing lure 3000 may include a cavity portion 3800 to provide yet additional configuration options for the angler . said cavity portion may be used to house a variety of elements which will be discussed later in greater detail . fig3 b shows a perspective view of fishing lure 3000 . fig3 c shows an underneath , perspective view of fishing lure 3000 , wherein lip 3100 has not yet been inserted into leading portion 3200 . fig3 d shows an upper , perspective view of fishing lure 3000 , wherein lip 3100 is not yet been inserted into leading portion 3200 . fig3 d shows a side elevational view of fishing lure 3000 , wherein lip 3100 has been inserted into leading portion 3200 . fig3 f shows an upper , perspective view of lip 3100 . fig3 g shows an underneath perspective view of lip 3100 . fig3 h shows a right side elevational view of lip 3100 . fig3 j shows a front elevational view of lip 3100 . fig3 k shows a top view of the lip 3100 . said lip 3100 shown having a paddle - shaped design , although a wide variety of designs are contemplated herein . fig3 l shows a cross - sectional view of lip 3100 from fig3 k , wherein the male connection portion 3710 a may be further appreciated by one skilled in the art . fig3 m shows a front elevational view of fishing lure 3000 wherein lip 3100 having been inserted into leading portion 3200 . fig3 n shows a cross - sectional view taken a long line a - a of fig3 m . as can be seen , lip 3100 having a male connection portion 3710 a may be inserted and releasably engaged to leading portion 3200 and mated with female connection portion 3710 b . fig3 p shows a front elevational view of fishing lure 3000 wherein lip 3100 has not yet been inserted . fig3 p is provided to give further appreciation of the female connection portion 3710 b . female connection portion 3710 b may be further appreciated within cross - sectional view in fig3 q which is taken along cross - sectional line b - b within fig3 p . fig4 a shows yet another non - limiting , exemplary fishing lure embodiment in accordance with the present invention . more specifically , fishing lure 4000 may comprise of a lip 4100 , a leading portion 4200 , a body portion 4300 , and a trailing portion 4400 . each of said components being directly and / or indirectly engageable in such a way so as to provide a customizable fishing lure . said lip 4100 may be moved inwardly and outwardly from leading portion 4200 in such a manner as to change the amount of surface area exposed externally which may alter the movement properties of lure 4000 . for example , the more that said lip 4100 is externally exposed , the deeper that said lure 4000 may dive into the water upon being moved within the water . of course , one skilled in the art would appreciate that obvious variations of such inward / outward movement may be incorporated . further , one skilled in the art would appreciate that obvious variations of changing the amount of exposed surface area , pitch or angle may also be incorporated . accordingly , fig4 a and 4 b show a lever 4712 which may be actuated to cause stop 4714 to engage or disengage a first engaging surface 4717 so as to permit or inhibit the movement of said lip 4100 . as can be appreciated in fig4 c and 4 d , the lever mechanism 4710 may include a fulcrum 4713 that permits the actuation of lever 4712 . in addition , a second engaging surface 4719 may be include and adapted to engage with said first engaging surface 4717 to provide additional structural integrity and engagement locking . referring now to fig4 e and 4 f , said first engaging surface 4717 and said second engaging surface 4719 are shown to have mating grooves ; however , one skilled in the art would appreciate that obvious variations of mating surfaces may also be incorporated . additionally , fishing lure 4000 may also comprise a first connection mechanism 4720 which may be provided so as to engage leading portion 4200 to body portion 4300 and / or a second connection mechanism 4730 which may be provided so as to body portion 4300 to trailing portion 4400 . as may be appreciated by one skilled in the art , fishing lure 4000 may be constructed in a variety of ways when a variety of said components are provided . fig5 a - 5 c show a non - limiting , exemplary lip embodiment in accordance with the present invention . more specifically , lip 5000 may comprise of a ruder portion 5100 , a locking portion 5710 a , a reservoir inlet 5990 , a reservoir 5994 and a reservoir outlet 5992 . said lip 5000 may be filled with a substance ( e . g ., fragrant solution ) by introduction through reservoir inlet 5990 , temporary storage in reservoir 5994 and ultimate dispensing through reservoir outlet 5992 for dissemination into the water for attracting fish . locking portion 5710 a may be adapted to engage with the leading portion ( or like portion ) of the fishing lure . one skilled in the art would appreciate that obvious variations of shape , size , design , engagement , etc . may be incorporated . fig6 a - 6 c show a non - limiting , exemplary lip embodiment in accordance with the present invention . more specifically , lip 6000 may comprise of a ruder portion 6100 , a locking portion 6710 a , a reservoir 6994 and a reservoir elements 6990 . said reservoir 6994 may be occupied with said reservoir elements 6990 so as to provide altering properties of said lip 6000 . for example , reservoir elements 6990 may be round weights that are permitted to move about within said reservoir 6994 , wherein such movement causes the fishing lure to alter its overall movement . causing the fishing lure to move in such a manner may result in more life - like movement or minimally in a non - traditional manner that may attract fish . in another example , the inclusion of free moving components ( e . g ., glass beads , ceramic balls , plastic pellets , etc .) may contact each other and / or the inner walls of cavity 6994 causing the production of sound . this emitted sound can attract fish to the lure . locking portion 6710 a may be adapted to engage with the leading portion ( or like portion ) of the fishing lure . one skilled in the art would appreciate that obvious variations of shape , size , design , engagement , etc . may be incorporated . fig7 a - 7 c show a non - limiting , exemplary lip embodiment in accordance with the present invention . more specifically , lip 7000 may comprise of a ruder portion 7100 , a locking portion 7710 a , an illumination element 7290 , a power source 7294 and a source - to - illumination connection 7292 . said illumination element 7290 may be adapted to provide illumination which is visible to fish and thus attract them . said power source 7294 may be adapted to be disposable and / or replaceable . locking portion 7710 a may be adapted to engage with the leading portion ( or like portion ) of the fishing lure . one skilled in the art would appreciate that obvious variations of shape , size , design , engagement , etc . may be incorporated . in addition , one skilled in the art would appreciate that obvious variations of level , color , flashing , continuance , etc . for the illumination may be incorporated . fig7 d shows a non - limiting , exemplary lip embodiment in accordance with the present invention . more specifically , lip 7300 may comprise of a ruder portion 7305 , a locking portion 7310 a and a fracture section 7320 . locking portion 7310 a may be adapted to engage with the leading portion ( or like portion ) of the fishing lure . fracture section 7320 may be adapted so as to allow a ruder front portion 7305 f of the ruder portion 7305 to be broken away . for example , if the ruder front portion 7305 f were to get caught in underwater weeds , excess retraction force ( e . g ., pulling harder on the fishing rod ) may be exerted to cause rude portion 7305 to break along fracture section 7320 ; thus , ruder front portion 7305 f will be left stuck in the weeds while the remainder portion of the fishing lure may be retrieved . once retrieved , the broken lip may be replaced with a new lip . while this embodiment shows fracture section 7320 is shown as a fracture line , one skilled in the art would appreciate that obvious variations of shape , size , location , etc . may be incorporated . fig7 e shows a non - limiting , exemplary lip embodiment in accordance with the present invention . more specifically , lip 7400 may comprise of a ruder portion 7405 , a locking portion 7410 a and a pivoting section 7406 . locking portion 7410 a may be adapted to engage with the leading portion ( or like portion ) of the fishing lure . pivoting section 7406 may be adapted so as to allow a front portion of the ruder portion 7405 to be pivoted , as for example , between ruder portion positions 7405 a and 7405 b . such pivoting motion may provide more life - like lure retrieving motions or other desirable motions . fig7 f shows a non - limiting , exemplary lip embodiment in accordance with the present invention . more specifically , lip 7500 may comprise of a curved ruder portion 7505 and a locking portion 7510 . lip 7500 is provided to illustrate the various shapes and configurations of lips in accordance with the present invention , as appreciated by one skilled in the art . fig7 g shows a non - limiting , exemplary lip embodiment in accordance with the present invention . more specifically , lip 7600 may comprise of a flat portion 7605 and a locking portion 7610 . this particular lip 7600 may be used to plug the otherwise opening within the fishing lure in such a way to provide a lip with minimal exposure . when lip 7600 is used to plug said opening , the fishing lure can be retrieved with minimal resistance in the water , thus allowing said lure to raise more towards the top of the water . fig7 h and 7 i show a non - limiting , exemplary lip embodiment in accordance with the present invention . more specifically , lip 7700 may comprise a first lip portion 7705 a , a second lip portion 7705 b and a locking portion 7710 a . lip 7700 is adapted to be retrieved on a non - linear path back to the angler or fishing pole . such non - linear retrieve may be desirable , for example , when trolling . as can be appreciated from fig7 i , which is taken along cross - sectional line a - a within fig7 h , the first lip portion 7705 a may be tapered to increase drag on its side of lip 7705 as compared to the drag imparted on second lip portion 7705 b , thus causing lip 7700 to deflect on an angle when pulled through the water . with the teachings herein , one skilled in the art would appreciate that other lip designs causing differing drag may be used to cause the lure to retrieve in a non - linear manner . while the above embodiments have illustrated a variety of lip design in accordance with the present invention , one skilled in the art would appreciate additional lip designs which would be in keeping with the teachings of the present invention . for instance , the lips may vary in a variety of physical characteristics which may alter the fishing lure &# 39 ; s performance . for example , the lip may be made of a substantially heavy material so as to cause the fishing lure to dive deeply into the water . in another example , the lip may have a particular color ( s ) to match the desired fishing conditions ( e . g ., an injured fish ; fish spawning , etc .). in another example , the lip may be made to look like other body segments , for example , legs of a frog or transforming tadpole . while the above embodiments have been shown to have their connection portions exposed ( as exemplified in fig8 a ), one skilled in the art would appreciate that said connection portions may be substantially covered by connection covers 2750 , 2752 , as exemplified in fig8 b . for example , connection covers 2750 , 2752 may be constructed of a thermoplastic elastomer or any like material that has flexible properties . in addition , said connection covers may be made to appear as fish - like features including , but not limited to , gills , scales , injured portions , etc . . . . . further , said connection covers may be made to extend beyond the perimeter of the fishing lure so as to appear as fins or the like . still further , it should be noted that any section of the customizable fishing lure can be produced using molding techniques that incorporate multiple materials of construction . the combination of materials ( plastics , rubber , metal , ceramic , etc .) using molding techniques known in the art ( insert molding , co - molding , etc .) may allow optimization of the aesthetics , security of part fitment , scent retention , flexibility or optical qualities of the part ( s ). fig9 shows a non - limiting , exemplary fishing lure system embodiment in accordance with the present invention . more specifically , fishing lure system 8000 may comprise of at least one fishing lure 8102 , at least one lip 8203 and a package 8300 . in addition , fishing lure system 8000 may also comprise a communication 8600 which describes recommendations for combining fishing lures and lips for targeted fishing . fig9 shows a first fishing lure 8102 , a second fishing lure 8104 and a third fishing lure 8106 , wherein at least one of said lures is different from another . for example , lure 8106 is smaller than 8104 which is smaller than lure 8102 . labels 8302 , 8304 , 8306 which may be used to emphasis the difference between said lures . similarly , fig9 shows a first plurality of first lips 8203 , a second plurality of second lips 8205 and a third plurality of third lips 8207 , wherein at least one of said lips is different from another lip . for example , first lips 8203 are smaller than second lips 8205 which are smaller than third lips 8207 . labels 8403 , 8405 , 8407 may be used to emphasis the difference between said lips . lastly , package 8300 may also comprise of a panel 8500 having at least one hole 8502 which permit said package to be displayed on a peg board type display within a retail store . fig1 a and 10 b show a non - limiting , exemplary fishing lure system embodiment in accordance with the present invention . more specifically , fishing lure system 9000 may comprise a fishing lure 9300 having an extendable lip 9202 a , a backpanel 9100 and a package cover 9200 . referring now to fig1 a , extendable lip 9202 a is shown in a retracted position , wherein the amount of exposed lip surface area is minimized . referring now to fig1 b , extendable lip 9202 b is shown in an extended position , wherein the amount of exposed lip surface area is maximized . fishing lure system 9000 allows the shopping customer to feel and extend the lip prior to purchasing ; such a point - of - sale interaction should result in increased sales of said fishing lure systems . lastly , fishing lure system 9000 may also comprise of a backpanel 9502 having at least one hole 9504 which permits said package to be displayed on a peg board type display within a retail store . fig1 shows a non - limiting , exemplary fishing lure retail display embodiment in accordance with the present invention . more specifically , fishing lure retail display 9600 may comprise at least one fishing lure 9602 having an extendable tether 9612 , at least one lip 9622 and a communication 9650 which describes recommendations for combining fishing lures and lips for targeted fishing . fig1 shows a first fishing lure 9602 , a second fishing lure 9604 and a third fishing lure 9606 , wherein at least one of said lures is different from another . for example , lure 9606 is smaller than 9604 which is fatter than lure 9602 . tethers 9616 , 9614 , 9612 may be attached to said lures , respectively . similarly , fig1 shows a first lips 9622 , a second lip 9624 and a third lip 9626 , wherein at least one of said lips is different from another lip . for example , first lip 9622 is smaller than second lips 9624 which are smaller than third lip 9626 . tethers 9632 , 9634 , 9634 may be attached to said lips , respectively . as is illustrated , first lip 9622 can be moved from an initial position 9622 a to an engaged position 9622 b , wherein said tether 9632 can be extended from an initial position 9632 a to an engaged position 9632 b . fig1 shows a non - limiting , exemplary fishing product recommendation system having a user input interface embodiment in accordance with the present invention . more specifically , user input interface 9700 may be take a variety of forms including , but not limited to , an internet website , kiosk , point - of - sale communication and computer software . said interface 9700 may comprise of a communication 9710 which is directed at acquiring information to assist in a product recommendation 9720 or assistance . for example , communication 9710 may comprise of a variety of questions used to identify the recommend fishing lure system for the desired fishing experience . with said recommendation , the consumer can better select the right fishing lure system within the retail store . additionally , the consumer may be able to use such interface on the internet and then have the recommend products delivered . even further , after returning from the fishing trip , the angler can record which lures did better than others so as to track performance . the angler may also indicate which lures were lost so that a new product order may be initiated . with the teachings of this disclosure , one skilled in the art would appreciate other variations directed at achieving the overall result of educations , assisting and selling to the others . while particular embodiments of the present invention have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention . for example , one skilled in the art would appreciate that many of the disclosed features illustrated within the body of the fishing lure may also be applied to other segments of the lure , as exampled in fig1 a - c . more specifically , fig1 a shows the inclusion of rattles in each of the segments . fig1 b shows the inclusion of weights in each of the segments . fig1 c shows the inclusion of fluorescent materials in each of the segments . further , if each segment were made via a process that allowed a cavity within the part , a variety of other elements may be utilized including , but not limited to , sound producing mechanisms , light emission , or weight / weight differential mechanisms . for example , one skilled in the art would appreciate that the segments of the fishing lure may be produced from one or more materials incorporating varying rigidity , flexibility , weight and / or buoyancy . further , materials that exhibit ecological advantages , such as polylactic acid ( pla ) that will biodegrade overtime if lost into the water , may be incorporated . even further , materials that are made from post consumer recycle substances may be incorporated as such fact is often deemed desirable to the common nature - loving angler . for example , one skilled in the art would appreciate that the segments may be engaged in a variety of configurations . for example , hooks may be placed on a variety of locations ( trailing portion , body , leading portion , etc .). for example , male and female connections may be reversed . further , other suitable types of connections may be used to engage segments . for example , one skilled in the art would appreciate that the segments may be of varying sizes , lengths and designs . for example , the lip may be designed to extend beyond the leading portion , extend equal to the leading portion and / or extend short of the leading portion . fishing lures with such varying lips are often referred to as different types of bait ( e . g ., poppers having short lips to cause the lure to remain on the surface or “ pop ” via the trapping of air between an upwardly exposed “ cup shaped ” lip and the water surface ; crank baits having longer lips to cause the lure to dive , etc .). further , one skilled in the art would appreciate that the benefits of the present invention may be applied to other lures used in fishing ; for example , lures commonly referred to as jig or spinner lures . see fig1 a - 14 c for non - limiting , exemplary embodiments . the lures in fig1 a - 14 c comprise a leading portion 9802 , a trailing portion 9804 and a connection mechanism 9806 which releasably engages said leading portion and said trailing portion . despite the often different fisherman and / or fishing conditions between traditional crank bait and jigs , the embodiments of the present application demonstrate how the benefits of the present invention may be appreciated in a variety of lure types . for example , one skilled in the art would appreciate that a variety of connection mechanisms may be used in keeping with the teachings of the present invention . for example , fig1 a - 15 b show a non - limiting , exemplary embodiment of a fishing lure having a trailing portion and body connection mechanism which allows swivel or pivoting motion during travel through water . more specifically , fig1 a shows said embodiment in a pre - engaged position and fig1 b shows said embodiment in an engaged position . said connection mechanism 9811 may be comprised of a first connection portion 9811 a and a second connection portion 9811 b that are releasably engageable so as to permit engagement and disengagement without the need of a special tool such as a screw - driver or pliers . fig1 c - 15 e show non - limiting , exemplary embodiments of first connection portions . fig1 - 17 show a non - limiting , exemplary fishing lure embodiment in accordance with the present invention . more specifically , fishing lure 9901 may comprise of a lip 9915 , a left body portion 9905 , a right body portion 9910 ( left and right body portions together being called fishing lure body 9902 ), a front eyelet 9920 to receive a hook , a mid eyelet 9922 to receive a hook , a rear eyelet 9924 to receive a hook , and an optional rubber gasket 9930 . each of said components being directly and / or indirectly engageable in such a way so as to provide a customizable fishing lure . as may be appreciated by one skilled in the art , fishing lure 9915 may be constructed in a variety of ways when a variety of said components are provided . fig1 a - 18 b show the left body portion 9905 with a fin 9906 that facilitates a subsequent connection to ridges 9911 of the right half body 9910 of fig1 a - 19 b by way of an ultrasonic weld or other like connection technologies . fig2 a shows a top view of the lip 9915 of fig1 . stem portion 9916 of lip 9915 is adapted to be inserted and rotated inside fishing lure body 9902 . the amount of rotation may vary , but it is preferred that the amount of rotation needed to lock lip 9915 into fishing lure body 9902 is no greater than 360 degrees and more preferably no greater than 90 degrees of rotation . protrusion portion 9917 is adapted to engage and lock lip 9915 into fishing lure 9902 . fig2 b shows a perspective , right - side view of the lip 9915 of fig2 a . fig2 c shows a bottom view of the lip 9915 of fig2 a . fig2 d shows a rear view of the lip 9915 of fig2 a . fig2 e shows a perspective , left - side view of the lip 9915 of fig2 a . fig2 f shows an elevational , right - side view of the lip 9915 of fig2 a . lip 9915 may be constructed as different sizes and / or weights . a kit could be provided with one or more fishing lure bodies 9902 and multiple lips 9915 wherein said lips have different physical properties ( e . g ., weights ) to provide the user with an array of different customizable lures . lip 9915 could be made to be porous so as to emit a liquid ( not shown ; fore example , a scent that attracts fish ) from inside the body 9902 . lips 9915 of varying physical characteristics could be distinguished from one another in various ways including , but not limited to , different colors , raised dots for tactile differentiation ; surface indicia (“ shallow ”, “ mid ”, “ deep ”). fig2 a shows a bottom view of the fishing lure body 9902 of fig1 with the lip 9915 is removed . fig2 b shows a rear , perspective view of the lip 9915 of fig1 that is adapted to be engaged with the fishing lure 9901 of fig2 a . fig2 a shows a front , elevational view of the fishing lure body 9902 and lip of fig1 wherein the lip 9915 is being positioned for subsequent engagement into the fishing lure body 9902 . fig2 b shows a front , elevational view of the fishing lure body 9902 and lip 9915 of fig1 wherein the lip 9915 has been inserted into the fishing lure body 9902 but not yet rotated into a locked position . fig2 c shows a front , elevational view of the fishing lure body 9902 and lip 9915 of fig1 wherein the lip 9915 has been inserted into the fishing lure body 9902 and rotated into a locked position ; fig2 a shows an elevational , right - side view of the left half body 9905 and lip 9915 of fig2 a . fig2 b shows an elevational , right - side view of the left half body 9905 and lip 9915 of fig2 b . fig2 c shows an elevational , right - side view of the left half body 9905 and lip 9915 of fig2 c . fig2 a shows an close - up view of the left half body 9905 and lip 9915 of fig2 a wherein keyway 9940 is adapted to receive , engage and lock lip 9915 into fishing lure body 9902 . fig2 b shows an close - up view of the left half body 9905 and lip 9915 of fig2 b . fig2 c shows an close - up view of the left half body 9905 and lip 9915 of fig2 c . fig2 a shows a cut - away view of the left half body 9905 and lip 9915 of fig2 a wherein the lip is inserted but not yet rotated . fig2 b shows a cut - away view of the left half body 9905 and lip 9915 of fig2 b wherein the lip 9915 is inserted and partially rotated to an interference point to provide the user with a signal that the rotation is near its completion and nearing to be locked into place . fig2 c shows a cut - away view of the left half body 9905 and lip 9915 of fig2 c wherein the lip 9915 is inserted and rotated to a locked position . fig2 a shows a cut - away view of the left half body 9905 and lip 9915 of fig2 c wherein a gasket 9950 is used to further secure the connection between the lip and fishing lure body . fig2 b shows a perspective view of the lip 9915 and gasket 9950 of fig2 a . gasket 9950 may be optional used to provide greater resistance for improved force - fit connection of lip 9915 and fishing lure body 9902 . gasket 9950 may be constructed of rubber or any other suitable materials . fig2 shows a cut - away view of the left half body 9905 containing a reservoir element ( e . g ., ball bearing that may produce a wabble movement for the fishing lure ). left half body 9905 may comprise a raised internal portion 9965 that is adapted to temporarily contain at least one reservoir element 9960 until such time that said lip 9915 can be inserted to permanently contain one or more reservoir element 9960 . reservoir elements may include , but are not limited to , weights , glass beads , ceramic balls , plastic pellets and any combinations thereof . a significant benefit of the exemplary embodiment depicted in fig1 is that it does not require a squeezing action on the part of the user in order to engage or disengage the lip 9915 from the body 9902 . such squeezing action can be difficult to perform when the lure is wet , weather is cold ( especially with gloves ) and / or the sunlight is limited , especially when one considers that sharp hooks are part of the lure . further , this embodiment does not require the lip to be rotated more than 360 degrees which can also be difficult under similar circumstances . | 0 |
fig1 shows a driving range 10 that includes at least one hitting station 100 , at least one golf ball 110 , at least one golf club 120 , and a range surface 200 . the hitting station 100 is positioned at one end of the range surface 200 . it will be understood that a player 300 standing in the hitting station 100 may swing the golf club 120 to hit the golf ball 110 over and onto the range surface 200 . turning to fig2 , shown therein is the path that the golf ball 110 travels from the point of impact with the golf club 120 ( referred to as the origination point 160 ) to the point that the golf ball 110 initially impacts the range surface 200 ( referred to as the impact point 170 ). the path the golf ball 110 travel from the origination point 160 to the impact point 170 is referred to as the flight path 130 . the path that the golf ball 110 travels from the impact point 170 to the point it comes to rest on the range surface 200 ( referred to as the resting point 180 ) is referred to as the ground path 140 . the total travel path 150 refers to the complete path that the golf ball 110 travels after the origination point 150 to the resting point 180 , and is equivalent to the combination of the flight path 130 and the ground path 140 . fig2 and 3 depict the flight path 130 , ground path 140 and total travel path 150 of a golf ball 110 . turning back to fig1 and 2 , in accordance with a preferred embodiment of the present invention , therein depicted is a preferred embodiment of a multiple sensor tracking system specially configured to track the total travel path 150 of the golf balls 110 used at a driving range 10 and to display that total travel path 150 to the player 300 . the multiple sensor tracking system preferably includes a plurality of sensors 410 , 420 , and 430 , a display 450 , and a computer having a processor and a database . each sensor in the plurality of sensors is configured to record certain parameters about the total travel path 150 . such parameters may include , without any limitation , the detection of the moment of impact , the origination point 150 , the launch angle of the flight path 130 , side spin of the golf ball 110 , vertical spin of the golf ball 110 , initial location of the golf ball 110 , the impact point 160 , speed / velocity of the golf ball 100 on the flight path 130 , the three - dimensional coordinates of the flight path 130 , the three - dimensional coordinates of the ground path 140 , and the resting point 180 . in addition , certain sensors may be configured to detect other parameters related to the golf swing of the player 300 , including but not limited to the club path and the club speed / velocity . it will be understood that by those skilled in the art that there are numerous types of sensors and technologies available for the detection of parameters , including for example and without limitation , infrared beam sensors , radar sensors , pressure sensors , sound sensors , laser sensors , and cameras ( both infrared and visible light ). it will be further understood that certain sensors are capable of detecting a subset of the total parameters available about the total travel path 150 . for example , infrared beam sensors are particularly well - suited for detecting the moment of impact , but are not able to detect or otherwise determine the side spin of the golf ball 110 , the impact point 170 , or other similar parameters . in contrast , sophisticated camera sensors are available that are well - suited to determine the parameters related to the flight path 130 , such as direction , speed and the impact point 170 , but are not as accurate at determining parameters associated with the ground path 140 , such as the resting point 180 . by way of further example , radar sensors are particularly well suited to detect the side spin and vertical spin of the golf ball 110 on the initial flight path 130 , as well as the club path and club head speed , but unable to determine parameters associated with the ground path 140 . in addition to being configured to detect certain parameters , each sensor type also has a field of detection . the field of detection is the general area in front of the sensor from which the sensor can detect parameters . it will be understood that the field of detection can be adjusted for each sensor type , but may be restrained by the particular technology used to detect parameters . furthermore , the position of each sensor may affect its field of detection . for example , fig2 depicts a sensor 410 positioned in the back of a hitting station 100 , with a field of detection 411 . in such a position the sensor &# 39 ; s 410 view of the flight path 130 can be obscured by the golfer , or the divisions between each of the hitting stations 100 . such obstructions often adversely impact a sensor &# 39 ; s ability to detect parameters . a key improvement of the invention is the placement of other sensors in the plurality of sensors such that their respective fields of detection 411 , 421 , and 431 are not similarly obstructed . it will be therefore understood that such placements can thereby ensure a high probability that the combined fields of detection 411 , 421 , and 431 provide for an uninterrupted view of the total travel path ( 150 ). for example , in the preferred embodiment depicted in fig2 , the fields of detection 411 , 421 and 431 for each of the sensors 410 , 420 and 430 respectively are shown to overlap , yet cover different areas where the golf ball 110 might travel on the total travel path 150 . it will be understood that numerous embodiments of the multiple - sensor tracking system are possible by including different types of sensors 410 , 420 , 430 in the plurality of sensors , and positioning those sensors at different places within the driving range 10 . fig2 depicts one such preferred embodiment . it will be further understood that a driving range 10 may include a plurality of hitting stations 100 arranged in a curve around an end of the range surface 200 , as depicted in fig4 . a first - type sensor 410 is positioned at the back of each of the hitting stations 100 . in this embodiment , the first - type sensor 410 uses radar to detect club path , club face angle , launch angle , side spin , vertical spin and initial velocity . a second - type sensor 430 is positioned at another end of the range surface 200 , and is generally positioned to face a plurality of hitting stations 110 , as shown in fig4 . the second - type sensor 430 has a narrower field of detection 431 and is thus used to detect parameters related to the ground path 140 . in this embodiment , the second - type sensor uses narrow - angle cameras to detect the three - dimensional coordinates of the ground path 140 and the speed / velocity of the golf ball 110 . it will be understood that while only one sensor 430 is depicted in this embodiment , several second - type sensors 430 could be used in combination to detect parameters for ground paths 150 that occur in different places on the range surface 200 . in the depicted embodiment , two third - type sensors 430 are positioned at opposite ends of the plurality of hitting stations 100 . the third - type sensors are configured to face inwards towards the range surface 200 and have overlapping fields of detection 421 . such overlapping fields of detections 421 are either necessary for certain types of sensors , or can be optionally employed to improve the accuracy of the detected parameters . turning to fig3 and 4 , depicted therein are alternate preferred embodiments of the multiple - sensor tracking system wherein the first - type sensors 410 of the first preferred embodiment depicted in fig1 and 2 have been replaced with a fourth - type sensor 460 . it will be understood that in the depicted alternative preferred embodiments , the fourth - type sensor 460 is configured to be a simple infrared directional trip sensor . such sensor 460 includes a beam emitter and a beam detector positioned on opposite sides of the hitting station 100 . in the simplest embodiment , the beam emitted of sensor 460 sends an infrared light beam to the other side of the hitting station 100 where it is detected by the beam detector . it will be further understood that when the golf ball 110 is hit it will travel between the beam detector and the beam emitter of sensor 460 , and will thereby interrupt the infrared light beam being detected by the beam detector . in this manner , sensor 460 is able to identify when the flight path 130 begins , but is unable to detect other more advanced parameters associated with the total travel path 150 . the database of the computer stores all parameters necessary for the multiple - sensor tracking system , which may include the size , shape and location of the hitting station , the location of each of the sensors in the plurality of sensors , the parameters that each of the sensors in the plurality of sensors can detect , the location and boundaries of the range surface 200 , and the number , expected distance and trajectory of shots hit with the selected golf club 120 . such parameters are retrieved by the processor as needed to operate the multiple - sensor tracking system . it will be understood that by using multiple sensors 410 , 420 , and 430 ( or alternatively 460 , 420 and 430 ), the multiple - sensor tracking system is able to capture certain desired parameters of the total travel path 150 . because the sensors 410 , 420 and 430 may detect the same parameters , a method is necessary to determine which parameters should be chosen to depict the total travel path 150 on the display 450 . fig5 depicts a method for making such determinations . the method of fig5 begins in step 500 when the golf ball 110 is struck by the golf club 120 . the moment of impact is potentially detected by sensor 410 in step 504 ( or alternatively by sensor 460 as described above ). if sensor 410 detects the moment of impact , processing is transferred to step 506 . in step 506 , the computer uses the launch angle , initial velocity and origination position to estimate three - dimensional coordinates of the flight path 130 and an estimated impact point 170 . in the first preferred embodiment , the launch angle , initial velocity and origination position are all parameters that can be detected by sensor 410 . processing is then passed to step 508 . the purpose of step 508 is to determine if the sensors 420 have detected a golf shot that corresponds to the golf shot that was detected by the sensor 410 from step 504 . this is done by comparing the estimated three - dimensional parameters from step 506 with the actual three - dimensional parameters detected by the sensors 420 . it will be understood that in the typical driving range 10 there may be several different golf shots being tracked at any given time , such as those depicted in fig4 . in the preferred embodiment , sensors 420 may detect actual three - dimensional parameters for many if not each flight path 130 associated with each such golf shot . accordingly , in step 508 , the computer first collects the actual three - dimensional parameters associated with each flight path 130 that was detected by sensors 420 during the time window when sensor 410 captured the parameters that were processed in step 506 . the particular duration of the time window may depend on the types of sensors used , the weather conditions , the particular arrangement of the plurality of the hitting stations 100 on the driving range 10 , the size and shape of the range surface , the positioning of the plurality of sensors , or any other condition that might effect the amount of time that a golf ball 110 could be expected to travel in each of the respective fields of detection 411 , 421 , 431 . after capturing the actual three - dimensional parameters of the flight path 130 for the appropriate time window , the computer then compares such actual three - dimensional parameters for each flight path 130 with the estimated three - dimensional coordinates of flight path 130 and determines if any of the actual three - dimensional parameters correspond to the estimated three - dimensional parameters . such correspondence may be immediately apparent because the actual three - dimensional coordinates overlap a portion of the estimated three - dimensional coordinates . alternatively , where the actual three - dimensional coordinates do not begin with actual origination position , the computer can calculate an estimated origination position 160 by extrapolating the three - dimensional parameters of the flight path 130 backwards . the estimated origination positions 160 ( and actual origination positions 160 detected by the sensors 420 to the extent they exist ) for each of the flight paths 130 are then compared to the actual origination position 160 detected by the sensor 410 . if a corresponding actual / estimated origination position 160 detected by sensors 420 is found for the actual origination position 160 detected by sensor 410 is found , then processing proceeds to step 510 . if no corresponding actual / estimated origination position 160 is detected by sensors 420 , then processing proceeds to step 514 . in step 514 the flight path 130 is depicted on the display 450 using the three - dimensional parameters detected by sensor 420 . in step 510 the flight path 130 is depicted on the display 450 using the three - dimensional parameters detected by sensor 410 , or where sensor 410 did not detect three - dimensional parameters for the entire flight path 130 , the computer will estimate any missing three - dimensional parameters by extrapolating the detected three - dimensional parameters along a parabolic curve . processing is then transferred to step 516 wherein sensor 430 potentially detects parameters associated with the ground path 140 of the golf ball 120 . if sensor 430 detects parameters associated with the ground path 140 , then in step 520 , the total travel path 150 is depicted as continuing from the depicted flight path 130 using the parameters for the ground path 140 detected by sensor 430 . it will be understood that in a typical driving range 10 , sensor 430 may detect parameters for the ground path 140 of many different golf shots ( as shown in fig4 ). accordingly , in step 516 the computer will attempt to align the parameters for the ground path 140 with the corresponding flight path 130 . this is accomplished by taking the three - dimensional parameters used to depict the flight path 130 and calculating an estimated impact point 170 . if sensor 430 detects parameters for the ground path 140 that correspond to the estimated point of impact , then processing proceeds to step 520 . if sensor 430 does not detect parameters that correspond to the estimated impact point 170 , then processing proceeds to step 518 . in step 518 , the computer calculates parameters for the ground path 140 and depicts that ground path 130 on the display 450 . this calculation is done by using the parameters used to depict the flight path 130 , which may include an actual / estimated speed / velocity and direction as well as parameters that describe the effect of the friction between the range surface 200 and the golf ball 130 . in step 520 , the ground path 130 is depicted on the display 450 using the actual parameters for the ground path 130 that were detected by sensor 430 . if sensor 410 fails to detect the moment of impact in step 504 , then processing moves to step 512 wherein sensor 420 potentially detects parameters associated with the flight path 130 . if sensor 410 fails to detect the moment of impact , but sensor 420 detects parameters associated with the flight path 130 , then processing is transferred to step 514 . if sensor 410 fails to detect the moment of impact and sensor 420 fails to detect any parameters associated with the flight path 130 , then processing returns back to step 500 . it is to be understood that even though numerous characteristics and advantages of various embodiments of the present invention have been set forth in the foregoing description , together with details of the structure and functions of various embodiments of the invention , this disclosure is illustrative only , and changes may be made in detail , especially in matters of structure and arrangement of parts within the principles of the present invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . it will be appreciated by those skilled in the art that the teachings of the present invention can be applied to other systems without departing from the scope and spirit of the present invention . | 6 |
monte carlo tracks each discrete particle history exactly and develops a stochastic result using hundreds of millions ( if not billions ) of exact particle histories ( e . cashwell & amp ; c . everett , the practical manual on the monte carlo method for random walk problems , pergamon press ( 1959 )). the present invention inverts this process by defining discrete particles that occupy computer memory in a detailed phase space — essentially representing millions of distinct phase space particle count values . stated otherwise , the present invention exactly and efficiently computes distributed phase space discrete particle transport to local surfaces , function coefficients and volumes , reducing the results of these calculations to a multiplication field appropriate for each surface , function coefficient and volume . the approximation involved in the calculation is the assumption that the increment of the discrete particle itself is truly constant . thereafter , “ exact ” calculations are used to determine generalized field transport multipliers in a local area to create continuity , with extensions to a generalized area . discrete particles emanating from surfaces and volumes are directly “ wired ” to lvg neighboring surfaces , function coefficients and volumes through multiplier , voxel pointer pairs — to provide a near exact local solution of particle transport ( the assumption being the constancy of the discrete particle itself ). the lvg provides a local exact solution that reduces the particle count contribution from a local reference voxel volume or surface to external voxel volumes and surfaces . this provides the accuracy required to tackle three - dimensional problems , as opposed to imbedded invariants methods that break down past one dimension . the lvg multiplier field greatly reduces ray effects as particles are properly distributed in a local system . those particles that are not distributed within the lvg are attenuated and emanate from the lvg surface . the distribution of particles emanating from a surface may be explicitly tracked either through a direct tally process or function deposition in a least squares sense to determine the angular distribution at the surface interface . in a similar fashion , function coefficient tallies may be used with complex interaction models to allow for high order particle scattering , for example anisotropic p 5 . a ray set concept is introduced to the phase space of the discrete particles to provide accurate lvg - to - lvg surface interface transport of particles , further improving accuracy . the computer memory system is then swept , allowing discrete particles to conceptually travel from surfaces to surfaces , from surfaces to volumes , from volumes to surfaces and from volumes to volumes in an abstract sense using the transport multiplier / pointer system ( fig7 block 4 ). any number of possible interaction models ( for example , simple nuclear particle mono - energetic isotropic scatter , or multigroup , anisotropic scatter ) are then employed to adjust particle interaction within volumes and make appropriate phase space adjustment to continue particle transport sweeps ( fig7 blocks 4 , 5 and 6 ). the instant invention can itself be used to create an appropriate interaction model . by decoupling interaction from multiple collision transport , exact direct local analytic solutions along ray paths through voxels are possible . the interaction model then serves to produce new voxel discrete particle sources for further discrete particle transport sweeps . thus by employing exact transport solutions of approximate discrete particles , high accuracy is achieved through the use of many phase space particles . single multipliers are employed within the lvg , providing direct non - stochastic results very quickly . the fundamental difference between this method and a classic green &# 39 ; s function approach [ r . d . lawrence and j . j . doming , a nodal green &# 39 ; s function method for multidimensional diffusion calculations , nuclear science and engineering 76 , 218 – 231 ( 1980 )] is that a green &# 39 ; s function solves a boundary value problem either over the entire time domain and all scattering interactions moments , and is therefore constrained to boundary conditions . whether one solves a 1 - d or multidimensional green &# 39 ; s function response , the green &# 39 ; s function describes all events that occur between two points over time . in the present invention , the one - dimensional first flight collision solution is a transport solution with a vacuum boundary that is irrelevant in terms of time . as a result , there is no approximation ; it is a true transport solution . an outer iteration and separate interaction model account for scattering interactions and reaction rate / transient variables . the green &# 39 ; s function approach creates a full matrix response that includes scatter and as a result approximations such as modified diffusion theory must be made . what the present invention and green &# 39 ; s functions share is location coupling . however , the present invention provides far greater accuracy by separating out the scatter component in a separate time and scattering iteration . the use of discrete particle definitions completely differentiates the present system from all prior art . furthermore , the reduction of ray set data to form memory pointer / multiplier pairs is also unique to the instant invention , as is the use of ray sets δ to provide extensions for accurate lvg - to - lvg particle transport . the figures contained herein sequentially describe the invention and the manner in which it may be utilized to overcome the problems in the prior art . set forth below is a description and explanation of each figure . this figure presents a simple depiction of a finite incremental surface traversed by a representative particle on a particular ray . ray tracing from volumes to surfaces may deposit particles uniformly on the smallest incremental surface . rays emanating from surfaces may be assumed to proceed from the surface center , losing some information . alternatively , in a pre - compute variant of the instant invention , surface distribution of rays may be uniform across the surface . the angular representation of particles across rays may be explicit for all angles for each incoming ray set . alternatively , particles from volumes to surfaces may be deposited to function coefficients constructed from a least squares error matrix to provide for surface data compression ( see fig6 description ). as an alternative refinement to the present invention , function coefficients may also be used to determine detailed spatial particle distributions across a single surface , sub - surface or plurality of surfaces . these methods are discussed in greater detail in the fig6 description . this figure graphically illustrates the voxel and grid system concept . voxels may be regular or irregular in shape , as depicted . voxels may be of a homogenous material , or they may be bounded surfaces with heterogeneous sub - voxels within a larger system of grids . in the latter case , the voxel response is specified by the surface interface . a heterogeneous voxel may be generated by the present invention , and embedded into a grid system . in such a case the surface surrounding the embedded voxel acts as an interface between that voxel and the remaining grid system . furthermore , the embedded voxel may be composed of sub - voxels with like or differing angular ray set distributions ( see fig6 description ). when sub - voxels or a single voxel are used in such a manner , that sub - system is considered a local voxel group , lvg as defined above . this figure shows representative rays emanating from a surface point on a 2d plane . each ray is traced with coupling multipliers associated with the source surface . the appropriate integration kernel is applied for each ray trace to accumulate surface to position multipliers in this depicted case . this figure illustrates that multiple rays with identical angle and surface state values δs and δω , may emanate from sub - surfaces following various paths through a system of voxels . these pathways are combined to form single multipliers from the surface to each surrounding node , though many rays may emanate from the surface . the combination of multiple rays to a single multiplier greatly improves processing time without sacrificing accuracy . pre computation of sets of rays traversing a regular system of voxels may be used to improve processing speed in regular systems ( see fig7 ). this figure illustrates the bounding of a group of voxels to form a local voxel group . it is preferable in this 2d depiction , that the inner group of voxels is completely isolated from the outer group . in such a case , ray tracing and coupling from within the lvg terminates on the bounding surfaces , and ray tracing from outside the lvg terminates on the boundary . this isolation provides a practical mechanism for changing out individual voxels or voxel groups to arbitrary resolution . it is preferable to maintain a consistent ray set angular dependence within and without a ray - set if enough memory exists to do so . alternatively , one may map differing angular ray - set distributions from within and without the lvg boundary . as a further refinement , one may utilize direct function coefficient deposition to provide a generalized δω translation mechanism ( described below ). this figure illustrates the data relationship of the pointer / multiplier pairs and sets of the present invention . in the present invention , the pointer within the pointer / multiplier table refers to either a remote voxel interaction score terminal , a discrete surface terminal or a set of function coefficient terminals . as a preferred embodiment of the present invention , referential hash tables may be used as illustrated in this figure to reference particular ray sets with pointers on a grid position basis . there are various ways of accomplishing this particular task , and a variety of data structures may be used . depicted in this figure is the preferable light memory footprint data structure containing ray - set indices associated with particular remote pointers . the value of this preferred embodiment is that one can quickly change out remote voxel interaction points , surfaces and functions with a minimum of processing steps when reference is made to ray - set indices . for example , when changing out a particular position interaction point , all pointers associated with that point are identified , and all ray sets from all positions passing through that point are recomputed to affect the material property change . use of hashing techniques as depicted , relating ray sets to terminal pointers , speeds processing of the material change out . the pointer transport multiplier table of the present invention can be established using a ray tracing technique from particular points within voxels or surfaces of voxels . such a ray tracing technique can take two forms , generalized with established angular sets or point to point . it may also be accomplished using a pre - computed representative ray - set scheme ( see fig7 detail ). in both the point to point and pre - computed cases , uniform distribution of points within voxels and surfaces are used in combination with an appropriate angle distribution p ( ω ) are used to accumulate the representative ray set multipliers . angular weights are back calculated as discussed in the description of fig7 for these examples . for the forward ray - tracing technique , from a voxel interaction point , transport multipliers are accumulated by using a number of points within each voxel representing the interactions within the voxel . each point is given both a spatial weight , representing the volume represented by the point , and a position . judicial selection of positions and weights is used to minimize mathematical operations associated with each point . for each ray trace , the unique direction of the ray is ascertained and the ray is further weighted by the solid angle represented by the particular ray . in general , this is found as w δω = sin ( θ ) δθδφ / 4π as decomposed in polar , azimuthal spherical coordinate form where w δω represents the discrete angular weight . the problem appropriate integration kernel is applied representing attenuation through the system of voxels to further reduce the multiplier weights . in all cases , the transport multipliers are accumulated for each representative ray or a set of representative rays ( fig3 ) tracing through the system of voxels . weighting for both discrete surfaces and single voxel interaction points for accumulation uses the straightforward single collision integration kernel as accumulated on each ray trace pathway . as a preferred embodiment of the present invention , the transport / multiplier system of fig6 is typically generated with a hash table referring to the pointers for fast access . the multipliers are simply accumulated as a function of ray set and starting point . the functional coefficient deposition is a preferred embodiment of the present invention that may be generated in a number of ways and has two modes of use . each deposition to a functional coefficient is accumulated through the weighting of both the straightforward single collision integration kernel and an appropriate functional weight for each ray - set contributing to the coefficient . function coefficient deposition may be predetermined in the pre - compute option , and the weights are generally computed only once for any given grid system . to accumulate a functional coefficient , the preferred method is to compose a least squares error matrix which is the inverse of the curvature matrix ( see p . r . bevington , data reduction and error analysis for the physical sciences , page 153 , mcgraw hill book company , ( 1969 ) library of congress catalogue number 69 - 16942 ) associated with each ray set angle that contributes to a set of coefficients . it is well known in mathematics that given an orthogonal function , one can generate a coefficient matrix relating particular independent parameter sample points ( such as indexed representative ray set direction parameters ) using a least squares approach . this represents the weighting appropriate to deposit a particular sample function point to a particular coefficient . consider for example the well - known case of a spherical harmonic basis function : y 1m ={( 21 + 1 )/ 4π ( 1 − m )!/( 1 + m )! p 1m ( cosθ ) e imφ } 1 / 2 where p 1m ( cosθ ) is an associated legendre polynomial and i in the above polynomial represents an imaginary number . the construction of an angular function representing particle tallies as a function of discrete bins is f ( θ , φ )= σ 1 σ m c 1m × y 1m ( θ , φ ) where formally the summation of 1 is from 0 to ∞ and the summation of m is from − 1 to + 1 . as it is known before hand all possible sample point independent parameters ( these are discrete ray set values of angles or direction cosines ), one constructs a least squares weighting matrix by linearizing the coefficient matrix c 1m to a convenient form c j . one then constructs a coefficient weight matrix over i raysets as : wij = ∑ k ( y t y ) - 1 y t where w ij represents the weight appropriate for each ray set direction i for j , x linearized coefficients and where y = y 00 1 y 00 2 y 00 3 … y 00 n y 1 ( - 1 ) 1 y 1 ( - 1 ) 2 y 1 ( - 1 ) 3 … y 00 n … y lm 1 y lm 2 y lm 3 … y lm n y 00 i = y 00 ( θ i , ϕ i ) with each function evaluated at each i point from 1 to n . the k summation reducing the symetric square coefficient matrix is possible because the evaluation of the function in the transport sweep is always performed at known points . the resulting weighting matrix is used to modify transport multipliers for each ray accumulated to function - coefficient pointer / transport multiplier terminals c j . these linearized coefficients correspond to c 1m so that the function f ( θ , φ ) can be re - constructed with least squares fitting accuracy . the weights , w ij do not depend on actual values of f ( θ , φ ) but rather the known sample points θ i , φ i associated with each particular rayset contributing to n transport multipliers associated with the linearized function coefficients . the function is fully constructed in the transport problem sweep : c j = ∑ v t v * ∑ i g iv * w ij where v represents each voxel contributing to a particular terminal , g iv is the contribution from voxel v to the tally where the coefficients are accumulated , and the summation over all relevant n angles was computed as part of the transport multiplier process in a setup calculation ( fig7 block 2 or 2 a ). the summation over each v voxel with t v initial tally score at a voxel volume location is made during the transport sweep ( fig7 block 4 ). thus given a scattering or source tally at a location , and the computed transport multipliers represented by the coefficients compress the operations and explicit tally angles required from n ( summation over i ) explicit angular sets to smaller number of coefficients ( for example , there may be 4000 angles on a side for an extreme ray effect problem , but only 36 coefficients for a p 5 surface harmonic approximation ). or it may represent the compression from n surfaces to coefficients or other functional state values of interest . it must be remembered that while a function is being used for data compression , it is formally a function of discrete tallies . actual transport multipliers still proceed from surfaces using an explicit fine - grained discrete tally ray - set structure . the function only serves to translate ray set angular systems at a surface boundary , or compress data . for the example case of a solid spherical harmonic function , the utility and first mode of use is obvious . rather than depositing to a single interaction tally within a voxel , appropriate only for modified p 1 scattering the spherical harmonics function form allows for higher order anisotropic p n scattering in any given interaction voxel . it is traditional to use spherical harmonics functions of this sort for higher order scattering computation . high order double differential scattering data comes in forms that are readily amenable for use with such a representation . the second mode of use of this embodiment is as a data compression scheme for surfaces . this alleviates the need for thousands of individual ray set accumulators on lvg surfaces to exactly represent the angular deposition distribution from voxels to surfaces . rather than having a huge number of individually tracked i ray sets accumulate at a boundary , one only needs c j coefficients , which aggregate many different i ray set angles . in so compressing the deposition to the c j coefficients , in general fewer multiplication operations are required to construct an accurate surface shape and fewer memory locations are required to store pointer multiplier pairs . in addition to data compression , this functional form also serves to permit translation of one set of angular sets to another set at the surface interface . an lvg surface that completely isolates an lvg or heterogeneous voxel from the general system can utilize differing angular discretization schemes . for example , one may use a point - to - point system for the outside grid system , and a ray - tracing technique or pre - computed model either inside the isolated lvg . one can also use the same system of computing discrete angles , but have differing angular sets orders . for example , one may have hundreds of ray set angles on the outside of a system , and thousands of discrete angles used in the inside of the isolated lvg . the functional forms permit translation across the boundaries through functional interpolation . in all instances , the functions are used to re - compute angular tallies over each ray set solid angle direction . one set of functional coefficients is used from the inside out , and another set from the outside in along the lvg surface boundary . while this is one preferred form of use of the functional coefficients , this does not preclude other function deposition techniques . in the method described above , any orthogonal function may be used , and specific experiments using surface harmonics , which are related to spherical harmonics , as well as general orthogonal polynomials have been carried out . additionally , one may use b - splines with pre - computed bezier points to affect data compression and translation . wavelets might also be employed to improve data compression accuracy ( see y . nievergelt wavelets made easy birkhauser ( 1999 ) isbn 0 - 8176 - 4061 ). though generation of coefficients is different , the approach is still one of depositing transport multipliers to a coefficient system . such a method may have advantages in reducing the coefficients associated with tally function reconstruction . however the solid spherical harmonic or surface harmonic functional forms are preferred for data consistency , historic and theoretical reasons . it is consistent with the forms used in double differential scattering cross sections allowing for simple resolution of scattering through consistent orthogonal functions . fig7 presents a general flow diagram description of an algorithm for the present invention . each process or flow block is described below . a . physical system database ( fig7 . block 0 ) modeling of the transport of particles requires some specification of material and geometry layout associated with the transport medium . such physical system input is usually obtained from a database . b . grid construction ( fig7 . blocks 1 – 1 a ) consider for example a grid system of voxels . the grid overlays a physical system being modeled with material compositions within each voxel . converting a graphic image of a physical system into voxels forms the grid system . alternatively , specific input of a voxel grid system can be entered into the system ( fig7 , 1 a ). grid construction must consider variations in material composition . at the most basic level , when a single voxel encompasses multiple media , some form of homogenization must be applied . this may vary from a simple volume weighted scheme to a flux - volume weighting scheme . such methods are well known in the art . the present invention may be used to generate a complex voxel of heterogenous sub - voxels . for imrt 3drtp , the physical system is a 3d human model comprising tissue and bone as well as any metallic insert tabs and prosthesis . a grid system overlays the representation of the body and any material properties within , such as gamma ray homogenized macroscopic x - sections . this grid system may come from commercial 3d graphics package information converted to a suitable grid system . preferably , such a grid system is irregular forming about bone and tissue to maximize accuracy by minimizing the need to homogenize voxel material . c . ray set lvg construction — overview ( fig7 . blocks 2 a – 5 ) one may generate ray sets inline ( fig7 , 2 ) or in a pre - constructed manner ( fig7 , 2 a and 2 ai ). inline ray set / lvg construction is most appropriate for irregular grids . pre - computed ray set geometric properties used in lvg construction are most appropriate for fast computation of regular systems . a preferred embodiment of the present invention includes all forms of ray set lvg construction as options within the computer . pre - computed ray set geometries are preferred for analogue control systems . core to ray set modeling is the use of a single in - voxel interaction per interaction sweep . for each ray , the collided and un - collided particle density is used to determine the number of particles interacting , and hence subject to the interaction model ( fig7 , 5 ), or continuing to traverse to lvg surface boundary for further particle transport ( fig7 , 4 ). one may generate a ray set through a stochastic process for single collision interaction modeling ( cashwell et al ., supra ). one may also use direct integration of particle distributions over appropriate solid angle domains to directly compute appropriate ray set geometry factors . these factors may be analytically , semi - analytically or stochastically derived as part of a pre - computation ( fig7 , 2 ai ). they are then used with the appropriate discrete angular group δω frequencies associated with a particular representative ray , the individual length of representative ray within traversed voxels , and the appropriate single interaction particle transport kernel to compute lvg volume interaction and surface multipliers ( fig7 , 2 a ). alternatively , one may utilize a technique similar to the discrete transfer method to determine ray sets passing through an lvg emanating from reference voxel surface or volume ( lockwood et al ., supra ; cumber , supra ). the major differences between such an approach within the context of the present invention is that rays emanating from volumes are not represented solely from the centroid . most importantly , it is preferred to consider only the first flight interaction through the lvg , and use the separate interaction model to handle scattering . the present invention considers radiation transport in a forward direct approach with an iterative approach to handle particle scattering . these differences contribute to a significant improvement in accuracy . one may use a point - to - point method for surface - to - surface transport coupling that is similar to dtm , however , a pure ray tracing technique with predefined ray set angular groups provides excellent results and allows for simplified embedding of invariant voxel groups within a larger system . furthermore , the present invention provides for direct transmission to general function coefficients with the merits of the approach as discussed in the fig6 description . finally , the present invention accumulates 1d ray set results in transport multipliers , greatly improving computational performance . one may also use standard analytic direct solutions of appropriate particle transport equations for inline ( fig7 , 2 ) computation of discrete particle lvg transport multipliers . a preferred method is to utilize stochastic methods with extremely large sample sizes for large regular polyhedron grid systems with many surfaces and overlay ray set lengths upon lvgs . for irregular grids , one preferred method is to establish a large number of points within a reference voxel volume or upon a voxel surface as centers of finite surfaces δs and sub - surfaces . one then computes the representative ray set with a point - to - point method . in the point to point method , the applicable angular distribution , particularly for the im within voxel volumes and cosine for surfaces , is factored into the associated fractions of representative rays traveling from the reference point to lvg surface point based on the solid angles formed by the set of all points from the reference voxel surface or volume . in the forward ray - trace method , a sufficiently large number of solid angle discrete groups is used to alleviate the need for surface p ( ω ) distribution assumptions . d . pre - computed ray set ( fig7 . block 2 ai ) for the pre - computed ray set option , the following equations describe the processes involved for computing frequency and voxel length . the frequency associated with a particle ray set over a subsurface , sub - angular group is given as : f i , j ( δ s i , δ ω j ) = ∫ δ si ∫ δωj p ( ω ) ∂ ω ∂ s ∫ s ∫ ω ∂ ω ∂ s where p ( ω ) is the particle distribution appropriate for particles streaming through the applicable surface within the solid group δω j . note that different levels or collision moments of p ( ω ) are possible . near particle source distributions p ( ω ) are appropriate for the interaction model under consideration ( e . g . flat voxel volume distribution , isotropic ). relatively far from attenuated distributed sources , p ( ω ) would represent a cosine distribution normal to δs . δs i and δω j represent ray set bounded surfaces and angular groups appropriate for δ — the applicable ray set . f ij ( δs i , δω j ) represents the indexed appropriate frequency of particles traversing a particular ray set . we now consider an average ray length within a ray set , δ , within voxel i as : δ r l , i , j ( δ s i , δ ω j ) = ∫ δ si ∫ δωj r 1 ( ω , s ) p ( ω ) ∂ ω ∂ s ∫ δ si ∫ δω l p ( ω ) ∂ ω ∂ s where δr l , i , j ( δs i , δω j ) is the voxel and path dependent average ray length . the solution of these integrals , even for two - dimensional tessellations is often non - trivial . there are frequently complex dependencies between δs δω and δ . as such , the most general approach to solving pre - computed ray set frequencies and lengths is monte carlo . while this reverts to a stochastic process , one must remember that the computation is off - line and does not involve attenuation — hence material properties are irrelevant . the geometric properties obtained are later combined with material properties to determine transport multipliers ( fig1 ). therefore , the results are extremely accurate as billions of particle rays can be generated without collisions and properties can be averaged to effectively solve the above integrals . the results are also generic and applicable for a particular p ( ω ) with the modeled grid geometry irrespective of material . fig8 presents a simple monte carlo algorithm for computing ray sets for use in the present invention as a detail of fig7 , block 2 ai . a geometric local voxel group is setup ( fig8 , b 1 ). there are no material properties associated with the voxel as only geometric properties associated with rays are being generated . a pre - calculation is carried out to determine appropriate multiple representative rays associated with particular voxel pathway ray sets ( fig8 , b 2 – b 5 ). one generates a source particle using the p ( ω ) distribution appropriate for the reference voxel surface or volume ( fig8 , b 2 ). most conveniently , canonical u , v and w direction cosines are generated for cartesian 3d coordinates . use of local voxel volume source p ( ω ) distributions are specific to each ray set library , and several distributions may be used in actual computations . such sets represent distance moments , the first distance moment being from source ( including im source ) to lvg surface boundary . the second from lvg surface to far surface and so on . hence several outputs of fig8 may be used in fig7 processing . for imrt 3drtp , as well as other particle transport , a preferred embodiment of the instant invention in the pre - compute mode uses a two set distribution moment approach , considering source and scattered particles from voxel volumes with their particular distribution as one set . those particles emanating through an lvg surface are cosine distributed within angular groups δω and form the second moment set . however , as mentioned previously in the fig6 description , one can use the pre - computed set for nodes on one side of an lvg boundary , and totally different scheme , such as ray - tracing or point - to - point ray sets on the other side of a boundary . this type of an approach may be preferable when assumptions regarding p ( ω ) are inadequate . the source particle is next projected to the lvg boundary along a particular voxel pathway ( fig8 , b 3 ). the particle history is stored in accordance with a ray set representing the pathway and limiting path lengths are determined to appropriately develop representative rays for the ray set ( fig8 , b 4 ). after a pre - calculation minimum tally is achieved ( fig8 , b 5 ), appropriate voxel path dependent , ray set representative ray length bounds are developed ( fig8 , b 6 ). in a simple case , scoring bins are established based on an even bin distribution between the longest and shortest ray length in the pre - calculation . association of ray set scores and scoring bins is most effectively accomplished by constructing a unique hash string associated with a particular particle ray set . again , ray sets thus defined may include explicit angular groups , δω as well as values indicating projected lvg boundaries for both the local reference system and , most importantly , a surface referenced lvg adjacent system . this latter value is used for coupling lvgs at surfaces . the source particle , particle projection and scoring procedures are repeated ( fig8 , b 7 – b 9 ), this time scoring in finer detail representative rays within ray sets developed in the preliminary calculation . if additional unique ray set pathways are found , these are scored as well without multiple rays composing the set and saved for later fine - grained ray calculations . as a practical matter , this is often the case with many angular groups and large 3d geometries , even with 10 9 pre - calculation particle histories . upon receipt of a tally signal or predetermined count ( fig8 , b 10 ), pre - computed ray set properties are saved to a database , computer file or other storage medium ( fig8 , b 11 ). this particular process can be re - started for fine - grain , higher resolution calculations at a future time . this provides extremely high statistical accuracy for the geometric ray set properties ( fig8 , b 12 ). fig9 represents output for a particular ray set of the fig8 process for a flat source node emitting from a surface . this output was generated using prototype code of the present invention . line output of fig9 is described below . there can be from a few dozen to tens or even hundreds of thousands of ray sets depending upon the specification of size , angular groups and geometry . this is the 12927 th ray set in a 6 3 , 8 angular group system . the 10 represents the number of voxels traversed . [ 0 ][ 0 ][ 0 ] represents the angular group in terms of u , v and w cosine angle groups . line 2 reflects the hash code used to differentiate this particular ray set . the use of hash codes ( or alternatively binary trees ) provides an efficient mechanism to track ray sets . the direction cosines are provided [ 0 ][ 0 ][ 0 ] followed by two entries of 336 . this value represents the unique lvg exit surface point coordinate . as it happens , this value is also the same for the adjacent lvg exit surface coordinate when the local exit surface is used as a reference for an adjacent lvg system . the values that follow are pairs representing the voxel and exiting surface index , 1 thru 6 for cubic voxels ( note that one may have 24 , 54 or more surfaces for regular cubic voxels ). lines 3 and 4 provide the lvg surface exits for convenience . line 5 represents the average path length ( based on a unit 1 cubic voxel ) divided by the count of particles ( not used ). this is followed by the longest and shortest ray within the ray set , and finally the frequency of the ray set rays as sampled from p ( ω ). lines 6 – 15 provide the detailed pathway , each voxel per line of the average representative ray in [ i ][ j ][ k ] coordinates followed by the emergent side , followed by the average length traversed in each voxel . line 16 specifies that there are 3 representative rays for the set — similar in concept to 3 panel integration . line 17 provides information for the first panel , panel 0 , followed by the average ray length to lvg boundary , maximum length and minimum length . line 18 is a continuation of the above with the relative frequency of the representative ray within the ray set , followed by the upper length interval used . lines 19 – 28 supply the panel representative ray lengths for the pathway . lines 29 – 40 and 41 – 52 repeat the above sequence for panel 0 for the other two panels , 1 and 2 respectively . this completes the information for the 3 panel representative ray set . while monte carlo is generally the preferred method for complex geometries , other methods of solving the geometric integrals presented above for ray set frequency and voxel traversal length may be employed provided that such methods are capable of providing data similar to that of fig9 for the pre - compute process . pre - compute material specific lvg construction ( fig7 . block 2 a ) given the output presented in fig9 for average ray sets and using the material properties provided in fig7 , step 1 or 1 a for the general grid system , the specific lvg multipliers can be constructed . fig1 presents a block diagram of this process . the first step in processing a reference voxel position ( fig1 , b 1 ) is to allocate or reallocate a transmission accumulator ( fig1 , b 2 ). the accumulator is a function of each ray set δ as well as all explicit state particles that are affected by particle - material interaction such as energy δe . the next step is to allocate terminal memory for the reference voxel position ( fig1 , b 3 ). a terminal is defined as a pointer to a voxel lvg memory location either representing a discrete particle on the surface or an interaction tally within a voxel volume , and a transport multiplier from the reference to the terminal location . the terminals may also be functions of δ as well as other material state variables . following this allocation , terminal discrete particle memory pointer keyed hash tables are created for accumulating multiplier values by referencing terminal positions of the lvg ( fig1 , b 4 ). finally , one walks through each ray set grid position system , starting from the reference voxel position , to compute and accumulate discrete particle multipliers from the reference to the lvg terminals ( fig1 , b 5 ). the hash table aids in quickly identifying the proper bin for accumulating the multiplier at a walked position . the transmission accumulator is used to tally the integration kernel transmitted values to each voxel . applying the integration kernel to the ray set length , δr l , i , j ( δs i , δω j ), and beginning with a transmission accumulator initially set to the fraction of particles traversing the ray , f ij ( δs i , δω j ), one accumulates collision values for voxel volumes for use in the im and transmission values for lvg surfaces . the final summation from the reference position to final position is the transport multiplier . as an example , for a gamma ray attenuation in imrt , a transmission multiplier at the voxel surface would be f * σe − δr * μ , where the summation ( σ ) is carried out for each voxel on the path to the surface . the variable f is the fraction traversing the particular ray as defined above , δr is each voxel path length and μ is the appropriate attenuation factor based on voxel material . there are multipliers for every material phase space state such as energy . for surface lvg points , ray sets or angular groups may be used with unique multipliers to improve accuracy . the result for each position , ray set , angular group and material state is a linear array of pointer - multiplier pairs where the pointer references an lvg particle count address in computer memory ( see fig6 ). other storage schemes for pointer and multipliers such as two synchronized arrays are also possible . with these multipliers established , one only needs to sweep through the reference discrete particle &# 39 ; s lvg array to transport the particle to its lvg neighbor . in one embodiment of the instant invention , it is better from a memory utilization standpoint to simply have a vector of multipliers that are properly ordered to correspond to lvg terminal location sweeps . instead of pointer , multiplier pairs , the multipliers are arranged in a single vector that corresponds to pointer arithmetic utilized in the sweep . this is most easily accomplished for interior lvgs that do not include boundaries . it is important to note that the pre - computed geometric property lvg construction process does not need to be carried out at every point in the grid system . pattern matching of material indices within the grid can be applied to identify systems where the same multipliers may be used , and simple pointer arithmetic applied to translate the lvg array values to other identical material locations . ( see j . karkkainen & amp ; e . ukkonen , two - and higher - dimensional pattern matching in optimal expected time , 29 siam j . comput ., 571 – 589 ( 1999 ) for examples of efficient multi - dimensional pattern matching algorithms .) for regular grid systems where pre - computed lvg geometric systems are applicable , some form of pattern matching to speed up computations is preferred , as long as material compositions within the grid are not highly differentiated . likewise , pattern matching is a preferred embodiment of the present invention for use in imrt 3drtp when regular grids are used . a . inline ray set lvg construction ( fig7 . block 2 ) the preferred method for calculating discrete particle transport multipliers from reference positions in irregular grid systems throughout a single lvg is to utilize a point - to - point methodology somewhat similar to the ray layout of the discrete transfer method . the goal of the inline lvg construction is to assemble a ray set based computation of the discrete particle transport multiplier directly . as the spatial distribution of the source discrete particle is constant , and the pathway to the other discrete particle space is known , any direct conventional radiation transport method can be applied to compute the transport multiplier on a unit discrete source basis ( see , e . g ., bellman et al ., an introduction to invariant imbedding , siam ( 1992 ); a . shimizu , development of angular eigenvalue method for radiation transport problems , 37 j . nuclear science and technology , 15 – 25 ( 2000 ); olvey et al ., accuracy comparisons for variational r , t and t 1 response matrix formulations , 14 annals of nuclear energy , 203 – 209 ( 1987 ); sternick et al ., the theory & amp ; practice of intensity modulated radiation therapy , advanced medical publishing , 37 – 49 ( 1997 )). use of these constructions on a one - time basis necessitates the use of a large number of angular groups to mitigate ray effects . a conventional ray tracing technique can be used in such an approach , and there are times when it is necessary to do so . however , it is preferable to retain the ray set concept in preference to angular groups to link lvg surfaces even for arbitrary or irregular grid systems . whether using the point - to - point method or conventional ray tracing , the algorithm is practically the same and is presented in fig1 . the first step is to allocate memory for surfaces . for the point - to - point method , the angular distributions must be computed associated with the centers of surfaces . if one is using a ray tracing technique , the angle system is predefined . in both instances , the relative solid angle area represented by a ray is used to determine initial weighting for volume to surface coupling . surface to surface coupling is on a per ray - set basis and does not require special weighting unless function coefficients are used as the end points . following block b 1 , ray - tracing and point - to - point methods are identical . in fig1 block 2 , one begins by tracing rays from volumes to surfaces and accumulating point multiplier pairs . a representative ray trace routine , fig1 b 3 is used for this process utilizing the appropriate integration kernel . following the coupling of volumes to surfaces , one then couples surfaces to volumes and surfaces to surface in the step represented by fig1 block 4 . with surfaces , there each ray set may be individually tracked to provide fine grained detail for further transmission , and this is preferable when memory allows . when memory is constrained , one may use function coefficients to serve as surface termination points to condense data and reduce memory requirements . however , accuracy will suffer as precise angular information is lost on the boundary . b . initial discrete particle input ( fig7 . block 3 ) we now consider that at voxel boundaries we may have an initial condition of discrete particles specified with appropriate state variables . a discrete particle count spans the entire voxel surface from which it emanates . coincidentally or alternatively , initial conditions can also be provided as the number of source particles emanating from voxel volumes given as a source particle count . however , these values can be converted to an initial discrete particle count on the source voxel surfaces . for imrt 3drtp , the initial conditions for modeling scattered radiation within tissue proceed from a primary direct ray calculation ( fig7 , b 9 a ). the interaction rate and possibly angular information is recorded for the first collision of the ray within voxels . this value is then used to construct an initial gamma ray discrete particle count . it is also possible to use the present invention in total with a surface discrete particle count and cosine distance moment , although it is preferable to explicitly model true rays entering a system using a representative ray approach directly . the interaction model of the present invention can then be used to model scattered radiation serving as a source for further particle transport . function coefficient deposition as described in fig6 may be used to handle higher order scattering interactions . c . discrete particle transport sweep ( fig7 . block 4 ) once the initial source conditions have been specified for discrete particles , whether through block 3 or 9 a , one can proceed with the transport sweep . during the particle sweep , particles are transported to voxel discrete particle tallies for interaction model computation as well as lvg surface boundaries for further transport . this comprises simply sweeping through each discrete particle location with non - zero count as a reference . at each reference , one sweeps through the linear system of lvg terminal - multiplier pairs , applying each multiplier to the reference discrete particle count to accumulate fractional particle counts at the terminal discrete particle pointer locations . this computation may be carried out until one reaches an internal convergence where most non - interacting particles are swept from the system . variation of the internal convergence method may be needed for transient problems where the discrete time state epoch δt cannot be ignored . additionally , such a method might be preferable depending on the computation cost associated with the im . the transport sweep , however , may be performed for reference lvgs without internal convergence . in this case , the im is applied immediately after particles are transported to lvg boundaries . for imrt 3drtp , it is preferable to sweep through local lvg terminals and compute further scatters using the im as one iterative sweep system . a . interaction model ( fig7 . block 5 ) the interaction model receives terminal discrete particle tallies with appropriate state variables and generates new discrete particles either on voxel surfaces or from within the voxel itself , depending on model type preference . the present invention can be used to generate an interaction model for a relatively large voxel , which is a preferred embodiment of the system . this methodology is described below along with a simple collision probability approach to creating a valid interaction model . complex collision probability methods have been employed for some time . marleau et al . provide examples related to the use of these methods in neutron calculations ( analytic reductions for transmission and leakage probabilities in finite tubes and hexahedra , 104 nucl . sci . & amp ; eng ., 209 – 216 ( 1990 ); a transport method for treating three dimensional lattices of heterogeneous cells , 101 nucl . sci . & amp ; eng ., 217 – 225 ( 1989 )). these can be readily adapted for generalized particle transport in connection with the present invention . one may use function coefficient deposition as previously described to create spherical harmonics functions representing the angular particle distribution . these may be used in turn with high - order double differential cross sections to compute detailed angular scatter information . the goal of an interaction model is to compute the disposition of particles after a collision . this includes computation of collision parameters of the primary interacting particle after collision , changes in state , as well as generation of secondary particles with new state variables . for optics , radar , sonar and radiative heat transfer , relatively simple computation of primary particle post - collision parameters is required . for nuclear radiation processes , secondary radiation such as recoil electrons from compton scattering or additional neutrons from fission processes must be generated by the interaction module . for imrt 3drtp , gamma interactions result in photoelectric absorption and generation of photoelectrons at low γ energy . compton scattering with both scattered photons of reduced energy as well as recoil secondary electrons should be modeled at intermediate γ energies . for very high γ energies above 1 . 02 mev , pair production processes may also be modeled . for processes involving nuclear fission in critical systems , a special model is required that multiplies each generational infinite multiplication factor with the overall system eigenvalue to determine local source strength . assuming a single non - leakage parameter can be used for each voxel , this is a trivial model as is illustrated herein . as mentioned above , a simple collision parameter approach can be used for an interaction model . in this approach , one uses the ratios of macroscopic cross sections to determine the disposition of particles colliding within the voxel . in order to apply such a model , there should be on average less than one collision per voxel volume . for radiation transport , ideally this criteria can be met by the limiting state mean free path 1 / σ & gt ; d c , where σ represents the least material state total or transport macroscopic cross section and d c represents the largest possible path length across a voxel . however , practical experience has shown that such a criteria can be significantly relaxed ( see fig1 1 aii scattering results and description ). in this simple model , a non - leakage probability is computed and applied to all scattered and secondary particles emanating from each voxel . this probability may be obtained by assuming a flat distribution and computing the particles that exit with integration kernel attenuation . other methods discussed in the literature can also be used . in order to speed convergence in this model , each successive generation of interacting particles within a voxel is subject to this same non - leakage probability . fig1 illustrates a simple flow diagram of such a model . inputs to this model include those depicted in fig7 , block 4 as well as possible initial condition inputs from fig7 , block 9 a . grid initialization may incorporate a pre - calculation of material parameters for voxels useful for the interaction model . this includes non - leakage probability for each state ( such as energy ), particle absorption fractions , state transfer fractions and transmission fractions . there are two approaches that one can take with regard to non - leakage and transmission . the first approach is to assume that all scattered particles appear both inwardly and outwardly directed on the voxel surface . a preferred approach is to account for further in - scatter within a voxel using the non - leakage probability , referred to as p n1 . consider a particle that scatters from state energy group g to g ′ in a simple energy transfer model . we use σr gg ′ to represent the scatter / removal macroscopic cross section from group g to g ′ and σt g to represent the total macroscopic cross section of the voxel material . a particle that scatters ( and hence has been tallied as a collision ) has for its first collision a probability of σr gg ′ / σt g of scattering to group g ′. however , a particle has a probability of σr gg / σt g to scatter in - group . for subsequent collisions , we have : σr gg / σt g * p n1 * σr gg ′ / σt g subsequent in - voxel scatter transfer to g ′ followed by , σr gg / σt g 2 * p n1 2 * σr gg ′/ σt g and so on for each subsequent generation . it can be readily verified that as p n1 is less than 1 . 0 , and all transfer probabilities are less than 1 . 0 , the total number of particles in all generations that transfer from group g to g ′ within such a voxel is given by : for time eigenvalue problems , one should multiply p n1 by the problem eigenvalue λ . for fission problems , group dependent infinite multiplication factor ( k ? ) represents the ratio of particles produced to particles removed . it may replace or augment scatter moments as described above for sub - critical voxels . various schemes for incorporating fission are possible . alternatively , one may take a scatter or fission generational approach to p n1 , such that different values of p n1 might be appropriate for different collision moments . however the 1 / σ & gt ; d c collision criteria should be sufficient to limit the need to use scatter transmission moments within voxel volume interaction models . proceeding with the first inline process , one establishes a voxel position ( fig1 , b 1 ). one then obtains a given state tally ( fig1 , b 2 ). interaction tallies may be functions of all discrete particle state values as previously discussed . for each state discrete particle , interaction parameters are applied . the first voxel transmission process considers the process of scattering given a discrete particle interaction tally with state values ( fig1 , b 3 ). for p n scattering , the angular group of incoming rays as scored by the interaction tally is considered in the voxel discrete particle response with an appropriate scatter p ( ω ). tally entrance surface δs i may also be considered when determining voxel discrete particle transmission through other discrete surfaces . however , for a preferred embodiment of the present invention , namely , use of a simple effective single collision voxel model with isotropic scatter , only the first interaction moment is treated in this detail . this is due to the complexities of multiple scatters and the relatively low statistical number of subsequent scatter . for higher order scatter interactions , a function coefficient approach is used to determine the angular particle distribution , and this may be used to compute complex in - voxel scattering . however , such complexity is not required for most modeling tasks , it is considered better to simply use smaller voxel sizes than deal with such complex operations . one then moves from voxel transmission to final voxel volume tallies of processes such as absorption , scatter and energy deposition ( dose ) as appropriate ( fig1 , b 4 ). following this process , for all other states , one determines the in - voxel scatter contribution to voxel volume tallies ( fig1 , b 5 ). one then computes the secondary transmission of in - voxel scattered discrete particles ( fig1 , b 6 ). finally , one loops through all - particle states and positions as needed to complete the im sweep . for 3drtp imrt , the above model with scatter represents a preferred , simple radiation model . however , this model can also be used in another calculation to determine larger voxel volume imbedding invariants as described herein . depending on the application , one may pre - compute voxel volume interactions using various methods known in the art . however , for subsequent voxel discrete particle transmission , it is necessary to properly disposition particles leaving the voxel in appropriate ray set states when this is used as an explicit particle state value . in a preferred embodiment of the present invention , the invention itself can be used to generate imbedding invariants that are used for voxel volume interaction modeling so that one is not limited to small voxels , and the criteria as defined above , namely , 1 / σ & gt ; d c is met . as with lvg ray set properties , this operation may be performed off - line as a pre - compute , or inline after material and grid properties have been established . in either case , all that is needed is to establish an initial boundary condition on a set of voxels . for this model however , all voxels combined to create a larger voxel should be within reference lvgs . one subdivides the grid system and solves discrete particle transport across a grid system tracking collision moment responses explicitly . surface to volume information is retained for use in embedding the lvg into a larger system . several surfaces may be combined to create a large voxel entrance surface as well as exit surfaces . discrete particle density is evenly distributed across these surfaces to form the appropriate integrated voxel system response to external entrance particles . ray tracing or point - to - point methods may be employed from the center of sub - surfaces to determine transport in the embedded system . alternatively , a pre - compute method may also be used . void voxels may also be used for entrance and exit to allow for ray set initial conditions and ray set based scoring . voids serve to provide distance moment groupings of ray sets . in such a mode , the can be used to reduce the number of explicit angular groups required for modeling within the lvg . on the input side , they serve to cause particle streaming associated with far distant moment lvg ray sets . on the output side , they are used to compute exit ray sets . initial discrete particle groupings for all un - collapsed state groups must be explicitly modeled ( see fig7 , block b 9 a ). for problems that involve fission , explicit system responses as a function of collision time epoch must be utilized . the converged infinite system response may be determined after at least one and usually after several explicit generational responses have been determined . in no case may the group of voxels in a fissile system form a local critical system ( bellman , supra ). finally , data associated with the grouped voxels is saved for use either in later calculations as part of a pre - compute , or for use in the existing calculation . the present invention solves particle transport as an impulsive initial value problem as opposed to a boundary value problem for non - fissile particle transport . for fissile particle transport , a generational eigenvalue can be computed based on generational fission changes . when eigenvalue is combined with relative reaction rate criteria , convergence to an acceptable solution can be established . an absolute in - system particle count relative to the initial discrete particle input can be used to determine convergence , along with a computation of the ratio of residual interaction tally to total interaction tally on a voxel volume basis . following convergence , results should be re - normalized to reflect the residual scattered or secondary im particles that were not transported out of the system as part of the sweep . this is particularly important for problems where voxel invariant responses are being determined for incorporation into broader problem solutions . f . result database storage ( fig7 . block 7 ) results of calculations are preferably stored in a conventional relational or object database . ray set data can also be stored in this manner . this is a preferred mode of storage in the instant invention . g . optimization / design engine ( fig7 . block 8 a ) as mentioned previously , the present invention is ideal for automated design and / or treatment planning optimization . block 8 a represents a design optimization based on results of the present invention , in which the exact specification is outside of the invention . for imrt 3drtp , the storage results of the instant invention are utilized , and simulated reasonable external rays are generated in order to maximize the dose to target tumors while minimizing the dose to healthy tissue . the present invention can be used to generate survey initial computations , allowing for relatively fast rejection of incident radiation that does not contribute significantly to dosing the tumor . additionally , the present invention is ideal for modeling scattered radiation contribution to off - target healthy tissue . commercially available optimization engines may be utilized to select the optimal beam configuration and particle intensity using the computational results of the invention . h . initial particle distribution ( fig7 . block 9 a ) as mentioned previously , the results of an optimization engine specify an initial test particle distribution . for radiation pencil beams , the preferred modeling procedure is to model rays directly and use the interaction model ( fig7 , block 5 ) to determine an initial particle distribution associated with scattered radiation . such initial radiation beams must have knowledge of the grid system . this may entail reconstruction of lvgs for certain specialty cases . pencil beams may be modeled using representative rays . for imrt 3drtp , a direct ray beam calculation , using the present invention to compute scattered radiation effects , is preferable for direct radiation dose to target tissue . this figure shows the preliminary problem setup for a regular geometry utilizing the pre - compute option . the prototype used for this problem utilized fig7 blocks 1 a , 2 a 1 , 2 a , 3 , 4 , 6 and 7 . specific results for this problem setup are depicted in fig1 . other prototypes demonstrated the im aspects of the present invention in following figures . in the fig1 preliminary problem , particles stream through the near side shaded duct entrance in an off - cosine source distribution . the specific source distribution streaming through the otherwise perfectly shielded side had a source distribution of isotropic particles uniformly distributed over a 10 × 10 × 10 cm 3 adjacent source voxel that of itself had no attenuation . the duct system represents has a cross section 10 cm high and wide , and extends through the 60 × 60 × 60 cm 3 system . other source particles do not stream in from boundaries and scattering is not modeled in order to maximize ray effect error . boundary conditions on all sides are a perfect vacuum . a standard total particle attenuation cross section of 0 . 1 cm − 1 is used and is similar to international benchmark problems , with the exception that there is no reflection of particles about three of the problem axes . selected results comparisons for this problem setup are presented in fig1 . preliminary planer interaction rate results . this graphic depicts the results of the present invention ( middle values ) compared to a high particle count monte carlo ( top values ) with percent relative differences ( low cell percentage values ) for each 10 3 cell . results are presented for a plane between 40 and 50 cm above the source plane . one cell with 0 . 0 interactions represents the void duct while the shaded cell represents the maximum error for the plane . it is typical that direct solutions are as much as 20 % to 40 % off at such distances with other prior art direct methods . the signal is a few ten thousandths of the original source at these distances for an extreme ray - effect streaming problem . it should also be noted that the present invention processes multiple source distributions for this or other problems over a thousand times faster than monte carlo , making it ideal for design problems and 3drtp imrt . the monte carlo code used was of the inventor &# 39 ; s construction , and when used to compute a base case on the same computer proved to be 1000 times slower than the present invention . fig1 , 16 , and 17 present results against a standard international reference benchmark , using the inline ray option . fig1 shows current prototype results of the present invention against a standard international benchmark problem . the prototype includes a simple interaction model , and uses variable rectangular parallelepiped voxels . it utilized an algorithm fully utilizing fig7 blocks 1 a , 1 , 2 , 4 , 5 , and 6 . the reference problems and result comparison has been taken from “ 3d radiation transport benchmarks for simple geometries with void region ” published in a special issue of the journal progress in nuclear energy , volume 39 number 2 issn 0149 - 1970 ( 2001 ). the specific problem modeled from the benchmark is problem number 1 . this problem consists of a 200 × 200 × 200 cm 3 on a side cube of dark absorbing material with a 100 × 100 × 100 cm 3 central void . in the center of the void is a 20 × 20 × 20 cm 3 source consisting of dark material . the problem is solved in two modes . the total macroscopic cross section for the void region is 10 − 4 cm − 1 while the dark absorber cross section is 0 . 1 cm − 1 . this problem is extremely difficult for a direct method , as the material is dark , there is little or no scatter , and the problem size is large for the cross sections used . the problem is solved in two modes . in the first mode , 1 ai , the problem both regions are pure absorbers . in the second mode , problem 1 aii , both regions have 50 % scattering such that the both the absorption and scatter cross sections are 0 . 5 × 10 − 4 cm − 1 and 0 . 05 cm − 1 respectively for both the void and dark regions . the source rate in the center block is uniformly 1 particle cm − 3 - s − 1 . a single referential axis is provided for comparison . the coordinate system extends from − 100 cm to + 100 cm for each direction . compared with the present invention are respected nuclear transport codes such as tort , ardra and event . other codes such as penntran did not publish exact numbers , however from the graphics provided in the journal , in all cases it appears that the present invention provides superior results . either the exact analytic flux was used for comparison or the gvmp monte carlo code ( a variant of mcnp ). the monte carlo code was run for 378 , 000 seconds to obtain the 1 aii results presented ( see fig1 ). as the present invention does not compute flux directly , a small node size of 2 × 2 × 2cm 3 was utilized to reconstruct the flux rate . this is an additional source of error for the present invention as the node average flux is reported compared to the point fluxes computed by other codes . for fig1 scattering , the entire system was completely coupled in the present invention . the scatter problem required the modeling of fewer nodes as there was an effective vacuum boundary condition about the nodal axis . the scatter problem required full modeling of all nodes in problem 1 . node sizes were varied from the smallest 2 × 2 × 2cm 3 to 20 × 20 × 20cm 3 nodes distant from the measurement axis . this was consistent with the methodologies used for the other codes . ray tracing was used for these particular results , and this required the modeling of 9978 solid angles . the present invention was run with the distinct setup and execution modes separate . the setup was complete such that given any source distribution , the execution time was a small fraction of the original time . fig1 results present the present invention with an lvg approach breaking the reference benchmark problem in two . fig1 provides machine time comparisons . this figure shows the effect of an lvg surface cut in problem 1 ai . as this problem has no scattering , a surface is particularly problematic to model . the surface selected was at 50 cm at the void / absorber interface . three different surface results are presented . the first surface result presents no surface cut . the second presents 4 sub - surfaces per side ( an input to the prototype ) with ray sets explicitly tracked through the surface . the surface cut utilized a 6 th order surface harmonics function coefficient fit per cut side . results are shown for after the cut for the cut cases , as the results prior to the cut are identical . with the lvg surface and only 4 sub - surfaces , adequate results were obtained . a 6 th order surface harmonic function with 57 coefficients determined using the techniques described in fig6 , provides good agreement as well . additional sub - surfaces can be utilized to improve results further . the surface harmonic function was of the form : f ( μ , ϕ ) = a 0 + ∑ m { a m p m ( μ ) + ∑ n p mn ( μ ) * [ b m , n * cos ( n ϕ ) + c m , n * sin ( n ϕ ) ] } where the summation of m is from 1 to 6 , the summation of n is from 1 to m , p m ( μ ) represents a legendre polynomial and p mn ( μ ) an associated legendre polynomial . the cosine normal to the surface is given by μ , while φ is the azimuthal angle . the coefficients , a , b and c were linearized and fit in accordance with the methodology presented in fig6 . this figure shows the timing results comparison for fig1 and 16 . the present invention was run on an inexpensive pc processor . the clock speed of the present invention machine was higher than other cases , making timing comparisons difficult . the present invention setup time is a one - time cost for any source distribution optimization problem ( such as those in 3d imrt ). as such , this computational time is used once to couple the entire system . following this coupling , the execution times are presented and even for a tightly converged scatter problem are significantly faster than the setup time . even the setup times for the present invention were better than those of the comparison direct methods and significantly faster than monte carlo . this data , along with the fig1 results indicate a 1000 fold improvement in speed through use of the present invention . while the above - described invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that various alterations in form and detail may be made therein and various application employed , without departing from the spirit and scope of the invention . | 0 |
referring now to fig1 a load center monitor 10 is shown typically enclosed in a circuit breaker housing of standard configuration including connection to the main and neutral wires of a power distribution system . also shown by way of example , in dashed lines , is a panel 16 for supporting and / or enclosing the load center monitor ( lcm ) 10 . the connection of the main power line is shown at terminal 12 and the exemplary pigtail connection of the neutral power line is shown at line 14 . the lcm 10 has several input / output ports or output terminals as follows : a user port 20 is provided for connecting the lcm 10 to and from a first remote terminal . a service port 22 is provided for connecting the lcm 10 with a second remote terminal . a communication port 24 interconnects the lcm 10 with a communication bus 26 . connected to the communication bus 26 of the lcm 10 is a plurality of de breakers , each one being indicated by the reference numeral 40 and each de breaker 40 being connected in parallel to the communication bus 26 . each de breaker 40 is identified by a unique address assigned by the lcm 10 to be described in detail hereinafter . each of the de breakers 40 is an electronic circuit breaker of the type described in the co - pending patent application &# 34 ; entitled &# 34 ; circuit breakers with integrated control features .&# 34 ; the de breakers 40 function according to one or more programmed trip profiles stored in the de breaker memory . the trip profile is primarily for tailoring the response parameters of the individual de breaker to the load current that flows in the circuit protected by that particular de breaker . the response parameters are in the form of data constants , which represent current and time values , weighting factors and the like and are stored in one or more tables of the memory in each de breaker . these data constants can be dynamically changed on a continuous basis by the de breaker itself or by the lcm 10 . typically , this dynamic change or updating of the breaker tipping response parameters is performed on command from the lcm 10 or even an external computer ; however , the de breaker itself can change the trip profile data constants under certain conditions . in addition to the normal load current response mode of the individual de breaker , and the arcing response mode that will be described with respect to fig7 b hereinbelow , the de breaker has a third operational mode . this operational mode is the ground fault circuit interrupting mode in which the de breaker is responsive to a leakage current condition between the hot and the neutral line of a particular branch circuit to which a number of devices may be connected . the operation of this response mode was also thoroughly described in the previously mentioned u . s . pat . no . 5 , 875 , 087 , entitled &# 34 ; circuit breaker with integrated control features &# 34 ;. also shown connected to the lcm 10 is a diagnostic output 28 for connection to a test terminal , primarily for use during manufacturing . ports 20 , 22 , 24 and 28 may conveniently be modular telephone receptacles , for example . the lcm 10 further includes alarm output 32 which may also be a modular telephone receptacle , and a visible indicator 34 , which may include one or more light emitting diodes or other display . the visible indicator 34 may be mounted on the same surface of the lcm 10 as the user port . notice that both of these features are shown on the left hand border of fig1 to be visible to one who is facing a panel that includes the lcm 10 and an array of circuit breakers installed in a standard service box of an electrical distribution system . the other ports and outputs are arranged on the lcm 10 so as to be accessible when the panel supporting the lcm 10 and the other circuit breakers in the system are accessible from the backside of the panel 16 . the user port 20 and the service port 22 provide for connection to the lcm &# 39 ; s 10 signal processor with an external data - monitoring and / or data control system . this arrangement of communication ports 20 and 22 allows continuous readout of the lcm &# 39 ; s 10 internal data . moreover , the external controller can communicate with the de breakers in the system using the lcm 10 to relay the data in both directions . in a preferred embodiment , the user port 20 and the service port 22 may be serial i / o ports and implemented according to the eia rs - 232c asynchronous interface protocol . other data communication standards and protocols may , of course , be used depending on the circumstances of a particular application . although user port 20 and service port 22 in the preferred embodiment are essentially identical , they can be defined differently depending on the application . included among the applications user port 20 or service port 22 can be used for are , for example , obtaining data from the memory within the lcm 10 or giving commands to the lcm 10 for control and reconfiguration purposes . continuing with fig1 communication bus 24 can be either an i / o serial port such as the user port 20 or service port 22 or a low speed communication port , such as defined by the industry standard i 2 c protocol for interconnecting integrated circuits with each other . in this case , the integrated circuit or the microprocessor in the lcm 10 may be connected over the communication bus 24 to any of the de breakers 40 connected to communication bus 26 . communication bus 26 is preferably a bi - directional bus that enables data communication between any de breaker 40 and the lcm 10 . in the preferred embodiment , communication bus 26 is a three - wire bus including two data lines , local bus 1 and local bus 2 , and a third return line . in operation , a specific communication protocol has been devised for the use of this bus according to programs stored within the lcm 10 . the operation of this protocol will be described hereinafter . the de breakers connected to communication bus 26 are described in the co - pending patent application entitled &# 34 ; circuit breakers with integrated control features &# 34 ;, which application is incorporated herein by reference in its entirety . moreover , conflicts between the individual de breaker 40 units connected to communication bus 26 are resolved by a unique addressing scheme described hereinbelow in conjunction with fig4 and tables a and b in which addresses are assigned automatically when a new de breaker is installed and connected to communication bus 26 . the diagnostic output 28 is the output of an internal pulse with modulator within the lcm 10 . this pulse width modulated ( pwm ) output may be connected to a digital circuit analyzer or a test terminal for obtaining data from status registers or data related to certain operating parameters within the lcm 10 . for example , the average value of the pwm output may be used for diagnostic purposes to monitor data values inside the cpu of the lcm 10 with , for example , an oscilloscope or digital analyzer . the visible indicators 34 , implemented for example in the preferred embodiment by multiple color ( e . g ., red , green ) light - emitting diodes , are used to indicate the status of the system including the de breakers 40 and the lcm 10 . these colors are incorporated in one assembly in the preferred embodiment for convenience , but in principle , they may be in separate packages or may be different colors . further , the status indication displayed by the visible indicators 34 may be programmed to indicate other functional status information . typically , the green led flashes every two seconds in the preferred embodiment when the lcm 10 and all the associated de breakers 40 are operating normally . when one of the de breakers 40 trips , the red led flashes in various code patterns to indicate the nature of the problem detected by the lcm 10 . it should not be construed that the visible indicator 34 is limited to the use of leds . on the contrary any display configuration suited to the application may be used in the present invention . the external alarm connected 32 provides a connection for an external alarm . this terminal includes a power driver output to drive an external alarm such as an audible beeper or buzzer . the external alarm may be a dedicated unit or a feed to a general purpose emergency or security alarm system . this could be an rf wireless connection to a fire department , for example . this driver can be isolated or non - isolated from the ac line for safety purposes . the external alarm can likewise be driven in a coded pattern to provide specific information regarding the event causing the alarm . pre - recorded voice messages for specific conditions , stored with the lcm 10 or a remote terminal , may also be activated during operation of the external alarm function . lcm 10 further includes a power reset button 36 for operating a resettable fuse connected between the main terminal 12 and the power supply of the lcm 10 . a clear button 38 is also provided on the lcm 10 for clearing an audible alarm indication activated by the lcm 10 , for selecting operating modes of the lcm 10 , and for initiating a self - test routine during servicing . referring now to fig2 the lcm 10 is shown in a block diagram schematic including central processing unit or cpu 76 along with its associated non - volatile memory 70 , a power supply 54 , and the various communication ports described hereinabove . also shown is circuitry for the diagnostic output 28 , the external alarm 32 and the visible indicators 34 . power for the lcm 10 is provided by main power line 12 , shown connected to node 50 via resettable fuse 36 . a resistor 56 is connected between node 50 and pin rc5 of cpu 76 . pin rc5 is further connected to ground through resistor 58 . all operations include cpu 76 are synchronized with the ac line frequency ( 50 hz or greater ) through the coupling from node 50 . resistors 56 and 58 provide this synchronizing signal at a logic level input to the cpu 76 . pin rc5 is further connected inside cpu 76 to a zero - crossing detector . further connected to node 50 is the input line to the power supply 54 . the output of power supply 54 supplies a + 5 volt dc voltage to operate the circuits in the lcm 10 . the connection between the neutral power line 14 , which in the illustrative embodiment may be a pigtail lead , and the ground circuit of the lcm 10 is also shown in fig2 . the lcm 10 the associated real time clock ( rtc ) and non - volatile memory (&# 34 ; nvram &# 34 ;) 70 is connected to the cpu 76 through a pair of data buffers 72 and 74 , each via an 8 - bit bus , which are used to store the complete 12 - bit address for the 8k byte rtc / nvram chip 70 . the memory portion of rtc / nvram 70 is provided primarily for storing data from the de breakers and other data which is not critical to the operation of the lcm 10 . although shown for the preferred embodiment , the use of data buffer 72 and the data buffer 74 in discrete forms is not essential . in other implementations , data buffers 72 and 74 may be integrated within the rtc / nvram chip 70 itself . the cpu 76 in the preferred embodiment is an 8 - bit microcontroller such as a pic 16c73a manufactured by microchip technology , inc . the cpu 76 communicates with the rtc / nvram 70 through the array of data lines shown in fig2 as rb0 through rb7 . these lines are connected respectively to data buffer 72 and data buffer 74 and therethrough to the rtc / nvram 70 . in operation , the rtc portion of rtc / nvram 70 is provided to time - stamp the data downloaded from the de breakers 40 and stored in the nvram for historical and analysis purposes . time - stamped data is particularly useful when reconfiguring trip profiles for extended power outages , to accommodate the extremely high peak inrush currents flowing in a large number of incandescent lamps whose filaments have cooled substantially since the power outage occurred . various control lines connecting the cpu 76 to the rtc / nvram 70 include connections to i / o terminal ra0 , ra2 through ra3 , ra4 , and ra5 of cpu 76 . several of these lines , for example ra4 , the clock line to data buffer 74 , include pull - ups to the + 5 volt power supply . similarly , the control lines connected to i / o ports ra2 , ra3 and ra0 are connected through respective pull - up resistors to the + 5 volt power supply . the operating frequency of the microprocess or central processing unit 76 shown in fig2 may be controlled by a crystal or ceramic resonator or some other means of frequency control such as a capacitor combined with a resistor or even an inductor . in the preferred embodiment , crystal 68 operates at a frequency of 8 . 0 mhz . the terminals of crystal 68 are connected to the terminals labeled osc1 and osc2 on cpu 76 . a brown - out detector 60 is connected between the vdd terminal and the vpp or master clear terminal ( a reset pin ) of cpu 76 . in operation , brown - out detector 60 generates a reset signal during any period that the voltage input to power supply 54 falls below a predetermined level . the reset connection between brown out detector 60 and the vpp terminal of cpu 76 is coupled through resistor 62 . a third terminal of the brown - out detector 60 is connected to system ground . the brown - out detector 60 used in this illustrative embodiment may be a max889 manufactured by maxim integrated products , inc . the vss terminal of cpu 76 is connected to system ground . a capacitor 66 is connected between the vdd terminal and the vss terminal of cpu 76 . the vdd terminal of cpu 76 is also connected to the output of power supply 54 . the dc power for this microprocessor cpu 76 , is developed from the ac powerline at line 12 via resettable fuse 36 and power supply 54 . the power supply 54 operates as described in u . s . pat . no . 5 , 875 , 087 incorporated hereinabove by reference and entitled &# 34 ; circuit breaker with integrated control features &# 34 ; and will not be described further herein . the input / output communication ports of the lcm 10 will now be described . user port 20 , shown in fig2 at connector j1 , has three wires connected to the cpu 76 through a dual opto - coupler for isolating the communication port from the circuitry within the cpu 76 . the incoming receive line labeled rx is connected to pin 1 of opto - isolator 104 and exits from output pin 2 of opto - isolator 104 to connect to a common terminal which is connected in turn to the - 12 volt line at pine 3 of j1 , the user port 20 . terminals 1 and 2 of the opto - isolator 104 are connected to the anode and cathode respectively of the internal light - emitting diode , i . e ., the input side of opto - isolator 104 . the output side , which is an optically operated transistor is connected to terminals 8 and 7 of opto - isolator 104 with the collector of the output transistor connected to terminal 8 and the emitter connected to terminal 7 of the opto - isolator 104 . the collector of the output transistor at terminal 8 connects to the rc3 / scl pin of cpu 76 . this is the receive input line for the user port 20 . the return side of the output of the transistor at pin 7 of opto - isolator 104 is connected to the rc2 / pwm terminal of cpu 76 . a pull - up resistor is connected from pin 8 of opto - isolator 104 to the + 5 volt supply . the output or transmit line tx of user port 20 begins at pin rc4 / sda of cpu 76 and is connected through a series resistor to pin 3 of opto - isolator 106 to the anode of the light - emitting diode within the opto - isolator 106 . the cathode of the light - emitting diode in opto - isolator 106 connects to a common line connected to pins 4 and 7 of opto - isolator 104 and 106 and the rc2 input pin of cpu 76 . the output of opto - isolator 106 is an optically operated transistor with the collector at pin 6 and the emitter at pin 5 . pin 5 is connected to the - 12 volt common line to the user port 20 and pin 6 , the output of the transmit line , is connected to terminal 4 of j1 of user port 20 . the - 12 volt line of the io port is connected to terminal 3 of j1 of user port 20 . service port 22 is similar to user port 20 in that it includes a connector j2 having terminals 1 , 3 and 4 . the receive line rx at terminal 1 of j2 of the service port 22 is connected to pin 1 of opto - isolator 100 which is the anode of the light - emitting diode within opto - isolator 100 . the return path , that is the - 12 volt line , is connected to terminal 2 of opto - isolator 100 and to terminal 3 of j2 of the service port 22 . the receive output of opto - coupler 100 is at terminals 8 and 7 with terminal 8 connected to the internal transistor of opto - isolator 100 and terminal 7 of opto - isolator 100 connected to the rc3 / scl pin of cpu 76 . the return side of the receive line from the output of opto - isolator 100 at pin 7 , which is connected internally to the emitter of the internal transistor , is connected to the collector of transistor 90 and from there through resistor 92 to the + 5 volt supply . the emitter of transistor 90 is connected to ground . the base of transistor 90 is connected through series resistor 94 to node 88 and , in turn , to the output pin rc2 / pwm of cpu 76 . transistor 90 selects which is the two i / o ports , user port 20 or service port 22 , will be active . continuing with the service port 22 shown in fig2 the outgoing transmit line tx outputs from the collector of the internal transistor of opto - isolator 102 . the emitter of the internal output transistor is connected to the - 12 volt line which connects to pin 3 of connector j2 . the outgoing transmit line tx at pin 6 of opto - isolator 102 is connected to terminal 4 of connector j2 . the outgoing transmit line for the service port 22 begins at pin rc4 / sda of cpu 76 and continues through a series resistor to pin 3 of opto - isolator 102 , which is the anode of the internal light - emitting diode of opto - isolator 102 . the return side of the input connection to opto - isolator 102 at pin 4 , the cathode of the light - emitting diode within opto - isolator 102 is connected to the collector of transistor 90 . it will be appreciated from the above description that both of the output terminals of the incoming receive lines of user port 20 and service port 22 are connected together to a pull up resistor to the + 5 volt supply and to the rc3 / scl pin of cpu 76 . also connected to this pin is pin 6 of a 1k × 8 eeprom 108 which is provided for storing information critical to the operation of the lcm 10 . such information includes data that must be retained in the event of a complete power failure . pin 5 of eeprom 108 is connected to pin rb7 on cpu 76 . pins 1 , 2 , 3 and 4 of eeprom 108 are connected to ground and pin 8 of eeprom 108 is connected to the + 5 volt supply . various configuration parameters for the lcm 10 system may be saved in eeprom 108 for shifting into the cpu &# 39 ; s memory when called upon by a step in one of the operating program routines . eeprom 108 may further hold the primary addresses of each de breaker 40 as they are assigned by the lcm 10 as well as parameter settings and trip profiles of the individual de breakers 40 connected to the communication bus 26 . as shown , eeprom 108 may also be accessed through either user port 20 or service port 22 . it will also be appreciated by persons skilled in the art that other data storage configurations may be used to satisfy the functions supplied by eeprom 108 . continuing with fig2 for the lcm 10 , there is connected to pin rc0 of cpu 76 the anode of a red light - emitting diode through a resistor . similarly , there is connected to pin rc1 of cpu 76 the anode of a green light - emitting diode through a resistor . while the colors red and green are shown in the illustrative embodiment , other or additional colors may be employed and the choice of red and green is not intended to be limiting . the cathodes of both the red and the green light emitting diodes used as the visible indicator 34 are connected to ground . the signal at pin rc0 of cpu 76 is also connected through resistor 122 to the base of transistor 120 . the emitter of transistor 120 is connected to ground . transistor 120 is a driver transistor for operating an internal audible alarm such as buzzer 30 and / or for driving an external alerting signal through terminal 4 of connector j3 , thus providing the audible alarm 32 shown in fig2 . the collector terminal of transistor 120 includes buzzer 30 which is connected through diode 130 and resistor 128 in series to the + 5 volt supply . resistor 126 is connected across buzzer 30 . buzzer 30 may be an audible annunciator having the appropriate sensitivity and output characteristic . in operation , when the line from pin rc0 of cpu 76 is active , the red light - emitting diode of visible indicator 34 will flash , the driver transistor 120 will turn on to operate the buzzer 30 and provide a signal at terminal 4 of connector j3 to operate the external audible alarm 32 . an intelligent alarm may be provided by utilizing driver transistor 120 in a pulsed mode for sending an encoded message . also connected from the output terminal of collector terminal of transistor 120 is a reverse - biased rectifier 132 connected to ground and a transient absorbing device 134 connected to ground . associated with the audible alarm provided by the illustrative buzzer 30 are functions for clearing the audible alarm and for setting various operating and test modes of the lcm and the de breaker 40 using a clear button 38 connected to cpu 76 provided therefor . pressing the clear button 38 may be used to clear the alarm until a service person responds to the alarm . in operation , the alarm may be set in a mode to reactivate the alarm after specified intervals wherein the intervals may be adjusted for example , as to duration , volume , pitch or repetition rate , corresponding to various levels of urgency associated with or conditions which triggered the alarm . further , the clear button 38 may be pressed to initiate a self - test routine during servicing . continuing further with fig2 for lcm 10 , the pwm output of cpu 76 is provided at pin rc2 . this pin rc2 is also connected to node 88 which is coupled through resistor 80 and resistor 84 to the pwm output 28 . connected from the junction of resistor 80 and resistor 84 is a capacitor 82 connected to ground ; similarly , from the junction of the pwm output 28 and resistor 84 is a capacitor 86 also connected to ground . the combinations of resistor 80 and capacitor 82 and resistor 84 and capacitor 86 form a low pass filter of the pwm output to the diagnostic output 28 . in operation , cpu 76 shown in fig2 is programmed according to flow - charts to be described hereinafter , to store time - stamped data supplied by individual de breakers 40 in the non - volatile memory portion of rtc / nvram 70 . thus data logging information is retained in the non - volatile memory 70 even when there is no ac power for the lcm 10 . further , the eeprom 108 is available for storing the various configuration parameters for both the lcm 10 and the connected de breakers 40 as well as the primary addresses of the individual de breakers connected to communication bus 26 . the use in the preferred embodiment of eeprom 108 for storage of configuration parameters and primary addresses is not intended to be limited ; this data may also be stored in non - volatile memory , for example . thus it is one of the principal functions of cpu 76 to obtain and store the data logging information from the de breakers in the system for later use in analysis or remote control operations to be described hereinbelow . another principal function of cpu 76 is to perform parameter analysis of the time - stamped data stored in the non - volatile memory 70 to modify by adaptively reconfiguring the trip profiles of individual de breakers as necessary according to conditions experienced by that individual de breaker , and to report the evaluation of such data for use by personnel maintaining the system . yet another function of the cpu 76 in lcm 10 is to control or participate in the remote control of and / or reconfiguration of the data logging , analysis or adaptive reconfiguration of the lcm / de breaker network comprising of the lcm 10 and associated plurality of de breakers 40 in an electrical power distribution system . among the status indicators provided by the lcm 10 are the previously mentioned audible alarm provided by buzzer 30 , the visible indicator 34 provided , for example by the red and green light - emitting diodes , and the signal provided by driver transistor 120 to the external alert terminal 32 . the alarm indications provided by these three outputs provides information on the status of the lcm 10 and any of the associated de breakers 40 . continuing with the operation of the lcm 10 , another principal function of the lcm 10 is the remote data logging of de breaker 40 status and ac power line or load circuit status and line transients as well as other conditions on the ac power line network into which the lcm 10 is connected . for example , all data inside the cpu 76 is accessible by a remote control system for monitoring of lcm 10 data and the status of individual de breakers 40 . during the data collection activity , there is no compromise of the de breaker &# 39 ; s normal ability to detect circuit overloads and arcing . if several de breakers 40 , for example , are indicating a particular condition at the same time , the lcm 10 can use the commonality to detect problems that originate closer to the power source , such as a loose connection between the breaker box and the distribution transformer . thus , by remote control , data logging information and status information may be obtained through either the user port 20 or the service port 22 . further , the remote units communicating through either of these ports may issue commands to the lcm 10 to respond appropriately to conditions that are reported to the remote controller over the user port 20 or the service port 22 . such monitoring activity may be the result of normal service routines performed on the system or , in the case of an emergency , queries can be made over the communication ports to obtain information related to an existing or a potential emergency situation . similarly , the data acquisition properties of a lcm 10 can be used to analyze and monitor information supplied by the de breakers 40 and issue various alarms or alert notices to the remotely located terminals . moreover , upon a command from one of the remote terminals over one of the communication ports such as the user port 20 or the service port 22 , a command for providing adaptive control of an individual de breaker 40 in the network of circuit breakers connected to the communication port 24 can be used to adjust the response or trip profile of the individual de breakers 40 to conditions existing on the power line on the branch circuit protected by that individual de breaker 40 . continuing with the operation of lcm 10 shown in fig2 it has been described previously how transistor 90 operates as an enabling switch for user port 20 and service port 22 . this transistor may be operated by a control bit output from cpu 76 at pin rc2 . this single bit may be generated to control communication on either port by selecting the port to be used . moreover , this same bit may be programmed as the output of the pulse width modulator ( pwm ). in such case , the output of the pulse width modulator at pin rc2 of cpu 76 may be coupled to the pulse width modulator output 28 for conveying diagnostic data to a manufacturing terminal to monitor data values inside the cpu 76 . yet another important principal feature of the lcm 10 shown in fig2 is the re - configureability that is available because of the programmability of cpu 76 . as previously described , a microcontroller such as the pic 16c73a manufactured by microchip technology , inc ., is used for maximum versatility . this device can be programed after assembly and even modified by remote control for special requirements . thus , different characteristics may be programmed into the cpu 76 of the lcm 10 , both when the unit is manufactured and also in the field by remote control action through either one of the remote i / o communication ports , user port 20 or service port 22 . this re - configureability may be important when adapting the trip profile of individual circuit breakers on a particular branch circuit to particular kinds of appliances or other loads . trip profiles having differing characteristics for turn - on surge current and overload characteristics , such as electric motor stalling and inductive switching are just two of the illustrative examples of the many characteristics that can be adopted . these differing characteristics of the kinds of loads that are attached to individual branch circuits in an electrical power distribution system are described in detail in u . s . pat . no . 5 , 875 , 087 entitled circuit breaker with integrated control features filed on aug . 8 , 1996 as ser . no . 08 / 695 , 076 which was incorporated in its entirety by reference herein . yet another feature available because of the presence of the programmable microcontroller as used for cpu 76 is the ability to perform automatic self - tests at regular time intervals , update those results and store those results in the non - volatile memory 70 at periodic intervals . for example , in the preferred embodiment , the automatic self - test routine may be performed every nine minutes , or at other selected intervals , upon a command from a remote controller system through user port 20 or service port 22 . as will be described hereinbelow , the automatic self - test routine can provide information about a number of hardware or software operating parameters that exist in a lcm / de breaker system . referring now to fig3 there is shown a block diagram of a de breaker of the type used in conjunction with the lcm 10 of the present invention . each de breaker 40 of the type shown in the preferred embodiment of fig3 includes a cpu 376 connected to a plurality of sense inputs , a serial i / o communication port , a power supply and a non - volatile memory 35 sufficient to store basic configuration parameters and addresses with are entered during manufacturing . the incoming main power line 312 is connected to a node 313 and further to the input of a circuit breaker 318 . the output of circuit breaker 318 is further connected to a node 319 and therefrom to the input of the current sense circuit 324 of the de breaker . the output terminal of the current sense circuit 324 is connected to the load terminal 352 . the neutral power line at line 314 is connected to the ground terminal of the de breaker and also to the ground terminal of the power supply 354 and cpu 376 within the de breaker . ac voltage is supplied to power supply 354 from node 313 . the output of power supply 354 is supplied on line 356 to the vdd terminal of cpu 376 shown in fig3 . node 313 at the input to circuit breaker 318 is connected through line 334 to the first voltage sense input of cpu 376 . a second voltage sense input to cpu 376 is provided from the neutral side of breaker trip solenoid 316 via line 320 . the purpose of providing two voltage sense inputs will be described hereinafter . it will be appreciated , however , that the first voltage sense input is responsive to voltage changes that occur upstream from the de breaker 40 , that is , changes such as voltage dropouts which will affect all de breakers in the system . the second voltage sense input is also responsive to upstream voltage charges as long as the breaker has not tripped . since both voltage inputs are responsive to the voltage on the ac power line and are connected to opposite sides of the breaker trip solenoid 316 , sensing both lines 320 and 334 allows for testing the solenoid coil in breaker trip solenoid 316 . moreover , the first voltage sense line 334 may also be used to sense conditions on the upstream side of the de breaker even after it has tripped . circuit breakers 318 , which is of the type of circuit breaker described in detail in u . s . pat . no . 5 , 875 , 087 filed aug . 8 , 1996 , entitled &# 34 ; circuit breaker with integrated control features &# 34 ;, includes a trip override feature which is supplied by breaker trip solenoid circuit 316 shown in fig3 of the present application . the output of breaker trip solenoid circuit 316 is applied through control path 342 to operate the solenoid contacts to cause circuit breaker 318 to trip immediately upon an appropriate trip signal supplied by cpu 376 . a trip signal is provided over line 340 from cpu 376 to the input of the breaker trip solenoid circuit 316 . continuing with fig3 showing the block diagram of a de breaker 40 , an output for each of the visible indicators , a red light - emitting diode 370 and a green light emitting diode 372 is provided . each of these light emitting diode ( led ) visible indicators 370 and 372 are provided outputs by cpu 376 to provide visual indicators of conditions within the cpu 376 of a de breaker 40 . cpu 376 further has an input line 322 which connects the output of the current sense circuit 324 to cpu 376 , to provide an input for sensing the load current by the cpu 376 . there is further provided the output of temperature sense unit 326 through line 328 to another input of cpu 376 for monitoring the temperature of the de breaker 40 . there is yet another set of lines denoted as program lines 322 between program jumper set 330 and cpu 376 . the program jumper set 330 provides for programming various functions of the cpu 376 in response to particular circumstances of the installation in which the de breaker 40 shown in fig3 is used . there is also shown in fig3 the serial i / o coupler connected to cpu 376 through line 350 . line 350 enables bi - directional data communication between cpu 376 and a compatible terminal connected to the communication bus represented by the receive , the transmit and the common lines attached to the serial i / o coupler 352 . in the typical installation , the three - wire bus connected to the output of serial i / o coupler 352 provides a bi - directional communication path between the de breaker 40 and the cpu 376 in the lcm 10 of the present invention . continuing with fig3 other features of the de breaker 40 include first , storage capacity within cpu 376 for storing predetermined performance parameters . the controller within cpu 376 compares outputs of current sense unit 324 , the temperature sense unit 326 , and the voltage sense units through lines 320 and 334 to generate control signals when these parameters exceed the predetermined operating thresholds . second , the input / output port provided by the serial i / o coupler 352 enables communication with a computer external to the de breaker 40 . this allows information to be transmitted to and from the external computer . the controller within cpu 376 is therefore operable to receive data from the serial input / output port 352 regarding new desired operating relationships or trip profiles for storage in the memory within cpu 376 . for example , data can be uploaded from the de breaker to the external or remote computer or new trip profiles for the operation of the circuit breaker can be downloaded from the external or remote computer . moreover , remote control of the de breaker can be used to override the trip mechanism in the de breaker and trip the circuit breaker in certain conditions . for example , in the event of fire conditions detected within the building that houses the lcm 10 and its associated de breakers 40 , a command can be issued to the lcm 10 and , in turn , to the de breaker 40 to trip a particular branch circuit in the vicinity of the detected fire hazard . further , remote control can be used to disable the trip override feature in a de breaker so that it will operate as a conventional , thermally operated circuit breaker , for example during maintenance . continuing further with fig3 a zero - crossing detector within cpu 376 makes use of inputs provided by both the current sense circuit 324 and the second voltage sense input . voltage dividers ( not shown in fig3 ) reduce the input voltage to a level within the ratings of the zero crossing detector circuits within cpu 376 . the zero - crossing detector can determine , from the waveforms present at these two inputs to cpu 376 , the phase angle of the current to the load relative to the voltage supply to the load , thus determining the type of load that is connected to load terminal 352 . thus , characteristics peculiar to the particular load can be known and the trip profile for an individual de breaker adapted to the particular load . furthermore , within an individual de breaker , a memory contains a family of trip point profile curves . thus , the trip point profile curve needed for a particular kind of load can be retrieved from the family of trip point profile curves stored in memory . theses trip profiles are selectable either by the user or as a function of the measured parameters determined by the de breaker 40 from inputs provided by the current sense input 324 , temperature sense input 326 or the first and second voltage sense inputs through lines 334 and 320 . continuing with the operation of the de breaker shown in fig3 the de breaker 40 is programmed , in effect , to take a snapshot of multiple data values at the end of each half cycle of the incoming ac power line signal . this data will be saved in the memory buffer of the de breaker 40 within cpu 376 until the breaker 40 has a chance to offload the data to the lcm 10 . in normal operation , the lcm 10 can collect the data for an individual de breaker 40 during one full ac cycle . in operation , the cpu 376 shown in fig3 receives voltage sense inputs from a first input connected to the incoming ac supply voltage and also from a second input connected to the neutral side of the breaker trip solenoid 316 . the first voltage sense input thus detects voltage drop outs which may be caused by arcing across an open circuit or a loose connection in the upstream circuit or across the hot and neutral wires in the upstream circuit . such a condition would affect all the de breakers 40 served by the malfunctioning power line . the response of the lcm 10 to upstream arcing and voltage drop outs is described in conjunction with fig7 b . in another fault condition , suppose the lcm 10 receives data from all de breakers 40 , having the same time stamp values , that arcing or drop outs are indicated downstream because the de breaker 40 current sense inputs detect a current drop - out . the lcm 10 interprets this condition as a loose or open connection in the neutral wire and accordingly activates an alarm as described in conjunction with fig7 b . it will be appreciated by persons skilled in the art that the concept of the lcm 10 and de breaker 40 network or system illustrated herein may also be applied to dc circuits as well as to ac circuits . in ac circuits the power line frequency provides a convenient reference for synchronizing the operation performed by the lcm 10 and the de breakers 40 . however , in a dc circuit system , the choice of synchronizing reference is up to the designer to select one appropriate for the application . reference timing may , of course , be supplied by a system oscillator or some other stable source provided for this purpose . this completes the detailed description of the principle structural features of the lcm 10 and the de breakers 40 intended to be used therewith . the remaining detailed description will address two major areas . first , the communication between the lcm 10 and the de breakers 40 will be described in conjunction with fig4 . this description will include the automatic address assignment routine for the individual circuit breakers , the communication protocol and arbitration used to operate the intercommunication between these two units , and the processing of parametric data saved by the lcm 10 . second , the program operating routines for the lcm 10 will be described with the aid of fig5 , 7 and 8 . additional mechanical features of the lcm 10 and de breakers 40 system will be described in conjunction with fig9 and 11 . preparatory to the description of fig4 it will be helpful to describe the basis for the timing used by both the communication protocol and the a / d converters in the de breakers 40 . in both cases , these timing frequencies are keyed to the ac line frequency . for example , the sampling rate of the a / d converters is 1 / 16 of the period of 1 / 2 cycle of the 60 hz power line frequency . this calculation works out to 1 / 16 × 8 . 33 milliseconds or approximately 520 microseconds for the duration of a sampling interval . the 520 microsecond interval is also the length of a communication data byte which is transmitted between the lcm 10 and a de breaker 40 . as is well known , an individual data byte consists of a start bit , 8 data bits , a parity bit and a stop bit for a total of 11 bits . in operation , 16 data samples are acquired for an individual de breaker 40 during a half cycle of the 60 cycle ac line frequency . this sampling rate is synchronized by the zero - crossing detector in the microcontroller , cpu 376 . the first sample begins at the zero - crossing , the eighth sample occurs at the ac line waveform peak , and the sixteenth sample occurs just prior to the next zero - crossing . these and other sample positions will become important during the description of the program flow charts to be described hereinbelow . responsive to the ac line frequency and the sampling rate are two 8 - bit counter timers used to determine the timing of certain events . the so - called two - second timer , to be discussed hereinbelow , counts to 256 times the duration of 1 / 2 cycle of the ac waveform or 2 . 13 seconds . similarly , the so - called nine - minute timer , also to be discussed hereinbelow , counts to 256 times the duration of the two - second timer , or approximately 9 . 1 minutes . the two - second timer is used to control the flash repetition rate of the visible leds . the nine - minute timer is used to control the lcm 10 self - test program repetition rate . referring now to fig4 there is shown an example of the communication protocol for data communication between a lcm 10 and a de breaker 40 when data is being downloaded from a de breaker 40 to the lcm 10 . in fig4 the lower line is a time line with equally spaced intervals beginning with t 0 . each interval represents the sampling period of 520 microseconds . above the lower horizontal time line are two sequences of pulses . the upper row of pulses illustrates the data bytes transmitted by the lcm 10 which are transmitted at approximately 1 , 040 microsecond intervals . the sequence of pulses below the upper row of pulses represents the data bytes transmitted by an individual de breaker 40 . notice that these pulses are transmitted at equally spaced alternate intervals with respect to the lcm 10 data byte transmissions . fig4 thus shows that individual data bytes are alternately transmitted by first the lcm 10 , then the de breaker 40 with which it is communicating , and so on . this particular illustrative example of the communication protocol was designed using the eia standard no . rs - 232c for serial binary data interchange . however , other schemes are possible . for example , the i 2 c bus , which is a trademark of phillips corporation , could also be used to implement the communication bus for data communication between the lcm 10 and a smart breaker such as the de breaker 40 of the present invention connected to the communication port of the lcm 10 . the present invention disclosed herein , however , is not limited by this particular illustrative example . each of the data byte pulses shown in fig4 includes a complete data byte consisting of a start bit , 8 data bits , a parity bit and a stop bit . referring further to fig4 each of the pulses shown in both of the sequences of data bytes are identified with the name of the data byte being transmitted . theses identities correspond with the names shown in table a hereinbelow and will be used to describe a typical example of data communication between a lcm 10 and de breaker 40 connected to the communication port of the lcm 10 . further , just to the left of each data byte pulse in fig4 is shown a numeral indicating the position in the sequence of pulses of that particular data byte pulse . these numerals correspond to the numerals that appear in table a . table a______________________________________communication protocol______________________________________1 . lcm 10 sends address ( 8 bits ). 2 . de breaker 40 receives address and sends a random number 0 - 255 . 3 . lcm 10 receives the number 4 . de breaker 40 receives the and echoes back its complement . echo and sends its address as an &# 34 ; ok &# 34 ; code . 5 . lcm 10 receives the &# 34 ; ok &# 34 ; and 6 . db breaker 40 receives the op then sends an op code . code . if this is a datalog command , breaker sends the byte count . 7 . lcm 10 receives the byte count 8 . db breaker 40 receives the and echoes its complement . complement of the byte count and begins sending data one byte at a time . 9 . lcm 10 receives a data byte and echoes its complement . ______________________________________ in the above example shown in table a , if the lcm 10 detects an error at steps 5 , 7 , or 9 , it will disable itself for 50 milliseconds . if , on the other hand , a breaker detects an error at steps 4 , 6 , or 8 , it will reassign itself a random address address between 128 and 255 according to a procedure to be described hereinbelow and then disable itself for a random number of half - cycles . in operation , table b shown below presents a numerical example of the data bytes that are transmitted between the lcm 10 and the de breaker 40 that corresponds with the data byte pulse trains shown in fig4 . there are two conditions for the transmission of data byte information between a lcm 10 and a de breaker 40 . the first condition occurs when the breaker address is unique , that is , there is not a conflict on the data bus with another de breaker 40 having the same address . the second case occurs when the breaker address is not unique ; that is , there are two or more de breakers 40 active which have the same address . in such case , the lcm 10 will automatically assign a new address for a particular de breaker 40 that experiences a conflict with another de breaker 40 on the data bus . the first breaker assigns itself a new random address between 128 and 255 and programs its delay time for a value of 16 to 47 half - cycles . similarly , the second breaker also assigns itself a new random address between 128 and 255 and programs its delay time for a value of 16 to 47 half - cycles . the meaning of these statements will become clear after the automatic address assignment feature for the de breaker 40 is described . table b______________________________________numerical examplesfunction lcm breaker______________________________________1 . breaker address is unique : brk . sub .-- adr 0x03random . sub .-- num 0x51random . sub .-- num 0xafbrk . sub .-- adr 0xfdlog . sub .-- command 0x96byte . sub .-- count 0x10byte . sub .-- count 0xf0data1 0x23data1 0xdddata2 0x82data2 0xe7data16 0x66data16 0x9aacknowledge 0xc52 . breaker address is not unique : brk . sub .-- adr 0x03random . sub .-- num . sub .-- 1 0x51random . sub .-- num . sub .-- 2 0x72random . sub .-- num 0xb0 ( logic 0 overrides a logic 1 ) ______________________________________ breaker . sub .-- 1 assigns itself a new random address between 128 and 255 and programs its delay time for a value of 16 to 47 halfcycles . breaker . sub .-- 2 assigns itself a new random address between 128 and 255 and programs its delay time for a value of 16 to 47 halfcycles . continuing with fig4 each of the de breakers 40onnected to an lcm 10 is assigned a unique address . the addresses can be assigned when the de breaker 40 is manufactured , or the address can be assigned automatically after the de breaker 40 is installed in a system with a lcm 10 . thus , in a system including a plurality of de breakers 40 connected to the communication port of a lcm 10 , each de breaker 40 in a panel will have a unique address . in the illustrative example given below , the range of addresses is zero to 127 . at the factory , individual de breakers 40 will be assigned temporary numbers in the range of 128 to 255 . a value with bit 7 turned on indicates , for example , that the breaker has not been installed in a panel with a lcm 10 , before being assigned a permanent address between 0 an 127 . however , during the installation process , which may require resolution of address conflicts , individual de breakers 40 may be assigned temporary addresses between 128 and 255 by the lcm 10 . there are 8 conditions which governs the assignment of address numbers to individual de breakers 40 by the lcm 10 . each can be described in successive paragraphs 1 - 8 . ______________________________________case 1 : a new de breaker 40 is installed in an existing panel . in this case , the lcm 10 finds the new de breaker 40 during a scan of all possible addresses between 0 and 255 . the new de breaker 40 is then assigned an unused number between 0 and 127 . case 2 : several new de breakers 40 are installed in an existing panel . some of these addresses may be in conflict . in this situation , when conflicts are encountered , the de breakers 40 involved will assign themselves new , temporary random addresses in the range of 128 to 255 . this reassignment continues until no conflicts exist . when the situation where no conflicts exist is reached , the lcm 10 will assign new permanent addresses in the range of 0 to 127 to each of the de breakers 40 . case 3 : a used de breaker 40 is installed in an existing panel . when a data conflict is noticed while communicating with a parti - cular address , the two conflicting de breakers 40 involved will reassign themselves random , temporary addresses between 128 and 255 . these addresses may still be in conflict , in which case the reassignment continues for addi - tional cycles . after conflicts have been eliminated , the lcm 10 will assign new addresses just as in case 3 above . case 4 : several used de breakers 40 are installed in an existing panel . the conflicts will be resolved just as in case 2 above . case 5 : a new lcm 10 is installed in a panel . the lcm 10 will scan all addresses and make an internal list . case 6 : a used lcm 10 is installed in a panel . the internal address list is not valid in this situation . the lcm 10 will scan the list of stored addresses first . addresses corresponding to de breakers 40 that don &# 39 ; t exist will be deleted . then , all the other addresses will be scanned , looking for new de breakers 40 . this time , it is assumed there are no conflicts because only the lcm 10 has been changed . case 7 : a de breaker 40 is removed from a panel . the lcm 10 notices the de breaker 40 is not responding . it then blinks its red light and beeps until the lcm &# 39 ; s 10 clear button is pressed . then , the de breaker 40 is deleted from the active list . case 8 : the lcm 10 is removed from a panel or a used de breaker 40 is installed in a panel without a lcm 10 . in this case , after ten minutes without being logging by an lcm 10 , a de breaker 40 with a valid address . blinks its red led with a special code indicating a communication failure . this led continues to blink until an lcm 10 is installed . ______________________________________ communication between the lcm 10 and de breakers 40 will now be described . the lcm 10 is the master and will initiate all data transactions . it begins by first sending an 8 - bit address databyte . when a de breaker 40 or several de breakers 40 responds , that de breaker 40 will send an 8 - bit random number obtained from an internal free - running counter . since the oscillators in the de breakers 40 are not synchronized , their counter data will generally be different . however , there is a 1 in 256 chance that they will be the same . next , the lcm 10 receives the data byte and sends back its two &# 39 ; s compliment for the de breaker 40 to verify that it is unique . if a conflict exists , one or more of the de breakers 40 will respond as though the data is in error . in that case , the de breaker 40 will reassign itself a new temporary address in the range of 128 to 255 using a number from the free - running counter . the de breakers 40 will also be looking for conflicts during the transmission of data log information . each data byte sent by a de breaker 40 will be echoed back by the lcm 10 . if a de breaker 40 notes an error , it will reassign itself a new address . if , later , the lcm 10 notes that the de breaker 40 is missing , the de breaker 40 will be located when the lcm 10 scans the data bus looking for new de breakers 40 . if a de breaker 40 formerly had a valid address , if will send that address to the lcm 10 first ( otherwise it sends a zero ), so that lcm 10 can update its table and merge the new data with the old data for that de breaker 40 . the foregoing description provided information on the communication protocol used in the lcm 10 network system with a plurality of de breakers 40 to illustrate how information is exchanged between the lcm 10 and the de breakers 40 connected to the communication port of that lcm 10 . the principle purpose of this communication protocol is , however , to send parametric data from individual de breakers 40 in response to a command from the lcm 10 . an example of the protocol for transferring this data is given in table c below . table c presents an example of intercommunication between the lcm 10 and a de breaker 40 in much the same pattern that was illustrated in table a . in fact , a generalization can be drawn in the following way . if data is being transmitted from a de breaker 40 to a lcm 10 , the lcm 10 echoes the data byte transmitted by the de breaker 40 . similarly , if data is being transmitted from the lcm 10 to a de breaker 40 , the de breaker 40 echoes the data byte transmitted by the lcm 10 . table c______________________________________parametric data protocol example______________________________________1 . lcm 10 sends command 0x6d 2 . breaker echoes - 0x6d3 . lcm 10 sends byte count 4 . echo - byte count5 . lcm 10 sends register address to 6 . echo - addressput the data7 . lcm 10 sends data byte 8 . echo - data9 . lcm 10 sends ack 0xd9______________________________________ in the present embodiment , there are defined 22 bytes for de breaker 40 parameters that can be saved by a lcm 10 . these bytes are defined in table d below . table d__________________________________________________________________________breaker parameters saved by lcm__________________________________________________________________________data record format : 22 bytes total 1 . 6 bytes : datetime : date and time this record was saved . year , month , day of month ( dom ), hour , minute , second 2 . 1 byte . my . sub .-- adr breaker id number . 3 . 1 byte : log . sub .-- code record . sub .-- type : 1 = standard periodic datalog . 2 = delta . sub .-- i & gt ; min . sub .-- delta . sub .-- i . ( significant load current change ) 4 = delta . sub .-- v & gt ; min . sub .-- delta . sub .-- v . ( significant line voltage change ) 8 = breaker status change . ( tripped ; or self - test failure ) 16 = ac main power turned on / off . note : record . sub .-- type may have more than one bit on at a time . 4 . 1 byte max . sub .-- arc maximum value of the arc . sub .-- accumulator during the data log interval . 5 . 1 byte : iavg2 value in the current averaging digital capacitor which has a time constant of 2 seconds . 6 . 1 byte : ipkcycle max value of current during this half - cycle . 7 . 1 byte : iprevpk max value of current during the previous half - cycle . 8 . 1 byte : imax . sub .-- log peak current found during this logging interval . 9 . 1 byte : i . sub .-- soak2 soak current value when this record was stored . time constant is 68 seconds . 10 . 1 byte : ig . sub .-- peak peak current since main ac power was turned on . 1 byte : vac max line voltage found during last half - cycle . 1 byte : arc . sub .-- accum present accumulated value found in arc register . 0 - 255 . 1 byte : gfi . sub .-- pp ground fault current ,, peak to peak . 1 byte : flagbreaker . sub .-- status : an 8 bit flag word that shows whether the breaker is tripped or if the self - test has failed . ( bit . sub .-- 0 = lsb . ) bit . sub .-- 4 = 1 =& gt ; trippedbit . sub .-- 5 = 1 =& gt ; self - test min current & gt ; 20 amps . bit . sub .-- 6 = 1 =& gt ; self - test 100 amp reading was low . bit . sub .-- 7 = 1 =& gt ; self - test triac trip signal nonfunctional . 1 byte : trip code : this byte is set to a coded value when a trip occurs , indicating whatcaused the breaker to trip . number of failurered lbd code sentflashes to lcm 10 description ( 1 ) 129 communication failure ( 1 ) 131 manual trip . ( 1 ) 133 iavg greater than triplimit . ( 2 ) 135 arc detected . ( 3 ) 137 manual test button pressed longer than 2 seconds . ( 4 ) 139 external trip command via rs232 . ( 5 ) 141 adc reading greater than trip . sub .-- immed value . ( 6 ) 143 hissing arc . ( 7 ) 145 gfci trip . ( 8 ) 147 high current arc detected . ( 10 ) 151 excessive contact temperature . ( 11 ) 153 overflow from iavg2 during current averaging . ( 12 ) -- invalid trip code . 1 byte : resp . sub .-- modebreaker . sub .-- mode : a number from 0 . . . 3 indicating the mode switchsettings : 11 = standard response curve . 10 = response curve 2 . 01 = response curve 1 . 00 = response curve 0 . 1 byte : versionprogram version : a number indicating the software version . __________________________________________________________________________ referring now to fig5 there is illustrated a flow chart for the main lcm 10 program . this program is initiated at a function block 502 which follows power - up of the lcm 10 system . function block 502 performs initialization of data registers and i / o ports in the lcm 10 following power up . following initialization , the flow proceeds to function block 504 where the system waits for a zero - crossing of the ac line waveform . a zero - crossing signal is responsive to the arrival of a zero - crossing event at pin rc5 of cpu 76 in the lcm 10 . it will be appreciated at this point that the zero - crossing event is the data event for the operation of the programs within the lcm 10 as was previously discussed in conjunction with fig2 and fig4 . following the zero - crossing event , the flow proceeds to function block 506 to execute a sub - routine for sending data to a computer ( computer ) connected to one of the i / o ports of the cpu 76 in the lcm 10 . as was described previously , a computer can be connected to either the user port 20 or the service port 22 . data communications with a computer on either of these i / o ports may typically be using the rs 232c standard for serial binary data interchange . typically , data is sent from the lcm 10 to the computer on request or in response to a command from the remote computer . thereafter , the flow proceeds to function block 508 to read data from a computer . data being read from a remote computer may be in the form of commands to execute certain operations or from data being downloaded from the computer to the lcm 10 . this functional block 508 will be described in greater detail in conjunction with fig6 to be described hereinbelow . previously , it was described that the sampling clock rate was synchronized with the zero - crossing periods , that is , with the intervals between zero - crossings of the ac line waveform . for example , the sampling rate was shown to be 16 samples taken every half - cycle of the ac line waveform . the timing of numerous events in the main program sequence is related directly to which particular sample is being output at a given instant . there is a counter in the lcm 10 which keeps track of the number of samples that have transpired since the last zero - crossing . thus , at various points within the main program , there will be a function block that will identify a particular sample count . returning now to the fig5 description , the flow proceeds from function block 508 to function block 510 where the system checks to see if the sample count is equal to eight . this sample count value is important because it occurs at the peak value of the incoming ac line waveform that is monitored at pin rc5 at cpu 76 which is the input to the zero - crossing detector . if the sample count value is eight , that is the answer to the question is a &# 34 ; y &# 34 ; or a yes , the flow proceeds to function block 512 where the lcm 10 will read the ac line polarity . if the sample count is not eight , then the flow proceeds from function block 510 along the line labeled &# 34 ; n &# 34 ; for no to the following function block 514 . a no response in block 510 means that the sample count is not eight and it is not at a peak value of the ac waveform . function block 514 similarly checks to see if the sample count is equal to thirteen . the value 13 for the sample count signifies that a zero - crossing event is approaching within a few count values . if the sample count does equal thirteen , then flow proceeds along the &# 34 ; y &# 34 ; line to function block 516 to read the day and time from the realtime clock . this step in the main lcm 10 program takes approximately 100 microseconds . if the sample count value was not thirteen in function block 514 , then flow proceeds along the &# 34 ; n &# 34 ; line where it joins with the output of function block 516 to enter the next function block 518 in which the buzzer status is checked . at function block 518 , if data is present in the buzzer status register , then the program routine will be interrupted and will process the data that is present in that register . otherwise , if there is no data in the buzzer status register , then flow will proceed with the main routine and enter step 520 . at step 520 , the lcm 10 program will clear the watchdog timer . as is well known in the art , a watchdog timer provides a means of exiting a program and restarting at the initialization step if for some reason the microprocessor is hung up in the routine at some point . in the preferred embodiment of the lcm 10 in this illustrative example , the time value of the watchdog timer is set to at least one sampling cycle , that is , approximately 16 times the 520 microsecond sampling interval for a total of 8 . 33 milliseconds which is the interval between zero lines of the ac wave line . other intervals may be used , of course , but it will be appreciated that this value for the watchdog timer is a convenient one in this particular application . thus , the purpose of function block 520 is to clear whatever value of time is in the watchdog timer counter , and proceed to the following function block 522 . proceeding with fig5 in function block 522 , a step is provided to check the data from the de breaker 40 . if data is present in the data buffer that was input from the de breaker 40 , the main program will be interrupted and the lcm 10 will process the data in the data buffer . if there is no data from a de breaker 40 in the data buffer , the main program will not be interrupted and the program will then flow to function block 524 . in function block 524 , the routine increments the sample counter from the current value . following function block 524 , the program will flow to function block 526 , where the program checks to see if the sample count value is equal to sixteen . a sample count value of sixteen means that the sampling cycle has reached the end of a sampling cycle in that particular interval between zero - crossings . therefore , the zero - crossing event will follow immediately upon the end of the sixteenth sample . if the result of the test in function block 526 is &# 34 ; y &# 34 ; or yes , then the sample count is set to &# 34 ; 0 &# 34 ;. if the result of the sample count test is in functional block 526 &# 34 ; n &# 34 ; or no , then the flow proceeds to function block 530 , where the program will wait until the end of the sample interval before it flows back to function block 506 or the send data to computer function block . it will be appreciated that if the sample count has not yet reached sixteen , then the program routine must return to an earlier point in the program so that the next sample interval may be accomplished . if , on the other hand , the sample count was sixteen and flow proceeded to function block 528 where the sample count was reset to &# 34 ; 0 &# 34 ;, then flow proceeds further to the function block 532 . the purpose of function 532 is to increment the two second counter in the lcm 10 . the purpose of the two second counter is to control the led flashing rate that is part of the visible and audible alarm operation within the lcm 10 . this function block 532 will be described in greater detail in conjunction with fig8 . returning to function block 522 where the program checked data from the de breaker 40 , this step is described in further detail in fig7 and will be described hereinbelow . referring now to fig6 there is illustrated a flow chart depicting the remote data read routine . this routine begins with function block 508 , part of fig5 entitled read data from computer . during this step , flow proceeds to function block 602 , where the sample count is checked for a value of &# 34 ; 1 &# 34 ;. if the value is &# 34 ; 1 &# 34 ; then flow proceeds along the &# 34 ; y &# 34 ; line to function block 604 . at function block 604 , the program shifts any received data left by one place . if the result of the sample count check is not &# 34 ; 1 &# 34 ;, then flow proceeds along the &# 34 ; n &# 34 ; line to function block 606 , to return to the main program at function block 510 . returning now to the remote data read routine of fig6 when the data received has been shifted left by one place , the program then flows to function block 608 where the routine enters the new data in the least significant bit ( lsb ) buffer 609 . as is well understood by those skilled in the art the most significant or the highest valued bit is the left most bit in a binary data word ; similarly , the least significant or smallest valued bit being the right - most bit of an 8 - bit word . thus , in function block 608 , the new data is entered into the lsb buffer 609 ; that is , the current bit is entered into the right - most position . as other bits are entered , the current bit is shifted to a more significant position . following entry of the new data into the lsb 609 , flow proceeds to function block 610 . the remaining steps contained in fig6 are concerned with determining whether , first , the data buffer contains a command and , second , whether the command is a valid command . referring again to fig6 beginning with function block 610 in which the system checks the data buffer for a &# 34 ; 0 &# 34 ;. if the data buffer is equal to all &# 34 ; 0 &# 39 ; s &# 34 ;, i . e ., a computer is not present on either of the i / o ports of the lcm 10 , then a non - operative condition ( no -- op ) exists and the program will jump ahead to function block 638 . thus , if the data buffer is &# 34 ; 0 &# 34 ;, then operation flows along the &# 34 ; y &# 34 ; line indicating a no -- op condition to function block 638 . if , however , there is data in the data buffer , that is it is not &# 34 ; 0 &# 34 ;, then flow proceeds along the &# 34 ; n &# 34 ; line to function block 614 , where the system determines whether or not the remote computer is sending an enable bit to the lcm 10 . thus the program executes the step of remote ena = 1 . when a remote computer sends the code interpreted as an enable bit , it is in effect saying to the lcm 10 &# 34 ; i am enabling you to receive a command .&# 34 ; the purpose of the enable command is to prepare the lcm 10 to read data from the external remote computer via one of the i / o ports . this step is a procedural redundancy in the main program routine to make sure that noise on the data line , which may exist from time to time , it not interpreted as data from the remote computer . if the system determines in function block 614 that there is not an enable bit from the remote computer present on the i / o , then the program will flow to function block 618 where the system checks to see if the data buffer contains an enable command . if an enable command is present in the buffer then the system in function block 620 checks to see if the remote enable value is equal to &# 34 ; 1 &# 34 ;. if the value is equal to &# 34 ; 1 &# 34 ; then the data bit count is set to &# 34 ; 0 &# 34 ; in function block 622 . if the data buffer does not contain an enable command , the flow proceeds along the &# 34 ; n &# 34 ; line to function block 622 where the data bit count is set to &# 34 ; 0 &# 34 ; and flow proceeds to function block 624 . function block 624 depicts the flow returning to the main program at functional block 510 shown in fig5 . returning now to function block 614 in fig6 the remote data reed routine , if it was determined that the remote enable bit has a value of one , that is there is an enable bit from the remote computer , then flow proceeds along the &# 34 ; y &# 34 ; line to optional function block 616 where the data bit counter is incremented by one step . following function block 616 the program then proceeds to function block 626 where the system checks to see if the data bit count is equal to eight . if the data bit count is not equal to eight , which means that there is not a complete byte in the data bit counter , the flow proceeds along the &# 34 ; n &# 34 ; line to return to the main program in function block 510 in fig5 . if the data bit counter is full , that is there are eight bits present , then flow proceeds along the &# 34 ; y &# 34 ; line to function block 628 where the system checks to see whether the command that is present there in the data bit counter is a valid command . if the system determines that the command that is present in the data bit counter is a valid command at function block 628 , then flow proceeds along the &# 34 ; y &# 34 ; line to function block 632 , where the system executes the command . following the execution of the command , the program flows to function block 634 where the program returns to the main routine in fig5 at function block 510 . if the command is found to be invalid in function block 628 , the program flows along the &# 34 ; n &# 34 ; line function block 638 , where the system will clear the remote enable data from the data bit counter . if will be recalled from the previous function block 610 , if the data buffer was found to be &# 34 ; 0 ,&# 34 ; then the program will flow along the no -- op line directly from function block 610 to function block 638 where the data bit counter is cleared of any data indicating a remote enable bit . the program then flows to function block 640 where the data bit counter is set to &# 34 ; 0 &# 34 ; thereafter flowing to function block 642 where the data buffer is also set to &# 34 ; 0 &# 34 ; and thereafter returning to the main program at step 510 . referring now to fig7 a , there is illustrated a flow chart for the de breaker data read routine . this program is initiated at function block 522 shown in fig5 labeled check data from breaker . the purpose of this step is to check data , whether there is data in the buffer ; then the main program routine is interrupted in order to process the data . that is , the system will go to function block 702 . if there is no data present in the data buffer from the de breaker 40 then the program will flow to function block 524 in the main routine . returning to fig7 a , the flow then proceeds next to the function block 702 in which the system checks to see if the delay time is complete . the delay time is an operation performed by the lcd 10 to , in effect , tell any other de breakers 40 that are connected to the communication port to stay off the line , that is to just listen to the lcm 10 so that the lcm 10 has time to initiate communication by sending an address to the de breaker 40 with which it wishes to communicate . in the preferred embodiment of lcm 10 of the present invention , the value of the delay timer is set to at least several times the sampling interval . in this particular illustrative example , the value of the delay timer is set to approximately 100 times the sampling interval , or approximately 100 milliseconds . in function block 702 , if the delay time is not complete , flow proceeds along the &# 34 ; n &# 34 ; line to function block 706 where the delay timer is decremented by one step . thereafter flow proceeds to function block 708 in which the program returns to the main program , that is , to function block 524 in the main program shown in fig5 . if , however , the delay time is complete , that is , the entire delay timer sequence has timed out then flow proceeds along the &# 34 ; y &# 34 ; line from function block 702 to function block 704 where the program checks for the presence of an action flag . the action flag in the present embodiment of the lcm 10 is defined to have two different bytes of data . in other words , each of the sixteen bits of data in the action flag register is defined to indicate what happens in the next step in a particular part of the routine . in other words , at selected points within the program routine , an action flag bit indicates the position of that point in the sequence . it is used for monitoring the action of the program or for trouble shooting . when the system has checked the action flag in the de breaker data read routine , the program then flows to function block 710 to check whether a data byte is available . function block 710 tests whether a data bit has been received by the de breaker 40 in the hardware register in either the lcm &# 39 ; s microcontroller or in the de breaker &# 39 ; s 40 microcontroller . if this bit tests affirmative , then the program flows along the &# 34 ; y &# 34 ; line to function block 714 where the lcm 10 will echo the data that is present in the data buffer register . if a data byte is not available then flow proceeds from function block 710 to function block 712 where the system will decrement a retry counter and the flow thereafter proceeds to function block 720 . in function block 720 , the system checks whether the retry counter value is &# 34 ; 0 &# 34 ;. if the value is not &# 34 ; 0 &# 34 ; then the system returns to function block 524 . if the retry counter is equal to &# 34 ; 0 &# 34 ; no further effort will be made to determine if a data byte is available and the program flows along the &# 34 ; y &# 34 ; line from function block 720 to function block 728 . there the system clears all action flags and flows to block 730 where the system will set the delay timer and return to the main program in function block 726 . returning to function block 710 , if it was determined that a data byte is available , then flow proceeds along the &# 34 ; y &# 34 ; to function block 714 where the lcm 10 will echo the data to the de breaker 40 . the program will then flow to function block 716 , where the system asks if the command is complete . if the command is not complete , the program flows along the &# 34 ; n &# 34 ; line to function block 724 where the lcm 10 will set the flag for the next action . thereafter , the program will flow to function block 726 , where the de breaker data read routine returns to the main program , that is function block 524 shown in fig5 . returning to function block 716 , if the command is found to be complete , then the program flows along the &# 34 ; y &# 34 ; line to function block 718 where the lcm 10 will execute the command followed by clearing the action flags in function block 728 and setting the delay timer in function block 730 . thereafter , the program will flow to function block 726 where the de breaker data read routine returns to the main program . referring now to fig7 b , the program flow for reducing the arc sensitivity of an individual circuit breaker will now be described . in a network of de breakers 40 connected to a common power line source , arcing of conductors in the main power line circuit can lead to inconsistent performance of individual circuit breakers . arcing can also be a fire hazard which must be eliminated and / or made known to emergency personnel . in some situations arcing may be a normal operating characteristic of a load deice , to the arc sensitivity of the de breaker 40 needs to be revised to accommodate that characteristic . the lcm 10 of the present invention , when connected in a network comprised of a plurality of de breakers 40 , is programmed to analyze data from these individual de breakers 40 to determine if an arc indication from several de breakers 40 requires a change in the arc sensitivity of the breakers in the system . the program routing in the lcm 10 for accomplishing this purpose is illustrated in fig7 b . the flow in fig7 b begins with block 718 entitled execute . command . it will be recalled that block 718 is one of the blocks illustrated in the flow chart of fig7 a . the program flow to execute a command from the de breaker 40 begins with block 732 which checks the arc level . if there is no arcing level indicated , then flow proceeds to block 734 where the system checks other commands , and thereafter returns to the main program in block 736 . if , however , the system , when checking the arc level , indicates that an arc level is present , then flow proceeds along the &# 34 ; y &# 34 ; line from block 732 to block 738 where the de breaker 40 which is indicating the presence of an arc is tested by the lcm 10 to see if that de breaker 40 is conducting a current which is greater than a predetermined value of the minimum arcing current , i arc min . this test is performed to determine whether the current level is large enough to make a meaningful measurement . if it is not , the flow proceeds along the end line to block 740 and returns to the main program in fig7 a . if , however , the arcing current measured by the individual breaker is above the minimum level necessary for making a meaningful measurement , then flow proceeds along the &# 34 ; y &# 34 ; line to block 742 . the purpose of block 742 , is to normalize the arc indication from the individual de breaker that is reporting an arc . the lcm 10 performs this normalization by dividing a quantity stored in memory representing an integrated sum of the arcing events time the average de breaker 40 load current by the average de breaker 40 load current . this normalized value is called &# 34 ; arc meas &# 34 ; for arc measure . after dividing the quantity breaker arc by a quantity breaker current load in the individual circuit breaker , the lcm 10 uses the resulting value for arc measure and the flow proceeds to block 744 where the measured value is compared with a value for the maximum arc measure . if this value is not greater than arc measure maximum , then flow proceeds along the end line to block 746 where the value for arc measure is compared with the minimum arc measure value stored in memory . if the value of arc measure is less than the minimum arc measure value , then the flow proceeds along the &# 34 ; n &# 34 ; line to block 752 . if the value of arc measure is not less than the minimum value of arc measure , then flow proceeds along the &# 34 ; y &# 34 ; line to another block 748 , where the minimum value for an arc measured is set equal to the arc measure value . returning to block 744 , if the test performed there to determine whether the arc measure value exceeds the maximum arc measure value , then flow proceeds along the &# 34 ; y &# 34 ; line to block 750 where the maximum arc measure value is set equal to the arc measure value received from the breaker . the flow in fig7 b thereupon proceeds along a line to block 752 . the purpose of block 752 is to collect the data from individual de breakers 40 that are reporting arcing and to collect the results of the tests that measure the value of the measured arc and compare it to the minimum and maximum values . block 752 in the program routine uses this information to analyze the arcing status of all the individual breakers in the system and ignore any arcing unless several de breakers 40 are reporting arcing . the reasong for this is that , unless arcing occurs in more than a minimum number of breakers , the arcing phenomenon or condition is not an upstream condition and no action to reduce the arc sensitivity of any of the breakers in the system is warranted . thus , if the number of breakers reporting arcing is not greater than or equal to the minimum number established as a triggering point , then flow proceeds from block 752 along the &# 34 ; n &# 34 ; line to block 754 where the program operation returns to the main program . if , however , the number of breakers that are reporting arcing is greater than or equal to the minimum number , then flow proceeds along the &# 34 ; y &# 34 ; line to block 756 where the lcm 10 checks the range of arcing values that have been reported by the individual de breakers 40 in the system . this test compares the difference between the arc measure maximum and minimum values described hereinabove and compares it with an arc measure limit value . if the range of measured arcing values is greater than the limit value , then flow proceeds along the &# 34 ; y &# 34 ; line to block 760 . if , however , the measured range of arcing values is not greater than the limit value , then flow proceeds along the &# 34 ; n &# 34 ; line to block 758 . in the block 758 , the measured range of arcing values is called the &# 34 ; arc response &# 34 ; and it is determined that it is normal in block 758 . thereupon , flow proceeds to block 762 . if , however , the range of arcing values is greater than the limit value measured in block 756 , then flow proceeds along the &# 34 ; y &# 34 ; line to 760 where the arc response is determined to be low , meaning that the breaker sensitivity should be reduced in order to avoid nuisance tripping at that individual breaker . following this determination , flow proceeds to block 762 . in block 762 , the lcm 10 checks to see if the arc response level has changed . if the answer to that comparison is &# 34 ; no &# 34 ;, then flow proceeds along the &# 34 ; n &# 34 ; line to the return block 764 . if , however , the arc response has changed , then flow proceeds along the &# 34 ; y &# 34 ; line to block 766 . here the lcm 10 updates the arc sensitivity in the breakers by sending the arc response value to all breakers in the system . all breakers in the system receive this updated arc sensitivity because arcing in a upstream condition will effect all breakers , therefore all breakers should receive the updated arc sensitivity information . the purpose of the program routine illustrated in fig7 b , is to determine the most appropriate arcing response of all of the individual de breakers 40 in the system connected to the lcm 10 . this arcing response determination is an independent function of the lcm 10 and is not associated with the adaptive updating of the data constants that make up the trip profile that is stored in the memory of the individual de breakers 40 . continuing further with fig7 b , the program routine described hereinabove is an example of the kind of analysis functions performed in the lcm 10 previously described . also , previously described were functions performed by the lcm 10 in which the lcm 10 adaptively reconfigures the trip profiles in individual de breakers 40 . it will be appreciated that , since the trip profiles referred to control the operation of the de breaker 40 during the normal current overload mode , the adaptive reconfiguration function performed by the lcm 10 applies to the current overload mode . referring now to fig8 there is illustrated the audible and visible indicator routine . this program routine is initiated at the function block 532 shown in fig5 where the system increments the two second counter . as was explained previously , the two second counter is used to time the flashing rate for the visible and audible indicators . thus , in function block 532 the program flows to function block 802 shown in fig8 where the system makes a determination as to whether two seconds have elapsed . if two seconds have not yet elapsed then flow proceeds along &# 34 ; n &# 34 ; line to function block 804 , where the routine returns to the main program at function block 504 shown in fig5 . if , however , two seconds have elapsed then flow proceeds along the &# 34 ; y &# 34 ; line to function block 806 where the system determines if nine minutes have elapsed . if nine minutes have elapsed , then the flow proceeds along the &# 34 ; y &# 34 ; line to function block 810 where the system performs the self - test routine . this is the function of the nine minute timer , to determine when the self - test routine should be performed in the system . upon completion of the self - test routine in function block 810 , the program flows to function block 808 where the system determines whether or not the green led has been enabled . returning to function block 806 , if nine minutes have not elapsed then flow proceeds along the &# 34 ; n &# 34 ; line to function block 808 where the system determines whether the green led has been enabled . if in function block 808 , the system determines that the green led has been enabled , then flow proceeds along the &# 34 ; y &# 34 ; line to function block 812 where the system will turn on the green led to indicate when the lcm 10 and all the associated de breakers 40 are operating normally . if the green led was not enabled in function block 808 , then flow proceeds along the &# 34 ; n &# 34 ; to function block 814 where the system determines whether or not the red led has been enabled . if in function block 814 the red led has been enabled then flow proceeds along the &# 34 ; y &# 34 ; line to function block 816 where the system acts to turn on the red led and the audible alert or buzzer . the meaning of the red led is that a de breaker 40 has tripped and the flashing pattern of the led transmits a coded message to indicate the nature of the problem that occurred at that particular de breaker 40 . simultaneously , with the flashing of the red led , the audible alarm or buzzer will also be activated to provide an audible alert that a problem exists with one of the de breakers 40 . following the application of a bit in either function block 812 , turning on the green led , or in function block 816 , turning on the red led and the audible alert , the program then flows to function block 818 where the routine returns to the main program . similarly , if in function block 814 , the test to determine if the red led was enabled is negative , flow then proceeds along the &# 34 ; n &# 34 ; line to the return function block at function block 818 where the audible and visible indicator routine returns to the main program . referring now to fig9 there is illustrated a load center monitor 10 and circuit breaker 40 installed in an electrical service panel . referring now to fig1 there is illustrated a pictorial view of a load center monitor depicting access buttons and communication ports . the clear and read buttons , led status indicators , the user communication port , the neutral pigtail lead , the communications port for connecting the monitor 10 to the breakers 40 in a system . a diagnostic port and a service port is also provided . referring now to fig1 , there is illustrated a breaker system including a load center monitor connected via the communication port to four breakers 40 . although the preferred embodiment has been described in detail , it should be understood that various changes , substitutions and alterations can be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
referring to fig1 , a pool filter 10 has a skimmer inlet housing 12 and a skimmer filter chamber 14 . the skimmer inlet housing 12 has a primary opening flange 16 bearing a primary lid 18 , preferably at the top of the skimmer inlet housing 12 . the skimmer inlet housing 12 also includes a weir door 20 , disposed in a weir housing 22 , which is generally incorporated into and a part of the skimmer inlet housing 12 , and a primary portal 24 , which includes a lock down ring 26 , acting much like a retaining ring . because the skimmer inlet housing 12 is vertically elongated , along with the weir door 20 , the filter can accommodate a greater span of water levels as evaporation occurs , avoiding the need for refilling the pool frequently . still referring to fig1 , the skimmer inlet housing 12 is connected to the elongated skimmer filter chamber 14 by the primary portal 24 . preferably , the primary portal 24 is below the weir door 20 to prevent air from entering the pool pump lines ( not shown ) attached to the filter 10 , and is disposed directly below the primary opening flange 16 . the skimmer filter chamber 14 includes an elongated skimmer filter basket 28 and a filter bag 30 ( not shown in this view ) lining the skimmer filter basket 28 . ideally the primary portal 24 and skimmer filter basket 28 are smaller than the primary opening flange 16 such that with the primary opening flange 16 disposed directly above the primary portal 24 , the skimmer filter basket 28 may be easily removed from the filter 10 for cleaning . at the bottom of the skimmer filter chamber 14 , a primary outlet 32 leads to the pool pump ( not shown ). in one embodiment the primary outlet 32 is adapted for two inch suction . referring to fig2 , a perspective view of the skimmer inlet housing 12 is shown . to ensure an accurate installation prior to pouring a concrete or similar pool foundation ( not shown ) the skimmer inlet housing 12 includes slots 34 for rebar ( not shown ) and holes 36 for wiring the rebar to the skimmer inlet housing 12 . also shown in fig2 is the weir housing 22 which is incorporated as a part of the skimmer inlet housing 12 . the weir housing 22 terminates in a face frame 38 which holds the weir door 20 ( not shown in this view ) in place . the skimmer inlet housing 12 also includes an overflow outlet 40 to prevent pool overflows , and a primary equalizer port 42 for connecting to a drain inlet housing 44 ( not shown in this view ). referring to fig3 , another embodiment of the filter 10 having both skimming and drain suction functions is shown . in this embodiment , the filter 10 includes the skimmer inlet housing 12 and skimmer filter chamber 14 , but also includes apparatus for drain filtration , including a drain inlet housing 44 , and a drain filter chamber 46 . notably , in embodiments where only a skimming function is needed , the primary equalizer port 42 will be capped . in embodiments such as the illustrated embodiment , where both skimming and drain suction functions are needed , the primary equalizer port 42 will connect to the drain inlet housing 44 using an equalizer line 48 , discussed below , which connects to a secondary equalizer port 50 on the drain inlet housing 44 . still referring to fig3 , the drain inlet housing 44 has a secondary opening flange 52 bearing a secondary lid 54 , preferably at the top of the drain inlet housing 44 . the drain inlet housing 44 also includes a secondary portal 56 , which includes a lock down cap 58 . the lock cap 58 may include an optional vacuum port 60 for easily attaching a pool vacuum hose ( not shown ). the lock down cap 58 may also be exchanged for the lock down ring 26 for vacuuming through the skimmer inlet housing 12 . still referring to fig3 , like the skimmer inlet housing 12 , the drain inlet housing 44 includes a secondary portal 56 disposed directly below the secondary opening flange 52 . an elongated drain filter chamber 46 includes a drain filter basket 62 lined with a filter bag 30 ( not shown in this view ). also , like the skimmer inlet housing 12 , the secondary portal 56 and drain filter basket 62 are smaller than the secondary opening flange 52 such that with the secondary opening flange 52 disposed directly above the secondary portal 56 , the drain filter basket 62 may be easily removed from the filter 10 for cleaning . at the bottom of the drain filter chamber 46 , a secondary outlet 64 , preferably adapted for two - inch suction leads to the pool pump ( not shown ). still referring to fig3 , the drain inlet housing 44 includes a water fill inlet 66 , allowing it to connect to a water source ( not shown ) for re - filling a pool ( not shown ) as water evaporates . at the bottom of the drain inlet housing 44 , a drain inlet 68 allows water from a main drain line ( not shown ) to enter the drain inlet housing 44 and proceed to the drain filter basket 62 . to account for the extra space taken up by the drain inlet 68 , a spacer 70 may be included between the lock down cap 58 and drain filter basket 62 . in one embodiment , the spacer 70 may include spacer ports 72 for closing off the drain inlet 68 . still referring to fig3 , stabilizing pipes 74 are disposed between the skimmer inlet housing 12 and drain inlet housing 44 , and the skimmer filter chamber 14 and drain filter chamber 46 , linking and holding them firmly together . there is no water flow between the stabilizing pipes 74 . the equalizer line 48 which connects the skimmer inlet housing 12 and drain inlet housing 44 also helps anchor them together . the purpose of the equalizer line 48 is to maintain the water level in the drain inlet housing 44 , thereby preventing a loss of prime if the pool drain ( not shown ) becomes obstructed . fig4 shows a perspective view of the drain inlet housing 44 , including a stabilizer pipe fitting 76 , drain inlet 68 and secondary equalizer port 50 . referring to fig5 . 1 and 5 . 2 , the elongated nature of the filter assembly is shown , with a filter basket 28 lined by a filter bag 30 ( fig5 . 2 ). the skimmer filter basket 28 , which as mentioned may be identical to the drain filter basket 62 ( not shown ) for economy , comprises an elongated basket structure to maximize the surface area of the skimmer filter basket 28 and provide for longer filter runs , avoiding the need for frequent filter backwashing or full - scale cleaning . in the illustrated embodiment , the skimmer filter basket 28 includes a cylindrical wall 78 with a dome cap 80 . at the top of the skimmer filter basket 28 , a lower lip 82 and upper lip 84 are disposed for engaging the primary portal 24 , and preventing the skimmer filter basket 28 from being drawn into the skimmer filter chamber 14 . the elongated filter assembly has a length dimension l that is substantially greater than the diameter dimension d . the ratio of length l to diameter d should be at least 2 : 1 . the ratio can be increased depending on filtered water flow characteristics and the quantity of particles within the water . for example , for higher flow rates and greater quantities of particulates , the length l can vary from twice the diameter d to five times or greater the diameter d . in the example embodiment illustrated in fig5 , the length l is greater than three times the diameter d . in this way , maximum filtering area is achieved while the diameter d is sufficiently small to fit through the primary opening flange 16 . still referring to fig5 , the skimmer filter basket 28 has a mesh surface 86 covering the cylindrical wall 78 , dome cap 80 or bottom , and even extending into an area between the lower lip 82 and upper lip 84 . since the mesh surface 86 is typically weaker than a solid surface , ribs 88 are incorporated into the skimmer filter basket 28 , running along its length and around its circumference . a filter bag 30 , in one embodiment capable of filtering to 300 microns or less , is adapted to fit inside the skimmer filter basket 28 , and pulled against the mesh surface 86 under suction . referring specifically to fig5 . 1 , the skimmer filter basket 28 ideally also includes a zinc anode 116 for electrolysis to preserve metal filter components , and a handle 118 for easily removing the skimmer filter basket 28 when cleaning is occasionally necessary . referring to fig6 , in some embodiments , the filter 10 may also be equipped to incorporate an ozone unit ( not shown ). in this configuration , a pool inlet fitting 90 , preferably about 1½ inches in diameter , leads to a vertical pvc pipe 92 , also preferably about 1½ inches in diameter . an ozone stone 94 is placed at the bottom of the vertical pvc pipe 92 , and connected to an ozone source ( not shown ). a customary connection might incorporate ¼ inch flexible tubing . the top of the vertical pvc pipe 92 terminates in a two port ozone adapter 96 incorporated into the bottom of the skimmer inlet housing 12 . referring to fig7 , a perspective view of the two port ozone adapter 96 is shown along with an ozone bubble plate 98 . the bubble plate 98 includes perforations 100 which allow ozone - bearing water and ozone gas to rise through the vertical pvc pipe 92 and enter the skimmer inlet housing 12 where it can mix with and purify water being drawn through the filter 10 . referring to fig6 and 7 , preferably , a one inch pvc pipe to house ozone tubing 102 also connects to the two port ozone adapter 96 , providing a path for the flexible ozone tubing ( not shown ) from the skimmer inlet housing 12 back to the ozone unit ( not shown ). by constructing the one inch pvc pipe to house ozone tubing 102 to be higher than the overflow outlet 40 in the skimmer inlet housing 12 , ( hartford loop ) the amount of water in the ozone tubing is minimized . referring to fig8 , an exploded view of a filter 10 is shown . in this view , the components of the weir door 20 are shown . the enlarged weir housing 22 extends from the skimmer inlet housing 12 and is large enough to allow the weir door 20 to swing approximately ninety degrees without obstruction . clips 104 incorporated into the weir door 20 and weir housing 22 create a hinged connection . to ensure that the weir door 20 remains near the surface of the water , a weir door cap 106 is placed on the weir door 20 with an air - tight seal , thereby creating a float . the face frame 38 covers the weir door 20 to engage the surface of a pool ( not shown ). still referring to fig8 , the skimmer filter basket 28 and drain filter basket 62 each nest in a primary threaded collar 108 and secondary threaded collar 110 , respectively . the primary threaded collar 108 engages the lock down ring 26 to anchor the skimmer filter basket 28 in place , and the secondary collar 110 engages the lock down cap 58 to anchor the drain filter basket 62 in position . also shown are a primary bag collar 112 which is sandwiched between the lock down ring 26 and the upper lip 84 of the skimmer filter basket 28 , and a secondary bag collar 114 sandwiched between the spacer 70 and the upper lip 84 of the drain filter basket 62 . in order to use the pool filter 10 , a user will first decide whether only skimming activity is needed or both skimming and draining . while the pool filter 10 is designed modularly , such that skimming - only installations ( discussed below ) are possible , for purposes of illustration , a complete skimming and drain pool filter is discussed . installation of the pool filter 10 ideally occurs during construction of a swimming pool . after the pool has been designed and excavated , the skimmer inlet housing 12 is placed in the desired position adjacent the side of the pool . to ensure an accurate installation , prior to pouring the pool foundation rebar will be attached to the skimmer inlet housing 12 using the slots 34 and wire wrapped around the rebar and through the holes 36 to hold the skimmer inlet housing 12 in place . the weir housing 22 extends from and is incorporated into the skimmer inlet housing 12 . with the skimmer inlet housing 12 in place , the weir housing 22 and its face frame 38 which holds the weir door 20 in place will be disposed at the edge of the pool wall . by masking the face frame 38 , the area around it can be plastered or tiled as desired , once the foundation is poured . prior to pouring the foundation , however , the drain inlet housing 44 will be connected to the skimmer inlet housing 12 . also , for stability , the drain filter chamber 46 depending from the drain inlet housing 44 will be attached to the skimmer filter chamber 14 which depends from the skimmer inlet housing 44 . both attachments may be accomplished using the stabilizing pipes 74 . an additional attachment between the skimmer inlet housing 12 and drain inlet housing 44 is the equalizer line 48 , which adds stability , although that is not its primary purpose . additional attachments that may be necessary before pouring the pool foundation include the overflow outlet 40 , if desired , from the skimmer inlet housing 12 to a suitable overflow source , a water source attaching to the water fill inlet 66 to provide a way of refilling the pool out - of - sight , attaching a main drain line coming from the drain at the bottom of the pool to the drain inlet 68 , and most importantly , attaching the primary outlet 32 from the skimmer filter chamber 14 and secondary outlet 64 from the drain filter chamber 46 , both of which lead to the pump which drives debris into the pool filter 10 . other attachments may include connecting the two port ozone adapter 96 and bubble plate 98 to the skimmer inlet housing , and connecting a pool inlet fitting 90 to the vertical pvc pipe 92 for ozonation . an ozone stone 94 is placed in the vertical pvc pipe 92 with a line running through the pvc pipe to house ozone tubing 102 to an ozone source . ideally , the ozone source may be installed near the pump or in an adjacent out - of - the - way place . with all of the attachments in place , the pool foundation poured , and the pool plastered and / or tiled as desired , the pool filter 10 may commence operation . when the pump is activated , suction draws water out of the primary outlet 32 and secondary outlet 64 . water is consequently drawn into the skimmer inlet housing 12 through the weir door 20 and weir housing 22 . and water is drawn into the drain inlet housing 44 through the drain inlet 68 . the equalizer line 48 ensures water on top of the lock down cap 58 to prevent loss of prime in the drain inlet housing 12 . water travels through the primary portal 24 and spacer 70 , into the skimmer filter chamber 14 and drain filter chamber 46 , respectively . there , it is drawn through the skimmer filter basket 28 and drain filter basket 62 , and through the filter bags 30 lining them . any debris , from leaves drawn in by the skimmer to small particulates drawn in from the drain are retained in the filter bags , which may have a porosity of 300 microns or smaller . since the skimmer filter basket 28 and drain filter basket 62 are extremely elongated , they may collect substantial debris before any measurable drop in performance is detected . furthermore , since the skimmer inlet housing 12 may draw in more debris than the drain inlet housing 44 , the skimmer filter basket 28 may be easily removed and cleaned independently of the drain filter basket 62 . to clean the skimmer filter basket 28 , a user simply opens the primary lid 18 , thereby gaining access to the skimmer filter chamber 12 . reaching down through the skimmer filter chamber 12 , the user unlocks the lock down ring 26 , perhaps by rotating a threaded connection , removes the lock down ring 26 and draws the skimmer filter basket 28 and attendant filter bag 30 from the skimmer filter chamber 14 . a similar action is used to clean the drain filter basket 62 by accessing it through the secondary lid 54 , unlocking the lock down cap 58 , and removing the spacer 70 if necessary . once debris from the filter bags 30 has been discarded and new or perhaps cleaned filter bags 30 installed , the skimmer filter basket 28 and drain filter basket 62 are inserted into the skimmer filter chamber 14 and drain filter chamber 46 , and locked in place . during this process , suction from the pump , prevents the filter bags 30 from floating out of the baskets 28 , 62 . as the pool filter 10 operates , ozone from an ozone source may be pumped through the pvc tube , through the two port ozone adapter 96 and down to an ozone stone 94 at the bottom of the vertical pvc pipe 92 . ozone bubbles through the ozone stone 94 , rising , and with the intake action of the weir housing 22 , drawing pool water through the pool inlet fitting 90 . the ozone bubbles , travelling through the vertical pvc pipe and bubble plate 98 , act to disinfect the water , killing microorganisms . on occasion , manual vacuuming of the pool may be desired . this is easily accomplished using the optional vacuum port 60 in the lock down cap 58 . if maximum vacuum suction is desired , a user can stop the flow through the drain inlet 68 . in such an arrangement , water from the equalizer line still travels into the drain filter chamber 46 , thereby preventing air in the system and a loss of prime . an automatic water fill system is contemplated . if an automatic water fill is not available or malfunctions , the weir housing 22 is designed to accommodate a six - inch weir door 20 , which will allow up to six inches of evaporation before the pool filter 10 ceases to operate . likewise , if the water fill system malfunctions and remains on , the overflow outlet 40 in the skimmer inlet housing 12 prevents the pool from overflowing . in an installation where drain filtering is not necessary , the stabilizing pipes 74 may be omitted , and the primary equalizer port 42 capped . in this manner , the skimmer inlet housing 12 and skimmer filter chamber 14 work alone to pre - filter the pool . in such an instance , a water fill inlet 66 may be included on the skimmer inlet housing 12 along with the overflow outlet 40 . in this manner , the filling and overflowing , manual vacuuming , and ozone saturation functions can still be performed . since the pool filter 10 with regular cleaning will prevent the intrusion of particulate matter over 300 microns into the main pool filter , it is anticipated using the pool filter 10 will avoid the necessity of cleaning a main filter , greatly reducing the cleaning cycle . | 1 |
the present invention is based upon an analysis of link adaptation within a retransmission environment . the present invention departs significantly from traditional link adaptation schemes for wireless data services , which neglect retransmissions and ultimately produce an erroneous link adaptation framework that produces instability , misallocation of bandwidth and poor system performance . the retransmission model underlying the present invention generated two critical discoveries that significantly shaped the present invention . first , the threshold values for a link adaptation system using a retransmission model can be derived from the no - retransmission model thresholds . the retransmission thresholds are obtained by shifting the throughput characteristic curves for the no - retransmission model by an amount relating to the difference between the signal to interference ratio generated by the base offered traffic , sir 0 , and the resulting signal - to - interference ratio generated due to the base traffic plus retransmissions , sir . second , the retransmission model revealed that there should be no transmission at all below a base threshold sir ( referred to herein as the “ no - transmission ” or “ mode 0 ” threshold ). transmitting below this “ no - transmission ” threshold produces system instability such that excessive retransmissions result causing unbounded delay and almost zero throughput at the receiver . this instability is a product of the retransmission environment itself and is not analyzed or accounted for in conventional link adaptation systems . the complex analysis and insights underlying the retransmission model are an essential underpinning of the present invention and are outlined below . this analysis was summarized from j . chuang , x . qiu , “ an improved link adaptation algorithm and its implementation requirements ”, presented at smg2 edge ad hoc on edge physical / link layer issues in london , aug . 12 - 13 , 1998 , and “ link adaptation in wireless data networks for throughput maximization under retransmissions , at & amp ; t technical memorandum , ha6132000 - 980714 - 06tm , july 1998 , also submitted to ieee icc &# 39 ; 99 , jun . 6 - 10 , 1999 . in one embodiment of the present invention , the retransmission model was derived and analyzed using the modulation / coding schemes outlined in edge . however , this analysis would apply to any modulation / coding framework . thus , link adaptation threshold values in a retransmission environment for any modulation / coding architecture can be derived using the framework outlined herein . recently , for example , new modulation schemes were proposed , and the methodology outlined herein can be applied to them . furthermore , this same embodiment relied primarily upon an infinite retransmission model , an assumption that packets would be retransmitted until success . however , the basic analysis presented herein can be used for a retransmission model based upon any arbitrary number of retransmissions ( e . g ., a one retransmission model or a two retransmissions model ). fig1 depicts the large - scale architecture of a wireless communications system according to one embodiment of the present invention . transmitter 100 communicates with receiver 105 through communications channel 104 . transmitter 100 contains transceiver 115 , data module 125 , modulator / encoder 110 , controller 122 and antenna 140 . controller 122 calculates modulation / encoding scheme 150 from quality measure 155 sent from receiver 105 and transmits this information to modulator / encoder 110 . modulation / encoding scheme 150 is used by modulator / encoder 110 to modulate and encode data retrieved from data module 125 . the modulated / encoded data is sent to transceiver 115 for transmission through antenna 140 onto communications channel 104 . receiver 105 contains decoder 120 , controller 122 , transceiver 115 and antenna 140 . transceiver 115 is coupled to antenna 140 and communications channel 104 from which data is received . data is sent from transceiver 115 to decoder 120 , which is controlled by controller 122 . decoder 120 outputs decoded data 152 and quality measure 155 , which might for example be the current bler or sir at the receiver . quality measure 155 is transmitted back to transmitter 100 through communications channel 104 . fig2 depicts the architecture of a link adaptation system consisting of a set n of modulation / coding schemes 210 according to one embodiment of the present invention . each scheme n ∈ n ( 210 ) is characterized by a set of performance attributes 220 that may include , for example , the radio interference rate r n 225 and bler n characteristic 227 where n ∈ n depicts the particular link adaptation mode 210 . bler n characteristic 227 is a function relating the bler to the sir at the receiver 105 for each mode 210 . for example , fig3 depicts bler as a function of sir for the eight transmission modes 210 in edge . a wireless transmission model 240 is associated with the entire link adaptation scheme and is used to derive a throughput characteristic 250 as a function of sir for each mode 210 . a threshold level 260 is derived for each mode 210 from the set of throughput characteristics 250 in the link adaptation system . for each mode 210 , the threshold level 260 corresponds to the range of sir over which that mode 210 produces the highest throughput among all modes 210 in the link adaptation scheme . the set of threshold values 260 dictate the selection of a mode 210 based upon real - time measurement of the sir at the receiver 105 . the wireless environment model 240 , which comprises a mathematical and conceptual framework for the wireless transmission environment , is a critical component in determining the set of threshold values 260 for each mode 210 . the throughput characteristic 250 of each mode 210 is derived from wireless environment model 240 and the performance attributes 220 unique to each mode ( i . e . r n and bler n characteristic where n ∈ n ). for example , using a no - retransmission environment model , the throughput s is equal to the probability that a block is transmitted correctly ( 1 - bler n ) multiplied by the actual data transmission r n where sir 0 is the signal - to - interference ratio for the base offered traffic of the system without taking into account any retransmissions . based upon the no - retransmission environment model 240 as codified in equation ( 1 ) and the bler / sir relationship depicted in fig3 , fig4 depicts a set curves relating the sir 0 for the offered traffic to the throughput for each mode 210 using the edge modulation / coding architecture . however , the curves depicted in fig4 are erroneous in a retransmission environment ( such as that required for data services ). in fact , using such a link adaptation scheme in a retransmission environment will actually reduce system performance and result in instability in the system . for example , in edge , in the range of sir for which ecs - 6 is chosen , the average bler is higher than 65 %, meaning that 65 % of packets require retransmission . as a result of this bler , the load in the system and the interference in the system will be increased substantially . the increase of interference will further lower the sir and cause even more retransmissions until either the system reaches the steady state if it exists , or the system becomes unstable resulting in a throughput of zero . the realization that the traditional no - retransmission model 240 could not adequately capture the behavior of the retransmission environment led to a complex and detailed analysis of an infinite retransmission environment underlying the present invention . to develop a conceptual and mathematical model to account for infinite retransmissions required analysis of the traffic load in a communications system operating in a retransmission environment . ρ 0 represents the average offered traffic in the communications system neglecting retransmissions . however , the actual load in a transmission system will be higher , represented by ρ , the amount of traffic in the system including base offered traffic and retransmission traffic . thus , the total load considering retransmissions ρ will be the offered load ρ 0 plus the amount of traffic generated by retransmissions . p n represents the probability of using a particular modulation / coding mode n ∈ n , where σ n ∈ n p n = 1 . for the first retransmission , the additional traffic will be the offered traffic ρ 0 multiplied by the probability of choosing mode n ( n ∈ n ) 210 multiplied by the bler for mode n 210 summed over all modes n ( n ∈ n ) 210 . the same relationship will apply for the second retransmission except that the bler term will be of second order due to the two retransmissions . if a user does not change the modulation / coding scheme until the current packet is successfully transmitted , in the steady state , the load in the transmission system under the assumption of infinite retransmissions is given generally by : ∑ n ∈ n ρ 0 p n 1 - bler n ( 3 ) using a first order approximation , assuming that the total interference i is a linear function of the load ρ , the interference can be described as : i = ∑ n ∈ n i 0 p n 1 - bler n ( 4 ) where i 0 is the interference at the receiver 105 if erroneous packets are discarded ( i . e ., no retransmissions ). therefore , in the steady state , the sir at a particular link is : sir = sir 0 ∑ n ∈ n p n 1 - bler n ( 5 ) where sir 0 is the sir at a link receiver 105 without considering retransmissions . thus , the sir at the receiver 105 is the sir of the offered traffic ( i . e . without retransmissions ) plus an additional factor c ( ρ ) ( herein referred to as the “ sir margin ”) corresponding to a reduction in sir at each receiver link 105 due to retransmissions relating equation ( 1 ) to the preceding analysis , in the steady state , the throughput using the infinite retransmission model 240 is : according to one embodiment of the present invention , the determination of c ( ρ ) was simplified by making the assumption that all users in the system use the same modulation / coding scheme n ( nån ) 210 , i . e ., p n = 1 , when the sir margin of mode n ( n ∈ n ) 210 is considered . without this assumption , evaluation of c ( ρ ) proved to be highly complex since c ( ρ ) is a function of both { p n } and { bler n } where { p n ) is a function of the offered load ρ 0 and many other parameters such as the propagation environment . using this analysis , the determination of the sir margin was greatly simplified since c ( ρ ) is reduced to a function of bler n alone which itself is a function of sir ( see fig3 ). predictions based upon this assumption have corresponded very closely with measured experimental results . thus , using the assumption that interaction between different modes can be decoupled , the sir at each receiver link 105 is : assuming that there is a well defined bler n characteristic for a given mode 210 and provided with sir 0 , sir and c ( ρ ) can be obtained analytically by solving equation ( 10 ). according to one embodiment of the present invention , the following steps describe a method to evaluate c ( ρ ): 1 . for different values of sir 0 , the curves y = sir 0 + c ( ρ ) and y = sir are plotted as a function of sir . 2 . for a given value of sir 0 , the intersection of the curves y = sir 0 + c ( ρ ) and y = sir yields the sir that satisfies equation ( 10 ). the sir margin can then be calculated as : 3 . if y = sir 0 + c ( ρ ) and y = sir do not intersect for a given sir 0 , then there is no sir that satisfies equation ( 10 ) and the system is not stable under this offered load . fig5 depicts an example of the determination of c ( ρ ) using the above steps for edge mode ecs - 5 ( 210 ). points of intersection ( 510 ) of the line y = sir ( 530 ) and y = sir 0 + c ( ρ ) ( 540 ) represent stable solutions for the infinite retransmission model 240 . c ( ρ ) can be calculated by finding the difference between sir and sir 0 at any of these intersection points . for instance , following the steps outlined above , based upon the data in fig5 , c ( ρ ) is approximately − 2 db for sir 0 = 6 db . once c ( ρ ) is calculated according to the above - mentioned steps , it is possible to calculate the threshold values 260 for a link adaptation system based upon an infinite transmission model 240 by simply shifting the throughput characteristic curves 250 derived for the no - retransmission model 240 ( e . g ., fig4 ). this is evident from equation ( 9 ) which is of the same form as equation ( 1 ) except for the additional term c ( ρ ), the amount by which sir is reduced due to retransmissions ( c ( ρ )= sir − sir 0 ). therefore , the thresholds for the no - retransmission model 240 should be increased approximately by − c ( ρ ) in order to obtain the thresholds for the infinite transmission model 240 . fig6 depicts the derived throughput characteristics for the edge modes 210 using the infinite retransmission model 240 as outlined herein . the threshold values for this infinite retransmission model are obtained by finding the mode 210 that produces the highest throughput over the entire sir range . as described earlier , other retransmission models such as one - retransmission or two - retransmissions can be analyzed using a similar framework . see j . chuang , x . qiu , “ an improved link adaptation algorithm and its implementation requirements ”, presented at smg2 edge ad hoc on edge physical / link layer issues in london , aug . 12 - 13 , 1998 , and “ link adaptation in wireless data networks for throughput maximization under retransmissions ”, at & amp ; t technical memorandum , ha6132000 - 980714 - 06tm , july 1998 , also submitted to ieee icc &# 39 ; 99 , jun . 6 - 10 , 1999 . analysis of the infinite retransmission model produced a further critical discovery that in a retransmission environment there exists a cutoff sir 0 , below which there should be no transmissions at a transmitter 100 . if a transmitter 100 is operating with sir below this cutoff threshold , transmitting will result in system instability , close to zero throughput and waste of bandwidth resources . for example , an examination of fig5 reveals that there is no stable solution for equation ( 9 ) if sir 0 is below approximately 4 db . this is apparent by noting that none of the curves y = sir 0 + c ( ρ ) ( 540 ) below sir 0 = 4 db ( marked with ‘ x ’) intersect the line y = sir ( 530 ). because sir is a function of sir 0 , this means that there is a minimum sir threshold 260 below which system behavior will become unstable . for example , for the 4 db value of sir 0 from fig5 , the corresponding minimum sir threshold 260 was determined to be approximately 9 db ( see fig6 ( 610 )). the discovery of this minimum sir threshold 260 led to a new no - transmission mode ( or mode 0 ) for link adaptation systems . this mode 0 ( cutoff threshold ) is the sir level at a link receiver 105 below which transmission should cease at the corresponding transmitter 100 . if transmissions continued below the mode 0 threshold 260 , system instability and near zero throughput would result at the link receiver 105 . thus , transmitting below mode 0 wastes bandwidth and system resources and produces near zero throughput . this no - transmission mode is different from conventional admission control , which is performed only once upon admitting a user . mode 0 is part of the continuous link adaptation process . fig7 depicts the operation of a no - transmission mode ( mode 0 ) according to one embodiment of the present invention . at time 710 , the sir at the link receiver 105 exceeds the cutoff threshold . thus , at time 710 , the corresponding transmitter 100 is transmitting using the appropriate mode x 210 for the current sir in the link adaptation system . at time 720 , the sir at link receiver 105 falls below the cutoff threshold and the transmitter 100 enters mode 0 ending transmission . at time 730 , however , the sir at link receiver 105 again exceeds the mode 0 cutoff threshold and the transmitter 100 begins transmitting using the appropriate mode y 210 for the current sir . fig8 is a flowchart that depicts a set of steps that may be implemented at a wireless transmitter to utilize a no - transmission mode and perform link adaptation according to one embodiment of the present invention . in step 805 , the procedure is initiated . in step 820 , a signal quality value is measured at a receiver . the signal quality value may be a sir , bler or any other value corresponding to the suitability of the signal for reception . in step 830 , the signal quality value is compared to a no - transmission threshold value . if the signal quality value is less than the no - transmission threshold (‘ yes ’ branch of step 830 ), the receiver ceases transmission to the receiver ( step 840 ). otherwise (‘ no ’ branch of step 830 ), link adaptation is performed . in particular , in step 850 a best link adaptation mode is selected ( e . g ., a mode that maximizes some performance measure such as throughput ). in step 860 , a modulation and / or coding scheme is adjusted at the transmitter to conform to the best link adaptation mode selected in step 850 . the procedure ends in step 870 . | 7 |
fig1 shows the principle of an electronic device for the production of color separations in which a circuit 14 is drawn upon for the refinement of the line recording according to the invention . such a device consists of a scanning cylinder 1 which bears the half tone information 2 . a further scanning cylinder 3 bears the line information 4 . on a further cylinder 5 , the combined color - corrected and rastered output product 6 is recorded in the form of a color separation for the further processing for the production of the form . this can occur , for example , by means of light beams on light - sensitive film . all three cylinders 1 , 3 , 5 are driven with the same speed of rotation by a motor 7 . arranged in front of the cylinder 1 is a scanning element 9 for the scanning of the half tone information 2 , arranged in front of the cylinder 3 is a scanning element 10 for the scanning of the line information 4 . in front of the recording cylinder 5 there is arranged a recording element 12 . the scanning elements 9 and 10 as well as the recording element 12 by means of the spindle 13 which is driven by the motor 11 carry out a forwarding motion axial to the cylinders . from the interplay between rotary movement , forwarding movement and a clock pulse generator 8 arranged with the cylinder 1 , 3 , 5 on the same shaft , there results the scanning raster and the half tone recording raster . besides the raster clock pulse , the clock pulse generator 8 also generates a pulse which indicates the beginning of each circumferential line . both clock pulses are supplied via lines 20 or , respectively , 21 to a multiplier 19 which prepares the clock pulse for a raster computer 17 in which , corresponding to the scanning values of the half tone raster 9 , form and size of the raster points to be recorded are generated . the scanning values from the scanning element 9 first pass through an analog color computer 15 which undertakes the color correction . the raster computer 17 operates digitally . therefore , the values corrected in the color computer 15 are first digitalized in an analog - digital transducer 16 . the raster clock pulse from line 20 as well as the clock pulse for the line beginning from line 21 are further also fed to the circuit 14 of which a circuitry example is explained more precisely with the use of fig4 . in modern electronic devices for the production of color separations , size and form of the half tone raster points are generated in the raster computer 17 and recorded by means of several separately drivable writing beams , as for example , is described in german pat . no . 2 , 107 , 738 and german pat . no . 1 , 901 , 101 which corresponds to u . s . pat . no . 3 , 657 , 472 . because of the complicated and varied structure of the half tone raster points , as a rule thereby the number of the writing beams in a scanning line width is higher than would be necessary for the inventive refinement of the line reproduction . the circuit 18 in which raster information and line information converge in an advantageous manner thus contains logic switching elements which , in the case of blending in of line information , combine the writing beams in groups , for example , three groups for two writing beams each or two groups for three writing beams each . also , reversible grouping is possible for different uses . fig2 and 3 clarify with differently shaped contours 51 how the refinement of the line recording comes about . here for example , within a writing line width b there are arranged three recording beams which can be driven separately . thereby , the individual beams in an advantageous manner can consist of groups of combined recording beams , of a multi - beam recording device for the depiction of half tone raster points , as is described for example in german pat . no . 2 , 107 , 738 . these recording beams can for example , be driven three times by the circuit 14 onto the length of a half tone raster point interval l in circumferential direction so that in a raster mesh b × l , nine fields can be acted upon separately . one recognizes that the contour forms 51 selected randomly as an example in fig2 and 3 are refined by means of specific point patterns within each raster field b × l in the sense of the invention . in fig2 also for the clarification , three light modulators 50 and the light source 49 are drawn in . with the use of fig4 an example is described for the circuit 14 ( fig1 ) for the obtaining of the point patterns from the items of information of the specific surroundings of the point in the case of line recording . the circuitry example again proceeds from the assumption that a raster mesh ( b × l in fig2 ) is sub - divided into 3 × 3 individual fields . the principle manner of operation is the following : the line information from the line scanner 10 ( fig1 ) proceeds via line 22 and a demultiplexer 25 into a quadruplex reciprocal memory 23a - d which stores the value in each case of four consecutive scanning lines in such a manner that in each memory portion , there is one scanning line . three portions of the memory hold the surrounding information of the point to be evaluated in readiness , while in the fourth portion , the next scanning line is written in . the information of the surroundings of the point , which is available in the three memories in each case loaded with neighbouring image lines , is associated via read - only memory 39 with a specific pattern of the point to be written by the recording element 12 . the read only memory 39 is programmed such that this point pattern is optimally appropriate to the contour detected by the scanning and its reproduction is refined in the inventive form . a line counter 24 , ( for example sn 74293 of the firm texas instruments ) controls via 2 - bit line 41 the cyclic change - over of the reciprocal memory 23a - d ( for example 4 x semi 4200 of the firm electronic memories and magnetics ), whereby via a demultiplexer 25 ( for example sn 74139 of the firm texas instruments ) it determines into which portion of the reciprocal memory the line information is read in . it further controls the reading pulse which comes from the control unit via line 42 , which it switches on via a further demultiplexer 26 ( for example sn 74130 of the firm texas instruments ) corresponding to the reciprocal memory . simultaneously , the line counter 24 via three subtractors 27 ( for example , s . n . 7482 of the firm texas instruments ) which constantly substract by 1 , 2 or , respectively 3 and via a multiplexer 34 ( for example , sn 74153 of the firm texas instruments ) make available the addresses for those lines from which read - out is permitted . the address counter 28 ( for example 3 x sn 74293 of the firm texas instruments ) which is driven via line 20 by the clock pulse generator 8 ( fig1 ) with the scanning pulse , together with an adder 29 ( for example 3 x sn 74283 of the firm texas instruments ), which constantly adds by 1 and a subtractor 30 ( for example 3 x sn 74283 of the firm texas instruments ) which constantly subtracts by 1 prepares the three point addresses from which read - out can occur . the controlling is laid out for linear program flow and consists of a program counter 31 ( for example , sn 7492 of the firm texas instruments ) and a programmable memory 32 ( for example 2 x sn 74188 of the firm texas instruments ). this contains the micro - program for the controlling , whose pulse diagram is depicted in fig5 . the clocking of the control unit occurs with a multiplying of the sanning frequency ( here , for example , by 12 times ), which is generated via a frequency multiplier 33 in pll circuit ( for example , described in rca application report ican 6101 ). the factor 12 makes available to the control unit 12 program steps for the duration of a scanning clock pulse . in the course of these program steps , the control unit via line 43 ( 2 bits ) connects via the multiplexer 34 , one after the other , the three reciprocal memory portions , which just contain the complete neighbouring line information , via a further multiplexer 35 ( for example sn 74153 of the firm texas instruments ) to a shift register 36 ( for example 3 x sn 7495a ) and within each line via line 44 ( 2 bit ) via a multiplexer 37 ( for example 3 x 74153 of the firm texas instruements ) selects three points so that at the input of the shift register 36 , one after the other , nine items of point information appear . the control unit via line 45 for each point information delivers a pulse which causes the shift register to shift so that after the nine shifts , the information is present in parallel at the output of the shift register . via line 46 , the control unit provides to a postconnected register 38 ( for example , 2 l x sn 74174 of the firm texas instruments ) with a charge pulse so that the 9 bit information is taken over into the register 38 in order there to be ready for the next - following scanning duration for the generation of the point pattern , while the shift register 36 becomes free for the collecting of the next information . the information stored in the register 38 together with a 2 bit item of information , which comes via line 48 from the control unit , forms the address for the programmable memory 39 . thereby , for the duration of the writing clock pulse for an entire point ( b × l ), the address portion which comes from the register 38 remains constant while the address portion which comes from the control unit via line 48 is reversed within a point three times . thus , the point to be written is resolved also in circumferential direction in three lines , whereby the refinement becomes effective also in circumferential direction . after intermediate storage by means of a pulse on line 47 in a further register 39a ( for example type 74175 sn 74175 of the firm texas instruments ), a drive signal for the circuit 18 ( fig1 ) stands ready at its outputs 40a - c . for the program example stated , in fig5 for the clarification , a pulse diagram is stated which shows the timerelated course of the output pulses from the programmable memory 32 . program counter 31 operates in conjunction with the other units to control how the individual program steps are to occur . the following operation occurs with the circuit of fig4 . each basic timing signal from line 20 at which a basic timing signal occurs is converted into 12 intermediate timing signals by the pll circuit 33 . the program counter 31 divides the output clocks by the pll circuit into blocks of respectively 12 subclocks and it counts up from 1 through 12 each time and then again counts from 1 through 12 . the output clocks of the program counter 31 serve as input addresses for the memory 32 , i . e ., the addresses 1 , 2 , etc ., through 12 successively are supplied to the memory 32 . the signals illustrated in fig5 for the lines 42 through 48 which correspond to the individual program steps 1 through 12 are deposited in the memory 32 . when the program counter 31 , for example , supplies the address 1 , then the signals of the first column of fig5 are emitted to the corresponding output lines . upon application of address 2 , the signals of the second column are read out , etc . the sequence of how the individual program steps are then executed with the assistance of the multiplexers 34 and 37 is as described above . fig6 shows an example of the circuit 18 ( fig1 ) which unites raster signals and refined line signals before the recording in a suitable manner . here as example again one proceeds from the fact that six recording beams are present . these can for example be light beams which , modulated by light modulators 50 ( fig2 ), record on light - sensitive film . the light modulators are controlled via the six lines 58a - f . these lines are outputs of six or gates 57a - f , at whose inputs the raster information from the output lines 53a - f of the and gates 56a - f and the inventively refined line information from the lines 40a - c ( fig4 ) converge . the raster information in each case stands at an input of the and gates 56a - f ; the other inputs lie parallel on line 54 . depending upon which logic signal is adjacent to line 54 , according to the invention the raster information is either suppressed or not during the writing of a refined line pattern . two electronic change - over switches 52 , here depicted for the sake of simplicity as mechanical switches , can change the grouping of the six recording signals 57a - f by means of driving of the switches 52 via line 55 selectively in three groups for each two neighbouring recording beams or in two groups for each three neighbouring recording beams . although the invention has been described with respect to preferred embodiments , it is not to be so limited as changes and modifications can be made which are within the full intended scope of the invention as defined by the appended claims . | 7 |
the transfer controller with hub and ports architecture is optimized for efficient passage of data throughout a digital signal processor chip . fig1 illustrates a block diagram of the principal features of the transfer controller with hub and ports . it consists of a system of a single hub 100 and multiple ports 111 through 115 . at the heart of the hub is the transfer controller with hub and ports hub control unit 109 which acts upon request and status information to direct the overall actions of the transfer controller . the transfer controller with hub and ports functions in conjunction with , first , a transfer request bus having a set of nodes 117 which bring in transfer request packets at input 103 . these transfer request bus nodes ( tr nodes ) individually receive transfer request packets from transfer requesters 116 which are processor - memory nodes or other on - chip functions which send and receive data . secondly the transfer controller uses an additional bus , the data transfer bus having a set of nodes 118 , to read or write the actual data at the requester nodes 116 . the data transfer bus carries commands , write data and read data from a special internal memory port 115 and returns read data to the transfer controller hub via the data router 150 function at inputs 104 . the transfer controller has , at its front - end portion , a request queue controller 101 ( also commonly referred to as the queue manager of this invention ) receiving transfer requests in the form of transfer request packets at its input 103 . the queue manager prioritizes , stores , and dispatches these as required . the queue manager connects within the transfer controller hub unit 100 to the channel request registers 120 which receive the data transfer request packets and process them . in this process , it first prioritizes them and assigns them to one of the n channel request registers 120 , each of which represent a priority level . if there is no channel available for direct processing of the transfer request packets , it is stored in the queue manager memory ( usually a ram ) 102 . the transfer request packet is then assigned at a later time when a channel becomes available . the channel registers interface with the source 130 and destination 140 control pipelines which effectively are address calculation units for source ( read ) and destination ( write ) operations . outputs from these pipelines are broadcast to m ports through the transfer controller ports i / o subsystem 110 which includes a set of hub interface units , which drive the m possible external ports units ( four such external ports are shown in fig1 as 111 through 114 ). the external ports units ( also referred to as application units ) are clocked either at the main processor clock frequency or at a lower ( or higher ) external device clock frequency . if a port operates at its own frequency , synchronization to the core clock is required . as an example of read - write operations at the ports , consider a read from external port node 112 followed by a write to external port node 114 . first the source pipeline addresses port 112 for a read . the data is returned to the transfer controller hub through the data router unit 150 . on a later cycle the destination control pipeline addresses port 114 and writes the data at port 114 . external ports as described here do not initiate transfer requests but merely participate in reads and writes requested elsewhere on the chip . read and write operations involving the processor - memory nodes ( transfer requesters ) 116 are initiated as transfer request packets on the transfer request bus 117 . the queue manager 101 processes these as described above , and on a later cycle a source pipeline output ( read command / address ) is generated which is passed at the internal memory port to the data transfer bus 118 in the form of a read . this command proceeds from one node to the next in pipeline fashion on the data transfer bus . when the processor node addressed is reached , the read request causes the processor - memory node to place the read data on the bus for return to the data router 150 . on a later cycle , a destination pipeline output passes the corresponding write command and data to the internal memory port and on to the data transfer bus for writing at the addressed processor node . the channel parameter registers 105 and port parameters registers 106 hold all the necessary parametric data as well as status information for the transfer controller hub pipelines to process the given transfer . both pipelines share some of the stored information . other portions relate specifically to one pipeline or the other . the transfer controller with hub and ports introduced several new ideas supplanting the previous transfer controller technology . first , it is uniformly pipelined . in the previous transfer controller designs , the pipeline was heavily coupled to the external memory type supported by the device . in the preferred embodiment , the transfer controller with hub and ports contains multiple external ports , all of which look identical to the hub . thus peripherals and memory may be freely interchanged without affecting the transfer controller with hub and ports . secondly , the transfer controller with hub and ports concurrently executes transfers . that is , up to n transfers may occur in parallel on the multiple ports of the device , where n is the number of channels in the transfer controller with hub and ports core . each channel in the transfer controller with hub and ports core is functionally just a set of registers . these registers track the current source and destination addresses , the word counts and other parameters for the transfer . each channel is identical , and thus the number of channels supported by the transfer controller with hub and ports is highly scalable . thirdly , the transfer controller with hub and ports includes a mechanism for queuing transfers up in a dedicated queue ram . fig2 illustrates from a higher level an overview of a multiprocessor integrated circuit employing the transfer controller with hub and ports of this invention . there are four main functional blocks . the transfer controller with hub and ports 220 and the ports , including ports external port interface units 230 to 233 and internal memory port 260 , are the first two main functional blocks . though four external port interface units 230 , 231 , 232 and 233 are illustrated , this is an example only and more or less could be employed . the other two main functional blocks are the transfer request bus 245 and the data transfer bus ( dtb ) 255 . these are closely associated functional units that are but not a part of the transfer controller with hub and ports 220 . transfer request bus 245 is coupled to plural internal memory port nodes 270 , 271 and 272 . though three internal port nodes 270 , 271 and 272 are illustrated , this is an example only and more or less could be employed . each of these internal memory port nodes preferable includes an independently programmable data processor , which may be a digital signal processor , and corresponding cache memory or other local memory . the internal construction of these internal memory port nodes 270 , 271 and 272 is not important for this invention . for the purpose of this invention it sufficient that each of the internal memory port nodes 270 , 271 and 272 can submit transfer requests via transfer request bus 245 and has memory that can be a source or destination for data . transfer request bus 245 prioritizes these packet transfer requests . transfers originating from or destined for internal memory port nodes 270 , 271 or 272 are coupled to transfer controller with hub and ports 220 via data transfer bus 255 and internal memory port master 260 . fig2 highlights the possible connection of data transfer bus 255 to multiple internal memory port nodes 270 , 271 and 272 and the possible connection of multiple transfer request nodes to transfer request bus 245 . fig3 illustrates a transfer request bus at the major block level . the processor - cache internal memory port nodes of fig2 are shown as requestor nodes 270 , 271 and 272 of fig3 . other additional requestor nodes 313 through 319 are shown in fig3 . upstream request signals 320 , 322 , 325 , and 326 , local request signals 334 , and 335 , stall signals 330 and 337 , and token signals 323 , 327 and 329 are identified in fig3 and these will now be described . a transfer request ( e . g . 320 , 322 , 325 , 334 , or 335 ) consists of one or more n bit word transfer request packets . these transfer request packets are always originated and propagated back to back on the tr bus . in other words , a local request 334 can stall and preempt an upstream request 325 only when the first upstream packet arrives . after the first packet has gone through a tr node , the local request can be injected only at the end of the upstream packet transfer . the tr node , in its simplest form , multiplexes between dispatching one of local or upstream requests and stalling the other one . the frequency and scaling requirements of the architecture require the stall signal to be pipelined from one tr node to another . this requires the tr nodes to have local storage so that upstream request during stall propagation will not be lost . the stall to the local requester is also pipelined , requiring local storage for these requests as well . a node having an upstream request and a local request collide causes stalls . on a collision if the tr node does not have the token , it will pass the upstream request and stall the local request . if the tr node has the token , it will pass the local request and stall the upstream request . the upstream stall ripples up until it hits a tr node with no upstream request at that node . in order to guarantee against starvation of getting a local request onto the tr bus , a token is passed downstream from node to node to give priority to the next local request for that node over the incoming upstream request . when a node receives the token , it can stall and buffer the incoming upstream request and pass its local request to the downstream node . the token passing protocol is detailed below for all possible operating scenarios : if a tr node 302 has no local request pending or arriving in the same clock as the token arrives , then the token ( see active token 323 ) is passed on to the next downstream node 302 in the very next clock . assume a tr node 302 has a local request pending or arriving in the same clock as the actual token 323 arrives , and there is no upstream request 343 . then the token is passed onto the next downstream node 301 in the same cycle as the first transfer request packet of local request . note that if there is a downstream stall 331 coming back , then the token is held at the tr node until the stall goes away and the transfer of first local transfer request packet can be initiated . yes local request , first transfer request packet of upstream request , token in assume a tr node 302 has a local request 342 pending or arriving in the same clock as the actual token 323 arrives and also the first transfer request packet of upstream request 343 arrives in the same clock . then the token is passed onto the next downstream node 301 in the same cycle as the first transfer request packet of local request 342 , and the upstream request 343 is stalled . yes local request , second transfer request packet of upstream request , token in assume a tr node 302 has a local request 342 pending or arriving in the same clock as the actual token 323 arrives and also that the second transfer request packet of the upstream request 343 arrives in the same clock . then the token is held till the upstream request passes through , and is then passed onto the next downstream node 301 in the same cycle as the first transfer request packet of local request 342 . to summarize , the transfer request node implements the operations illustrated in table 1 . refer to fig4 for the detailed diagram of the transfer request bus node . the implementation shown is the heart of this invention . before describing how the elements of the transfer request bus node accomplish the desired behavior of table 1 and the four operating scenarios described above , it should be noted that there are two additional busses not shown in fig3 . one of the two additional buses runs upstream and parallel to the tr bus is the requestor acknowledge bus qack shown in fig4 as 413 . this bus sends the requestor id of those transfer requests ( mapped to the priority bits of the request and the requester id of the unit submitting the request ) which have been accepted by the transfer controller for servicing . this allows the local node to increment its counter of reserved space , so it may issue more transfer requests . the qack bus is simply passed on to the local node so it that may decide based on the counter value , priority information , and requestor id information what operations will proceed next . the format of the qack is , in the preferred embodiment : the second additional bus , also runs upstream and parallel to the tr bus and is referred to as the request completed bus , qcomp ( see 414 of fig4 ). this request completed bus sends the report code ( as specified in the tr parameters ) with a valid bit on completion of the request by the i / o subsystem . the qcomp bus is simply passed on to the local node so it may test the information contained and take the appropriate action . the report word portion of qcomp can be encoded to carry relevant information about a transfer request completion . the format of the qcomp , in the preferred embodiment is as follows : acknowledgement of completion of the transfer request may be used in control of local processor functions . the report word may indicate any exceptions or special conditions or the like . the basic tr protocol involves sending requests , and responding to stalls , while not losing any of the data . the basic mechanism of the local node interface to the tr node ( to the tr bus ) is to set local request 406 ‘ high ’ whenever data is sent , and hold the same data if a stall is received on the next cycle . if there is no stall , then local request remains ‘ high ’, and the next data is sent to the tr node , until the entire transfer request has been sent , and then local request is set ‘ low ’. ( 1 ) local request 406 must be ‘ high ’ when data is being sent to the tr node ; ( 2 ) once a request ( local or upstream ) is initiated , the entire transfer request data ( two 68 - bit data words ) must be sent to the tr node in successive cycles ( disregarding stalls ); ( 3 ) when a node receives a stall , the data sent last cycle must be resent that cycle as well ; ( 4 ) there is no guarantee about when a stall may come , so it must be comprehended in either case , whether it occurs both before , between , or after the two 68 bit words are transferred ; ( 5 ) there are no restrictions on how many transfer requests can be sent successively , although they may be stalled . the heart of the tr node control is the finite state machine which accepts the upstream token input 404 , the upstream request input 402 , and the downstream stall input 410 . each of these signals is registered , the upstream token input in register 431 , the upstream request input in register 432 and the stall input in register 438 . the finite state machine control block 400 , keeps track of the number of each type of inputs in it &# 39 ; s counters and generates the control signals for the multiplexers and registers for the tr node datapath . the datapath in tr node is primarily devoted to multiplexing and holding the incoming upstream transfer request packets 405 and local transfer request packets 401 and also holding outgoing downstream transfer request packets 411 in case of a downstream stall . the transfer request packets are 68 bit wide data words . register 433 is used to register the incoming local request packet 401 and drives it through the output multiplexer 423 as downstream data 411 to the downstream node . also in case of a stall , register 433 recirculates and holds the local request packet 401 which has arrived . similarly register 434 keeps track of the upstream transfer request packets 405 . register 437 holds and recirculates the outgoing transfer request packets 411 in case of a downstream stall . the other paths simply involve registering and forwarding the qack ( register 435 ) and qcomp busses ( register 436 ). downstream qack input is labeled 413 and upstream qack output is labeled 415 . downstream qcomp input is labeled 414 and upstream qcomp output is labeled 416 . fig5 illustrates the waveform diagram showing a simple request with a stall and no token present at the local tr node . during time interval 500 both a local transfer request packet 401 and an upstream transfer request packet 405 are present but a downstream stall input 410 has also been received . during time interval 501 the downstream stall input is registered in finite state machine block ( 400 in fig4 ) and is output as an active upstream stall output 403 . also during time interval 501 an active local stall output 407 is generated . the downstream transfer request packet output 411 will hold and recirculate data n as shown in fig5 . the local transfer request packet input 401 with data l 2 and upstream transfer request packet input 405 with data u 2 will hold their data until the downstream transfer request packet output 411 completes processing of the respective inputs . note that recirculation of input local data l 2 and upstream data u 2 takes place in registers 433 and 434 of fig4 respectively and recirculation of output downstream data n takes place in register 437 . with no active token present at this node , the local stall output 407 persists until all upstream requests are cleared . the upstream stall output 403 however goes inactive in time interval 502 allowing the upstream requests to be completed . during time intervals 502 and 503 the upstream transfer request packet 405 data u 1 and data u 2 are cleared and passed on as downstream transfer request packets 411 . during time interval 503 no upstream request is present and the local stall 407 becomes inactive at the beginning of time interval 504 . during time intervals 504 and 505 , the local stall output 407 being inactive , the local requests data l 1 and data l 2 are passed downstream . fig6 illustrates the waveform diagram showing a simple request with a stall but with an active token present at the node . during time interval 600 both a local transfer request packet 401 and an upstream transfer request packet 405 are present but a downstream stall input 410 has also been received . with an active upstream token input 404 present at this node , the local stall output 407 persists for only through time interval 601 . during time interval 602 the local transfer request packet data l 1 receives priority and is processed and shows as an output downstream transfer request packet 411 during time interval 602 . the upstream transfer request packet data u 1 is recirculated in register 434 until the local transfer request packet has been processed . during time interval 603 the processing of the local request packet completes with the downstream transfer request packet output 411 being data l 2 . during time intervals 604 and 605 the processing of the upstream transfer request packet data u 1 and data u 2 resumes producing the downstream transfer request packet outputs data u 1 and u 2 respectively . this invention has been described in conjunction with the preferred embodiment in which the requests are for data transfer . those skilled in the art would realize that this type request is not only type that can be serviced by this invention . this invention can be used to connect and prioritize any data processing function that can be requested by plural requesters and is serviced by a central application unit . | 6 |
in the following description , for purposes of explanation , numerous specific details are set forth in order to provide an understanding of the invention . it will be apparent , however , to one skilled in the art that the invention can be practiced without these specific details . in other instances , structures , devices , systems and methods are shown only in block diagram form in order to avoid obscuring the invention . reference in this specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the invention . appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment , nor are separate or alternative embodiments mutually exclusive of other embodiments . moreover , various features are described which may be exhibited by some embodiments and not by others . similarly , various requirements are described which may be requirements for some embodiments but not other embodiments . broadly , embodiments and techniques of the present invention disclose or relate to systems and methods for circulating or agitating the medium , liquid , fluid or water in an algae cultivation pond . while there are various mechanisms to circulate or agitate the medium ( e . g ., impellers , propellers , water jets ) a preferred mechanism is to periodically generate a propagating surface wave . in a preferred implementation , a propagating wave travels the length of the pond . it was found that a propagating wave adequately circulates the medium in the pond and does not appreciably disturb or inhibit growth of the algae . in fact , circulation of the medium by propagating waves was found to be preferable to other means of circulation . fig1 shows a perspective view of a single algae cultivation pond 100 ( herein “ pond ”) according to one implementation of the invention . with reference to fig1 , a pond 100 is at least partially filled with a cultivation medium ( e . g ., water , water - based solution of algae feeding nutrients ) 102 . the medium 102 is prevented from escaping the pond 100 by a liner 104 spread over the bottom and sides of the pond 100 . the liner 104 also facilitates harvesting of the algae ( not shown ) as described in more detail below . at or near a proximal side or edge 106 of the pond 100 , an agitator 108 is installed or placed in the pond 100 . the agitator may be maintained in place such as with permanent , temporary , moveable or removable anchors 110 . the anchors 110 are optional . in one implementation , the agitator 108 is made of an inexpensive , flexible polyvinyl or plastic material . in this implementation , the agitator 108 is an inflatable bladder . intermittently , the agitator 108 is caused to generate a traveling or propagating wave 112 that travels the length or width 114 of the pond 100 to a distal side or edge 116 of the pond 100 . in one implementation , the propagating wave 112 is created as follows . the agitator 108 is partially or fully submerged in the pond 100 , and the agitator 108 is rapidly filled or pulsed with air through a hose or air duct 118 . a fast - acting damper ( not shown in fig1 ) may provide air to the air duct 118 . in one exemplary implementation , the damper is charged or pressurized to 25 - 30 inches water column ( 62 - 75 mbar ). in response to the pulse of air , the agitator 108 rapidly floats to the surface of the pond 100 and emerges there . the movement of the agitator 108 through the vertical distance 120 creates a propagating wave 112 . the agitator 108 is allowed to deflate and re - submerge into pond 100 to await another inflation cycle . in a preferred implementation , several inflations are performed per minute . accordingly , several propagating waves 112 may be incident in the pond 100 at any given time depending on the dimensions of the pond 100 and other conditions . in an example of such implementation , a 12 - inch ( 30 cm ) diameter bladder or agitator 108 at rest is deflated such that about 24 inches ( 61 cm ) of its diameter is deflated or collapsed . the result is about a 12 - inch ( 30 cm ) diameter partially or fully submerged agitator 108 , or about a six - inch ( 15 cm ) diameter partially or fully submerged agitator 108 . when pulsed with air , the bladder or agitator 108 is again inflated and displaces about 0 . 75 cubic feet ( ft 3 ) of water for each running foot of agitator corresponding to about 0 . 07 cubic meters of water for each meter of agitator . after causing a pulse or relatively rapid inflation , another fast acting damper ( not shown ) is used to deflate the agitator 108 . in addition to ( or in place of ) a deflating damper , deflation vents or vent holes may installed in the agitator 108 or inflatable portion of the agitator 108 . in one implementation , one or more deflation vents are located along a bottom edge of the agitator 108 so as to encourage draining of any water that enters the agitator 108 . even with some water entering the agitator 108 , inflation and deflation of the agitator 108 causes substantial and sufficient agitation so as to create a propagating wave that travels all or substantially all of the length or width 114 of the pond 100 . alternatively , other movements and other means may be used to cause a propagating wave 112 . for example , the agitator 108 may remain inflated and may be rapidly moved downward or pulsed rapidly in a horizontal or other direction ( s ) ( not shown ) to cause the propagating wave 112 . in yet another alternative example , instead of using air to inflate the agitator 108 , a series of cables or cords are used to provide a pulsing motion to the buoyant agitator 108 . in yet another alternative , the agitator 108 is made of two or more materials such as one or more foam portions and one or more hollow or inflatable portions . an air pump would then only need to fill or partially fill a smaller volume to cause the agitator 108 to float to the surface of the pond 100 . in any event , the agitator 108 may be made of other materials ( e . g ., wood , straw , composite , dried and treated algae , metal , foam polymer ). with reference to fig1 , algae cultivation preferably includes a nutrient line 122 at or near the distal edge 116 of the pond 100 . the nutrient line 122 preferably runs along substantially all or a substantial part of the length or side 124 of the pond 100 . in a preferred implementation , the length 124 of the pond 100 is substantially larger than the width 114 of the pond 100 . nutrients ( not shown ) are released into the medium 102 over the course of time . nutrients may be intermittently supplied , or may be continuously fed to the medium 102 . nutrients or a nutrient - enriched flow is provided to the nutrient line 122 through a nutrient supply 126 . the nutrient line 122 may require an intake line ( not shown ) that draws medium 102 from the pond 100 and recycles it to the pond 100 . a nutrient line 122 alternatively may deliver a variety of materials not traditionally considered as “ nutrients ” or fertilizers for algae including carbon dioxide or other off gases from power plants , or other gaseous or liquid based materials from production or processing facilities . by delivering materials to algae ponds , materials can be sequestered or captured by algae or other organism cultivated in ponds . while a single nutrient line 122 is shown , multiple nutrient lines may be provided . one or more nutrient lines may be arranged in or around the pond 100 in a variety of ways conforming to the needs of the algae , environment and pond 100 . fig2 shows a profile or lateral cross - sectional view of an algae cultivation pond 100 and exemplary agitation mechanism according to one implementation of the invention . the elements shown in this view are not drawn to scale but are shown for illustration purposes only . ( the same applies to the other figures .) the width 114 and pond 100 are cut to show that the width 114 and pond 100 are not limited in size relative to the length ( not shown ) of the pond 100 or consistent with other typical algae ponds . with reference to fig2 , an agitator 108 is located at the proximal edge 106 of the pond 100 such as by one or more anchors 110 . the proximal depth 202 of the pond 100 ( or , more accurately , the depth of the medium 102 near the proximal end 106 ) as measured at or near the proximal edge 106 is preferably larger or deeper than a distal depth 204 . however , the proximal depth 202 and the distal depth 204 may be the same or about the same . as a specific example , a proximal depth 202 could be about 20 inches ( 51 cm ) and a distal depth 204 could be about 12 inches ( 30 cm ). in this example , for a round - shaped agitator 108 , a diameter 208 of the agitator 108 could be about 12 inches ( 30 cm ). propagating waves 112 originate at and travel from the proximal edge 106 to or toward the distal edge 116 . in one example , propagating waves are generated by a generally rapid and generally vertical movement of the agitator 108 shown by a distance 120 in fig2 . as viewed along the width 114 of the pond 100 , the bottom of the pond 100 is preferably substantially smooth to encourage recycle 206 of flow of medium 102 and nutrients ( not shown ) from the area near the nutrient line 122 . in one implementation , leveling machinery is used to create a substantially smooth pond bottom that has little or no slope . in another implementation , a slight slope is provided to each pond with a proximal depth 202 being greater than a distal depth 204 . nutrients may be carried from the distal end 116 toward the proximal 106 in a counter - current fashion in the pond 100 as shown by the arrows in fig2 . thus , nutrients may travel by diffusion and circulation of the medium 102 . the propagating waves 112 are useful for more than dispersing nutrients . first , the propagating waves 112 agitate the surface of the medium 102 . such agitation encourages exchange of oxygen , nitrogen and carbon dioxide with the ambient air . carbon dioxide is generally absorbed by the algae and oxygen is released into the medium 102 and ultimately the ambient air . second , the propagating waves 112 agitate the medium 102 . as algae captures light at the surface of the pond 100 , the algae grows . the agitation of the medium circulates growing algae to other depths of the medium 102 thereby allowing the algae to grow to a greater depth than would normally grow without agitation , which , in turn , causes increased growth of biomass over a same amount of time as compared to a stagnant pond or one that is agitated with impellers or propellers . third , the propagating waves 112 promote dispersion of nutrients along the width 114 of the pond 100 . without propagating waves 112 , nutrients generally have to be introduced at a substantially greater number of locations in each pond 100 or in a more cumbersome fashion . a first pond 100 is separated from neighboring ponds 212 by berms 210 . the width of each berm 210 may be selected based on convenience when harvesting algae from a series of neighboring ponds 100 and 212 , or the width of each berm 210 may be uniform . fig3 shows an overhead view of an algae cultivation pond and exemplary agitation mechanism according to an alternative implementation 300 of the invention . with reference to fig3 , an agitator 108 is placed at an arbitrary distance along the width 114 of the pond ; in fig3 , the agitator 108 is shown located somewhat toward the proximal edge 106 of the pond . the agitator 108 is placed at an arbitrary angle 302 as measured between a line parallel with the proximal side 106 of the pond and the agitator 108 . a first end 304 of the agitator 108 is located a first distance 306 from the proximal edge 106 of the pond . a second end 308 of the agitator 108 is located a second distance 310 from the proximal edge 106 of the pond . in this example , propagating waves 112 are directed to both the proximal edge 106 and the distal edge 116 of the pond . the alternative arrangement may reduce the amount of equipment needed to supply propagating waves 112 to the pond , or may reduce the number of ponds ( not the surface area of cultivation or volume of media 102 ) needed to cultivate a desired amount of algae . this alternative arrangement may allow the ponds to be of other than rectangular shape , or may allow for increased propagation of waves or some other benefit . the alternative arrangement may provide needed flexibility based on construction , harvesting or other considerations or restrictions . in an alternative implementation , the agitator 108 may occupy substantially all of the length 124 of the pond 100 as shown in fig1 , 3 . in another implementation , the agitator 108 merely occupies a portion of the length 124 of the pond . in yet other implementation , the agitator 108 is broken into several portions or units ( not shown in fig1 , 3 ). each agitator unit may operate independently of other agitator unit ( s ), or may act in concert or coordination with other agitator unit ( s ). for example , each unit may operate in sequence to cause a rolling wave or wave that travels in a direction that is not substantially parallel to the width 114 or length 124 of the pond 100 . alternatively , the units may operate in sequence starting at a middle portion of the length 124 of the pond 100 and ending at the edges of the pond — a v - shaped wave may be created and propagated . in yet another alternative implementation , waves of different magnitudes may be generated over time . for example , propagating waves 112 may be created in a pattern or rhythm such as two waves of relatively small magnitude followed by two waves of relatively large magnitude . in this example , perhaps the waves of relatively small magnitude fail to reach the distal edge 116 of the pond 100 , but the waves of relatively large magnitude do so . in yet another variation of propagating waves 112 , as the algae biomass increases over time , the magnitude of propagating waves 112 is increased as needed or as measured ( e . g ., in real time ) to ensure that the propagating waves 112 reach the distal end 116 of the pond 100 or detectably reach a point of measurement along the length 114 of the pond 100 . in such a scenario , a propagating wave magnitude sensor ( not shown ) relays feedback to the control system of the actuator of the agitator 108 so that a proper or desired magnitude of propagating wave 112 is delivered at any given time . propagating waves 112 may be varied in frequency depending on a variety of factors including , but not limited to , time of day , day versus night , width of the pond , density of algae , strain or type of algae , depth of water in the pond , age of the inflatable agitator . in the implementation shown in fig3 , a bridging section 312 may connect agitators 108 in neighboring ponds . that is , compressed air may be passed into the agitators 108 of neighboring ponds at substantially the same time , or that agitators 108 of neighboring ponds may be actuated at substantially the same time or through the same actuation or mechanism . fig4 shows an overhead view 400 of an algae cultivation system including a set of algae cultivation ponds and a system of agitation mechanism ( s ) for production of algae on an industrial scale according to one implementation of the invention . with reference to fig4 , a first array 402 and a second array 404 of cultivation ponds 100 are evident . as one example of the arrangement of ponds , each of the ponds may be about 40 feet ( 12 meters ) in width 114 . given that each pond 100 is about 1 mile long ( 1 . 6 km ), about 120 ponds may be placed side by side in a square mile with about 4 feet ( 1 meter ) of berm 210 between neighboring ponds 100 . during algae cultivation , propagating waves 112 are capable of traveling from one edge of these mile - long ponds to the other . other arrangements are possible . for example , ponds 100 may be about ¼ mile ( 0 . 4 km ) long . one disadvantage of such an arrangement would be the requirement for four times the number of agitators 108 and increased amount equipment needed to actuate the agitators 108 . an industrial scale compressor 406 provides air through ducts 408 to agitators 108 . control equipment such as valves , computers , actuators and the like are not shown in fig4 . however , it is to be understood that such are used to operate the agitators 108 and other components of the system . for example , dampers ( not shown ) provide pulses of air to agitators 108 . in a first array or set of ponds 402 , the agitators 108 are operated in synchronization with each other . this is evident by the propagating waves 112 shown at about the same position in each of the ponds 100 at a given instant of time . in this implementation , air is introduced into each inflatable portion of the agitators 108 at about the same time . this may be accomplished by connecting neighboring agitators 108 with each other so that only one or just a few ducts 408 are needed to actuate agitators in the ponds 100 in the first array 402 . in another implementation , in the second array 404 of ponds , the agitators 108 are operated ( one or more at a time ) in series according to a control scheme . for example , each of the agitators 108 receives a pulse of air from the compressor 406 in turn . this is evident by the propagating waves 412 shown at different positions in each of the ponds 100 at the given instant of time . this scheme would require a damper for each agitator or group of agitators 108 receiving a pulse of air . the scheme in the second array 404 provides a more balanced load on the compressor 406 and related equipment . the air compressor 406 , ducts 408 and various equipment could be sized depending on a variety of factors including ( but not limited to ): the number of propagating waves desired each hour for each pond , the desired size of propagating wave in each pond , the length or width of each pond or the array of ponds , the number of agitators operating in tandem or synchronization , the ambient temperature , the amount of algae biomass in each pond , and the energy source used to compress the air . in one implementation , an air compressor 406 is sized to supply enough compressed air for operating agitators 108 in both the first array 402 and second array 404 . in one implementation , an algae cultivation and harvesting system comprises a central facility for growth media preparation , one or more feed canals a set of pulse agitated cultivation ponds 402 and one or more harvest canals . the growth media for the algae may be enriched with carbon dioxide . there are many sources of carbon dioxide . a predominant source of the carbon dioxide may be a gaseous exhaust of an industrial scale fermentation , industrial combustion gaseous exhaust , or may be taken from a source of geologically - derived carbon dioxide , or any combination of such sources such as a combination of gaseous exhaust of an industrial scale fermentation , geological carbon dioxide , and gaseous exhaust from an industrial combustion . the algae cultivation system shown in fig4 preferably includes pulsed agitation predominantly across the respective short dimension of each pond 100 . during cultivation , it may become necessary to include a source of makeup water . this makeup water may be derived from various sources including from : oil and gas production water , saline aquifers , inland saline lakes , sea water , surface fresh water , and fresh water aquifers . the algae cultivation system such as the one shown in fig4 may produce a wet algal cake or a dry algal powder . the algae cultivation system or facility may an algal product into two or more commodities . alternatively , the cultivation facility may use fermentation to separate starch and sugar from protein , oils , or from the protein and oils . the ponds 100 of the algae cultivation system may be covered , lined , or covered and lined . the pulse agitation sub - system 406 , 408 ( and other parts not shown in fig4 ) may include a source of compressed air , ducts to distribute the compressed air , and control dampers . the in - pond agitators may take the form of ballasted floating bladders . fig5 shows a flowchart 500 of one implementation of a method for causing agitation ( e . g ., propagating wave ) in an algae cultivation pond . with reference to fig5 and as explained at least in reference to fig4 , a compressor may compress air or other gas 502 . when desired , a damper is actuated 504 and an inflatable portion or portions of an agitator are inflated 506 . the action of pulsing or relatively rapidly inflating the agitator 506 causes a propagating wave in the growth medium of an algae pond . the propagating wave travels in the algae pond . before a next pulsing , the agitator is deflated 508 . deflation allows the agitator to sink back into the pond or otherwise configure itself to a starting or ready position . it is through intermittent or cyclical application of pulses of compressed air or gas that propagating waves are introduced into a pond and thereby improves or encourages growth of algae . fig6 shows a flowchart of one implementation of a method for cultivating algae according to the invention . with reference to fig6 , algae may be cultivated by supplying growth medium to a recess 602 . the recess may or may not be lined or enclosed . generally , a recess is a pool , pond , furrow , channel , tube or canal formed specifically for the purpose of cultivating algae . nutrients and other materials may be supplied to the growth medium 604 , either before , during or after algae is supplied to the growth medium and recess 606 . these first steps 602 , 604 and 606 ) may be performed in any order , all at once , intermittently , or continuously . at some point in time , propagating waves are generated in the growth medium 608 . the propagating waves may be generated frequently or infrequently , but at least frequently enough to provide improved growing conditions over those associated with a non - agitated growth medium . when it is time for algae harvesting , the growth medium in the recess is drained 610 , and the algae is dried or allowed to dry 612 . in preparation for another batch of algae , the dried or partially dried algae is removed from the recess 614 . the process or method for cultivating algae may then be repeated . unless stated otherwise , or found in conflict , the following language provides at least one meaning of the terms used herein to describe and explain the invention . algae medium refers to the liquid , fluid , water and the like refer to the liquid medium resident in ponds for algae or biomass cultivation . an example of an algae medium is found in fig1 as 102 . an algae cultivation pond or reservoir has been referred herein to an open recess in which a liquid medium for algae or biomass cultivation is disposed . however , the concepts described apply equally well to all sizes , shapes and arrangements of equipment and materials . for example , propagating waves may be applied from a nano - scale up to and including ponds and reservoirs that are miles in length . although the present invention has been described with reference to specific exemplary embodiments , it will be evident that the various modification and changes can be made to these embodiments without departing from the broader spirit of the invention . in an area of technology such as this , where growth is fast and further advancements are not easily foreseen , the disclosed embodiments may be readily modifiable in arrangement and detail as facilitated by enabling technological advancements without departing from the principals of the present disclosure . | 2 |
this invention is directed to compounds of formula i above . the invention is particularly directed to compounds as follows , where : r 3 , when it is lower alkyl , is methyl , ethyl , propyl , or butyl , or r 4 , when it is lower alkyl , is methyl or ethyl ( especially compounds where r 3 and r 4 are both so defined ), or r 1 , when substituted , is substituted with halo , lower alkyl , or —( r 5 ) n — c ( o )— or 6 , or compounds where any two or more , or all , of these conditions are met . for any compound of this invention where r 1 , r 2 , or r 3 are not specified , it is preferred that the variable is as described in this paragraph . certain preferred compounds of formula i include a compound where r 1 is substituted or unsubstituted thiazolyl ( compound a ). among the embodiments of compound a are those compounds where r 1 is thiazolyl substituted with halo , lower alkyl , or —( r 5 ) n — c ( o )— or 6 , and especially with —( r 5 ) n — c ( o )— or 6 . ( compound a - 1 ). in compound a - 1 , it is preferred that r 2 is cyclopentyl or cyclohexyl . it is also preferred that r 3 is cyclopentyl or cyclohexyl . it is preferred that r 4 is hydrogen . it is especially preferred that r 2 and r 3 are cyclohexyl . in preferred embodiments of compound a - 1 , r 2 and r 3 are cyclopentyl or cyclohexyl , and r 4 is hydrogen ( compound a - 1a ). in one embodiment of compound a - 1a , n is 0 ( e . g ., the thiazolyl is substituted with — c ( o )— or 6 ). examples of such compounds are in such a compound , r 2 and r 3 may both be cyclohexyl , for example ( s , s )- 2 -[[ 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidin - 1 - yl ] propanoyl ] amino ] thiazole - 4 - carboxylic acid methyl ester . in another embodiment of compound a - 1a , r 5 is — c ( o )— or lower alkyl ( e . g ., the thiazolyl is substituted with — c ( o )— c ( o )— or 6 or - lower alkyl - c ( o )— or 6 ). in addition , in such compounds r 2 and r 3 may be cyclohexyl . examples of such compounds are in another embodiment of compound a1 , r 2 is cyclopentyl or cyclohexyl ( compound a - 1b ). in one embodiment of compound a - 1b , r 3 is substituted or unsubstituted phenyl and r 4 is hydrogen . examples of these compounds are in another embodiment of compound a - 1b , at least one of r 3 and r 4 are lower alkyl . examples of such compounds are in yet another embodiment of compound a - 1b , r 3 is naphthyl and r 4 is hydrogen . an example of such a compound is ( s , s )- 2 -|| 3 - cyclohexyl - 2 -[ 2 , 5 - dioxo - 4 -( naphthalen - 2 - yl ) methylimidazolidin - 1 - yl ] propanoyl ] amino ] thiazole - 4 - carboxylic acid methyl ester . in another embodiment of compound a - 1b , r 3 and r 4 together with the carbon atoms to which they are attached form a cycloalkyl ring containing 5 to 7 carbon atoms . an example of such a compound is ( s )- 2 -[[ 3 - cyclohexyl - 2 -( 2 , 4 - dioxo - 1 , 3 - diazaspiro [ 4 . 4 ] non - 3 - yl ) propanoyl ] amino ] thiazole - 4 - carboxylic acid methyl ester . and in another embodiment of compound a - 1b , r 3 is an unsubstituted five - or six - membered aromatic heterocyclic ring having one or two heteroatoms selected from nitrogen , oxygen , and sulfur . an example of such a compound is ( s , s )- 2 -[[ 3 - cyclohexyl - 2 -[ 2 , 5 - dioxo - 4 -( thiophen - 2 - yl ) methylimidazolidin - 1 - yl ] propanoyl ] amino ] thiazole - 4 - carboxylic acid methyl ester . in one embodiment of compound a ( a compound of formula i wherein r 1 is substituted or unsubstituted thiazolyl ), r 1 is unsubstituted thiazolyl ( compound a - 2 ). it is preferred that r 2 and r 3 are cyclohexyl and r 4 is hydrogen . an example of such a compound a - 2 is ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidin - 1 - yl ]- n -( thiazole - 2 - yl ) propanamide . in other preferred compounds of formula i , r 1 is substituted or unsubstituted pyridine ( compound b ). it is preferred that r 2 is cyclopentyl or cyclohexyl , especially cyclohexyl . it is also preferred that r 3 is cyclopentyl or cyclohexyl , especially cyclohexyl . it is preferred that r 4 is hydrogen . in one embodiment of compound b , r 2 is cyclohexyl . in such a compound where r 2 is cyclohexyl , it is preferred that r 3 is cyclohexyl and r 4 is hydrogen ( compound b - 1 ). in one embodiment of compound b - 1 , r 1 is substituted pyridine . preferably the pyridine is substituted with —( r 5 ) n — c ( o )— or 6 , especially where n is 0 and r 6 is lower alkyl , such as methyl ( e . g ., methoxycarbonyl ). examples of such compounds are in another embodiment of compound b - 1 , r 1 is unsubstituted pyridine . an example of such a compound is ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidin - 1 - yl ]- n -( pyridin - 2 - yl ) propanamide . in the compound of formula i the “*” and “**” illustrate the two separate asymmetric centers . the ( s ) enantiomer at the position designated by “**” is preferred . however the compounds of this invention may be pure ( r )( r ), pure ( s )( s ), pure ( r )( s ), pure ( s )( r ) or any mixture of pure enantiomers . as used throughout this application unless otherwise specified , the term “ lower alkyl ” includes both straight chain and branched chain alkyl groups having from 1 to 6 or 1 to 7 carbon atoms , such as methyl , ethyl , propyl , isopropyl , preferably methyl and ethyl . unless otherwise specified , propyl is taken to include both forms of propyl ( e . g ., isopropyl , n - propyl ) and butyl is taken to include all forms of butyl ( e . g ., isobutyl , n - butyl , tert - butyl ). preferred at r 3 is methyl , ethyl , propyl , or butyl . preferred at r 4 is methyl or ethyl . the term “ cycloalkyl ring ” may be a ring of from three to seven carbon atoms , but preferably from five to seven carbon atoms , especially cyclopentyl , cyclohexyl , cyclobutyl and cyclopropyl . the more preferable cycloalkyl groups contain from 5 to 6 carbon atoms , e . g ., cyclopentyl and cyclohexyl , and cyclohexyl is most preferable . as used herein , “ perfluoro - lower alkyl ” means any lower alkyl group wherein all of the hydrogens of the lower alkyl group are substituted or replaced by fluoro . among the preferred perfluoro - lower alkyl groups are trifluoromethyl , pentafluoroethyl , heptafluoropropyl , etc . as used herein , “ lower alkyl thio ” means a lower alkyl group as defined above where a thio group is bound to the rest of the molecule . similarly “ perfluoro - lower alkyl ” thio means a perfluoro - lower alkyl group as defined above where a thio group is bound to the rest of the molecule . as used herein , “ lower alkyl sulfonyl ” or “ lower alkyl sulfinyl ” means a lower alkyl group as defined above where a sulfonyl or sulfinyl group is bound to the rest of the molecule . similarly “ perfluoro - lower alkyl sulfonyl ” means a perfluoro - lower alkyl group as defined above where a sulfonyl group is bound to the rest of the molecule . when r 3 and r 4 together with the carbon atom to which they are attached form a cycloalkyl ring containing five to seven carbon atoms , this includes the ring carbon atom and the methylene linking the ring carbon atom and r 4 such that if r 3 and r 4 are each methylene , cyclobutyl is formed . if r 3 is methylene and r 4 is ethylene , cyclopentyl is formed , etc . as used herein , the terms “ halogen ” or “ halo ” unless otherwise specified , designates all four halogens , i . e . fluorine , chlorine , bromine and iodine . r 1 is , and r 3 can be any five - or six - membered aromatic heterocyclic ring containing from one to three , preferably from one to two , heteroatoms selected from the group consisting of sulfur , oxygen or nitrogen . any such five - or six - membered aromatic heterocyclic ring can be used in accordance with this invention . among the preferred rings for r 1 are thiazole and pyridine ( especially pyridine ), and a preferred ring for r 3 is thiophene . r 1 , and r 3 when r 3 is a heterocyclic ring , is connected to the remainder of the molecule of formula i through a ring carbon atom . when r 1 is substituted as described in formula i , the substituent is on a ring carbon atom . r 1 is preferably monosubstituted , but may be di or tri substituted . a preferred substituent , especially for pyridine , is lower alkoxy ( preferably methoxy ) carbonyl . as used herein the term “ aryl ” signifies an aromatic hydrocarbon ring having six or ten carbon atoms such as phenyl or naphthyl . the compounds of this invention may be produced by the reaction schemes provided below . the term “ resin ” designates any conventional polymer resin which has suitable characteristics for use in solid phase peptide synthesis . a resin with the suitable characteristics is inert , physically stable , insoluble in inorganic solvents , and has a linker functionality which is labile under known chemical conditions . preferred are polystyrene resins having chemically labile functional linkers such as trityl resins and especially wang resins . the term “ amino protecting group ” designates any conventional amino protecting group which can be cleaved to yield the free amino group . the preferred protecting groups are the conventional amino protecting groups utilized in peptide synthesis . especially preferred are those amino protecting groups which are cleavable under treatment with secondary dialkyl amines . a particularly preferred amino protecting group is 9h - fluoren - 9 - ylmethoxy carbamate . “ orthogonal ” is the term used to describe the relationship of the amino protecting group to the resin . the resin and the amino protecting group must be compatible , in that the resin - peptide bond and the amino protecting group should not labile under the same conditions . during synthesis of a given compound , one should be able to cleave the amino protecting groups off the compound while leaving the compound attached to the resin . in other words , the conditions under which the amino protecting group comes off the compound should not also cause the compound to come off the resin . it is preferred that the amino protecting group be cleavable under basic or weakly acidic conditions , because the preferred wang - type resins are cleavable under strongly acidic conditions ( i . e . about ph 0 to about ph 1 ) a skilled person will readily be able to determine the necessary conditions to select an orthogonal amino protecting group — resin set . the term “ pharmaceutically acceptable salts ” as used herein include any salt with both inorganic or organic pharmaceutically acceptable acids such as hydrochloric acid , hydrobromic acid , nitric acid , sulfuric acid , phosphoric acid , citric acid , formic acid , maleic acid , acetic acid , succinic acid , tartaric acid , methanesulfonic acid , para - toluene sulfonic acid and the like . the term “ pharmaceutically acceptable salts ” also includes any pharmaceutically acceptable base salt such as amine salts , trialkyl amine salts and the like . such salts can be formed quite readily by those skilled in the art using standard techniques . in accordance with this invention , the compounds of formula i are produced by the following reaction schemes . any compound of formula i may be produced as shown in reaction scheme 1 . the compounds of formula i - a are produced as shown in reaction scheme 2 . reaction scheme 3 shows how to produce n - fmoc - aminothiazole - 4 - carboxylic acid , which is compound 3 of scheme 2 where pg is the protecting group fmoc . wherein r 1 , r 2 , r 3 and r 4 are as previously described and pg 1 and pg 2 are amine protecting groups which may or may not be equivalent , that are removable under conditions compatible with the linker - o bond . wherein r 2 , r 3 , r 4 and r 6 are as previously described and pg , pg 1 and pg 2 are amine protecting groups which may or may not be equivalent , that are removable under conditions compatible with the linker - o bond and where the ring a represents a five or six membered heteroaromatic ring having one , two or three hetero atoms selected from nitrogen , oxygen or sulfur . the synthesis of the compounds of this invention may be carried out by a procedure whereby each amino acid in the desired sequence is added one at a time in succession to another amino acid or residue thereof or by a procedure whereby peptide fragments with the desired amino acid sequence are first synthesized conventionally and then condensed to provide the compound . such conventional procedures for synthesizing the novel compounds of the present invention include for example any solid phase peptide synthesis method . in such a method the synthesis of the novel compounds can be carried out by sequentially incorporating the desired amino acid residues one at a time into the growing peptide chain according to the general principles of solid phase methods [ merrifield , r . b ., j . amer . chem . soc . 1963 , 85 , 2149 - 2154 ; barany et al ., the peptides , analysis , synthesis and biology , vol . 2 , gross , e . and meienhofer , j ., eds . academic press 1 - 284 ( 1980 ); bunin , b ., combinatorial index , academic press ( 1998 )]. common to chemical syntheses of peptides is the protection of reactive side chain groups of the various amino acid moieties with suitable protecting groups , which will prevent a chemical reaction from occurring at that site until the protecting group is ultimately removed . usually also common is the protection of the alpha amino group of an amino acid or fragment while that entity reacts at the carboxyl group , followed by the selective removal of the alpha amino protecting group and allow a subsequent reaction to take place at that site . while specific protecting groups are mentioned below in regard to the solid phase synthesis method , it should be noted that each amino acid can be protected by any protective group conventionally used for the respective amino acid in solution phase synthesis . for example , alpha amino groups may be protected by a suitable protecting group selected from aromatic urethane - type protecting groups , such as benzyloxycarbonyl ( z ) and substituted benzyloxycarbonyl , such as p - chlorobenzyloxycarbonyl , p - nitrobenzyloxycarbonyl , p - bromobenzyloxycarbonyl , p - biphenyl - isopropoxycarbonyl , 9 - fluorenylmethoxycarbonyl ( fmoc ) and p - methoxybenzyloxycarbonyl ( moz ); aliphatic urethane - type protecting groups , such as t - butyloxycarbonyl ( boc ), diisopropylmethoxycarbonyl , isopropoxycarbonyl , and allyloxycarbonyl . in the present case , fmoc is the most preferred for alpha amino protection . guanidino groups may be protected by a suitable protecting group selected from nitro , p - toluenesulfonyl ( tos ), z , pentamethylchromanesulfonyl ( pmc ), adamantyloxycarbonyl , and boc . pmc is the most preferred for arginine ( arg ). the solvents dichloromethane , dimethylformamide ( dmf ) and n - methylpyrrolidinone and toluene may be purchased from fisher or burdick and jackson and may be used without additional distillation . trifluoroacetic acid was purchased from halocarbon or fluka and used without further purification . diisopropylcarbodiimide and diisopropylethylamine ( dipea ) was purchased from fluka or aldrich and used without further purification . 1 - hydroxybenzotriazole ( hobt ) may be purchased from sigma chemical co . and used without further purification . protected amino acids , unless otherwise specified , are generally preferably of the l configuration and may be obtained commercially from bachem , advanced chemtech , or neosystem . such amino acids may also be chemically synthesized using any one of several well known methods of amino acid synthesis . the configuration of the amino acids 5 and 7 used to prepare a given compound of this invention will determine the configuration of the ** and * positions respectively of formula i . therefore , it is useful to select the amino acid configuration with the desired final configuration in mind . l amino acids have the ( s ) absolute configuration and d amino acids have the ( r ) absolute configuration . compounds of this invention may be prepared using solid phase synthesis following the principles and general methods described by merrifield or by bunin , although other equivalent chemical synthesis known in the art could be used as previously mentioned . solid phase synthesis is commenced from the c - terminal end of the peptide by coupling a n - protected amino acid to a suitable resin . such a starting material can be prepared by attaching an n - protected amino acid by an ester linkage to a p - benzyloxybenzyl alcohol ( wang ) resin , or by an amide bond between an fmoc - linker , such as p -[( r , s )- α -[ 1 -( 9h - fluoren - 9 - yl )- methoxyformamido ]- 2 , 4 - dimethyloxybenzyl ]- phenoxyacetic acid ( rink linker ) to a benzhydrylamine ( bha ) resin . preparation of the hydroxymethyl resin is well known in the art . wang resin supports are commercially available and generally used when the desired peptide being synthesized has an ester or a substituted amide at the c - terminus . to form the starting resin bound amino acid , a fmoc n - protected amino acid is activated by the formation of a mixed anhydride which in turn couples with the hydroxymethyl resin though an ester bond . several reagents are used to form mixed anhydrides in which the carbonyl group originating from the c - terminal amino acid is preferentially activated to nucleophilic attack by the hydroxymethyl residues in the wang resin , through either electronic or steric effects . for example , appropriate compounds used in the formation of the mixed anhydrides are trimethylacetyl chloride , 2 , 6 - dichlorobenzoyl chloride and 2 , 4 , 6 - trichlorobenzoyl chloride , preferably 2 , 6 - dichlorobenzoyl chloride . subsequently , the amino acids or mimetics are then coupled onto the wang resin using the fmoc protected form of the amino acid or mimetic , with 2 - 5 equivalents of amino acid and a suitable coupling reagent . after each coupling , the resin may be washed and dried under vacuum . loading of the amino acid onto the resin may be determined by amino acid analysis of an aliquot of fmoc - amino acid resin or by determination of fmoc groups by uv analysis . the resins are carried through one or two cycles to add amino acids sequentially . in each cycle , the n - terminal fmoc protecting group is removed under basic conditions from the resin bound amino acid . a secondary amine base such as piperidine , piperazine or morpholine , preferably piperidine ( 20 - 40 % v / v ) in an inert solvent , for example , n , n - dimethylformamide is particularly useful for this purpose . following the removal of the alpha amino protecting group , the subsequent protected amino acids are coupled stepwise in the desired order to obtain an n - fmoc protected peptide - resin . the activating reagents used for coupling of the amino acids in the solid phase synthesis of the peptides are well known in the art . for example , appropriate coupling reagents for such syntheses are [( benzotriazol - 1 - yl ) oxy ] tris ( dimethylamino ) phosphonium hexafluorophosphate ( bop ), [( benzotriazol - 1 - yl ) oxy ] tris ( pyrrolidino )- phosphonium hexafluorophosphate ( pybop ), o -( 1h - benzotriazole - 1 - yl )- n , n , n ′, n ′- tetramethyluronium hexafluorophosphate ( hbtu ), and diisopropylcarbodiimide ( dic ), preferably hbtu and dic . other activating agents as described by barany and merrifield [ the peptides , vol . 2 , j . meienhofer , ed ., academic press , 1979 , pp 1 - 284 ] may be utilized . the couplings are conveniently carried out in an inert solvent , such as n , n - dimethylformamide or n - methylpyrrolidinone , preferably n - methylpyrrolidinone , optionally in the presence of a substance that minimizes racemization and increases the rate of reaction . among such substances are 1 - hydroxybenzotriazole ( hobt ), 3 , 4 - dihydro - 3 - hydroxy - 4 - oxo - 1 , 2 , 3 - benzotriazine ( hoobt ), 1 - hydroxy - 7 - azabenzotriazole ( hoat ), and n - hydroxysuccinimide ( iiosu ). in the present instance , hobt is preferred . the protocol for a typical coupling cycle is as follows ( method b ): solvents for all washings and couplings may be measured to volumes of , for example , 10 - 20 ml / g resins . coupling reactions throughout the synthesis may be monitored by assays , such as the kaiser ninhydrin test , to determine extent of completion [ kaiser et at . anal . biochem . 1970 , 34 , 595 - 598 ]. when the requisite number of amino acid units have been assembled on the resin , the n - terminal fmoc group may be cleaved using steps 1 - 4 of method b and the deprotected amine is reacted with phosgene or a phosgene equivalent to form an isocyanate . the reagent of choice in this transformation is trichloromethyl chloroformate ( diphosgene ). the reaction is carried out in an inert solvent , for example dichloromethane , in the presence of a proton acceptor . when a suspension of the resin bound isocyanate is heated , cyclization occurs wherein the isocyanate moiety condenses with the nitrogen of the neighboring amide group to form a 2 , 5 - dioxoimidazolidine ring . the compounds may be cleaved from the resin by the following procedure , conditions which also remove other protecting groups if they are present . the peptide - resins are shaken in a mixture ( 1 : 1 ) of trifluoroacetic acid in dichloromethane , optionally in the presence of a cation scavanger , for example ethanedithiol , dimethylsulfide , anisole or triethylsilane , at room temperature for 60 min . the cleavage solution may be filtered free from the resin , concentrated to dryness , and the product then used per se in subsequent transformations as shown in reaction scheme 1 and reaction scheme 2 . compounds of formula 1 can be prepared by the methods outlined in reaction scheme 1 and reaction scheme 2 . reaction scheme 2 is a general procedure that can be used to prepare all compounds embodied by formula 1 , but in the present case , it is particularly useful in the preparation of compounds where r 1 is varied while r 2 and r 3 are limited to cycloalkyl and r 4 is hydrogen . reaction scheme 1 is used in the preparation of compounds of formula i - a . in reaction scheme 2 , an n - protected - amino acid 3 ( see reaction scheme 3 ) is converted to a mixed anhydride on treatment with 2 , 6 - dichlorobenzoyl chloride in the presence of wang resin 2 and a proton acceptor , such as triethylamine , diisopropylethylamine or pyridine , preferably pyridine to give the resin bound amino acid of structure 4 . the reaction is conveniently carried out in an inert solvent for example n , n - dimethylformamide or n - methylpyrrolidinone , preferably n - methylpyrrolidinone at from zero degrees to room temperature , most conveniently at room temperature . the conversion of 4 to the resin bound compound of structure 6 can be achieved by using the protocol outlined in method b . thus after n - deprotection of the resin bound amino acid of structure 4 with piperidine in n , n - dimethylformamide , the product is then acylated with the n α - protected amino acid of structure 5 in the presence of diisopropylcarbodiimide and hobt in n - methylpyrrolidinone . the deprotection and n - acylation is carried out at a temperature between about zero degrees and about room temperature , preferably at about room temperature . by using the coupling cycle described above for the conversion of 4 to 6 the n α - protected amino acids of structure 7 is incorporated into the resin bound compound of structure 6 . thus compounds of structure 6 are sequentially deprotected with piperidine in n , n - dimethylformamide and then coupled with compounds of structure 7 in the presence of diisopropylcarbodiimide and 1 - hydroxybenzotriazole in n - methylpyrrolidinone at a temperature between about zero degrees and about room temperature , preferably at about room temperature to afford the resin bound compounds of structure 8 . the n - terminus protecting group pg 2 in the compounds of structure 8 was removed on treatment with a secondary amine base , preferably piperidine in an inert solvent ( preferably n , n - dimethylformamide ) and then was reacted with phosgene or a phosgene equivalent reagent , to ultimately yield in a two step sequence , the 2 , 5 - dioxoimidazolidines of structure 10 . the reaction to give the intermediate isocyanate 9 is conveniently carried out using trichloromethyl chloroformate ( diphosgene ) in an inert solvent , for example , a halogenated hydrocarbon in the presence of a proton acceptor , for example , pyridine , triethylamine or diisopropylethylamine , preferably diisopropylethylamine at a temperature between about zero degrees and about room temperature , preferably at about room temperature . the thermally induced cyclization of the intermediate isocyanates is performed by heating a suspension of the resin bound isocyanates of structure 9 in an inert solvent , for example toluene , at a temperature of from between 50 ° c . and the reflux temperature of the mixture , preferably at about 70 ° c . to give the resin bound compounds of structure 10 . cleavage of the assembled peptidic residue 10 from the solid support to give the acids of structure 11 is achieved by shaking a suspension of 10 in a strong acid , for example methanesulfonic acid , hydrofluoric acid or trifluoroacetic acid , preferably trifluoroacetic acid optionally in the presence of a cation scavenger and an inert co - solvent , for example dichloromethane . the reaction is conveniently run at a temperature between about zero degrees and about room temperature , preferably at about room temperature . to complete the synthesis , the acid of structure 11 is reacted with an alcohol ( r 6 oh ) to form the ester 1 . the esterification can be accomplished using many of the methods well known to those of average skill in the field of organic chemistry . the conversion is conveniently carried out using a coupling reagent , for example one of the many useful carbodiimides , preferably the water soluble 1 -( 3 - dimethylaminopropyl )- 3 - ethylcarbodiimide , optionally using r 6 oh or a mixture of r 6 oh and a inert co - solvent , e . g ., dichloromethane , as the reaction medium . the reaction is run at a temperature between about zero degrees and about room temperature , preferably at about room temperature . in a similar fashion , reaction scheme 1 , the n α - protected amino acids of structure 5 is converted to a mixed anhydride on treatment with 2 , 6 - dichlorobenzoyl chloride in the presence of wang resin 2 and a proton acceptor , such as triethylamine , diisopropylethylamine or pyridine , preferably pyridine to give the resin bound amino acid of structure 12 . the reaction is conveniently carried out in an inert solvent for example n , n - dimethylformamide or n - methylpyrrolidinone , preferably n - methylpyrrolidinone at from zero degrees to room temperature , most conveniently at room temperature . the conversion of 12 to the resin bound compound of structure 13 can be achieved by using the protocol outlined in method b . thus after n - deprotection of the resin bound amino acid of structure 12 with piperidine in n , n - dimethylformamide , the product is then acylated with the n α - protected amino acid of structure 7 in the presence of diisopropylcarbodiimide and hobt in n - methylpyrrolidinone . the deprotection and n - acylation is carried out at a temperature between about zero degrees and about room temperature , preferably at about room temperature . the n - terminus protecting group pg 2 in the compounds of structure 13 was removed on treatment with a secondary amine base , preferably piperidine in an inert solvent , preferably n , n - dimethylformamide and then was reacted with phosgene or a phosgene equivalent reagent , to ultimately yield in a two step sequence , the 2 , 5 - dioxoimidazolidines of structure 15 . the reaction to give the intermediate isocyanate 14 is conveniently carried out using trichloromethyl chloroformate ( diphosgene ) in an inert solvent , for example , a halogenated hydrocarbon in the presence of a proton acceptor , for example , pyridine , triethylamine or diisopropylethylamine , preferably diisopropylethylamine at a temperature between about zero degrees and about room temperature , preferably at about room temperature . the thermally induced cyclization of the intermediate isocyanates is accomplished by heating a suspension of the resin bound isocyanates of structure 14 in an inert solvent , for example toluene , at a temperature of from between 50 ° c . and the reflux temperature of the mixture , preferably at about 70 ° c . to give the resin bound compounds of structure 15 . cleavage of the peptidic residue 15 from the solid support to give the acids of structure 16 is achieved by shaking a suspension of 15 in a strong acid , for example methanesulfonic acid , hydrofluoric acid or trifluoroacetic acid , preferably trifluoroacetic acid optionally in the presence of a cation scavenger and an inert co - solvent , for example dichloromethane . the reaction is conveniently run at a temperature of between about zero degrees and about room temperature , preferably at about room temperature . reaction of the acid 16 with r 1 — nh 2 to form the amide of formula 1 can be carried out under the coupling conditions previously described . the preferred coupling reagent in this instance is hbtu . the reaction is carried out in the presence of a tertiary amine base , such as triethylamine or diisopropylethylamine , preferably diisopropylethylamine in an inert solvent , for example n , n - dimethylformamide or n - methylpyrrolidinone , preferably n - methylpyrrolidinone at from zero degrees to room temperature , most conveniently at room temperature . reaction scheme 3 outlines the preparation of the intermediate n - fmoc - 2 - aminothiazole - 4 - carboxylic acid 3 . initially 9 - fluorenylmethoxycarbonyl chloride ( 18 ) is reacted with potassium thiocyanate in an inert solvent , preferably ethyl acetate at a temperature of between zero degrees and 5 ° c . then the reaction is allowed to proceed at a temperature of from zero degrees to 40 ° c ., preferably at room temperature to furnish n - fmoc - thiocyanate ( 19 ). treatment of 19 with a solution of ammonia in an inert solvent , for example methanol or ethanol , preferably methanol at a temperature of from zero degrees to room temperature , preferably zero degrees afforded n - fmoc - thiourea 20 . in the final step , the thiourea 20 is then reacted with bromopyruvic acid to form the thiazole of structure 3 . the reaction is conveniently carried out if an inert solvent , such as a cyclic ether , for example tetrahydrofuran or dioxane , preferably dioxane at a temperature of from 40 ° c . to the reflux temperature of the mixture preferably at about 70 ° c . all of the compounds of formula i which include the compounds set forth in the examples , activated glucokinase in vitro by the procedure of example a . in this manner , they increase the flux of glucose metabolism which causes increased insulin secretion . therefore , the compounds of formula i are glucokinase activators useful for increasing insulin secretion . these examples are provided in illustration and are not intended to limit the invention in any way . analytical high performance liquid chromatography was ( hplc ) was conducted on a hewlett - packard 1090 system with ultraviolet ( uv ) detection system at 214 nm using an es industries c 18 column ( 30 × 3 . 2 mm ). preparative hplc separations were carried out using a shimazu vp series system interfaced with a perkin - elmer sciex mass spectrometer detector ( pe sciex 150ex ) using a ymc c 18 column ( 2 × 5 cm ). to a suspension of potassium thiocyanate ( 8 . 55 g , 88 mmol ) in ethyl acetate ( 100 ml ) cooled to 0 ° c . was added dropwise a solution of 9 - fluorenylmethoxycarbonyl chloride ( 20 . 7 g , 80 mmol ) in ethyl acetate ( 100 ml ) over a period of 15 min . the resulting suspension was allowed to warm to ambient temperature overnight with stirring . the formed solid was filtered off and the filtrate was concentrated in vacuo to afford an orange oil . without further purification , the oil was dissolved in ethanol ( 50 ml ) and treated by dropwise addition with a cold solution of ammonia in ethanol ( 7n , 91 ml , 637 mmol ). a precipitate formed upon addition of the ammonia solution . the suspension was stirred vigorously at 0 ° c . for 15 min and then the solids were filtered off , washed with cold ethanol ( 3 × 20 ml ) and dried to afford n - fmoc - thiourea ( 16 . 8 g , 70 %) as an off - white solid : ei - hrms m / e calcd for c 16 h 14 n 2 o 2 s ( m + ) 298 . 0776 , found 298 . 0770 . a solution of n - fmoc - thiourea ( 5 . 96 g , 20 mmol ) in dioxane ( 40 ml ) was treated with bromopyruvic acid ( 3 . 34 g , 20 mmol ). the reaction mixture was refluxed for 1 h , then the precipitated solids were recovered by filtration and washed with diethyl ether ( 3 × 20 ml ) to afford n - fmoc - 2 - aminothiazole - 4 - carboxylic acid ( 7 . 1 g , 97 %) as a white solid : ei - hrms m / e calcd for c 19 h 14 n 2 o 4 s ( m + ) 366 . 0674 , found 366 . 0679 . step ( i ). a mixture of n - fmoc - 2 - aminothiazole - 4 - carboxylic acid ( 6 . 0 g , 16 . 5 mmol ), 2 , 6 - dichlorobenzoyl chloride ( 7 . 9 ml , 55 mmol ) in n - methylpyrrolidinone ( 50 ml ) was added into a fritted polypropylene column charged with wang resin ( midwest bio - tech , 10 g , 11 mmol ). after the suspension was shaken for 5 min , pyridine ( 6 . 2 ml , 77 mmol ) was added slowly and the resulting dark mixture was shaken overnight at ambient temperature . the mixture was then filtered and the resin was washed with n , n - dimethylformamide ( 3 × 100 ml ), methanol ( 3 × 100 ml ), dichloromethane ( 3 × 100 ml ) and dried in vacuo . step ( ii ). to the resin product of the previous step ( 3 g , 2 . 31 mmol ) was added 20 % piperidine in n , n - dimethylformamide ( 25 ml ). the reaction mixture was shaken at ambient temperature for 30 min . the mixture was filtered and the resin was washed with n , n - dimethylformamide ( 3 × 30 ml ), methanol ( 3 × 30 ml ), dichloromethane ( 3 × 30 ml ). the resin was then suspended in n - methylpyrrolidinone ( 10 ml ) and n - fmoc - 3 - cyclohexyl - l - alanine ( 2 . 7 g , 6 . 93 mmol ), diisopropylcarbodiimide ( 1 . 09 ml , 6 . 93 mmol ) and hobt ( 0 . 936 g , 6 . 93 mmol ) were added . the resulting mixture was shaken at ambient temperature overnight and filtered . the resin was washed with n , n - dimethylformamide ( 3 × 100 ml ), methanol ( 3 × 100 ml ), dichloromethane ( 3 × 100 ml ) and dried in vacuo . step ( iii ). to the resin product of the previous step ( 200 mg , 0 . 14 mmol ) was added 20 % piperidine in n , n - dimethylformamide ( 5 ml ) and the reaction mixture was shaken at ambient temperature for 30 min . the mixture was filtered and the resin was washed with n , n - dimethylformamide ( 3 × 10 ml ), methanol ( 3 × 10 ml ), dichloromethane ( 3 × 10 ml ). the resin was then suspended in n - methylpyrrolidinone ( 2 ml ) n - fmoc - 2 - amino - 2 - methylpropanoic acid ( 136 mg , 0 . 42 mmol ), diisopropylcarbodiimide ( 65 μl , 0 . 42 mmol ) and hobt ( 57 mg , 0 . 42 mmol ) were added . the resulting mixture was shaken at ambient temperature overnight and filtered . the resin was washed with n , n - dimethylformamide ( 3 × 10 ml ), methanol ( 3 × 10 ml ), dichloromethane ( 3 × 10 ml ) and dried in vacuo . step ( iv ). to the product of the previous step ( 0 . 14 mmol ) was added 20 % piperidine in n , n - dimethylformamide ( 5 ml ) and the reaction mixture was shaken at ambient temperature for 30 min . the mixture was filtered and the resin was washed with n , n - dimethylformamide ( 3 × 10 ml ), methanol ( 3 × 10 ml ), dichloromethane ( 3 × 10 ml ). the resin was then suspended in dichloromethane ( 2 ml ) and treated with diisopropylethylamine ( 73 μl , 0 . 42 mmol ). the reaction mixture was then cooled to 0 ° c . and diphosgene ( 50 μl , 0 . 42 mmol ) was added dropwise . the resulting mixture was allowed to warm to the ambient temperature and was stirred for 3 h . the mixture was filtered and the resin was washed with dichloromethane ( 3 × 10 ml ) and dried in vacuo . the resin was then suspended in toluene ( 2 ml ) and stirred reaction mixture was heated at 70 ° c . for 4 h . the cooled resin mixture was filtered and the resin was washed with dichloromethane ( 3 × 10 ml ). cleavage from the support was effected by treatment with 50 % trifluoroacetic acid in dichloromethane ( 3 ml ) for 1 hr . concentration of the filtrate yielded a brown solid . step ( v ). without further purification , the solid from step ( iv ) was dissolved in methanol ( 1 ml ) and then treated with 1 -( 3 - dimethylaminopropyl )- 3 - ethylcarbodiimide ( 40 mg , 0 . 21 mmol ). the mixture was stirred at ambient temperature overnight and then was concentrated in vacuo . the resulting oil was triturated with 99 / 1 dichloromethane / methanol ( 3 × 5 ml ) and filtered through a silica gel plug . the filtrate was concentrated in vacuo to afford ( s )- 2 -[[ 3 - cyclohexyl - 2 -( 4 , 4 - dimethyl - 2 , 5 - dioxoimidazolidin - 1 - yl ) propanoyl ] amino ] thiazole - 4 - carboxylic acid methyl ester ( 18 mg ) as a white foam : ei - hrms m / e calcd for c 19 h 26 n 4 o 5 s ( m + ) 423 . 1702 , found 423 . 1701 . the compound was prepared as described in example 3 , except n - fmoc - 3 - cyclohexyl - l - alanine was the amino acid incorporated in step ( iii ) of the procedure . the title compound was obtained as a white foam : ei - hrms m / e calcd for c 24 h 34 n 4 o 5 s ( m + ) 491 . 2328 , found 491 . 2323 . the compound was prepared as described in example 3 , except n - fmoc - 3 -( naphthalen - 2 - yl )- l - alanine was the amino acid incorporated in step ( iii ) of the procedure . the title compound was obtained as a white foam : ei - hrms m / e calcd for c 28 h 30 n 4 o 5 s ( m + ) 535 . 2015 , found 535 . 2035 . the compound was prepared as described in example 3 , except n - fmoc - 3 -( 4 - chlorophenyl )- d - alanine was the amino acid incorporated in step ( iii ) of the procedure . the title compound was obtained as a white foam : ei - hrms m / e calcd for c 24 h 27 n 4 o 5 scl ( m + ) 519 . 1469 , found 519 . 1466 . the compound was prepared as described in example 3 , except n - fmoc - l - tyrosine was the amino acid incorporated in step ( iii ) of the procedure . the title compound was obtained as a white foam : ei - hrms m / e calcd for c 24 h 28 n 4 o 6 s ( m + ) 501 . 1808 , found 501 . 1815 . the compound was prepared as described in example 3 , except n - fmoc - 1 - aminocyclopentanecarboxylic acid was the amino acid incorporated in step ( iii ) of the procedure : ei - hrms m / e calcd for c 21 h 28 n 4 o 5 s ( m + ) 449 . 1859 , found 449 . 1853 . the compound was prepared as described in example 3 , except n - fmoc - 3 -( 3 - hydroxyphenyl )- l - alanine was the amino acid incorporated in step ( iii ) of the procedure : ei - hrms m / e calcd for c 24 h 28 n 4 o 6 s ( m + ) 501 . 1808 , found 501 . 1816 . the compound was prepared as described in example 3 , except n - fmoc - 3 -( 4 - fluorophenyl )- dl - alanine was the amino acid incorporated in step ( iii ) of the procedure : ei - hrms m / e calcd for c 24 h 27 n 4 o 5 sf ( m + ) 503 . 1764 , found 503 . 1776 . the compound was prepared as described in example 3 , except n - fmoc - 3 -( thiophen - 2 - yl )- l - alanine was the amino acid incorporated in step ( iii ) of the procedure : ei - hrms m / e calcd for c 22 h 26 n 4 o 5 s 2 ( m + ) 491 . 1423 , found 491 . 1425 . the compound was prepared as described in example 3 , except ( r )- n - fmoc - 2 - aminopentanoic acid was the amino acid incorporated in step ( iii ) of the procedure : ei - hrms m / e calcd for c 20 h 28 n 4 o 5 s ( m + ) 437 . 1859 , found 437 . 1850 . the compound was prepared as described in example 3 , except n - fmoc - l - phenylalanine was the amino acid incorporated in step ( iii ) of the procedure : ei - hrms m / e calcd for c 24 h 28 n 4 o 5 s ( m + ) 485 . 1859 , found 485 . 1857 . the compound was prepared as described in example 3 , except n - fmoc - 3 - cyclopentyl - l - alanine was the amino acid incorporated in step ( iii ) of the procedure : ei - hrms m / e calcd for c 23 h 32 n 4 o 5 s ( m + ) 477 . 2172 , found 477 . 2170 . the compound was prepared as described in example 3 , except n - fmoc - 3 - cyclopentyl - l - alanine was the amino acid incorporated in both step ( ii ) and step ( iii ) of the procedure . the title compound was obtained as a white foam : ei - hrms m / e calcd for c 22 h 30 n 4 o 5 s ( m + ) 463 . 2015 , found 463 . 2023 . the compound was prepared as described in example 3 , except n - fmoc - 3 - cyclopentyl - l - alanine and n - fmoc - 3 - cyclohexyl - l - alanine were the amino acids incorporated in step ( ii ) and step ( iii ) of the procedure respectively : ei - hrms m / e calcd for c 23 h 32 n 4 o 5 s ( m + ) 477 . 2172 , found 477 . 2164 . step ( i ). a mixture of n - fmoc - 3 - cyclohexyl - l - alanine ( 3 . 47 g , 8 . 8 mmol ), 2 , 6 - dichlorobenzoyl chloride ( 3 . 2 ml , 22 mmol ) in n - methylpyrrolidinone ( 20 ml ) was added into a fritted polypropylene column charged with wang resin ( midwest bio - tech , 4 g , 4 . 4 mmol ). the suspension was shaken for 5 min , then pyridine ( 2 . 5 ml , 30 . 8 mmol ) was then added slowly and the resulting dark mixture was shaken overnight at ambient temperature . the mixture was then filtered and the resin was washed with n , n - dimethylformamide ( 3 × 30 ml ), methanol ( 3 × 30 ml ), dichloromethane ( 3 × 30 ml ) and dried in vacuo . step ( ii ). to the resin product of step ( i ) was added 20 % piperidine in n , n - dimethylformamide ( 25 ml ) and the reaction mixture was shaken at ambient temperature for 30 min . the mixture was filtered and the resin was washed with n , n - dimethylformamide ( 3 × 30 ml ), methanol ( 3 × 30 ml ), dichloromethane ( 3 × 30 ml ). the resin was then suspended in n - methylpyrrolidinone ( 10 ml ) and n - fmoc - 3 - cyclohexyl - l - alanine ( 5 . 2 g , 13 . 2 mmol ), diisopropylcarbodiimide ( 2 . 1 ml , 13 . 2 mmol ) and hobt ( 1 . 8 g , 13 . 2 mmol ) were added . the resulting mixture was shaken at ambient temperature overnight and filtered . the resin was washed with n , n - dimethylformamide ( 3 × 30 ml ), methanol ( 3 × 30 ml ), dichloromethane ( 3 × 30 ml ) and dried in vacuo . step ( iii ). to the resin product of step ( ii ) was added 20 % piperidine in n , n - dimethylformamide ( 25 ml ) and the reaction mixture was shaken at ambient temperature for 30 min . the mixture was filtered and the resin was washed with n , n - dimethylformamide ( 3 × 30 ml ), methanol ( 3 × 30 ml ), dichloromethane ( 3 × 30 ml ). the resin was then suspended in dichloromethane ( 20 ml ) and treated with diisopropylethylamine ( 2 . 3 ml , 13 . 2 mmol ). the reaction mixture was then cooled to 0 ° c . and diphosgene ( 1 . 6 ml , 13 . 2 mmol ) was added dropwise . the mixture was allowed to warm to room temperature with stirring for 5 h , then was filtered and the resin was washed with dichloromethane ( 3 × 30 ml ) and dried in vacuo . the resin was then suspended in toluene ( 20 ml ) and the stirred mixture was heated at 70 ° c . for 4 h . the cooled resin mixture was filtered and the resin was washed with dichloromethane ( 3 × 30 ml ). cleavage from the support was effected by treatment with 50 % trifluoroacetic acid in dichloromethane ( 30 ml ) for 1 hr . concentration of the filtrate yielded a brown solid . it was then purified by reversed phase hplc to afford ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidin - 1 - yl ] propanoic acid ( 850 mg ) as a white foam : ei - hrms m / e calcd for c 19 h 30 n 2 o 4 ( m + ) 350 . 2205 , found 350 . 2204 . step ( iv ). a solution of ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidin - 1 - yl ] propanoic acid [ step ( iii ); 25 mg , 0 . 071 mmol ] in n - methylpyrrolidinone ( 1 ml ) was treated with diisopropylethylamine ( 19 μl , 1 . 065 mmol ) and hbtu ( 29 . 3 mg , 0 . 078 mmol ). the reaction mixture was then treated with 2 - aminothiazole ( 7 . 2 mg , 0 . 071 mmol ) and stirred at ambient temperature overnight . the reaction mixture was then diluted with water ( 2 ml ) and extracted with ethyl acetate ( 2 × 3 ml ). the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . the product was purified by using flash chromatography ( merck silica gel 60 , 230 - 400 mesh , 99 / 1 dichloromethane / methanol ) to furnish ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidin - 1 - yl ]- n -( thiazol - 2 - yl ) propanamide ( 27 mg , 88 %) as a white foam : ei - hrms m / e calcd . for c 22 h 32 n 4 o 3 s ( m + ) 433 . 2273 , found 433 . 2270 . by using the conditions described in step ( iv ) of example 17 , ethyl 2 - amino - 4 - thiazoleglyoxylate was condensed with ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidinyl ] propanoic acid [ example 17 , step ( iii )] to give the title compound as a colorless foam : ei - hrms m / e calcd . for c 26 h 36 n 4 o 6 s ( m + ) 533 . 2434 , found 533 . 2431 . by using the conditions described in step ( iv ) of example 17 , ethyl 2 - amino - 4 - thiazoleacetate was condensed with ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidinyl ] propanoic acid [ example 17 , step ( iii )] to give the title compound as a colorless foam : ei - hrms m / e calcd . for c 26 h 38 n 4 o 5 s ( m + ) 519 . 2641 , found 519 . 2620 . by using the conditions described in step ( iv ) of example 17 , 2 - amino - 5 - methylpyridine was condensed with ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidinyl ] propanoic acid [ example 17 , step ( iii )] to give the title compound as a colorless foam : ei - hrms m / e calcd . for c 25 h 36 n 4 o 3 ( m + ) 441 . 2866 , found 441 . 2869 . by using the conditions described in step ( iv ) of example 17 , methyl 6 - aminonicotinate was condensed with ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidinyl ] propanoic acid [ example 17 , step ( iii )] to give the title compound as a colorless foam : ei - hrms m / e calcd for c 26 h 36 n 4 o 5 ( m + ) 485 . 2764 , found 485 . 2768 . by using the conditions described in step ( iv ) of example 17 , 2 - amino - 5 - chloropyridine was condensed with ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidinyl ] propanoic acid [ example 17 , step ( iii )] to give the title compound as a colorless foam : ei - hrms m / e calcd for c 24 h 33 n 4 o 3 cl ( m + ) 461 . 2319 , found 461 . 2321 . by using the conditions described in step ( iv ) of example 17 , 2 - aminopyridine was condensed with ( s , s )- 3 - cyclohexyl - 2 -[ 4 -( cyclohexyl ) methyl - 2 , 5 - dioxoimidazolidinyl ] propanoic acid [ example 17 , step ( iii )] to give the title compound as a colorless foam : ei - hrms m / e calcd for c 24 h 34 n 4 o 3 ( m + ) 427 . 2709 , found 427 . 2706 . glucokinase assay : glucokinase ( gk ) was assayed by coupling the production of glucose - 6 - phosphate to the generation of nadh with glucose - 6 - phosphate dehydrogenase ( g6pdh , 0 . 75 - 1 k units / mg ; boehringer mannheim , indianapolis , ind .) from leuconostoc mesenteroides as the coupling enzyme ( scheme 2 ). recombinant human liver gk1 was expressed in e . coli as a glutathione s - transferase fusion protein ( gst - gk ) [ liang , y ., kesavan , p ., wang , l ., niswender , k ., tanizawa , y ., permut , m . a ., magnuson , m ., and matschinsky , f . m . variable effects of maturity - onset - diabetes - of - youth ( mody )- associated glucokinase mutations on the substrate interactions and stability of the enzyme . biochem . j . 309 : 167 - 173 , 1995 ] and was purified by chromatography over a glutathione - sepharose 4b affinity column using the procedure provided by the manufacturer ( amersham pharmacia biotech , piscataway , n . j .). previous studies have demonstrated that the enzymatic properties of native gk and gst - gk are essentially identical ( liang et al , 1995 ; neet , k ., keenan , r . p ., and tippett , p . s . observation of a kinetic slow transition in monomeric glucokinase . biochemistry 29 ; 770 - 777 , 1990 ). the assay was conducted at 25 ° c . in a flat bottom 96 - well tissue culture plate from costar ( cambridge , mass .) with a final incubation volume of 120 μl . the incubation mixture contained : 25 mm hepes buffer ( ph , 7 . 1 ), 25 mm kcl , 5 mm d - glucose , 1 mm atp , 1 . 8 mm nad , 2 mm mgcl 2 , 1 μm sorbitol - 6 - phosphate , 1 mm dithiothreitol , test drug or 10 % dmso , 1 . 8 unit / ml g6pdh , and gk ( see below ). all organic reagents were & gt ; 98 % pure and were from boehringer mannheim with the exceptions of d - glucose and hepes that were from sigma chemical co , st . louis , mo . test compounds were dissolved in dmso and were added to the incubation mixture minus gst - gk in a volume of 12 μl to yield a final dmso concentration of 10 %. this mix was preincubated in the temperature controlled chamber of a spectramax 250 microplate spectrophotometer ( molecular devices corporation , sunnyvale , calif .) for 10 minutes to allow temperature equilibrium and then the reaction was started by the addition of 20 μl gst - gk . after addition of enzyme , the increase in optical density ( od ) at 340 nm was monitored over a 10 minute incubation period as a measure of gk activity . sufficient gst - gk was added to produce an increase in od 340 of 0 . 08 to 0 . 1 units over the 10 minute incubation period in wells containing 10 % dmso , but no test compound . preliminary experiments established that the gk reaction was linear over this period of time even in the presence of activators that produced a 5 - fold increase in gk activity . the gk activity in control wells was compared with the activity in wells containing test gk activators , and the concentration of activator that produced a 50 % increase in the activity of gk , i . e ., the sc 1 . 5 , was calculated . all of the compounds of formula i described in the synthesis examples had an sc 1 . 5 less than or equal to 30 μm . | 2 |
embodiments of the present disclosure may allow older - style transponders to have the ability to verify the altitude and reply codes being sent to air traffic control ( atc ) without having to be replaced by a modern transponder . more specifically , if an aircraft is equipped with an older - style mode c transponder , a transponder monitoring device ( referred to herein as the transmon ) may be installed as the control input for a transceiver , such as an ads600 - b . the transmon is a standalone device that may monitor transponder transmissions through a shielded rf coupler connection to an aircraft &# 39 ; s transponder antenna coaxial cable . the transmon device may be attached to the existing transponder antenna coaxial cable of a mode c transponder to pick up altitude , reply codes and / or identity information , decode the information , and transmit it digitally for use by a transceiver , such as an ads600 - b , or another separate external monitor ( e . g ., existing efis , mfd , pfd or purpose - built display ). it should be appreciated that monitoring of old - style transponders and altitude encoders connected to old - style transponders may be performed in a variety of manners without departing from the present disclosure . these techniques may include , but are not necessarily limited to , direct , simple monitoring ; direct , complex monitoring ; and indirect , complex monitoring . each of these techniques may be described in more detail below . in an embodiment of the present disclosure , a direct , simple monitoring technique may be employed as depicted in fig2 a . using this technique , the transmon device may be connected to an ads - b transceiver , such as an ads600 - b , and the ads - b transceiver may be connected to an instrument panel dedicated read - out . in another embodiment of the present disclosure , a direct , complex monitoring technique may be employed as depicted in fig2 b wherein the transmon device may be connected to an ads - b transceiver , and the ads - b transceiver may be connected to a multi - function display ( mfd ), a primary flight display ( pfd ) or another electronic flight instrument system ( efis ). the mfd , pfd or efis may be programmed to show the mode a and mode c codes that may be transmitted by the transmon device according to an embodiment of the present disclosure . in a further embodiment of the present disclosure , an indirect , complex monitoring technique may be employed as depicted in fig2 c . this embodiment of the present disclosure takes into account the situation wherein an ads - b transceiver may form part of an faa ads - b system . when the ads - b transceiver is part of such a system , the faa may send back traffic targets for ads - b equipped aircraft . when a transmon device is employed with the ads - b transceiver , a traffic target may be received for an aircraft in which the ads - b transceiver and the transmon device are installed . once the traffic target has been received , the associated mode a and mode c codes may be displayed from the faa ads - b transmitted message , and this information may be presented to a pilot so that he / she may cross - check the information against what is being shown on a transponder . while various monitoring techniques have been described , it should be appreciated that other monitoring techniques may be utilized without departing from the present disclosure . further , more or fewer devices / mechanisms may be utilized for monitoring without departing from the present disclosure . a means for monitoring the transponder transmissions according to embodiments of the present disclosure is through use of the transmon device via a shielded rf coupler as depicted in fig1 . receiving and decoding the timing bits may be accomplished by programmable hardware and / or software . the software may provide the mechanism to transmit the data digitally out of the transmon device . by virtue of the direct shielded connection of the rf coupler to the transponder antenna cable , no transmissions of other transponders would be received . in embodiments of the present disclosure , a transponder may transmit both mode a ( reply ) and mode c ( altitude ) codes in response to it being interrogated . the data output from the transponder may remain in the same format regardless whether the transponder is transmitting reply or altitude codes . to distinguish between reply or altitude codes , one has to know what type of interrogation that the transponder received and is replying to ( i . e ., mode a or mode c ). because the encoder feeds into the transponder as well as into the transmon device via an rf coupler , it can distinguish whether a mode a code is actually a mode a code and not a mode c code . this may be helpful insofar as when the transponder transmits either a mode a or c code , the format of the data is the same , but the transmon device can cross check using the encoder data . the transmon device does not listen to what interrogations the transponder is receiving because it would not know if it was intended for this specific transponder or for a transponder on another aircraft . accordingly , the transmon device must be clever to distinguish between the altitude code and the reply code and vice versa . because there is no difference in the output format between the mode a and the mode c codes , the transmon device may determine what is received based on several factors . the transmon device monitors the data being transmitted by the transponder . the transmon device may use a shielded “ antenna ” ( wire ), acting as an rf coupler , so that only certain transponder transmissions may be received . the transmon device does not disturb the existing transponder system so it may reduce costs . in one scenario , various a , b , c , and d bits may be transmitted by the transponder , and as such , 4096 possible codes may be emitted . mode a ( reply ) codes may use all 4096 possible codes while mode c ( altitude ) codes may require only 1280 codes . in this scenario , any code received by the transmon device that is not a valid altitude code may be considered a squawk code . the 1280 codes represent altitudes from − 1200 to 126 , 700 in 100 - foot increments [ 126 , 700 −(− 1200 )= 128 , 000 / 100 = 1280 ]. certain ads - b products ( such as the universal access transceivers [ uat ]) can only be used up to a certain altitude ( such as 18 , 000 feet ). accordingly , the altitude codes may be limited to those that would realistically be transmitted by the transponder , when a uat ads - b device is installed in an aircraft , so 1280 codes may be limited to 212 codes that may represent − 1200 up to 20 , 000 feet [ 20 , 000 −(− 1200 )= 21 , 200 / 100 = 212 ]. the final determinate to distinguish whether the transponder code is a squawk or an altitude code is to cross - check against the aircraft &# 39 ; s altitude encoder . the federal aviation administration ( faa ) requires that both the transponder and ads - b radios utilize the same altitude encoder . if the transponder code has not been ruled to be a squawk code by the above procedures , then a check of the altitude encoder against the code should identify whether it is an altitude code ( i . e ., it matches ) or a squawk code ( i . e ., does not match ). by using these procedures , the faa may be more likely to certify the transmon device . in another embodiment of the present disclosure , the output of the altitude encoder may be used to cross check to ensure that the mode a code is indeed the mode a code and not a c code that maps to an a code . it should be appreciated that embodiments of the present disclosure may provide the ability to discern a mode a from a mode c code without interrogating the transponder . this is a departure from previous devices that may interrogate a transponder in order to discern the mode a or mode c code received from the transponder . it also should be appreciated that different methods may be used to discern the mode a ( squawk ) from the mode c ( altitude ) codes , including using the altitude encoder connected to a transmon device to cross - check the altitude code coming from the received reply . if the altitude code matches with what the altitude encoder has read , then the code received is identified as an altitude mode c reply code , and any different code would be confirmed as a squawk mode a reply code . however , in some embodiments of the present disclosure , the altitude encoder cross - check mode may be eliminated but the two reply codes may still be accurately discerned . this may save the cost of installing a device to monitor the altitude encoder by the transmon device in certain aircraft . in another method , the two codes may be discerned by understanding how radars work . radars are all programmed to interrogate more mode a reply codes than mode c reply codes . using this information , if two different reply codes both map to an altitude , and an altitude cross - check is not used , then a situation may arise wherein the correct mode a may not be discerned from the mode c . however , by knowing that the radar interrogates mode a more times than mode c , the reply codes may be accurately identified . in embodiments of the present disclosure , an interrogated pressure altitude ( y ) over time ( x ) may be calculated for transceiver transmissions , such as for an ads - b transmitter , as depicted in fig3 . an atcrbs radar may interrogate a transponder and may provide pressure altitude output for air traffic control . the atcrbs may interrogate an aircraft transponder approximately every 12 seconds . it should be appreciated that the atcrbs may interrogate an aircraft transponder at predetermined points in time without departing from the present disclosure . it should further be appreciated that the atcrbs may interrogate an aircraft transponder for more or less than approximately every 12 seconds without departing from the present disclosure . it should be appreciated that the atcrbs may calculate a rate of climb ( roc ) by calculating a change of altitude between successive radar interrogations . the roc may be calculated by dividing time between successive interrogations and a change in altitude ( e . g ., δ altitude / time between interrogations ), wherein time between interrogations may typically be measured in seconds . this process may break down when using the interrogated transponder pressure altitude for ads - b . the ads - b transceiver output typically transmits aircraft information each second , and the atc may compute roc every second , expecting that ads - b transmitted pressure altitude may be updated every second . as the transponder interrogated pressure altitude may change every 12 seconds , the ads - b output transmitter may end up sending “ stale ” data for 11 out of 12 seconds , updating with the current pressure altitude once each 12 seconds . in embodiments of the present disclosure , corrected interrogated pressure altitude ( y ) may be calculated over time ( x ), as depicted in fig4 . a transceiver , such as an ads - b , may be a gps - based system and may include an ads - b output transmitter that may transmit an aircraft &# 39 ; s gps position and altitude . the gps may be utilized by the transceiver and may update the aircraft &# 39 ; s position in space at least every second . it should be appreciated that aircraft position may be updated any number of seconds using the gps without departing from the present disclosure . by using the gps altitude to correct the transponder pressure altitude , an accurate 1 - second updated pressure altitude may be transmitted via the output transmitter . it should be appreciated that utilizing an altitude sensor onboard a universal access transceiver ( uat ) or a transceiver may also update aircraft position in space at least approximately every second , even if a gps is not utilized . it should be appreciated that aircraft position must be updated any number of seconds using the altitude sensor without departing from the present disclosure . the gps altitude may be utilized to correct the pressure altitude provided by the transponder . it should be appreciated that a corrected pressure altitude may be accurate when the altitude is updated by the gps . the corrected pressure altitude may be transmitted via the transceiver output , such as , ads - b out . the atcrbs may interrogate a transponder , and a transponder monitoring device , such as transmon , may receive the transponder interrogated pressure altitude ( tipa ) or a first transponder interrogated pressure altitude . concurrently , the transceiver gps altitude or subsequent position may be saved approximately every second and may be designated by gpsa ( n ). it should be appreciated that the transceiver gps altitude or subsequent position gpsa ( n ) may be determined at any desired time increments without departing from the present disclosure . when the gps altitude is recorded at the same time as the atcrbs interrogates the transponder , this gps altitude or initial position may be designated by gpsa ( 0 ). during periods of time between the atcrbs transponder interrogations , the transceiver may transmit the corrected pressure altitude which may be calculated by adding the tipa and gpsa ( n ) and subtracting the gpsa ( 0 ) [ corrected altitude pressure = tipa + gpsa ( n )− gpsa ( 0 )]. for example , an aircraft may climb or ascend at a rate of 1000 feet per minute . before the aircraft ascends , the atcrbs radar may interrogate the transponder and the connected pressure altitude encoder which may provide a pressure altitude of 1000 feet . if the gps altitude or the initial position is approximately 900 feet , then the gps altitude may increase by a climb or ascend rate of approximately 1000 feet per minute or 17 feet per second . the transceiver may transmit the corrected pressure altitude , t ( n ), [ t ( n )= tipa + gpsa ( n )− gpsa ( 0 )] which may be approximately 1000 feet at zero seconds [ t ( 0 )= 1000 feet + 900 feet − 900 feet = 1000 feet ], 1017 feet at 1 second [ t ( 1 )= 1000 feet + 917 feet − 900 feet = 1017 feet ], 1033 feet at 2 seconds [ t ( 2 )= 1000 feet + 933 feet − 900 feet = 1033 feet ], etc . it should be appreciated that the pressure altitude and the gps altitude may be provided in any desired units of measurement . although the present disclosure and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the disclosure as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present disclosure . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps . | 6 |
the structure and method of fabrication of the present invention is applicable to a cable supporting and spacing device employing a solid plastic - like body , made from a plastic material , such as polypropylene foam , of the rigid variety , being substantially devoid of voids or cavities . such plastic material should possess good weathering characteristics , be resistant to ultraviolet rays , and be usable in a wide spectrum of ambient temperatures . in general , such solid plastic block should be provided having a pair of opposed troughs , each being located on opposite surfaces of the block , and each extending substantially parallel to each other and the longitudinal axis of the block , so as to form in cross section , a concave - like elongated pair of channels . one of the trough - like channels should have a smaller opening than the other , so that the smaller mouthed trough is useful in engagement with a small diameter supporting cable , such as a galvanized multi - strand bare steel wire assembly . the lowermost trough , when the device is positioned in a use position , contains a wider mouth opening of its trough or channel , than the uppermost trough . the operating cable or conduit , supported by the present invention , resides in the lowermost trough , such that the lowermost cable has its longitudinal axis extending parallel to the longitudinal axis of the lowermost trough and parallel to the uppermost trough whose longitudinal axis is parallel to the longitudinal axis of the supporting wire , partly nestled therewithin . a series of block - like devices are installed along a free run of supporting cable and useful or conduit or operating cable , so as to suspend the operating cable substantially parallel and directly below the supporting cable . in order to secure the assembly of a portion of the uppermost cable , and the block , to a portion of the lowermost cable , a metallic or other bendable - like band is employed . here , the band has provided , at one end , a belt - loop - like opening , fabricated from a rigid material . the belt - loop - like opening extends parallel to the width of the band and normal to the longitudinal axis thereof . the belt - loop - like opening has a width equal to or greater than the remaining width portions of the band , such that the free end of the band may be inserted into the belt - loop - like fitment and so that the end of the band carrying the loop - like end thereon may be positioned anywhere along the length of the remaining portions of the band when the free end of the band is passed through the loop - like opening and the band is pulled taut . in this position , the band portion extending outwardly from a closed loop formed by the band , may be bent so as to preclude the loop - like section of the band formed thereby , from enlarging . it is in such position that the band engages a small portion of the length of the supporting cable , two opposed faces of the block , and a small portion of the operating cable . the free end of the band may be bent backwards on the portion of the band encircling the two wire - like structures and the block . the two portions of the band engaging the opposed pair of faces of the block , should be positioned in juxtaposed spaced - apart relationship , and located parallel to one another , provided that both pairs of opposed lateral surfaces of the block , contacting the band portions , are in two planes -- parallel to one another . if desired , one or both of such opposed faces of the block , adapted to contact portions of the closed loop portion of the band , when tightened , may be grooved . when so grooved , the portion of the block having such a groove receives a portion of the band contacting the base of the groove . the groove is provided having a width somewhat larger than the width of the band , so that the band is positioned within the groove , prohibiting the band from side to side motion , as well as permitting the longitudinal axis of the band to be positioned other than transverse to the longitudinal axis of the block . in utilizing one or two band receiving grooves , the block is further secured against accidental dislodgment during the assembly process , thereby insuring that the entirety of the length of the block is positioned under the band and facilitating the tightening process of the band , at a selected location along the length of the operated cable and its supporting cable . the present invention also provides for at least two hook - like devices , which are positioned on one of the opposed lateral surfaces of the block , at locations along the line extending parallel to the longitudinal axis of the block . part of each of the hook - like devices extend over the area adapted for receiving the metallic band . the hook - like portions of the apparatus extend slightly over opposed marginal edges of the metallic band , facilitating the insertion of the metallic band by a simple application of an inward directed force , applied manually to the surface of the metallic band positioned between the pair of projections , when the metallic band is placed over the hook - like projections . a snap - in effect takes place , engaging the band then in contacting relationship with the portion of the block designed to receive the band when tightened . the hook - like projections may be positioned so as to have their hook - like ends extending over the groove that may be located in one or both sides of the body . in those cases where no groove is employed , the hook - like end of the projections is positioned at a location on one or both opposed side surfaces of the body , so as to substantially center the band along the length of the body . such pair of opposed surfaces extend substantially parallel to the longitudinal axis of the body and may extend intermediate the uppermost and lowermost supporting and supported cable receiving trough - like grooves . in an alternate embodiment , the band itself may be provided having a pair of notches located on opposed marginal edges thereof , at opposite locations , adjacent the free end of the band . in such construction , the band may be attached to the block by simply positioning the notch bearing portions of the band over the hook - like pair of projections . a modest force applied to the outside surface of the band causes the band to communicate with one of the side surfaces of the body , without requiring any flexure of the band . lateral displacement of the band , disposing the pair of notches out of alignment with the two hook - like projections , prevents the band from accidental dislodgment thereafter . this arrangement may be employed for blocks that are provided with band receiving grooves or for blocks that do not utilize such grooves . the modified band , containing the pair of notches , after engagement with two hook - like projections on one opposed side surface of the block , may be manipulated so as to position the opposed notch - bearing portions of the band , located near its free end , so as to be over another pair of hook - like projections , located on the opposed side surface of the block . in such application , the band will ultimately reside in two captured positions , on opposite sides of the block and may not be removed therefrom excepting by positioning the notches at the locations of the pairs of hook - like projections . the projections may be shaped so as to resemble an l - shaped body , the free leg of which is chamfered on its uppermost and endmost surfaces , facilitating the easy insertion and hence -- the difficult removal of the band under the hook - like end of such projection . alternatively , a disc - like projection may be employed , simulating a flat disc residing on a post . the uppermost edge of the flat disc , adjacent the perimeter of the disc , is chamfered , again facilitating the easy insertion and difficult removal of the band adapted to be captured under the lateral surface of the disc - like structure and the solid plastic body . alternatively , the hook - like projection may be resemble a semi - circular plate portion secured to a post portion , where the uppermost marginal edge of the semi - circular disc portion is chamfered . all of the aforementioned chamfered hook - like projections may be utilized on opposed side surfaces of a body , wherein such body is provided with or without a groove . now referring to the figures , and more particularly to the embodiment illustrated in fig1 showing the present invention 10 comprising body 12 to which is attached strap or band 14 . end 16 of band 14 is attached to loop 18 , in which portion 20 , of band 14 , passes . portion 20 of band 14 resides over portion 22 , of band 14 , which is located adjacent end 16 of the band . surfaces 24 and 26 of body 12 are disposed opposite one another . uppermost trough 28 extends parallel to longitudinal axis 30 of body 12 . lowermost trough 32 also extends parallel to longitudinal axis 30 . body 12 , as shown , is fabricated from a solid material , as by foam in place molding techniques . band 14 , in the regions depicted by 34 and 36 form a closed loop , engaging a portion of supporting cable 38 and a portion of supported cable 14 , as well as encircling body 12 . supporting cable 38 , as shown , may be fabricated from a group of solid steel cables , plated to resist rust and oxidation . the uppermost edges of the clamped portion of supporting cable 38 are forced downwardly into trough - like groove 28 , by band 14 . similarly , the uppermost portions of supporting cable 40 are pushed into the narrowest regions of trough - like groove 32 by band 14 . as can be seen , both trough - like grooves 28 and 32 are provided having open mouth portions 42 and 44 respectively , each being substantially larger than required for cable 38 and supported cable 40 . this is so , to permit larger diameter supporting cables 38 and larger diameter supported cables 40 over those shown , to be utilized by the same apparatus . block 12 is provided having groove 46 disposed in side face 24 . hook - like projections 48 extend over the open mouth region 50 , of groove 46 , and over portions of band 14 , preventing the release of band 14 from groove 46 . free end 52 of band 14 extends outwardly from the loop - like receiving portion 18 , located at end 16 of band 14 . free end 52 may be bent upwardly , away from open mouth portion 44 of lowermost trough - like groove 32 , preventing lowermost supported cable 40 , as well as uppermost supporting cable 38 from their locked - in positions in their respective trough - like grooves . fig2 illustrates base 54 of groove 46 partially concealed by hook - like projections 48 . dotted lines 56 delineate the base of trough - like groove 28 . similarly , dotted lines 58 delineate the base of trough - like groove 32 . as shown in fig3 block 12 is provided having a groove 46 located in opposed side faces 24 and 26 , each being provided with a pair of projections 48 . as can be seen in fig4 projections 48 are provided having a ramped - like surface 60 disposed on its outermost surface extending at an angle relative to opposed sides 24 and 26 , of projections 48 . notch 62 is adapted to receive portions of band 14 , shown in fig1 therewithin . fig5 illustrates block 12a , an alternate embodiment of block 12 , shown in fig1 . such block is provided having uppermost trough - like groove 64 and lowermost trough - like groove 66 . dotted lines 68 depict a band receiving groove 70 , located in opposed side wall 72 . opposite side wall 74 is provided with outstanding hook - like projection 76 , shown partially capturing a portion of band 14a therewithin . fig6 illustrates two hook - like projections 76 located on surface 74 of block 12a . dotted lines 78 depict the base of the trough - like groove 64 . dotted lines 80 depict the base of trough - like groove 66 , shown in fig5 . fig7 illustrates base 82 of groove 70 , as viewed from the side of block 12a having opposed side wall 72 . the lowermost broken away portion 84 , of band 14a , is shown extending below body 12a . fig8 illustrates a typical side wall , herein shown as surface 74 . l - shaped projection 86 extends outwardly from surface 74 and is provided having a chamfered surface 88 extending between outermost surface 90 of the l - shaped hook - like projection 86 and the lowermost surface 92 , of the free leg of such projection . cavity 94 , so formed , permits the introduction of a portion of band 14a , therewithin , and for retention in cavity 94 by having a marginal edge of band 14a displaced downwardly , along ramp surface 88 , and followed by such marginal edge being captured within cavity 94 . fig9 illustrates an alternate embodiment of a surface mounted projection 95 , similar to projection 86 , and serving the same purpose . chamfered edge 98 extends around the plate - like perimeter of projection 95 and provides a hook - like shape 100 , by the overhang of the disc - like portion over post - like portion 102 . as can be seen , post - like portion 102 may be mounted to an outside surface 74a , of a side surface of block 12a , which is provided with an elongated groove 104 . such elongated groove is provided having side wall 106 . side wall 106 may be equal to or lesser than the thickness of a band , not shown , utilizable for insertion under the disc - like portion of hook - like projection 95 and for capturing on engaging surface 108 -- the base of groove 104 . fig1 illustrates a semi - circular disc - like portion 110 of hook - like projection 112 , being supported on post - like portion 114 . surface 74 and undersurface 116 , of disc - like portion 110 , form opposed lateral surfaces for retaining a portion of band 14a , not shown , thereinbetween . the band portion , not shown , cannot move unlimitedly in the direction of arrow 118 , before same is stopped by post portion 114 . fig1 illustrates block 12b , being a variant of block 12 , shown in fig1 . block 12b is identical in all respects to block 12 , excepting that projections 48a are devoid of the ramp - like surfaces , disposed adjacent to outermost surfaces 24 , shown in fig4 as surface 60 . in fig1 , projections 48a are simply rectangular in shape , extending partly over groove 46 . band 14a , shown in fig1 , is different from band 14 , as shown in fig1 in that free end 120 is shown having ramped - like edges 122 and is provided with notches 124 disposed opposite one another on opposed marginal edges 126 of band 14a . notches 124 are provided having an open mouth portion 129 and a base portion 128 . open mouth portion 129 and base portion 128 are designed to be longer than length 130 of projections 48a . in all other respects block 12b and band 14a are equivalent to block 12 and band 14 -- shown in fig1 for the side 24 . fig1 illustrates block 12a , showing projection 48a being depicted by dotted lines 48b . side face 26 is shown devoid of projections but is provided having groove 46 . groove 46 is provided for side face 24 . band 14a is shown having its free end 120 and its broken end 132 located a distance away from surface 24 . by moving band 14a , in the direction of arrows 134 , it can be seen that band 14a communicates with surface 136 of projection 48a . by approximate alignment , in the direction of arrows 138 , band 14a may have the base of notches 124 , shown as solid lines 128 , aligned outwardly from the ends of projection 48a -- depicted in fig1 by dotted lines 48b . when this occurs , continued moving force , exerted in the direction of arrows 134 , permits innermost surface 140 , of band 14a , to contact base surface 54 of groove 46 . in such position , not shown , by a movement of band 14a , in the direction of arrow 142 , the band becomes locked in by projections 48a and base surface 54 within groove 46 . fig1 illustrates block 12a , showing band 14a in upside down relationship to band 14a , as shown in fig1 . in this position , it can be seen that notches 124 are aligned with projections 48a . band 14a can then be moved in the direction of arrow 144 , if desired . the direction of inserting band 14a , as shown in fig1 , ends up in the configuration of band 14a , as shown in fig1 . fig1 illustrates how projections 48a may be utilized when it is desired to install band 14a in an opposite direction . block 12a , depicted in fig1 , 12 and 13 , may be equipped , as desired , with another pair of projections 48a , disposed on opposite side face 26 , if desired . if such be the case , band end 120 , of band 14a , may be installed in projections 48a associated with side face 26 , by overalignment , over projections 48a , not shown , followed by an inward force directed in the area intermediate notches 124 . alternatively , for the second groove associated with side face 26 , free end 120 of band 14a may be threadingly engaged beneath projections 48a . one of the advantages of the present invention is a cable supporting and spacing device which is easy to install , in field applications , without the use of tools and without requiring the installer to perform complicated manual maneuvers during the installing process . another advantage of the present invention is an inexpensive cable supporting device which is capable of maintaining the spacing insulated block in a defined parallel arrangement with the two cables associated therewith , before and during the installing process . still another advantage of the present invention is a cable spacing device employing two smooth trough - like surfaces to engage opposed cables and conductors , thereby eliminating sharp edge contact with the cables . yet another advantage of the present invention is a unitary cable supporting and spacing device which positions its associated encircling band automatically at the correct location , insuring that the spacer and the cables are disposed in parallel relationship at all times . a further advantage of the present invention is a cable supporting and spacing device which can be easily molded , inexpensively manufactured , and is not fragile in its construction . thus , there is disclosed in the above description and in the drawings , an embodiment of the invention which fully and effectively accomplishes the objects thereof . however , it will become apparent to those skilled in the art , how to make variations and modifications to the instant invention . therefore , this invention is to be limited , not by the specific disclosure herein , but only by the appending claims . | 7 |
a preferred embodiment of the invention can be seen in fig1 in which a perspective overall view of the apparatus 10 can be seen . the apparatus includes various sub - systems including a vacuum frame 20 , a power supply 30 , a filter assembly 40 , a light head 50 , and an integrator 60 . the various subsystems will be discussed in turn . the assembly 10 includes a base 11 from which uprights 12 extend supporting the light hood 50 which in turn supports the filter assembly 40 . a chest of drawers 13 is provided in which exposure materials can be stored for ready accessibility . a curtain rod 14 is provided supporting a curtain 15 which can be closed to exclude ambient light from the vacuum frame 20 . base 11 also supports power supply 30 . the vacuum frame 20 can be any of various types known in the art , although a particularly preferred embodiment is the structure disclosed in u . s . pat . no . 4 , 754 , 309 , referred to above . the entire disclosure thereof is incorporated herein by reference . controls for the operation of the vacuum frame are included in the integrator 60 or may be automated , as disclosed further in this discussion . the power supply 30 may be seen generally in fig8 and electrically in fig2 and 3 . the power supply includes components for monitoring and adjusting line voltage and providing desired lamp open circuit voltage , current limiting impedances an scr assembly for lamp dimming , ac capacitors for power factor correction , a control board for logic and power control , and an interface board for data collection and user interfacing . power supply 30 includes a connection 301 to an external ac power source . in the embodiment depicted , that is a 220 volt , 3 - wire source . the power is supplied through a circuit breaker 302 to the control board 303 . it is also applied to center of transformer 304 . the voltage is applied at 305 and 306 as can be seen in fig3 on the board 303 , to comparators 307 and 308 . they also receive a sample voltage reference . the output of the comparators is used to set a flip flop 312 which in turn controls a relay driver 313 . relay 309 ( fig2 ) switches the line voltage from the 230 volt tap of transformer 304 to the 210 volt tap if the voltage sensed in comparators 307 and 308 suggest that the voltage is too high . conversely , if the voltage is too low , it will retain the voltage at the 230 tap . a capacitor 310 is provided to reduce arcing of the relay and to provide a source of energy during commutation of the relay . relay 309 can be conservatively sized , because of the capacitor 310 . although the foregoing example was described with respect to a 230 volt 3 - wire supply , other similar arrangements can be used with other supplies . the main contactor for the lamp 501 is driven by a contactor driver 318 which in turn is controlled by and - gate 315 . and - gate 315 requires high inputs from delay 314 , the power &# 34 ; on &# 34 ; switch 316 and interlock 317 to enable the contactor driver 318 . interlock 317 detects the presence of a protective pane in the light head , as will be discussed further . thus , the pane must be in place and the power on and the line voltage set in order to operate the main contactor . the power &# 34 ; on &# 34 ; signal 316 may be derived from the memory set in the integrator discussed below . an additional delay 314 is interposed and feeds and - gate 315 along with the power &# 34 ; on &# 34 ; switch 316 and the line from interlock sensor 317 , also seen on fig5 . the contactor actuation allows power flow from the mains to the lamp . the lamp 501 is typically a gaseous discharge lamps which starts with an extremely high voltage pulse , typically 10 kilovolts . after a current is struck , the lamp voltage drops to approximately 30 volts and then slowly increases to its nominal voltage . the voltage drop across the lamp 501 is sensed and applied to a summing differential amplifier 319 , a comparator 320 and another summing differential amplifier 321 . a reference voltage comparable to the operating voltage of the lamp 501 as warmed up is also applied to the comparator 320 . the output of comparator 320 goes low when the lamp voltage reaches its operating voltage and is applied to the summing differential amplifier 319 so that when the lamp voltage is at its operating voltage , the lamp voltage and the sensed lamp current 322 are multiplied in multiplier 323 . that product is applied to a further summing differential amplifier 324 along with the output of the comparator 320 and a signal 325 indicative of desired power level to operate the lamp 501 as recorded in the integrator discussed further with respect to fig9 . the stability of the closed loop feedback circuitry is maintained with compensation unit 326 . this signal is applied to a gate driver 327 of the lamp scr &# 39 ; s 328 . that is , the gate driver 327 controls the firing angle of the scr &# 39 ; s 328 in the forward and reverse directions to control the amount of power going to the lamp 501 . the circuit works to keep the power supplied to the lamp constant at the set point , regardless of voltage changes . the power monitoring to the lamp is achieved by obtaining the average and comparing it with a reference from an integrator to shift the phase of the firing angle of the silicon control rectifier . the reference is fed with a pulse width modulated signal . no direct electrical connection is needed because the signal is electrically isolated and sent through an optical coupling . the power supply to the lamp includes a inductor l - 1 which is parallel with the scr to maintain the current to the lamp at at least 10 % of maximum . during the starting process , it is undesirable to operate the lamp in a constant power mode , since the demand for current would be beyond the limits of the lamp . to circumvent this situation , a constant offset is added to the lamp voltage to operate the lamp in a constant current mode . after the lamp voltage exceeds the warmup reference as noted by the comparator 320 , the constant offset is removed and the lamp is allowed to operate in a constant power mode under the control of the summing differential amplifier 324 serving as an error amplifier . the sample lamp voltage as applied to the summing differential amplifier 321 converts the voltage according to an inverse relationship to control a blower driver 329 to control the triac to the blowers 330 in the head as shown in fig2 . a motor speed control circuit suitable for use as the blower control is described in a copending application of ira pitel filed on even date herewith and entitled &# 34 ; burst voltage motor speed control &# 34 ;. the entire disclosure thereof is incorporated herein by reference . that circuitry has the power controlled by short bursts of an integral number of fundamental cycles &# 34 ; on &# 34 ; and a short number of cycles &# 34 ; off &# 34 ;. the voltage burst is initiated at strategic points in the cycle to minimize the electrical and mechanical transient response . this minimizes power loss and abrupt torque changes . by providing the blower control as responsive to lamp voltage , it is also responsive to lamp temperature . thus , controlling the blower speed with the lamp voltage allows the lamp to remain at higher temperatures during an idle state and to rapidly set maximum luminous intensity during normal full output state . that is , the lamp can have its power reduced between illumination cycles . however , the temperature will remain near its desired level because the fan speed will be reduced if the voltage drops , so that the temperature will not drop too far during off cycles . the blower driver 329 is also controlled by the error amplifier 321 to operate the blower on high speed when the power &# 34 ; on &# 34 ; switch 316 is switched off . this permits rapid cooling of the lamp so that if lamp changing is the reason for turning off the power , it can be changed as quickly as possible . also , if it is desired to restart the lamp , rapid cooling brings its temperature back down to the range in which it can be restarted . the shutter 502 shown in fig5 and 6 in the light head 50 is driven by a motor 503 in response to signals from the control board 303 . a shutter enable signal 331 is applied with the interlock signal 317 and the inverse of the warmup complete signal from comparator 320 in an and - gate 330 . that signal is applied to a delay 332 to permit time for the lamp power to increase to its operating level and for lamp operating temperature to increase to its desired level before opening the shutter . upon expiration of that delay , that signal and the shutter sense signal 504 indicative of a closed shutter are applied to and - gate 333 which sets a flip flop 334 applying to or - gate 335 . the output of or - gate 335 is applied to and - gate 336 which also receives the delay signal from delay 314 indicative that the tap change has been completed . the and - gate output is applied to the shutter motor drive 337 to drive a triac 338 to drive the shutter motor 503 . the motor will drive the shutter until a cam on the shutter senses the full open position and reverses shutter sense 504 , which resets the flip flop 334 to stop the motor . it also resets flip flop 337 . upon receipt by the reset flip flop 337 of a set signal from and - gate 338 of signals inverse to those applied to and - gate 333 , the motor is again driven to shut the shutter . the inverse signal from and - gate 338 will be applied to flip flop 337 when a shutter close signal is applied to shutter line 331 . upon extinguishing the power &# 34 ; on &# 34 ; signal 316 , an inverse signal is applied to three minute timer 339 through not - gate 340 . that signal is applied to and - gate 341 along with the interlock sense 317 . when both interlock and the inverse signal from the timer 339 are low , the output of and - gate 341 is applied through data selector 342 to close the shutter . this prevents access to the lamp when interlock senses that the protective pane is out of place or while the power is on , or for three minutes thereafter , in order to prevent accidental touching of the extremely hot lamp or the energized electrodes . fig2 and 8 also illustrate a very convenient feature of the invention -- chainable control lines . the control unit , in large part the power supply of fig8 controls various remote units such as the filter assembly 40 and the light head 50 and does so with cabling with is conveniently installed by a customer on his or her own premises . it has been found in the past that such cabling can be confusing to novices , and the present invention provides a fail - safe way to provide such cabling . first , as can be seen in fig8 there are four physically identical but electrically different pin sockets 343 . identical pin sockets are provided on the remote units to be controlled and cabling is provided to extend between the pin sockets 343 and the remote sub - system unit to be controlled . thus , any cable can be used to extend from the pin sockets 343 to the pin sockets on the remote unit . if , however , the remote unit is improperly selected , nothing undesirable will happen . the reason for this is that only one of the leads of each of the pin sockets 343 is provided with a connection to an associated signal or power source . a similar configuration is use in the subsystem unit . thus , by making the connections in the main unit and subsystem units in the factory so that they agree with each other , but not with any other unit , a mistake in connecting pin sockets with the cables will not result in any electrical connection being made . the user will find his error by the non - functioning of the equipment and be able to readily reconnect the units as designed . further , this principle may be generalized for remote unit connections as seen in fig2 . a plurality of connections are provided between the power supply and the filter unit and also the apc 1 board in the apc1 assembly . the apc 1 board is provided with dipswitches which can be selectively actuated to make a desired one of the leads active . thus , the signal derived from the power supply by the apc1 assembly from this connection can be used to switch on or off the input power from a 120 volt source to a vacuum pump . that is , the control signals are used to actuate or not , as desired , the power to the vacuum pump . also can be seen in fig8 the hours used on any particular lamp can be recorded in a readable fashion on a lamp power reader 344 . the reading can be reset to zero with a reset button 345 when a lamp is changed so that an accurate reading of the age of the lamp in use can be determined . the lamp idle power ( i . e . the power supplied to the lamp to keep it hot during non - use ) can also be selected using a selector switch 346 . the electronic circuitry of the control board can be used to reduce the duty cycle of the scr &# 39 ; s 328 from full power ( i . e . 7500 watts ) to lesser values in increments of 100 watts by selectively gating the scr &# 39 ; s to make them conductive for that portion of the sinusoidal power input cycle as needed to achieve the desired power to the lamp . the power monitoring circuitry as disclosed maintains the power supplied to the lamp at the desired value . referring now to fig4 there is shown in a perspective view , partially broken away , the filter assembly including a housing 401 . housing 401 has a plurality of ( at least three ) pairs of opposed channels 402 . the channels 402 on one side of the housing 401 are provided with a pair of pulleys 403 and 404 , a movable frame 405 and a cable 406 . the cable is preferably an aircraft cable such as is used to operate the control surfaces of aircraft , although any suitable cable could be substituted . each frame 405 can removably support a filter 404 . it does so by receiving an edge of the filter in an inwardly facing channel of the frame which also has a spring . the filter can be pressed against the spring and have its opposing edge inserted into an opposing channel so that the relaxation of the compression of this spring will lock the filter in place between the opposed channels of the frame 405 . each of the frames 405 can be independently positioned in alignment with the light head 50 . alternatively , multiples of them can be positioned simultaneously to achieve the filtering of the light emanating from head 50 as desired . the housing 401 is also provided with limit switches 407 at opposed ends of the housing , one for each end of the opposed pair of channels . upon closing of the limit switch 407 by the positioning of its associated frame 405 thereagainst , the position of the frame can be sensed electrically . with reference to fig4 a , the operation of the positioning of the filters can be better seen . the cable 406 includes in its length a spring 409 . also , the cable 406 is wrapped once around a sheave driven by a motor 410 . thus , the energization of the motor in one direction will rotate the sheave and drive the cable 406 , which in turn moves the frame 405 . when the frame 405 reaches an extended position , to either side of the frame 405 , the associated limit switch 409 is closed . the sensing of the closure of such switch stops the motor and holds the frame in position . when it is desired to move the frame the opposite direction , the motor is reversed and the frame moves until the other of the limit switches 407 for that frame senses the reaching of the frame at its most extended position . the presence of spring 409 in the cable line limits the tension in the cable . thus if a person &# 39 ; s hand is in the way of the frame , the cable can slip around the rotating sheave 408 and not crush the hand . similarly , if for some reason the motor becomes inoperative , the reduced tension in the cable permits the frame 405 to be moved by hand with the cable merely slipping around the motionless sheave . the light source for the apparatus 10 is included in the light head 50 as seen in fig5 and 7 . it includes a housing 505 having mounted on either end ( only one is shown in fig5 ), a cooling blower 330 mounted so that its discharge is somewhat at an angle to the axis of lamp 501 . the lamp 501 is supported in a conventional lamp support 507 affixed to a reflector 508 , all of which are affixed in turn to a bearing 509 having a passageway aligned with the length of the lamp 501 . the bearing 509 is affixed to end wall 510 of the light chamber . the housing 505 has mounted in it a main reflector 511 of a dimpled specular material . the reflector is supported in opposite channels 512 , 513 of the housing 505 . the channels are provided with side openings 514 , to chambers 515 which in turn have openings 516 through which hot air may escape . thus , the air forced axially along the lamp 501 at an angle from the blower 330 swirls around the lamp 501 in a helical pattern to provide effective , uniform cooling and then passes outward into the interior of the main reflector 511 , out through openings 514 , 516 . it can also pass in the space between the housing 505 and the main reflector 511 to chamber 515 and out the opening 516 . the use of the helical or cyclonic air flow obtained by the use of the present invention reduces the power demands on the blower motors . thus , instead of needing conventional 750 cfm motors , a 300 cfm rated motor suffices to adequately cool the lamp . also , the helical airflow assures more even exposure , more uniform temperature over the lamp and , therefore , less preferential depositing of dopants . the end result is longer useful lamp life . as noted above in the power supply discussion , the blower speed is desirably controlled to maintain the lamp temperature at a desired set point by correlating blower speed with the voltage across the lamp , which is indicative of lamp temperature . bearings 509 support the end faces of shutter 502 by outward engagement with roller bearings 518 , 519 , 520 . roller bearings 520 ( one in each end of the shutter ) are supported in the shutter 502 by compression springs 521 while the other roller bearings are at fixed positions . the shutter thus is supported by the bearing 509 , but has some free movement because of the spring 521 . this movement is necessary to accommodate changes in dimensions caused by the extreme heat environment to which the components will be exposed . the shutter relationship to the lamp can be seen better in fig7 in which the bearing 509 is shown secured to an end wall 510 of the housing 505 . the reflector 508 is shown secured to the bearing 509 and having the lamp support 507 supported thereon . to one end of shutter 502 is affixed a cam ring 522 having a cam 523 as a portion thereof . the cam ring 522 has a shutter position switch 504 adjacent thereto supported in the housing so that , upon rotation of the shutter , the cam 523 can actuate the shutter position switch 504 . the actuation of switch 504 sends the signal to the and - gate 333 and flip - flop 334 referred to with respect to fig3 . affixed to the other end of the shutter 502 is a gear 524 about which a chain is applied to be driven by the shutter motor 503 actuated by triac 338 referred to with respect to fig3 but not shown herein . the mechanical apparatus of fig7 is thus controlled by the electronics of fig2 and 3 . the shutter 502 is made of a steel base with a black ceramic coating . the black ceramic coating is provided because of the extreme range of temperatures to which the shutter is exposed being in close proximity to the high temperature lamp . the black ceramic does not deteriorate at the range of temperatures and therefore maintains its light - absorbing power long after previously used materials would have deteriorated . blackened portions 517 of such ceramic coating are preferably affixed to the reflectors 511 and 508 proximate the mid - portion of the lamp 501 to attenuate the reflected light in that region since the mid - portion of the lamps tend to be hot spots . the absorption of light by the blackened portion 517 compensates for the hot spots . opposed channels 520 and 521 formed in the head across from one another selectively support pane 522 , typically of a material which filters out dangerous uv - b rays . the pane 522 is secured in position by a leaf spring ( not shown ) in one of the channels , which urges the pane to stay in place until the spring is compressed for pane removal . the presence of the spring is sensed by a switch 317 which generates the interlock signal referred to in connection with the power supply discussion . fig9 shows the keyboard 601 of the integrator 60 of fig1 . the details of the integrator circuit and its programming will be dispensed with in the interest of clarity and brevity , particularly since those of ordinary skill in the art can readily come up with such details once the mode of operation as disclosed herein is made known to them . as can be seen in fig2 the data entered on keyboard 601 is applied to a digital board 602 and from there to an analog board 603 . one of the main features of the keyboard and digital board are the input and storage of programs for the sequencing of the operation of the entire apparatus . the keyboard 601 includes a first group of function keys 604 , a second group of function keys 605 , a group of numeric keys 606 , a plurality of signal lights 607 , and readouts 608 . the keys and lights can be used to program routines for operation of the apparatus and store them in memory and then , as desired , selectively operate the equipment according to a recorded memory sequence . programming is initiated by pressing the key labelled &# 34 ; m - set &# 34 ;. then a numeric program number from 1 to 99 is entered via the numeric keypad followed by the &# 34 ; enter &# 34 ; key to store the program number which is displayed at the memory readout . this number can then be used to recall and act on information in the memory location entered . the &# 34 ; enter &# 34 ; button stores program information that has been selected in a program function via the numeric keypad . upon pressing the &# 34 ; focus &# 34 ; button , the signal light labelled &# 34 ; exposure &# 34 ; under the phrase &# 34 ; program sequence &# 34 ; will illuminate , the shutter will open and the exposure lamp will illuminate to the wattage previously selected on the pwr - set mode . this function permits photocell ( i . e . photocells 21 , 22 , and 23 of fig1 ) calibration to a specific wattage . if no wattage is selected , the exposure lamp will automatically illuminate to 500 watts . to turn off the focus mode , press cancel . upon selecting the function key &# 34 ; esp - set &# 34 ;, the expose signal light on the memory signal light panel will flash . the operator is then able to select an exposure in units from 00 . 1 to 999 . thus , this gives the operator extended flexibility in selecting exposure time . upon pressing the pwr - set function button , the signal light labelled &# 34 ; power &# 34 ; on the memory signal light panel will flash . the operator is then able to make a power selection by entering the desired wattage in kilowatts via the numeric keypad . after the desired wattage has been selected , the &# 34 ; enter &# 34 ; key is pressed to store this value . during program operation , the power selected in the power set mode is the data entered on the power set line 325 of fig3 . by pressing the &# 34 ; delay &# 34 ; function button , the delay signal light on the memory signal light panel flashes and the operator is able to select a specific vacuum delay time from 00 . 1 to 999 seconds . the &# 34 ; inspect &# 34 ; button is used in conjunction with the delay mode . by pressing the &# 34 ; inspect &# 34 ; button , the inspect signal light on the memory signal light panel illuminates . this enables the operator to inspect the vacuum chamber evacuation before the exposure starts . to continue the exposure , the operator must press &# 34 ; start &# 34 ;. if a problem is found with the vacuum chamber evacuation , &# 34 ; cancel &# 34 ; may be pressed and the program returns to the beginning of the exposure program and the vacuum pump is shut off . the &# 34 ; cancel &# 34 ; button can be used to cancel exposure before it is complete . to reset the integrator after an exposure program is completed as well as to reset the count mode and the focus mode , when they are selected . the &# 34 ; start &# 34 ; button is used to initiate exposure programs and to reset the integrator after the exposure program is completed . by pressing the &# 34 ; 1 / 10 &# 34 ; button , the operator can select an exposure setting or delay time to tenths of units or seconds . that is , when &# 34 ; 1 / 10 &# 34 ; is depressed , a decimal point of a numeric value being changed moves one digit to the left . upon pressing the &# 34 ; count &# 34 ; button , the operator can see the sum of completed exposures from all exposure programs . to retain the total memory after inquiry , press &# 34 ; enter &# 34 ;. to reset the count to zero , press &# 34 ; cancel &# 34 ;. pressing the &# 34 ; lock &# 34 ; function key illuminates the &# 34 ; lock &# 34 ; signal light on the constant signal light panel . this will disable the numeric keys as well as the filter key , the time / integrate / quartz key , the output key and the a - step key . these keys can be unlocked by pressing &# 34 ; lock &# 34 ; a second time . by pressing the &# 34 ; m - step &# 34 ; key , the operator will be able to sequentially scroll through the program channels and program number will be displayed on the readout 608 . by pressing &# 34 ; a - step &# 34 ; once , the &# 34 ; auto &# 34 ; step function is activated , and the &# 34 ; a - step &# 34 ; signal light on the memory signal light panel will illuminate . this function allows the operator to make the integrator proceed to the next consecutive exposure program channel when it completes an exposure program that has a step function selected . by pressing the &# 34 ; a - step &# 34 ; button once more , the continuous vacuum function will be activated and the &# 34 ; cont vac &# 34 ; signal light on the memory signal light panel will also illuminate . this continuous vacuum function allows the operator to maintain a vacuum drawdown between auto step exposures . thus , if desired , the same negative and light sensitive material could be used with two different filter settings or power exposures or whatever is required to expose the materials . pressing the &# 34 ; filter &# 34 ; function key selects a filter or combination of filters that can be stored in an exposure program . upon execution of the exposure program , the appropriate filters will move into position before the exposure begins . by repeatedly pressing &# 34 ; filter &# 34 ;, the operator can select the desired combination of filters . assuming the filters are identified as filters a , b and c , logic pattern for filter selection is : a ; b ; c ; ab ; ac ; bc ; abc . during the selection process , the appropriate signals lights for the selected filter will illuminate on the memory signal light panel . exposures may need to be changed due to variables in film speed , chemistry , number of overlays , or as an option by the user . these changes are known to the art as compensations , and the present invention permits compensation to be accomplished in percentages or log density . upon selecting the &# 34 ; comp - set &# 34 ; function key , the &# 34 ; comp &# 34 ; signal light on the memory signal light panel flashes and the readout reads . 00 . the &# 34 ; density &# 34 ; signal light also illuminates . by pressing the &# 34 ;% d &# 34 ; button , the signal light display will read 00 . and the % signal light will illuminate . note that the % and &# 34 ; density &# 34 ; signal lights are located on the constants signal light panel . a compensation value may be entered via the numeric keypad by entering the digits and then depressing &# 34 ; enter &# 34 ;. when a compensation has been entered , the &# 34 ; comp - led &# 34 ; on the memory signal light panel will remain illuminated along with either the &# 34 ;%&# 34 ; or &# 34 ; density &# 34 ; signal light on the constants signal light panel . to clear a compensation value , select &# 34 ; comp &# 34 ; and enter &# 34 ; 0 &# 34 ; as a value , then press &# 34 ; enter &# 34 ;. while in the compensation mode , whether it be &# 34 ;%&# 34 ; or &# 34 ; density &# 34 ;, depressing the &# 34 ;-&# 34 ; button switches the entered compensation value to a minus value . once the compensation mode has been selected , the % density mode of compensation can be selected by pressing the &# 34 ;% d &# 34 ; button . this converts the value shown in the readout from a % to a density . for example , if 0 . 4 is entered as a density and the &# 34 ;% d &# 34 ; button pressed , the value changes to 10 %, with &# 34 ; 10 &# 34 ; showing in the readout display . then , pressing &# 34 ; enter &# 34 ; adds the selected value to the exposure program . thus , if a 10 second exposure is programmed and &# 34 ; start &# 34 ; is pressed , the count will begin at &# 34 ; 11 &# 34 ; so that the exposure is 10 % greater than was originally programmed . while still in the compensation mode , if the &# 34 ;-&# 34 ; button has been pressed , the example exposure would have started at &# 34 ; 9 &# 34 ;, 10 % less than the selected exposure . upon initially powering up the apparatus , the &# 34 ; integrate &# 34 ; mode will be automatically selected as indicated by illumination of the &# 34 ; integrate &# 34 ; signal light on the memory signal light panel . the &# 34 ; integrate &# 34 ; function provides consistent exposures by compensating for power fluctuations as well as lamp deterioration . it does so by evaluating the light as actually received on the vacuum frame 20 , particularly as measured by photocells 21 , 22 , 23 and identified in the keyboard as probes a , b , and c . the &# 34 ; integrate &# 34 ; mode of operation allows the operator to select light units of up to 999 units , by tenths of a unit if necessary . the invention permits the integration mode to be selected for each exposure . thus , by pressing the &# 34 ; t / i / q &# 34 ; button once , the quartz mode will be selected and both the &# 34 ; time &# 34 ; and &# 34 ; integrate &# 34 ; signal lights on the memory signal light panel will be illuminated . the quartz function is designed to be used in conjunction with a quartz halogen light source . in the quartz mode , the electronics continuously samples the voltage to the lamp and integrates it and selects the exposure to terminate when a desired integrated value is reached . if the voltage is low , the length of the exposure will be extended to compensate for the relative dimness of the lamp . the inverse is true if the voltage is high . by pressing &# 34 ; t / i / q &# 34 ; button once more , the time mode will be selected and the &# 34 ; time &# 34 ; signal light on the memory signal light panel will be illuminated . in the &# 34 ; time &# 34 ; function , the operator selects exposure times in seconds from a tenth of a second up to 999 seconds . in the &# 34 ; integrate &# 34 ; mode , the exposure is calibrated using the light impacting on one of the probes . the &# 34 ; probe &# 34 ; button allows the operator to select which of the three probes is to be used as the reference to be integrated . upon initial power - up , the integrator automatically selects &# 34 ; probe a &# 34 ; and the probe a signal light on the memory signal light panel is illuminated . by pressing the &# 34 ; probe &# 34 ; button once , &# 34 ; probe b &# 34 ; is selected and its signal light is illuminated . a third pressing results in the selection of &# 34 ; probe c &# 34 ; and illuminating of its associated signal light . the &# 34 ; save &# 34 ; button actuates a function to save all specific information that has been selected for the exposure program . when building an exposure program , &# 34 ; save &# 34 ; must be pressed before leaving the program channel or the information entered will be lost . when the &# 34 ; dim &# 34 ; button is pressed , all of the signal lights on the integrator extinguish ; pressing that button again reilluminates all signal lights appropriate for the stage of operation . this provides reduced illumination for particularly sensitive materials . the control panel is also provided with a vacuum regulator to control the level of vacuum in the exposure chamber and a vacuum gauge to measure the same . a vacuum switch is provided to provide for manual operation . also provided is a safe light switch which can be used to switch on and off a safe light as desired . the &# 34 ; power &# 34 ; switch on the keyboard is used to operate the control circuit , generating the power set signal 316 and discussed with respect to fig3 . those of ordinary skill in the art will be able to use the foregoing discussion of the functioning desired for the keyboard operation of the programmable features to devise suitable specific circuits using widely commercially available circuit components to carry out these functions . actuation of a particular program is accomplished by pressing the &# 34 ; m - set &# 34 ; key and a corresponding numeric value corresponding to the program number desired to be operated , followed by the &# 34 ; enter &# 34 ; key and the &# 34 ; start &# 34 ; key . during the programming of the data in a memory location , the signal light associated with the function being programmed flashes on and off to provide a prompt to the programmer of what value is being set at a particular time . similarly , during program actuation , the program sequence lights illuminate ( unless the dim mode is selected ), corresponding to the portion of the program operating at the time . the present invention has been found to improve the productivity of workers making exposures of negatives by 50 - 100 %, due to the flexibility of capabilities built into the unit , and its easy programmability and rapid adjustment from one set of operating conditions to another . three levels of protection from line voltage fluctuation are provided in this system : line voltage tap select ; integration of the light according to the desired mode ; and use of the actual power to the lamp being used to modulate the power supply to the lamp . this redundant level of protection provides maximum control over the actual exposure made . the selectability of powers output from the light permits a wide range of emulsions of light sensitive material to be used . these advantages provide accurate control and optimum productivity to provide those of ordinary skill in the art with a unique tool . various modifications to the foregoing will occur to those of ordinary skill in the art , which modifications are deemed to be within the scope of the invention as enumerated in the claims . | 6 |
describing now the drawings , in the exemplary embodiment according to fig1 the current regulator 1 and the voltage regulator 2 , connected to not particularly illustrated but conventional actual value transmitters and adjustment or positioning devices which have been merely schematically indicated by the arrows j act and u act , are selectively connected via switch means 3 to a current - reference or set value transmitter 4 and a voltage - reference value transmitter 5 , respectively , or with a control computer 6 . the positioning or adjustment device connected to the current regulator 1 acts upon a suitable electrode raising and lowering or elevational positioning device for actuating the self - consumable electrode for regulating or adjusting the lowering or immersion speed thereof , whereas the positioning or adjustment device connected to the voltage regulator 2 acts upon the tap of a regulating transformer supplying power to the electroslag - remelting apparatus which is of conventional design and therefore here not further illustrated in the drawings . the control computer 6 is connected with a resistance computer 7 and with a power value transmitter 8 to which there are connected the signal mixers or circuit sections . this control computer 6 supplies the current regulator 1 and the voltage regulator 2 with the required power value and the respective set or reference current and voltage values j &# 39 ; ref and u &# 39 ; ref which are dependent upon the resistance value delivered by the resistance computer 7 . in the control computer 6 there are arranged the appropriate adjustable limiter means or the like for setting the upper and lower thresholds of the bath active power . the portion or part of the signal delivered by the power value transmitter 8 to the control computer 6 is adjustable by means of the signal mixer 12 , 13 and to which there is connected the positioning or adjustment magnitude output 14a of the melting rate regulator 14 . by means of the signal mixer 12 , 13 there is adjusted or set the regulation and control proportion or part ( r / c ). with a control proportion or part of 100 % the signal of the power value transmitter 8 is fully effective in the control computer 6 and vice versa . the resistance value computer or resistance computer 7 is connected by means of the lines 4a and 5a with the current and voltage reference value transmitters 4 and 5 , respectively , and calculates from the values received therefrom a base value r o of the resistance . this resistance base value r o is corrected in accordance with a signal delivered by a position regulator 9 and can be inputted by means of a switch 10 . the position regulator 9 , in turn , is connected with a reference or set value transmitter 11 for the electrode immersion weight and immersion depth ( position ) and an actual value transmitter , merely schematically indicated by the arrows labelled weight act and position act at the left side of the position regulator 9 , for the actual - immersion weight and immersion depth ( position ) of the electrode . from these values there is calculated the weight of the immersed portion or part of the electrode , which is compared with the set or reference values , and in the event of a deviation there is altered the quotient of u ref and j ref , while the product is maintained constant . furthermore , the positioning regulator 9 is provided with a correction logic and computer unit or device , which evaluates both of the actual melting rates from the weight and length measurement and upon exceeding a certain differential value carries out corrections , for instance by maintaining the last determined value . the melting rate regulator 14 receives its set or reference value -- the reference melting rate mr ref -- from a melting rate transmitter 15 and its actual value from a melting rate computer 16 . by differentiating or difference forming within finite time intervals of the preferably directly determined melting weight of the electrode this melting rate computer 16 delivers a signal which preferably corresponds to the actual melting rate ( mr act ). in fig2 there are schematically illustrated various possibilities of arranging the measuring devices for determining the lowering or immersion path of the self - consumable electrode . arranged at a cable winch platform 17 is a cable winch 18 or equivalent structure and its drive 19 as well as a cable guide roll 20 . guided over this cable guide roll 20 is a cable 23 which is attached to an electrode carriage or slide 21 , this cable 23 or the like serving for displacing the electrode carriage 21 along the guide column 22 . furthermore , there are arranged upon the cable winch platform 17 or , as indicated by phantom or broken lines , upon a carrier arm or bracket 100 connected to the guide column 22 measuring value transmitters 24 for monitoring the displacement or adjustment movements of the electrode . these measuring value transmitters 24 are connected to the electrode carriage 21 by means of measuring chains 25 which advantageously extend exactly in vertical direction , so that due to rotation of a sprocket wheel or gear of the measuring value transmitter 24 meshing with the measuring chain 25 through the same angular amount corresponds to the same changes of the elevational position of the electrode . with respect to the various possible installation or mounting locations of a measuring value transmitter 24 , designated by reference numerals i , ii and iii , the installation location i delivers the most accurate measuring values , since according to this technique the measuring chain 25 practically extends along the lengthwise axis 26 of the electrode . therefore , the bending of the electrode carriage or slide 21 , which is reduced during the course of melting of the electrode , is not a factor which is incorporated into the measuring result , whereas this is the case to an increasing extent when the measuring value transmitters 24 are mounted at locations ii and iii . fig3 schematically illustrates the possibilities of arranging force - measuring value pick - ups or receivers . in an arrangement wherein the cable 23 is guided in a substantially pulley - block - like fashion a pick - up or receiver for the force - measuring values , constructed as a tension - force measuring cell 27 , can be directly built into or otherwise incorporated in the cable run ( arrangement iv ) kept at a fixed point . such tension - force measuring cell 27 equally can be arranged at a location where it picks - up or detects half the weight of the electrode carriage 21 together with the electrode 28 , apart from the negligible weight of the cable run and the friction forces between the electrode carriage 21 and the guide column 22 , and which weight , of course , changes during lowering of the electrode 28 and the electrode carriage 21 . it is possible , of course , to tare the weight part of the electrode carriage 21 by means of a subsequently arranged suitably structured evaluation circuit and from the corrected signal there can be formed the time differential or the difference within finite but very small time intervals . in contrast thereto , a tension - force measuring cell 27 remains uninfluenced by the changing weight of the cable if it is interposed , as with the mounting location v , between the loose or dancer roll 102 of the pulley - block - like cable guide and the electrode carriage 21 . however , in this case the tension - force measuring cell 27 must take - up the full weight of the electrode carriage 21 with the electrode 28 . at this installation or mounting location v the pick - up for the measuring values equally must take - up a great tare weight , i . e . the electrode carriage or slide 21 . on the other hand , at the installation or mounting locations vi there are provided pressure measuring cells 27 &# 39 ; which are supported at the electrode carriage 21 and carry a weighing platform 29 at which there is supported , in turn , the electrode 28 . this results in a comparatively smaller tare weight than with the mounting locations iv and v . furthermore , there is omitted the effects of frictional forces between the electrode carriage 21 and the guide column 22 . in fig4 to 15 there are schematically illustrated various possibilities of supporting and establishing electrical contact for the electrode 28 and which equally affect to a greater or lesser degree the measuring or measurement result of the direct weight measurement of the electrode 28 for determining the actual melting rate . with the embodiment according to fig4 and 5 , shown in elevational and plan view , respectively , the contact jaws 30 are secured to a pressing device while interposing suitable insulation 31 . this pressing or contact device essentially is composed of two levers 34 which are operatively interconnected by means of a hydraulic cylinder unit 32 or equivalent structure and hinged to a rocker bearing arrangement 33 . the rocker bearing arrangement 33 allows for a pivoting movement of the swivel or pivot levers 34 about the lengthwise axis of the rocker bearing arrangement 33 which is secured to the electrode carriage or slide 21 . by means of a lifting hydraulic unit or system 35 mounted at the electrode carriage 21 the electrode 28 can be lifted off from its support at the electrode carriage 21 by means of the cable 23 and the thereto attached insulated grasping hook 27 or the like . at the cable 23 there is arranged a tension - force measuring cell 27 . this lifting - off action is necessary in order to eliminate force shunts or by - pass paths caused by an electrode head resting upon the electrode carriage or slide 21 . the raising and lowering of the electrode 28 itself is performed by means of the electrode carriage or slide 21 . the indicated weighing platform with the measuring cells 27 &# 39 ; for pressure or compressive forces constitutes an alternative to weighing by means of measuring cells responsive to tension or traction forces . when suspending the electrode 28 the pressure - force measuring cells 27 &# 39 ; must be relieved . the current infeed lines 36 are directly connected to the contact jaws 30 and are preferably extremely flexible . with this embodiment the weight measurement of the electrode 28 is only influenced by a very small tare weight , because the weight of the contact jaws 30 together with the portions of the lever 34 facing the contact jaws 30 roughly corresponds to the weight of the hydraulic cylinder 32 together with the portions of the levers 34 which are hinged thereto . however , frictional forces occurring at the hinges of the pressing or contact device enter the weight measurement . with the embodiment according to fig6 and 7 there are welded to the head of the electrode 28 flexible copper bands or strips 36 &# 39 ;. these copper bands or strips 36 &# 39 ; can be connected to the contact jaws 30 which can be closed by means of the hydraulic cylinder 32 &# 39 ;. these contact jaws 30 are seated upon insulation 31 arranged at the electrode carriage or slide 21 . the current infeed lines 36 to the contact jaws 30 can be rigid or stiff because they do not affect the measurement . just as was the case for the embodiment according to fig4 and 5 , the electrode 28 is suspended at an insulated hook 37 . by means of a cable provided with a tension - force measuring cell this hook 37 is connected to the lifting hydraulic unit or system , or else is supported upon a weighing platform 29 . this results in a very small tare weight , i . e . the hook 37 , the cable or the weighing platform 29 , a part of the weight of the copper bands 36 &# 39 ; and the protection cabinet or box 38 enclosing the same . however , due to heating the copper bands 36 &# 39 ; are subject to unavoidable alterations in their flexural or bending strength which are incorporated into the measurement . yet , this embodiment affords the advantage of an especially small tare weight and an exceedingly simple construction . fig8 and 9 illustrate further embodiments , wherein the tare load acting upon the pick - ups or receivers for the force measuring values is very small . this enables selecting force - measuring pick - ups or receivers which have a correspondingly small measuring range , and thus , beneficially respond more sensitively to force changes . with this embodiment the electrode 28 is provided with an armature rod 39 which penetrates through a bushing or sleeve element 40 which is supported at the electrode carriage or slide 21 . the contact jaws 30 engage at this sleeve element 40 which is connected to the electrode 28 by means of copper bands or strips 36 &# 39 ;, which are enclosed by means of a protection cabinet or box 38 . with this embodiment the electrode 28 is weighed by a weight - measuring device which engages thereat by means of an insulated hook and contains a tension - force measuring cell . the raising and lowering of the electrode 28 is performed by means of the electrode carriage or slide 21 , at which there are supported the sleeve element 40 and the contact jaws 30 . by virtue of this construction the measurement is no longer affected by the weight of the protection cabinet or box 38 , since the latter is supported at the sleeve element 40 . with the embodiment according to fig1 and 11 the lifting and lowering device -- provided with the force - measuring device 27 or 27 &# 39 ; and formed either by the separate lifting hydraulic unit or system 35 or by the cable winch of the electrode carriage , not illustrated in fig1 and 11 --, in the event there are used a weighing platform 29 and pressure - force measuring cells 27 &# 39 ;, engages at the contact jaw 30 &# 39 ;. this contact jaw 30 &# 39 ; is supported upon the weighing platform 29 or the electrode carriage , respectively , so as to be insulated either by means of the insulation 31 or directly by means of the electrode carriage . the contact jaw 30 &# 39 ; is provided with a self - adjusting surface which extends , for instance , in a substantially cone - shaped fashion and in which there are arranged contact blocks 41 . this self - adjusting surface of the contact jaw 30 &# 39 ; is provided with a slot 42 which substantially corresponds in size to the diameter of the rod of the electrode 28 . through this slot 42 there can be laterally inserted the rod of the electrode 28 which is provided , for instance , with a substantially conical head , which thus can be seated in the substantially cone - shaped contact jaw 30 &# 39 ;. if the weight of the electrode 28 is not sufficient for achieving a faultless electrical contact in the contact jaw 30 &# 39 ;, then there can be attained an increase in the contact pressure exerted by the conical head of the electrode 28 upon the contact blocks 41 of the contact jaw 30 &# 39 ; by means of the clamping arms 44 which are actuatable by means of the hydraulic cylinder means or unit 43 . the contact jaw 30 &# 39 ; beneficially is attached to the lifting hydraulic system 35 by means of a cardan - joint suspension through the tension - force measuring cells 27 , or supported at the weighing platform 29 . to increase the measuring precision it is beneficial , with the embodiment under discussion , to use extremely flexible copper bands or strips for the current supply . a similar embodiment is portrayed in fig1 and 13 , but instead of one cone - shaped contact jaw 30 &# 39 ; here there are employed two contact jaws 30 between which the head of the electrode 28 can be clamped . these contact jaws 30 are provided with two substantially cylindrical surfaces and are movable towards each other by means of two hydraulic cylinders 32 &# 39 ;. when using tension - force measuring cells 27 , wherein one of them may be found to be sufficient , as shown by referring to fig1 , the cables connected to these measuring cells or this measuring cell 27 as the case may be , engage at a holder or support 45 which guides the contact jaws 30 . connected to this holder or support 45 are the hydraulic cylinders 32 &# 39 ;. if there are employed pressure - force measuring cells 27 &# 39 ; the same can possibly engage directly at or be supported at the holder 45 . in the embodiment according to fig1 and 15 the head of the electrode 28 is provided with an axial non - circular bore 50 and two non - circular bores 49 extending transversely with respect to the axial bore 50 . at this head of the electrode 28 there engages the insulated hook of the weight measuring device which is provided with here not particularly illustrated tension - force measuring cells . in the embodiment under discussion the contact jaws 30 &# 34 ; are pierced by a traction rod 47 provided with a hammer head 46 and impacted by a suitable spring 48 . this spring 48 is arranged in a housing 51 and can be compressed , for load - relieving the traction rod 47 , by means of a sleeve element 52 and a rocker 53 . furthermore , there is arranged at the housing 51 a pivoting or turning device 54 which is connected to the traction rod 47 and allows pivoting the same through an angle of 90 °, so that the traction rod 47 can be inserted into the non - circular bores 49 and thereafter pivoted , so that following release of the spring 48 the hammer head 46 of the traction rod 47 bears against the inner wall of the bore 50 and presses the contact jaws 30 &# 34 ; against the head of the electrode 28 , while the contact jaws 30 &# 34 ; are only loosely guided by the base plate 55 . with this embodiment there is ensured for a reliable self - clamping electrical contact action , wherein force shunts or by - pass paths are avoided with respect to the weight measurement . fig1 illustrates an alternative to directly weighing the electrode . here the entire ingot or block is weighed and through the increase in the block weight there is determined the molten block weight . the weighing device is formed by weight measuring cells arranged below the cooled block or ingot carriage . with lifting molds there occur considerable force shunts between the block and the mold , so that the weighing result is distorted or falsified . for this reason either the mold carriage has to be weighed , analogous to the electrode carriage in fig3 or better still the mold itself is weighed by means of weight measuring cells . consequently , the measuring values are : g bo block or ingot weight after the last electrode , g . sub . σ momentary indicated apparent ingot or block weight , g s slag weight and g mold momentary appararent weight of the lifting mold . thus , the momentary melting weight g g of the electrode is : wherein t is the reference to taring to zero of the empty mold and ingot or block carriage . with this arrangement the expenditure is greater than with the arrangements discussed above , but there is afforded the advantage of avoiding the affects of the current infeed lines . while there are shown and described present preferred embodiments of the invention , it is to be distinctly understood that the invention is not limited thereto but may be variously embodied and practiced within the scope of the following claims . | 2 |
a preferred embodiment of the present invention is outlined in fig1 . it consists of several fundamental steps where : step 100 entails the application of electrodes on a subject &# 39 ; s scalp . this requires a practical method to hold the electrodes in place on the scalp so as to make good electrical contact . typically this is accomplished with manually attached electrodes with adhesives or caps / cap - like structures that fit over a subject &# 39 ; s scalp that integrate or have adapters for the electrodes ; a number of these are commercially available . a conductive medium is also generally required for the conductance of electrical signals between the scalp and electrodes ; typically the conductive medium is the same as the adhesive used , although it can be separate . the positions of the electrodes may be known to assist in the localization calculations , or generalized electrode positions based on ratios or morphological features of the scalp , such as the 10 - 20 system , may be utilized . the electrodes may also be placed symmetrically , or asymmetrically , around the subject &# 39 ; s head and different caps with varying numbers of electrodes and electrode spacing may also be utilized . custom electrodes may also be utilized with varying geometrical shapes and configurations . step 200 entails the connecting of the electrodes to the eeg amplifier / recorder that digitizes signals obtained from electrodes placed on a subject &# 39 ; s scalp . the particular setup used in the demonstrated reduction to practice includes a twente medical systems international ( tmsi ) refa32 digital eeg recorder . step 300 entails the receiving of electrical signals from the subject by the eeg amplifier / recorder . step 400 entails the capturing of relevant electrical signals by a computer , from the eeg amplifier / recorder . this is a multi - step process as the signal that is output by the amplifier / recorder is unusable in its raw state . it is at this point data may be subjected to near real - time component and feature isolation and artifact ( noise ) removal , such as those generated by movement , interfering electric fields , and what is known as the ‘ dc - offset ’ ( the potential difference , or voltage , resulting from the interface between scalp and electrode which is far larger in magnitude than any of the relevant electrophysiological signals ). the filters may include , but are not limited to ; low , high , band - pass , or band - stop filtering , discrete fourier analysis , kalmann filtering , z or hilbert transforms , or similar analytical filtering or spectral analysis techniques known to those skilled in the art . for example , dc - offset would be removed using a frequency filter such as the fast fourier transform ( fft ), or windowed sinc filter to remove all very low frequencies , typically below 0 . 1 hz . eeg data filters generally operate by transforming the most recently acquired eeg signal ( or frames , where the number of frames acquired per second is equal to the sampling frequency of the eeg amplifier / recorder ) by a process specific to the particular filter in question ; for example , the windowed sinc filter , designed to isolate or remove a range of frequencies would involve convolving the most recent segment of eeg frames acquired from the recorder with the filter kernel ( generated from the specified parameters of high and low ends of a frequency range along with the intention to band - pass or band - stop those frequencies ). it is noted that dc - offset removal may not be required if another filter operates on the data such that the removal would be superfluous ; an example of this would be a band - pass filter between 8 and 12 hz , as all & lt ; 0 . 1 hz frequencies would be removed inherently . it is also during this step that the electrical signals ( either pre - or post - filtering ) may be recorded to random access memory , onto an external media such as a cd , dvd or cassette , or onto a hard drive . the particular setup used in the demonstrated reduction to practice includes an intel pentium iv - 2 . 4 ghz desktop computer with 1 gb of ram . the software utilized by the demonstrated reduction to practice is designed in a way that multiple filters can run in tandem on the same set of data , and the filters exist as dynamic linked libraries such that they can be expanded and upgraded independently of the main program ( hereafter defined as plugin architecture ); the software can also record pre - and post - filtered electrical signals to random access memory , hard disk , or both . step 500 entails the use of a computer in processing the captured electrical signals from step 400 , transforming it into localized electrical activity represented within three - dimensional space using a mathematical procedure , or combination of procedures . fig2 expands on this step when using inverse solution approximation algorithms for localization . at this point , the localized electrical activity data can optionally be filtered , e . g . for statistics , near - real time diagnostics , state changes . this also utilizes plugin architecture . after the transformation , the data can optionally be displayed on a monitor in near - real time . near - real time recording and 3d localization of electrical activity is accomplished by the continuous capture and processing of eeg data ( steps 300 - 500 ; a loop of operation ) until the termination of the procedure . localization of electrical activity utilizing an inverse solution approximation — fig2 fig2 depicts the transformation of electrical signals captured and processed by the computer , from the eeg amplifier / recorder into a 3d solution space utilizing an inverse solution approximation . the inverse solution approximation involves a transformation matrix that converts electrical signals into localized electrical activity confined to a solution space , representing the volume and shape of the cerebral cortex . localization is accomplished by multiplication of each new frame of captured eeg data ( e ) by a transformation matrix ( t ) that is generated by the inverse solution approximation algorithm in use to yield the array of voxels containing localized electrical activity ( v ). voxels are defined as discrete units of volume within the solution space and they contain the localized electrical activity for that particular region of the cerebral cortex . the localized electrical activity for each voxel is represented as a three - dimensional vector with an x , y and z component . the demonstrated reduction to practice currently implements the inverse solution approximation algorithm known as loreta , details of which can be found in : pascual - marqui r d , michel c m , lehmann d . low resolution electromagnetic tomography : a new method for localizing electrical activity in the brain . international journal of psychophysiology 1994 , 18 : 49 - 65 . any appropriate inverse solution approximation algorithm could be used ; other possibilities include but are not limited to : hamalainen m s , ilmoniemi r j ( 1984 ): interpreting measured magnetic fields of the brain : estimates of current distributions . technical report tkk - f - a559 . helsinki : helsinki university of technology . ii ) l1 minimum norm , also known as the selective minimum norm , inverse solution : matsuura k , okabe y ( 1995 ): selective minimum - norm solution of the biomagnetic inverse problem . ieee trans biomed eng 42 : 608 - 615 . backus g , gilbert f ( 1968 ): the resolving power of gross earth data . geophys j r astron soc 16 : 169 - 205 . grave de peralta menendez r , gonzalez andino s l ( 1999 ): backus and gilbert method for vector fields . hum brain mapp 7 : 161 - 165 . fuchs m , wagner m , kastner j . boundary element method volume conductor models for eeg source reconstruction . clin neurophysiol 2001 ; 112 : 1400 - 7 . andino s . electrical neuroimaging based on biophysical constraints . neuroimage 2004 ; 21 : 527 - 39 . r . d . pascual - marqui , standardized low resolution brain electromagnetic tomography ( sloreta ): technical details . methods & amp ; findings in experimental & amp ; clinical pharmacolgoy 2002 , 24d : 5 - 12 . author &# 39 ; s version , details of which can be found at liu h , schimpf p h , dong g , gao x , yang f , gao s ieee trans biomed eng . 2005 october ; 52 ( 10 ): 1681 - 91 . standardized shrinking loreta - focuss ( sslofo ): a new algorithm for spatio - temporal eeg source reconstruction . the demonstrated reduction to practice also currently implements a solution space of 2394 voxels available in the public domain , based on the mni - 305 template of neuroanatomical data from the montreal neurological institute ( mni ), based on the averaging of 305 mri scans of human brains . this solution space is first described in : a . c . evans and d . l . collins and s . r . mills and e . d . brown and r . l . kelly and t . m . peters , “ 3d statistical neuroanatomical models from 305 mri volumes ”, proc . ieee - nuclear science symposium and medical imaging conference , 1813 - 1817 , 1993 . any appropriate cortical solution space could be used ; other possibilities include but are not limited to : a ) the international consortium for brain mapping 152 brain average ( icbm152 ): evans , a . c ., collins , d . l ., et al ., three - dimensional correlative imaging : applications in human brain mapping . in : huerta , m . ( ed . ), functional neuroimaging : technical foundations . academic press , san diego , pp . 145 - 162 , 1994 . b ) talairach space : talairach , j ., tournoux , p ., co - planar stereotaxic atlas of the human brain . thieme , new york , 1988 c ) the pediatric solution space in development at the pediatric data center at the mni d ) an individualized solution space derived from a subject &# 39 ; s own mri or ct scan . the basic display result using the mni 305 solution space is demonstrated in fig5 a . first successful reduction to practice of the present invention — fig3 fig3 depicts the first successful reduction to practice of the present invention . the hardware utilized at the time was the tmsi refa32 digital eeg recorder connected to a 19 electrode (+ 1 ground ) neuroscan cap , and an intel pentium iv - 2 . 4 ghz desktop computer with 1 gb of ram , although we have later successfully included the use of 32 (+ 1 ground ) medcat silver chloride ( agcl ) sintered ring electrodes . the demonstrated reduction to practice utilizes custom - written software by the inventors . the software written to implement the methods of this invention is designed to : a . display both near - real time and pre - recorded data using three - dimensional cubes ( known as voxels ) projected onto a two - dimensional display surface ( i . e . the screen ), and can freely be manipulated in ways that allow for the visualization of any region , whether on the surface or buried within the rest of the grey matter . this is true three - dimensional near - real time manipulation of the cortex . b . use the opengl library to display the three - dimensional graphics , although other three - dimensional application programming interfaces may be supported in the future . c . be programmed in c ++ and speed - optimized to allow fast user responsiveness and the execution of many potential data filters and display windows . d . display multiple windows corresponding to different points of view of the cortex ( vantage points ), display options , or sets of data filters . e . handle far larger data - sets than similar non - real - time methods found in prior art ; the amount of data that can be analyzed is solely limited by the amount of memory of the computer the analysis is performed on . f . run on any computer that can run microsoft windows ™, although the responsiveness is dependant on both the speed of the video card and microprocessor within the computer ; other operating systems may be supported in the future . g . be intuitive and easy to use , extending its accessibility to individuals without developed computer skills . fig4 - 6 depict three groups of tools that allow the human operator to manipulate and display localized electrical activity within the solution space comprised of voxels . they are a selection of independent tools whose use is not required for the function of the present invention ; they serve to facilitate analysis and interpretation . these tools may be utilized alone or in any combination . group 1 : tools to manipulate the graphical display and analysis of voxels — fig4 fig4 depicts diagrams that demonstrate the various ways by which the voxels that comprise the solution space can be displayed . generally , each voxel within the solution space utilized is displayed using 3d graphics , as a discrete cube ( 6 sided polygons ) within each voxel &# 39 ; s own assigned position as determined by the solution space model used . each solution space may be given its own display window , or superimposed onto an existing window . fig4 a depicts the solution space comprised of voxels in three points of view , drawn as a 3d array of cubes ; front ( left ), top ( middle ), and right ( right ) views . fig4 b depicts the tool for near - real time translucent visualization of displayed voxels ; on the left is the solution space with the tool enabled , whereas the solution space on the right has the tool disabled . the purpose of this tool is to allow the operator to visualize activity occurring at all depths . this is useful for viewing the entire cortex at a glance , as it will reveal all inner activity with the same weighting as any surface activity , and instantly reveal any significant deeper signals . this is achieved by means of drawing all voxels with additive blending , that is , instead of replacing the pre - existing pixels of the 2d projection plane ( i . e . the screen ) of the 3d solution space ( that is subsequently rendered to the screen ), we add the pixel values of the current object drawn closer to the viewing plane to the pre - existing pixels . for example , if there was a voxel with a value of 100 , and we drew a new voxel that would partially or completely occlude the underlying voxel , with a value of 50 , the resulting area where the two voxels overlap would have a value of 150 . if additive blending was not used that area would have a value of 50 , and the new voxel would have partially or completely replaced the color value of the deeper voxel depending on the spatial arrangement of the two voxels . fig4 c depicts the tool for near - real time spatially filtered data on the basis of regions of interest ( roi ). this is useful in such applications as when the operator is interested in only one region of the cortex . such areas may be deep inside the cortex thus making it desirable to filter out regions that are not of interest while the near - real time display or analysis is being generated . we achieved roi filtration by implementing a spatial filter that takes a single 3d coordinate selected by the user and then only processes those voxels that are within the spherical boundary defined by the user as a radius from that central coordinate . fig4 d depicts the tool for near - real time spatially filtered data on the basis of neuroanatomical information . this is useful as there is a massive amount of scientific literature on the subject of what is called functional localization , with a great deal known about the function of many regions of the brain . there is a need in research and in clinical work to be able to focus on a region of interest , so as to be able to later correlate findings made by imaging or analysis with what is known about a particular neuroanatomical region . we achieved this spatial filtering by assigning each voxel multiple description fields by which they could be identified as being part of a series of neuroanatomical regions , and then only displaying those voxels that are members of the neuroanatomical region in question . in the implementation demonstrated , the neuroanatomical classifications of each voxel originate from a table generated by the montreal neurological institute based on the solution space currently utilized by the software and described previously ( mni - 305 ). fig4 e depicts the tool to control the display of voxel size . this enables reductions in voxel size to allow for visualization of buried features . this is useful when looking at 3d images the cortex and when it is desirable to look at underlying voxels while preserving their colorimetric values that may be lost using other tools ( e . g . the translucent visualization tool ). this method essentially shrinks the displayed size of each voxel , effectively creating gaps in between the voxels , allowing for the visualization of deeper voxels . we achieved this by adding a scale parameter s within the voxel drawing function that draws 3d cubes of a length , width , and height of the standard voxel size , v * s . the variable s , unless otherwise specified by this tool has a value of one ( 1 ). fig4 f depicts the tool for visualization of voxel outlines in a disabled state , since this tool is especially useful in delineating the boundaries between individual voxels as can clearly be seen in every figure of this section . this was achieved by drawing a series of 12 lines , forming a wire - frame cube of a slightly larger size than the solid polygons comprising the voxels . the x , y and z axes , further described in fig6 e , are labeled in this figure to orient the reader . fig4 g depicts the tool for the near - real time selective display of cortical shells to view buried visual features . this is useful for removing surface features that may otherwise occlude the visualization of significant events deeper within the cortex . we achieve this by means of assigning each voxel within the solution space a shell number , of an integer type , based on its distance from the center of the solution space . only those voxels that have a shell number matching the range of shells to be displayed are then displayed on the screen . the demonstrated implementation of this tool divides the cortex into five distinct shells . group 2 : tools to analyze and graphically display localized electrical activity — fig5 fig5 depicts diagrams that demonstrate the various ways by which the electrical activity within each voxel can be represented graphically . as mentioned in fig2 , the inverse solution approximation algorithms output 3 values for each voxel of the solution space , for each given instance in time ; an x - component ( x ), a y - component ( y ), and a z - component ( z ) of a vector indicating the amount ( magnitude ) of electrical activity and a direction in which this electric activity is moving . generally , there are two approaches to represent this electrical activity ; displaying within each voxel , the magnitude ( m ; defined as the square root of the sum of the components squared ; m =√( x 2 + y 2 + z 2 )) of the electrical activity vector ( defined as current density ) of that voxel as a shade of color , increasing in intensity as electrical activity increases ; and secondly , displaying the magnitude and direction of the electrical activity vector as a line with a distinct direction and magnitude emanating from the center of each voxel . fig5 a depicts the electrical activity of each voxel within the entire solution space as shades of color . this represents the magnitude , or amount , of electrical activities occurring within the solution space . fig5 c depicts the first 54 voxels of the solution space , represented in the same way , for increased clarity . this essentially represents the amount of each current density in each voxel as the color of the voxel . this is useful as the operator needs a convenient method of continuously visualizing the level of electrical activity in a voxel or a set of voxels without having to resort to looking at tables and numbers from which these activity levels are internally derived . this is also very useful as a shortcut to help the viewer to recognize such patterns as “ hot spots ” of high activity and hot clusters , cold spots and cold clusters and current density gradients from one voxel to another . we achieved this by multiplying the value of the current density at each instant by a user - adjustable scalar ( referred herein as the display gain ) that is then used as a parameter by the voxel drawing function to determine its displayed color . in the current implementation reduced to practice , a bright blue shade indicates high levels of electrical activity , and darker blue shades , lower levels ; other single color shades or false - color spectra are easily possible . fig5 b depicts the electrical activity of each voxel within the entire solution space as a combination of shades of colors and lines . the lines represent both the magnitude and direction of the electrical activities within the solution space while the shades represent only the magnitude , as shown in fig5 a and 5c . the lines protruding from the voxels shown in fig5 b directly represent the vectors of electrical activity . fig5 d depicts the first 54 voxels of the solution space , represented in the same way , for increased clarity . we achieved this by drawing a line from the center of the voxel ( c ) to the center of the voxel plus the voxel &# 39 ; s electrical activity vector ( v ) multiplied by a scalar ( s ) ( referred herein as the vector gain ); in symbolic form this means drawing a line from c to c + v * s . there are several ways to further display these vectors of electrical activity . in the current implementation reduced to practice , the vector is drawn in white . fig5 e depicts the electrical activity vectors as two - tailed entities for purposes such as the facilitation of the correlation between voxels and their nearby electrode positions . this is accomplished by drawing a second line from c to c − v * s for each voxel . in this drawing , the thicker lines represent vectors in the opposite direction to the electrical activity while the thinner lines represent the true vectors ; in addition , only the first 54 voxels of the solution space are represented for increased clarity . in the current implementation reduced to practice , the true vector is drawn in red , while the negative vector is drawn in blue . fig5 f depicts only the directional ( angular ) information of the electrical activity vectors in the first 54 voxels of the solution space . this is accomplished by normalizing each vector to a length of one by dividing each vector component by the magnitude of the vector ; x ′= x / m , y ′= y / m , z ′= z / m . fig5 g depicts the use of thresholds to limit the display of electrical activity to only those in a top percentage group , selected by the user . the top - left panel of fig5 g depicts 100 % of the electrical activity , the top - right depicts the top 50 % of activity , and the bottom - middle depicts only the top 25 % of electrical activity within the solution space . fig6 depicts diagrams that demonstrate the various ways by which the graphical displayed results can be further modified . fig6 a depicts the utilization of multiple display windows . this is useful for examining several sources of data , or several aspects of a single recording at once . we achieve this by means of instantiating a number of new memory buffers and display windows corresponding to the number of windows desired to be displayed . the example depicted in this figure demonstrates the usage of multiple display windows to display the same data whose original eegs have been filtered with multiple frequency parameters in near - real time ; the top left image has been filtered between 1 - 3 hz , top right 4 - 7 hz , bottom left 8 - 12 hz , bottom right 12 - 16 hz . in addition to displaying the contents of multiple results in separate windows , they can be displayed in a single window , where each display result has a different color - key ; this has also been reduced to practice but for practical reasons , cannot easily be depicted in the diagrams . these powerful features are very useful for such applications as sleep medicine and the monitoring of neurology patients . fig6 b depicts the tool for mouse - controlled free rotation . this is useful as the operator can in near - real time simultaneously observe the shifts in the electrical activity and perform mouse controlled free rotation manipulations of the display so as to observe all angles of the 3d cerebral cortex . this gives the operator the power to see the cortex from any angle and not be restricted to fixed views such as front , back , bird &# 39 ; s eye and side views ( which is a drawback of tomography ). we achieved this by generating a standard 3d rotation matrix from variables specifying the degrees of rotation around each of the 3 axes , x , y , and z , then using that matrix in successive transformations , in a manner well known to those skilled in the art . fig6 c depicts the tool for mouse - controlled brain panning . this is useful as it allows free movement outside and even inside the solution space to allow for the visualization of tiny areas within the cerebral cortex . we achieved this by generating a 3d translation vector from variables specifying the operator &# 39 ; s ‘ camera ’ position in each of the 3 axes , x , y , and z , then using that vector in successive transformations , in a manner well known to those skilled in the art . fig6 d depicts the tool for the display of electrode positions . this allows the operator to visualize , relative to the solution space , where the electrodes that collect the raw electrical signals have been placed . this is useful as it allows the operator to correlate the contribution of a particular electrode to the observed electrical activity . this was accomplished by drawing spheres at the 3d coordinates of the electrodes utilized by the present invention , transformed to the solution space coordinate system , dependant on which solution space is utilized . fig6 e depicts the tool to mark axes . this is useful as when the cortex is imaged on a screen the operator can easily be disoriented and not know what part of the cortex they are looking at . this is especially true when the cortex is being rotated frequently by the mouse - controlled free rotation tool . we therefore have implemented a method to draw the x , y , and z axes of the cortex so as to aid the operator in knowing where up , down , left , right , front and back are . this was accomplished by drawing 3 lines , all originating from the center of the 3d solution space , and terminating at boundaries slightly larger than the dimensions of the solution space . at the line termini , text identifiers of each axis (“ x ”, “ y ”, and “ z ”) are drawn . fig6 f depicts the tool to simultaneously display and navigate through eeg and 3d images . this is useful as people in the eeg field often have a considerable knowledge of cortical activity based on wave forms and spikes visible on eeg . we have observed in our own experience that there is a synergistic effect in making near - real time eeg and near - real time 3d cortical imaging visible to the operator simultaneously . we have implemented this in a manner which time locks the eeg signal display and the corresponding 3d images so as to allow the operator to correlate the two , and this feature is available in near - real time . this has been reduced to practice as part of the invention &# 39 ; s custom software , as shown in this figure . fig6 g depicts the tool for the near - real time display of the name , location , and current density of a voxel . this is accomplished by drawing the number , numerical value of the current density , location in the solution space , and neuroanatomical regions of a selected voxel into a window for the current instance in time . fig6 h depicts the tool for the alphanumeric display of a predetermined list of voxels in near - real time . the voxel number , hemisphere ( side ), the associated brodmann area ( a neuroanatomical classification system based on human brain histology developed by korbinian brodmann in 1909 ), major anatomical region , minor anatomical region , the magnitude of the electrical activity ( current density ) at the current instant in time , and the x - component , the y - component , and the z - component of electrical activity vector at the current instant in time are all displayed as alphanumeric text in a window . this is accomplished by drawing the values for these aforementioned fields that already exist in memory from preceding calculations or stored tables , as text in the window . fig7 - 15 depict flowcharts that describe the steps involved in the utilization of the present invention and its intended applications . the solid boxes represent required steps , while the dashed boxes represent optional steps . the arrows represent sequential orders of execution beginning with the steps connected to the tail ends of the arrows , then ending with the heads of the arrows . hollow diamond shapes with solid borders represent decision steps , and the filled octagons represent termination steps , where operation of the present invention ceases . smaller symbols that appear inside steps are represented as follows ; solid triangle for a step requiring the human operator to interpret a result or alert ; solid square for a step requiring the human operator to select a parameter or purpose ; and a solid diamond for a step requiring the human operator to setup an apparatus . a preferred embodiment of the present invention and its particular applications — fig7 fig7 depicts a master flowchart for the 8 applications of the present invention along with steps that are required for all 8 , and optional steps that are application specific pertaining to analysis , and setup of the application . fig7 a describes an extended scheme by which the present invention operates in a preferred embodiment , whereas fig1 depicted the most basic embodiment . steps 100 - 500 in fig7 a are identical to those in fig1 , hence do not need to be described again . however , following step 500 , the present invention may optionally be involved in executing a particular application ( listed in fig7 b , and further described in fig8 - 15 ), chosen by the human operator , as depicted by step 714 . the execution of a particular application may involve the further spatial filtering of voxels , by which only those voxels that are deemed by the application to be relevant or of interest are included in subsequent calculations , as depicted by step 716 . step 718 depicts the optional step where only voxels exceeding or falling within a certain threshold of electrical activity would be included in subsequent calculations ; for example , only those voxels that are in the bottom 50 % of electrical activities at the present time would be included in further steps . step 720 - 724 refers to the optional display and manipulations of the voxels and localized electrical activity , as previously described in fig4 - 6 . at this point , the displayed voxels and localized electrical activity may optionally then be incorporated into the final presentation method , described further below and depicted in step 712 . alternatively , instead of graphically displaying the localized electrical activity , as in steps 720 - 724 , the localized electrical activity may be displayed as alphanumeric text , as demonstrated in fig6 h and depicted in step 736 , followed by the optional incorporation into the final presentation method , depicted by step 712 . step 710 depicts the optional acquisition of signals in near - real time from other devices , such as those that capture video , audio , physiological parameters , or information from remote locations ( as in the case of telemedicine ), which could then further contribute to the function and operation of the invention . step 70 depicts the setting up of the other devices or effectors involved in the acquisition of additional signals , manipulating the environment , or functioning as transmitters to remote locations . this is further elaborated upon in fig7 c . step 712 entails a final presentation method to present results to the human operator of the invention , which generally may be any one or combination of the items below : i ) a single screen display with one window , ii ) a single screen display with multiple windows , iii ) a multiple screen display with single windows , iv ) a multiple screen display with multiple windows , v ) an audio speaker . the selection of the type of final presentation method will depend on the particular application of the present invention . following step 712 , the human operator may interpret the results presented using the final presentation method and then act accordingly , depending on the intended application for the present invention , as depicted in step 734 . step 730 follows step 400 , the capturing of electrical signals ( eeg signals , since they originated from the cerebral cortex ) from the amplifier / recorder , and it depicts the optional further processing of the eeg signals , that extends beyond the filtering described in step 400 ; this may include examining the signals for certain features or thresholding activity originating from within any or all electrodes . step 732 follows step 730 , in that the eeg signals may then be displayed on a screen , and optionally further incorporated into the final presentation method in step 712 . this has been reduced to practice as part of the invention &# 39 ; s custom software , as shown in the right panel of fig6 f . this was accomplished by drawing onto the display each electrode name on the screen in a vertical list , and for each electrode , drawing lines connecting each data point ( with each point representing the electrical potential read from the electrode and captured with the computer from the amplifier / recorder at that time in the y axis and the time of capture in the x axis ), preceding the present time . stimulation of the subject , depicted in step 726 , may also be an optional step during the operation of the present invention ( depicted as leading into step 300 , the start of the near - real time loop of operation ) as it may be a relevant requirement of the chosen application of the present invention . this stimulation may be performed in several ways : a ) auditory stimulation , such as the playing of sounds or audio recordings with a speaker , or live in the subject &# 39 ; s environment , b ) visual stimulation , such as the presentation of images , c ) tactual stimulation , such as light touch , or mechanical stimulation , d ) olfactory stimulation , such as the presentation of smell , e ) internal chemoreceptor stimulation , such as the alteration of blood ph . f ) thermal stimulation , such as the presentation of a cold stimulus , g ) nociceptive stimulation , such as the presentation of a painful mechanical stimulus , h ) proprioceptive stimulation , such as the disruption of self - awareness , i ) equilibrioceptive / vestibular system stimulation , such as the disruption of the inner - ear fluid to upset balance , and j ) stimulations which evoke a specific emotion using a complex sensory stimulus and cognitive stimulation including the presentation of an idea or words or presentation of any cognitive stimulus such as one that evokes a mental change such as the recall of a memory . fig7 b lists the eight particular applications of the present invention , and serves as an index for which figure further explains each application . each application originates from fig7 a , step 714 , which calls for the execution of a particular application , decided by a human operator . the applications and their associated figures are as follows : a ) researching — fig8 , b ) diagnosing — fig9 , c ) monitoring — fig1 , d ) treating — fig1 , e ) lie detecting — fig1 , f ) educating the brain — fig1 , g ) entertaining — fig1 , and h ) effecting an industrial process — fig1 . fig7 c depicts the setup and utilization of the other devices or effectors mentioned in fig7 a , steps 70 and 710 . some particular applications may require or may benefit from additional information that supplements the subject &# 39 ; s localized electrical activity . for example , in the case of sleep medicine it is relevant to collect physiological signals from a subject , such as those from an oxygen monitor , to determine the breathing status of the subject . some particular applications may require transmitters and receivers to send and receive a subject &# 39 ; s localized electrical activity between remote locations , such as in the case of telemedicine , where the human operator that would interpret a subject &# 39 ; s condition may be located hundreds of kilometers away . step 738 depicts the setup of a transmitter and receiver for the purpose of telemedicine . the transmitter could be anything capable of sending a signal with sufficient bandwidth to capture the near - real time localized electrical activity data . this could be performed over a private network , the internet , or through wireless transmission of electromagnetic radiation with wavelengths similar to those use by radio or television broadcasts . the transmitter would be located at the site where the subject is located and connected to the present invention . the receiver would be at a remote location and would use the same medium of communication that the transmitter would use , and it would be connected to an alternate ‘ remote site ’ embodiment of the present invention where the receiver would generate the electrical activity signals as opposed to a computer transforming electrical signals captured from an eeg amplifier / recorder . step 740 depicts the operation of the aforementioned transmitters and receivers . data would be transmitted at the subject site prior to fig7 a step 710 , and the data would be received at the remote site before fig7 a step 710 in the ‘ remote site ’ embodiment of the present invention . steps 742 - 748 depict the setup , capturing , recording and playing of an audio signal . the audio signal capturing device , such as a microphone connected to a soundcard in a computer , would be connected in step 742 following fig7 a step 70 . during the operation of the present invention , audio signals may then be captured for use by the present invention in fig7 a step 710 as depicted in step 744 , recorded as in step 746 , or played as in step 748 . audio signals may be recorded to random access memory , on an external media such as a cd , dvd or cassette , or onto a hard drive . playing of the audio signal could be integrated with the final presentation method in fig7 a step 712 , or accomplished using a standalone loud - speaker or equivalent . steps 750 - 756 depict the setup , capturing , recording and playing of a video signal . the video signal capturing device , such as a digital camera or camcorder connected to a video card in a computer , would be connected in step 750 following fig7 a step 70 . during the operation of the present invention , video signals may then be captured for use by the present invention in fig7 a step 710 as depicted in step 752 , recorded as in step 754 , or displayed as in step 756 . video signals may be recorded to random access memory , on an external media such as a cd , dvd or cassette , or onto a hard drive . displaying of the video signal could be integrated with the final presentation method in fig7 a step 712 , or accomplished using a standalone monitor or equivalent . steps 758 - 764 depict the setup , capturing , recording and playing of physiological signals . examples of physiological signal capturing devices include : a ) electrooculogram , b ) electromyogram , c ) electrocardiogram , d ) strain gauges , e ) piezoelectric bells , f ) inductive plethysmography , g ) impedance gauge , h ) pneumograph , i ) endoesophageal pressure monitor , j ) air flow thermistor , k ) pneumotachograph , l ) oxygenator , m ) body position monitor , n ) vibration monitor , o ) end tidal co2 monitor , p ) transcutaneous co2 monitor , q ) esophageal ph monitor , penile r ) tumescence monitor , s ) galvanometer , t ) sphygmomanometer , and u ) heart rate monitor . any one of these devices , or any combination of them may be connected to the present invention in step 758 following fig7 a step 70 . during the operation of the present invention , physiological signals may then be captured for use by the present invention in fig7 a step 710 as depicted in step 760 , recorded as in step 762 , or displayed as in step 764 . physiological signals may be recorded to random access memory , on an external media such as a cd , dvd or cassette , or onto a hard drive . displaying of the physiological signals could be integrated with the final presentation method in fig7 a step 712 , or accomplished using a standalone monitor or equivalent . fig8 depicts how the present invention may be utilized to discover a wide variety of information and insight on the involvement of the cerebral cortex by its localized electrical activity through conducting research in near - real time . this research will generate quantitative datasets on normal and abnormal conditions , disorders , and states . examples of these datasets include : i ) brain disorders , ii ) changes in the conditions of subjects with brain disorders , iii ) normal brain processes , iv ) characterization of the synergy between functional elements of the brain ( i . e . areas of the brain that work together to perform a function ), v ) cortical targets for treating diseases , vi ) lying , vii ) telling the truth , viii ) thoughts and ideas , ix ) feelings and emotions , x ) sensations , xi ) beliefs , xii ) predispositions , xiii ) planning , and xiv ) psychological states of mind . in order to perform many of the particular applications of the present invention listed in fig7 b , including diagnosing , monitoring ( especially for an improvement or deterioration ), treating , lie detecting , educating the brain , entertaining and effecting an industrial purpose , it will be necessary to first conduct research on subjects to establish parameters such as : i ) what is normal , to provide a basis of comparison towards , ii ) what is abnormal ( i . e . the signature or pattern of a particular condition , disorder or state ), iii ) thresholds , that when exceeded or have fallen below , signify something important , and iv ) correlations between two or more variables , so that if one variable changes or can be changed , the response of the other , or others , can reliable be predicted . there are two ways to establish these parameters , as mentioned by the decision step 802 ; autonomously and non - autonomously . an autonomous way of establishing parameters involves the processing of the localized electrical activity information by algorithms , without human involvement , whereas the non - autonomous establishment of these parameters initially involves a human operator observing gross phenomena , which is step 808 . the observation of gross phenomena , depicted by step 808 , means that there are changes that are noticeably visible to the operator of the present invention . one important type of observable gross phenomena is a correlation such as when the operator can see a noticeable change in a subject &# 39 ; s near - real time localized electrical activity and other cues such as gross deflections on the simultaneous near - real time eeg signals or physiological signals . these changes would be observed using the final presentation method and initial interpretation mentioned in fig7 a step 734 . however , there may other cues involved that are not related to the collection of signals , such as gross facial expressions as well as audible utterances , and gestures . after forming a judgment as to the occurrence of a correlation , the operator may use the present invention to deconstruct the associated 3d signal . for example , if one sees an interesting feature on eeg and associated localized electrical vectors that point away from that electrode &# 39 ; s position adjacent to the solution space , then one can play back the display in slow - motion and perform simultaneous viewing so as to isolate precisely which vectors are most responsible for the observation of gross phenomena . this may require the utilization of a number of the tools or procedures described in this document as well as any sort of stimulus previously mentioned . if the parameters mentioned in section [ 00099 ] are to be established autonomously , then the decision in step 804 must be made ; is the parameter going to involve a comparison , or will it depend on a correlation ? if the answer is yes , then the generation of normative datasets and abnormal datasets must occur ( steps 812 and 814 ). if the answer is no , then correlative datasets must be generated ( step 806 ). calculating statistical norms requires normal data . step 812 depicts the generation of normative data for the purpose of establishing a statistical norm . this entails the near - real time collection of localized electrical activity from a number of subjects that are healthy and are not afflicted by the condition , state or disorder that the particular research application is attempting to identify . it is possible to accomplish this in a way such that as the present invention is operating , the normative dataset would continually be added to , if the data is being stored in near - real time , either in the form of captured electrical signals , localized electrical activity , or processed localized electrical activity . in addition this same method can be utilized to generate a normative dataset for a patient &# 39 ; s own healthy state . generating an abnormal dataset , as mentioned in step 814 , requires a similar procedure with the exception that subjects are now required to be afflicted or expressing the condition , state or disorder that the research application is attempting to identify . it is possible to generate both normative and abnormal datasets in near - real time on the basis of the following items : i ) * average or standard deviation of the current density for each voxel over time , ii ) * average or standard deviation of the x , y , and z components of the localized electrical activity vectors for each voxel over time , iii ) * average or standard deviation of the localized electrical activity vector rotation over time , iv ) * average rate of change of items i - iii above ( i . e . velocity ), v ) median or mode of the current density for each voxel over time , vi ) median or mode of the x , y , and z components of the localized electrical activity vectors for each voxel over time , vii ) median or mode of the velocity of electrical activity vector rotation over time , viii ) average rate of change of items v - vii above ( i . e . velocity ), ix ) average acceleration ( i . e . rate of change of velocity ) of items i - vi above , and x ) average counts for a specific current density pattern in time such as the number of occurrences or frequency of spikes ( a sudden increase in current density ) over time . note : on items marked with an asterisk (*), the present invention has reduced to practice via the custom software . the near - real time averaging of values and calculation of standard deviations was accomplished by continuously adding the values in question ( i . e . current densities , electrical activity vectors , or electrical activity directions ) ( v ) into an memory buffer over time ( v ) and then dividing by the number of instances in time , or frames that have elapsed ( n ). in addition , the standard deviation ( s ) at any given moment can be obtained by the following well - known formula : s =√( σ ( v − v ) 2 /( n − 1 )). alternatively , averaging in near - real time over a period of time for any sort of item mentioned can be accomplished by calculating a weighted average between the previously calculated average and the current value . for example , if the invention has been operating for 1000 instances in time , or frames , to calculate the average at frame # 1001 , one would add the value at the current time , frame # 1001 , divided by 1001 , to the previous average calculated over the past 1000 frames multiplied by 1000 / 1001 . calculating the change or instantaneous velocity of a vector component , angle , or current density was accomplished by taking the difference between the value at the current frame and the value at the previous frame . calculating the rotation of the electrical activity vectors was accomplished by normalizing the vector by its magnitude , as previous described in fig5 f . once the datasets have been generated , comparisons can take place , as denoted by step 816 , to ask such questions as : i ) are these abnormal datasets significantly different from what is known to be normal ? ii ) is this subject with the condition , state or disorder that the research application is attempting to characterize the same as all the other abnormal datasets ? iii ) is this subject really normal ? to answer the above questions , statistical tests between the two datasets have to be performed . it is possible to use tests such as t - tests and its derivatives , poisson tests , x 2 tests , analysis of variance ( anova ), topographical analysis of variance ( tanova ), multiple analysis of variance ( manova ), general linear model ( glm ) tests , statistical parametric mapping ( spm ) and statistical non - parametric mapping to do this . the results of these tests could then be presented using the final presentation method , fig7 a step 712 . both t - tests and poisson tests have been reduced to practice by the present invention via the custom software . this was accomplished utilizing techniques known to those skilled in the art . to generate a correlative dataset , a similar approach to the generation of a normative or abnormal dataset can be undertaken , only that instead of establishing a comparison , a correlation between two or parameters would be generated instead , as mentioned in step 806 . based on the correlative data generated , thresholds can then be defined . for example , in section [ 00026 ] it was mentioned that alcohol intoxication exhibited increased theta activity ; if one were to measure a subject whose level of intoxication was steadily increased through the consumption of a certain fermented hops and barley containing beverage and the subject &# 39 ; s captured electrical signals were filtered for the theta range of frequencies then processed into localized electrical activity , one could plot a correlation between frontal lobe theta band localized electrical activity and level of intoxication in near - real time . one could also repeat this in a number of subjects to build a correlative index with a higher statistical power . the results of these correlative studies could then be presented using the final presentation method , fig7 a step 712 . in the context of the above example , if one were to then finally examine and interpret the correlative data , one could determine a quantitative threshold based on the theta band localized electrical activity defining at what level of activity a subject would be considered to be legally intoxicated . an additional important step in these aforementioned methods of research is the utilization of a stimulus applied to a subject to test for a response . this is encompassed by fig7 a step 726 . the present invention has been designed to perform this type of research . research into the mechanism of action of drugs and into the discovery of characteristics of lying may be performed using this method . fig9 depicts how the present invention can be utilized to diagnose the wide variety of brain disorders mentioned in section [ 00026 ]. the research application described in fig8 is very important in establishing the diagnostic parameters , patterns and datasets required for the use of this invention in diagnosis , hence many of the methods utilized by this application are similar if not identical to those in the researching application . the present invention has three principle methods to diagnosing brain disorders . two are autonomous and one is not , with the differences between the two approaches described previously in fig8 . step 902 is where the decision to use an autonomous method is made , and the particular choice depends on the suspected brain disorder or provisional diagnosis made by a clinician . this decision may not require human choice as it may be predetermined depending on the disorder . the non - autonomous method is based on observation for known characteristics , as depicted in step 912 . observation in this case means that the human operator is utilizing the final presentation method and interpretations thereof from fig7 a step 734 , with all necessary potential signals ( fig7 c ), and tools for manipulating electrical activity ( fig4 - 6 ) at the operator &# 39 ; s disposal to make a diagnosis based on the operator &# 39 ; s own experience in utilizing the present invention and interpreting for the particular brain disorder or brain disorders to be diagnosed in the patient . at this point the operator can then issue a diagnosis , as depicted in step 914 , followed by the termination of the operation of the present invention as the procedure has been completed . the autonomous methods are further divided into comparative and non - comparative methods at the decision made in step 904 . this decision may not require human choice as it may be predetermined depending on the disorder . step 906 represents the autonomous comparative method where the patient &# 39 ; s localized electrical activity is processed as mentioned in fig8 and compared to either the patient &# 39 ; s own normal dataset , or a normative dataset that is a statistical norm for healthy individuals not suffering from the patient &# 39 ; s suspected condition . the comparison would be performed utilizing a number of statistical tests , described in fig8 . step 910 represents the autonomous non - comparative method where the patient &# 39 ; s localized electrical activity is processed as mentioned in fig8 and relevant activity assessed to see if it is crossing over or under a threshold derived from either the patient &# 39 ; s own correlative dataset , or a correlative dataset from a number of patients . upon the completion of either autonomous test , a result or an alert would be indicated in step 908 , which could be interpreted by the operator either before or after integration into the final presentation method ( fig7 a step 712 ). fig1 depicts how the present invention can be utilized to monitor the wide variety of monitorable conditions that consists of the brain disorders and conditions mentioned in sections [ 00026 - 00027 ]. monitoring provides a flow of information in near - real time either locally to an observer that is in the presence of the patient or to a remote observer , by means of telemedicine techniques . monitoring can be achieved using of audio , visual , or mechanical alarms as opposed to display monitors , and when alarms are involved , a visual display monitor may not be required . many of the methods utilized by this application are similar if not identical to those in the researching and diagnosing applications . step 1002 is describes the situation wherein a decision to use an autonomous method is made , and the particular choice depends on the patient &# 39 ; s monitorable condition . this decision may not require human choice as it may be predetermined depending on the monitorable condition . the non - autonomous method is based on observation for known characteristics , as depicted in step 1012 . the operator performs this observation utilizing the tools and methods of the invention in addition to drawing upon the experience of the operator in recognizing changes in the monitorable condition . when a change is observed , the operator can then issue an alert , as depicted in step 1014 , followed by the termination of the operation of the present invention as the procedure has been completed . the autonomous methods are further divided into comparative and non - comparative methods at the decision made in step 1004 . this decision may not require human choice as it may be predetermined depending on the monitorable condition . step 1006 represents the autonomous comparative method where the patient &# 39 ; s localized electrical activity is processed as mentioned in fig8 and compared to either the patient &# 39 ; s own normal dataset , or a normative dataset that is a statistical norm for healthy individuals that are not exhibiting the patient &# 39 ; s monitorable condition . the comparison would be performed utilizing a number of statistical tests , described in fig8 . step 1010 represents the autonomous non - comparative method where the patient &# 39 ; s localized electrical activity is processed as mentioned in fig8 and relevant activity assessed to see if it is crossing over or under a threshold derived from either the patient &# 39 ; s own correlative dataset , or a correlative dataset from a number of patients . upon the completion of the autonomous test , a result or an alert indicating a chance in condition would be indicated in step 1008 , which could be interpreted by the operator either before or after integration into the final presentation method ( fig7 a step 712 ), or interpreted by the patient if a portable embodiment of the invention is utilized . fig1 depicts how the present invention can be utilized to treat the wide variety of treatable conditions that consists of the brain disorders and treatable conditions mentioned in sections [ 00026 - 00028 ]. in general , the role of the present invention in the realm of treatment is to serve as a guidance system to help target a particular treatment . this would be accomplished by using the present invention to isolate a target region or a target electrical activity pattern which is characteristic of a treatable condition . subsequently a corrective action is taken using any of a number of treatment modalities , described below . many of the methods utilized by this application are similar if not identical to those in the researching , diagnosing , and monitoring applications . step 1102 is where decision to use an autonomous method is made , and the particular choice depends on the patient &# 39 ; s treatable condition . this decision may not require human choice as it may be predetermined depending on the treatable condition . the non - autonomous method is based on observation for known characteristics , as depicted in step 1106 . the operator performs this observation utilizing the tools and methods of the invention in addition to drawing upon the experience of the operator in recognizing regions or activities as potential targets in the treatable condition , as shown in step 1112 . the autonomous methods are further divided into comparative and non - comparative methods at the decision made in step 1104 . this decision may not require human choice as it may be predetermined depending on the treatable condition . step 1110 represents the autonomous comparative method where the patient &# 39 ; s localized electrical activity is processed as mentioned in fig8 and compared to either the patient &# 39 ; s own normal dataset , or a normative dataset that is a statistical norm for healthy individuals that are not exhibiting the patient &# 39 ; s treatable condition . the comparison would be performed utilizing a number of statistical tests , described in fig8 . step 1108 represents the autonomous non - comparative method where the patient &# 39 ; s localized electrical activity is processed as mentioned in fig8 and relevant activity assessed to see if it is crossing over or under a threshold derived from either the patient &# 39 ; s own correlative dataset , or a correlative dataset from a number of patients . upon the completion of the autonomous test , regions or activities would be identified as potential targets for the treatable condition , as shown in step 1112 . when a target has been identified , the operator can then proceed with administering a treatment , as depicted by step 1114 , such as a non - invasive treatment with a transcranial magnetic stimulation ( tms ) device , or an entrainment device . entrainment devices are used to attempt to modify the electrical activity in the patient &# 39 ; s brain , generally to bring about a beneficial effect . such devices may stimulate the patient visually , acoustically or via another sensory modality . tms devices utilize magnetic fields to modify the patient &# 39 ; s brain electrical activity . at this point the results of the treatment may be observed using the final presentation method ( fig7 a step 712 ) for effectiveness . in addition , the operator may want to refer the patient for a surgical intervention , such as the implantation of a stimulatory or inhibitory device to invasively treat the target . at this point the operation of the present invention will terminate as the procedure has been completed . fig1 depicts how the present invention can be utilized to detect whether a subject is lying or telling the truth . in order to develop this application , signature patterns for localized near - real time electrical activity indicative of lying and truthfulness may be identified through research trials utilizing the present invention and methods previously described in fig8 . to elaborate , the trials may involve generating datasets from subjects who are instructed to lie or instructed to tell the truth and who comply with this request while connected to the present invention . these datasets of truths and lies may later be used when testing future subjects for lying and may serve as a basis for comparison . the first specific step in the lie detecting application is the decision step 1202 asking whether to use an autonomous method . the answer depends on the results of the research trial into the most accurate determining test for truthfulness . if the trial indicates that the non - autonomous method is ideal ( akin to how polygraphs are still completely human - interpreted ), then steps 1204 - 1208 will commence afterwards ; otherwise , steps 1210 - 1212 will . the subject would then be stimulated , as previously described in fig7 step 726 , where in this case , the stimulus could be in the form of a question that would elicit a response from the subject , which may or may not be a truthful one . it may also involve other forms of stimulation such as showing someone an object . in some instances no question is asked and the subject &# 39 ; s electrical activity is studied for known indicators of lying . step 1204 is an optional step that involves the observation of a single or any combination of additional near - real time signals from other signal acquisition devices such as those previously described in fig7 c . each of these signals may have characteristic markers for lying including previously known physiological markers for lying , video markers for lying ( such as facial expressions and gestures ), or near - real time audio markers of lying . step 1206 involves the observation for known characteristics utilizing interpretation of the final presentation method from fig7 a step 734 . the human operator may utilize any single tool or combination of tools for manipulating electrical activity ( fig4 - 6 ) to assist in the isolation of the localized activity specific to lying and truthfulness . based on the observations from step 1206 , the human operator would then form an opinion on lying . at this point the application would be complete , and the operation of the present invention terminated . if the autonomous method of determining truthfulness was demonstrated to be ideal , then step 1210 would execute , the subject &# 39 ; s localized electrical activity would be compared , using the previously described statistical tests , to the subject &# 39 ; s own baseline ( normal truthful state ), or a baseline generated from a number of healthy truthful subjects in an identical way that the normative dataset would be generated from fig8 . at this point , a result or alert on the subject &# 39 ; s truthfulness would be indicated by the statistical test utilized , and incorporated into the final presentation method in fig7 a step 712 . fig1 depicts how the present invention can be utilized to educate the subject &# 39 ; s own brain such that the condition , disease or performance of the subject &# 39 ; s brain would improve . it is possible to use the present invention to educate people to modulate their cortical activity by using the results presented using the final presentation method as a form of biofeedback so as to teach the brain to work more effectively or to reduce the occurrence of an ineffective or abnormal state or process . step 1302 is the first step in this application , which is to identify an objective for correction or improvement , i . e . the subject ( or the subject with the assistance of a therapist ) must opt either to train a desirable electrical activity to occur , or to decide to train an undesirable activity so that it does not occur . for example , if a subject has difficulty concentrating , then the subject may want to improve on the ability to suppress alpha - band electrical activity located in the posterior of the cerebral cortex . a system of rewards and punishments may be used to encourage desirable patterns and discourage unwanted patterns . the subject then has the choice in decision step 1304 , to look at raw data only , or data that has been processed in an assistive manner . raw data in this case is defined as localized electrical activity that has not had any algorithms such as those mentioned in fig8 performed on the data . if the subject chooses to observe raw data only , then the subject may choose to interpret it then examine it using the final presentation method , which would involve fig7 a step 734 , or the subject could remain passive and just examine it without application - specific interpretation by proceeding to fig7 a step 712 . if the subject chooses to observe the localized electrical activity that has been computationally assisted via a previously described algorithm , then the algorithm would provide the necessary evidence , especially if there had been a research trial completed on the particular objective for correction or improvement . the subject would then examine the computationally assisted localized electrical activity using the final presentation method , which would involve fig7 a step 712 . at this point , the subject would then attempt to enact a mental change to attempt to achieve the objective . fig1 depicts how the present invention may be utilized to entertain the subject . entertaining is defined as the enjoyment or excitement obtained by a subject upon seeing a display of his or her own electrical activity . step 1402 is a decision step asking whether the entertainment application involves autonomous algorithms to process the localized electrical activity . if the application does not involve autonomous processing , then the subject would then watch his or her own localized electrical activity utilizing the final presentation method , in fig7 a step 712 . if the application does involve autonomous processing , then the subject would be able to utilize algorithms such as those previously described to recognize patterns automatically which can then in turn be utilized to manipulate a game character or visually entertaining display which ultimately is presented using the final presentation method to display a visual change in the character ( fig7 a step 712 ). in this instance the character may be an image of a person or an object . there are a number of options as to which localized signals are harnessed to manipulate the character . the movement of the character on the screen could be linked to electrical activity with is non - volitional , in which case the movement of the figure would be under involuntary control . however , if volitional signals from the motor cortex were localized and captured , then it is possible to have the characters moving according to the volition of the operator . methods of effecting an industrial purpose utilizing the present invention — fig1 fig1 depicts how the present invention may be utilized to effect an industrial purpose . it is possible to isolate localized electrical activity emanating from a subject and then to capture it and activate a change in the environment using an effector . effectors can be mechanical , as in the case of a robotic arm ; physical as when causing changes in temperature : or chemical , whereby a chemical changes are produced . step 1402 is when an effector would be setup , leading into fig7 a step 70 , when other devices are to be setup . step 1404 entails the use of algorithms to autonomously recognize certain patterns and capture them so as to activate an external effector to produce a tangible effect on the surrounding environment . examples include industrial processes to control an external mechanical device , such as an assembly arm , or other industrial robots . the method of pattern recognition may involve one of the previously described algorithms or approaches , specifically from fig8 , but it also may require the development of new algorithms to account for the fine control that may be required of certain effectors . in order for the environmental manipulation to be planned and meaningful volitional signals emanating from the frontal lobe of the cerebral cortex , and especially the areas of the brain involved in voluntary motor control will likely need to be isolated , then captured , and finally utilized to activate an effector in step 1406 . in addition , it is possible to add a transmitter , which is in turn connected to a receiver and finally connected to a remote effector in order to produce an industrial change in the environment at a remote location . an alternate embodiment of the invention is directed towards a method of performing near - real time three - dimensional display and analysis with multiple forms of near - real time statistical analysis and quantification using state of the art components including a customized solution space ( based on the subject &# 39 ; s own cerebral cortex isolated from his or her own mri or other appropriate brain imaging methodology , using accepted techniques currently in use ), an electrode digitizer ( a device that accurately measures the electrode positions on the subject &# 39 ; s scalp in 3d space ), ultrahigh sampling eeg amplifiers / recorders (& gt ; 20 khz , so as to sample the cortical activity with great rapidity to allow for generating as many pictures of the cortex as possible per second ); the most accurate inverse solution approximations which would allow for the display of voxels with the highest possible spatial resolution despite computational expense ; the fastest computers available on the market ; and large and / or multiple high resolution screens . this embodiment would be especially useful for imaging changes occurring over extremely short time intervals , and in which multiple forms of analysis are needed to clarify the cortical activity . in one embodiment of the present invention , data generated using an inverse solution is analyzed by a microcomputer which identifies specific danger signals . this microcomputer is in turn connected to an alarm such as a bell which alerts medical personnel to possible danger to the patient . this embodiment can be without the use of imaging or the display of localized electrical activity . this embodiment represents a portable version of the invention . an alternate embodiment of the portable invention entails integration with telemedicine methods including transmitters and receivers so that the signals and data are communicated to a second location where clinicians can view and interpret the data for a patient that is remote to them . ambulatory monitoring of persons that are conscious and can walk may be performed using miniature amplifiers . another embodiment of the invention is directed at a method of monitoring electrical activity in sleep and as an aid in the quantification and analysis of sleep stages and as an aid to the diagnosis of sleep disorders . in this embodiment , it is possible to perform near - real time three - dimensional display and analysis of known clinically important waveforms and frequency bands including alpha , beta , delta and theta within sleep activity in separate windows on a screen or screens simultaneously , by combining elements of the present invention with existing techniques involving physiological monitoring devices of parameters that are used in the field of sleep medicine such as oxygenation , or heart rate , it is possible to create an improved form of polysomnography . the present invention should not be considered limited to the particular examples described above , but rather should be understood to cover aspects of the invention as fairly set out in the attached claims . various modifications , equivalent processes as well as numerous structures to which the present invention may be applicable will be readily apparent to those of skill in the art to which the present invention is directed upon review of the specifications . | 6 |
fig1 shows a filtering device 100 which consists substantially of a housing 20 and a screen plug 10 . the particularly cylindrical screen plug 10 is movably mounted in a screen plug bore 27 of the housing 20 . on the inlet side of the housing 20 , an inlet opening 23 is provided , which branches into two housing inlet channels 21 , 22 . each housing inlet channel 21 , 22 is in connection with a screen cavity 13 , 14 in the screen plug 10 , when the screen plug 10 is in the production position depicted in fig1 . on the other side of the housing 20 , an outlet opening 26 is provided , at which the two housing outlet channels 24 , 25 join . the housing outlet channels 24 , 25 each are in connection with the clean side of the screen cavities 13 , 14 . within the screen cavities 13 , 14 , screen elements 13 . 1 are inserted . behind the screen elements 13 . 1 , viewed in the throughflow direction , the screen cavity 11 in each case narrows to a funnel area 11 . 6 . whereas in conventional filtering devices , a screen plug outlet channel usually starts directly from the tip of the funnel area 13 . 1 , in the filtering device 100 according to the invention a screen plug outlet channel 11 is provided with an inlet area 11 . 1 which is directly adjacent to the funnel area 11 . 6 . the inlet zone 11 . 1 is delimited by a flank 11 . 4 which starts approximately from the tip of the conical funnel area 11 . 6 and from there extends over some distance toward a second flank 11 . 5 . the second flank 11 . 5 extends approximately in the extension of the lateral delimitation of the screen cavity 11 and thus approximately parallel to the center axis of the screen cavity 11 . at a deflecting point 11 . 3 , the screen plug outlet channel 11 is deflected by an angle of 90 ° or also less , and transitions into an outlet zone 11 . 2 . in the outlet zone 11 . 2 , the screen plug outlet channel 11 then extends farther as a groove , which is preferably configured approximately in the shape of a keyway , and finally transitions into the housing outlet channel 24 . the same holds for the other screen cavity 12 on the right side of the filtering device 100 with a screen plug outlet channel 12 shown in fig1 , which also has an inlet zone 12 . 1 , a deflecting point 12 . 3 , and an outlet zone 12 . 2 . in the represented embodiment example , the outer flanks 11 . 5 , 12 . 5 of the inlet zone 11 . 1 , 12 . 1 extend in each case parallel to the direction of flow , and the inclined flanks 11 . 4 , 12 . 4 extend from inside to outside in the represented embodiment example , wherein “ inside ” is defined as the center line which extends between the screen cavities 13 , 14 , and thus also , in the production position shown , centrally through the inlet opening 23 and the outlet opening 26 . whereas in fig1 the inlet zones 11 . 1 , 12 . 1 have a triangular appearance , in a transverse cross - sectional plane through the screen plug 10 , as represented in fig2 , they appear only as a thick disk which is adjacent to the funnel area 11 . 6 . the operation of the filtering device according to the invention is explained below : during normal production operation according to fig1 , the two screen cavities 13 , 14 are located before the inlet channels 21 , 22 . on the outlet side , the openings of the outlet zones 11 . 2 , 12 . 2 are also located before the openings of the outlet channels 24 , 25 . the melt is able to flow uniformly through the two screen cavities 13 , 14 , and the flow distribution indicated by the arrows becomes established . in the case of soiling of a screen cavity — as shown in fig3 — the screen plug 10 can be withdrawn from the housing 20 until one of the screen cavities 14 is in a position that is freely accessible outside of the housing 20 . there , the screen cavity 14 including the outlet zone 12 . 2 can be cleaned without effort . the screen element 12 . 7 is also freely accessible , so it can be taken out and replaced . in the mean time , the melt , as before , is able to flow through the housing inlet channel 22 into the screen cavity 13 , and from there it can flow off again through the housing outlet channel 25 , so that the production operation does not have to be interrupted . after the screen cavity 12 has been cleaned and optionally provided with a new screen insert , the screen plug 10 is again moved back into the housing 20 , but at first not yet into the production position according to fig1 , but rather into a position shown in fig4 , in which a gradual filling of the previously cleaned screen cavity 12 with the melt and simultaneous ventilation of the screen cavity 12 occur . in this position , the screen cavity 14 is in connection with the housing inlet channel 22 only by a very small connection site 14 . 2 , so that only a greatly slowed melt flow into the screen cavity 14 is possible . consequently , the melt can accumulate in the screen cavity 14 and displace the air contained therein . in the upper area of the screen plug , a ventilation groove 14 . 3 is provided . in fact , said ventilation groove is not located , as indicated here , in the cross - sectional plane through the center axis , but above said plane , on the cylindrical jacket of the screen plug . therefore , it is indicated in fig4 only by the dashdotted line . rising air can flow out of the bore 14 . 4 , and it reaches the groove 14 . 3 which extends outside of the housing edge of the housing 20 , so that air can escape there . after the preflooding of the screen cavity 12 and the ventilation , the screen plug 10 is then moved back into the production position shown in fig1 . the groove 14 . 3 is then located again entirely within the housing 20 , and it is thus sealed off in the housing bore 27 . in fig5 , an additional embodiment of a filtering device 100 ′ is represented . the housing design of the housing 20 corresponds to the above - described embodiment . additional backwash bores 28 are provided only beneath the screen plug 10 ′. the screen plug 10 ′ is also largely similar to the screen plug 10 of the first embodiment . the design , which is essential for the invention , of the screen plug outlet channel with an inlet zone 11 . 1 ′ and an outlet zone 11 . 2 ′ corresponds to that of the first embodiment . the difference is that , besides the screen cavities 13 ′, 14 ′, a backwash opening 15 ′ is provided in each case , which has to be brought to correspond with the backwash bores 28 in the housing 20 . in the position shown in fig5 , a normal production operation occurs . the two screen cavities 13 ′, 14 ′ are supplied through the housing inlet channels 21 , 22 . from the production position according to fig5 , the screen plug 10 ′ can be moved sideways out of the housing 20 , so that one of the screen cavities , in this case the right screen cavity 14 ′, is completely cut off from the housing inlet channels 21 , 22 . the melt can now flow through the left screen cavity 13 and the screen plug outlet channel 11 thereof into the inlet channel 24 , and then again through the outlet channel 25 into the right screen cavity 14 ′, because there is no longer any pressure applied to the soiled side of the screen cavity 14 ′. instead , in this position , there is a connection to the backwash bore 15 ′ on the soiled side of the screen cavity 14 ′. the melt can flow through said connection to the backwash bore 28 in the housing , and from there it reaches the outer side of the housing 20 . coarse soiling particles that adhere to the soiled side of the screen element 13 . 1 can be detached by backwashing in a manner which in itself is known . in the second embodiment of a filtering device 100 ′, the screen plug 10 ′ can be moved even farther out of the housing 20 , so that a screen replacement analogous to the position in fig3 is possible . similarly , a ventilation and preflooding of the clean screen cavity is possible analogously to the procedure described in fig4 . a third embodiment of a filtering device 200 is represented in fig7 a , 7 b and 8 . it comprises two identical screen plugs 210 , 210 ′, which can be shifted independently of each other via the hydraulic cylinders 231 , 232 in a housing 220 . each screen plug 210 , 210 ′ has , as can be seen in fig7 a and 7 b , two screen cavities 213 , 214 , 213 ′, 214 ′ next to each other and , moreover , as can be seen again in the cross section according to fig8 , again the same number of screen cavities on the rear side , so that the filtering device 200 has a total of eight screen cavities . in fig7 a , the production position is shown in a side view on the filtering device 200 , in which the two screen plugs 210 , 210 ′ are positioned in such a manner that there is flow through all the screen cavities 213 , 214 , 213 ′, 214 ′. the fluid flows through an inlet opening 223 at the top in the housing into housing inlet channels 221 , 222 that branch off from said housing , into the screen cavities 213 , 214 , 213 ′. 214 ′, each of which has at least one filter element that is not shown here . in the flow direction behind the filter elements , in each case — as also in the embodiments according to fig1 - 6 — a funnel area is present , in which the fluid collects , and is led to an inlet zone 211 . 1 , 212 . 1 of a screen plug outlet channel 211 , 212 which starts in an edge region of the given screen cavity 213 , 214 , 213 ′. 214 ′. adjacent to this there is in each case , in the screen plug outlet channel 211 , 212 , a deflecting point 211 . 3 , 212 . 3 , wherein a transition into the outlet zone 211 . 2 , 212 . 2 occurs . the latter extends parallel to the center axis of the screen plugs 210 , 210 ′, until they open into the v - shaped mutually separated housing outlet channels 224 , 225 . the housing outlet channels 224 , 225 lead to a common outlet opening 226 at the bottom on the housing 220 . fig7 b shows a situation in which the upper screen plug 210 is in a so - called screen replacement position . here , the screen cavity 213 which is visible on the left outside and the associated screen cavity of the same pair are positioned on the rearward side of the screen plug 210 outside of the housing 220 . the screen cavities 213 can be cleaned , and the filter elements contained therein can be removed . the right screen cavity 214 , on the other hand , has a connection to the left housing outlet channel 224 and can thus continue to be fully used . fig8 shows a cross section along the dashdotted line in fig7 a , which extends through the inlet and the outlet openings 223 , 226 . the screen cavities 214 , 214 ′ which are visible in fig7 a and 7 b from the side have , on the other side of the screen plugs 210 , 210 ′, counterpieces in the form of screen cavities 216 , 216 ′. the broken lines indicate the course of the housing inlet channels 221 , 221 ′ and the housing outlet channels 225 . in order to be able to supply a total of eight screen cavities of the filtering device 200 , four vertical housing inlet channels 221 , 221 ′ are provided , which first branch away from the inlet opening 223 , and then lead downward on both sides of the screen plugs 210 , 210 ′, wherein they tangentially intersect the screen cavities 214 , 216 , 214 ′, 216 ′. at the same time , four housing outlet channels 225 are provided , which branch off in the longitudinal direction from an outlet opening 226 ( see fig7 a , 7 b ) or open into said opening , and which also strut apart height - wise ( see fig8 ) in such a manner that they cut the upper screen plugs 210 at the bottom and the bottom screen plugs 210 ′ at the top . in this representation , one can clearly see the groove - shaped outlet zones 212 . 2 , 212 . 2 ′, which are in connection with the housing outlet channels 225 . | 1 |
the first embodiment of the monitoring device and antenna combination of the present invention is depicted in fig1 - 4 and is indicated generally by the numeral 10 . in accordance with one of the objectives of the invention , monitoring device and antenna combination 10 includes a dipole antenna 12 that is connected to a monitoring device 14 . dipole antenna 12 is mounted on a pneumatic tire 16 in a manner that maximizes the probability of desirable signal propagation through the tire sidewall 18 . pneumatic tire 16 includes a bead ring 20 from which sidewall 18 extends outwardly substantially radially . a package of reinforcing cords 22 extends around bead ring 20 and radially outward through sidewall 18 . reinforcing cord package 22 may be fabricated from a variety of materials and disposed in a variety of orientations in sidewall 18 . in large , off - the - road tires , reinforcing cord package 22 may include a plurality of metal reinforcing cords 24 that each extend radially outward through sidewall 18 . cords 24 are thus closer together adjacent bead ring 20 that at the outer radius of sidewall 18 . tire 16 further includes an innerliner 26 positioned on the inside surface of tire 16 . innerliner 26 may be significantly thicker in off - the - road tires than it is in passenger car tires . as is known in the art , pneumatic tire 16 is mounted on a rim and has a pressurized inner chamber when in use . monitoring device and antenna combination 10 are disposed in this pressurized chamber as shown in fig1 . monitoring device 14 may include a board 30 upon which a pair of batteries 32 , a central processing unit ( cpu ) 34 , and at least one sensing element 36 are mounted . various other elements may also be positioned on board 30 . this specific configuration of monitoring device 14 is not to limit the scope of the invention as numerous monitoring device configurations will function with the present invention . antenna 12 is in electrical communication with sensing element 36 such that the information gathered by sensing element 36 can be transmitted by antenna 12 outside of tire 16 . components 30 , 32 , 34 , and 36 are all encapsulated by an encapsulation material 38 to form an encapsulated monitoring device 40 . encapsulation material 38 provides protection to components 30 , 32 , 34 , and 36 . encapsulation material 38 may be a suitable epoxy or other material that is substantially rigid after it has encapsulated the components . dipole antenna 12 includes a first antenna element 50 and a second antenna element 52 that extend away from each other . each element 50 and 52 may be preferably fabricated from a round metal wire although different materials may be used without departing from the concepts of the invention . dipole antennas are known in the art and may have various configurations , any of which may be used with the present invention . each antenna element 50 and 52 is connected to and is in electrical communication with sensing element 36 by a suitable connector 54 that may be one of a variety of connectors known in the art . antenna 12 is disposed in an attachment patch 60 that is used to mount encapsulated monitoring device 40 on innerliner 26 . attachment patch 60 includes a foot portion 62 that extends away from encapsulated monitoring device 40 . antenna 12 is preferably located in foot portion 62 . encapsulated monitoring device 40 is mounted on attachment patch 60 by a suitable connector , such as an adhesive that is known in the art . similarly , attachment patch 60 is mounted on innerliner 26 by a suitable connector , such as an adhesive , that is known in the art . as may be seen in fig1 and 2 , antenna 12 is arranged and configured with respect to tire sidewall 18 such that antenna 12 is above bead ring 20 and substantially perpendicular or orthogonally oriented to reinforcing cords 24 . in accordance with one of the objectives of the invention , locating antenna 12 substantially perpendicularly to reinforcing cords 24 maximizes the probability of desirable signal propagation through tire sidewall 18 . when monitoring device and antenna combination 10 is used with another tire that has reinforcing cords 24 that are biased , antenna 12 is turned so that antenna 12 remains substantially perpendicular to reinforcing cords 24 . it has been found that the signal propagation pattern from radial dipole antenna 12 provides a good probability of signal propagation through sidewall 18 . fig2 depicts three monitoring device and antenna combination 10 locations as shown at 10 a , 10 b , and 10 c . each combination 10 a , 10 b , and 10 c includes an antenna 12 a , 12 b , and 12 c connected to an encapsulated monitoring device 40 a , 40 b , 40 c . the curvature of each antenna 12 a , 12 b , and 12 c matches its location with respect to sidewall 18 such that the curvature of antenna 12 is substantially equal to the radius of curvature of sidewall 18 . the dipole antenna , which is mounted to the tire at one of a plurality of radius distances defined by the sidewall , has a radius of curvature that is substantially equal to the radial distance where the dipole antenna is mounted . as such , the radius of curvature of antenna 12 a is less than the radius of curvature of antenna 12 b and both radii of curvatures for antennas 12 a and 12 b are less than the radius of curvature for antenna 12 c . by matching the radius of curvature of antenna 12 a with its location on tire sidewall 18 , each intersection of antenna 12 with a reenforcing cord 24 is substantially perpendicular or orthogonal . the first alternative embodiment of the invention is depicted in fig5 and 6 . the components of the first alternative embodiment are substantially the same as described above and the same numbers are used to refer to the same elements . in this embodiment , patch 60 includes a groove 70 into which antenna 12 is placed when encapsulated monitoring device 40 is attached to attachment patch 60 . groove 70 properly positions antenna 12 with respect to attachment patch 60 so that a person installing attachment patch 60 and encapsulated monitoring device 40 will know that antenna 12 is oriented in a certain manner with respect to patch 60 . after antenna 12 is disposed within groove 70 and encapsulated monitoring device 40 is securely to attachment patch 60 , a covering material 72 is positioned over antenna 12 and groove 70 to cover antenna 12 from the inside of tire 16 . covering material 72 also holds antenna 12 in position . covering material 72 preferably may be an epoxy but may be other materials that are known in the art . the second alternative embodiment of the invention depicted in fig7 where antenna 12 is embedded within innerliner 26 . in this embodiment , antenna 12 is positioned within innerliner 26 during the fabrication of tire 16 such that antenna 12 is substantially perpendicular to reinforcing cords 24 . tire 16 is then cured with antenna 12 which is held in innerliner 26 . monitoring device 14 is then connected to antenna 12 at a later time by known means . a third alternative configuration of the monitoring device and antenna combination of the present invention is depicted in fig8 and is indicated generally by the numeral 100 . the antenna 102 of configuration 100 includes first antenna element 50 and second antenna element 52 of radial - dipole antenna 12 discussed above . antenna 102 further includes a third antenna element 104 that is spaced from first and second antenna elements 50 and 52 . third antenna element 104 is connected to first and second elements 50 and 52 by a pair of end elements 106 that are substantially semi - circular . in accordance with the objectives of the present invention , antenna elements 50 , 52 , and 104 are oriented substantially perpendicular to the lines of electrical interference in sidewall 18 . a fourth alternative embodiment of the monitoring device and antenna combination of the present invention is depicted in fig9 and is indicated generally by the numeral 110 . combination 110 includes substantially the same elements as combination 100 disclosed above . the only difference is that the end elements 112 of radial dipole antenna 114 are each substantially perpendicular to the end portions of antenna elements 50 , 52 and 104 . in accordance with the objectives of the present invention , radial dipole antenna 114 is positioned to be substantially perpendicular to the lines of electrical interference in sidewall 18 . accordingly , the improved - radial dipole antenna and tire tag combination is simplified , provides an effective , safe , inexpensive , and efficient device which achieves all the enumerated objectives , provides for eliminating difficulties encountered with prior devices , and solves problems and obtains new results in the art . in the foregoing description , certain terms have been used for brevity , clearness , and understanding ; but no unnecessary limitations are to be implied therefrom beyond the requirement of the prior art , because such terms are used for descriptive purposes and are intended to be broadly construed . moreover , the description and illustration of the invention is by way of example , and the scope of the invention is not limited to the exact details shown or described . having now described the features , discoveries , and principles of the invention , the manner in which the radial dipole antenna and tire tag combination is constructed and used , the characteristics of the construction , and the advantageous new and useful results obtained ; the new and useful structures , devices , elements , arrangements , parts , and combinations are set forth in the appended claims . | 7 |
fig1 illustrates a laminated rotor core 100 for use with the present invention . the laminated rotor core 100 is preferably used in a squirrel cage rotor of an induction motor for a compressor . the laminated rotor core 100 is formed or assembled by stacking a plurality of laminations 102 . the number of laminations required to assemble the laminated rotor core 100 is dependent upon the thickness of the laminations 102 and the desired height of the laminated rotor core 100 . in one embodiment of the present invention , the thickness of the laminations can range from about 0 . 015 inches to about 0 . 025 inches and is preferably 0 . 022 inches thick for a standard application and 0 . 018 inches thick for a “ low loss ” application . fig2 illustrates a top view of a lamination 102 . each lamination 102 that is assembled into the laminated rotor core 100 preferably has a central aperture or bore 104 . the central bore 104 of the laminated rotor core 100 is configured to receive the shaft of the motor upon complete assembly of the motor . in addition , each lamination 102 preferably has a plurality of rotor slots or apertures 106 . the rotor slots 106 are preferably completely enclosed by the outer circumference of the laminated rotor core 100 , i . e ., they are closed rotor slots . it is to be understood that apertures 106 , while being referred to as rotor slots and shown as circular apertures in the figures can have any desired shape including oval , circular , rectangular , irregular or any other suitable shape . the plurality of rotor slots 106 are positioned circumferentially about the center axis a of the lamination 102 . the plurality of rotor slots 106 are preferably positioned equidistant and / or equiangular to one another about the axis a . the shape , number and size of the rotor slots 106 are dependent on the particular configuration of the motor and rotor cage used . in one embodiment of the present invention , the number of rotor slots ( and bars ) can range from about 20 to about 40 and is preferably 34 bars for a high torque application and 28 bars for a high performance application . furthermore , each rotor slot 106 is positioned a distance “ d ” from the outer circumference of the lamination 102 . the distance “ d ” corresponds directly to the bridge thickness of the lamination 102 and laminated rotor core 100 . to obtain optimal motor performance , the bridge thickness “ d ” should be as small or thin as possible while still maintaining the structural integrity of the rotor during operation of the motor . for example , for a laminated rotor core 100 having an outer diameter of 2 . 6 inches , the bridge thickness is preferably between about 0 . 01 inches and about 0 . 02 inches wide . the preferred bridge thickness “ d ” can vary depending on the configuration and size of the motor . finally , it is to be understood that the lamination 102 can include additional features which are not shown for simplicity . the laminations 102 are preferably formed from a magnetic material such as iron or steel by an extrusion or pressing operation of one or more steps . once the extrusion operation is complete , the laminations 102 will preferably have a top view similar to the top view of fig2 . after the laminations 102 are extruded , they are stacked or assembled to obtain the laminated rotor core 100 . during the assembly operation , the laminations 102 are preferably aligned and / or oriented to obtain a central bore 104 which extends substantially longitudinally and coaxially through the laminated rotor core 100 and to obtain rotor slots 106 which extend substantially longitudinally and coaxially through the laminated rotor core 100 , i . e ., the rotor slots 106 have a skew of 0 degrees . in another preferred embodiment , the laminations 102 can be oriented to obtain rotor slots 106 that extend longitudinally through the laminated rotor core 100 with a skew of 2 - 15 degrees and preferably between about 4 - 12 degrees . the embodiment of the laminated rotor core 100 that does not have a skew of the rotor slots 106 can be used for a three phase application and the embodiment of the laminated rotor core 100 that has a skew of the rotor slots 106 can be used for a single phase application . in a preferred embodiment of one process of the present invention , laminations 102 are formed or extruded with a bridge thickness “ d ” that provides for optimal performance of the motor , and are then assembled together to form the laminated rotor core 100 . the laminated rotor core 100 is placed in a mold of a casting or injection molding apparatus ( not shown ). once the laminated rotor core 100 is placed in the mold , both radial forces and pressure and axial forces and pressure are applied to the laminated rotor core 100 by the mold and / or casting or injection molding apparatus to hold or secure the laminated rotor core 100 in position for the casting or injection molding operation and to prevent the molten material used in the casting or injection molding process , preferably aluminum or aluminum alloy , from leaking or seeping between the stacked laminations 102 of the laminated rotor core 100 . upon being secured in the mold of the casting or injection molding apparatus , the laminated rotor core 100 is now ready for the commencement of the casting or injection molding operation to manufacture some or all of the rotor cage . the casting or injection molding apparatus includes a system or device for casting , injecting or introducing the rotor bars into the rotor slots 106 of the laminated rotor core 100 and preferably a mold or cast for casting , injecting or introducing end rings to connect the ends of the rotor bars . the application of both the radial and axial forces to the laminated rotor core 100 during the casting or injection molding operation prevents the leaking or seeping of the molten material between the stacked laminations 102 even though the laminations 102 and laminated rotor core 100 have a “ thin ” bridge thickness “ d ” for optimal performance of the motor . fig3 and 4 illustrate schematically two embodiments for applying the axial and radial forces to the laminated rotor core 100 . in fig3 , the laminated rotor core 100 is held in position by one or more axial force members 302 and one or more radial force members 304 . the axial force members 302 are configured and disposed to apply an axial force f a , as shown in fig3 , to the top and bottom of the laminated rotor core 100 to axially compress the laminated rotor core 100 and laminations 102 without interfering with the casting operation . in addition , the axial force members 302 are configured and disposed to preferably apply the axial force f a about substantially the entire circumference of the laminated rotor core 100 , although the axial force f a can be applied to selected segments of the laminated rotor core 100 . similarly , the radial force members 304 are configured and disposed to apply a radial force f r , as shown in fig3 , to the sides or outer perimeter of the laminated rotor core 100 to radially compress the laminated rotor core 100 and laminations 102 without interfering with the casting operation . in addition , the radial force members 304 are configured and disposed to preferably apply the radial force f r about substantially the entire outer perimeter of the laminated rotor core 100 , although the radial force f r can be applied to selected segments of the laminated rotor core 100 . in fig4 , the laminated rotor core 100 is held in position by two or more “ l ”- shaped force members 402 . the “ l ”- shaped force members 402 are configured and disposed to apply both an axial force f a , as shown in fig4 , to the top and bottom of the laminated rotor core 100 to axially compress the laminated rotor core 100 and laminations 102 without interfering with the casting operation and to apply a radial force f r , as shown in fig4 , to the sides or outer perimeter of the laminated rotor core 100 to radially compress the laminated rotor core 100 and laminations 102 without interfering with the casting operation . in addition , the “ l ”- shaped force members 402 are configured and disposed to preferably apply the axial force f a and the radial force f r about substantially the entire circumference and outer perimeter of the laminated rotor core 100 , although the axial force f a and the radial force f r can be applied to selected segments of the laminated rotor core 100 . in this embodiment of the present invention , any suitable type of casting or injection molding apparatus and / or mold can be used for the casting or injection molding of the rotor cage so long as the casting or injection molding apparatus and / or mold can apply both an axial force or pressure and a radial force or pressure to the laminated rotor core at the same time during the casting operation . finally , while not described herein , the remaining process steps for the manufacture of the rotor and motor would be completed as is well known in the art . in another preferred embodiment of the present invention , the laminated rotor core 100 is assembled using the laminations shown in fig5 - 7 . fig5 illustrates a top view of the lamination 500 of this embodiment of the present invention . as shown in fig5 , lamination 500 has a central bore 502 and a plurality of rotor slots 504 , similar to the lamination 102 described above . however , in contrast to the lamination 102 of fig2 , the lamination 500 , as shown in greater detail in fig6 , has a countersink or groove portion 506 and a collar or lip portion 508 adjacent to each rotor slot 504 . the countersink portion 506 is preferably disposed on one planar side of the lamination 500 and is preferably a channel or groove in the side of the lamination 500 that is open to the rotor slot 504 and substantially circumferentially encloses or surrounds the rotor slot 504 . the collar portion 508 is disposed opposite the countersink portion 506 on the other planar side of the lamination 500 and is preferably an extension or projection extending from the other planar side and circumferentially enclosing or surrounding the rotor slot 504 . preferably , the countersink portion 506 and the collar portion 508 are substantially coaxial to the center axis of the rotor slot 504 . as shown in fig7 , when assembling the laminated rotor core 100 with laminations 500 , the collar portions 508 of each lamination 500 are preferably configured to mate with or fit in the countersink portions 506 of adjacent laminations 500 , such that an interference fit or connection is formed between the two . the countersink portions 506 and the collar portions 508 are preferably configured and disposed on the lamination 500 such that a substantially cylindrical rotor slot 504 is produced as shown in fig7 , which rotor slot 504 is similar to the rotor slot 106 of lamination 102 . when assembled , the countersink portion 506 and the collar portion 508 form a liquid barrier between a spacing 510 between the laminations 500 and the rotor slots 504 . the liquid barrier formed by the countersink portion 506 and the collar portion 508 is used to prevent the molten material used to cast the rotor bars from leaking or seeping between the laminations 500 during the casting operation . while the countersink portion 506 and the collar portion 508 are shown with surfaces that are substantially parallel or perpendicular to the central axis of the rotor slot 504 , the surfaces of the countersink portion 506 and the collar portion 508 can have any type of surface including angled or curved surfaces so long as the countersink portion 506 and the collar portion 508 can be fit together to form an interference fit and the rotor slot 504 is not altered . furthermore , the depth of the countersink portion 506 is substantially equal to the height of the collar portion 508 . however , it should be noted that slight differences in the depth and height of the countersink portion 506 and the collar portion 508 may be accommodated for in the casting operation when the laminated rotor core 100 is axially compressed . in a preferred embodiment of the present invention , the height of the collar portion 508 ( or the depth of the countersink portion 506 ) is between about 10 % and about 30 % of the thickness of the lamination . the process of manufacturing a laminated rotor core 100 with laminations 500 will now be described . to begin , laminations 500 are produced by an extrusion or stamping process with a bridge thickness “ d ” that provides for optimal performance of the motor , and then the laminations 500 are assembled together to form a laminated rotor core 100 . the laminated rotor core 100 is positioned in a mold of a casting or injection molding apparatus ( not shown ) and secured or held in place . the securing and holding of the laminated rotor core 100 can be accomplished using techniques that are known in the art or by the technique described above that applies both radial forces and pressure and axial forces and pressure are applied to the laminated rotor core 100 . upon being secured in the mold of the casting or injection molding apparatus , the laminated rotor core 100 is now ready for the commencement of the casting or injection molding operation to manufacture some or all of the rotor cage . the casting or injection molding apparatus includes a system or device for casting , injecting or introducing the rotor bars into the rotor slots 504 of the laminated rotor core 100 and preferably a mold or cast for casting or injection molding end rings to connect the ends of the rotor bars . the presence of the countersink portions 506 and the collar portions 508 form a barrier in the rotor slots 504 to prevent the leaking or seeping of the molten material from between the stacked laminations 502 even though the laminations 502 and laminated rotor core 100 have a “ thin ” bridge thickness for optimal performance of the motor . while the invention has been described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims . | 8 |
referring first to fig1 a refrigerated container 10 is shown which has associated therewith an integrated electrically operated refrigeration system , comprising several components 12 , and , a controlled atmosphere system , a part of which 14 is shown . the refrigeration system 12 and the controlled atmosphere system are mounted at one end of the container and are adapted to regulate the temperature , and the atmosphere , respectively within the container 10 . with reference to fig2 the refrigeration system 12 comprises a vapor compression refrigeration system which is well known in the prior art for such application . briefly , the system includes an electrical power cord 16 , providing electrical power to a refrigeration system controller 18 . the controller 18 is preferably a programmed microprocessor which is adapted to receive inputs from the system operator and from various sensors in the refrigeration system and thereby control the operation of the refrigeration system components , in a manner which is well known in the art . the refrigeration system comprises a refrigeration circuit including an electrically driven compressor 20 communicating in turn with an evaporator coil 22 , and a condenser coil 24 . appropriate evaporator fans 26 are provided to recirculate the atmosphere within the container 10 over the evaporator coil 22 and into the container where it is appropriately circulated and returned to the evaporator coil for further cooling , again as is conventional . a condenser fan 28 is provided to direct a cooling flow of atmospheric air over the condenser coil 24 to facilitate rejection of heat removed from the container 10 . the refrigeration system controller 18 operates the various components , to maintain a selected set point temperature within the container as is conventional . the controlled atmosphere system 14 is illustrated in more detail in fig3 . the basic components of the controlled atmosphere system are an air compressor 30 , a filter 32 , an air heater 34 , a nitrogen separation membrane 36 , a system of metering valves 38 , gas sensors 40 and a controller 50 . the purpose of the controlled atmosphere system is to control the amount of oxygen and carbon dioxide inside the refrigerated container 10 to change the rate of ripening of produce stored in the container . the system controls the amount of oxygen ( o 2 ) and carbon dioxide ( co 2 ) by replacing it with nitrogen generated from the membrane 36 . with continued reference to fig3 when the controlled atmosphere system 14 is running , air 44 from outside the container enters the compressor 30 through a dust filter 46 . the atmospheric air is then compressed to a high pressure by the compressor 30 . the high pressure air is then filtered by the particulate filter 32 to remove moisture and dirt before passing to the air heater 34 . a normally closed drain valve 48 is provided on the filter 32 . the drain valve 48 is adapted to be electrically opened when energized by the controlled atmosphere system controller 50 . the controller is programmed to periodically open the drain value 48 , for a short time , to remove residue which may build up in the filter 32 . high pressure air from the filter 32 passes to the air heater 34 where it is heated to the optimum operating temperature for the membrane 36 being used in the system . as indicated in the drawing the heater output is controlled to 55 ° c ./ 131 ° f . this is the optimum operating temperature for a membrane separator 36 available as a model 4241 permeator from a company known as medal membrane separation systems dupont airliquide . the controlled atmosphere controller 50 receives inputs from a temperature sensor 52 and controls energerization of a heater switch 54 to maintain the temperature of the compressed air leaving the air heater . the warmed , high pressure air passing from the heater 34 enters the membrane 36 , where it is separated into high purity nitrogen , which passes from the nitrogen outlet 56 , and oxygen / and other gases which are passed to the oxygen outlet 58 . the rate of separation occurring in the membrane separator 36 depends on the flow of air through the membrane . this flow rate is controlled by the pressure in the nitrogen outlet 56 . the higher the pressure in the nitrogen outlet 56 , the higher the nitrogen purity generated , and the lower the flow rate of nitrogen . the membrane 36 is capable of generating nitrogen purity levels greater than 99 percent . as the pressure in the nitrogen outlet 56 falls , the purity level of the nitrogen falls , and the flow rate increases . the nitrogen enriched gas passing from the membrane through the outlet 56 passes to the flow control valves 38 . the oxygen / other gasses from the oxygen outlet 58 are exhausted to the outside air . the pressure on the nitrogen outlet 56 of the membrane 36 is regulated by the aforementioned flow control valves 38 . to control the percentage of nitrogen present in the container , the controller 50 is programmed to cycle the flow control valves 38 to increase or decrease the amount of nitrogen in the container as required . the controller 50 may also add co 2 from an external co 2 source 65 if desired . the controller 50 monitors the amount of oxygen and carbon dioxide in the container , using oxygen and carbon dioxide gas concentration sensors 40 via a sample line 64 . periodic calibration of the sensors to correct drifts with time and temperature require sampling outside air via line 66 . in normal operation , following loading of the container , and connection of the power cord 16 to an appropriate power source the refrigeration system controller 18 is energized and programmed to a desired set point temperature for the load . at the same time the controller 50 for the controlled atmosphere system is energized and set for the desired oxygen and carbon dioxide ranges for the load . with both the refrigeration system 12 and the controlled atmosphere system 14 energized and suitably programmed the refrigeration system will begin immediate operation according to its programmed operation . the controlled atmosphere system 14 however , will begin operation only when a controlled atmosphere enable switch 70 located in the refrigeration controller 18 is closed . the enable switch 70 is closed by the refrigeration system controller 18 when it determines that the operating conditions of the refrigeration system , and conditions within the refrigerated container 10 are such that it is acceptable to allow the controlled atmosphere machine to operate . the system described above in connection with figure is representative of a typical prior art system and is meant to give an understanding of the overall principals of operation of such a system . looking now to fig4 a schematic diagram of a controlled atmosphere system according to the present invention as installed in a container refrigeration unit will now be described in detail . for reference purposes it should be understood that the broken lines in the schematic are used to generally define different parts of the refrigerated / controlled atmosphere refrigeration container unit and thus are useful in describing the location of various components with respect to these parts of the unit . first the enclosed portion defined by the broken line 68 on the left hand portion represent the interior of the refrigerated container box 10 . the portion to the right of the interior of the box , identified by numeral 70 , represents the evaporator section of the combined refrigeration / controlled atmosphere unit mounted to the end of the container . it should be appreciated that the atmosphere in the evaporator section 70 is the same as the atmosphere within the container box as the circulating fans 26 of the refrigeration unit 12 recirculate the air between these sections . the right hand portion of the schematic as defined by the lines 72 is the condenser section of the combined container refrigeration controlled atmosphere unit . it will be appreciated that the condenser section is in direct contact with the normal atmosphere , with the condenser section 72 and the evaporator section 70 are separated by a substantially fluid tight barrier represented by line 74 . the system of fig4 will be described using the reference numerals used in fig3 where appropriate . looking now at fig4 in detail the intake air filter 46 is located in the condenser section 72 so as to receive outside atmospheric air . an appropriate inlet conduit 76 is in fluid communication with a two cylinder air compressor 30 which has an outlet conduit 78 for high pressure compressed air discharged therefrom . an overtemperature switch 80 is provided on the air compressor motor to direct a signal to the controlled atmosphere controller 50 should the compressor reach an unsafe temperature . the outlet conduit 78 from the compressor communicates with a tortuously shaped condensing coil 81 which serves to cool the high pressure high temperature air discharged from the compressor and to condense moisture contained therein to a liquid state . from the condensing coil 81 conduit 82 passes from the evaporator section through barrier 74 into the condenser section 72 . located in the conduit 82 is a schrader valve 84 which facilities servicing of the system as for example conducting a pressurized leak check . also located in conduit 82 is a pressure relief valve 86 designed to protect the air compressor should a high back pressure develop in the system which could damage the compressor 30 . downstream from the pressure relief valve 86 , in conduit 82 , is the air filter 32 for filtering the high pressure air discharged from the compressor 30 . in the preferred embodiment this filter is actually two separate filters , a primary discharge air filter 90 for large contaminants and a secondary discharge air filter 92 for fine particulate contaminants . each of the filters 90 and 92 is provided with a filter media which is replaceable on a periodic schedule . each filter 90 , 92 is also provided with a drain solenoid valve 94 . these electrically operated valves are normally closed and are adapted to be periodically opened by the controlled atmosphere controller 50 on a periodic schedule , for a short period of time , to remove residue built up in the filter . conduit 96 communicates the outlet of filter 92 with the inlet of the air heater 34 . as previously discussed the air heater is controlled by the system controller 50 to maintain the optimum temperature for the membrane separator 36 utilized in the system . heater operation is controlled by the system controller by way of a program which uses inputs from the desired set point temperature and from an air temperature sensor 52 which is located in the conduit 100 which communicates the outlet of the air heater 34 with the inlet of the membrane 36 . air heater temperature control inputs from the controller 50 cycle a solid state heater switch 54 located adjacent to the heater . as will be seen , the heater 54 is on whenever the compressor 30 is on . as shown in fig1 , the actual heater control output is determined by a &# 34 ; fuzzy logic &# 34 ; algorithm 156 which responds to inputs from the sensor 52 as shown at step 158 . as previously described the membrane separator 36 has an oxygen outlet 58 which extends from the separator through the barrier 74 to discharge oxygen and other gases to the outside atmosphere . the nitrogen outlet 56 also extends through the barrier 74 into the condenser section 72 where it communicates with the flow control or metering valve system 38 . located in the nitrogen outlet conduit 56 is a pressure transducer 98 which provides a pressure input to the controlled atmosphere controller 50 . an air pressure gage 102 is also illustrated in the nitrogen outlet line 56 to provide a visual reading of nitrogen pressure in the outlet line 56 . the flow control valve system 38 comprises three separate metering devices arranged in a parallel fluid flow relationship . as will be seen , these devices cooperate to control the flow of nitrogen to a nitrogen delivery line 106 which passes through the barrier 74 into the evaporator section 70 . the nitrogen delivered by line 106 is then circulated by the fans 26 of the refrigeration system to the interior 68 of the container box 10 . a flow meter 108 is shown in the nitrogen delivery line which will provide a visually perceptible reading of the nitrogen flow from the flow control valve system 38 to the container . the flow control valve system comprises two solenoid valves designated a and b and a fixed orifice 104 , which in the preferred embodiment is a capillary tube . the flow control solenoid valves a and b are normally closed and are selectively opened and closed in response to the control algorithm from the controlled atmosphere system controller 50 to adjust the purity of nitrogen generated by the membrane 36 . in the preferred embodiment , with both valves a and b open , flow is through all three metering devices and the membrane will produce an output of approximately 15 percent oxygen and 85 percent nitrogen . this is defined as the low purity , high flow condition . with one valve , ( a or b ) open the system will produce approximately 5 percent oxygen and 95 percent nitrogen . this is defined as the medium purity , medium flow condition . with both valves a and b closed , the system will produce approximately 0 . 5 percent oxygen and 99 . 5 percent nitrogen . this is defined as the high purity , low flow condition . as will be seen , the control algorithm uses this for the system oxygen value as its primary control input . also located in the evaporator section 70 , above the circulating fan 26 , are the gas sensors 40 . the sensors include an oxygen sensor 110 which is used to measure the concentration of oxygen inside the container . the oxygen sensor used in a preferred embodiment of the system is a galvanic fuel cell . when a gas sample is passed through the galvanic cell , oxygen reacts with the cell to produce a small voltage . the voltage output is directly proportional to the oxygen concentration . the controller 50 converts the voltage output to a percent oxygen readout on the digital display which will be described hereinbelow . a model ke - 50c galvanic cell oxygen sensor available from the japan storage battery company , ltd . is used in a preferred embodiment of the system . also included is a co 2 sensor 112 which is used to measure the concentration of carbon dioxide inside the container . the co 2 sensor is what is known as a non dispersive infrared ( ndir microbench co 2 sensor , available as part number 032 from sensors inc . the co 2 sensor has an internal temperature sensor which generates a signal which is also delivered to the controller . the sensor generates a signal which is converted by the controller 50 to a percent co 2 readout on the digital display . the o 2 and co 2 sensors 110 , 112 are in serial fluid flow relationship in a gas sampling line 114 . downstream from the sensors is a discharge line 115 open to the evaporator section of the unit , while upstream is a gas sample filter 116 . four electrically actuated solenoid valves may be selectively actuated to provide the desired gas sample flow to the inlet line 118 to the sensors 40 . a first solenoid valve 118 is located in an air sample line 120 which is adapted to deliver a sample of the warm air from the inlet line 100 to the membrane 36 . a capillary tube or other pressure drop device 123 is provided in this line as the air supply line is at high pressure . a second solenoid valve 122 is positioned in a nitrogen sample supply line 124 which communicates with the nitrogen delivery line 106 . a third solenoid valve 126 is located in a calibration gas delivery line 128 . the calibration gas delivery line communicates with a suitable gas fitting 130 located on the outside of the condenser section 72 . it is adapted to be connected with a calibration gas tank 131 which contains a calibration gas made up of 5 percent co 2 and 95 percent nitrogen . for safety purposes a pressure relief valve 132 is provided in the calibration gas line 128 . finally the fourth solenoid valve 134 is located in the sample line 64 which is adapted to deliver a sample of the gas within the container 10 to the gas sensors . it should be appreciated that each of these solenoid valves is selectively actuated by the control atmosphere system controller 50 . in a like manner , the outputs from the o 2 sensor 110 and the co 2 sensor 112 are delivered to the system controller to monitor the operation and performance of the system as will be appreciated . with continued reference to fig4 the system is provided with a co 2 supply system generally identified by reference numeral 65 . the system includes a co 2 delivery line 138 which has a normally closed electrically actuated solenoid valve 140 positioned therein . a pressure relief valve 142 is also provided in the co 2 supply line 138 . in the illustrated embodiment two locations for co 2 supply bottles are shown . the first is in the interior 68 of the container box wherein a co 2 bottle 144 is shown in communication with an appropriate fitting 146 and a supply line 148 to the co 2 system . a second co 2 bottle 150 located outside of the entire unit communicating through a fitting 152 and a line 154 to the co 2 system 65 . the co 2 supply system is physically separate from the rest of the controlled atmosphere system and is actuated as needed by the control atmosphere controller 50 by selective actuation of the solenoid valve 140 . located within the interior 68 of the container 10 is a door safety interlock solenoid 156 . this solenoid is associated with an interlock mechanism which will prevent the doors to the container form being opened when the oxygen level in the container falls below a predetermined value . in order for the integrated refrigeration / controlled atmosphere system to operate according to the present invention it is necessary that the controller 18 of the refrigeration system and the controller of the controlled atmosphere system 50 be able to communicate electronically with one another . one example of such communication is the over riding control of the refrigeration controller 18 by the enable switch 70 , briefly described hereinabove , which is the subject of a co - pending application . this relationship between the controllers 18 and 50 is shown schematically in fig5 wherein the solid arrows 155 interconnecting the controllers and electronic data recorder 156 are meant to illustrate the ability of these components to electronically communicate with one another . the data recorder 156 serves to periodically record , for future reference , information from both the refrigeration controller and the controlled atmosphere controller . information recorded from the refrigeration controller typically includes temperature of supply and return air being circulated . information recorded from the controlled atmosphere controller includes o 2 and co 2 levels , the result of pre - trip tests , alarm activity , and the state of the enable switch 70 . for convenience in understanding the role of the controlled atmosphere controller 50 in controlling all of the components of the system illustrated in fig4 fig6 generally illustrates the controller 50 and the inputs and outputs thereto / therefrom . each of the inputs is identified and the corresponding reference numeral in fig4 is also used . the container atmosphere temperature input is derived from a temperature sensor 157 , not previously mentioned , located within the enclosed space 68 of the container 10 . the key pad 160 inputs will be described below in connection with fig7 . all of the other inputs have been discussed above in connection with the description of the system shown in fig4 . the outputs from the controlled atmosphere controller 50 are likewise each described along with the relevant reference numeral used in fig4 . again each of these components has been described previously and will not be further elaborated upon at this time . fig7 illustrates the appearance of the key pad 160 which provides operator inputs to the controller 50 . most of the input buttons on the key pad 160 are not necessary to an understanding of the present invention and will not be described herein . when deemed necessary for a full understanding of a function , the buttons will be described at that time . fig8 represents the display 170 of the controlled atmosphere controller 50 . across the top of the display are a series of seven indicator lights 174 useful in conveying information to the operator during operation of the system . at the bottom of the display are two alphanumeric lcd visual display regions . the left hand display 171 and the right hand display 173 are useful in conveying information to the operator as will be appreciated . operation of the controlled atmosphere control algorithm which is shown generally as reference numeral 160 in fig9 will be described in connection with the actual operation of the system as described in detail hereinabove . briefly , repeating what was mentioned above , with the refrigeration system 12 and the controlled atmosphere system 14 energized and suitably programmed the refrigeration system will begin immediate operation according to its programmed operation . the controlled atmosphere system 14 however , will begin operation only when the controlled atmosphere enable switch 70 in the refrigeration controller 18 is closed . as previously indicated , the enable switch 70 is closed by the refrigeration system controller 18 when it determines that the operating conditions of the refrigeration system , and conditions within the refrigerated container 10 are such that it is acceptable to allow the controlled atmosphere machine to operate . such conditions will be referred to in connection with the description of the various subsystems of the control algorithm for the system . assuming now that the refrigeration and controlled atmosphere systems are energized and that the controlled atmosphere system has been suitably programmed through keyboard 162 to set the desired setpoints to control oxygen within the range of 1 % to 15 % and carbon dioxide within a range of 0 to 25 %. the controlled atmosphere control 18 then continuously monitors the input from the controlled atmosphere enable switch 70 . if this switch 70 is closed the controlled atmosphere system will operate , if it opens , the system will immediately enter a stand - by mode . at this time the stand - by light 162 on the display 170 will be illuminated . when in the stand - by mode , the controlled atmosphere control 50 continuously monitors the status of the controlled atmosphere enable input 71 . all outputs from the controller 50 as illustrated in fig6 are turned off , and the display 171 , 173 is blank . on the other hand , when the ca control indicates , through the signal 71 , that the controlled atmosphere system may operate the system operates according to the main controlled atmosphere algorithm 160 of fig9 . the air heater control system 164 has already been briefly described hereinabove , and , as indicated is used to maintain the temperature of the air leaving the heater 34 at 55 ° c . the heater is on whenever the compressor 30 is operating . looking now to the compressor control system 166 and the flow control system 168 . the operation of these systems according to the control algorithms illustrated in fig1 and 12 respectively will now be described . looking first at fig1 the control logic for the compressor control system 166 is entered at point 170 wherein the inquiry is made as to whether the ca enable switch 70 is closed . if the switch is not closed , at step 172 , no further action will be taken and the system will remain in stand - by until it is determined that the ca enable switch is closed at which point the logic will pass via the &# 34 ; yes &# 34 ; branch 174 to evaluate the o 2 and co 2 concentrations at steps 176 and 178 respectively . in each of these comparison steps the actual gas concentration is compared to a control band above and below the setpoint programmed into the controller for the particular gas . with reference to step 176 , when the controller determines that the co 2 level is above the control band the ca air compressor 30 will be started at step 180 , via the &# 34 ; yes &# 34 ; branch 182 . if step 178 indicates that the oxygen level is either above or below , i . e . &# 34 ; outside &# 34 ; the control band the air compressor 30 will be started , via the &# 34 ; yes &# 34 ; branch 184 . if neither of the conditions of step 176 or 178 are met the controller will loop , following the &# 34 ; no &# 34 ; branches , 186 , 188 respectively until the conditions of steps 172 , 176 and 178 result in starting of the ca air compressor at 180 . once the decision has been made to start the air compressor at 180 the system again evaluates , at step 190 the status of the enable switch 70 . if the enable switch is open the compressor is stopped , at step 200 , via the &# 34 ; no &# 34 ; branch 192 . if the enable switch is closed the controller then evaluates the oxygen level at step 194 . if the o 2 level is within the control band the controller then evaluates , via the &# 34 ; yes &# 34 ; branch 195 , the co 2 level at step 196 . if the co 2 level is below the setpoint the controller stops the compressor , via the &# 34 ; yes &# 34 ; branch 198 , at step 200 . this is done because operation of the compressor has no effect on &# 34 ; raising &# 34 ; the co 2 level within the container . upon stopping the compressor , at step 200 , the controller returns via 202 to the entry point 170 of the compressor control algorithm . it should be appreciated that , following starting of the compressor at step 180 , the status of the ca enable switch 70 is continuously evaluated via the &# 34 ; no &# 34 ; branches 204 and 206 respectively of steps 194 and 196 by returning to step 190 . as a result the air compressor 13 stopped at step 200 , via the &# 34 ; no &# 34 ; branch 192 , at any time that the ca enable switch 70 is opened and the controller 50 places the controlled atmosphere system into a stand - by mode . whenever the compressor 30 is actuated as described above , the flow control valve system , previously described , operates , according to its control algorithm 168 , to bring the oxygen level and the carbon dioxide level to their programmed setpoints . before describing this program and the operation of the flow control valves , several general principles of the operation of the system will be restated . first , the algorithm uses the oxygen value as its primary control input . secondly , when the oxygen requirement is met , the algorithm then attempts to control co 2 . second , it will be recalled that co 2 concentration is increased by opening the co 2 solenoid valve 140 , which adds co 2 from an external tank 146 or 150 . co 2 concentration is reduced by adding nitrogen from the membrane to displace the co 2 in the container 10 . it will be seen that the control algorithm will maintain the oxygen level within the control band until the co 2 level is at or below the set level . it will be noted however that the co 2 control does not become active until the oxygen setpoint is achieved . flow control algorithm 168 will first be described , and then the specific programming of the controller for adding nitrogen , at the three different levels of purity , will be described in connection with different setpoint ranges as shown in fig1 and 14 . looking now at fig1 the o 2 / co 2 flow control algorithm is entered at point 208 and the controller evaluates at step 210 whether the oxygen level in the container is at the programmed setpoint . if it is , the controller moves through the &# 34 ; yes &# 34 ; branch 212 to ask , at step 214 , whether the co 2 level is at or below the programmed setpoint . if it is not the controller moves through the &# 34 ; no &# 34 ; branch 216 to step 218 where , if the compressor 30 is not already running it is started and the co 2 level is reduced by adding nitrogen to the container thereby displacing co 2 . this condition is illustrated in the left hand portion of the graph shown in fig1 . with the compressor operating to decrease the co 2 level the controller moves to step 220 where , if the co 2 level is at the programmed setpoint , it moves through the &# 34 ; yes &# 34 ; branch 222 to stop the air compressor at 224 and returns to the beginning 208 of the flow control algorithm . if the co 2 level , at step 220 , is not at setpoint the controller moves through the &# 34 ; no &# 34 ; branch 226 returning to the starting point 208 . returning back to step 214 , if the co 2 level is at or below setpoint the controller moves through the &# 34 ; yes &# 34 ; branch 228 to stop the compressor at step 230 , and , to increase the co 2 level by adding co 2 as at step 232 . the addition of co 2 as previously described and as illustrated in the right hand portion of fig1 is achieved by the controller opening the co 2 valve 140 until the co 2 value reaches setpoint at which time the co 2 valve 140 is closed . returning to step 210 , if the o 2 level is not at setpoint the controller moves through the &# 34 ; no &# 34 ; branch 234 to step 236 where the controller asks whether the o 2 level is within the control band of the programmed o 2 level . if the o 2 is in the control band the controller then moves through the &# 34 ; yes &# 34 ; branch 238 of step 236 to step 218 . at step 218 the system will operate to control the o 2 level and as previously described the co 2 control system will also be active . if at step 236 it is determined that the o 2 level is not within the control band the controller will move through the &# 34 ; no &# 34 ; branch 240 to step 242 and commence oxygen control by adding nitrogen with the co 2 control system not enabled . during such operation the controller continues to evaluate via branch 244 , the oxygen and co 2 levels relative to their setpoints and control bands to determine the best mode of operation of the system . with reference now to fig1 and 14 , the operation of the system illustrated in fig4 to establish the desired oxygen level within the container and to maintain it within the control band by adding nitrogen to the container will be described . it will be recalled that the system is operable at three different nitrogen purity levels . the first , with both valves a and b open produces 15 % oxygen and 85 % nitrogen . this has been defined as the low purity , high flow condition . the second with one valve ( a or b ) open , is the medium purity , medium flow condition with 5 % oxygen and 95 % nitrogen being produced . third , with both valves a and b closed in the high purity , low flow condition the system produces 0 . 5 % oxygen and 99 . 5 % nitrogen . looking now at fig1 the operation of the controller to operate the valves in response to the sensed oxygen level within the container is shown for setpoints between 0 % and 5 % oxygen . this drawing illustrates operation of the system to bring the oxygen level down from the approximately 20 . 8 % oxygen contained in atmospheric air to the desired setpoint value . looking at &# 34 ; time 0 &# 34 ; the system begins operation with the compressor operating and both valves a and b open , and operates , as seen at segment 246 , until the oxygen level has been brought down to approximately 15 %. at that point valve b is closed and the system moves to the medium purity , medium flow condition as represented by segment 248 until the oxygen level reaches the 5 % value . at that point valve a is closed , and the system operates as represented by segment 250 , in the high purity , low flow condition until it reaches the lower end 252 of the control band . at that time control valve a is again opened and the system returns , as represented by segment 254 , to a medium purity , medium flow condition until the upper range of the control band is reached , as at 256 , whereupon valve a is again closed and the system returns to high purity , low flow . such alternating opening and closing of valve a continues in order to maintain the oxygen level within the container within the control band . fig1 illustrates the operation of the system where the oxygen setpoint is between 5 % and 15 %. as in the lower setpoint situation described in fig1 , the system begins operation in the low purity , high flow mode with valves a and b open as indicated by segment 258 in fig1 . again , when the sensor determines that the oxygen level has reached 15 % valve b is closed and it shifts to the medium purity , medium flow condition as indicated at segment 260 . valve b is then alternately opened and closed as the oxygen value hunts between the set value within the control band . it should be appreciated that , regardless of the oxygen setpoint and the mode of operation , while step 242 of fig1 is being carried out the controller , via branch 244 is continuously evaluating the o 2 value to determine the optimum system mode of operation . referring now to fig9 and 16 , the automatic compensation and calibration of the oxygen sensor 110 is also programmed into the controlled atmosphere controller 50 and is referred to in the main algorithm as reference numeral 266 . as previously mentioned , the oxygen sensor 110 is used to measure the concentration of oxygen within the container 10 . opening of the sample valve 134 will allow atmosphere from the container to pass over the sensor 110 . as previously noted , the oxygen sensor 110 produces a small voltage output which is directly proportional to the oxygen concentration of the gas it is sensing . the microprocessor of the controlled atmosphere controller 50 converts the voltage output to a percent oxygen readout which is shown on the digital display 173 . the microprocessor is programmed with the sensor specifications for a range of oxygen measurements from 0 to 20 . 9 %, and the expected rating for this range of oxygen levels . the span of the oxygen sensor is defined as the difference between the voltage reading from the oxygen sensor at its maximum level less the reading at its minimum level . the span and linearity of the oxygen sensor are sensitive to temperature and aging . as an example , the span with time may decrease to the point where the sensor is not capable of producing a voltage output which matches the sensor specification for 20 . 9 % oxygen . to compensate for this the controlled atmosphere controller 50 is programmed as illustrated in fig1 . the oxygen sensor compensation and calibration program 266 is entered at point 268 where the controller 50 first ascertains the temperature of the air returning from the interior of the container as measured by temperature sensor 158 , at step 270 . if this temperature is below 5 ° c ., the output of the sensor is compensated at step 272 using a compensation curve , which has been programmed into the controller 50 . if the air temperature is not below 5 ° c . the controller moves through the &# 34 ; no &# 34 ; branch 274 . from step 272 , or from the &# 34 ; no &# 34 ; branch 274 , the controller then considers whether one or the other of two events 276 or 278 have occurred . accordingly , two hours after power has been turned on to the ca system , as at step 276 , or after 24 hours have elapsed since the last calibration , as at step 278 , the span of the oxygen sensor will be calibrated by passing outside air ( 20 . 8 % oxygen ) through the oxygen sensor 110 . as indicated this occurs whenever the &# 34 ; yes &# 34 ; branch of step 276 or 278 , collectively 280 , is followed . before initiating the test the controller ascertains , at step 282 , whether the controlled atmosphere compressor 30 is on . operation of the compressor is necessary in order to get a reliable air sample for the calibration and therefore if it is not on the controller will pass through the &# 34 ; no &# 34 ; branch 284 until the compressor is activated . when the compressor is on calibration is initiated via the &# 34 ; yes &# 34 ; branch 286 at step 288 where the controller closes the nitrogen valve 122 , the sample valve 134 and calibration gas valve 126 , and opens the air valve 118 to thereby provide a flow of outside air across the sensor . the output is then sensed and compared , at step 290 , to determine if it is within the expected range of the sensor . if it is , via the &# 34 ; yes &# 34 ; branch 292 , the value is recorded at step 294 and is used to set the span of the oxygen sensor , and the system returns , via 296 , to the starting point 268 . if in step 290 the sensor is not within the expected range the controller passes , via the &# 34 ; no &# 34 ; branch 298 , to display a &# 34 ; fault &# 34 ; result , at step 300 , on the display 171 . the system will then use the previous o 2 sensor span value , as at step 302 , and return to start 268 . referring now to fig1 , the span and zero point of the carbon dioxide sensor 112 are sensitive to temperature and thus the controller is programmed , as shown in this figure , to compensate and / or calibrate the co 2 sensor in a manner which will now be described . the co 2 sensor temperature compensation / calibration algorithm 304 is shown generally as it relates to the other control algorithms continuously operating in the controlled atmosphere system in fig9 and in detail in fig1 . the co 2 sensor algorithm 304 is entered at 306 and at step 308 the controller determines using the input from the co 2 sensors 112 internal temperature sensor whether the sensor temperature is less than 25 ° c . if it is , the controller will move through the &# 34 ; yes &# 34 ; branch 309 to step 310 where the output of the co 2 sensor is compensated using a temperature compensation curve which is programmed into the ca controller 50 . from the temperature compensation step 310 , or via the &# 34 ; no &# 34 ; branch 312 of step 308 , the controller then determines whether one or more of three conditions exist which will result in co 2 sensor calibration . these events , as indicated at steps 314 , 316 and 318 are : &# 34 ; is it two hours after system start &# 34 ;? &# 34 ; has there been a 5 ° c . change since last calibration &# 34 ;?, or &# 34 ; has it been 24 hours since the last calibration &# 34 ;?, respectively . a yes answer to any of these inquiries results in moving , via the &# 34 ; yes &# 34 ; branch 320 , to initiation of co 2 , sensor calibration at step 322 . a &# 34 ; no &# 34 ; result to each of the inquiries 314 , 316 and 318 results in a return to the start 306 via the &# 34 ; no &# 34 ; branches 324 . co 2 sensor calibration is initiated by determining at 322 whether the ca compressor 30 is on to assure a reliable flow of gas through the co 2 sensor 112 . if the compressor is not on the test will not continue as evidenced by the &# 34 ; no &# 34 ; branch 326 result . assuming the compressor is on the controller next opens the nitrogen solenoid valve 122 , and closes the air , sample and calibration gas solenoids 118 , 134 and 126 . the controller also closes both nitrogen flow control valves a and b . the controller then goes into a nine minute delay period to allow system conditions to stabilize with the highest purity nitrogen passing over the co 2 sensor , all as indicated at step 328 . following the nine minute delay the co 2 sensor is read , and , if it is the first calibration attempt , as at step 330 , the first zero point value is stored , and , via the &# 34 ; yes &# 34 ; branch 332 , the controller shifts the system into a normal control mode of operation as at 336 for fifteen minutes . a counter within the controller 50 is set at &# 34 ; 10 &# 34 ; at this time . after the fifteen minutes of normal control operation the controller returns to step 328 and 330 where it generates a second zero point value which is compared to the first zero point value at step 338 . if at step 338 the controller finds that both zero points are within 50 m v of each other , the second determined zero point is stored , via the &# 34 ; yes &# 34 ; branch 340 , at step 342 . the control then returns to the start point 306 via branch 344 and the new zero value is used until the control decides that compensation or calibration is again necessary . if , at step 338 the second zero value is not within 50 m v of the first value the controller moves through the &# 34 ; no &# 34 ; branch to step 348 wherein the counter 334 number is reduced by one and the new count is evaluated . if the new count is not &# 34 ; zero &# 34 ; the control passes , via the &# 34 ; no &# 34 ; branch 350 , to step 336 and the process continues until a new zero value is determined , or , until the count at step 348 equals &# 34 ; zero &# 34 ;. at this point the controller will move through the y branch 350 from step 348 and display a fault , as at 352 , on the controller display 171 . the controller 50 will then use the previous valid carbon dioxide zero point as at step 354 for system control . in the preceding description , on several occasions the alarm / fault system generally identified by reference numeral 356 in fig9 has been referred to . this system , programmed into the controlled atmosphere controller 50 is used to detect major faults in the system and to shut the system down or put it into a safe operating mode if one occurs . it also accumulates the amount of operating time for the system . after fixed operating intervals the control will display at 171 , a service alarm , indicating it is time to service certain components of the unit . specifically , a service alarm appears upon 5000 lapsed hours for the filters 90 and 92 and a compressor service alarm appears at 14 , 000 hours . after servicing the unit , the operator resets the timer for the particular component using the keyboard 162 . other features of the alarm / fault system 356 include the following : ( 1 ) monitoring the status of the compressor overtemperature switch 80 . if this switch opens the compressor 30 will be shut down and the display will indicate a fault . ( 2 ) monitoring of the status of the system fuse ( not shown ) and should it open the system will enter a stand - by mode as indicated by illumination of the light 162 on the display 170 . ( 3 ) monitoring the status of the heater overtemperature switch 99 . if this switch opens , the heater 34 will be shut down and the display 171 will indicate a fault . ( 4 ) monitors the output of the oxygen sensor 110 and the co 2 sensor 112 . if these sensors read outside their expected range as described above or fail to calibrate , the control will indicate a fault on the display 170 . | 5 |
a block diagram of an exemplary system 100 in accordance with an embodiment of the present invention is shown in fig1 . the system preferably includes a memory 102 for storing test data . the memory 102 is accessible from a processor 104 . processor 104 receives inputs from input devices 106 , such as a keyboard and mouse . processor 104 also produces outputs which are displayed on an output device 108 , which can be a monitor or printer , for instance . the memory 102 preferably stores test data to be evaluated , but may store other information , such as program instructions for executing a program in accordance with an embodiment of the present invention . data can be entered into memory 102 through user input devices 106 , or alternatively , optional lab equipment 110 can automatically store test results . processor 104 executes a set of machine instructions adapted to evaluate the test data stored in memory 102 . the test data relates to test results obtained using various testing methods on a common set of donors , as will be explained in greater detail below . the data includes at least one and preferably two results per subject using the reference ( control ) methods , and at least one result for each evaluation method . processor 104 is adapted to perform a series of calculations which determine if the evaluation test methods are clinically equivalent to the reference method or methods . the calculations and steps performed by the processor to make this determination will be described in greater detail below . an exemplary set of data associated with two reference test method results and one result from each of two evaluation test methods per subject is reproduced in appendix a . these data , as shown , are preferably stored in a spreadsheet program , such as microsoft ™. excel . as shown , the data are stored in cells of a table identified by columns and rows . rows 2 - 4 of the exemplary table contain information about the test , including the test name , the units appropriate to the results of each test , and user - defined limits of equivalence ( acceptable bias ) for each test . as shown the limits can be expressed in exact quantities , such as 2 mmol / l for sodium , or in percentages , such as 10 % for ast . as further shown in the table of appendix a , row 6 contains labels for f each of the columns of data in rows 7 and above . column a contains donor numbers , column b contains the main variable in the testing methods ( the blood collection tube type ), column c contains results of the tests for sodium , column d contains results of the tests for ast , and column e contains results of the tests for triglycerides . there were three types of blood collection tubes used in this study , serum , sst .™., and sst ii .™. as can further be observed from the exemplary table of appendix a , specimens from 30 donors were tested , and each donor was tested for three analytes , sodium , ast , and triglycerides . for each donor , four blood specimens were drawn , two with the serum type tube , and one each with the sst .™. and sst ii .™. tubes , with each of the three analytes being measured in each specimen . two specimens were drawn with the serum tube , which in this case was considered to be the reference or control method . one specimen was drawn with each of the two evaluation devices . thus there were twelve results ( 4 for each analyte ) for each donor . tube type is the main variable in the exemplary test methods , but it should be understood that any variable could be evaluated , and blood collection tube type is chosen and discussed herein simply as an example . the serum tube was the reference or control device . the first evaluation device in this example was a blood collection tube labeled sst .™., and the second evaluation device was a blood collection tube labeled sst ii .™. the user interface will now be described in connection with fig2 , which is a screen shot of a user interface according to an embodiment of the invention . in the preferred embodiment of the invention , a graphical computer interface such as the one shown in fig2 is provided . the invention is embodied in a computer program which acts as a plug - in to microsoft .®. excel . of course it will be understood by those of skill in the art that the invention could be programmed as an independent software application running on a personal computer , or embedded in hardware , or implemented in any other suitable manner . when the plug - in is activated , the user interface 200 shown in fig2 is presented . the user interface 200 allows for the user to identify parts of a table , such as the spread sheet shown in appendix a , which are related to reference and evaluation test methods , and to choose certain available options for the type of evaluation to be performed , as well as the types of outputs desired . the user then uses a mouse or other suitable input device to identify the corresponding portions of the table which contain the information needed by the program to perform the necessary calculations and generate the desired output . for example , a portion of the user interface 200 is labeled “ study information ” 202 . this portion includes experiment name 204 , analyte names 206 , and analyte units 208 . the user has the option of typing the cell range corresponding to “ experiment name ” directly into the space provided for in the user interface at 204 , or to click a button 210 allowing the user to use a mouse to identify the corresponding cell range within the excel worksheet . since the experiment name in this example is “ anaplot test ” at cell a6 of the table in appendix a , cell a6 would be identified by the user in field 204 of the user interface . similarly , cells c6 - e6 would be identified as corresponding to the “ analyte names ” at 206 of the user interface 200 . cells c4 - e4 would be identified as corresponding to “ analyte units ” 208 in the user interface 200 . a type of mean difference limit calculation is selected using the user interface 200 at 212 . the choices are replicated control calculation 214 , bland altman 216 , given variability 218 , and no control limits 220 . only one of the four selection can be selected . also , a choice between constant cv 222 and constant sd 224 is provided in this section 212 . the types of mean difference limit calculations will be discussed in further detail below . a portion of the user interface 200 is provided to allow for the selection of desired outputs 226 . the possible selections preferably include confidence limits for bias 228 , mean difference plot 230 , chevron plot 232 , correlation plot 234 , and data in appendix 236 . a checkbox for each type of output to be included is provided , and selecting any of the output types will cause the output to be included in the report generated by the system . the clinical criteria for bias limits 238 can also be set , either by entering the criteria directly in the space provided , or by referring to cells in a table which contain the clinical criteria for bias limits , such as an excel worksheet . a section of the interface 200 is provided for identifying certain relevant data 240 . the data identified in this section includes a donor id column 242 , a cont / eval id column 244 , and a data range 246 . in the present example , donor id column would refer to column a of the table reproduced in appendix a . this is the column of data containing donor ids . cont / eval id column 244 refers to the column in the table which contains the names of the reference and evaluation variables for each donor . in this example , column b of the table in appendix a would be identified . column b contains the labels for the blood collection tubes used in each test ( serum , sst .™., and sst ii .™.). the data to be evaluated , including reference data and evaluation data as appropriate , are identified in the data range 246 field . in this example , columns c , d , and e are identified as corresponding to the test results for both the reference and evaluation tests . these columns contain the actual test data for the three analytes tested , and for each of the 30 donors . the interface 200 also includes a field for control id 248 and evaluation id 250 . a “ select all but control ” button 252 is provided . finally , an “ ok ” button 254 , a “ cancel ” button 256 , an “ add comparison ” button 258 and a “ restore prior values ” button 260 are provided . the method according to an embodiment of the present invention will now be described in connection with the flowchart of fig3 . at step 300 a reference method is conducted . observations from the reference method are recorded at 302 . the reference method forms the basis for comparison to the evaluation method . preferably , the reference method is performed at least twice , and observations of both reference methods are recorded . in this manner , the variability between successive runs of the same method can be measured . at step 304 , the evaluation method is performed , and observations are recorded at 306 . preferably , the observations are recorded into a table , such as a microsoft .®. excel worksheet , to facilitate accessing the data for calculations to be performed by the statistical analysis program . more than one evaluation method may be performed and recorded . advantageously , according to an embodiment of the present invention , any number of evaluation methods can be evaluated simultaneously . at 308 the statistical analysis program is started . preferably , this produces an interface as described above in connection with fig2 . various data are identified in the user interface 200 at 310 . preferable , the data identified in the user interface 200 include the donor id &# 39 ; s associated with the data , the control / evaluation ids , and the columns of data for the tests performed . a sample table of data is provided at appendix a . also in the interface 200 , the types of mean difference limit calculations desired are selected 312 . the types available are replicated control calculation 214 , bland altman 216 , given variability 218 , and no control limits 220 . also to be selected are constant cv 222 or constant sd 224 . if replicated control calculation 214 is selected , the statistical program calculated the acceptable variability in the evaluation data based on the variability between the at least two sets of reference data . bland altman 216 selects a bland altman mean difference calculation . given variability 218 allows the user to select the acceptable variability . finally , no control limits 220 allows the user to select a set of calculations without control limits . at step 314 , the user selects the desired set of outputs to be generated . these selections are available at 226 of the user interface 200 . the user &# 39 ; s choices comprise confidence limits for bias 228 , mean difference plot 230 , chevron plot 232 , correlation plot 234 , and data in appendix 236 . examples of each type of data will be described in greater detail below . once all data have been identified , and calculations and outputs have been selected , the user selects the “ ok ” button 254 at step 316 to begin the calculations selected . a series of equations appropriate to the various selections available to the user are shown at appendices b and c . appendix b shows the set of equations associated with determining the slope and intercept in a correlation plot 234 . different equations are provided for different combinations of calculation type , and the kind and number of reference and evaluation data sets , as well as the type of variation selected . appendix c shows the set of equations used to generate chevron plot data . the chevron plot will be described in greater detail below in connection with fig4 . at step 318 , the system determines based on statistical analysis , whether the evaluation data indicates that the evaluation method is clinically equivalent to the reference method or methods . finally , at step 320 the selected outputs are generated , along with conclusions reporting whether the evaluation method is clinically equivalent or not . various outputs will now be described . the outputs described were based on the sample data provided in the table of appendix a . a complete sample report is reproduced in appendix d , and this report includes each of the types of outputs to be described in the foregoing description , for each of the three analytes tested in the reference and evaluation methods shown in appendix a . for brevity , the outputs will each be described once in connection with one of the three analytes , ast . fig4 illustrates the confidence limits for bias output , selected by checking confidence limits for bias 228 in the user interface 200 . the output shown in fig4 corresponds to the analyte ast which was tested for each donor and for each reference and evaluation test method . the 95 % confidence interval for bias gives a feasible range of possible values for the average bias or difference between results obtained using a reference method or device and an evaluation method or device . thus , if the 95 % confidence interval for bias in ast between sst .™. and serum tubes is ( 5 %, 8 %), then there is 95 % confidence that the true difference is somewhere between 5 % and 8 %. the confidence interval for each of the evaluation methods , sst .™. and sst ii .™., are shown to be well within the 10 % limits designated , indicating equivalence between the evaluation and reference devices . fig5 illustrates a mean difference plot generated by the program according to an embodiment of the present invention . data for each of the evaluation methods , sst .™. and sst ii .™., are plotted . each point represents a difference between the result observed using the reference method and the result observed using the evaluation method . fig6 illustrates a chevron plot generated by the program according to an embodiment of the present invention . the chevron plot is a measure of bias ( accuracy ) and precision . each evaluation experiment is plotted . evaluation methods with a combination of good accuracy , and good precision are preferred . regions are designated as “ good ”, “ satisfactory ”, “ unsatisfactory ” and “ poor ” so that the user can easily see which classification applies to each of the evaluation methods . of course , it will be understood that while the chevron plot is the preferred manner of presenting accuracy and precision data , any graphical or non - graphical method of presenting accuracy and precision data is considered to be within the scope of the present invention . fig7 and 8 illustrate correlation plots generated according to an embodiment of the present invention . fig7 correlates reference ( serum ) results with the first evaluation method ( sst .™.). fig8 correlates reference results with the second evaluation method ( sst ii .™.). regression is performed on the data and a regression line is plotted . an ideal line with slope equal to 1 and intercept equal to zero is also produced for comparison . a sample report generated by the system according to an embodiment of the invention is reproduced in appendix d . the report includes the various outputs selected in the user interface 200 as described above for each analyte tested . also , the report includes conclusions about the clinical equivalence of the evaluation methods for each of the analytes evaluated . in this manner , new test methods ( including existing test methods with new components , such as blood collection tubes , chemical reagents or analytical instruments ), can be evaluated , and a lab can quickly and definitively determine that test results using the new method are clinically equivalent to previous test results . if the new method is shown not to be clinically equivalent , steps can be taken to correct the problem . while the invention has been described by means of specific embodiments and applications , numerous modifications or variations could be made thereto by those skilled in the art without departing from the scope of the invention as set forth in the appended claims and equivalents thereof . | 6 |
in the following description , reference is made to the accompanying drawings which form a part hereof and which illustrate several embodiments of the present inventions . it is understood that other embodiments may be utilized and structural and operational changes may be made without departing from the scope of the present inventions . as shown in the drawings for purposes of illustration , some aspects of the present inventions are directed to a drive mechanism for an infusion pump for medication or other fluids . in preferred embodiments , a releasable coupler couples an in - line drive to a plunger or piston of a reservoir to dispense fluids , such as medications , drugs , vitamins , vaccines , hormones , water or the like . however , it will be recognized that further embodiments of the invention may be used in other devices that require compact and accurate drive mechanisms . in addition , other embodiments use a telescoping drive member ( or lead screw ) to minimize the packaging dimensions of the drive mechanism and the overall configuration of the medication pump . still further , a ventilation feature using hydrophobic materials or a relief valve can be employed to equalized any pressure differentials which might otherwise exist between the atmosphere and the interior of the pump housing . as a back up to this ventilation feature , a threaded attachment permits a secure coupling between the reservoir piston and the in - line drive . fig4 shows a side plan , cut - away view of an infusion pump drive mechanism according to a preferred embodiment of the inventions , in which a housing 401 , containing a lower section 402 for a power supply 420 and electronic control circuitry 422 , accommodates a driving device , such as a motor 403 ( e . g ., a solenoid , stepper or d . c . motor ), a first drive member , such as an externally threaded drive gear or screw 404 , a second drive member , such as an internally threaded plunger gear or slide 405 , and a removable vial or reservoir 406 . the reservoir 406 includes a plunger or piston 407 with o - rings or integral raised ridges for forming a water and air tight seal . the reservoir 406 is secured into the housing 401 with a connector 431 which also serves as the interface between the reservoir 406 and the infusion set tubing ( not shown ). in a preferred embodiment , the reservoir piston 407 is coupled to the plunger slide 405 by a releasable coupler . in the illustrated embodiment , the coupler includes a female portion 424 which receives a male portion 426 carried by the plunger slide 405 . the female portion 424 is positioned at the end face 428 of the piston 407 and includes a threaded cavity which engages the threads of a male screw extending from the end 430 of the plunger slide 405 . while preferred embodiments of the present inventions are directed to disposable , pre - filled reservoirs , alternative embodiments may use refillable cartridges , syringes or the like . the cartridge can be pre - filled with insulin ( or other drug or fluid ) and inserted into the pump . alternatively , the cartridge could be filled by the user using an adapter handle on the syringe - piston . after being filled , the handle is removed ( such as by unscrewing the handle ) so that the cartridge can be placed into the pump . referring again to fig4 as the drive shaft 432 of the motor 403 rotates , the drive screw 404 drives the plunger slide 405 directly to obtain the axial displacement against the reservoir piston 407 to deliver the predetermined amount of medication or liquid . when using a dc or stepper motor , the motor can be rapidly rewound when the reservoir is emptied or as programmed by the user . a sealing device , such as an o - ring seal 409 is in contact with the plunger slide 405 thus allowing it to move axially while maintaining a water resistant barrier between the cavity holding the reservoir 406 and the motor 403 . this prevents fluids and other contaminants from entering the drive system . an anti - rotation key 410 is affixed to the plunger slide 405 and is sized to fit within a groove ( not shown ) axially disposed in the housing 401 . this arrangement serves to prevent motor and plunger slide rotation which might otherwise result from the torque generated by the motor 403 in the event that the friction of the o - ring seal 409 is not sufficient alone to prevent rotation . the motor 403 is a conventional motor , such as a dc or stepper motor , and is journal mounted in the housing 401 by a system compliance mounting 412 . a system compliance mount can be useful in aiding motor startup . certain types of motors , such as stepper motors , may require a great deal of torque to initiate rotor motion when the rotor &# 39 ; s initial at - rest position is in certain orientations with respect to the motor &# 39 ; s housing . a motor which is rigidly mounted may not have enough power to develop the necessary starting torque . including system compliance mounting permits the motor housing to turn slightly in response to high motor torque . this alters the orientation between the rotor and the housing such that less torque is required to initiate rotor motion . a compliance mount can include a rubberized mounting bracket . alternatively , the mounting could be accomplished using a shaft bearing and leaf spring or other known compliance mountings . fig5 shows a perspective view of the in - line drive mechanism of fig4 outside of the housing . the plunger slide 405 ( internal threads not shown ) is cylindrically shaped and has the screw - shaped male portion 426 of the coupler attached to one end thereof . the anti - rotation key 410 is affixed to the opposite end of the slide 405 . the drive screw 404 is of such a diameter as to fit within and engage the internal threads of the plunger slide 405 as shown in fig4 . a conventional gear box 501 couples the drive screw 404 to the drive shaft 432 of the motor 403 . fig4 and 6 show the infusion pump assembly with the plunger slide 405 in the retracted position . the reservoir 406 which may be full of medication or other fluid is inserted in a reservoir cavity 601 which is sized to receive a reservoir or vial . in the retracted position , the plunger slide 405 encloses the gear box 501 ( not visible in fig6 ) while the drive screw 404 ( not visible in fig6 ) remains enclosed within the plunger slide 405 but is situated close to the coupler . the motor 403 may optionally include an encoder ( not shown ) which in conjunction with the system electronics can monitor the number of motor rotations . this in turn can be used to accurately determine the position of the plunger slide 405 thus providing information relating to the amount of fluid dispensed from the reservoir 406 . fig7 a and 7 b show the infusion pump assembly with the plunger slide 405 in the fully extended position . in this position , the plunger slide 405 has withdrawn from over the gear box 501 and advanced into the reservoir 406 behind the reservoir piston 407 . accordingly , the plunger slide 405 is sized to fit within the housing of the reservoir 406 , such that when the reservoir piston 407 and the plunger slide 405 are in the fully extended position as shown , the reservoir piston 407 has forced most , if not all , of the liquid out of the reservoir 406 . as explained in greater detail below , once the reservoir piston 407 has reached the end of its travel path indicating that the reservoir has been depleted , the reservoir 406 may be removed by twisting such that the threaded reservoir piston 407 ( not shown in fig7 b ) disengages from the male portion 426 of the coupler . in a preferred embodiment , the motor drive shaft 432 , gear box 501 , drive screw 404 , and plunger slide 405 are all coaxially centered within the axis of travel 440 ( fig4 ) of the reservoir piston 407 . in certain of the alternative embodiments , one or more of these components may be offset from the center of the axis of travel 440 and yet remain aligned with the axis of travel which has a length which extends the length of the reservoir 406 . fig8 is a cut away perspective view of an anti - rotation device . the anti - rotation key 410 consists of a ring or collar 442 with two rectangular tabs 436 which are spaced 180 ° apart . only one tab is visible in fig8 . the ring portion 442 of the key 410 surrounds and is attached to the end of the plunger slide 405 which is closest to the motor . disposed in the housing 401 are two anti - rotation slots 434 , only one of which is visible in fig8 . the anti - rotation slots 434 are sized to accept the rectangular tabs of the key 410 . as the plunger slide 405 moves axially in response to the motor torque as previously described , the slots 434 will permit the key 410 to likewise move axially . however the slots 434 and the tabs 436 of the key 410 will prevent any twisting of the plunger slide 405 which might otherwise result from the torque generated by the motor . fig9 illustrates a split lead - screw ( or plunger slide ) design in accordance with an embodiment of the present inventions . the use of a split lead - screw or telescoping lead screw allows the use of an even smaller housing for the drive mechanism . a telescoping lead - screw formed from multiple segments allows the pump to minimize the dimensions of the drive mechanism , in either in - line or gear driven drive mechanisms . in preferred embodiments , an interior shaft 901 is rotated by a gear 906 which is coupled to a drive motor ( not shown ). this in turn extends a middle drive segment 902 by engaging with the threads of an internal segment 904 . the middle segment 902 carries an outer segment 903 forward with it in direction d as it is extended to deliver fluid . when the middle segment 902 is fully extended , the internal segment 904 engages with a stop 905 on the middle segment 902 and locks it down from pressure with the threads between the middle and internal segments . the locked middle segment 902 then rotates relative to the outer segment 903 and the threads between the middle segment 902 and the outer segment 903 engage to extend the outer segment 903 in direction d to its full length . the use of multiple segments is not limited to two or three segments ; more may be used . the use of three segments reduces the length of the retracted lead - screw portion of the drive mechanism by half . in alternative embodiments , the outer segment may be connected to the motor and the inner segment may be the floating segment . in preferred embodiments , o - rings 907 are used to seal each segment relative to the other and to form a seal with the housing to maintain water sealing and integrity . as previously noted , the construction of these pumps to be water resistant can give rise to operational problems . as the user engages in activities which expose the pump to varying atmospheric pressures , differential pressures can arise between the interior of the air tight / water - resistant housing and the atmosphere . should the pressure in the housing exceed external atmospheric pressure , the resulting forces could cause the reservoir piston to be driven inward thus delivering unwanted medication . on the other hand , should the external atmospheric pressure exceed the pressure in the housing , then the pump motor will have to work harder to advance the reservoir piston . to address this problem , a preferred embodiment of the inventions includes a venting port which resists the intrusion of moisture . referring to fig7 b , venting is accomplished through the housing 401 into the reservoir cavity 601 via a vent port 605 . the vent port can be enclosed by a relief valve ( not shown ) or covered with hydrophobic material . hydrophobic material permits air to pass through the material while resisting the passage of water or other liquids from doing so , thus permitting water resistant venting . the preferred embodiment uses a hydrophobic material such as gore - tex ®, ptfe , hdpe , uhmw polymers from sources such as w . i . gore & amp ; associates , flagstaff , az ., porex technologies , fairbum , ga ., or dewal industries , saunderstown , r . i .. it is appreciated that other hydrophobic materials may be used as well . these materials are available in sheet form or molded ( press and sintered ) in a geometry of choice . referring to fig1 a - 10 c , preferred methods to attach this material to the housing 401 include molding the hydrophobic material into a sphere 1001 ( fig1 a ) or a cylinder 1002 ( fig1 b ) and pressing it into a cavity in the pre - molded plastic housing . alternatively , a label 1003 ( fig1 c ) of this material could be made with either a transfer adhesive or heat bond material 1004 so that the label could be applied over the vent port 605 . alternatively , the label could be sonically welded to the housing . in either method , air will be able to pass freely , but water will not . in an alternative embodiment ( not shown ), the vent port could be placed in the connector 431 which secures the reservoir 406 to the housing 401 and which also serves to secure and connect the reservoir 406 to the infusion set tubing ( not shown ). as described in greater detail in copending application ser . no . 09 / 428 , 818 filed contemporaneously herewith ( attorney docket no . 0059 - 0307 ), which application is incorporated by reference in its entirety , the connector and infusion set refers to the tubing and apparatus which connects the outlet of the reservoir to the user of a medication infusion pump . an advantage of placing the vent port and hydrophobic material in this location , as opposed to the housing 401 , is that the infusion set is disposable and is replaced frequently with each new reservoir or vial of medication . thus new hydrophobic material is frequently placed into service . this provides enhanced ventilation as compared with the placement of hydrophobic material in the housing 401 . material in this location will not be replaced as often and thus is subject to dirt or oil build up which will retard ventilation . in yet another alternative embodiment however , vent ports with hydrophobic material could be placed in both the pump housing and in the connector portion of the infusion set . regardless of the location of the vent port , there remains the possibility that the vent port can become clogged by the accumulation of dirt , oil , etc . over the hydrophobic material . in another feature of certain embodiments of the present invention , the releasable coupler can act to prevent unintentional medication delivery in those instances when the internal pump housing pressure exceeds atmospheric pressure . referring to fig1 , the coupler includes threads formed in a cavity within the external face of the reservoir piston 407 . the threaded cavity 424 engages the threads of the male portion 426 which in turn is attached to the end 430 of the plunger slide 405 . this thread engagement reduces or prevents the effect of atmospheric pressure differentials acting on the water resistant , air - tight housing 401 ( not shown in fig1 ) from causing inadvertent fluid delivery . the threads of the male portion 426 act to inhibit or prevent separation of the reservoir piston 407 from the plunger slide 405 which , in turn , is secured to the drive screw 404 ( not shown in fig1 ) by engagement of the external threads of the drive screw 404 with the internal threads of the plunger slide 405 . as a result , the coupler resists movement of the reservoir piston 407 caused by atmospheric pressure differentials . when the reservoir 406 is to be removed , it is twisted off of the coupler male portion 426 . the system electronics then preferably cause the drive motor 403 to rapidly rewind so that the plunger slide 405 is driven into a fully retracted position ( fig4 and 6 ). a new reservoir 406 , however , may not be full of fluid . thus the reservoir piston 407 may not be located in the furthest possible position from the reservoir outlet . should the reservoir piston 407 be in such an intermediate position , then it may not be possible to engage the threads of the male portion 426 of the coupler ( which is in a fully retracted position ) with those in the female portion 424 of the coupler in the reservoir piston 407 upon initial placement of the reservoir . in accordance with another feature of certain embodiments , the illustrated embodiment provides for advancement of the plunger slide 405 upon the insertion of a reservoir into the pump housing . the plunger slide 405 advances until it comes into contact with the reservoir piston 407 and the threads of the coupler male portion 426 of the coupler engage the threads in the female portion 424 in the reservoir piston 407 . when the threads engage in this fashion in the illustrated embodiment , they do so not by twisting . rather , they rachet over one another . in the preferred embodiment , the threads of the coupler male portion 426 have a 5 start , 40 threads per inch (“ tpi ”) pitch or profile while the threads of the coupler female portion 424 have a 2 start , 40 tpi pitch or profile as illustrated in fig1 . thus these differing thread profiles do not allow for normal tooth - to - tooth thread engagement . rather , there is a cross threaded engagement . the purpose of this intentional cross threading is to reduce the force necessary to engage the threads as the plunger slide 405 seats into the reservoir piston 407 . in addition , the 2 start , 40 tpi threads of the coupler female portion 424 are preferably made from a rubber material to provide a degree of compliance to the threads . on the other hand , the 5 start , 40 tpi threads of the male coupler portion 426 are preferably made of a relatively hard plastic . other threading arrangements and profiles could be employed resulting in a similar effect . if on the other hand , the threads had a common thread pitch with an equal number of starts given the same degree of thread interference ( i . e ., the od of the male feature being larger than the od of the female feature ), then the force needed to insert the male feature would be pulsatile . referring to fig1 a , as each thread tooth engages the next tooth , the insertion force would be high as compared to the point where the thread tooth passes into the valley of the next tooth . but with the cross threaded arrangement of the preferred embodiment , not all of the threads ride over one another at the same time . rather , they ratchet over one another individually due to the cross - threaded profile . this arrangement results in less force required to engage the threads when the plunger slide moves axially , but still allows the reservoir to easily be removed by a manual twisting action . while the advantage of utilizing a common thread pitch would be to provide a maximum ability to resist axial separation of the reservoir piston 407 from the plunger slide 405 , there are disadvantages . in engaging the threads , the peak force is high and could result in excessive delivery of fluids as the plunger slide 405 moves forward to seat in the cavity of the reservoir piston 407 . as described in greater detail in copending application ser . no . 09 / 428411 filed contemporaneously herewith ( attorney docket no . 0059 - 0308 ), which application is incorporated by reference in its entirety , the pump may have an occlusion detection system which uses axial force as an indicator of pressure within the reservoir . if so , then a false alarm may be generated during these high force conditions . therefore , the insertion force profile is preferably more flat than that shown in fig1 a . to accomplish this , the cross threading design of the preferred embodiment causes the relatively soft rubber teeth of the female portion 424 at the end of the reservoir piston 407 to rachet or swipe around the relatively hard plastic teeth of the coupler resulting in a significantly lower insertion force for the same degree of thread interference . ( see fig1 b ) this is due to the fact that not all of the thread teeth ride over one another simultaneously . moreover , the cross - sectional shape of the threads are ramped . this makes it easier for the threads to ride over one another as the plunger slide is being inserted into the reservoir piston . however , the flat opposite edge of the thread profile makes it much more difficult for the plunger slide to be separated from the reservoir piston . referring to fig1 and 12 , the 5 start , 40 tpi ( 0 . 125 ″ lead ) thread profile of the coupler male portion 426 was chosen in consideration of the thread lead on the preferred embodiment of the connector 431 . the connector 431 is secured into the pump housing with threads 433 ( fig7 b ) having a 2 start , 8 tpi ( 0 . 250 ″ lead ) profile . therefore the 0 . 250 ″ lead on the connector is twice that of the reservoir piston 407 which is 0 . 125 ″. this was chosen to prevent inadvertent fluid delivery during removal of the reservoir from the pump housing , or alternatively , to prevent separation of the reservoir piston 407 from the reservoir 406 during removal from the pump housing . when the connector 431 is disengaged from the pump , the connector 431 as well as the reservoir 406 will both travel with the 0 . 250 ″ lead . since the threaded coupler lead is 0 . 125 ″, the plunger slide 405 will disengage somewhere between the 0 . 125 ″ lead of the threaded coupler and the 0 . 250 ″ lead of the infusion set 1103 . therefore , the rate that the reservoir piston 407 is removed from the pump is the same down to half that of the reservoir 406 / connector 431 . thus any medication which may be present in the reservoir 406 will not be delivered to the user . additionally , the length of the reservoir piston 407 is sufficient such that it will always remain attached to the reservoir 406 during removal from the pump . although the preferred embodiment describes the plunger slide 405 having a coupler male portion 426 with an external thread lead that is different from the connector 431 , this is not necessary . the thread leads could be the same or of an increment other than what has been described . the 2 start thread profile of the coupler female portion 424 on the reservoir piston 407 of the preferred embodiment provides another advantage . some versions of these reservoirs may be designed to be filled by the user . in such an instance , a handle ( not shown ) will need to be screwed into the threaded portion of the reservoir piston 407 in order for the user to retract the reservoir piston 407 and fill the reservoir . the number of rotations necessary to fully insert the handle depends upon the distance the handle thread profile travels to fully engage the reservoir piston 407 as well as the thread lead . for example , a single start , 40 tpi ( 0 . 025 ″ lead ) thread requires 4 complete rotations to travel a 0 . 10 ″ thread engagement . however , a 2 start , 40 tpi ( 0 . 050 ″ lead ) thread only requires 2 complete rotations to travel the 0 . 10 ″ thread engagement . therefore , an additional advantage of a 2 start thread as compared to a single start thread ( given the same pitch ) is that half as many rotations are needed in order to fully seat the handle . in alternative embodiments which are not shown , the end of the plunger slide 405 may include a detente or ridge to engage with a corresponding formation in the reservoir piston 407 to resist unintended separation of the plunger slide 405 from the reservoir piston 407 . in other embodiments , the plunger slide 405 is inserted and removed by overcoming a friction fit . preferably , the friction fit is secure enough to resist movement of the reservoir piston 407 relative to the plunger slide 405 due to changes in air pressure , but low enough to permit easy removal of the reservoir 406 and its reservoir piston 407 from the plunger slide 405 once the fluid has been expended . in other embodiments , the detente or ridge may be spring loaded or activated to grasp the reservoir piston 407 once the drive mechanism has been moved forward ( or extended ), but is retracted by a switch or cam when the drive mechanism is in the rearmost ( or retracted ) position . the spring action could be similar to those used on collets . in other embodiments of the inventions , the threaded coupler may be engaged with the threaded cavity of the reservoir piston by twisting or rotating the reservoir as it is being manually placed into the housing . as set forth above , the reservoir piston 407 is made of rubber . in the illustrated embodiment , an insert 1201 ( fig1 ) which is made of hard plastic may provided in the upper portion of the reservoir piston 407 . the insert 1201 provides stiffness to the rubber reservoir piston 407 . this reduces undesirable compliance which is associated with the reservoir . without the insert 1201 , the flexibility in the reservoir piston 407 due to its rubber composition could cause it to deform under varying reservoir fluid back pressures . this deformation could in turn vary the internal volume of the reservoir 406 . such variances may adversely affect the controlled delivery of the fluid from the reservoir 406 via the infusion set to the user . it can be appreciated that the design of fig4 - 12 results in an arrangement where ; the plunger slide 405 is reliably but releasably coupled to the drive screw 404 . when it is time to replace the reservoir 406 , it can be detached from the male end of the coupler without affecting the plunger / drive screw engagement . moreover in the preferred embodiment , the plunger slide 405 is shaped as a hollow cylinder with internal threads . thus it completely encircles and engages drive screw 404 . when the plunger slide 405 is in a relatively retracted position , it encloses any gears which couple the motor 403 with the drive screw 404 thus achieving an extremely compact design . alternative embodiments include an arrangement where the plunger slide 405 encloses the motor 403 itself . a vent port covered with hydrophobic material as well as a threaded coupler provide redundant means for permitting exposure of the pump to changing atmospheric pressures without the unintended delivery of medication . while the description above refers to particular embodiments of the present inventions , it will be understood that many modifications may be made without departing from the spirit thereof . the accompanying claims are intended to cover such modifications as would fall within the true scope and spirit of the present inventions . the presently disclosed embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the inventions being indicated by the appended claims rather than the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . | 8 |
the indefinite articles “ a ” and “ an ” and the numeric expression “ one ” used herein are intended to describe a copper clad laminate and a method for manufacturing the same of the present invention in terms of elements and compositions for illustrative sake and general conceptual description of the present invention . furthermore , the indefinite articles “ a ” and “ an ” and the numeric expression “ one ” used herein may imply “ at least a / an ” and “ at least one ” as needed , whereas any ensuing singular noun used herein may imply the corresponding plural noun unless otherwise specified . where quantity , concentration or any value or parameter is expressed by a range , a preferred range , an upper limit , and / or a lower limit , it must be interpreted as falling within the range between the upper limit or preferred value and the lower limit or preferred value , regardless of whether the range is disclosed . moreover , unless otherwise specified , in case a range of values is disclosed herein , the range of values must cover its endpoints as well as all the integers and fractions which fall within the range of values . according to the present invention , a numeric value must be interpreted in a way to demonstrate the precision attributable to the significant figures thereof , provided that the objectives of the invention are achievable . for instance , the number 40 must be interpreted to cover the range from 35 . 0 to 44 . 9 , and the number 40 . 0 must be interpreted to cover the range from 39 . 50 to 40 . 49 . changchun epoxy resin ( model no . cne - 200elf and be501 , purchased from chang chun plastics co ., ltd . ), a curing agent which is dicyandiamide ( dicy ), a flame retardant agent which is 9 , 10 - dihydro - 9 - oxa - 10 - phosphaphenanthrene - 10 - oxide ( dopo ) and a solvent which is dimethylformamide ( dmf ). the aforesaid raw materials are commercially available as they can be directly purchased from the market , and they need not be purified before direct use . in an embodiment of the present invention , the present invention provides a halogen - free flame - retarded curing agent which demonstrates enhanced thermal stability and chemical stability and is capable of high flame retardation and curing . the flame - retarded curing agent is a translucent brownish - yellow solid produced by mixing dopo and dicy at 100 c .˜ 140 c .° for 6 hours and then cooling the mixture until its temperature drops to the room temperature . the chemical structure of the compound contained in the resultant flame - retarded curing agent ( dopo - dicy ) is expressed by at least one of the formulas ( 1 ) through ( 3 ) as follows : the amide group of the flame - retarded curing agent ( dopo - dicy ) is highly hygroscopic and thus absorbs water readily when kept in an atmospheric environment . the high water content of the flame - retarded curing agent ( dopo - dicy ) leads to the uneven thermal curing of the flame - retarded curing agent ( dopo - dicy ) and the epoxy resin during a subsequent process of lamination of a copper clad laminate ( ccl ). hence , before it is put to use , the flame - retarded curing agent ( dopo - dicy ) must be dried until its water content is reduced to 800 ppm or lower . in an embodiment of the present invention , the base fabric for use in the copper clad laminate comprises a cyclic olefin copolymer ( coc ) fabric which is produced by winding coc fiber with polyvinyl alcohol ( pva ) fiber to form a core - spun yarn , warping and beating - up the core - spun yarn to produce a plain woven fabric with a gauge of 50 × 37 pieces / inch and a thickness of 0 . 2 mm , then rinsing the woven fabric in hot water at 80 c .° and for 30 minutes , and eventually removing the pva fiber to finalize the coc fabric . both the warp and weft of the coc fabric are formed from coc fiber . the coc fiber has a low dielectric constant , and thus the coc fabric has a low dielectric constant too . referring to fig1 , a copper clad laminate 1 of the present invention comprises a plurality of prepregs 12 and a copper clad 11 disposed on the prepregs 12 , wherein the prepregs 12 are stacked up and are each formed from resin and base fabric . the base fabric for use in the prepregs 12 either comprises coc fabric and glass fiber fabric or comprises coc fabric . furthermore , regarding their quantity , the prepregs are provided in the number of 4 to 12 , for example . referring to fig2 through fig6 , there are shown schematic views of a copper clad laminate according to embodiment 1 through embodiment 5 of the present invention , respectively , wherein the copper clad laminate comprises seven prepregs . referring to fig2 , highest and lowest prepregs 221 of a copper clad laminate 2 are made from coc fabric , whereas five intermediate prepregs 222 of the copper clad laminate 2 are made from glass fiber fabric . referring to fig3 , highest and lowest prepregs 322 of a copper clad laminate 3 are made from glass fiber fabric , whereas five intermediate prepregs 321 of the copper clad laminate 3 are made from coc fabric . referring to fig4 and fig5 , prepregs made from coc fabric alternate with prepregs made from glass fiber fabric . fig4 shows that highest and lowest prepregs 421 are made from coc fabric . fig5 shows that highest and lowest prepregs 522 are made from glass fiber fabric . referring to fig6 , all the prepregs , that is , prepregs 621 , of a copper clad laminate 6 are made from coc fabric . moreover , to contrast with the copper clad laminates in the above embodiments , the present invention further provides a comparative embodiment in which a copper clad laminate has all its base fabric made from glass fiber fabric , though its other constituent materials and build - up structure are identical to their counterparts in the above embodiments . the glass fiber fabrics are commercially available products on an electronic basis ( product no . 7628 ) with a gauge of 44 × 33 pieces / inch and a thickness of 0 . 18 mm . during the manufacturing process of the copper clad laminates , the resin in the embodiments and the comparative embodiment of the present invention is a mixture of ingredients whose proportions are appropriately controlled to control the extent of curing . experiments are conducted , using different resin formulas and proportions shown in table 1 , wherein , during the experiments , the copper clad laminates are subjected to a hot pressing pressure of 20 kg / cm 2 , at a hot pressing temperature of 185 c .°, and for a hot pressing duration of 2 hours to identify the best resin formula . cne - 200 , which is the model number for epoxy resin , dissolves in acetone to achieve a solid content of 70 %, and can be purchased from the market . 2 - mi denotes 2 - methyl imidazole which is a curing promoter administered at a usage unit of 0 . 05 phr . dopo - dicy denotes the flame - retarded curing agent of the present invention . dmf denotes dimethylformamide . given the optimal curing time of 180 seconds during the manufacturing process of the copper clad laminates , table 1 shows that the gel time of formula 1 approximates to 180 seconds . hence , the copper clad laminates are manufactured in accordance with resin formula 1 . afterward , the copper clad laminate manufacturing process begins with formula 1 and involves dissolving the flame - retarded curing agent ( dopo - dicy ) in dmf , mixing them with epoxy resin and a filler , thinning the mixture with acetone until the viscosity of the mixture is appropriate so as to form a varnish , confirming the gel time at an electric hot plate of 170 c .°, setting the impregnation time to two - thirds of the gel time , performing impregnation of the varnish at the room temperature and in the presence of the base fabric , bake drying the impregnated varnish at 165 c .° with a hot air oven to produce prepregs , stacking 7 prepregs and 1 oz of copper clad at 185 c .° to perform thermal curing and lamination thereon under a hot pressing pressure of 20 kg / cm 2 , wherein its temperature - rising process takes place step by step : raising the temperature from 35 c .° for 11 minutes , heating , after the temperature has reached 85 c .°, for another 20 minutes without raising the temperature , raising the temperature from 85 c .° for 45 minutes until the temperature reaches 185 c .°, and heating at 185 c .° for 120 minutes . upon completion of the temperature - rising process , the thermal curing and lamination process is finished . understandably , according to the present invention , in an embodiment for use in an equivalent change , the temperature at which the thermal curing and lamination process takes place ranges between 175 c .° and 200 c .°. coc fabric differs from glass fiber fabric in terms of thermal expansion coefficient , and thus the present invention is exemplified by two different base fabrics illustrated with embodiment 1 through embodiment 4 . as a result , upon completion of the thermal curing and lamination process , warpage happens to the copper clad laminate , causing a difference of at least 3 mm between the height of the center of the laminate and the height of the periphery of the laminate . furthermore , in embodiment 5 , warpage does not happen to the copper clad laminate , because its base fabric is always coc fabric . hence , in embodiment 1 through embodiment 4 , after the temperature of thermal curing and lamination has reached 185 c .°, an annealing process begins ; in other words , the thermal curing and lamination process will stop , only if a cooling process follows the temperature - rising process . table 2 enumerates the differences between the height of the center of the laminate and the height of the periphery of the laminate in embodiment 1 through embodiment 4 , wherein the annealing processes are performed at different temperatures , respectively , for 30 minutes . as shown in table 2 , when the annealing temperature increases to 100 c .°, only the copper clad laminate of embodiment 1 meets the requirement of height evenness , whereas warpage still happens to the copper clad laminates in embodiments 2 , 3 , 4 . at the annealing temperature 120 c .°, the copper clad laminates in embodiment 1 through embodiment 4 meet the requirement of height evenness , as table 2 shows that they have a height difference of 0 mm . the result of table 2 indicates that , to meet the requirement of height evenness of copper clad laminate , it is necessary that an annealing process must be performed at 120 c .° for an additional period of 30 minutes in the case of copper clad laminates which comprises coc fabric and glass fiber fabric . the annealing temperature for a copper clad laminate depends on how many prepregs of the copper clad laminate are stacked up and how the prepregs are stacked up . hence , according to the present invention , in an embodiment for use in an equivalent change , the annealing temperature is 90 c .° ˜ 150 c .°, and the annealing duration is adjustable according to the annealing temperature . regarding the measurement of high flame retardation of copper clad laminates of the present invention , the flame retardation level of the copper clad laminates is determined by ul - 94 standard . according to the present invention , a derivative ( dopo - dicy ) of dopo is added to epoxy resin to function as a curing agent for the epoxy resin , enhance the flame retardation capability and thermal stability of the epoxy resin , and , more importantly , prevent environmental pollution which might otherwise arise from the use of bromide epoxy resin and occur in the course of the use and recycling thereof . due to the reduction in the cross - linking density of the cured epoxy resin as a result of the introduction of a phosphorus - containing flame retardant , td decreases but remains higher than 300 c .° and thus meets the thermal stability requirement (& gt ; 288 c .°) of copper clad laminates . during the heating process , the phosphorus - containing residual of the phosphorus - containing group of the resin is conducive to the enhancement of the flame retardation of the laminates . table 4 enumerates the measured flame retardation - related data of the copper clad laminates manufactured from resins with different phosphorus content in the embodiments , to allow persons skilled in the art to gain insight into the flame retardation capability of a flame - retarded curing agent of the present invention and prove that the flame - retarded curing agent of the present invention is effective in achieving flame retardation . as indicated by table 4 , when phosphorus content exceeds 13000 ppm , the laminate ( embodiment 5 ) manufactured solely from coc fabric has a flame retardation level of ul - 94 v0 . referring to fig2 through fig5 for the way of stacking up glass fiber fabric and coc fabric and table 4 , the required phosphorus content is much higher for the laminate enclosed by coc fabric than for the laminate enclosed by glass fiber fabric , so is it when coc fabric accounts for more than 50 % of the composition of the copper clad laminate . it is because the degradation of the phosphorus - containing group in the phosphorus - containing epoxy resin is conducive to increasing the degradation temperature , and a carbonized substance encloses the laminate to function as a flame retardation layer , thereby enhancing flame retardation . according to the present invention , physical properties , such as electrical properties , of the copper clad laminates are measured by a dielectrometer . coc fabric has a low dielectric constant ( do of about 2 . 3 and a low dissipation factor ( d f ) of about 0 . 00007 . the electrical properties of the copper clad laminates of the present invention are measured according to different ways of stacking up the glass fiber fabric and coc fabric . table 3 shows the data related to the analysis of the electrical properties of the copper clad laminates in the embodiment 1 through embodiment 5 and the comparative embodiment . referring to table 3 , where the dielectric constant is measured by a ipc - tm - 650 test standard method , the dielectric constant of the copper clad laminate of embodiment 5 is , from 1 mhz to 5 ghz , lower than the dielectric constant of the copper clad laminate of the comparative embodiment , with a maximum difference of 2 . 1 . referring to table 3 , the copper clad laminate will have a low dielectric constant , provided that the base fabric of the highest prepreg and the base fabric of the lowest prepreg are the coc fabrics , for example , in embodiment 1 ( fig2 ) and embodiment 3 ( fig4 ); hence , the dielectric constant of a copper clad laminate is correlated with the position of the coc fabric - made base fabric at the copper clad laminate , but is not correlated with the proportion of coc fabric in the copper clad laminate . furthermore , as indicated by the data pertaining to the dissipation factor of the copper clad laminates and shown in table 3 , among the copper clad laminates in embodiments 1 - 5 , the copper clad laminate in embodiment 5 has the least dissipation factor and has the obviously lowest dissipation factor of 0 . 0004 at high frequency compared with the dissipation factor of 0 . 035 in the comparative embodiment . the dissipation factor of the copper clad laminates correlates with the proportion of coc fabric in the copper clad laminates . referring to table 3 , at a frequency of 5 ghz , the copper clad laminate made solely from coc fabric ( as in embodiment 5 ) has the least dissipation factor ( 0 . 0004 ), embodiment 2 ( fig3 ) comes second , embodiment 3 ( fig4 ) comes third , and the copper clad laminate made solely from glass fiber fabric ( as in comparative embodiment ) has the largest dissipation factor ( 0 . 035 ). in conclusion , the dielectric constant of a copper clad laminate depends on the position of coc fabric at the copper clad laminate , whereas the dissipation factor of a copper clad laminate correlates with the proportion of coc fabric in the copper clad laminate . the present invention is disclosed above by preferred embodiments . however , persons skilled in the art should understand that the preferred embodiments are illustrative of the present invention only , but should not be interpreted as restrictive of the scope of the present invention . hence , all equivalent modifications and replacements made to the aforesaid embodiments should fall within the scope of the present invention . accordingly , the legal protection for the present invention should be defined by the appended claims . | 1 |
a combustion - operated setting tool 10 according to the present invention , which is shown in fig1 - 2 , includes a one - or multi - part housing generally designated with a reference numeral 11 , and a drive 12 located in the housing 11 and driven by an air - fuel mixture . with the drive 12 , a fastening element , such as nail , bolt , etc . can be driven in a workpiece . the fastening elements can , e . g ., be stored in a magazine secured on the setting tool 10 . the drive 12 includes , among others , a combustion chamber 15 and a guide cylinder 13 which adjoins the combustion chamber 13 and in which a setting piston 14 is axially displaceable . the combustion chamber 15 , which defines a combustion chamber axis a , is limited , in its initial position shown in fig1 , circumferentially by a combustion chamber sleeve 28 and axially , at its first end , by the setting piston 14 and an annular combustion chamber wall 29 and , at its second end , by a combustion chamber rear wall 30 formed as a cylinder head . a ventilator 16 , which is provided in the region of the second axial end 32 and is driven by a motor 17 , serves both for producing a turbulent flow regime of the air - fuel mixture located in the closed combustion chamber 15 and for flushing the open combustion chamber 15 with fresh air after completion of a setting process . the motor 17 is supported on the combustion chamber rear wall 30 that serves for closing of the axially displaceable combustion chamber sleeve 28 . as shown in fig1 , a trigger switch 19 is arranged on a handle 18 of the setting tool 10 . the trigger switch 19 actuates , via control electronics , an ignition device 26 having an ignition element such as , e . g ., a spark plug , located in the combustion chamber 15 , when the setting tool 10 is pressed against a workpiece and , thereby , a press - on switch 24 , which is located in the region of the muzzle 27 of the setting tool 10 produces an actuation signal . the setting tool 10 can be operated with fuel gas or vaporizable liquid fuel available in a fuel reservoir 20 such as , e . g ., fuel can . a fuel conduit 22 connects the fuel reservoir 20 with a fuel inlet 23 of the combustion chamber 15 . in the fuel conduit 22 , a metering device 21 such as , e . g ., metering valve , is located . the metering device 21 controls the fuel supply into the combustion chamber 15 . for supplying electrical consumers such as , e . g ., the ignition device 26 and the motor 17 with electrical energy , there is provided an electrical power source 40 such as , e . g ., an accumulator . the control electronics 25 controls both the ignition device 26 and the metering valve 21 . the control electronics 25 has , e . g ., one or several microprocessors for processing data and for controlling different electrical functions of the setting tool . the control electronics 25 is connected with the power source 40 by an electrical conductor 44 . the control electronics 25 is connected with a first sensor , which is formed as a flue gas sensor 31 ( such as , e . g ., a lambda probe ), and a second sensor formed as a temperature sensor 32 . both the flue gas sensor 31 and the temperature sensor 32 are located in the combustion chamber and transmit , during the operation of the setting tool 10 , corresponding measurement data to the control electronics data to the control electronics 25 via corresponding electrical data conductors 41 , 42 . the flue gas sensor 31 is in fluid communication with the flue gases produced by combustion of fuel in the combustion chamber 15 . alternatively , the flue gas sensor 31 can be located , e . g ., in the exhaust or in the flushing chamber of the setting tool 10 . the measurement with the flue gas sensor takes place after combustion , preferably , before the combustion chamber 15 or the combustion space opens to the environment , and fresh air can enter the combustion chamber . the measurement function of the flue gas sensor 31 is controlled by the control electronics 25 and is effected , e . g . with a time - delay with regard to actuation of the trigger switch 19 or with regard to ignition pulse produced by the control electronics 25 . however , the control electronics 25 can control the flue gas measurement dependent on combustion pressure in the combustion chamber or dependent on the position of the combustion chamber sleeve 28 relative to the housing 11 . a timewise control dependent on the metering signal is also possible . if the flue gas sensor 31 is formed as a lambda probe , then the control electronics 25 can determine a metered amount of fuel , which is to be metered by the metering device 21 , for the next setting process dependent on an amount of an unconnected oxygen available in the flue gas . the metering is so selected by the control electronics 25 that lambda ratio equals one ( lambda ration is the ratio of air to fuel , at a stoichiometric fuel ratio [ lambda ]= 1 , the air amount in the combustion chamber is precisely the amount necessary for a complete combustion of the fuel ). thereby , the entire amount of oxygen , which is contained in the combustion chamber , is completely consumed during a following combustion . as a result , the resulting flue emission of an undesirable flue gas components is very small . in order to more rapidly reach the optimal operational temperature of the flue gas sensor 31 , it is combined with thermal element 33 . the thermal element 33 is likewise , controlled by the control electronics 25 and is supplied with electrical energy from the power source 40 . an electrical conductor 43 connects the thermal element 33 with the control electronics 25 . for a temperature compensation of the flue gas sensor 31 , the temperature sensor 32 is located in the immediate vicinity of the flue gas sensor 31 . a suitable software , which is contained in the control electronics 25 , or the control routine compensates the deviations of the flue gas sensor 31 at changing measurement temperatures sensed by the temperature sensor 32 . the temperature sensor 32 also provides for turning the thermal element 33 off by the control electronics 25 after the operational temperature of the flue gas sensor 31 has been reached . it is to be noted that when the flue gas sensor 31 is formed as a lambda probe , it includes , in addition to a measurement sensor located in the combustion chamber , also a measurement sensor for the environmental air for determining a reference air value . alternatively , instead of being formed as a lambda probe , the flue gas sensor 31 can be equipped with means for measuring reaction products of combustion such as carbon monoxide ( co ) or carbon oxide ( co 2 ) so that an optimal air ( or oxygen )- fuel ratio and , thereby , a necessary amount of fuel can be determined by the control electronics 25 based on content of such reaction products in the flue gas . the flue gas sensor 31 can also be equipped for measurement of a fuel component such as , e . g ., fuel gas isobutan that often forms a fuel component . for calculation of a metering time necessary for metering a necessary amount of fuel with the control electronics 25 , other operational parameters such as fuel level in the fuel reservoir 20 , gas pressure in the fuel reservoir 20 , temperature of the fuel reservoir 20 , voltage of the electrical power source 40 , environment temperature , and temperature of the combustion chamber 15 can be taken into account . for measuring these parameters , corresponding sensors are provided on the setting tool 10 . the setting tool , which is shown in fig2 , differs from the setting tool 10 shown in fig1 , in that the flue gas sensor 31 and the thermal element 33 are mounted not in or on the combustion chamber 15 but rather in or on an exhaust 35 of the setting tool 10 . the temperature sensor 32 can remain , as shown , in the combustion chamber 15 or , alternatively , also be located in the exhaust 35 . otherwise , the explanations given with respect to fig1 are valid for the setting tool 10 shown in fig2 ; therefore , with regard to the reference numerals not specifically mentioned above , a corresponding description made with reference to fig1 applies in its entirety . though the present invention was shown and described with references to the preferred embodiments , such are merely illustrative of the present invention and are not to be construed as a limitation thereof and various modifications of the present invention will be apparent to those skilled in the art . it is therefore not intended that the present invention be limited to the disclosed embodiments or details thereof , and the present invention includes all variations and / or alternative embodiments within the spirit and scope of the present invention as defined by the appended claims . | 1 |
reference will now be made in detail to preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . the exemplary embodiment will be described in the context of a system for processing aerial imagery with enhanced 3d & amp ; nir imaging capability especially for crop management , but those skilled in the art will recognize that the teachings of the exemplary embodiment can be applied to other applications including aerial surveying . the present solution offers a semi - automated image collection process , which begins with the planning of a collect over an area of interest . the area of interest may be defined by one or more environmental systems research institute ( esri ) shape files that circumscribe the area of interest , or by a defined geographic location or other point of reference in combination with a desired radius or distance from this point . a pilot is engaged to fly the collect and is provided with a flight plan in the form of a collection box to overfly containing the area of interest . in many cases , several collects are planned for one flight and the pilot flies from one collection box to the next . the collect flight is computer - guided and image acquisition is automated as described below . the payload requires a gps receiver , but otherwise no inertial measurement capabilities or imu , and is well suited for flight in a manned general aviation aircraft or a uav . at least one and preferably two payload cameras are mounted inside the aircraft and pointed out of an optical port in the floor , or alternatively mounted externally in pods specially designed to accommodate cameras on planes lacking optical ports . the payload camera may comprise either a consumer market digital single lens reflex camera , a near - infrared ( nir ) camera , and / or a consumer slr modified for acquisition of nir imagery . fig1 illustrates an exemplary two camera airborne imaging payload . camera 110 is a consumer grade digital single lens reflex camera such as a nikon ™ d5100 16 . 2mp cmos digital slr camera with 18 - 55 mm f / 3 . 5 - 5 . 6 af - s dx vr nikkor ™ zoom lens . camera 112 is a comparable camera for near - infrared ( nir ) imagery , and indeed may be an identical camera to the first that has been modified for acquisition of nir as set forth in u . s . pat . no . 7 , 911 , 517 to hunt et al . issued mar . 22 , 2011 . in addition , a standard gps receiver 40 is used , and this may be any consumer or oem receiver with a serial output , such as a garmin gps - 35lvc ™ gr - 213u gps receiver . the cameras 110 , 112 and gps receiver 40 are connected to an avionics box 30 which is in turn connected to a tablet pc 20 ( or laptop pc ). the tablet pc 20 runs pilot interface software for guiding the collect over the area of interest based on the gps 40 data . fig2 is a block diagram of the payload of fig1 . the avionics box 30 contains a microprocessor that runs a firmware program to record the gps 40 time and position once each second ( gps top - of - second ) and communicates this data to the tablet pc 20 ( or laptop ) in serial messages sent over an rs - 232 or other digital interface . the tablet pc 20 uses these messages to drive the pilot &# 39 ; s display and to record a flight log . whenever the plane is within the collection box , the flight control software on the tablet pc 20 sends a serial command to the avionics box 30 to enable camera triggers . the avionics box 30 includes a counter that increments with each top - of - second gps pulse , and when the counter reaches a preset value , the camera ( s ) 110 , 112 are triggered , a photo is taken , and the counter resets . user controls are provided at the tablet pc 20 to program the number of seconds between photos . in operation , the laptop 20 guides the pilot to fly the collection plan to collect imagery over a large collect area , while the avionics box 20 controls the cameras 110 , 112 and furnishes telemetry from gps 40 including time , latitude and longitude of each photo for guidance and post - flight processing . fig3 shows a screen capture from the pilot &# 39 ; s interface display on the tablet pc 20 in the cockpit . the aircraft 2 is represented near the center of the display at the geographical site reported by the gps receiver 40 . given the above - mentioned collect of an area of interest , the collection box is represented by a blue box 102 that circumscribes the collection area , and box 102 is plotted with several flight lines 104 (“ rasters ”). the rasters 104 are calculated and plotted in real time by the tablet pc 20 . the spacing between rasters 104 is calculated in accordance with a predefined altitude so that all the ground between different rasters 104 will be photographed and that photos from adjacent rasters 104 will overlap . importantly , the software automatically orients the rasters 104 so that the direction of flight is either towards or away from the sun at the time of the collect . a solar ephemeris inside the flight control software calculates the position of the sun in the sky using the position and time from the gps 40 . the tablet pc 20 determines the solar ephemeris using the time when the aircraft arrives in the vicinity of the collect , calculates the direction of flight toward and away from the sun , and automatically orients the rasters 104 in parallel paths of alternating direction . this helps to improve tile boundary continuity in the mosaics as there is generally a strong dependence on reflected light intensity according to whether sunlight is reflected towards the camera ( s ) 110 , 112 in the forward - scatter or away from the camera ( s ) in the back - scatter geometry . in general , when flying towards or away from the sun , scattering differences will create a noticeable seam between pictures belonging to the same raster in a mosaic . however , decreasing the time between successive photos brings seams closer together , which diminishes the difference in scattering across each seam for a smoother transition . the pilot interface display software tracks the aircraft 2 position . the current - heading line 107 is color - coded to indicate current heading and the checkerboard gives scale . the pilot interface display updates in real time using the latest gps 40 information . as the aircraft 2 flies along a raster 104 , the camera ( s ) 110 , 112 are repetitively triggered at the beginning of each gps 40 cycle . typically , the flight plan will require a photo every 1 , 2 , or 3 seconds in order to collect photos with significant overlap along the raster 104 and the avionics box 30 synchronizes the camera 110 , 112 shutters to the gps 40 signal , firing periodically but each time at the “ top - of - the - second .” camera shutter triggering is automatically suppressed outside of the collection area 102 , after which the pilot breaks off the flight line , turns around , and heads into the next raster 104 . the pilot interface display software offers the pilot cues such as “ true - heading ” directional vector 107 for aligning the flight path with the intended raster 104 , and numerical readouts including heading 121 , lateral displacement 122 , ground speed 123 , and gps altitude 124 , all of which help to maintain proper heading , altitude and ground speed . tracks actually flown are shown in serrated lines 109 . if the pilot fails to fly a sufficiently precise flight path along a raster 104 ( within predefined error tolerances ) the pilot interface display software designates the raster 104 for reflight . the pilot , after landing the plane or uav , subjects the collect including photos and flight log ( with recorded shutter times and gps positions of the aircraft during flight ) to a multi - step process that begins with local pre - processing and upload to a cloud - based network , followed by a one or two - pass processing in the cloud - based network . the cameras 110 , 112 are equipped with secure digital ( sd ) cards , which are taken out of the cameras and inserted into a local pc computer to facilitate pre - processing and upload . fig4 is a block diagram illustrating the steps of photo pre - processing and cloud - based network upload . at step 200 the collected photos are transferred from the sd cards from cameras 110 , 112 in uncompressed “ raw ” format to a local computer . at step 210 the collected photos are processed into tagged image file format ( tiff ) format using an open source software program called dcraw . the conversion to tiff may be done on a local computer or in the cloud . when the raw files from the nir camera 112 are processed to tiff it is important , for agricultural applications , to apply a white balance calibration , the calibration parameters being specific to the particular camera used . the white balance calibration is applied at step 240 . at the same time , at step 220 , the flight log file ( with recorded shutter times and gps positions of the aircraft during flight ) is input at step 230 , to extract the gps locations for the aircraft 2 and to construct a local reference frame for the aircraft at its location for each photo in which to orient the camera ( s ) 110 , 112 . the local reference frame is defined by the aircraft position and velocity vectors , which are respectively approximately parallel to the aircraft yaw and roll axes . at step 250 the tiff format photos are uploaded to the cloud computing network 50 if not already existing there . at steps 260 - 280 necessary data from public sources is uploaded , including a digital elevation model ( dem ) for the area of interest at step 270 , the height of geoid above the wgs 84 ellipsoid at step 260 , and any reference imagery or survey markers at step 280 . in addition , default camera calibration parameters specific to the camera - lens combinations in use by cameras 110 , 112 are uploaded at step 290 . fig5 illustrates a suitable cloud computing network 50 with an attached cloud data store 52 . any number of cloud computing nodes 54 may be connected in the cloud computing network 50 , each running cloud computing services 53 in accordance with the present invention . a local network 58 is in communication with the cloud computing network 50 . end users 59 in local network 58 access cloud - based applications 53 from their local computers through a web browser or a light - weight desktop or mobile application , using a standard i / o - devices such as a keyboard and a computer screen in order to upload all of the foregoing tiff format photos , flight log , public source data and calibration data to the cloud computing network 50 . once uploaded , the collective data is subjected to a one or two - pass image registration process described below . fig6 ( a ) is a flow chart illustrating the first - pass steps of the image registration process , beginning with the now - uploaded tiff images at step 251 . at step 255 , the tiff images are linked to create a large set of image tie - points ( itps ). one of the cloud - based applications 53 is an automated image tie - point registration module . itp module 53 uses an automated tie - point process to do an approximate registration between pairs of photos . image - to - image tie - point registration is well known and generally involves the identification of many image tie - points . the present approach works with image pairs . one image is designated as the “ home frame ” and small templates called “ chips ” are extracted from it . a match for each chip is searched for in the other photo ( called the “ target frame ”). the present invention uses a novel “ accelerated ” multi - resolution matching method as described below . when a match is successful , we know that an object in the chip centered at a specific pixel location ( row 1 , column 1 ) within the home frame is found at ( row 2 , column 2 ) within the target frame . this correspondence between ( row 1 , column 1 ) and ( row 2 , column 2 ) is a tie point . since the orientation between photo 1 and photo 2 can be arbitrary , the first photo is remapped (“ pre - rectified ”) into the geometry of the second as the chips are extracted . therefore , the chips are as they would appear were they acquired from the vantage point of the second photo . the linking of images 255 by tie points is highly parallelized within the cloud computing network 50 . two problems arise with the foregoing approach . the first problem is that knowledge of all twelve states ( three position and three orientation states per image ) associated with each image pair is required for pre - rectification . the second problem is that image matching must face an added complication in that perspective changes from image - to - image . in each pair of images , three dimensional objects are being viewed on the ground from two distinct vantage points . this can make the appearance of the object change and compromise the ability of algorithms such as normalized cross correlation to find matches . to overcome both problems , a multi - resolution matching method is used . the registration software module ( resident on one or more computing nodes 54 of fig5 ) loads the first and second images to be registered . fig7 is a detailed illustration of one stage of the present multi - resolution matching method . the stages are stacked with n = 0 on the bottom , followed by n = 1 , and progressing up to a top stage . stage n works with imagery with its resolution reduced by 2 n binning relative to the original image . at left , the home frame is read into memory . at the right , the target frame is read in . at steps 102 , 108 both are iteratively binned two fold , progressing stage - by - stage up to the top . the first iteration of matching starts at the top stage with a very low resolution , e . g ., 32 × 32 binning , where arrays of 32 × 32 pixels have been binned into a single larger pixel , greatly reducing the overall number of pixels . this aggregation greatly reduces the processing time but degrades resolution . chips are extracted from the home frame at step 103 on a regular grid and reprojected from the perspective of the home frame into the perspective of the target frame in a pre - rectification step 105 relying on the three position and three orientation states for each frame . an accelerated normalized cross - correlation ( ncc ) algorithm 106 finds itp matches for each chip in the target frame . when successful , the itps are saved and used to re - navigate the target frame at step 111 , which allows for a more accurate pre - rectification in the stage below . processing terminates at stage zero . fig8 pictorially illustrates how this works in practice over an orange grove in california . matches between frame pairs ( left and right , e . g ., 1992 and 1993 ) are attempted at each site marked . the quality of the result is graded and color - coded , with the best indicated by purple , followed by blue , green and red . higher quality purple and blue sites are considered adequate for navigation purposes , although a few matches may be cast out in statistical outlier editing during the navigation step 111 . the starting resolution ( bottom right ) is that of 32 × 32 binning . at this scale , no matches are found in this illustration . next , 16 × 16 binned - resolution is attempted ( middle right ). best results are obtained at 8 × 8 and 4 × 4 binning . perspective change between pictures interferes with effective matching at 2 × 2 and 1 × 1 binning in this illustration . the ncc algorithm first normalizes the chip template t ( x , y ) by subtracting its mean and dividing by its standard deviation , so that the result { circumflex over ( t )}( x , y ) has zero mean and unit variance . the normalized cross - correlation for the chip over the image i ( x , y ) is ordinarily calculated at all possible shifts ( u , v ) according to the formula : in the formula , the notation ī u is the mean value of the image pixels underneath the chip when offset by ( u , v ). acceleration of the ncc algorithm is accomplished by first sorting the { circumflex over ( t )}( x , y ) in descending order by absolute value . those that are early in the sorted list are the most important contributors in the formula . at each ( u , v ), a partial calculation is made with a subset of the sorted list to predict the value of the full precision calculation . in almost all cases , the predicted value of c ( u , v ) will be small and it is not worth completing the calculation to full precision ; however , when the prediction is large , the calculation is completed to full precision . all successfully matched itps are collected from all the stages of the multi - resolution matching process for all frames linked by tie points . fig9 shows a practical illustration with eight rasters . the gps location for the aircraft at each frame is plotted next to a frame number . purple links indicate that a large number of itps were found and blue links indicate that an adequate number were found . the entire collection of itps are input into a navigation process 256 , which estimates a set of six states for each frame plus common states to represent the camera calibration ( focal length and optical distortion ). fig1 plots a typical set of state solutions . state estimation uses a conventional nonlinear weighted least squares estimation method so the states solved for are the optimal ones to describe the complete set of itp measurements . roll ( r ), pitch ( p ), and yaw ( y ) states orient the camera . position states represent corrections to the gps along the x - axis ( direction of flight ), y - axis ( along wing ), and z - axis ( vertical ) of the local reference frame . not shown are the camera calibration states for one camera . green symbols are in an earth fixed frame , whereas blue symbols are in the local reference frame for each state . individual itp measurements are more heavily weighted in the least squares estimation if made at a finer resolution . itps are also two - dimensional measurements , so that the direction parallel to the baseline between the two aircraft positions can be down - weighted relative to the orthogonal direction , which is beneficial because this direction along the baseline is affected by parallax . at step 229 each uploaded image is ortho - rectified to a map projection ( e . g ., utm ) in accord with the state solution . an orthorectified image is one that has been geometrically corrected (“ orthorectified ”) such that the scale of the photograph is uniform , meaning that the photograph can be considered equivalent to a map . every pixel of an orthorectified image of the earth corresponds to a view of the earth surface seen along a line perpendicular to the earth . an orthorectified image also comprises metadata referencing any pixel of the orthorectified image to a point in the geographic coordinate reference system . each remapped frame is prepared as a geotiff ( tiff file extended to include geographic referencing metadata tags ). the georegistration of the collect can be checked in step 231 by comparing the locations of fixed landmarks seen in reference imagery or positions of aerial surveying targets versus their locations seen in the geotiffs . deviations in geo - registration of landmarks , if deemed too large , can be corrected in an optional second pass as shown in fig6 ( b ) . the landmark measurements from the quality control step 231 are added as itps between the reference imagery and the image frames containing the landmarks . the navigation step 256 and remapping step 230 are repeated and georegistration quality is re - verified in step 231 . the remapped photos cover the entire collect with great redundancy ( i . e ., significant overlap between photos so that the same point on the ground is covered multiply ). thus , a single pixel can be chosen from each image pair to represent each point on the ground , or alternatively , mosaic pixel values can be blended from two or more pixels . either way , the process will create a single two - dimensional mosaic as shown in fig1 ( a & amp ; b ). fig1 ( a ) is a sample mosaic from camera 110 , while sample 11 ( b ) is from nir camera 112 . note that renderings 11 ( a , b ) lose their 3d information . in order to restore 3d , the present process rasterizes the two remapped photos and determines the overlaps between successive ones . overlapping pairs of successive images ( stereo pairs ) are rendered for the left and right eye using 3d enabled graphical display technology to present the user with a 3d mosaic . the parallax between stereo pairs gives the height above the digital elevation model used in remapping . we can measure heights of objects from this residual parallax . either 2d or 3d mosaics can be converted into normalized differential vegetation index ( ndvi ) products , as seen in fig1 ( c ) . ndvi is a measure of plant cover and plant health . a green ndvi is possible with a one - camera payload as follows : e . g ., the difference between the nir and green responses divided by their sum . a red ndvi is possible with the two - camera payload as the difference between red and green divided by their sum . fig1 ( c ) shows both red ndvi ( red ) and green ndvi ( green ) overlaid . it should now be apparent that the above - described system provides a turnkey solution for collecting and processing aerial imagery at far lower cost and reduced computer overhead , allowing geolocation of each pixel to high accuracy and generating uniquely processed 3d nir imagery for diagnosis of plant health . deployed as a cloud - based software as a service ( saas ) the system allows uav and manned aircraft pilots to upload and manage their image processing through a web based interface . the foregoing disclosure of embodiments of the present invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . many variations and modifications of the embodiments described herein will be obvious to one of ordinary skill in the art in light of the above disclosure . the scope of the invention is to be defined only by the claims , and by their equivalents . | 6 |
a beam of neutral atoms or molecules each having a magnetic dipole moment m d is propagatable along the z axis of a cartesian coordinate system . if a homogeneous magnetic field h is applied in the y direction , the torque expressed by the equation : influences each beam particle . it is known from atomic physics that the magnetic dipole moment is a function of the angular momentum of the electron shell j according to the equation : and that the torque d effects precession of j and m d around the y - axis . the precessional frequency is defined by the equation : in equations ( 2 ) and ( 3 ), μ b = magneton ; h = h / 2π ( h = planck &# 39 ; s constant ), m e = electron rest mass , and g j = landes &# 39 ; g - factor . given such precession , only the y - component of the dipole moment m d remains constant with time . this y - component of the dipole moment m d is related to the magnetic quantum number m j by the equation : wherein the magnetic quantum number m j may assume a total of 2j + 1 values where j is the total angular momentum quantum number of the electron shell . in order that the y - component of the dipole moment , m dy , is of the same size for all beam particles , all beam particles must exhibit the same magnetic quantum number m j . other quantum states can be stripped , for example , with a stern - gerlach separator . when the particles are aligned as described above , only the chronologically constant component m dy of the dipole moment need be considered for the beam deflection and beam focusing , because the transit time τ is large in comparison to the precessional period t p , according to the relationships : which can be achieved by means of a sufficiently high b - field . in equation ( 5 ), l is the beam length and v is the velocity of the beam particles . the force f exerted on magnetic dipole particles in a magnetic field h is expressed by the equation : ## equ1 ## requiring the magnetic field h to have a gradient for deflecting the dipole particle in the direction of the magnetic dipole moment m d . in the simplest case , such a gradient may be selected to be a constant . quadrupole fields having the following configuration exhibit such a constant field gradient : ## equ2 ## in the above equations constituting ( 7 ), ψ is the scalar magnetic potential and ψ 2c ( z ) and ψ 2s ( z ) are field coefficients which are not dependent on x or y . using the expression m d = m dy e y , and substituting the magnetic field h from equation ( 7 ) into equation ( 6 ) for the force f , the following expression for the force f derives : ## equ3 ## the quadrupole field b according to equation ( 7 ) causes deflection of neutral particles exhibiting a magnetic moment m d = m dy e y both in the y - direction and in the x - direction . by superimposing the quadrupole field which causes deflection in the x - direction and the quadrupole field which effects deflection in the y - direction , deflection of the neutral particles , which essentially exhibit only a y - component of the magnetic dipole moment , can be accomplished in any desired direction . the deflection direction having a deflection angle θ a is determined by the ratio of the field coefficients ψ 2c / ψ 2s from equation ( 7 ) as follows : ## equ4 ## the magnitude of the deflection coordinate r a =√ x a 2 + y a 2 is proportional to √ ψ2c 2 + ψ2s 2 . the generation of an azimuthally rotatable quadrupole field which is variable in intensity utilizing a magnetic six - pole or eight - pole lens is described in greater detail below in connection with fig1 and fig2 . although neutral particles exhibiting a magnetic dipole moment can be focused by means of six - pole magnets , such focusing is generally convergent in only one section and is divergent , i . e ., &# 34 ; defocusing &# 34 ; in another section . because the magnetic dipole moments of the beam particles in the sample embodiment discussed herein are aligned in the y - direction by the external magnetic field h , the six - pole field for focusing the beam particles should be of the form : is allocated . the following motion equation can then be derived utilizing equation ( 10 ): ## equ5 ## in equation ( 12 ), m denotes the mass of a neutral particle , and t designates time . applying the chain rule for derivatives , t can be eliminated from equation ( 12 ) as follows : ## equ6 ## wherein v denotes the particle velocity . the following two orbital equations can then be derived : ## equ7 ## analysis of the equations designated ( 13 ) shows that when the coefficient ψ 3s is greater than zero , focusing occurs along the x - section and diverging or defocusing occurs in the y - section ; however , when the coefficient ψ 3s is less than zero , defocusing occurs in the x - section and focusing occurs in the y - section . additionally , the paraxial orbital equations for a neutral particle exhibiting a magnetic dipole moment designated at ( 13 ) exhibit the same shape in a six - pole field as the paraxial orbital equations of a charged particle in a quadrupole field . the paraxial orbital equations of a charged particle in a quadrupole field are described in the text &# 34 ; quadrupoles in electron lens design ,&# 34 ; p . w . hawkes , academic press ( 1970 ). this means that all laws known from quadrupole optics can be fully transferred for focusing neutral particles in the embodiment disclosed herein . stigmatic imaging with neutral particles can be achieved with a pair of six - pole magnets , of which one six - pole magnet has a coefficient ψ 3s greater than zero , and the other of which has a coefficient ψ 3s less than zero . in such an embodiment , however , the two primary enlargements v x and v y are no longer variable without changing the subject - to - lens distance , the image distance , or the distance between the pair of six - pole lenses . if a trio of six - pole lenses is employed , stigmatic imaging can be achieved and the quotient v y / v x of the two primary enlargements can be varied within certain limits by changing the six - pole lens strengths without deteriorating the stigmatic image plane . utilizing four six - pole lenses , it is possible to separately change the primary enlargements v y and v x within certain limits without losing stigmatic imaging in the fixed image plane . the magnetic induction b necessary for alignment of the neutral particle beam has the relation : ## equ8 ## wherein u b is the kinetic energy of the neutral particle expressed in volts and m is the mass of the neutral particle . utilizing arsenic as an example in equation ( 14 ), which has an atomic weight of 74 . 9 and a lande factor g j = 2 ( because of ground energy level 4 s 3 / 2 ), and assuming a beam length l = 0 . 2 m and a voltage ub = 2 kv , the magnetic induction b must be significantly greater than 0 . 3 gauss , which is relatively easy to achieve . the equation for computing the maximum possible beam deflection , neglecting the fringe field , is : ## equ9 ## for the deflection y a according to the fundamental calculation . in equation ( 15 ), l indicates the path length along which the magnetic induction b influences the neutral particles and l indicates the distance which the neutral particles traverse after influence of the magnetic induction up to the location at which the deflection y a is measured . the following exemplary calculation can be undertaken to determine the maximum deflection y a . assume ψ 2c is the quadrupole coefficient of a magnetic field b expressed as follows : if a value of 20k gauss is assumed for the fringe field strength at the pole pieces of the magnetic lens , a value of 2 kv is assumed for the kinetic energy of the neutral particles , a value of 4 mm is assumed for the spacing of the pole pieces of the magnetic lens , a value of 200 mm is assumed for the path length of the neutral particles within the influencing range of the magnetic induction , and a value of 500 mm is assumed for l up to the z coordinate of that plane in which the deflection y a is measured , and further assuming a value 3 / 2 for the magnetic quantum number m j and a value of 2 for the lande factor g j , the deflection | y a | is approximately 5 μm . in practice , because of the small raster field of the beam deflection lens , a laser - controlled mechanically movable specimen table is required for the workpiece . a magnetic six - pole lens which may be employed in a beam lens for varying the beam cross - section is shown in fig1 . the magnetic six - pole lens is disposed in the x - y plane and has a yoke jo with six pole pieces 1 through 6 each having an excitation winding e . the following currents flow in the excitation windings e of the individual pole pieces : ## equ10 ## half the distance between the pole pieces 1 through 6 is referenced a . the azimuthal angle θ is measured from the positive x - semiaxis proceeding toward the positive y - semiaxis . the winding currents are proportional to the coefficients of the scalar magnetic potential , that is , the winding currents having a specific index are respectively proportional to the coefficient ψ having the same index . the scalar magnetic potential ψ is then of the following form : ## equ11 ## in the sample embodiment , the magnetic induction and the magnetic field of a magnetic six - pole lens as shown in fig1 are composed of three terms : a dipole field far in the y - direction alignment of the beam particles , a quadrupole field for beam deflection variable in strength and azimuthal position , and an azimuthally fixed six - pole field for beam focusing as derived and specified above : ## equ12 ## a magnetic eight - pole lens which can be employed in the vario - shaped beam deflection lens disclosed herein is shown in fig2 . the magnetic eight - pole lens shown in fig2 is again disposed in the x - y plane , and has a yoke jo and eight pole pieces 1 through 8 , each having an excitation winding e . the following winding currents flow into the excitation windings e of the pole pieces 1 through 8 : ## equ13 ## the winding currents i i for the windings shown in fig2 have the same relationship to the scalar magnetic potential and to the magnetic induction and to the magnetic field as the corresponding winding currents for the six - pole arrangement shown in fig1 . the component currents proportional to i is generate a dipole field for alignment of the magnetic dipole moment of the beam particles in the y - direction . the component currents proportional to i 2c or i 2s generate a quadrupole field for deflection of the atom beam in the x - and y - directions which is adjustable in strength and azimuthal position . the component currents proportional to i 3s generate a six - pole field fixed in azimuthal position by means of which the particle beam can be focused in one section and defocused in the other section . a schematic representation for a vario - shaped beam deflection lens for neutral particles is shown in fig3 a and fig3 b . fig3 a shows a section in the x - z plane and fig3 b shows a section in the y - z plane . a neutral particle beam n traverses a beam diaphragm f and is caused thereby to expand conically in the z - direction exhibiting an angle α . the neutral particle beam n then traverses a system s consisting of at least two lenses l , which may be six - pole lenses as shown in fig1 or eight - pole lenses as shown in fig2 . as indicated by the dashed lines , the system s may be comprised of three such lenses or four such lenses as well without departing from the inventive concept disclosed and claimed herein . the nondeflected shaped particle beam probe su is conically focused on a subject , such as a workpiece . the angles of this cone in the two sections are β x and β y respectively . the two primary enlargements v x and v y are also indicated according to the relationships v x = α / β x and v y = α / β y . the deflected shaped beam probe sg can exhibit any designed deflection coordinates x a , y a . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventor to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of his contribution to the art . | 6 |
hereinafter , exemplary embodiments of the present invention will be described with respect to the accompanying drawings . in describing the present invention , if it is determined that the detailed description of a related known function or construction renders the scope of the present invention unnecessarily ambiguous , the detailed description thereof will be omitted . fig3 is a diagram showing an architecture of 8 × 8 add - drop benes networks according to the present invention . the architecture of the add - drop benes networks includes an input stage 210 having eight input ports , an input connection stage 220 for connecting output signals of the input stage 210 , an add connection stage 230 for connecting the input connection stage and connecting the inputs of the eight add ports , a drop connection stage 240 for connecting the outputs of the add connection stage 230 , outputting some outputs to a next stage , and outputting some outputs to drop ports , an output connection stage 250 for connecting some outputs of the drop connection stage 240 to an output side , and an output stage 260 for outputting the outputs of the output connection stage 250 to output ports . in the 8 × 8 add - drop benes networks having such an architecture , 2 × 2 switches located at an intermediate stage of the 8 × 8 add - drop benes networks are replaced with four 2 × 2 switches . since the replaced four 2 × 2 switches are connected to the switches of other stages and are connected to other add - drop ports , 8 × 8 benes networks , in which a total of eight add - drop ports is included , are implemented in view of the overall network . the present invention is not limited thereto and is applicable to n × n benes networks . in the implementation of the add - drop function of the n × n benes networks , the number of 2 × 2 switches of the intermediate stages is increased to four . accordingly , in the method of implementing the n × n add - drop benes networks , a total of n ( log 2 n + 1 ) 2 × 2 switches is required . a table for comparing the number of 2 × 2 switches necessary for the existing n × n benes networks , the number of 2 × 2 switches necessary when using 2n × 2n benes networks in order to implement n × n benes networks , and the number of 2 × 2 switches necessary for n × n add - drop benes networks using the method suggested by the present invention is shown in fig4 . in the benes networks , with respect to time slot - based packets in which different input ports have different output ports as the destinations , physical connections of all input - output pairs can be performed using a looping algorithm . in the add - drop benes networks of the present invention , when an add - drop function is implemented by a relatively small number of 2 × 2 switches , the ratio of 2 × 2 switches per port is smaller than that of the existing benes networks and thus a degree of freedom for the physical connection between the ports is decreased . accordingly , an algorithm for the add - drop benes networks and an add - drop looping algorithm require an additional limitation , as compared with the looping algorithm used in the existing benes networks . the add - drop looping algorithm processes the time slot - based packets , and requires an add function from the add ports and a function for transmitting contention packets or loss packets to drop ports in addition to the physical connection of the input - output pairs . the add - drop looping algorithm extracts packets to be dropped from the packets input during the time slot and arranges the packets in a last portion thereof . after the connection between the inputs and the outputs , which are not dropped , is performed using the existing looping algorithm , packets to be transmitted to the drop ports are processed by checking the states of the switches of the intermediate stage . when the number of packets to be dropped is n , n switches of 2 × 2 switches of a log 2 n - th stage are in an idle state and one of two switches of a ( log 2 n + 1 )- th stage connected thereto is also in an idle state . after the packets to be dropped arrive at the 2 × 2 switches of the log 2 n - th stage in the idle state , the current switch state is determined so as to be connected to the 2 × 2 switches , which are not in the idle state , of the switches of the ( log 2 n + 1 )- th stage . since the connection state is determined in advance such that the 2 × 2 switches which are not in the idle state are connected to the output ports , the packets which arrive at the ( log 2 n + 1 )- th stage through the above process are dropped . if all the switches of the ( log 2 n + 1 )- th stage connected to the 2 × 2 switches of the log 2 n - th stage in the idle state are in the idle state , the states of the 2 × 2 switches of the log 2 n - th stage are determined to arrive at any of the 2 × 2 switches . the current switch states of the switches of the ( log 2 n + 1 )- th stage , the subsequent states of which have not been determined , are determined such that the input packets are dropped . the add function may be performed before the packets to be dropped are processed . however , in the present invention , the add function has been performed after the drop function , for simplicity . if the output ports which are the destinations of the packets to be added are occupied by the connection of the input and output packets , which is performed in advance , the packets are not added and wait for a next time slot . if the output ports of the packets to be added are not occupied by other packets , the packets may be added . at this time , an algorithm for determining the add ports is necessary . the packets to be added should necessarily pass through the switches in the idle state out of the 2 × 2 switches of the ( log 2 n + 1 )- th stage . due to the characteristics of the architecture of the add - drop benes networks , the 2 × 2 switches of the ( log 2 n + 1 )- th stage are not connected to all the output ports , odd - numbered 2 × 2 switches from the top in the ( log 2 n + 1 )- th stage are connected to first to n / 2 - th output ports , and even - numbered 2 × 2 switches are connected to ( n / 2 + 1 )- th to n - th output ports . accordingly , the packets to be added are added to the adequate add ports according to the numbers of the output ports which are the destinations of the packets to be added . at this time , in a state in which it is determined whether or not the 2 × 2 switches of the ( log 2 n + 1 )- th stage of the add - drop benes networks are in the idle state , if the output ports of the add packets are between 1 and n / 2 , any one of the odd - numbered switches of the switches in the idle state of the ( log 2 n + 1 )- th stage is arbitrarily selected and any one of the 2 × 2 switches of the log 2 n - th stage connected to the 2 × 2 switches in the idle state of the ( log 2 n + 1 )- th stage is arbitrarily selected so as to select the add ports connected thereto . if the output ports of the add packets are between n / 2 + 1 to n , any one of the even - numbered switches of the switches in the idle state of the ( log 2 n + 1 )- th stage is arbitrarily selected and any one of the 2 × 2 switches of the log 2 n - th stage connected to the 2 × 2 switches in the idle state of the ( log 2 n + 1 )- th stage is arbitrarily selected so as to select the add ports connected thereto . the connection of the input - output pairs in the add - drop benes networks , the drop function and the add function may be performed by the add - drop looping algorithm process , without causing a problem . an example of the time slot - based input - output pair of the 8 × 8 add - drop benes networks is shown in fig5 a . here , the numbers of the input ports and the output ports denote the numbers of the 2 × 2 switches . in the input stage 210 of fig3 , an upper input port of an uppermost 2 × 2 switch has a number 1 and a lower input port thereof has a number 2 . in the output stage 260 , an upper output port of an uppermost 2 × 2 switch has a number 1 and a lower output port thereof has a number 2 . when the packets in one time slot have properties of the input / output ports of ( 6 -& gt ; 3 ), ( 3 -& gt ; 7 ), ( 1 -& gt ; 6 ), ( 8 -& gt ; 3 ), ( 2 -& gt ; 6 ), ( 7 -& gt ; 5 ), ( 4 -& gt ; 7 ) and ( 5 -& gt ; 8 ), since the output port having the number 3 is occupied by the ( 6 -& gt ; 3 ) packet , the ( 8 -& gt ; 3 ) packet is dropped . similarly , the ( 2 -& gt ; 6 ) and ( 4 -& gt ; 7 ) packets are dropped and the algorithm rearranges the packets to be dropped . in the add function , when the packets having the output ports having the numbers 1 , 2 , 3 and 4 as the destinations are added , since the output port having the number 3 is occupied by the ( 6 -& gt ; 3 ) input - output pair in advance , the packet having the output port having a number 3 cannot be added and waits for a next time slot , and only the packets having the output ports having the numbers 1 , 2 and 4 are added . the add - drop looping algorithm is used for the add - drop function and the connection of input - output packets in the time slot shown in fig5 a , and the processes thereof in the 8 × 8 add - drop benes networks are shown in fig5 b , 5 c and 5 d . an example of the input - output connection of the add - drop looping algorithm in the 8 × 8 add - drop benes networks is shown in fig5 b . on the basis of the rearranged packets , packets which are not dropped , that is , ( 6 -& gt ; 3 ), ( 3 -& gt ; 7 ), ( 1 -& gt ; 6 ), ( 7 -& gt ; 5 ) and ( 5 -& gt ; 8 ), are connected using the looping algorithm . an example of the drop function of the add - drop looping algorithm in the 8 × 8 add - drop benes networks is shown in fig5 c . in order to drop the packets to be dropped , that is , ( 8 -& gt ; 3 ), ( 2 -& gt ; 6 ) and ( 4 -& gt ; 7 ), the states of the switches are determined such that the packets arrive at the switches in the idle state of the 2 × 2 switches in the log 2 n - th stage and the current switch states of the log 2 n - th stage are determined so as to be connected to the switches , which are not in the idle state , of the 2 × 2 switches of the ( log 2 n + 1 )- th stage . since the input ports are connected to the output ports in advance , the newly input packets to the switches which are not in the idle state are connected to the drop ports . an example of the add function of the add - drop looping algorithm of the 8 × 8 add - drop benes networks is shown in fig5 d . for the add function , the packet having the output port of the number 3 as the destination out of the standby packets cannot be added in this time slot , because the output port 3 is occupied in advance . only the packets having the output ports of the numbers 1 , 2 and 4 can be added in this time slot . since the numbers of all the output ports are equal to or less than 4 , the add function is performed through the odd - numbered switches , that is , the third , fifth and seventh switches out of the 2 × 2 switches in the idle state in the fourth stage . since the third switch of the four stage is connected to the third and fourth switches of the third stage , the packets to be added through the third switch of the fourth stage use the add port connected to the third or fourth switch of the third stage . similarly , the packets to be added using the fifth switch of the fourth stage use the add port connected to the fifth or sixth switch of the third stage , and the packets to be added using the seventh switch of the fourth stage use the add port connected to the seventh or eighth switch of the third stage . in fig5 d , the add packets having the output port having the number 1 are added through the third switch of the third stage and the third switch of the fourth stage , the add packets having the output port having the number of 2 are added through the fifth switch of the third stage and the fifth switch of the fourth stage , and the add packets having the output port having the number of 4 are added using the seventh switch of the third stage and the seventh switch of the fourth stage . accordingly , it can be seen that the add - drop looping algorithm is operated in the add - drop benes network without causing a problem . an example of an application of the add - drop benes networks having the add - drop function is shown in fig6 . however , the present invention is not limited thereto and is applicable to all the cases in which the add - drop function is necessary . in the present embodiment , the application of the add - drop benes networks for controlling the packets due to contention and loss in the networks , which includes add - drop benes networks , an optical / electrical converter , an electrical / optical converter , an electrical buffer and an electrical switch , is shown . if packets of different input ports have the same output port as the destinations during the same time slot , since only one of the packets can arrive at the output port , it is determined that contention between the packets occurs . the packet which cannot arrive at the output port due to the contention should be controlled in the benes networks . in the add - drop benes networks , the contention packet is sent to the drop port , is subjected to optical / electrical conversion , and is buffered by the electrical buffer . after buffering , the packet is allocated to the electrical buffer again by the electrical switch , is buffered until the output port which is the destination of the original packet enters the idle state , is subjected to the electrical / optical conversion when the output port enters the idle state , is added by the add port , and is sent to the original destination . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims . | 7 |
referring now to fig2 , there is shown a patch antenna 200 that may be used in a mobile device , such as a cellular phone . a patch antenna 200 comprises two conducting plates , 10 and 12 , sandwiching a dielectric material 14 , and may be built in a similar way as a parallel plate capacitor . in the case of an antenna , the bottom conducting plate 10 may be referred to as the “ ground plate ”, and the top conducting plate 12 may be referred to as the “ patch ”. the patch 12 may comprise a thin metal foil such as copper or aluminum and may be smaller than , and centered over , the ground plate 10 . an antenna feed 16 may connect to one side of the patch 12 . the ground plate 10 , the patch 12 , and feed 16 may be made of the same conducting material . the dielectric material 14 may be , for example silicon , alumina , or a printed circuit board laminate such as fr - 4 . while the patch may be any shape , for simplicity of illustration it is shown as a square or rectangular . the size of the patch 12 may be chosen relative to the frequency in which the antenna is to operate where antenna bandwidth is proportional to the antenna volume , length ( l )× width ( w )× height ( h ), ( l × w × h ). antenna efficiency and quality or “ q - factor ” are two metrics for qualifying the antenna design . antenna efficiency may be designated by the symbol “ μl ”, where q equals power radiated / input power . the q - factor is generally understood to mean the ratio of the stored energy to the energy dissipated per radian of oscillation and may be used to describe antennas and other inductive or capacitive devices . for patch antennas the q - factor depends on several factors which are determined not only by the materials in the antenna ( metals and dielectrics ) but also geometry of the antenna and its surrounding environment . according to embodiments of the invention , the center frequency of an antenna may be tuned such as by using a variable mems capacitor or varactor . as shown in fig3 , an antenna may be tuned to the center frequencies of the tx and rx ranges for either the gsm 850 or gsm 900 bands . as shown , for gms 850 the center frequency for tx is 836 . 5 mhz and the center frequency for rx is 881 . 5 mhz . similarly , for the gsm 900 band , the center frequency for tx is 897 . 5 mhz and the center frequency for rx is 942 . 5 mhz . for example , by changing a capacitive load , a single antenna may be tuned to a variety of center frequencies even in different bands . further , the tuning may be adjusted dynamically to maintain tuning locked on the center frequency even as the capacitive loading due to the environment changes ( e . g ., as the antenna is moved and repositioned during use ). referring now to fig4 , there is shown an exemplary tunable antenna design in accordance with an embodiment of the invention . the antenna 20 may be a patch antenna as discussed above . the antenna 20 may include the bottom plate or “ ground ” plate 10 and a top conducting plate or “ patch ” 12 . the patch 12 may comprise a thin metal foil such as copper or aluminum and may be smaller than , and centered over , the ground plate 10 . an antenna feed 16 may connect to one side of the patch 12 . an antenna switch filter ( asf ) module 22 switches the antenna 20 between a low noise amplifier ( lna ) 24 for transmission ( tx ) and a power amplifier ( pa ) 26 for reception ( rx ). the asf module 22 , lna 24 , and pa 26 may comprise a front end module of a cell phone for example or other wireless device . as previously noted , the antenna 20 may be initially tuned to various center frequencies as well as adjusted in real time to maintain a desired center frequency by adjusting the capacitive load to compensate for environmental loading . fig4 shows two types of variable capacitive modules 30 and 32 , discussed in greater detail below , for altering the capacitive load to the antenna . the variable capacitive module , 30 or 32 , connects between the ground plate 10 and patch 12 of the antenna 20 . a controller 34 connects to the capacitive module , 30 or 32 , to select a proper capacitance to initially tune the antenna 20 to a desired center frequency such as , for example , those shown in fig3 . a feedback loop 36 comprising a sensor 38 that measures the radiated power , which may be a pick - up coil or directional coupler , and a power detector 40 , continuously measures the near field radiated power from the antenna 20 to provide the appropriate tuning corrections . the controller 34 may use a fourier transform to correlate the detected near field to a far field measurement to closely approximate the current tuning frequency of the antenna 20 . alternatively the power delivered to the antenna 20 ( which is not necessarily the same amount that is radiated ) may be used to approximate the radiated power to simplify the monitoring . for example , the power amplifier 26 may provide a signal that is proportional to delivered power . the controller 34 may then compare this to the desired tuning frequency for the antenna 20 to determine a drift from the desired center frequency . the controller 34 may then adjust the capacitive load via the variable capacitive module 30 or 32 . the appropriate capacitance of the variable capacitive module 30 or 32 to produce the desired tuning of the antenna 20 may be calculated by the controller 34 or accomplished by , for example , a look - up table 42 within the controller 34 . thus , as the antenna 20 is constantly detuned due to external factors such as repositioning of the host wireless device with respect to the surrounding environment , embodiments of the invention may continuously compensate in real time to keep the antenna 20 tuned to a desired center frequency . still referring to fig4 , various variable capacitor schemes may be used . in one embodiment , the variable capacitor module 30 comprises a bank of high - q capacitors , 50 , 52 , 54 , and 58 connected in parallel , each of which may have a different fixed capacitive value . each of the capacitors 50 , 52 , 54 , and 58 may be switched on or off by a mems switch 60 , 62 , 64 , 66 , or 68 , respectively . a mems switch may be preferred to a solid state - switch since solid state switches are generally non - linear devices which create undesirable frequency sidebands which can interfere with other wireless devices . as shown , the variable capacitor module 30 comprises a bank of five fixed capacitors 50 - 58 and associated mems switches 60 - 68 . the capacitors 50 - 58 may for example have values of 1 pf ( picofarad ) to 5 pf , respectively . by selecting one of more of the mems switches to close , a wide range of variable capacitance values may be realized to keep the antenna 20 tuned to a desired center frequency . this is of course by way of example only as more or less than five capacitors may be used and the capacitive value of each may comprise different values than those offered . in another embodiment , the variable capacitive module 32 may comprise a variable mems parallel plate capacitor 70 where one plate is made to move to change the capacitance value . variations of suitable variable mems capacitors may be found with reference to u . s . pat . nos . 6 , 355 , 534 to ma et al . and 6 , 593 , 672 to cheng et al . as shown the variable capacitor 70 may comprises a fixed charge plate 72 , a movable charge plate 74 disposed above the fixed charge plate 72 by spacers 75 . a stiffener 76 may be affixed to the movable charge plate 74 . in operation , when an actuation voltage is applied to the variable mems capacitor , such as by the controller 34 , the moveable charge plate 72 is caused to flex in a downward direction , illustrated by dashed lines as movable charge plate 74 ′. in this manner the mems capacitor may produce a continuous range of variable capacitance values the proper value of which may be selected to tune the antenna 20 to the desired center frequency . according to embodiments of the invention , the antenna 20 may be switched to multiple desired center frequencies and thereafter continuously monitored and tuned to maintain the desired frequency to facilitate higher antenna efficiency . power may be efficiently radiated under changing environmental conditions as opposed to being dissipated promoting longer battery life and improved range . the above description of illustrated embodiments of the invention , including what is described in the abstract , is not intended to be exhaustive or to limit the invention to the precise forms disclosed . while specific embodiments of , and examples for , the invention are described herein for illustrative purposes , various equivalent modifications are possible within the scope of the invention , as those skilled in the relevant art will recognize . these modifications can be made to the invention in light of the above detailed description . the terms used in the following claims should not be construed to limit the invention to the specific embodiments disclosed in the specification and the claims . rather , the scope of the invention is to be determined entirely by the following claims , which are to be construed in accordance with established doctrines of claim interpretation . | 7 |
illustrated in fig1 through 3 is a corner of a dmos device 10 in accordance with a first embodiment of this invention . as illustrated , the device 10 is equipped with a field limiting ring defined by an array of field limiting cells 14 . the field limiting ring completely circumscribes a number of &# 34 ; active &# 34 ; cells 12 located in an interior region of the surface of the device 10 . as used herein , the term &# 34 ; active cell &# 34 ; is intended to denote a transistor device , and to distinguish these cells from the field limiting cells 14 . in the context of a dmos device , the active cells 12 are metal - oxide - semiconductor field - effect transistors ( mosfet ). while the primary function of the field limiting cells 14 is to form an isolating barrier between the active cells 12 and the perimeter of the device 10 , it will become apparent that the field limiting cells 14 also contribute to the forward current conduction in the device 10 , and are therefore are also &# 34 ; active &# 34 ; in this respect . as seen in fig1 which represents a corner of the device 10 , gate contact cells 16 are provided along the edges of the device 10 and corner cells 18 are located in the corner of the device 10 . a single field limiting cell having a relatively large radius extends arcuately through the corner cell 18 shown in fig 1 . the active , field limiting , gate contact and corner cells 12 , 14 , 16 and 18 are illustrated with upper layers ( a dielectric layer 42 and metallization layers 44 and 46 of fig2 and 3 ) omitted to illustrate the cells and their construction . the surface seen in the plan view of fig1 is primarily a polysilicon layer 40 . numerous openings 28 are formed in the polysilicon layer 40 , exposing an underlying substrate ( an epitaxial layer 32 of fig2 and 3 ). the openings 28 also form bridges 20 between each pair of adjacent field limiting cells 14 . the bridges 20 serve to electrically interconnect the active cells 12 within the interior region of the device 10 with the gage contact cells 16 in the exterior region of the device 10 . as such , the bridges 20 serve to bring the gate signal from the gate contact cells 16 to the active cells 12 . the bridges 20 are a critical feature of this invention , in that their widths must be controlled in order to enable the creation of the field limiting ring of the invention , as will be explained below . centrally located in the openings 28 of the active cells 12 are source contacts 26 , and centrally located in the openings 28 of the field limiting cells 14 are source contacts 24 . gate contacts 22 are shown within each of the gate contact cells 16 through which electrical contact is made with the polysilicon layer 40 . as is conventional , the contacts 22 and 26 enable electrical contact with the gate and source terminals of the device 10 , respectively . unique to the present invention , the contacts 24 enable the field limiting cells 14 to contribute to the current conduction through the device 10 in the on - state , as will also be explained below . fig2 illustrates in cross - section , from left to right , a gate contact cell 16 , a field limiting cell 14 and an active cell 12 of the device 10 . fig2 further illustrates the device 10 as being formed on a substrate 30 on which the epitaxial layer 32 is grown by any suitable method . in the context of the n - channel dmos device 10 shown , the substrate 30 is heavily doped n - type , enabling the substrate 30 to serve as a drain terminal for the device 10 . the epitaxial layer 32 is lightly - doped n - type . a first dielectric layer 38 , such as silicon dioxide , is formed over the surface of the epitaxial layer 32 . a thin layer of gate oxide 38a is formed over the active cells 12 , while a thicker layer of field oxide 38b may be formed around the device periphery . this is followed by the formation of the polysilicon layer 40 , illustrated in fig2 as being composed of two tiers 40a and 40b , thereby forming a two tier polysilicon field plate . a first tier 40b is located above the gate oxide 38a . in the on - state , the first tier 40b provides for the formation of a channel at the surface of an underlying p - well region 34 , in the off - state , the first tier 40b provides a field - plate over the edge of the p - well diffusion , which serves to reduce the electric field in this area and thus increases the breakdown voltage of the device 10 . the second tier 40a of the polysilicon layer 40 provides further electric field reduction , thereby further increasing the breakdown voltage of the device 10 . in addition , the first tier 40b forms the bridges 20 between each adjacent pair of field limiting cells 14 and the gates for each of the active cells 12 . as can be seen from fig1 the width of the first tier 40b between each pair of adjacent openings 28 of the active cells 12 is larger than the widths of the bridges 20 . the openings 28 in the polysilicon layer 40 are shown in fig2 as extending through the dielectric layer 38 to the epitaxial layer 32 . located beneath each opening 28 and within the epitaxial layer 32 is an n + source region 36 within a p - well 34 . as is conventional , the wells 34 and source regions 36 are formed by ion implantation through the openings 28 , with the wells 34 being laterally diffused to extend beneath the adjacent portions of the polysilicon layer 40 . as such , the wells 34 of the field limiting cells 14 diffuse laterally beneath their bridges 20 . the openings 28 are subsequently filled by a second dielectric layer 42 , such as a low temperature oxide ( lto ), which overlays the polysilicon layer 40 . openings are then formed in the second dielectric layer 42 through which the contacts 22 , 24 and 26 are formed by a gate metallization 44 and a source metallization 46 . notably , the source metallization 46 includes projections 48 which extend into the epitaxial layer 32 , thus directly contacting the wells 34 and source regions 36 of the active and field limiting cells 12 and 14 . this feature reduces the gain of the npn transistor formed by each of the active cells 12 . the structure portrayed in fig2 illustrates the operation of the device 10 . in the on - state , a positive voltage is applied to the polysilicon layer 40 through the gate contact 22 formed by the metallization 44 , such that the first tier 40b of the polysilicon layer 40 acts as a gate over the p - well 34 of each active and field limiting cell 12 and 14 . as a result , the surface of each p - well 34 inverted , creating a channel in the p - well 34 through which electrons can laterally flow from the n + source region 36 ( the source terminal of the device 10 ) to the epitaxial layer 32 , and thereafter downward through the epitaxial layer 32 to a drain terminal formed by the substrate 30 . in view of the above , it can be appreciated that each of the field limiting cells 14 are electrically connected to the source metallization 46 , such that the field limiting cells 14 are active during the on - state and can therefore contribute to forward current conduction when the device 10 is in the on - state . as a result , the field limiting ring of the present invention makes more efficient use of the surface area of the device 10 . fig3 illustrates a row of field limiting cells 14 , and therefore a segment of the field limiting ring of this invention . as shown in fig3 the field limiting ring is formed by the merger of the p - wells 34 of the field limiting cells 14 . in this manner , the p - wells 34 form a continuous equipotential ring that prevents the high electric fields that can be present when such a ring is interrupted or forms a sharp corner . for the same reason , the field limiting ring is continuous through the corner cell 18 and maintains a large radius of curvature . in order to assure that the wells 34 of the field limiting cells 14 will merge , the widths of the bridges 20 between each adjacent pair of field limiting cells 14 must be carefully sized . in practice , limiting the width of each bridge 20 to be not more than about 1 . 6 times greater than the final juncture depth of each adjacent well 34 enables adjacent wells 34 to merge beneath their shared bridge 20 during diffusion of the wells 34 . openings 28 having a dimension aligned with the field limiting ring of about sixteen micrometers and bridges 20 having a width of about four micrometers have been found to achieve the desired results of this invention . in this scenario , a well junction depth of about 2 . 5 micrometers would be required to obtain a lateral diffusion of about two micrometers for each of the wells 34 of the field limiting cells 14 . in accordance with this invention , the above structure is achieved by a process which completely eliminates the requirement for separate masking , implanting and diffusion steps for forming the field limiting ring . specifically , each of the openings 28 are formed simultaneously through the dielectric and polysilicon layers 38 and 40 . the openings 28 corresponding to the field limiting cells 14 are aligned so as to form the bridges 20 and locate the field limiting ring . the openings 28 corresponding to the active cells 12 are disposed within the interior region , with the polysilicon layer 40 forming a gate terminal between each adjacent pair of these openings 28 . the wells 34 for both the active and field limiting cells 12 and 14 are then simultaneously formed by an implant technique through each of the openings 28 and a subsequent diffusion . in this manner , the implants are self - aligned by the openings 28 , as is conventional with dmos devices . during diffusion , each pair of wells 34 separated by a bridge 20 diffuse together to form the continuous , equipotential field limiting ring , while the wells 34 of the active cells 12 remain isolated from the wells 34 of their adjacent active cells 12 . the n + source regions 36 are then implanted through each of the openings 28 and diffused , followed by deposition and etching of the second dielectric layer 42 and the metallization 44 and 46 . a second embodiment of the present invention is illustrated in fig4 and 5 , which illustrate a dmos device 110 employing a second field limiting ring . the second field limiting ring is composed of a number of field limiting cells 50 . in contrast to the field limiting cells 14 of the first field limiting ring , the field limiting cells 50 are not electrically connected to the source metallization 46 . this configuration is shown in fig5 which illustrates in cross - section , from left to right , a field limiting cell 50 , a field limiting cell 14 and an active cell 12 of the device 110 of fig4 . as with the field limiting cells 14 , the field limiting cells 50 are delineated by bridges 120 formed by openings 128 in the first tier 40b of the polysilicon layer 40 . as before , p - wells 34 formed beneath the openings 128 are diffused together to form a continuous equipotential ring . accordingly , the bridges 120 must be narrow enough to allow the wells 34 of the field limiting cells 50 to merge . as is apparent from fig5 the field limiting cells 50 are formed simultaneously with the active and field limiting cells 12 and 14 . the device 110 can be provided with multiple field limiting rings , each of which can be formed in accordance with the above as a fully integrated step of the dmos process . in the off - state , each successive ring serves to further reduce the electric field and thereby increase the breakdown voltage of the device 110 . however , because the field limiting cells 50 are not electrically connected to the source metallization 46 , these cells 50 are not capable of contributing to forward current conduction when the device 110 is in the on - state . from the above , it can be seen that a significant advantage of the present invention is that a semiconductor device can be provided with a field limiting ring whose process is fully integrated with the formation of the active cells of the device . the field limiting ring is formed by a number of field limiting cells whose wells are laterally diffused to form a continuous equipotential ring between interior and exterior regions of the device . advantageously , the field limiting cells of this invention are configured to conduct current during the on - state , and are therefore able to improve the on - state performance and area efficiency of the device . another advantage of this invention is that the process does not require masking , implanting and diffusion steps for the sole purpose of forming one or more field limiting rings . as a result , the process of this invention can be performed at a lower cost than prior art processes which require separate masking , implanting and / or diffusing steps to form a field limiting ring . while our invention has been described in terms of a preferred embodiment , it is apparent that other forms could be adopted by one skilled in the art for example , by modifying the layout of the gate contact , field limiting and active cells , using alternative materials to form the device , and forming other types of active devices . accordingly , the scope of our invention is to be limited only by the following claims . | 8 |
[ 0016 ] fig1 depicts a high level block diagram of a multiple user information distribution and delivery system 100 . the overall system comprises a data storage , retrieval and distribution system 102 , and a data delivery network 104 and a plurality of client terminals 106 . generally , the client terminals 106 contain network interface circuits that communicates with the system 102 through the communications network 104 , e . g ., a hybrid fiber - coax ( hfc ) network , telephone lines , and the like . the data link from the data distribution system to the network interface circuitry is typically a high speed , time - division - multiplexed channel or packet based digital network . the interface circuitry demultiplexes the data from these channels and the client terminals are sent serial data streams that they had previously requested from the data distribution system 102 . additionally , the client terminals 106 control , via command links , the data flow and the type of data that they each receive . the data distribution system 102 processes commands received from a plurality of users , then interprets and implements the commands . the data delivery network 104 could be created and operated by the local telephone system , the is local cable company , or some other service provider organization . the inventive data distribution system 100 sends data to the data delivery network 104 in a compatible data format to facilitate distribution of data to the proper client terminals . one illustrative example of a use for the inventive data distribution system 100 is within a video - on - demand ( vod ) system . although , in the broadest sense , the inventive data distribution system can distribute any type of digital data , e . g ., audio information , video information , textual information , graphics , and the like , to simplify the description of the invention , the following discussion will focus upon using the invention within a vod system having a large number of users being supplied audio - visual data . in a vod system , the users generally have “ set top ” interface units ( client or user terminals ) that enable each user to select a video program such as a movie or other multimedia program and control playback of that program using video tape player - like control functions . specifically , a user can play , pause , stop , fast - forward , fast - fast - forward , reverse , and fast - reverse the program at any time . the data distribution system rapidly processes and implements each user command . importantly , every user of the system can simultaneously utilize the same control features on any number of programs . thus , each user views their set top unit as a video tape player capable of accessing a large database of video programming . the data storage , retrieval and distribution system 102 contains certain apparatus and concomitant methods for interacting with the user and implementing the user commands with unnoticeable delay , i . e ., relatively low latency . typically , once the command has been implemented , the requested data is transmitted onto one of a plurality of user networks by the distribution center in a multiplexed format . network interface units , within the data delivery system , demultiplex the data streams and extract the data for the appropriate user . the data may be sent in digital format or , in some cases , converted to an analog signal for use by the user . an example of a data distribution system can be found in u . s . pat . no . 5 , 671 , 377 , issued sep . 23 , 1997 and commonly assigned u . s . pat . no . 6 , 253 , 375 , issued jun . 26 , 2001 , both of which are herein incorporated by reference . [ 0021 ] fig2 depicts a high level block diagram of the multiple user data storage , retrieval and distribution system 102 shown in fig1 . the system contains a mass storage device 202 , a host computer 200 , a digital information server 202 , a network interface module 204 and an additional data source 224 , such as a mass storage device . in general , a plurality of users ( not shown ) are sent , via the network 104 , multiplexed serial information . the users control the operation of the system 102 via a command link . the command link is assumed to be embedded within the full - duplex user connection to the network 104 . the command link could be a separate communication channel such as ethernet , telephone line , and the like . the specific implementation of the command link is typically defined by the data delivery system . each command from the command link is interpreted by the network interface module 204 . the network interface module 204 formats the commands ( data requests ) such that the server can retrieve the requested data . using the command link , the user has the capability of selecting a video program , e . g ., a selected multimedia program , and thereafter starting , stopping , pausing , reversing , and fast - forwarding the video program . in other words , the vod system provides to each user functions that are similar to those available on a conventional video cassette player . the server 202 comprises a plurality of processor subsystems 206 where each comprise a processor ( p ) 208 , solid state memory 210 , a disk array 212 , and processor support circuits 214 . the processor subsystems 206 are coupled to one another by various input / output buses 222 a and 222 b . the subsystems 206 are all coupled through a bus 222 a to the host computer 200 . the support circuits 214 may include well known circuitry such as bus interface circuits , cache , clocks , data registers and the like . the disk array 212 may contain one or more disk drives for storing data 216 , e . g ., movies or other multimedia assets . in accordance with the present invention the solid state memory 210 stores search tools 218 ( e . g ., a search engine and / or programming guides ) and frequently used data 230 ( e . g ., video chips ). since the disk drive arrays 212 have limited storage , an additional data source 224 is provided . the source 224 may be a magneto - optical drive array , a data delivery network , a live feed from one or more television networks , and the like . in operation , when a user requests information , e . g ., a selected multimedia stream , the server 202 retrieves the information from the disk array 212 . the user performs information selection through a graphical interface known as a search engine or program guide . the search engine is known as a navigator that is implemented as a series of “ applet ” programs and concomitant graphics that are sent from the server 202 to the user terminals . these applets produce a menu structure that enables the user to interact with the system . a detailed disclosure of such a navigator is disclosed in commonly assigned u . s . pat . no . 6 , 200 , 335 , issued mar . 27 , 2001 , and incorporated herein by reference . the server 202 contains two forms of local memory ( a disk drive array 212 and dynamic random access memory ( dram ) 210 ) that respectively store the selectable information and the applets . to facilitate rapid access and distribution of search engine applets , these applets are stored in dram 210 . these applets are recalled on a regular basis and transmitted to the user terminals to facilitate selection of the information . an example of a parallel processor based server is disclosed in u . s . pat . no . 5 , 671 , 377 , issued sep . 23 , 1997 which is incorporated herein by reference . [ 0027 ] fig3 depicts a flow diagram showing a process 300 used to input data and search tools into the server 202 . the process 300 starts at step 302 and proceeds to step 304 . at step 304 , the server inspects the incoming bitstream to identify search tool components and general data , e . g ., movies . the search tool information contains various files , graphics , video and audio that are labeled in the bitstream as belonging to the search tool . the identified data is stored at step 306 in a disk drive or drives . if the data is striped across one or more disk drives , the server facilitates the striping process . the search tool components are stored , at step 308 , in dram . if data striping is used , as described in u . s . pat . no . 5 , 671 , 377 , the search tool components are striped across the processor subsystems and their respective dram in the same manner as the data is striped onto the disks . the data input routine 300 stops at step 310 . [ 0028 ] fig4 depicts a flow diagram showing a process 400 used to retrieve data / search tools from the server . the process begins at step 402 and proceeds to step 404 . at step 404 , the process queries whether the requested information is stored in dram . if the query is negatively answered , the process proceeds to step 406 where the data is retrieved from disk . the process 400 then ends at step 410 . if the query at step 404 is affirmatively answered , the information is retrieved , at step 408 , from dram . the process ends at step 410 . the information stored in dram is rapidly accessed with very little latency . as such , the information includes material that users frequently request such as search tools and frequently viewed video clips . by storing this frequently used information in dram rather than bulk storage ( e . g ., disk drive storage ), the information can be rapidly retrieved for transmission to users . [ 0030 ] fig5 depicts an alternative embodiment of the invention wherein the frequently used data is stored in a select number of solid state dram rather than distributed across all of the drams . specifically , server 500 comprises a plurality of processor subsystems 502 1 through 502 n that are organized into parity groups 504 1 through 504 m . each parity group contains a plurality of processor subsystems 502 , e . g ., five . each processor subsystem 502 comprises a processor 510 , a disk - based storage device 506 , and solid state dram 508 . using five subsystems in a parity group as an illustrative example , the group 504 1 comprises four processor subsystems 502 1 through 502 4 that handle data as described with respect to fig2 and the processor subsystem 502 5 handles parity processing . the parity bits of the data stored in the disk storage of subsystems 502 1 through 502 4 are stored on the disk storage 506 of subsystem 502 5 . since the parity processor subsystems are not used as often as the other data subsystems , the frequently used data 220 and / or search tools 218 are stored in dram 508 of the parity processor subsystems 502 5 , 502 10 , etc . as with the previous embodiment , the data is striped across the drams , in this case , striped across the parity drams only . the i / o buses 220 a and 220 b facilitate data storage and command implementation as described above . although various embodiments which incorporate the teachings of the present invention have been shown and described in detail herein , those skilled in the art can readily devise many other varied embodiments that still incorporate these teachings . | 8 |
this disclosure describes a number of embodiments of one or more optical transmission systems and elements . within this disclosure , the term “ optical ” indicates electromagnetic range at or near optical frequencies ; this includes visible light and so - called “ near - visible ” light such as near infrared , infrared , far infrared and the near and far ultra - violet spectra . the preferred operating range is around 1 . 5 micron . the transmitter and receiver block diagrams are shown in fig2 ( a ) and ( b ) for the preferred embodiment of the communication link . at the transmitter 1 the data 2 and 3 enter the system for each orthogonal polarization , named v ( vertical ) and h ( horizontal ), but can be any other orthogonal polarization pair such as rhc / lhc . the data is forward error correction ( fec ) encoded , any suitable fec code or algorithm known in the art may be used , for example reed - solomon code . as it is shown in fig2 , fec encoder 4 and 5 encode electrical waveform before it is converted to an optical signal . alternatively fecs may operate on directly on optical signals in v and h polarizations . fec is used to correct the transmission impairments . fec operation is based on transmission of parity information , and it works fine for recovering from individual errors occurred during the transmission . however , it does not recover information when burst - errors occur . the interleavers 6 and 7 serve to stretch the burst - errors by interleaving fec codes resulted in their independent impairments . next a group of data bit is mapped onto a symbol bit in symbol mappers 8 and 9 . for example , four data bits are mapped onto a complex constellation of 2 4 = 16 point , each point is represented by two digital signed value : real and imaginary . the digital complex signals 10 and 11 named sig_in_v and sig_in_h respectively enter into a digital polarization controller unit 12 . in one embodiment , it performs a rotation transform function outputting two signals 13 and 14 : sig_out_v and sig_out_h . the transform function is implemented by digital multiplier and adder normally implemented in fpga or in asic , the digital polarization rotation function is represented by the matrix multiplication : in another embodiment , the controller 12 performs bit cross scrambling . the data from v and h part are cross scrambled randomly , the function select randomly either d_out_v = d_in_v ; and d_out_h = d_in_h ; ( straight connect ) or d_out_v = d_in_h ; and d_out_h = d_in_v ( cross connect ). the function is implemented by a digital mux function in fpga or in asic . the in and out signals not necessarily need to be complex signal or even bipolar signal , they can be any type of modulation signal including amplitude shift keying ( ask ) or on off keying ( ook ). the output signals 13 and 14 are digital to analog converted in dacs 15 and 16 . the electric signals 17 and 18 modulate in the optical modulators 21 and 22 optical laser beams 19 and 20 from the laser light source 21 . optical signals are shown by bold arrows . the two optical modulated signals 23 and 24 are combined in an polarization combiner 25 then amplified 26 and thru an optional dwdm sent to the fiber plant . the receiver part 30 is presented in fig2 ( b ). modulated optical beam 31 after demultiplexing and amplification in 32 is split by a polarization recovery unit 33 into v and h polarized beams 34 and 35 . each polarized signal is optically demodulated in detectors 36 and 37 . these detectors can be of any kind , however in the preferred embodiment they are coherent detectors . incoming light 34 and 35 is mixed with local oscillator beams 38 and 39 emitted by a local oscillator light source 40 . the local oscillator beams have the same polarization state as the incoming signals . then electrical demodulated signals 41 and 42 are converted to digital signals 43 and 44 by corresponding adcs 45 and 46 . digital polarization controller 47 performs the signal transformation . in one embodiment , it rotates the signal polarization in the opposite direction compared to the transmitter rotation with exactly same random modulation as in the transmitter part and in time sync with the transmitter , taking into account total system and fiber plant propagation time , the implementation is identical to the transmitter part . the random modulation rate should have a short coherency time in at least order of magnitude shorter than the interleaving depth time in order to evenly randomize the mixing of the two polarizations in each fec block . some random function have a tendency to have a long repetition period where the same random sequence is repeated again , this period should be an order of magnitude longer than the interleaver &# 39 ; s depth and fec block length . an alternative to random polarization is to use a periodical modulation rotation , for example increment / decrement polarization rotation phase by a constant value each time interval , in this case the period of rotation should several order of magnitude shorter than the interleaver &# 39 ; s depth and preferably the fec block should be a whole number of complete rotation period . in another embodiment , the digital signals 43 and 44 are cross scrambled in the opposite direction with exactly same random sequence as in the transmitter part and in time sync with the transmitter so same bit return to their original place , the implementation is identical to the transmitter part . the random sequence rate should have a short coherency time in at least order of magnitude shorter than the interleaving depth time in order to evenly randomize the mixing of the two polarizations in each fec block . some random function have a tendency to have a long repetition period where the same random sequence is repeated again , this period should be an order of magnitude longer than the interleaver depth and fec block length . an alternative to random scrambling sequence is to use a periodical scrambling sequence , for example each even symbol connect straight and each odd symbol connect across , in this case the period of sequence should be several order of magnitude shorter than the interleaver &# 39 ; s depth and preferably the fec block should be a whole number of complete sequence period . the digital polarization rotator output sig_out_v 49 and sig_out_h 48 are digitized / demapped in the symbol demappers 50 and 51 , deinterleaved in de - interleavers 52 and 53 and fec decoded in fec decoders 54 and 55 to output information data bits 56 and 57 in each polarization . assuming two symbols to be encoded a = b 1 + jb 2 and c = b 3 + jb 4 ; where b 1 , b 2 , b 3 and b 4 are polar bit taking value +/− 1 . straight forward encoding in the transmitter for two polarizations is : v = a ; h = b . other alternatives are : all these encoding may be interleaved ( round robin ) yielding the same or better effect as polarization rotation while keeping initial phase of phy untouched ( code frame synchronization is done later ( phy acquisition independent ) and is much simpler . the polarization change have a correlation time defined as the time the absolute value of the autocorrelation function of the polarization vector fall to below 0 . 1 , let define it as t if the interleaving depth time of an fec block is longer than correlation time we can assume the bit in that fec block are scrambled enough , in average are suffering from all polarization or insensitive to some specific polarization pdl . for a signal at rate r bit / sec , fec block length of n bit and interleaving depth ( length ) of m , number of polarization that one fec function is applied is either k = 1 in method 1 or k = 2 for method 2 , then t should be 1 / t & gt ;= r /( k * n * m ). fig3 ( a ) and ( b ) shows the probability that the horizontal and vertical snr , respectively , to be above a certain value . simulation for pdl over a 2000 km link ( 25 segments ) shows 0 . 22 db average signal to noise loss however 1 % of all snr can loss more than 1 . 0 db , simulation done for pdl of 0 . 3 db std per segment and 20 db ( 100 ) original snr w / o pdl . the reason for that small loss is most of pdl do not cause loss of ortogonality between h and v polarization on average , noise has very small covariance between polarization : 3e − 3 . this description of a preferred embodiment of the invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and obviously many modifications and variations are possible in the light of the above teaching . the described embodiment was chosen and described in order to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto . | 7 |
in fig1 the numeral 10 generally designates a rolling rotor motor which has a plurality of windings with six , 11 - 1 to 6 , being illustrated . power from power supply 12 is supplied to windings 11 - 1 to 6 by power switch module 14 under the control of switching logic module 16 . referring to fig2 it will be noted that the power supply 12 is connected to windings 11 - 1 to 6 through switches 14 - 1 to 6 which are controlled by switching logic module 16 . switch 14 - 1 is illustrated as solenoid actuated but any suitable power switching may be employed . switches 14 - 1 to 6 , as illustrated in fig3 can be actuated in an &# 34 ; on at off &# 34 ; mode wherein the shutting off of power to one winding coincides with the supplying of power to the next winding . alternatively , as illustrated in fig4 switches 14 - 1 to 6 can be actuated in an &# 34 ; on before off &# 34 ; mode wherein power is supplied to a winding for a short period of time after power is supplied to the next winding . in fig5 the rolling rotor motor 10 of fig1 and 2 is seen to include a fixed stator 20 with windings 11 and an external annular rotor 21 surrounding stator 20 . motor 10 is located in shell 30 of hermetic scroll compressor 40 . shell 30 is made up of upper section 30 - 1 , middle section 30 - 2 and lower section 30 - 3 which are secured together in any suitable fashion such as by welding . secured to the ends of rotor 21 are flanged annular extensions 22 and 23 , respectively , which are movable with rotor 21 as a unit . annular flanges 22 - 1 and 23 - 1 coact with shoulders on middle section 30 - 2 to axially position rotor 21 within shell 30 . stator 20 has a pair of axial extensions having end plates 24 and 25 , respectively , defining bearing plates . extensions 22 and 23 are movable with rotor 21 , as a unit , and with end plates 24 and 25 , define protective housings or covers for windings 11 . end plates 24 and 25 are fixedly supported to upper shell section 30 - 1 and to lower shell section 30 - 2 respectively as shown in fig6 . fixed scrolls 42 and 43 having wraps 42 - 1 and 43 - 1 respectively , are secured to upper section 30 - 1 and lower section 30 - 3 , respectively . wrap 44 - 1 of orbiting scroll 44 operatively engages wrap 42 - 1 of fixed scroll 42 and is supported by end plate 24 . similarly , wrap 45 - 1 of orbiting scroll 45 engages fixed scroll 43 and is supported by end plate 25 . a first series of circumferentially spaced pivoted links 48 are fixedly supported and pivoted with respect to shell 30 but each simultaneously engages both orbiting scroll 44 and extension 22 . similarly , a second series of circumferentially spaced pivoted links 49 are fixedly supported and pivoted with respect to shell 30 but each simultaneously engages both orbiting scroll 45 and extension 23 . the mass of rotor 21 and extensions 22 and 23 , will be equal to the sum of the masses of the orbiting scrolls 44 and 45 . if just one orbiting scroll 44 was present , then rotor 21 , and extension 22 would have the same mass as orbiting scroll 44 . in operation , as the magnetic field moves about the stator 20 through the selective activation of some of the windings , as described above , annular rotor 21 tends to follow the magnetic field and coacts with the stator 20 . the annular rotor 21 thus tends to rotate about the stator 20 together with extensions 22 and 23 . as extensions 22 and 23 move with the rotor 21 they act on links 48 and 49 , respectively , causing orbiting scrolls 44 and 45 to be shifted so that they are 180 ° out of phase with the rotor 21 and the center of gravity of the orbiting scrolls 44 and 45 represented by c - c is on the opposite side of the centerline a - a of stator 20 than that of the integral member defined by rotor 21 , and extensions 22 and 23 represented by b - b . thus , the unit can be dynamically balanced with the correct selection or design of the parts using standard moment of inertia equations to balance the rotor 21 and its associated parts with the orbiting scrolls 44 and 45 . if the axis b - b of rotor 21 coincided with a -- a , links 48 and 49 would be parallel to a - a and b -- b and orbiting scrolls 44 and 45 would not be out of phase with respect to rotor 21 but the scrolls 42 - 45 would not function to compress gas . additionally , some type of anti - rotation device is necessary to maintain the proper orientation between the fixed and the orbiting scrolls . also , it should be noted that the unrestrained movement of rotor 21 is to roll around stator 20 and this will result in a relative rotary movement between extensions 22 and 23 and links 48 and 49 , respectively . as best shown in fig5 and 7 , orbiting scrolls 44 and 45 each have one or more holes 44 - 2 and 45 - 2 , respectively , formed therein and of a diameter equal to the diameter of the orbit of orbiting scrolls 44 and 45 plus that of pins 34 and 35 , respectively . pins 34 and 35 are fixedly located in end plates 24 and 25 , respectively , and extend into and coact with recesses 44 - 2 and 45 - 2 in orbiting scrolls 44 and 45 . since the gas loads change with the compression process , there will be unbalance at some time since the centers of gravity do not accommodate these changes . however , the initial selection of the centers of gravity can chose some stage of the compression stroke at which balance is established . if a liquid slug , for example , was in the trapped volume of the compressor , its incompressibility would create an excess pressure . the orbiting scrolls 44 and 45 can move away from the fixed scrolls 42 and 43 thereby unsealing the trapped volume and permitting the orbiting scrolls 44 and 45 to override the liquid slug , grit , etc . rotor 21 will be moved away from the stator 20 due to the coaction of linkages 48 and 49 when the orbiting scrolls 44 and 45 move away from the fixed scrolls 42 and 43 . for compressor operation , refrigerant at suction pressure is supplied from the refrigeration system ( not illustrated ) to the interior of shell 30 and refrigerant at discharge pressure is supplied to the refrigeration system ( not illustrated ) via lines 37 and 38 , respectively in the conventional manner for a scroll compressor . specifically as the magnetic field moves about the stator 20 annular rotor 21 together with extensions 22 and 23 roll around stator 21 . as extensions 22 and 23 move they coact with links 48 and 49 which tend to maintain orbiting scrolls 44 and 45 180 ° out of phase with the rotor 21 and orbiting scrolls 44 and 45 coact with fixed scrolls 42 and 43 , respectively , in the normal coaction of a scroll compressor . orbiting scrolls 42 and 43 thus function as counterweights with respect to the rotor structure to thereby provide a dynamic balance . pins 34 and 35 coact with recesses 44 - 2 and 45 - 2 to restrict relative movement between orbiting scrolls 44 and 45 and plates 24 and 25 , respectively , to an orbiting motion which , in turn , restricts relative motion between orbiting scrolls 44 and 45 with fixed scrolls 42 and 43 , respectively , to orbiting motion . although a preferred embodiment of the present invention has been illustrated and described , other changes will occur to those skilled in the art . for example , rotor 21 can be held to an orbiting motion and both extensions 22 and 23 and links 48 and 49 can be used when only a single orbiting scroll is used provided the mass of the orbiting scroll is equal to the combined mass of the rotor 21 and extensions 22 and 23 . it is therefore intended that the scope of the present invention is to be limited only by the scope of the appended claims . | 5 |
a preferred embodiment of the invention is shown in fig1 & amp ; 3 . the disc replacement prosthesis of the present invention is an implantable intervertebral disc replacement prosthesis 50 containing a flexure 100 which has an axis 103 . the flexure 100 is formed from a solid piece of material in which a blind hole is bored defining an axial cavity 105 which extends along the axis 103 . in this embodiment , a helical slit 101 is cut in the perimeter surface , with the axis of the helix approximately coincident with axis 103 of disc member 50 , so that the perimeter surface resembles a helical coil or spring . the disc replacement of the present embodiment further comprises a lower disc support 102 housed in the axial cavity 105 , and an upper disc support 104 housed in the axial cavity 105 , with the lower and upper disc supports communicating with one another to provide support to the disc . the lower and upper disc supports also act as bearing elements , and may communicate in a ball - and - socket type arrangement . these elements ( i . e . the lower and upper disc supports ) communicate to act as a transferor of axial compression loads . lower disc support 102 may or may not be rigidly attached to flexure 100 . upper disc support 104 may be rigidly attached to the flexure 100 by press - fit , retaining ring , pins , welds or some other means , and also forms the upper surface of the disc member all embodiments of the present invention are to be made from a surgically implantable biocompatible material . the preferred material for the flexure 100 should possess high fatigue strength such as titanium , titanium alloy , or stainless steel . the material for the upper and lower disc supports 104 and 102 should possess excellent wear resistance and compressive strength . ceramics , titanium , titanium alloy , stainless steel , cobalt chrome , composites , or polymers should preferably be used for these elements . alternatively , a biocompatible material with a wear reducing coating could be used . for example , a titanium nitride coating may be used on the supports or the flexure . attachment of the disc member 50 to the adjacent vertebrae should involve both immediate and long - term fixation . immediate fixation can be achieved with a mechanical bone attachment means . for example , the upper and / or lower surfaces may include mechanical elements such as teeth 108 . also , the entire superior and inferior surfaces , including teeth 108 can be coated with a bone ingrowth inducing osteoconductive substance such as sintered beads or sintered wires or an osteoinductive coating such as hydroxyapatite for long - term fixation . osteoinductive and osteoconductive coatings have been used extensively in joint replacement for many years and have been proven to be effective . the flexure 100 allows the disc member 50 to react to bending loads by flexing . the geometry of helical slit 101 can determine the stiffness of flexure 100 and therefore the stiffness of disc member 50 . for example , to produce a more flexible implant the thickness of helical slit 101 can be increased so that less material of flexure 100 remains . also the number of coils will determine the stiffness of the flexure . the spring action of flexure 100 will allow rotation and will have an inherent torsional stiffness that is also determined by the geometry of helical slit 101 . the range of motion of disc member 50 is determined by the point at which flexure 100 bottoms out ( the point at which a bending load causes adjacent coils to come into contact ). the range of motion is determined by the space between the coils , which is equivalent to the thickness of helical slit 101 multiplied by the number of coils . therefore helical slit 101 can be tailored to match the mechanical and kinematical characteristics of a normal disc at any level in the spine . the instantaneous axis of rotation ( iar ) is a parameter that characterizes how one body rotates with respect to another body ( or a fixed point ) in planar motion . normal spinal motion can be characterized as planar ( 2 d ) for pure flexion - extension . fig4 demonstrates the general method of determining the iar of the motion of a body from two positions . translation vectors a 1 , a 2 and b 1 , b 2 are drawn from points before the motion to corresponding points after the motion . the intersection of the perpendicular bisectors of these translation vectors is the iar of the motion . the preferred embodiment of the present invention incorporates a mobile iar . the ball - and - socket arrangement of the preferred embodiment of fig1 , & amp ; 3 may comprise a lower disc support 102 having a convex surface , and an upper disc support 104 having a surface suitable for receiving and communicating with the convex surface of lower disc support 102 . the convex surface of lower disc support 102 may vary . for instance , it may range from a partial hemisphere to a full hemisphere or it may be an elongated element with a rounded or partially rounded end . motion at the interface between lower disc support 102 ( as seen in fig2 ) and upper disc support 104 has an iar at the center of the radius of the bearing surface of lower disc support 102 . however , this embodiment also allows translation between lower disc support 102 and flexure 100 . the combination of rotation and translation allows a range of possible jar &# 39 ; s . fig5 is a cross - sectional view of a motion segment including a superior vertebra 200 , ivd 204 and an inferior vertebra 202 . the iar for adjacent vertebrae in the normal lumbar spine has been shown to be located on or near the superior endplate of the inferior vertebra 202 of a motion segment , as shown . fig6 shows the same cross - section of the spine as fig5 , but with placement of disc member 50 . in order to prevent unnatural loading of the facet joints 206 , the correct iar must be maintained . the mobile iar described above may allow correct iar of motion between superior vertebra 200 and inferior vertebra 202 after implantation of disc element 50 . fig7 and 8 show an alternative embodiment where approximately horizontal perimeter slits 152 have been cut into flexure 150 instead of a helical - type slit . preferably , the slit is substantially at a right angle to the axis of the disc member . the orientation of the slits is such that at least one slit is opened and at least one slit is closed under the action of bending loads imposed at any plane through the axis of the disc member . in the embodiment depicted in the drawings , each slit terminates in a hole or a perimeter opening 154 , with a diameter that is larger than the thickness of the slit to reduce stress concentration . preferably , the perimeter opening is circular - shaped . the depth , thickness and number of the perimeter slits 152 as well as the size of perimeter opening 154 determine the stiffness of the disc member . the thickness and number of perimeter slits 152 determine the range of motion of the prosthesis . disc 50 can be made into a variety of shapes , as long as the spirit of the invention is not adversely affected . that is , the disc prosthesis of the present invention may have a surface ( such as , for example , the upper surface or the lower surface ) that is flat , convex in shape or is otherwise shaped to fit the cavity of a vertebral endplate . furthermore , from a top ( superior - to - inferior ) view , disc member 50 may be of a variety of shapes : for example circular , kidney - shaped , or oval - shaped . fig9 shows an alternative embodiment of a disc 51 of the invention in which flexure 160 is oval shaped . teeth 168 and upper disc support 164 are similar to those described above . multiple alternative embodiments are also shown . a cross sectional view of an alternative embodiment of a disc 52 of the invention is shown in fig1 that has a fixed iar at the center of the radius of hemispherical lower disc support 205 . the flexure 100 and the upper disc support 104 are also shown . fig1 shows a cross sectional view of an alternative embodiment of a disc 54 of the invention in which the iar has been shifted down and left , demonstrating that the iar can be tailored to match the iar of a healthy disc simply by altering the radius of curvature and the center of the radius of curvature of partial hemispherical lower disc support 305 . upper disc support 304 has been made to communicate with partial hemispherical disc support 305 . the flexure 100 is also shown . fig1 shows angulated disc member 56 with angulated flexure 400 and augmented lower disc support 405 and augmented upper disc support 404 . the angle θ incorporated into angulated disc member 56 is meant to maintain the natural lordosis of the lumbar or cervical spine or the natural kyphosis of the thoracic spine . this angle could be matched to any lordosis or kyphosis of a disc level being replaced . fig1 shows a disc 58 of the present invention with the addition of a lower seat member 510 communicated with the axial cavity of flexure 100 . in the case that a metal material is used for flexure 100 and a harder ceramic material is used for shortened lower disc support 505 , lower seat member 510 could also be made of ceramic so that all elements experiencing sliding contact would gain the advantage of low wear ceramic on ceramic contact . the upper disc support 104 is also shown . another alternative embodiment of the disc 60 of the present invention is pictured in fig1 . a concave recess is created in flexure 600 which is meant to communicate with a flanged lower disc support 605 . in this way , the upper disc support is incorporated into flexure 600 . flexure 600 may be rigidly attached to flange 610 of flanged lower disc support 605 by weld , pins , retaining ring or some other means . another alternative embodiment of the disc 60 is pictured in fig1 . a spring element 700 is a conventional helical spring made by forming a wire into a helix . flanged upper disc support 704 and flanged lower disc support 705 are made to communicate with each other and to communicate with spring 700 . spring 700 may be rigidly attached to either or both flanged upper disc support 704 or flanged lower disc support 705 . another alternative embodiment if the disc 64 of the present invention is pictured in fig1 . flexure 800 incorporates a protuberance 805 which serves as a lower disc support . upper disc support 104 is made to communicate with protuberance 805 . therefore , the lower disc support is incorporated into flexure 800 . the disc prosthesis of the present invention may be inserted into the spine using standard medical procedures . for example , see benzel , spine surgery : techniques , complication avoidance , and management , 1999 , the contents of which are incorporated herein by reference . particularly see benzel , at section 11 , pages 142 - 192 . additionally , when inserting the disc prostheses of the present invention , the prosthesis may be inserted so that the lower disc support is superior to ( from a top view ) to the upper disc support . in other words , the disc prosthesis of the present invention mat be used such that , when looking at the spine , the upper disc support as described herein is on the bottom and the lower disc support is on top . all cited patents and publications referred to in this application are herein expressly incorporated herein by reference . this invention thus being described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the present invention , and all such modifications as would be obvious to one of ordinary skill in the art are intended to be included within the scope of the following claims . | 0 |
a preferred embodiment of the present invention incorporates moveable arms , a retractable electrode , tubes surrounding the electrode , and an inert ionizable gas such as argon to provide a single device capable of performing both traditional lletz surgery and argon plasma ( or beam ) coagulation . a preferred embodiment will be described in connection with fig1 - 7 . the device has a cylindrical or tubular body 110 having a collet , handle , plug or other means 120 . for lletz surgery , it may be preferable for the body 110 to be rigid or semi - rigid , but for other types of surgery , such as endoscopic or laparoscopic surgery , the body 110 may be flexible . the body 110 further has means for connecting the device to an electrosurgical generator and a source of an inert , ionizable gas such as argon . the means for connecting to the electrosurgical generator and / or argon gas may be through or part of the collet , handle or plug 120 or may be otherwise . the collet 120 is displaced from the distal end of the body 110 by a distance sufficient for the collet 120 to remain outside the patient &# 39 ; s body and be accessible to the surgeon during surgery . at the distal end of the body 110 , there are two adjustable or moveable arms 150 that are connected to the body 110 via a hinge 530 , hinges or other means that would permit the arms to rotate toward and away from each other in a plane . each arm 150 is connected to a collet 130 by a rod , wire or other means 170 . when the collet 130 is moved by the surgeon along the length of the body 110 by means of rotating the collet or otherwise , the rods 170 pull the arms 150 apart or push them together depending on which direction the collet 130 is moved . in an embodiment in which wires 170 are used rather than rods , the arms 150 may be biased toward one position , such as together , and the surgeon may used the collet 130 to pull the arms 150 apart via the wires 170 . within the body 110 , there is a channel 220 , within which there is a wire 210 for conducting electricity . the wire is formed of a conductive material , but preferably is formed from tungsten or tungsten and molybdenum . the channel may be formed integral with the body or may be a flexible plastic tube . the channel extends along the length of the body 110 at least from the collet or plug 120 to the distal end of the body , where the channel or tube splits into two channels , one along each arm . the channel along the arms may be formed integral with the arms or may be attached to the arms . for example , the channel 220 and the split channels along the arms may all be formed of flexible tubing that is attached or connected to the arms 150 . the wire 210 within the channel 220 likewise extends along the length of the body form the collet or plug 120 to the distal end of the body 110 . at or near the distal end of the body 110 , the wire 210 has a loop 160 that extends through the split channels at the arms 150 . the wire 210 is movable within the channel 220 via collet , handle , or plug 120 . when the arms are in a position extending away from one another such as is shown in fig1 - 2 , the loop 160 at the distal end of the wire 210 has an appearance and use similar to a conventional lletz device . when the arms are closed , however , the loop 160 may be withdrawn as shown in fig3 - 4 such that argon gas may flow down the channel 220 and may be sued to perform argon plasma coagulation by electrifying the wire 210 while argon gas is flowing through the tube . the preferred embodiment may further have enclosure means on the arms 150 or the split channels for enclosing the loop 160 during argon plasma coagulation as shown in fig5 and 6 ( a )-( d ). in a preferred embodiment , the enclosure means on each arm or split channel has a tubular portion 510 and a half - cylinder portion 520 . when the arms 150 are moved together and the wire is withdrawn , the semi - cylinder portions 520 for a channel such that the loop 160 is approximately 1 mm inside the end of the channel . the enclosure means may be formed as part of the arms 150 , part of the split channel , or as attachments to either the arms or the split channels . the enclosure means preferable is formed from a heat resistant material such as a ceramic material . in other embodiments , the collet , handle or plug 120 may be combined with the collet 130 such that the wire 210 moved out or in along with the movement of the arms 150 out or in . further , the device may include safety means to prevent or prohibit the flow of argon gas while the arms are in the extended lletz position . in still other embodiments , the invention may have one moveable arm that extends away from or together with either a fixed arm or the body 110 . other embodiments adapt the present invention for minimally invasive surgery such as laparoscopy or endoscopy . such adapted embodiments may be used or adapted to be used with any device for minimally invasive surgery , such as a colonoscope , laparoscope , thoroscope , etc . in such embodiments , the body 110 may be flexible and of a length and a diameter to permit the device to be inserted into the particular scope far enough that the distal end of the device extends out of the distal end of the scope . for example , the diameter would be small enough to be inserted into the working channel of an endoscope . such a diameter may be 5 mm or less depending on the type of endoscope . to insert the device into the scope , the surgeon or other operating room personnel would place the arms in the “ in ” or “ together ” position and then insert the distal end of the device into an opening in a channel in the scope . the elongated body 110 of the device would then be fed into the scope until the distal end of the device protrudes from the channel opening at the distal end of the scope . once outside the distal end of the scope , the arms may be opened for electrocautery or “ scooping ” of tissue or the arms may remain or be closed for performing argon plasma coagulation . the device may be manipulated within the endoscope , i . e ., moved in and out of the channel or rotated within the channel , by any means , such as by holding a portion of the body , collet or handle that is outside the opening at the proximal end of the endoscope . while the foregoing embodiments have been described as having a pair of moveable arms , an alternative embodiment would have only one moveable arm . such an embodiment would be akin to having a pair of arms one of which either is integral with the channel in the body or remains substantially parallel to the channel in the body while the other arm is moveable away from the body . such alternate embodiment will be apparent to those of skill in the art from the foregoing disclosure . the foregoing description of the preferred embodiment of the invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and modifications and variations are possible in light of the above teachings or may be acquired from practice of the invention . the embodiment was chosen and described in order to explain the principles of the invention and its practical application to enable one skilled in the art to utilize the invention in various embodiments as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto , and their equivalents . the entirety of each of the aforementioned documents is incorporated by reference herein . | 0 |
in the three different embodiments illustrated respectively in fig1 - 3 , the paper machine headbox includes a base 10 on which there is mounted a frame beam 14 to which different components of the headbox are fixed . thus the rear wal of the frame beam 14 has connected thereto a distribution header 13 of the headbox , this distribution header 13 being in itself known and providing for distribution of the pulp stock suspension flow which travels as indicated at f in from the distribution header means 13 through a turbulence section 15 of the headbox , this section 15 forming a turbulence passage means which in itself is known and includes a plurality of parallel flow passages each being of a relatively small cross section and each communicating at its rear end with the distribution header means 13 and at its front end with the upper surface of the wall 18a which forms a substantially horizontal apron board extending across the entire width of the machine and forming the lower limiting surface of the slice means . the slice means 19 is defined between the upper surface of the wall 18a and the lower surface of the wall 20a of a light - weight upper lip frame 20 of the headbox , the lower surface of the wall 20a and the upper surface of the wall 18a converging toward each other to define the slice through which the pulp suspension flows as indicated at f out onto the wire 12 which travels around the schematically illustrated breast roll 11 , the web w forming on the wire 12 in a well known manner as shown schematically . the slice means 19 further includes a transversely extending strip 22 forming the upper lip of the slice means and situated directly in front of the upper lip frame 20 of the slice means . this strip 22 which forms the upper lip of the slice is capable of being independently adjusted by a separate adjusting means 22 &# 39 ; indicated by the vertical double - headed arrow just in front of the strip 22 . thus the strip 22 can be adjusted independently of the upper lip frame 20 , and for this purpose the means 22 &# 39 ; includes in a known way a number of fine adjusting spindles carried by the structure 21 and operatively connected with the strip 22 . thus the several adjusting spindles for adjusting the strip 22 are distributed across the front of the vertical wall 21 in side by side relation transversely of the machine in the cross - machine direction . the lip portion of the headbox includes the lower lip beam 18 whose upper wall 18a forms the apron board as referred to above , this lower lip beam 18 being hollow and of a substantially triangular cross section . the rear vertical wall 18b of the beam 18 is fixed directly to the front wall of the frame beam 14 of the headbox . the hollow , light - weight upper lip frame 20 includes in addition to its lower wall 20a , the bottom surface of which determines the upper limit of the slice 19 , upwardly extending walls 20b which extend upwardly from the front and rear edge regions of the lower wall 20a . this upper lip frame 20 has a rear edge region pivotally connected by a transverse pivot structure 23 to the frame of the headbox . moreover , the upper lip frame 20 has the vertically extending portion 20c in front of which the fine adjusting spindles for the strip 22 are located . a construction of this latter type is shown , for example , in u . s . pat . no . 3 , 976 , 539 , which illustrates how it is possible to prevent deflections of the upper lip frame 20 from being transferred to the structure which carries the strip 22 . it is thus possible when utilizing the present invention to provide an upper lip frame 20 which has a comparatively light - weight construction and relatively small dimensions . according to the present invention an air - tank means 24 which in itself is of a known construction has been operatively connected with the slice means 19 . the air - tank means 24 has an internal space v filled with air under pressure , this gas which is under pressure in the interior space v serving to damp in a known way those pressure disturbances which occur in the pulp suspension flow f . the air tank means 24 extends traversely across the entire width of the headbox and at its upper region has supporting flanges 25 which are respectively situated in the planes which extend longitudinally in the machine direction . the air - tank means 24 has a lower wall portion 17 which at its outer region at the bottom of the flanges 25 is fixed to the turbulence section 15 of the headbox , this lower wall portion 17 extending inwardly beyond the flanges 25 toward the left , as viewed in fig1 - 3 , to terminate in fig1 and 2 somewhat beyond the left end of the turbulence passage means 15 while in fig3 the lower wall portion 17 of the headbox terminates in a front edge which is approximately at the left end of the turbulence passage means 15 . of course at the inner edges of the flanges 25 the air - tank means 24 has a wall forming part of the cylinder , for example , and extending upwardly from the lower wall portion 17 rearwardly of the front edge thereof then around to terminate over the upper lip frame 20 . the loads which are applied to the lower wall portion 17 of the air - tank means 24 are transmitted to the frame beam 14 through a supporting plate 16 which extends substantially vertically through the turbulence passage means 15 , this supporting plate 16 being formed with perforations so that the pipe assembly which forms the turbulent section 15 passes through the supporting plate 16 . in the embodiments of fig1 and 2 , it will be seen that the lower wall portion 17 of the air - tank means 24 terminates in a front edge which is spaced rearwardly from the rear end region of the upper lip frame 20 , where the pivot 23 is located , so that this rear edge region of the upper lip frame 20 and the front edge of the lower wall 17 define between themselves an aperture or gap 28 which is of a substantially constant width and which extends transversely across the entire headbox . through this aperture 28 it is possible for the pulp suspension flow to communicate with the space v in the interior of the air - tank means so that in this way the pulp suspension flow will be exposed to the influence of the air under pressure in the space v . in the embodiments of fig1 and 2 there is a direct contact between the air pressure in the air - tank means 24 and the pulp suspension , the latter extending upwardly through the aperture 28 and having an upper surface s of relatively large area in contact with the air under pressure in the space v . in fig1 and 2 the elevation of the surface s of the pulp suspension is determined by an overflow weir . thus in fig1 the overflow weir 26a includes a wall extending upwardly and rearwardly from the front edge of the lower wall portion 17 of the air - tank means 24 , this upwardly and rearwardly inclined wall of the illustrated weir 26a being connected at its upper edge to a downwardly and rearwardly inclined wall which directs the pulp suspension which overflows the weir to an outlet pipe 27 forming an overflow pipe communicating with the interior of the tank 24 behind the weir 26a and directing the overflow back into circulation after the pulp suspension has travelled over the top edge of the weir 26a . it will be noted that in fig1 a wall 20b of the upper lip frame 20 is inclined forwardly and upwardly from the rear edge of the upper lip frame where the pivot 23 is located , so that the upwardly and rearwardly inclined wall of the weir 26a and the upwardly and forwardly inclined wall 20b of the upper lip frame 20 converge in a downward direction toward the gap 28 . in the embodiment of fig2 the air - tank means 24 also has a wall which is inclined upwardly and rearwardly from the front edge of the lower wall 17 , but in this case this upwardly and rearwardly inclined wall forms an extension of the cylindrical wall portion which extends around toward the front of the air - tank over the upper lip frame 20 . in this case the upper lip frame 20 has its lower wall 20a extending rearwardly behind the rear vertically extending wall 20b and terminating in the pivot 23 . in this case the overflow weir 26b includes a wall which extends upwardly and fowardly from the rear edge of the upper lip frame 20 where the pivot 23 is located , and the overflow is also directed to the pipe 27 which returns the overflowing pulp stock back into circulation . thus the embodiment of fig2 also has a weir 26b determining the elevation of the surface s , but in this case the weir is operatively connected with the lip frame 20b , and it will be seen that in fig2 also the upwardly and forwardly inclined wall of the weir 26b and the upwardly and rearwardly inclined wall extending from the front edge of the lower wall portion 17 of the tank 24 converge downwardly toward the gap 28 . in the embodiment of fig3 there is no direct communication between the pulp suspension and the air under pressure in the air - tank means 24 . instead with this embodiment there is a deflectable wall means 30 which has an upper surface contacting the air under pressure in the air - tank means 24 and a lower surface contacting the pulp suspension so that it is through the deflectable wall means 30 that the air under pressure acts on the pulp suspension in the slice means 19 . in the particular example illustrated in fig3 the deflectable wall means 30 is in the form of a stretchable resilient diaphragm made , for example , of rubber , this diaphragm 30 extending across the entire width of the headbox and being fluid - tightly fixed along its entire periphery to the opposed sides of the headbox as well as at its rear edge to the front end or edge of the lower wall portion 17 of the air - tank while at its front edge the diaphragm 30 is fixed in a fluid - tight manner to the rear edge of the upper lip frame 20 . thus through this deflectable wall means 30 it is possible to achieve the vibration - damping communication between the pulp suspension and the air under pressure . instead of using at the space between the rear edge of the upper lip frame 20 and the front edge of the lower wall portion 17 a resilient stretchable disphragm 30 , it is also possible to use a hinged plate or other equivalent pressure - transmission members as shown , for example , in u . s . patent applications ser . nos . 839 , 502 and 839 , 503 . as has been indicated above , the upper lip frame 20 is of a comparatively light - weight construction and is permitted to undergo deflections in a comparatively free manner . since furthermore the surface area dimensions of the pressure loads acting on the upper lip frame 20 , both horizontally and vertically , are relatively minor , the loads imposed by the pressure of the pulp stock on the upper lip frame 20 can be made relatively minor . the deflections caused by such loads are not permitted to extend up to the edge strip 22 , so that in this way a comparatively simple construction is achieved . as is illustrated in fig1 - 3 , the lower front edges of the flanges 25 are fixed to a transversely extending front wall of the air - tank means 24 , and this transversely extending front lower wall of the air - tank means 24 , is fixed in a fluid - tight manner to a transversely extending rear edge region of a resilient stretchable strip 29 of rubber or the like , the front edge region of this strip 29 being fluid - tightly fixed to the upper lip frame 20 , while the opposed side edge regions of the strip 29 are fluid - tightly fixed to the opposed side walls of the air - tank means 24 and the opposed ends of the upper lip frame 20 , so that in this way the connection between the air - tank means 24 and the upper lip frame 20 is such that this upper lip frame is relatively free to find its own particular position with respect to the air - tank means 24 . of course the invention is not to be narrowly confined to the details presented above by way of example only and which may vary within the frame of the inventive concept defined by the claims which follow . | 3 |
the invention will now be elucidated by the following non - restrictive examples . thin films of mg 55 ti 30 al 15 , mg 60 ti 30 al 10 , mg 68 ti 22 si 10 and mg 69 ti 21 al 10 were prepared by means of high vacuum deposition ( base pressure 10 − 7 mbar ). the thin films , with a thickness of 200 nm ( nominally ), were deposited on quartz substrates ( 20 mm diameter ), which were thoroughly cleaned beforehand using an in - house procedure . cap layers of 10 nm pd were deposited on top of the thin films in order to protect the films against oxidation and to catalyze hydrogen absorption and hydrogen release . uniformity of composition throughout the entire film was checked by means of rutherford backscattering spectroscopy ( rbs ), which showed that the deposition rates of the individual elements were controlled well . furthermore , x - ray diffraction was used to identify the crystallographic phases of the as - deposited films . calculations of the hydrogen content in the thin films are solely based on the rbs measurements , of which the accuracy is around 1 %. it should be noted that no correction is made for the pd cap layer , as the amount of hydrogen in the pd can never account for a deviation of this value that exceeds 3 %. electrochemical measurements were performed using a three - electrode electrochemical cell , thermostated at 298 k by means of a water jacket surrounding the cell , filled with 6 m koh electrolyte in which the thin film acted as working electrode ( active surface area of 3 cm 2 ). the thin films were contacted with a silver wire , which was attached using a conductive adhesive . a chemically inert isolating lacquer was applied to the contacts and the edges of the substrate shielding them from the electrolyte . the potential of the working electrode was measured with respect to a hg / hgo reference electrode filled with 6 m koh solution . this reference electrode was placed very close to the working electrode in order to minimize the ohmic drop caused by the electrolyte . the counter electrode , a palladium rod , was placed in a separate compartment in the cell and care was taken that the total area in contact with the electrolyte was sufficiently large . the compartments , which held both the working and counter electrode , were separated by means of fritted glass . in a separate setup the counter electrode was pre - charged with hydrogen ( pdh x ). the total amount of charge needed to extract all the hydrogen from this palladium rod far exceeded the charge needed to fully hydrogenate the thin film working electrode . this ensured that during the electrochemical experiments no oxygen was produced at the palladium counter electrode . argon gas , which was first led through an oxygen scrubber , was used before and during the measurements in order to de - aerate the setup . galvanostatic intermittent titration technique ( gitt ) was used to measure the electrochemical response that is related to the hydrogen insertion into and hydrogen extraction from the alloy . after each current pulse , the thin film was allowed to equilibrate for 1 hour . the current applied during each pulse was 100 ma / g . coulomb counting was used to determine the gravimetric storage capacity . the effect of the ti - content on the rate capability of mg y ti ( 1 - y ) alloys with 0 . 50 ≦ y ≦ 1 . 0 upon discharging the fully hydrogenated film with a high rate ( 1000 ma / g ; curve ( a )) and subsequently low rate current ( 100 ma / g ; curve ( b )) is depicted in fig1 , showing discharge capacities ( qd ) for mg y ti ( 1 - y ) electrodes with varying composition . comparable results are obtained for alloys wherein magnesium is partially replaced with an element capable of forming a covalently bound hydride , such as aluminium , for instance the alloys mg 55 ti 30 al 15 , mg 60 ti 30 al 10 , mg 68 ti 22 si 10 and mg 69 ti 21 al 10 . a similar compositional dependence of the discharge capacity ( qd ) for mg y sc ( 1 - y ) alloys was found in the paste . there , it was argued that the crystal structure of the hydride induces the hydrogen transport characteristics to change dramatically . in more detail , it was found that materials with an mg - content in the range of 0 ≦ mg ≦ 80 mol . % have a cubic , fluorite - structure . by increasing the mg - content beyond 80 mol . %, the kinetics of the hydride decomposition reaction decreases dramatically to very low q d values for pure mg . strikingly , in line with this observation the crystallographic structure was found to change from fluorite to the mg - familiar rutile - structure . the favourable fluorite structure of the mgsc hydride most likely originates from the fact that the face - centred cubic ( fcc ) structure of sch 2 is retained even when sc is partially substituted by mg . as tih 2 is also known to have a fcc - structure , the close analogy between mgsc and mgti alloys indicates that again the fluorite structure of mgtih x compounds is retained up to 80 mol . % mg . the main disadvantage of pure mgti hydrides is their low hydrogen partial pressure ( approx . 7 × 10 − 7 bar ). in order to increase the hydrogen partial pressure , the addition of an element which does not form an extremely stable hydride was included within the mgti lattice . furthermore to retain the high gravimetrical energy density of mgti alloys only light - weight elements are promising substitutes . one of the elements satisfying the requirements is al ( heat of formation — 4 kj / mol h for alh 3 ). fig2 shows the xrd spectrum of an as - deposited 200 nm thick mg 55 ti 30 al 15 thin film with 10 nm pd . it shows that a solid solution of ti in mg was formed with a preferential orientation in the [ 002 ] direction indicates to a single - phase crystalline alloy . in accordance with these observations , the xrd spectrum of the mgtisi compound also points to the formation of a single - phase crystalline alloy , however , in this case a somewhat lower intensity was found and hence the relative peak intensity w . r . t . pd decreases causing more pd planes to appear in the xrd spectrum . both xrd spectra show a decreasing lattice constant of the unit cell in comparison with mgti alloys by addition of al and si . the isothermal curves corresponding to the mg 69 ti 21 al 10 ( curve ( a )) and mg 68 ti 22 si 10 ( curve ( b ) alloys are depicted in fig3 . the measurements show a gravimetrical storage capacity of 6 . 03 wt % for the mg 69 ti 22 al 10 compound . a gravimetrical storage capacity of 4 . 53 wt % is obtained for the mg 68 ti 21 si 10 alloy . additionally , a very high hydrogen partial pressure , viz . 0 . 45 bar for mg 69 ti 21 al 10 and 0 . 24 bar for mg 68 ti 22 si 10 on average , is obtained up to approximately 2 . 2 wt % h and 1 . 44 wt % h , respectively . in comparison , mischmetal - based ab 5 compounds ( curve c ) as applied in commercially available nickel metal hydride batteries , are characterized by a high hydrogen partial pressure up to approximately 1 . 1 wt % hydrogen ( top axis corresponds to curve ( c )). the equilibrium curves of mg 55 ti 30 al 15 ( curve ( a )) and mg 60 ti 30 al 10 ( curve ( b ) alloys are depicted in fig4 . from the measurements it follows that the gravimetric capacities of mg 55 ti 30 al 15 and mg 60 ti 30 al 10 are 4 . 14 and 5 . 22 wt . % h , respectively . additionally , a very high hydrogen partial pressure , viz . 0 . 16 bar for mg 55 ti 30 al 15 and 0 . 40 bar for mg 60 ti 30 al 10 on average , is obtained during 1 . 7 wt . % h . as is shown , it is possible to increase the hydrogen partial pressure of mgti alloys by the addition of al . based on the findings discussed above , also b , c and si could be used for a similar effect . the heat of formations of the hydrides and the atomic radii of the elements mentioned in this invention disclosure are listed in tab . 1 . the hydrogen storage materials according to the invention such as the examples mg 55 ti 30 al 15 , mg 60 ti 30 al 10 , mg 68 ti 22 si 10 and mg 69 ti 21 al 10 , are suitable for various applications , for instance as an electrochemically active material in for instance fuel cells , or in media for the storage of hydrogen gas . | 7 |
[ 0021 ] fig1 illustrates the sliding door panel 12 . fig2 illustrates applicants &# 39 ; novel pocket door 10 which includes a sliding door panel 12 . fig3 a and 3b illustrate two positions of applicants &# 39 ; novel pocket door 10 . the first position illustrated in fig3 a is the closed position and prevents the passage of an occupant through the door opening . if a blowout or sudden decompression occurs to create a pressure gradient across sliding door panel 12 , then applicants &# 39 ; closed novel pocket door will rotate out of the sliding plane into a rotation plane about a primary axis 20 and , if the door strikes an obstruction ob , fold in the manner illustrated in fig3 b as it pivots along a secondary axis 30 , the secondary axis parallel and spaced apart from the primary axis 20 and laying between a first section 14 and a second section 16 of the door . [ 0023 ] fig4 and 6 all illustrate various views of the novel pocket door 10 including sliding door panel 12 with a novel hinge 34 between a first section 14 and a second section 16 . an overview of the accompanied drawings should provide a general understanding of the structure of applicants &# 39 ; novel pocket door 10 . turning now to fig1 it is seen that applicants &# 39 ; novel pocket door 10 may be comprised of a sliding door panel 12 . the sliding door panel 12 may include a multiplicity of sections , here first section 14 and second section 16 . the sections would typically be similar in height and thickness as illustrated in the accompanied drawings . furthermore , as is illustrated here , secondary axis 30 is seen to be about halfway between the primary axis and the leading edge of the door . however , it may be at any point between the primary axis and the leading edge of the door . indeed , the point at which the secondary axis is placed may depend upon where the obstruction is that requires the fold . further , although two sections are illustrated , requiring a secondary axis 30 , the specification anticipates that there may be a tertiary axis and three sections , or even more . the number of additional axis would depend on the requirements of the door and the environment in which the door is installed . [ 0026 ] fig2 illustrates the sliding panel 12 comprised of first section 14 and second section 16 . reference is made to also to fig4 and 5 that illustrate that first section and second section both may be similarly constructed and having a pair of parallel coplanar section walls 14 b and 16 b spaced apart from the second pair of coplanar adjacent section walls 14 c and 16 c . these may be made from foam core honeycomb composite construction known in the art . sliding panel door 12 typically has a leading edge 12 a and a trailing edge 12 b . the door moves between a first position and a second position . a first bulkhead pocket door wall 22 is spaced apart and parallel to a second bulkhead pocket door wall 24 to create a pocket 26 there between . the pocket door normally moves between an open and a closed position , the closed position illustrated in fig3 a and the open position not illustrated but known in the prior art and the position in which the pocket door is substantially enclosed in the pocket between first bulkhead wall 22 and second bulkhead wall 24 . the position illustrated in fig3 b is the rotated position , obtainable upon blowout with the door in the closed position if the door strikes an obstruction ob , as illustrated by the dotted lines in fig3 b . turning back to fig4 and 5 , and with reference to fig6 it is seen that an novel hinge 34 is provided between door sections 14 and 16 where a hinge bracket 14 a which includes a member spaced across between the two walls of the sections as set forth in fig6 and 7 and legs , legs typically imbedded within the composite comprising the section walls , the two hinge brackets facing one another when the door is in the normal position ( either open or closed ) and rotating out of flush alignment as the door goes into a folded position . turning now to fig4 , 6 , 6 a and 6 b for details of applicants &# 39 ; novel hinge , it is seen that hinge 34 includes an elongated shaft 36 , the shaft having a coil spring 46 wound around a portion thereof , the shaft having a removed end on which is received an adjustable spring retaining nut 38 as well as , optionally , a spacer 48 . the shaft may have a threaded portion for receiving the nut and adjustably selecting the tension in the spring so as to adjustably set the tension at which the door will begin to fold . the general construction of the hinge is to bias a folding section connector link or pin 42 which will float , connected pivotally at the near end of the shaft , thus securing the first door section 14 and pivotally connected to pin anchor 40 which is anchored tightly into second section 16 . the effect of using section connector link or pin 42 pivotally mounted at either end to the two adjacent door sections is to allow them to pivot with respect to one another while remaining engaged to one another . through the use of a bias shaft 36 and bias coil spring 46 which is connected at one end to a housing 50 fixed adjacent hinge bracket 14 , the effect is to bias section connector pin 42 to the left as illustrated in fig4 so as to hold flush against one another the inside faces of hinge bracket 14 a and hinge bracket 16 a . this holds the two door sections in a coplanar position . by threading down adjustable spring retaining nut 38 , one can increase the torque required to pull the doors out of coplanar alignment . shaft housing 50 includes a housing bore 50 a for receiving the near end of shaft 36 . furthermore , the near end or shaft 36 defines a tongue 36 a that has a rounded nose 36 b . cutout adjacent the tongue is a notch 36 c . with reference to fig5 fig6 a and 6b , it is also seen that door connector pin has , where it is pivotally mounted to the near end of the shaft , a similarly dimensioned tongue 42 a with a rounded nose 42 b and a notch 42 c such that when the two are layed together , the shaft diameter is reflected in the coupling created and , note that the dimensions , at least diameter is the same as the near end of shaft 36 . moreover , these dimensions are designed for snug receipt into bore 50 a of the housing 50 . the length of door section connector pin 42 is such that when the doors are in a flush position as illustrated in fig4 the joint portion where the tongue of the connector pin and the tongue of the shaft join will be within the bore holding the doors in a flush or coplanar position . when torque is applied to overcome resistance of the spring , edge - to - edge pivoting along mutual edges of hinge bracket 14 a and hinge bracket 16 a will pull the near end of the shaft out of the housing and allow the door connector pin to rotate at both points of articulation . further , with slots 52 cut into walls adjacent the hinge brackets , the connector pin 42 may pivot to hold the doors adjacent one another . this is done by providing the slots and further providing a distance between connector pin mounting pins 44 ( one at the shaft end and one at the anchor end ) such that the distance between adjacent pins 44 along the connector pin 42 is just slightly larger than the thickness of a door . drop down panels 32 maybe provided that are secured within pockets along the lower edge of each door segment and are either biased through the use of a spring , depressed against the floor of the cabin or , simply under the weight of the panels will lie against the floor of the cabin . drop down door sections 32 can slide up and down vertically within each of the door segments . after the door panel 12 is manufactured , veneer or fabric 54 may be stretched across outer walls 14 b , 14 c , 16 b and 16 c so that the seam created at the secondary axis 30 is invisible . a very thin veneer of wood may be used , in which case a very careful slice , such as with a razor or scalpel , may be executed in the veneer right where the edges of hinge brackets 14 a and 16 a meet . this will prevent the veneer from shattering in case the panel moves to a folded position . applicant &# 39 ; s novel hinge 34 mounted along a secondary axis 32 may be used in conjunction with a similar set of hinges at the primary axis with a tension set in the spring to first allow release along the primary axis and secondarily to allow release along the secondary axis . applicant &# 39 ; s secondary axis 30 with its novel breakaway hinge 34 may also be used with the novel pullout hinge featured in u . s . pat . no . 4 , 989 , 808 , the specification and drawings which are incorporated herein by reference . although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limited sense . various modifications of the disclosed embodiments , as well as alternative embodiments of the inventions will become apparent to persons skilled in the art upon the reference to the description of the invention . it is , therefore , contemplated that the appended claims will cover such modifications that fall within the scope of the invention . | 4 |
referring to fig1 a and 2 , an embodiment of a distribution system 10 for controlling and distributing the flow of liquid , gaseous , and particulate solid substances is shown including distribution medium 22 and containment layer 24 . distribution medium 22 includes a first principle side facing an inflow of substance and a second principle side facing containment layer 24 . containment layer 24 is designed to substantially prevent substance from flowing to an intended destination until distribution medium 22 is substantially filled with substance . in some embodiments , distribution system 10 can be utilized to fabricate composite materials . system 10 includes mold 12 and mold surface 14 . for purposes of illustration a flat mold surface 14 is shown , however , mold surface 14 can be curved , can include a moving conveyor belt , or any other surface for evenly distributing resin over one or more layers of material 16 a through 16 d to form lay - up 16 . in some embodiments , peel ply layers 18 a , 18 b can be positioned adjacent one or both of the outer sides of lay - up 16 . peel ply layers 18 a , 18 b are typically made of a porous material to allow resin to easily pass through without bonding to mold surface 14 or containment layer 24 as resin - impregnated lay - up 16 equilibrates into its final state . in other embodiments , peel ply layers 18 a , 18 b may not be included . in some embodiments , outer sheet 26 , also referred to as a vacuum bag , includes inlet port 28 positioned adjacent distribution system 10 and sealed at its marginal edges 30 to mold surface 14 by sealant tape 32 or other suitable means to form chamber 34 . an example of a sealant tape 32 that can be utilized is tacky tape ™ manufactured by schnee - moorehead , irving , tex . vacuum outlet port 35 can be installed between mold surface 14 and marginal edge 30 of outer sheet 26 for drawing a vacuum in chamber 34 . in some embodiments , substance enters inlet port 28 , while a vacuum is drawn from outlet port 35 . the vacuum causes outer sheet 26 to collapse down around distribution medium 22 . without distribution medium 22 , it would be difficult to evenly distribute resin over lay - up 16 , and substance starved areas or even voids could be created in the cured lay - up 16 . with substance distribution medium 22 , however , resin can flow evenly lay - up 16 , greatly reducing the chance of forming voids and the like in the final product . [ 0024 ] fig1 b shows another embodiment of distribution system 10 that include vacuum outlet ports 35 ′ in mold 12 . outlet ports 35 ′ can be positioned in one or more locations in mold 12 . portions of outlet ports 35 ′ extending from mold 12 can be fitted to a vacuum source to draw outer sheet 26 to collapse around distribution medium 22 and lay - up 16 . in some embodiments , one or more outlet ports 35 ′ are positioned around the periphery of lay - up 16 in areas where there are likely to be gaps between lay - up and outer sheet 26 . as many inlet ports 28 and outlet ports 35 ′ as necessary can be utilized , thereby enabling distribution system 10 to be utilized to fabricate components in a variety of shapes and sizes . further , a combination of one or more outlet ports 35 ( fig1 a ) and outlet ports 35 ′ can be utilized in the same distribution system 10 . lay - up 16 can comprise one or more layers of material , such as woven fiberglass , graphite or other composite reinforcement material . peel plies 18 a and 18 b can be made of a material such as coated fiberglass , which is porous to resin so that resin can easily pass through without bonding to mold surface 14 or containment layer 24 as the resin cures . a suitable peel ply material is release ease 234tfp , manufactured by airtech products , incorporated , huntington beach , calif . in some embodiments of distribution system 10 , a material suitable for use as outer sheet 26 is impregnated nylon , which can be obtained from numerous suppliers such as the previously mentioned airtech products . when the substance being distributed is resin , distribution medium 22 can be comprised of any suitable material . for example , a knitted mono - filament uv stabilized high density polyethylene can used as distribution medium 22 , such as commercially available solarguard ™ manufactured by roxford fordell company , greenville , s . c . anther suitable product for distribution medium 22 is colbond 7004 manufactured by colbond , incorporated , enka , n . c . colbond 7004 is a random orientated , heat fused mono - filament material . referring to fig1 a and 3 , in other embodiments , temperature sensitive containment layer 24 a has a melting point such that containment layer 24 a dissolves or melts after substance is at least partially distributed in distribution medium 22 . once containment layer 24 a melts , the substance can flow to its intended destination . distribution system 10 can include means for applying heat to temperature sensitive containment layer 24 a . heating can be done either directly by means such as raising the ambient temperature , blowing heated air , conducting electricity through a metallic frame , chemical reaction , or other suitable means . heat can also be applied to substance containment layer 24 a by heating the substance before , during , or after the substance contacts containment layer 24 a . other materials that dissolve can be used for containment layer 24 a in addition to , or instead of , containment layers 24 a that dissolve when heated . in some embodiments , a temperature sensitive containment layer 24 a includes a meltable substance layer 36 and porous veil material 37 . an example of a suitable material for temperature sensitive containment layer 24 a for use with resin is blue max tak tu on reemay ( a polyester non - woven veil ), manufactured by the blue max company , anaheim , calif . the blue max tak tu material is a low temperature melting resin 36 that is applied to a porous veil material 37 . referring to fig4 another embodiment of containment layer 24 b includes a plurality of holes 40 in a heat shrinkable material . holes 40 are a size such that substance will not readily flow there through at ambient temperatures . upon heating , the material of containment layer 24 b will shrink , causing holes 40 to increase in size , shown in dotted lines and indicated by numeral 40 ′, allowing substance to flow from substance distribution medium 22 . a suitable heat shrinkable material for use with resin substances includes intercept shrink film manufactured by fpm , incorporated , brownstone , me . referring to fig1 and 5 a , in some embodiments , containment layer 24 c is a porous film 42 includes a plurality of holes or very closely spaced perforations 44 . the size of the perforations is selected to prevent or greatly reduce substance flow through substance containment layer 24 c . holes 44 having a size such that substance will not flow there through when a vacuum is drawn to outlet port 35 at a first rate and will flow there through when a vacuum is drawn from outlet port 35 at a higher second rate . calculating the size of holes 44 in substance containment layer 24 c can be accomplished as follows . for a layer of substance above substance containment layer 24 c , the hydrostatic pressure at the layer is by the equation : the “ excess pressure ” developed by the surface tension of the substance and the openings ( perforations ) in substance containment layer 24 c can be expressed as : the governing equation for substance containment sets the hydrostatic pressure equal to the excess pressure : properties of a typical resin , such as derakane 411 c - 50 resin by dow chemical company , midland , mich . are : the maximum perforation size that overcomes the hydrostatic pressure is then : using a typical thickness of a substance distribution medium , where the substance is resin , the substance height becomes 0 . 00635 m ( 0 . 25 in ) and the maximum perforation size is : for thicker substance distribution mediums , the maximum perforation size will decrease . perforations larger than this maximum value may not contain the substance during infusion . similarly , the minimum perforation size can be estimated by equating the excess pressure to the sum of the hydrostatic pressure and the vacuum pressure in the bagged assembly : where pv will be on the order of one atmosphere . at sea level , pv is approximately 100 kilopascals ( kpa ) and dominates the left side of the equation above . the minimum perforation size is then estimated by : perforations smaller than this minimum value may not permit substance to pass through the substance containment layer 24 c under vacuum pressure . the substance containment layer 24 c perforation size is then bounded by : a suitable material for containment layer 24 c for use with resin substances is easy gardner tree wrap having round holes with a 0 . 015 inch diameter or easy gardner weed block with square holes of a similar size . both of these materials are manufactured by easy gardner , incorporated , waco , tex . this method of calculation can also be used to design the perforations for temperature sensitive containment layers 24 b ( fig4 ). in still other embodiments of distribution system 10 ( fig1 ), containment layer 24 can be comprised of a layer of perforated material including a plurality of embossed holes . sufficient pressure can be applied to containment layer 24 to cause the perforations to release and allow the substance to flow once it is distributed in distribution layer 22 . distribution system 10 can be modified to include means for applying pressure to the substance in distribution layer 24 to induce tearing of the holes in containment layer 24 . such means include physically applying pressure to the substance , applying vacuum pressure , such as by drawing a vacuum on chamber 34 , or other suitable means . containment layer 24 can also be configured to tear upon application of sufficient weight of the substance . distribution medium 22 can be configured to allow sufficient substance to accumulate to apply the required weight to containment layer 24 . other embodiments include containment layer 24 fabricated from materials whose porosity properties change under application of different rates of vacuum , different rates of atmospheric pressure , and varying heat . substances that can be distributed with distribution system 10 include any amounts of liquid , solid , and / or gaseous substances . distribution layer 22 can be fabricated from any suitable material or combination of materials , and can include grids or other suitable openings to distribute the substance . various embodiments can include two or more distribution systems 10 that are configured to allow substances to be combined automatically at desired pre - selected time intervals , or upon application of means to at least partially remove containment layer 24 to allow the substance to flow toward its intended destination . for example , containment layer 24 in one distribution system 10 can be configured to release the substance when activated by an operator . the distributed substance can flow onto and chemically react with another substance in a second distribution system 10 . containment layer 24 can be configured to release the combined substances either manually or automatically once the chemical reaction is complete . distribution medium 22 can be configured to accumulate all or a portion of the substance to be distributed by increasing the depth of the grid , including side walls around the perimeter of distribution medium 22 , or other suitable structure . further , distribution system 10 can be oriented to allow substance to flow in any desired direction . additionally , the substance can be forced to flow in any desired direction through the use pressure , pumps , or other suitable mechanism for inducing flow through distribution medium 22 . while the present disclosure describes various embodiments , these embodiments are to be understood as illustrative and do not limit the claim scope . many variations , modifications , additions and improvements of the described embodiments are possible . for example , those having ordinary skill in the art will readily implement the structures and methods disclosed herein , and will understand that any process parameters , materials , and dimensions are given by way of example only . the parameters , materials , and dimensions can be varied to achieve the desired structure as well as modifications , which are within the scope of the claims . variations and modifications of the embodiments disclosed herein may also be made while remaining within the scope of the following claims . in the claims , unless otherwise indicated the article “ a ” is to refer to “ one or more than one ”. | 1 |
turning now to fig1 and 2 which show a prior art for a tiled display 40 having a plurality of tiles 16 a - 16 b each with circuits 26 and drive circuits 22 and pixel electrodes 104 or 304 , formed on a back plate 18 . it is understood that the drive circuits 22 , circuits 26 and pixel electrodes 104 or 304 for each tile 16 a - 16 b exist in the same circuit layer . it is further understood that the circuit 26 includes the thin film transistors and associated capacitors . the pixel aperture ratio is limited by the space required for the circuits 26 and , furthermore , the drive circuits 22 extend beyond the area defined by the outermost pixels on each tile . alternately , the drive circuits 22 are separate discrete components that are interconnected to the tile using tape automated bonding or other means . the horizontal pitch 80 between adjacent pixels on adjacent tiles , across a seam , is substantially equivalent to the horizontal pixel pitch 80 on a single tile . additionally , the vertical pixel pitch 82 and the horizontal pixel pitch 80 are substantially the same for all tiles in the display . the vertical pixel length 84 and horizontal pixel length 78 are used in conjunction with the vertical pixel pitch 82 and the horizontal pixel pitch 80 to calculate the aperture ratio using the following equation : ( 84 × 78 )/( 82 × 80 )= aperture ratio . referring to fig3 - 5 , an emissive tiled display 42 is comprised of two or more emissive tiles 20 a - d arrayed , or tiled , together to provide a monolithic seamless display . the stacking of the circuits 26 and drive circuits 22 ( see fig5 ) under the pixels on each tile allows for pixels 300 to be positioned near the edge of tiles 20 a - 20 d with the distance from the outermost pixel edge to the tile edge at most equal to one - half the space between pixels 300 . furthermore , the integration of the drive circuits 22 onto each tile reduces the number of external signal connections ( not illustrated in this embodiment ) needed . the stacking of the drive circuits 22 under the pixels allows for the external signal connections to be made in the limited space at the edge of the tile 20 , or alternately , through vertical connections 36 to the back of the tile 20 . furthermore , a conductor can be provided along a tile edge to an adjacent tile for the purpose of carrying electrical signals out to the edge of a perimeter tile . the vertical 76 and horizontal pitch 72 between adjacent pixels on adjacent tiles , across a seam , is substantially equivalent to the vertical 76 and horizontal 72 pixel pitch on a single tile . additionally , the vertical 76 and horizontal 72 pixel pitch is substantially the same for all tiles in the display . the vertical pixel length 74 and horizontal pixel length 62 are used in conjunction with the vertical pixel pitch 76 and the horizontal pixel pitch 72 to calculate the aperture ratio using the following equation : ( 74 × 62 )/( 76 × 72 )= aperture ratio . the preferred embodiment of emissive tiles for use in the tiled emissive display is shown in fig5 - 7 . fig5 shows a composite view of an emissive multilayer tile 20 from the tiled display shown in fig3 . fig . 6 shows the drive circuits 22 and the circuits 26 that are located on the same plane on the tile 20 and are electrically connected by connectors 24 . the tile 20 does not have to be transparent but may be any material compatible with tft processing including , but not limited to , glass and co - fired ceramic . the pixel electrodes 304 are located above the circuits 26 and separated by insulating layers 60 and 66 shown in cross - sections fig1 - 13 . fig7 shows the circuits 26 connected to the pixel electrodes 304 by means of an additional layer containing a plurality of conductors 28 shown between the insulating layers 60 and 66 in fig1 - 14 . also shown in these figures are the components of the tft circuits : source 30 , insulating layer 58 , gate insulator 64 , anisotropic silicon 68 , and drain 70 . it is the preferred embodiment that the drive circuits 22 and circuits 26 are contained in an area defined by the outermost pixels wherein drive circuits 22 and circuits 26 do not extend past the outermost pixels . it is understood that each circuit 26 is not necessarily located directly under the corresponding pixel electrode 304 . the circuits 26 are electrically connected to the pixel electrode 304 through vertical connections and interconnections 28 . although the drive circuits 22 and circuits 26 are under the pixel array , the connections to the drive circuits , as shown in fig5 , can be made through vertical connections 36 that extend to the backside of the tile 20 . alternately , the external interconnections to the drive circuits 22 can extend to one or more edges of the tile 20 , beyond the outermost pixel . in another embodiment , the drive circuits 22 are integrated on a separate layer under the circuits . as shown in fig8 , circuits 26 reside above the drive circuits 22 and are separated from the drive circuits by an insulating layer . the pixel electrodes 304 are located above the circuits 26 , separated by another insulating layer . the interconnections 24 from the drive circuits 22 to the circuits 26 and from the circuits 26 to the pixel electrodes 304 are made using vertical connections 36 . furthermore , a layer containing a plurality of conductors 28 can be used to connect the circuits 26 to the pixel electrodes 304 . external signal connections to the drive circuits can be made along one or more edges of the tile 20 , or through vertical connections 36 to the backside of the tile 20 and on to the drive circuits through drive circuit signal connections 32 . in another embodiment , as shown in fig9 and 10 , the drive circuits 22 are integrated on the backside of the tile 20 . the drive circuits 22 are electrically connected to the topside circuits 26 through the tile 20 using vertical connections 36 . it is understood that double side tft processing is required on the tile . furthermore , a layer containing a plurality of conductors 28 can be used to connect circuits 26 that are offset from the pixels electrodes 304 to the pixel electrodes 304 . external signal connections to the drive circuits 22 can be made to the backside of the tile 20 . fig1 shows the cross - section of the multilayer emissive tile 20 . in this embodiment , the drive circuits 22 and circuits 26 are electrically connected to the pixels 300 through the conductor layer 28 . as shown in fig1 , the display includes a cover plate 52 and the display is viewed through the cover plate 52 . the cover plate 52 is a transparent substrate and includes , but is not limited to , glass and plastic . it is understood that a material 56 that has matching index of refraction to the cover plate 52 can be used to fill any gaps between the pixels 300 and the cover plate 52 . this material can also provide moisture and oxygen protection . in the preferred embodiment the cover plate 52 includes a polarization layer 50 to increase the contrast ratio of the display . in another embodiment , as shown in fig1 , the cover plate 52 includes a color filter array 54 . the patterned color filter array 54 is aligned with the pixel array . when a color filter array 54 is employed on the cover plate 52 the pixels 300 are understood to be white light - emitting . furthermore , the light - emitting layer 308 can be a continuous coating as shown . the cover plate 52 is bonded to the emissive tile 20 by means including , but not limited to , adhesive , metal and solgel . a desiccant can be positioned in or near the seals between the tile 20 and the cover plate 52 . furthermore , an oxygen getter can be positioned in or near the seals between the tile 20 and the cover plate 52 . in a further embodiment , the tiles are positioned between the cover plate 52 and a back plate 18 . the tiles can be affixed to either the cover plate 52 or back plate 18 . the back plate 18 does not need to be transparent . additionally , electrical connections can be made from the tile to the back plate 18 . in a further embodiment , the cover plate 52 and back plate 18 are sealed around the perimeter enclosing the tile array within . in a further embodiment , a desiccant may also be positioned in or near any of the seals previously described . alternately , an oxygen getter is positioned in or near any of the seals previously described . the present invention is applicable to emissive displays , and is particularly suitable for , but not limited to , use in organic electroluminescent displays . fig1 and 15 describe examples of pixels with organic electroluminescent materials . a light - emitting layer of an organic electroluminescent tile comprises a luminescent or fluorescent material where electroluminescence is produced as a result of electron - hole pair recombination in this region . in the simplest construction of a light - emitting pixel 100 , as shown in fig1 , the light - emitting layer 108 is sandwiched between pixel electrode 104 that is an anode and the cathode 106 . the light - emitting layer 108 is a pure material with a high luminescent efficiency . a well known material is tris ( 8 - quinolinato ) aluminum , ( alq ), which produces excellent green electroluminescence . the simple pixel structure 100 can be modified to a multilayer structure in which an additional electroluminescent layer is introduced between the hole and electron - transporting layers to function primarily as the site for hole - electron recombination and thus electroluminescence . in this respect , the functions of the individual organic layers are distinct and can therefore be optimized independently . thus , the electroluminescent or recombination layer can be chosen to have a desirable el color as well as high luminance efficiency . likewise , the electron and hole transport layers can be optimized primarily for the carrier transport property . in a preferred embodiment , the pixel 100 is described as a multilayer organic device that emits light from the top . as shown in fig1 , the multilayer organic device 300 has a substrate 302 on which is disposed a light reflective conductive anode 304 . the anode 304 comprises two layers including a light reflective conductive metal layer 304 a and a thin transparent layer of a conductive high work function material 304 b . an organic light - emitting structure 308 is formed between the anode 304 and a cathode 306 . the cathode 306 is composed of two layers including a thin transparent conductive layer of a low work function material 306 a and a transparent conductive layer such as indium tin oxide 306 b . the organic light - emitting structure 308 is comprised of , in sequence , an organic hole - transporting layer 310 , an organic light - emitting layer 312 , and an organic electron - transporting layer 314 . when an electrical potential difference ( not shown ) is applied between the anode 304 and the cathode 306 , the cathode will inject electrons into the electron - transporting layer 314 , and the electrons will migrate across layer 314 to the light - emitting layer 312 . at the same time , holes will be injected from the anode 304 into the hole - transporting layer 310 . the holes will migrate across layer 310 and recombine with electrons at or near a junction formed between the hole - transporting layer 310 and the light - emitting layer 312 . when a migrating electron drops from its conduction band to a valence band in filling a hole , energy is released as light , and is emitted through the light - transmissive cathode 306 . the invention has been described in detail with particular reference to certain preferred embodiments thereof , but it will be understood that variations and modifications can be effected with the spirit and scope of the invention . | 7 |
preferred embodiments of the present invention will now be explained with reference to the accompanying drawings . an electric power supplier is used in a state where it is connected to a target device to be connected . explanations will now be made to an electric power supplier according to the first embodiment of the present invention . a personal computer , including the electric power supplier and an information processing unit connected to the electric power supplier installed therein , will now specifically be described by way of example . [ 0073 ] fig1 is a block diagram showing the structure of a personal computer 100 , in which the electric power supplier according to the first embodiment is installed . this personal computer 100 briefly includes an information processing unit 120 and an electric power supplier 140 . the information processing unit 120 has the structure for realizing an information processing function which is fundamental to a general - purpose computer . the electric power supplier 140 supplies each section , such as a bus , etc ., included in the information processing unit 120 with electric power . the supplying of the electric power toward the information processing unit 120 is shown and represented by three arrows in fig1 . as illustrated in fig1 the information processing unit 120 comprises a memory 121 , an input / output control section 122 , a display section 123 , an external memory 124 , an operational input section 125 , and a processor 126 . the memory 121 includes a rom ( read only memory ), ram ( random access memory ), etc ., and stores program data or any other various data . the input - output control section 122 includes a dma ( direct memory access ) controller . the memory 121 , input / output control section 122 , and processor 126 are connected with each other through a bus , and can send and receive data to and from one another . the input / output control section 122 controls the display section 123 , the external memory 124 , and the operational input section 125 , so as to input and output various information . the display section 123 has an lcd ( liquid crystal display ) plate and a driving circuit , etc ., for example , and display various data . the external memory 124 includes an hdd ( hard disk drive ), a cd - rom read circuit , or the like , and stores program data and any other various data . the operational input section 125 has a keyboard , etc ., and sends various instructions to the processor 126 . the processor 126 has a cpu ( central processing unit ), and controls each section included in the information processing unit 120 , as will specifically described below . the processor 126 supervises the state of the operational input section 125 through the input / output control section 122 . the processor 126 reads out program data and various data from the memory 121 or external memory 124 , in accordance with the operational state of the input / output control section 122 . the processor 126 executes various information processing , based on the read data from the memory 121 or external memory 124 , and controls the display section 123 to display information corresponding to the executed information processing . as shown in fig2 the electric power supplier 140 includes an ac - dc converter 141 , a dc - dc converter 142 , a fuse 143 , a switching device 144 , a battery 145 , and a current control circuit 146 . the ac - dc converter 141 converts , for example , a commercial source voltage to a direct - current voltage of 19 v ( volts ), and outputs the converted direct - current voltage . the dc - dc converter 142 is connected to the ac - dc converter 141 , and is a load which absorbs power from the ac - dc converter 141 . the dc - dc converter 142 converts an output voltage value of the ac - dc converter 141 to a plurality of direct - current voltage values . to be more specific , connected to the dc - dc converter 142 is the information processing unit 120 . the dc - dc converter 142 converts an output voltage of the ac - dc converter 141 to three direct - current voltages of , for example , 5 . 0v , 3 . 3v , 1 . 5v , and supplies the sections inside the information processing unit 120 with their corresponding one of the converted direct - current voltages . the fuse 143 is , for example , of a current - fusing type . one end of the fuse 143 is connected to an output end of the ac - dc converter 141 , and the other end thereof is connected to an input end of the dc - dc converter 142 . the switching device 144 includes a p - channel type mosfet ( metal oxide semiconductor field effect transistor ). in this specification , the switching device 144 is hereinafter referred to as an fet 144 . the source ( s ) of the fet 144 is connected to the other end of the fuse 143 . a control voltage is sent from an output end of the current control circuit 146 to the gate ( g ) of the fet 144 . the drain ( d ) of the fet 144 is connected to the battery 145 , as will more specifically be described later . in the case where the fet 144 is in an on state , a current flows between the source and drain of the fet 144 , and a current flows from the ac - dc converter 144 to the battery 145 . in the state where the fet 144 is in an off state , no current flow between the source and drain of the fet 144 , the battery 145 is electrically disconnected from the ac - dc converter 141 . the battery 145 is a load which absorbs power from the ac - dc converter 141 . in the case where commercial electric power is suspended to be sent to the ac - dc converter 141 , the battery 145 functions as a back - up power source for supplying electric power to the information processing unit 120 . the battery 145 includes a charge control circuit 150 , a charge circuit 151 , and a secondary battery 152 . in the case where the charge control circuit 150 is in the on , the charge control circuit 150 controls the charge circuit 151 to charge the secondary battery 152 with electricity . as the secondary battery 152 , any one of , for example , a lithium ion battery , a nickel - cadmium battery , a nickel - hydrogen battery , etc . can be employed . when the battery 145 functions as a back - up battery , it supplies each section inside the information processing unit 120 with electricity charged in the secondary battery 152 through the dc - dc converter 142 . the current control circuit 146 discriminates whether the current flowing through the fuse 143 is an overcurrent . in the case where it discriminated that the current is an overcurrent , the current control circuit 146 controls the fet 144 to reduce the amount of current flowing through the fuse 143 . in particular , the current control circuit 146 detects a voltage across the fuse 143 , and amplifies the detected voltage . the current control circuit 146 compares the value of the amplified voltage with a predetermined threshold value , and generates a control signal s 1 corresponding to a result of the comparison . in this case , the threshold value is set to a value larger than the value of the amplified voltage across the fuse 143 in the case where a rated current of the ac - dc converter 141 flows through the fuse 143 . the current control circuit 146 generates a control signal s 1 at a low level , in the case where the value of the amplified voltage is lower than a threshold value , and generates a control signal s 1 at a high level , in the case where the value of the amplified voltage is higher than a threshold value . then , the current control circuit 146 supplies the gate of the fet 144 with the generated control signal s 1 . if the electric power supplier 140 supplies the information processing unit 120 with driving electricity , and if the information processing unit 120 executes various processing operations , the personal computer 100 executes fundamental information processing , likewise any other general - purpose computers . generally , the electric power supplier 140 operates in the manner described below . the ac - dc converter 141 converts a commercial source voltage of ac100v to a direct - current voltage of dc19v , for example . after this , the ac - dc converter 141 provides the direct - current voltage to the dc - dc converter 142 and battery 145 . the dc - dc converter 142 converts an output voltage ( 19v ) of the ac - dc converter 141 into three direct - current voltages of 5 . 0v , 3 . 3v , 1 . 5v , and supplies each section inside the information processing unit 120 with their corresponding one of the three direct - current voltages . the ac - dc converter 141 converts a commercial source voltage into a direct - current voltage , and outputs the converted direct - current voltage . upon this , a current flows through the fuse 143 , and a voltage drop is generated between both ends of the fuse 143 . the current control circuit 146 detects the voltage across the fuse 143 , amplifies the detected voltage , and compares the value of the amplified voltage with a threshold value . the current control circuit 146 generates a control signal s 1 in accordance with a result of the comparison , and supplies the gate of the fet 144 with the generated control signal s 1 . the fet 144 will be in an on or off state , in accordance with the supplied control signal s 1 . in the case where , for example , the processor 126 or external memory 124 inside the information processing unit 120 is to consume relatively a large amount of electric power , a current having a value higher than a rated current value of the ac - dc converter 141 flows through the fuse 143 . in such a case , the electric power supplier 140 operates as described below . the current control circuit 146 discriminates that the value of the amplified voltage is higher than a threshold value , generates a control signal s 1 at a high level , and supplies the gate of the fet 144 with the generated control signal s 1 . because the fet 144 will be in an off state in response to the supplied control signal s 1 , no current flows between the source and drain of the fet 144 . in addition , the battery 145 is electrically disconnected from the ac - dc converter 141 . hence , the ac - dc converter 141 supplies only the dc - dc converter 142 with a direct - current voltage . this prevents a state wherein the ac - dc converter 141 is over loaded . while this state continues for a predetermined period of time , the amount of electric power consumed by the processor 126 or external memory 124 is reduced . along with the reduction in the amount of consumed electric power , the current flowing through the fuse 143 is reduced , and the value thereof is returned to a value which is equal to or lower than the rated current value of the ac - dc converter 141 afterwards . in the case where the current , whose value is equal to or lower than the rated current value of the ac - dc converter 141 , flows through the fuse 143 , the electricity power supplier 140 operates in the manner described below . the current control circuit 146 discriminates that the value of the amplified voltage is lower than a threshold value , generates a control signal s 1 at a low level , and supplies the gate of the fet 144 with the generated control signal s 1 . because the fet 144 will be in an on state in response to the supplied control signal s 1 , a current flows between the source and drain of the fet 144 . the ac - dc converter 141 supplies the dc - dc converter 142 and battery 145 with a direct - current voltage . in the battery 145 , the charge control circuit 150 controls the charge circuit 151 to charge the secondary battery 152 with electricity . even if the battery 145 is electrically disconnected from the ac - dc converter 141 , while the secondary battery 152 of the battery 145 is charged with electricity , as long as the disconnection period is only a short period of time , the secondary battery 152 will not badly be effected . in the above - described embodiment , the current control circuit 146 generates the control signal s 1 , based on the value of the both - end voltage of the fuse 143 . however , the current control circuit 146 may generate the control signal s 1 , based on both of the value of the both - end voltage of the fuse 143 and the charge state of the secondary battery 152 . explanations will now be made to thus structured electric power supplier according to the second embodiment . [ 0097 ] fig3 is a block diagram showing the structure of an electric power supplier 240 according to the second embodiment . the electric power supplier 240 according to the second embodiment is installed in a personal computer , and has substantially the same structure as that of the electric power supplier of the first embodiment , so the same reference numerals as affixed to the same component elements . a battery 245 has a detection signal generation circuit 153 , in addition to the structure of the battery 145 described in the first embodiment . the detection signal generation circuit 153 detects whether the secondary battery 152 is fully charged with electricity , generates a detection signal s 2 , and sends the generated signal to the current control circuit 146 . the detection signal generation circuit 153 usually generates a detection signal s 2 at a low level , and generates a detection signal s 2 at a high level when the secondary battery 152 is fully charged with electricity . when the value of the amplified both - end voltage is larger than a predetermined value , and when the detection signal s 2 at a high level is supplied , the current control circuit 146 generates a control signal s 1 for controlling the fet 144 . in the case where the detection signal generation circuit 153 generates a detection signal s 2 at a high level , the battery 245 can electrically be disconnected from the ac - dc converter 141 . hence , in the case where the detection signal s 2 is at a high level , it is meant that the ac - dc converter 141 is electrically disconnected from the battery 245 . according to this embodiment , a direct - current voltage is stably supplied to the information processing unit 120 . at the same time , while the secondary battery 152 is charged with electricity , the battery 245 is electrically disconnected from the ac - dc converter 141 . in the above - described embodiments , the electric power supplier detects whether the ac - dc converter 141 is over loaded , based on the current flowing through the fuse , and the ac - dc converter 141 is electrically disconnected from the battery 145 . however , the component element for detecting the state wherein the ac - dc converter 141 is over loaded is not limited to the fuse . explanations will now be made to the third embodiment of the present invention , which has another component element for detecting the above state . [ 0104 ] fig4 is a block diagram showing the structure of an electric power supplier 340 according to the third embodiment of the present invention . the electric power supplier 340 is installed in a general - purpose personal computer . the direct - current voltage which is output from the ac - dc converter 141 includes frequency components which are caused by , for example , various noise , etc . in order to remove such noises , the electric power supplier 340 includes a noise filter . in place of the fuse , the electric power supplier 340 has substantially the same structure as that of the first embodiment , except that a coil included in the noise filter is used for detecting the state in which the ac - dc converter 141 is over loaded . hence , the same reference numerals are affixed to the component elements . a coil 343 forms a noise filter , together with a capacitor 347 , and has a function as resistance for a current including the frequency components . one end of the coil 343 is connected to an input terminal of one end of the current control circuit 346 . while the other end of the coil 343 is connected to an input terminal of the other end of the current control circuit 346 and to the source of the fet 144 . the capacitor 347 is connected to the other end of the coil 343 and a ground line . the current control circuit 346 detects and amplifies the voltage generated between both ends of the coil 343 , and compares the amplified voltage value with a predetermined value . under the same comparison condition performed in the first embodiment , the current control circuit 346 generates a control signal s 1 at a high or low level . according to the above structure , the electric power supplier 340 according to this embodiment , can be operated likewise the first embodiment . the electric power supplier 340 can attenuate noises to be transmitted to the information processing unit 120 connected to the electric power supplier 340 , through the noise filter . the structures of the electric power supplier and personal computer , in which the electric power supplier is installed , are not limited to those described in the above embodiments . a circuit which can electrically be disconnected from the ac - dc converter 141 may be prepared outside the electric power supplier . explanations will now be made to an electric power supplier having such a structure , according to the fourth embodiment of the present invention . [ 0110 ] fig5 is a block diagram showing the structure of a personal computer in which an electric power supplier 440 according to the fourth embodiment is installed . this personal computer 400 briefly includes an information processing unit 420 and the electric power supplier 440 . the information processing unit 420 has substantially the same structure as that of the information processing unit 120 of the first embodiment , except that the information processing unit 420 includes two auxiliary power supplying sections 427 a and 427 b . the electric power supplier 440 has substantially the same structure as that of the electric power supplier 140 of the second embodiment , except that the electric power supplier 440 individually supplies the auxiliary power supplying section 427 a , 427 b , and any other sections included in the personal computer 400 with electricity . each of the auxiliary power supplying sections 427 a and 427 b , which are shown in fig5 has a secondary battery , and provides each section included in the information processing unit 120 with electricity , when electricity stops to be supplied from the electric power supplier 440 . each of the auxiliary power supplying sections 427 a and 427 b detects the electricity charged - level of the secondary battery in its corresponding auxiliary power supplying section , generates binary - level detection signals s 2 a and s 2 b of high or low , and supplies the electric power supplier 440 with the generated signals . when a current having a current value which is higher than the rated current value of the ac - dc converter 141 flows through the fuse 143 , the electric power supplier 140 electrically disconnects at least one auxiliary power supplying section 427 from the ac - dc converter 141 , thereby to stably supply any other sections included in the information processing unit 420 with electricity . the electric power supplier 440 has the structure shown in fig6 . the same reference numerals are affixed to the same component elements as those of the first embodiment . as seen from fig6 the dc - dc converter 142 is connected to any sections inside the information processing unit 420 other than the auxiliary power supplying sections 427 a and 427 b . the ac - dc converter 141 is connected to each of the auxiliary power supplying sections 427 a and 427 b inside the information processing unit 420 , through transmission paths of fets 444 a and 444 b . the current control circuit 446 has two detection - signal input terminals . sent to the two detection - signal input terminals are detection signals s 2 a and s 2 b from the respective auxiliary power supplying sections 427 a and 427 b . the current control circuit 446 has two control - signal output terminals , and sends control signals s 1 a and s 1 b to the gates of the fets 444 a and 444 b corresponding to the auxiliary power supplying sections 427 a and 427 b , respectively . according to the above - described structure , in the case where the detection signal s 2 a at a high level and the control signal s 2 b at a low level are sent respectively from the auxiliary power supplying sections 427 a and 427 b to the current control circuit 446 , the electric power supplier 440 operates in the manner as will be described below the current control circuit 446 amplifies a voltage across the fuse 143 , compares the amplified voltage with a threshold value . in the case where it is determined that the value of the amplified voltage generated between both ends of the fuse 143 is higher than the threshold value , the current control circuit 446 generates a control signal s 1 a at a high level and a control signal s 1 b at a low level . after this , the current control circuit 446 sends the control signal s 1 a at a high level to the gate of the fet 444 a and a control signal s 1 b at a low level to the gate of the fet 444 b . in response to the sent control signal s 1 , the fet 444 a is off , and the ac - dc converter 141 does not send a direct - current voltage to the auxiliary power supplying section 427 a . in response to the sent control signal s 1 , the fet 444 b is on , and the ac - dc converter 141 sends a direct - current voltage to the auxiliary power supplying section 427 b . hence , the voltage output from the ac - dc converter 141 is sent to the dc - dc converter 142 and auxiliary power supplying section 427 b . similarly , in the case where detection signals s 2 a and s 2 b at a high level are sent from the auxiliary power supplying sections 427 a and 427 b to the current control circuit 446 , the voltage output from the ac - dc converter 141 is sent only to the dc - dc converter 142 . according to this embodiment , the electric power supplier 440 can stably supply each fundamental section inside the information processing unit 420 with electricity , when the ac - dc converter 141 is over loaded . in addition , the electric power supplier 440 can continuously send electricity to any one of the auxiliary power supplying sections which is not fully charged with electricity . various embodiments and changes may be made thereonto without departing from the broad spirit and scope of the invention . in the above explanations , the current control circuit 146 generates a control signal s 1 , in accordance with whether the value of the voltage across the fuse 143 is higher or lower than the threshold value . the present invention is not limited to this method . for example , the current control circuit 146 may generate the control signal s 1 , in accordance with the difference , between the detected voltage and the threshold value , and an integrated result of the difference , and a differentiated result of the difference , under the control of a pid ( proportional integration and differential ) control program stored therein . in the above - described embodiments , the explanations have been made to the battery circuit inside the electric power supplier or the auxiliary power supplying section inside the information processing unit , as one electrically disconnectable from the ac - dc converter 141 . however , such a circuit which can be electrically disconnected from the ac - dc converter 141 is not limited to the above . any circuit , other than the main circuit , such as the cpu or memory of the information processing device , etc ., may electrically be disconnected from the ac - dc converter 141 . for example , the personal computer may have the structure , wherein the backlight of the lcd ( liquid crystal display ) is electrically disconnected from the ac - dc converter . in this case , at the time a current whose current value exceeds the rated current value of the ac - dc converter 141 flows through the fuse 143 inside the electric power supplier , the electricity is temporarily suspended to be sent thereto . in the above - described embodiments , the current control circuit of the electric power supplier has determined whether the ac - dc converter is over loaded , based on the voltage across the fuse , or the coil forming the noise filter . however , the component element for detecting the current output from the ac - dc converter is not limited to the fuse or coil . for example , the element component for detecting the current output from the ac - dc converter may be a current transformer . in this case , the primary coil of the current transformer is formed in the voltage supply line for connecting the ac - dc converter and the dc - dc converter . the current control circuit is connected to the secondary coil of the current transformer , and detects whether the current flowing through the primary coil is an overcurrent . in the above - described embodiments , the switching element 144 has been described as the p - channel type mosfet . however , the switching element 144 may be a pnp - type bipolar transistor or any other device . in the case where the value of the amplified voltage is higher than a predetermined value , the current control circuit 146 has been described as one generating a control signal s 1 at a high level . however , when the value of the amplified voltage is higher than a predetermined value , the current control circuit 146 may generate a control signal s 1 at a low level , and when the value of the amplified voltage is lower than the predetermined value , the current control circuit 146 may generate a control signal s 1 at a low level . in this case , the switching device 144 is formed of an n - channel type mosfet , for example . the battery 145 has been explained as one usually generating a detection signal at a low level , and generating a detection signal at a high level when the secondary battery reaches a predetermined charged - electricity level . however , when the battery generates a detection signal at a high level and when the secondary battery reaches a predetermined charged - electricity level , the battery may generate a detection signal at a low level . in the above - described embodiments , the electric power supplier has been explained as one installed in a personal computer . however , the electric power supplier may be installed in a portable information terminal , a information processing device , or the like . further , the electric power supplier is not limited to one installed in the target electric device , and thus can externally be prepared on the electric device . the above - described embodiments are intended to illustrate the present invention , not to limit the scope of the present invention . the scope of the present invention is shown by the attached claims rather than the embodiments . various modifications made within the meaning of an equivalent of the claims of the invention and within the claims are to be regarded to be in the scope of the present invention . this application is based on japanese patent application no . 2000 - 141225 filed on may 15 , 2000 , and including specification , claims , drawings and summary . the disclosure of the above japanese patent application is incorporated herein by reference in its entirety . | 8 |
fig1 is an exploded view of part of a door latch and striker combination showing only those components thereof which relate to an understanding of the present invention , but which does not include other springs , gears , cams , levers , pivots and other linkages which are common to such latches and are well known to those skilled in the art . more specifically , fig1 shows a latch 2 having a plastic housing 4 secured to a metal frame member 6 . the housing 4 houses a fork - bolt type latch - bolt 8 adapted to rotate about an outboard end 10 of a bushing 12 which seats in an aperture 14 in the housing 4 . the housing 4 also houses a detent 16 which pivots about the outboard end 18 of bushing 20 fitted into opening 22 in housing 4 . the detent 16 includes a shoulder 24 which is engageable with a shoulder 26 on the inboard leg of the latch - bolt 8 throat 28 to locate the latch - bolt in a fully latched position . clockwise rotation of the detent 16 permits clockwise rotation of the latch - bolt 8 to permit unlatching of the latch 2 . the plastic housing 4 includes an opening 30 which receives an insert 32 having a surface 34 thereon . when the insert 32 is positioned in the opening 30 , the upper surface 34 on the insert 32 and undersurface 36 of the opening 30 define a generally bell - shaped mouth adapted to receive a complementary - shaped crossbar 38 which is riveted onto the distal ends of the trailing leg 40 and leading leg 42 of a striker 44 , which will be described in more detail hereinafter . the frame 6 also includes a bell - shaped opening 46 which receives the leading leg 42 and trailing leg 40 of the striker 44 when the wedge - shaped crossbar 38 is positioned in the opening 30 in the housing 4 , thus permitting the throat 28 of the latch - bolt 8 to engage the leading leg 42 ( i . e ., when latched ) to secure the door firmly to the surrounding doorframe . fig2 depicts a loop - type striker 48 comprising a base 50 having holes 52 and 54 therethrough for mounting the base 50 to a vehicle doorframe ( not shown ). the base 50 includes a mesa 56 which in turn supports a first leg 58 ( hereafter &# 34 ; leading &# 34 ; leg ) and a second leg 60 ( hereafter &# 34 ; trailing &# 34 ; leg ). the leading leg 58 has a first end 62 mounted to the top 64 of the mesa 56 and a distal end 66 remote from the first end 62 . similarly , the trailing leg 60 has a first end 68 adjacent the top 64 of the mesa 56 and a distal end 70 remote from the first end 68 . a crossbar 72 is riveted to the distal ends 66 and 70 of the leading and trailing legs 58 and 60 respectively heading over the distal ends 66 and 70 to provide a leading head 71 and trailing head 73 which hold the crossbar 72 to the legs 58 and 60 . a shoulder 74 stands above the trailing head 73 to prevent sheet metal 76 ( in phantom ) from the door ( moving from left - to - right in the figure ) from catching or hanging up on the outboard face 78 of the trailing head 73 . in accordance with the present invention , a ramp 80 is formed ( preferably stamped ) in the gap 82 between the heads 71 and 73 such that the elevated end 84 of the ramp 80 is adjacent the leading head 71 . as the sheet metal 76 moves from left - to - right , passed the trailing head 73 , it engages the ramp 80 and is cammed up and over the leading head 71 so as to prevent it from catching on the inboard face 86 of the leading head . alternatively rather than being stamped , a ramp in the form of a discrete insert could be secured to , or insert molded to ( i . e ., in the case of a plastic ramp ), the crossbar 72 . while the invention has been disclosed primarily in terms of certain specific embodiments thereof it is not intended to be limited thereto but rather only to the extent set forth hereafter in the claims which follows . | 8 |
an ebpvd apparatus 10 in accordance with this invention is schematically depicted in fig1 in which various components and features of the apparatus 10 are represented . the apparatus 10 is particularly intended for depositing a ceramic tbc on a superalloy component intended for operation within a thermally hostile environment . notable examples of such components include the high and low pressure turbine nozzles and blades , shrouds , combustor parts and augmentor hardware of gas turbine engines . while the advantages of this invention will be described with reference to depositing a tbc on such components , the teachings of this invention can be generally applied to a variety of coating materials and components . [ 0018 ] fig1 represents a coating process in which a ceramic coating is being deposited on one or more turbine blades 20 . turbine blades and other gas turbine engine components are typically formed of nickel - base or cobalt - base superalloys . prior to coating with the apparatus 10 , the surfaces of the components 20 are typically provided with an aluminum - containing bond coat , as known in the art . also prior to depositing the tbc , the surface of the bond coat can be grit blasted to clean its surface and produce an optimum surface finish required for depositing columnar ebpvd ceramic coatings . an alumina scale is then formed on the bond coat at an elevated temperature to promote adhesion of the tbc . the alumina scale , often referred to as a thermally grown oxide , or tgo , develops from oxidation of the aluminum - containing bond coat either through exposure to an elevated temperature prior to or during deposition of the ceramic coating , or byway of a high temperature treatment specifically performed for this purpose . while various materials could be used as the coating material , a preferred material for tbc on gas turbine engine components is zirconia ( zro 2 ) partially or fully stabilized by yttria ( e . g ., 3 %- 20 %, preferably 4 %- 8 % y 2 o 3 ), though yttria stabilized with magnesia , ceria , calcia , scandia or other oxides could be used . the coating operation within the apparatus 10 continues until the desired thickness for the coatings is obtained . for purposes of illustrating the invention , the ebpvd apparatus 10 is shown as including a preheat chamber 12 and a coating chamber 14 . however , the apparatus 10 could have any number of coating and preheat chambers , and will typically include one or more loading chambers through which the components 20 are initially loaded before being introduced into the preheat and coating chambers 12 and 14 . as known in the art , a loading chamber would be aligned with the preheat chamber 12 , and the components 20 loaded on a rake 18 that transfers the components 20 into the preheat chamber 12 and then the coating chamber 14 . with additional loading and preheat chambers , multiple loading and preheating stages can occur simultaneously while components 20 are being coated within the coating chamber 14 . according to a preferred aspect of this invention , multiple loading and preheat chambers are provided in accordance with commonly - assigned u . s . patent application ser . no . 09 / 624 , 809 to bruce et al ., whose disclosure is incorporated herein by reference . as is conventional , the preheat and coating chambers 12 and 14 are maintained at a subatmospheric pressure , preferable at a vacuum level of about up to 20 mbar in accordance with commonly - assigned u . s . patent application ser . no . 09 / 621 , 422 to rigney et al . a pumping system 16 , which may include mechanical , cryogenic and / or diffusion pumps of types known in the art , is employed to evacuate the preheat and coating chambers 12 and 14 ( and the loading chamber ). the desired deposition pressure is obtained by evacuating the preheat and coating chambers 12 and 14 , and then introducing an inert gas ( such as argon ) and , optionally , oxygen into the chambers 12 and 14 until the targeted process pressure is obtained . the preheat chamber 12 is shown as being equipped with a preheating element 22 that serves to heat the components 20 before being transferred into the coating chamber 14 , where coating is performed . the components 20 are preferably preheated to a temperature of higher than 1000 ° c ., such as about 1100 ° c ., which allows for cooling of the components 20 from the time they leave the preheat chamber 12 until the deposition process starts in the coating chamber 14 . coating deposition occurs by melting and evaporating an ingot 24 of the desired ceramic material with an electron beam 32 produced by an electron beam ( eb ) gun 30 . the eb gun 30 is represented as being equipped with a deflection device 34 to appropriately deflect and focus the beam 32 of electrons on the upper surface of the ingot 24 . the deflection device 34 can be of any suitable type , such as an electrostatic or electromagnet device . intense heating of the ceramic material by the electron beam 28 causes the surface of the ingot 24 to melt , forming a molten ceramic pool 36 from which molecules of the ceramic material evaporate , travel upwardly , and then deposit on the surfaces of the components 20 , producing the desired ceramic coating whose thickness will depend on the duration of the coating process . as indicated in fig1 the rake 18 can be rotated to promote the uniformity of the coatings deposited on the components 20 . while a single ingot 24 , gun 30 and beam 32 are shown in fig1 it is within the scope of this invention that the ebpvd apparatus 10 could be equipped with multiple ingots and eb guns , and that all ingots could be evaporated simultaneously or in any groupings at any given time . during a given coating campaign , multiple coating operations are performed with different sets of components 20 , with the coating operations being performed one after the other without interrupting the operation of the eb gun 30 . as a result , the molten pool 36 of ceramic material is continuously maintained during the successive coating operations , and as a result the temperatures of the ingot 24 and the coating chamber 14 continuously rise throughout the successive coating operations of the campaign . in the past , component surface temperatures during the first coating operation of a coating campaign would be near the lower limit identified for acceptable coatings , e . g ., about 925 ° c . for ysz , and the campaign would be terminated following a later coating operation in which surface temperatures are near some preestablished upper limit , e . g ., about 1125 ° c . for ysz on superalloy components . in contrast to previous practices , the ebpvd apparatus 10 is shown in fig1 to include several features that , alone or in any combination , can be used to maintain a relatively low temperature within the coating chamber 14 , and therefore lower and more consistent component surface temperatures during the deposition process . according to a particularly preferred aspect of the invention , the surface temperatures of components 20 coated during a coating campaign is maintained at a temperature of not higher than about 1000 ° c . in an investigation leading up to the present invention , nickel - base superalloy components were coated with 7 % ysz by ebpvd in which six process parameters were varied to determine their effect on the thermal conductivity of the deposited coatings : component surface temperature , chamber pressure , rotation of the components , gas flow , gas composition and deposition evaporation ) rate . of these , surface temperature was found to have a significant effect on coating conductivity . for example , the coefficients of thermal conductivity of 7 % ysz deposited on components with surface temperatures of about 1000 ° c . averaged about 1 . 45 w / m • k , which was about 20 % lower than the coefficient of about 1 . 80 w / m • k measured for identical coatings deposited under identical conditions but on components whose surface temperatures were about 1100 ° c . surprisingly , the reduced thermal conductivities exhibited by these coatings persist even after being subjected to temperatures sustained by components in the hot gas path of a gas turbine engine . in the investigation , after a thermal treatment of about two hours at about 1200 ° c ., the thermal conductivities of those components coated at about 1000 ° c . increased to an average thermal conductivity of about 1 . 68 w / m • k , or an increase of about 16 %. under the same treatment , those components coated at about 1100 ° c . increased to an average thermal conductivity of about 2 . 05 w / m • k , or an increase of about 13 %. from this investigation , it was concluded that surface temperatures below 1100 ° c ., and more preferably at or below 1000 ° c ., was preferred when depositing ysz as a thermal barrier coating . one technique for maintaining acceptable low component surface temperatures is to equip the coating chamber 14 with a heating element 40 positioned above the components 20 . the heating element 40 can be of any suitable type , such as an externally - powered radiant heating device or a reflector plate that radiates heat emitted by the molten pool 36 of the ingot 24 back toward the components 20 . according to this aspect of the invention , the heating element 40 is operated to have a decreasing heating effect on the components 20 as successive coating operations of a campaign are performed , during which time the temperature within the coating chamber 14 continuously rises as a result of heating of the interior of the chamber 14 by the electron beam 32 , the molten pool 36 of coating material , etc . if in the form of an externally powered device , the element 40 can be operated at a relatively high level at the beginning of a campaign , during which the temperature of the coating chamber 14 is relatively low , after which the heat output of the element 40 is gradually reduced during the course of the campaign . alternatively or in addition , the heating element 40 can be positioned relatively close to the components 20 with an actuator 26 to maximize heating of the components 20 at the beginning of a campaign , and then moved away from the components 20 as the temperature within the coating chamber 14 rises during the campaign to reduce heat transfer from the element 40 to the components 20 . the latter technique is also effective if the heating element 40 is in the form of a simple reflector plate . alternatively or in addition , if a reflector plate is used , a coolant can be caused to flow through the heating element 40 as the temperature within the coating chamber 14 rises during the campaign to reduce the temperature of the heating element 40 and therefore reduce the amount of heat radiated from the element 40 to the components 20 . in each case , the components 20 can be readily brought to an acceptable minimum deposition temperature at the start of a campaign , while attainment of the maximum allowed temperature of 1000 ° c . is delayed to maximize the length of the coating campaign . another feature for achieving a more consistent component surface temperature of not higher than about 1000 ° c . during the deposition process is through the placement of reflectors 42 near the crucible 38 . the reflectors 42 are depicted as being plates that can be coated with a ceramic or other suitable reflective material , though the reflectors 42 could be a ceramic or ceramic - coated granular material , or for convenience , pieces of an ingot of the same material as the ingot 24 . due to their proximity to the crucible 38 , the reflectors 42 are at a very high temperature during the coating process , and therefore radiate heat upward toward the components 20 . the reflectors 42 are shown as being supported on plates 44 that are preferably fluid - cooled so as not to appreciably radiate heat to the components 20 . the temperature of the reflectors 42 , and therefore the amount of heat radiated by the reflectors 42 , are inherently at a maximum toward the end of a coating campaign . according to the invention , the temperatures of the reflectors 42 can be minimized toward the end of the campaign by increasing the flow rate of coolant through the plates 44 , thereby absorbing heat at a greater rate from the reflectors 42 during a coating operation at the end of the campaign as compared to the rate of heat absorption during a subsequent coating operation at the beginning of the campaign . alternatively or in addition , the reflectors 42 can be positioned closer to the components 20 during the first coating operation of a campaign , and then removed from the coating chamber 14 or repositioned farther from the components 20 later during the campaign to reduce the amount of radiant heating of the components 20 attributable to the reflectors 42 . the reflectors 42 can be used alone or in conjunction with the heating element 40 to regulate the temperature of components 20 being coated within the coating chamber 14 during an ongoing campaign . another technique by which the surface temperatures of components can be maintained within the desired temperature range during a coating campaign is through the operation of the eb gun 30 . for example , the eb gun 30 can be operated at a higher power level during the first coating operation of a campaign , and subsequently at successively lower power levels as required during the campaign to reduce heating of the components 20 attributable to the eb gun 30 and the molten pool 36 of ceramic material maintained by the electron beam 32 . alternatively or in addition , the eb gun 30 can be operated to project the electron beam 32 over a larger surface area of the ingot 24 ( molten pool 36 ) at the beginning of a coating campaign and successively smaller surface areas during the course of the campaign . if the reflectors 42 are formed of a material with a sufficiently high melting temperature , the electron beam 32 or a separate beam ( not shown ) could be projected onto the reflectors 42 to further promote radiant heating by the reflectors 42 at the beginning of a campaign . the operation of the eb gun 30 can be used alone or in conjunction with one or more of the other techniques . in view of the above , the present invention provides several techniques that can be used alone or in combination so that the combined heat transfer from the coating chamber 14 ( i . e ., surfaces of the chamber 14 ) and the ingot ( i . e ., the molten pool 36 ) to the components 20 occurs at a higher heat transfer rate during the first coating operation of a coating campaign than during later coating operations of the same coating campaign , with the intent that the surface temperatures of the components 20 processed during the campaign are not higher than about 1000 ° c . while the ceramic coating ( tbc ) is deposited on the components 20 . according to a preferred aspect of the invention , the result is a tbc with a reduced and more stable coefficient of thermal conductivity . while the invention has been described in terms of a preferred embodiment , it is apparent that other forms could be adopted by one skilled in the art . accordingly , the scope of the invention is to be limited only by the following claims . | 2 |
[ 0024 ] fig1 , and 3 illustrate a preferred optical fiber winding system 10 in accordance with the present invention , wherein optical fiber 8 is drawn directly from an optical fiber preform or draw blank in an optical fiber draw process . as illustrated in fig1 the major components of the system include a screening section 12 , where the fiber is proof tested , and a winding section 14 , where the fiber is wound onto a fiber storage spool 15 . the fiber is mechanically stressed a desired amount ( i . e ., proof tested ) while traveling through screener section 12 which is illustrated in fig1 and 2 . the fiber is then wrapped directly onto spool 15 in fiber winder section 14 , illustrated in fig1 and 3 . spool 15 preferably is a shipping spool which is either to be shipped directly to a customer , which may be a purchaser of optical fiber and / or a cable manufacturing plant to be cabled directly without having to be respooled onto another fiber storage spool . in this way , from the time the fiber is first drawn into an optical fiber until the fiber is cabled into an optical fiber cable , the fiber may be stored on a single storage spool , without having to endure transfer to successive storage spools , between the time at which the fiber is manufactured and the time the fiber is shipped to a customer , to enable various testing procedures . a preferred optical fiber storage spool which may be used in accordance with the invention is illustrated in fig6 a and 6b , which show , respectively , side and bottom views of preferred shipping spool 15 . as shown in fig6 the spool 15 includes a primary barrel portion 60 , and lead meter barrel portion 62 , and an angled slot 64 through which fiber can be fed during the winding process from the lead meter portion 64 to the primary barrel portion 62 , or vice versa depending on desired winding techniques . such spools are described further , for example , in u . s . patent ser . no . 09 / 438 , 112 , filed nov . 10 , 1999 , titled system and method for providing under - wrap access to optical fiber wound onto spools , which claims the benefit of u . s . provisional application no . 60 / 114 , 516 , filed dec . 30 , 1998 , and no . 60 / 115 , 540 , filed jan . 12 , 1999 , the specification of which is hereby incorporated by reference . in a preferred embodiment of the invention , the fiber is fed onto spool 15 beginning at lead meter barrel portion 62 . when a desired amount of fiber has been stored on the lead meter portion 62 , the fiber is then fed through the slot and onto primary barrel portion 60 , and a desired amount of fiber is then wound onto primary barrel portion 60 . once the spool is full and / or a desired amount of fiber is contained within the primary barrel portion 60 , the fiber is cut , e . g . between the fiber winding system and the fiber screening system and rotating turret 40 indexes 180 degrees to provide another empty storage spool 15 onto which fiber can again be wound . the previously filled spool is then removed , and an empty spool loaded in its place , and so forth , so that when the newly provided empty spool is filled , the next spool will ready , and so forth . one reason shipping spool 15 is preferred is that fiber may be stored on spool 15 in a manner which enables access to both ends of the fiber . because the spool enables access to both ends of the fiber , optical and other testing can be conducted on the fiber which is stored on spool 15 after the fiber draw and winding process , without having to remove the entire length of fiber from the spool or rethread the fiber onto a different spool . the system also includes aspirator 16 , illustrated in fig1 and 2 , which is used to remove scrap fiber from the process as well as to facilitate automated threading of the fiber onto the various components of the system at the beginning of the draw operation or after a fiber break , of after the fiber is intentionally cut , as will be further described below . as can be seen in fig1 and 2 , aspirator 16 consists basically of a cylindrical tube such as a vacuum hose , and is movably attached to vertical support member 17 along which the aspirator can be moved in an upward or downward path . such aspirators can , for example , use compressed air to provide the sucking force needed to suck fiber into aspirator 16 . preferably the compressed air has a velocity which is high enough to provide sufficient tension to capture and control movement of the fiber throughout the winding system as it is being rethreaded , as well as to convey away any scrap fiber . vertical support member 17 is in turn movably mounted on transverse support member 18 , which in turn is movably mounted on main aspirator support frame 19 . in this way the aspirator can be moved in 3 dimensions , e . g ., the aspirator can be moved closer to or further away from screener section 12 by the sliding of transverse support member 18 along the main support frame 19 . the aspirator 16 can also be moved transverse to the main support frame ( toward or away from the back of the machine system , i . e ., parallel to the axis of the indexing spool winding 40 ) by sliding of the vertical suport member 17 along transverse support member 18 . operation of the fiber winding system in accordance with the present invention is preferably controlled via a computer control system , which may be programmed to respond to various inputs , which may be either automatically sent from the winding system or manually inputted by a machine operator . during the fiber draw operation , an optical fiber draw blank ( also known as an optical fiber preform ) is mounted in a draw furnace ( not shown ), and the temperature in the furnace is raised to a temperature suitable for drawing optical fiber from the preform . as can be seen in fig2 screener section 12 includes a pair of capstan assemblies 20 and 24 , each of which consist of a large capstan wheel and a belt which is in engagement with a portion of the circumference of the large capstan wheel . the belt is also supported by three smaller wheels , which are positioned so that the belt is held firmly against the larger capstan wheels . as used generally herein , capstan refers to such capstan assemblies as are illustrated in fig2 although alternative capstan assemblies could also be employed without detracting from the spirit of the invention . optical fiber 8 is pulled from the drawblank during the fiber draw operation by belted capstan 20 , also known as and referred to herein as the tractor capstan , illustrated in fig2 . the speed of belted capstan 20 can be controlled by suitable control means to achieve a desired speed for drawing the fiber . as shown in fig2 in the embodiment illustrated , the fiber exits tractor capstan 20 and wraps 180 degrees around turnaround pulley 22 . turnaround pulley 22 has a recessed groove around its periphery within which the fiber 8 is retained . turnaround pulley 22 is connected to a load cell which monitors the amount of tension applied onto the turnaround pulley by the passing fiber , and thus monitors the amount of tension being imparted to the fiber . from turnaround pulley 22 , the fiber enters belted screener capstan 24 . in the embodiment illustrated the screener capstan 24 is electronically “ slaved ” to tractor capstan 20 so that at all times it rotates slightly faster than tractor capstan 20 . the speed differential between screener capstan 24 and tractor capstan 20 is maintained at a magnitude , which causes a desired amount of strain within the fiber . the strain imparted to the fiber is directly proportional to the tensile stress in the fiber . any tension present in the fiber prior to entering the tractor capstan 20 is added to the tension caused by the differential speed of the two capstans 20 and 24 . depending on the speed at which the fiber is being drawn , the incoming tension during a normal blank run can vary by as much as 30 kpsi . consequently , in a preferred embodiment , feedback from the load cell of the turnaround pulley 22 is used to adjust the differential speed of the screening capstan 24 so that a sufficient screening tension is maintained consistently throughout drawing of the entire optical fiber blank into optical fiber . during the fiber draw process , fiber exits screener capstan 24 in screening section 12 and proceeds to winding section 14 , which is illustrated in fig3 . in the embodiment illustrated , the fiber leaves screening capstan 24 in fig2 at an angle which is approximately 30 degrees to the manufacturing plant floor , and proceeds to the winding section 14 illustrated in fig3 . at winding section 14 , the fiber 8 is wound through four process pulleys 30 a - 30 d before being wound onto fiber storage spool 15 . in the embodiment illustrated , the first three process pulleys 30 a - 30 c are disposed substantially within the same plane as the incoming fiber , in this case 30 degrees relative to the plant floor . the fiber wraps 90 degrees around the first pulley 30 a and then 180 degrees around second pulley 30 b , which is a dancer pulley . dancer pulley 30 b is attached to a pivot arm 32 . such dancer pulley mechanisms are described further , for example , in u . s . patent application ser . no . 09 / 390 , 866 , filed september 7 , titled passive tension regulator , the specification of which is hereby incorporated by reference . from dancer pulley 30 b , the fiber wraps 90 degrees around third pulley 30 c and then around fourth pulley 30 d , whose axis of rotation is perpendicular to that of the first three pulleys 30 a - 30 c . the fiber wraps approximately 45 degrees around the fourth pulley 30 d and then continues to the take up spool 15 . pulley 30 d is oriented to redirect and guide fiber 8 onto take up spool 15 . the third and fourth pulleys 30 c and 30 d are both mounted on traversing carriage 34 which traverse back and forth parallel to the axis of the take up spool 15 during the fiber winding operation to result in uniform winding of the fiber onto spool 15 . carriage 34 moves back and forth along a support bar ( not shown ), reciprocating parallel to the axis of spool 15 . the movement of carriage 34 is preferably controlled via computer . during the winding of the fiber onto spool 15 , a constant torque is applied to the dancer pivot arm 32 in a direction which is opposite , or away from , first pulley 30 a . such a torque may be provide , for example , via a hydraulic air cylinder attached to dancer pivot arm 32 . the torque applied to dancer pivot arm 32 and the speed with which the spool is rotated are controlled so as to wind the fiber onto the spool with a uniform winding tension applied to the fiber . the angular position of dancer arm 32 is monitored and employed in conjunction with a control computer to control the rotating take up speed of the spool 15 . a sensor senses the angular position of the second pulley 30 b . in a preferred embodiment , the sensor is an rvdt . the position of the second or dancer pulley 30 b is used to determine the difference between the speed at which the optical fiber is being supplied from screener section 12 and the speed at which the optical fiber is being wound on a spool . the speed at which the spool 15 is rotating can then be adjusted according to the speed of the optical fiber being supplied from screener section 12 , so that the fiber is wound under the spool 15 with a uniform amount of tension . the vertical position of the second pulley 30 b is also used to detect a break in the optical fiber , as the load cell attached to the second pulley 30 b will register zero load when the optical fiber breaks . as illustrated in fig1 winder section 14 includes two independent spindles which each retain a take up spool 15 . the spindles are mounted 180 degrees apart on an indexing turret 40 . winding of fiber only occurs to the spindle that is in the upper position . the lower position is used to hold an empty spool that is ready in the event of a fiber break . the breaks that occur during a fiber draw operation can be broken down into two basic categories , pre - screener breaks , which are breaks that occur in the fiber before the fiber has reached the screener capstan 24 , and post - screener breaks , which are breaks that occur in the fiber after the fiber has passed the screener capstan 24 . by monitoring the load cells attached to turnaround pulley 20 and the position of dancer arm 32 , the control computer can control operation of the winding system and react to breaks which occur at various points in the winding operation . for example , when a pre - screener break occurs , the load cell on turnaround pulley 22 will almost immediately register zero load . consequently , when the computer senses that the load at turnaround pulley is zero , the computer initiates a control sequence for rethreading of the fiber through the screener capstan as well as the remainder of the winding system . in a preferred embodiment of the invention , several simultaneous fiber threading actions occur at the screening section and at the winding section of the machine when a pre - screener break is detected . the actions at the screener section will be described first , followed by the winder section description . in normal operational mode , while fiber is being drawn and wound onto spool 15 , the nozzle of aspirator 16 is positioned adjacent the fiber path as it exits tractor capstan 20 traveling toward winder section 14 . when a fiber break occurs between the tractor and screener capstan , the fiber down stream of the break is pulled through the four remaining process pulleys downstream and onto the take up spool . the computer immediately detects the fiber break via the turnaround pulley load cell , registering zero load . with nothing to guide it , fiber exiting the tractor capstan is pushed out from the capstan in a straight line . aspirator 16 may be positioned such that the fiber streaming from the tractor capstan will be sucked into the nozzle of the aspirator 16 , as illustrated in fig4 a . alternatively , aspirator 16 can be positioned at a location which is remote from the path of the fiber , and after a fiber break occurs , the aspirator can be moved into a position in which it collects the fiber . high pressure air is supplied to the aspirator 16 from an electronically controlled proportional air valve , and the pressure to aspirator 16 creates a vacuum at the aspirator nozzle , and the vacuum pulls the fiber into the aspirator 16 . the fiber exits the aspirator into a fiber collection can . the amount of time between a prescreener break and acquisition of the fiber by the aspirator is only a fraction of a second due to the fact that the aspirator is positioned nearly in line with the path of the fiber during normal winding operation . of course , the aspirator could be positioned further away from the path of the incoming fiber and the aspirator vacuum increased until such time as the fiber is captured by the aspirator . consequently , almost immediately after a prescreener break occurs , the fiber is being sucked into aspirator 16 . the aspirator is then moved in accordance with the invention to facilitate rethreading of the fiber through the screener capstan . as illustrated in fig1 the aspirator is movable along three motorized linear axes 17 , 18 and 19 ( and thereby is movable in three dimensions ) to facilitate threading of the entire machine . the screener capstan rethreading sequence is illustrated with reference to fig1 and 4a - 4 e . it should be noted that fig4 a - 4 e are only schematic , and actual relative dimensions have been altered to facilitate illustrations of the invention . once fiber 8 is acquired by aspirator 16 , a rethreading sequence is initiated to rethread the turnaround pulley 22 and the screener capstan 24 . to accomplish this , the aspirator may be positioned or moved to be positioned essentially in line with fiber exiting the tractor capstan , as illustrated in fig4 a , so that the aspirator begins to collect the fiber exiting the capstan 24 . the aspirator is then moved along transverse support member 18 to guide the fiber onto the groove of turnaround pulley 22 and wrap the fiber around 90 degrees of turnaround pulley 22 , as illustrated in fig4 b . threading of the final 90 degrees of turnaround pulley 22 and the screener capstan is preferably done using a guide finger system 44 , as shown in fig2 . guide finger system 44 consists of at least one , and preferably a pair of guide fingers 45 a and 45 b . these finger - like guide fingers do not grasp the fiber , but rather enable the fiber to slide around their outer periphery and into the aspirator , where it is continuously discarded . this process facilitates rethreading of the fiber while the fiber continues to be drawn during the fiber draw operation . the guide fingers may be for example , a pair of cylindrical metal tubes which may or may not be rotatable around their axis to facility transport of the fiber over the surface of the guide fingers . the guide fingers are moved up and down via z - axis support bars 46 and back and forward ( left and right ) along x - axis support member 47 , by pneumatic slides . the second guide finger 45 b also has a pneumatic slide 48 that allows motion in and out ( y axis ). the guide fingers 45 a and 45 b are in the z - up , x - forward ( toward the winder section ), and y - in position , as illustrated in fig2 prior to the initiation of the rethreading sequence . once the aspirator has threaded 90 degrees of turnaround pulley 22 , the guide fingers are moved to the z down position so that both guide fingers are behind the line of fiber going into the aspirator from the turnaround pulley , as illustrated in fig4 b . the guide fingers 45 a and 45 b are then moved toward the x - back ( away from the winder section ) position so that threading of the screener capstan can take place . as the guide fingers 45 a and 45 b are moved in this manner , guide finger 45 a engages fiber 8 and moves it toward screener capstan 24 . at the same time , guide fingers 45 a and 45 b are moving to rethread the screener capstan 24 , aspirator 16 begins moving toward the winder section 14 to begin rethreading of winder section 14 , as illustrated in fig4 c . this action allows for faster rethreading of the entire system as two portions of the machine , the screener section 12 and the winder section 14 , are being threaded simultaneously . guide fingers 45 a and 45 b continue until first guide finger 45 a is adjacent screener capstan 24 , at which point the fiber path is almost 180 degrees around turnaround pulley 22 , 180 degrees around first guide finger 45 a , and into the aspirator which is still moving to a position behind the fiber take up spool 15 as illustrated in fig4 d . at this point , the second guide finger 45 b moves to the y - out position i . e ., toward screener capstan 24 , as illustrated in fig4 e . guide finger 45 b urges the fiber into the area of the screener capstan where the belt and the capstan meet . the screener capstan may also be provided with one or more nubs or snagger hooks that are positioned on the outer diameter of the capstan . as the capstan rotates , the nubs can help urge the fiber into the area where the belt and capstan meet . once the fiber is captured between the belt and capstan , the fiber is carried around the capstan , below and out of engagement with the first guide finger 45 a as it is carried around the screener capstan . at this point guide finger 45 b retracts , and the threading of screener section 12 is complete , with the fiber traveling around turnaround pulley 22 and screener capstan 24 . the result is that the turnaround pulley 22 and screener capstan 24 are threaded without breaking the line of fiber , which is traveling into the aspirator . guide fingers 45 a and 45 b are then returned to the y - in , z - up , and x - forward positions . threading of the winder section 14 preferably takes place simultaneous with the threading of the screener section 12 . thus , referring to fig3 when a pre - screener break is detected by the turnaround pulley 22 load cell , the first actions of winder section 14 occur simultaneously to facilitate threading of the winding section by the aspirator . in fig3 a pair of rotatable fiber storage spools 15 are mounted 180 degrees apart on turret 40 . in the embodiment illustrated , only one of the spools 15 is visible , and is collecting fiber being supplied via the fiber draw process . the other fiber storage spool 15 is positioned 180 degrees , or directly underneath the spool 15 which is visible . the other spool 15 is empty and ready to be moved into position to receive fiber from the fiber draw process . also visible in fig3 is dancer platform 56 , upon which dancer pulley 32 is mounted . dancer platform 56 is movable along a transverse slide ( not shown ), from the closed position illustrated , in which dancer pulley 32 is engaging fiber 8 and forcing fiber 8 to take a serpentine path , to an open position , in which dancer pulley 32 is moved and positioned on the other side of the path of fiber 8 . in fig3 dancer pulley 32 is shown in the closed position . likewise , pulley 30 c is mounted on a traverse ( not shown ), which is capable of moving pulley 30 c into and out of engaging position with the path of fiber 8 . as mentioned above , while the guide fingers 45 a and 45 b are moving the fiber 8 toward screener capstan 24 to thread the screener 24 , aspirator 16 and thus fiber 8 are simultaneously moved toward the winding section 14 . at the same time , three things preferably occur simultaneously : ( 1 ) the winder turret 40 indexes 180 degrees so that a new empty fiber storage spool 15 is in place for winding ; ( 2 ) the new spool 15 begins rotating slightly faster than the linear speed of the incoming fiber ; and ( 3 ) the pulley 30 a , dancer pulley 30 b and pulley 30 c are moved on their respective traverse slides into an open position ( as shown in fig5 a ) to enable threading of the fiber 8 through winder section 14 . for this to occur pulley 30 c is moved along its own pneumatic slide toward a position outboard of the fiber path . the dancer stops 33 come together to hold the dancer arm 32 in a fixed position , and the dancer slide ( not shown ) moves the dancer platform 34 toward the inboard position of the path to be taken by the fiber . pulley 30 a is moved along pneumatic slide 57 to a position outboard of the path to be taken by the fiber . as can be seen in fig3 the winder section was designed so that the aspirator 16 can pass freely above all of the winder components while fiber is being pulled into the aspirator nozzle . the aspirator 16 moves to a position that is above and behind the take up spool 15 . aspirator 15 then moves downward , guiding the fiber 8 onto the fourth process pulley 30 d . the aspirator continues moving down until the line of fiber coming from pulley # 4 is tangent to the barrel of the take up spool . at this point the winding section is as illustrated in fig5 a . when the aspirator has threaded fiber 8 onto the pulley 30 d and the fiber is tangent to the barrel of the spool 15 , pulleys 30 a , 30 b , and 30 c are moved to their normal run position . thus , as illustrated in fig5 b , pulleys 30 a and 30 b move into contact with the fiber . the dancer slide then moves the dancer pulley 30 b toward a position which is outboard of the path of the fiber . this action brings the fiber path to its normal running position illustrated in fig5 b , namely , approximately 90 degrees around pulley 30 a , 180 degrees around pulley 30 b , 90 degrees around pulley 30 c and approximately 15 degrees around pulley 30 d . the dancer stops are moved to their run position and the dancer is forced to the outboard stop . spool 15 is then traversed to bring the fiber into contact with a snagger tooth 58 , which is present on the flange of spool 15 . the fiber is wedged into the snagger and cut , separating the fiber from the aspirator and beginning the winding of the fiber onto spool 15 . the dancer is initially pulled toward the inboard position of the winder due to the over spinning of the take up spool . the speed of the rotation of the take up spool 15 may be controlled by the dancer position and the speed adjusted so that the dancer arm is pulled to a nominal running position . the aspirator then moves back to the staged position , which is proximate to in line with the fiber exiting the tractor capstan . the spool that was taking up fiber before the break is automatically unloaded from the bottom of the winder turret 40 , and a new empty spool is loaded into the spindle . the machine is then ready for the next fiber break event . cases also exist where the fiber is broken somewhere between the screener capstan and the take up spool . the first case may be when the take up spool is full . a second case occurs when the fiber is detected that is out of specification ( e . g . the diameter is too large or too small ). in either of these two cases , an automatic fiber cutter 36 intentionally cuts the fiber . such a mechanical cutting device may be positioned , for example , just before the fiber enters the first process pulley 30 a . a third case of a post screener break occur when something unexpected causes the fiber - to break ( stray fiber , nicked process pulley , etc . . . . ) after the screener capstan 24 . the only difference in the threading sequence between a post screener break and a pre - screener break is that the screener section does not need to be rethreaded . in the case of a post screener break , the fiber is carried out of the screener capstan in a straight line . the aspirator is moved to a position adjacent the screener capstan so that the fiber can be captured by its vacuum . once captured , the machine goes through the winder section threading sequences described above , as if it were a screener break , except that no actions need be performed to thread the screener capstan since it is still threaded . a control system for controlling the winding apparatus 10 to perform the abovementioned threading and winding operations is preferably also provided . the control system preferably includes a programmable logic controller to control the operation of the various sequence of events , monitor all of the sensors ( e . g ., the load cell on turnaround pulley 20 and the load applied by the fiber to dancer 34 ). the logic controller may also be used to control air cylinders which are used to move various components ( e . g . pulleys 30 a - 30 c ) into position , as well as to communicate with a motion control computer . the motion control computer preferably controls and monitors the moving mechanisms such as aspirator 16 , guide fingers 45 a and 45 b . it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit and scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 2 |
an overall system diagram of a first embodiment is shown in fig1 . the system includes a conventional internet web site 101 and an internet browser program 102 operated by a user ( who is not shown in the figure ). it should be understood that when implemented on the internet , the system would generally include many such web sites and many such browsers . the system also includes a central server 104 which includes data bases 104 a and 104 b . finally the diagram shows a web site 105 which includes information of particular interest to the user of browser 102 . note , in an internet implemented system there would be a relatively large number of web sites 105 , each having information for particular users that have particular sets on interest and characteristics . the browser 102 includes a watermark reading plug in program . if a web page or a file is sent to browser 102 which contains a watermark , the watermark is detected and read by the watermark reading program in browser 102 . co - pending application ser . no . 09 / 571 , 422 filed may 15 , 2000 which is incorporated herein by reference describes such a program . the flow diagram in fig2 illustrates the operation of the system . the process starts when browser 102 requests a file from web site 101 . the file can be a text file , an audio file or an image file . the file stored on web site 101 includes collateral data . this data may be in the form of a watermark in an image or audio file or as meta data in any type of file . the simplest situation is if the requested web page contains a watermarked image . it should however be noted that the invention can work with other types of collateral data transferred from server 101 to browser 102 , such as for example , when audio data is transferred . as indicated by blocks 202 and 203 , the file is sent to the browser and the browser extracts the collateral data from the file . if the data is in the form of a watermark in an image file or in audio data , the browser would utilize a plug - in which can read the watermark and extract the collateral data . the details of the watermark reading program per se are known in the art and are not part of the present invention . the collateral data extracted by the watermark reading program includes the url of central server 104 and an identifier of the file or image that contained the watermark . first data base 104 a is interrogated to find information concerning the organization that registered the particular watermark . this is similar to the process described in co - pending application ser . no . 09 / 571 , 422 filed may 15 , 2000 . central server 104 also includes a second data base 104 b which is indexed according to globally unique identifiers ( guids ). these identifiers allow the system to track references that come from a particular browser 102 without obtaining or using the actual name or e - mail address of the user . such globally unique identifiers ( guids ) are in widespread use by firms that provide advertisements on the world wide web . for example see an article in the magazine pc world june 2000 , page 103 to 108 entitled “ privacy 2000 in web we trust ”. the data base 104 b includes information relevant to each guid . the information in data base 104 b is acquired in a conventional manner . the data base 104 a and 104 b also includes a list or data base of alternate sites 105 . the data bases 104 a and 104 b include for each site listed , the characteristics of the users that the site owner would like to reach and the identifiers from watermarks . thus when the collateral data in a particular image causer browser 102 to contact central server 104 , the central server 104 makes two matches . first the identifier in the watermark is matched to registered identifiers to identify which particular image or web page contained the watermark . second , from the guid the server can determine the characteristics of the user . these two sets of information are used to determine the alternative site to which the user is directed . the following is a very simple example which illustrates the operation of the system . assume that the guids identify only three characteristics of users that are designated “ characteristic one ”, “ characteristic two ” and “ characteristic three ”. also assume that the watermarks read by browser 102 have only three different identifiers designated identifier a , identifier b and identifier c . the alternative site 105 to which the user would be directed would be determined by server 104 from the information in data bases 104 a and 104 b as shown by the following table . the point is that server 104 has available two sets of information . the first identifies the image or file from which the collateral data was obtained and the second is the characteristics of the user . these two bits of information can be combined as shown above to select an appropriate site ( above identified as sites s 1 to s 9 ) to which the user should be directed . it is specifically noted that in any practical situation there will be many more identifiers and many more characteristics or more probably combinations of characteristics . furthermore , many different combinations might point to the same web site . as shown above each different combination pints to a different web site s 1 to s 9 . finally as indicated by block 206 in fig2 , data from the selected alternate web site 105 is sent to the browser 102 . the net result of the process is that the user who requests a web page or file from web site 101 will also receive certain collateral data which may be in the form of a watermark in the web page or file . this collateral data results in a request to server 104 which using the guid of browser 102 and information from the watermark , locates an appropriate alternate web site 105 . information from the selected alternate web site 105 is then sent to browser 102 . an alternate embodiment of the invention is shown in fig3 . this alternate embodiment of the invention utilizes some of the components from the media bridge technology commercially available from digimarc corporation , tualatin oreg . with the media bridge technology , one can capture a digital image and read a digital watermark which is included in the image . the digital image can be captured with a commercially available pc camera . in the embodiment shown in fig3 , a pc camera 301 a located in a hand held device 301 captures images , which can , for example , be the front page of magazines 302 a to 302 x . the hand held device includes a watermark reading program 301 b and a data base 301 c that stores data concerning the user &# 39 ; s personal preferences . the hand held device 301 also includes a wireless internet connection which can connect to a web sites 303 . each of the magazine front page images 302 a to 302 x includes a digital watermark which specifies a particular url . the camera 301 a reads the watermarks in the images , 302 a to 302 x , obtains the information from the watermark and contacts one of the web sites 303 a to 303 x . the particular web sites contacted depends upon the information read from the watermarks . each web site includes an expanded index of the information in the associated magazine . this index is sent to handheld device 301 . the hand held device 301 compares the information in the expanded magazine indexes to the information in the data base 301 c and informs the user which particular magazine has articles which match the personal preferences stored in data base 301 c . thus a user can scan a rack of magazine covers with device 301 . device 301 reads the url specified by the watermark on each magazine cover and then obtains an index of the particular magazines from a remote data base . the index is compared to the users personal preferences stored in hand held device 301 and the user is informed as to which magazine matches the stored preferences . it is noted that the designations 302 a to 302 x and 303 a to 303 x is used to illustrate that the number of magazines and the number of associated web sites is an arbitrary number suited to a particular application . the designations are meant to illustrate that there is one web site 303 ( or one web page ) for each magazine cover 302 . it is noted that as new issues of the various magazines appear , the information in web sites 303 a to 303 x change . each magazine therefore has an identifier which directs the system to a particular web site . the web site will have the current information for that magazine . the present embodiment goes to a different web site for each magazine index . it noted that the various magazine indexes could be stored as different web pages on a single web site . in an alternate embodiment , the watermarks on the magazine images includes coded information about the content of the magazines . the hand held device can then compare the magazine content to the stored preferences and indicate a match without accessing a web site . in another alternate embodiment , the content can be stored in the hand held device and periodically synchronized with a remote source . it should be specifically noted that while the foregoing specification focuses on applications employing digital watermarking , the present invention can alternatively employ other data encoding techniques , including 1 d and 2d barcodes , magnetic ink character recognition ( micr ), optical character recognition ( ocr ), optical mark recognition ( omr ), radio frequency identification ( rf / id ), uv / ir identification technologies , data glyphs , organic transistors , magnetic stripe , etc ., depending on the particular application requirements . co - pending application ser . no . 09 / 571 , 422 filed may 15 , 2000 describes a system that reads collateral data and which has a router and registration data base to determine an appropriate url when a particular object is viewed . the content of application ser . no . 09 / 571 , 422 filed may 15 , 2000 is hereby incorporated herein by reference . the present invention can be applied as an extension of the system shown in application ser . no . 09 / 571 , 422 filed may 15 , 2000 . fig4 illustrates another alternate embodiment of the present invention . with the system shown in fig4 , there is equipment 401 at a remote location connected to equipment 402 which is at a central location . a user operates an originating device 412 at the remote location . the originating device 412 includes a pc camera 412 a which can acquire an electronic image of a printed advertisement 429 . the originating device 412 includes a watermark reading program 412 b and an internet browser 412 c . the collateral data read from the electronic image generated by camera 412 a is used to generate a url which directs the browser 412 c to server 414 via the internet 432 . when server 414 receives a request from originating device 412 , it uses the guid information to interrogate a data base 418 which contains information about users . the server 414 also interrogates a registration data base 417 which contains information relevant to the particular collateral data read from the object 429 . these two sets of information are combined as illustrated by the simple example in table 1 above . the sever can therefore respond to a request from originating device 412 by directing the browser 412 c to a web site ( not shown in fig4 ) which is determined by both the collateral data in the object 429 and the user &# 39 ; s characteristics and preferences in data base 418 . the content of data base 418 can be generated in any of the ways known in the art for obtaining information about particular users . it should be noted that as used herein the term “ user characteristics ” means any information about a user &# 39 ; s characteristics , preferences , interests , patterns or habits . furthermore , the term “ user ” in general means the person that operates or utilizes a particular terminal or system . it is noted that in some embodiments , the system has two data bases , one of which has information relative to the user and one of which has information concerning the detected collateral data . while such embodiments have two data bases , it should be understood that these two data bases can be implemented as and considered to be a single data base . thus , as used herein the term data base can be understood to mean a single data base or combination of multiple databases . it should also be noted that the invention may be extended to other forms of media data such as audio and video data . for example , as a user listens to music or watches a video , digital watermarks imperceptibly embedded in the audio or video carry collateral data used to interrogate data bases and retrieve information pertinent to the particular listener or viewer . alternative implementations of the invention use fingerprints of the content , such as a hash of perceptually relevant features of the content , to derive a content identifier from which information particular to the user can be fetched and returned . while digital watermarks embed auxiliary data imperceptibly in the content by subtly modifying it , fingerprints are dynamically derived from the content and do not require embedding of auxiliary data . both digital watermarks and fingerprints can be used in combination to look up related information and to find information particular to the user . while the invention has been shown and described with respect to several different embodiments , it is noted that many other changes in form and detail can be made without departing from the sprit and scope to the invention . | 6 |
the microorganism used for the production of aerocavin and aerocyanidin is aeromonas caviae sc 14 , 030 . a subculture of the microorganism can be obtained from the permanent collection of the american type culture collection , rockville , md . its accession number in the repository is a . t . c . c . no . 53434 . in addition to the specific microorganism described and characterized herein , it should be understood that mutants of the microorganism ( e . g ., mutants produced through the use of x - rays , ultraviolet radiation , nitrogen mustards , etc .) can also be cultivated to produce aerocavin and aerocyanidin . isolation of aeromonas caviae sc 14 , 030 from a water sample ( in this instance obtained in allamuchy mountain state park , new jersey ) in which it is present can be accomplished by plating the sample onto an agar of the following composition : ______________________________________tryptone 10 . 0 gglucose 5 . 0 gbile salts # 3 ( difco laboratories ) 1 . 5 gagar 15 . 0 gdistilled water to 1 , 000 mlcycloheximide ( 1 % aqueous solution )* 10 . 0 ml______________________________________ * filter sterilized and added to the medium that has already been adjusted to ph about 6 . 7 and sterilized by autoclaving at 121 ° c . for 30 minutes . after 48 - 72 hours incubation at about 25 ° c ., the colonies of aeromonas caviae sc 14 , 030 are isolated from the plated sample . the isolated colonies are picked off onto an agar medium composed of : ______________________________________yeast extract 5 . 0 gglucose 5 . 0 gmgso . sub . 4 . 7h . sub . 2 o 0 . 1 gfeso . sub . 4 . 7h . sub . 2 o 0 . 1 gsoil extract filtrate * 200 . 0 mlagar 17 . 5 gtap water 800 . 0 ml______________________________________ * soil extract filtrate is made by bringing to a boil a suspension of soil in tap water ( 1 : 2 , v / v ) and then allowing to simmer for about 60 minutes . after cooling , the extract is filtered through cheesecloth , then centrifuged to remove most of the remaining solids and finally filtered through whatman 4 filter paper . the resulting liquid is sterilized by autoclaving at 121 ° c . for 20 minutes . the medium is sterilized in an autoclave at 121 ° c . for 30 minutes . aeromonas caviae sc 14 , 030 is a gram negative rod , motile by means of monotrichous , polar flagella . lateral to sub - polar flagella are occasionally seen . the organism is cytochrome oxidase positive and metabolizes glucose fermentatively without production of gas . it is resistant to the vibrostat 2 , 4 - diamino - 6 , 7 - diisopropylpteridine and is dn - ase positive . these characteristics place the organism in the genus aeromonas . the culture , aeromonas caviae , sc 14 , 030 , matches the description of aeromonas caviae in those key characteristics that serve to differentiate this species from aeromonas hydrophilia and aeromonas sobria , the two other members of this genus that are motile , i . e ., being positive for esculin hydrolysis and for 1 - arabinose utilization . acetoin production , production of gas from glucose and production of hydrogen sulfide from cysteine are all negative . aeromonas caviae , sc 14 , 030 is , therefore , identical to aeromonas caviae and is so identified , in accordance with the description of aeromonas caviae by m . popoff ( bergey &# 39 ; s manual of systematic bacteriology , vol . 1 . eds . n . r . krieg and j . g . holt , williams and wilkins , baltimore , md ., pgs . 546 - 547 , 1984 ). the antibiotics aerocavin and aerocyanidin can be produced by cultivating aeromonas caviae a . t . c . c . no . 53434 at , or about , room temperature ( 25 ° c .) under submerged aerobic conditions in an aqueous nutrient medium containing an assimilable source of carbon and an assimilable source of nitrogen . the fermentation is carried out until substantial antibiotic activity is imparted to the medium , usually about 18 to 48 hours , preferably about 24 hours . the isolation procedure can be monitored by conventional means of paper disc - agar diffusion assay using , for example , staphylococcus aureus fda 209p . additionally , aerocyanidin can be monitored colorimetrically by the sievert - hermsdorf method ( p . a . s . smith , &# 34 ; the chemistry of open - chain organic nitrogen compounds &# 34 ;, benjamin , n . y ., 1965 ; vol . 1 , p . 225 ) which gives a blue color with isocyanides . samples to be tested , 0 . 1 ml , can be added to 0 . 9 ml of a reagent prepared by mixing equal portions of a 1 mg / ml solution of 3 , 3 &# 39 ;, 5 , 5 &# 39 ;- tetramethybenzidine in methanol : acetic acid , 9 : 1 , v / v and a 3 mg / ml solution of cupric acetate monohydrate in water . the increase in absorption at 370 nm relative to a blank prepared from ethanol and the reagent is proportional to the quantity of aerocyanidin present . aerocavin can be separated from the fermentation medium and purified using art - recognized techniques . for example , the broth can be centrifuged to remove the cells of the producing microorganism . the supernate , adjusted to a ph of about 5 with an acid ( e . g ., hydrochloric acid ) can be extracted with ethyl acetate , and the extract concentrated in vacuo to a syrup . the syrup can be chromatographed on a column of silicic acid with solvents , e . g ., hexane - chloroform , chloroform and finally , chloroform - methanol . the bioactive fractions , detected by conventional means of paper disc - agar diffusion assay against staphylococcus aureus or staphylococcus epidermidis , can be combined , concentrated in vacuo , and the residue chromatographed on a sephadex lh - 20 * column prepared and subsequently eluted with a solvent mixture of chloroform : methanol : heptane , 1 : 3 : 6 ( v / v / v ). active fractions can be pooled , concentrated in vacuo , and further purified by chromatography on cellulose with heptane and heptane - ether . rechromatography of the pooled , active fractions on cellulose affords highly purified aerocavin that crystallizes after concentration of the active eluate . an alternative technique for separating aerocavin from the fermentation medium , and one which yields aerocyanidin as well as aerocavin , comprises first adjusting the ph of the fermentation broth to 6 and centrifuging to remove cells and other particulate matter . the clear supernate can be extracted with ethyl acetate and the resulting organic layer , containing the antibiotic activity , can be concentrated in vacuo to a residue that can then be subjected to distribution in hexanes , toluene , methanol , water , 3 : 3 : 4 : 2 . methanol can be removed from the lower phase by concentration in vacuo , resulting in an aqueous solution containing the antibiotic activity . the mixture of antibiotics can be extracted into ethyl acetate and then purified by countercurrent chromatography in hexanes , ethyl acetate , methanol , water , 1 : 1 : 1 : 1 . during the course of this procedure , aerocyanidin is separated from aerocavin . the fractions containing each of the antibiotics can be pooled . the fractions containing aerocyanidin can be further purified by reverse - phase chromatography on a macroporous styrene - divinylbenzene polymer with a linear gradient of acetonitrile in water . extraction of the combined active fractions with ethyl acetate followed by concentration in vacuo gives aerocyanidin as a colorless crystalline solid . the fractions containing aerocavin can be purified as described above . aerocavin and aerocyanidin are acidic substances that form salts with various organic and inorganic bases . pharmaceutically acceptable salts are preferred , although other salts are also useful , e . g ., in the isolation of the antibiotics . salts of the antibiotics form an integral part of this invention and are readily prepared using art - recognized techniques . exemplary salts include ammonium salts , alkali metal salts ( e . g ., sodium and potassium salts ), alkaline earth metal salts ( e . g ., calcium and magnesium salts ) and other salts with organic bases such as dicyclohexylamine , benzathine , hydrabamine and n - methyl - d - glucamine . the following examples further illustrate the preparation of aerocavin and aerocyanidin . yeast extract , glucose , soil extract , salts , agar slants were seeded with aeromonas caviae , a . t . c . c . no . 53434 , incubated overnight at 25 ° c . and used to inoculate 100 ml portions of an aqueous medium contained in 500 ml erlenmeyer flasks . the composition of the germination medium was : ______________________________________yeast extract 4 . 0 gmalt extract 10 . 0 gdextrose 4 . 0 gdistilled water to 1000 ml______________________________________ the medium , adjusted to ph 7 . 3 , was sterilized at 121 ° c . and at 15 lbs . steam pressure for 15 minutes prior to use . the inoculated germination flasks were incubated at 25 ° c for approximately 24 hours on a rotary shaker , operating at 300 rpm with a 2 inch stroke . a 1 % ( v / v ) transfer was made from the germination flasks to 100 ml portions of a medium of the following composition contained in 500 ml erlenmeyer flasks : ______________________________________yeast extract 10 . 0 gmalt extract 10 . 0 gpeptone 1 . 0 gdextrose 20 . 0 gdistilled water to 1000 ml______________________________________ the medium , adjusted to ph 7 , was sterilized at 121 ° c . and at 25 lbs . steam pressure for 15 minutes prior to use . the inoculated flasks were incubated at 25 ° c . for about 24 hours on a rotary shaker operating at 300 rpm with a 2 inch stroke . the contents of the flasks were pooled and the pooled broth centrifuged , yielding approximately 160 liters of broth supernate , ph 6 . 6 . the supernate , adjusted to ph 5 . 5 with 6n hydrochloric acid , was extracted with two 80 liter portions of ethyl acetate . the extracts were pooled and then concentrated in vacuo at a temperature equal to or less than 40 ° c . to yield 14 . 6 grams of a syrup . the 14 . 6 grams of syrup was charged onto a silicic acid column ( 2 . 5 cm × 54 cm ) packed in hexane : chloroform , 1 : 1 ( v / v ). elution of the column was begun with 500 ml of hexane : chloroform , 1 : 1 ( v / v ) and followed by elution with 500 ml of hexane : chloroform , 1 : 2 ( v / v ), 3 liters of chloroform and finally with 500 ml of chloroform : methanol , 99 : 1 ( v / v ). the active fractions were collected , pooled and concentrated in vacuo giving 4 g of residue . this residue , dissolved in 20 ml of a solvent consisting of methanol : chloroform : heptane , 1 : 3 : 6 ( v / v / v ) was then chromatographed on a sephadex lh - 20 column ( 2 . 5 cm × 50 cm ) packed in the same solvent . this same solvent was used to elute the bioactive material , which was collected and concentrated in vacuo giving a residue of 1 . 1 g . the residue , dissolved in 20 ml of heptane , was placed onto a cellulose column ( whatman cf 11 , 2 . 5 cm × 28 cm ) packed in heptane . the column was eluted with 500 ml portions of heptane followed by heptane : ether , 1 : 1 ( v / v ). the concentrate of the pooled , active fractions was rechromatographed on a cellulose column ( whatman cf11 , 2 . 5 cm × 25 cm ) packed in petroleum ether ( 35 °- 60 ° c .). elution of the column with 500 ml portions of petroleum ether , petroleum ether : heptane , 1 : 1 ( v / v ), heptane , heptane : ether , 1 : 1 ( v / v ), and finally ether resulted in the activity being recovered . the pooled , active fractions were concentrated in vacuo , and the residue 0 . 2 g , was dissolved in a small volume of heptane : ethyl acetate , 9 : 1 ( v / v ), from which crystalline aerocavin ( 100 mg ) was obtained . aerocavin was found to be a colorless acidic substance with empirical formula c 27 h 44 o 6 , mw 464 ( high resolution fab mass spectometry ) and melting point of 127 ° c . ; uv max in meoh 220nm ( e 1 cm 1 % 250 ); [ α ] d 22 =+ 25 . 1 ° ( c = 0 . 9 , methanol ; 1 h nmr ( cdcl 3 ) ε0 . 87 ( 3h , t , j = 6 . 8 hz ), 1 . 26 ( ca . 13h ), 1 . 45 ( ca . 3h , m ), 1 . 49 ( 3h , s ), 1 . 60 ( 1h , ddd , j = 2 . 6 , 8 . 6 , 14 . 6 hz ), 1 . 88 ( 2h , m ), 2 . 02 ( 1h , dd , j = 11 . 7 , 11 . 7 hz ), 2 . 22 ( 1h , dd , j = 3 . 4 , 12 . 0 hz ), 2 . 25 ( 1h , d , j = 11 . 3 hz ), 2 . 50 ( 2h , m ), 2 . 58 ( 1h , ddd , j = 4 . 4 , 13 . 2 , ca . 18 . 4 hz ), 3 . 13 ( 1h , d , j = 15 . 2 hz ), 3 . 20 ( 1h , d , j = 15 . 2 hz ), 3 . 66 ( 1h , m ), 3 . 88 ( 1h , m ), 4 . 01 ( 1h , dd , j = 8 . 5 , 13 . 2 hz ), 5 . 11 ( 1h , m ), 5 . 26 ( 1h , m ), 5 . 26 ( 1h , ddd , j = 4 . 7 , 8 . 0 , 17 . 0 hz ), 5 . 37 ( 1h , ddd , j = 5 . 2 , 8 . 7 , 14 . 0 hz ), 5 . 76 ( 1h , s ), 6 . 02 ppm ( 2 to 3h , broad s ); 13 c nmr ( cdcl 3 ) ε 14 . 0 , 16 . 4 , 22 . 6 , 25 . 4 , 29 . 2 , 29 . 5 ( 3c ), 30 . 9 , 31 . 8 , 34 . 6 , 37 . 1 , 38 . 4 , 39 . 5 , 44 . 8 , 49 . 4 , 65 . 6 , 69 . 1 , 70 . 9 , 120 . 6 , 124 . 9 , 125 . 6 , 129 . 2 , 133 . 7 , 152 . 1 , 165 . 2 , 174 . 0 ppm ; ir ( kbr ) 3450 , 3025 , 2955 , 2927 , 2856 , 1721 , 1699 , 1649 , 1377 , 1235 , 1187 , 1156 , 1119 , 1062 , 965 cm - 1 . the antibiotic was substantially soluble in methanol , acetone , ethyl acetate , less soluble in heptane and insoluble in water . the minimum inhibitory concentration ( mic ) of aerocavin was determined by an agar dilution technique . the test organisms were prepared from frozen stocks and diluted to give a final level of 10 7 cfu / ml ( cfu is colony forming units ). aerocavin was dissolved in the appropriate diluent at a concentration of 1 , 000 μg / ml . two fold dilutions were made in yeast beef broth ( difco ), resulting in a range from 1 , 000 μg / ml to 0 . 5 μg / ml . a 1 . 5 ml sample of each dilution was placed into individual petri dishes to which 13 . 5 ml of k - 10 agar * was added . the final drug concentration in the agar ranged from 100 μg / ml to 0 . 05 μg / ml . organism growth control plates containing agar only were prepared and inoculated before and after the test plates . the organisms were applied to the surface of each plate with the denley multipoint inoculator ( which delivers approximately 0 . 001 ml of each organism ) resulting in a final inoculum level of 10 4 cfu on the agar surface . the plates were incubated at 37 ° c . for 18 hours and the mic &# 39 ; s then determined . the mic is the lowest concentration of compound inhibiting growth of the organism . ______________________________________organism sc no . * mic ( μg / ml ) ______________________________________staphylococcus aureus 1276 6 . 3staphylococcus aureus 2399 6 . 3staphylococcus aureus 10016 3 . 1 ( tetracycline . sup . r )** staphylococcus aureus 9593 6 . 3 ( penicillin . sup . r ) staphylococcus aureus 10820 3 . 1 ( erythromycin . sup . r ) staphylococcus epidermidis 9052 6 . 3staphylococcus epidermidis 10547 3 . 1 ( penicillin . sup . r ) escherichia coli 8294 100 . 0escherichia coli 10857 12 . 5pseudomonas aeruginosa 9545 25 . 0acinetobacter calcoaceticus 8333 12 . 5______________________________________ * sc no . is the number in the microorganism collection of e . r . squibb & amp ; sons , inc ., princeton , new jersey . **(. sup . r ) indicates that the organism is resistant to the antibiotic named . ______________________________________yeast extract 5 . 0 gglucose 5 . 0 gmgso . sub . 4 . 7h . sub . 2 o 0 . 1 gfeso . sub . 4 . 7h . sub . 2 o 0 . 1 gsoil extract filtrate * 200 . 0 mlagar 17 . 5 gtap water 800 . 0 ml______________________________________ * soil extract filtrate is made by bringing to a boil a suspension of soil in tap water ( 1 : 2 , v / v ) and then allowing to simmer for about 60 minutes . after cooling , the extract is filtered through cheesecloth , then centrifuged to remove most of the remaining solids and finally filtered through whatman 4 filter paper . the resulting liquid is sterilized by autoclaving at 121 ° c . for 20 minutes . were seeded with aeromonas caviae a . t . c . c . no . 53434 , incubated overnight at 25 ° c . and used to inoculate 100 ml portions of an aqueous medium contained in 500 ml erlenmeyer flasks . the composition of the medium was : ______________________________________tryptone 5 . 0 gmalt extract 3 . 0 gglucose 10 . 0 gyeast extract 3 . 0 gdistilled water to 1000 ml______________________________________ the medium was sterilized at 121 ° c . and at 15 lbs . steam pressure for 15 minutes prior to use . the inoculated flasks were incubated at 25 ° c . for about 24 hours on a rotary shaker operating at 300 rpm with a 2 inch stroke . growth from these flasks was then used to inoculate 100 ml portions of fresh medium of the same composition contained in 500 ml erlenmeyer flasks . these flasks were also incubated at 25 ° c . on a rotary shaker with the same conditions as just described for the preceding stage . this growth was then used as the source of inoculum ( 1 . 5 %, v / v ) for 250 liters of medium in a 300 liter stainless steel vessel . the medium had the following compositions : ______________________________________tryptone 5 . 0 gmalt extract 3 . 0 gcerelose hydrate 11 . 0 gucon lb 625 0 . 5 mldistilled water to 1000 ml______________________________________ the medium was sterilized at 121 ° c . and at 15 lbs . steam pressure for 30 minutes prior to use . the fermentation proceeded for 24 hours at 25 ° c ., with an agitation rate of 130 rpm , an airflow of 10 cfm and a pressure of 10 psig . at the completion of the fermentation , the broth was harvested . the ph was adjusted to 6 by the addition of 3 m phosphoric acid , chilled to 11 ° c . and centrifuged to remove cells and other particulate matter . the clear supernate was placed directly into a vessel containing ethyl acetate , 125 liters , while stirring . the organic and aqueous phases were separated by centrifugation and the clear supernate , 58 liters , was concentrated in vacuo at ≦ 20 ° c . to 2 liters . solids that formed during the concentration were removed by filtration . the clear filtrate was then washed with 2 liters of sodium 0 . 1 m phosphate buffer , ph 6 . 0 , followed by three 800 ml portions of water . the ethyl acetate layer , 1 . 6 liters , was concentrated in vacuo to give a residue , 87 g , that was subjected to a 2 funnel , 3 transfer countercurrent distribution in hexanes , toluene , methanol , water , 3 : 3 : 4 : 2 , v / v / v / v , 850 ml per phase , with the lower phase being the mobile phase . after completion of the distribution , the lower phases were pooled and methanol removed by concentration in vacuo . the resulting aqueous solution was extracted with ethyl acetate , 350 ml , and the organic phase separated and then concentrated in vacuo to give a residue , 4 . 1 grams . the residue was dissolved in 10 ml each of the upper and lower phases of a partition system composed of hexanes , ethyl acetate , methanol , water , 1 : 1 : 1 : 1 , v / v / v / v , and chromatographed in this solvent system on a high - speed countercurrent chromatograph ( p . c . inc ., potomac , md .) operated at 800 rpm using a multilayer teflon tubing ( 1 . 6 mm , i . d .) coil with a volume of 330 ml . the system was eluted with the upper phase at 4 ml per minute . aerocyanidin emerged between 250 and 370 ml . the fractions containing aerocyanidin were combined , washed with an equal volume of water , and the aqueous phase back - washed with ethyl acetate . the organic solvent pool , 250 ml , was concentrated in vacuo to a residue , 669 mg . the residue was mixed with 10 ml of acetonitrile : water , 3 : 7 , v / v , and the resulting turbid mixture was placed onto a 2 . 5 × 20 cm column of mci gel chp20p resin * packed in acetonitrile : water , 3 : 7 , v / v . the column was eluted at 2 ml per minute with a linear gradient ranging from 30 to 70 % acetonitrile in water over a volumn of 2 . 2 liters . aerocyanidin eluted between 700 and 760 ml . the active fractions were pooled and the pool was diluted with water , 60 ml . the diluted pool was extracted twice with ethyl acetate . the two ethyl acetate extracts were combined and the pool washed twice with water . the resulting ethyl acetate solution , 170 ml , contained 138 . 4 mg of aerocyanidin . aerocyanidin was stored in this solution at 4 ° c . since the antibiotic is less stable in the solid state . a small sample , when concentrated to dryness in a nitrogen stream , gave a crystalline residue that melted at 59 ° to 62 ° c . the highest melting point observed for material obtained by the above procedure was 63 . 5 ° to 65 . 5 ° c . aerocyanidin was found to be a colorless , acidic substance , [ α ] d 23 =- 20 ° ( c = 0 . 5 , methanol ), 1 h nmr ( cdcl 3 ) δ1 . 2 to 1 . 75 ( 16h ), 1 . 76 ( 3h , s ), 2 . 34 ( 2h , t , j = 7 . 3 , 7 . 3 hz ), 2 . 84 ( 1h , d , j = 8 . 1 hz ), 3 . 66 ( 1h , td , j = 8 . 0 , 8 . 0 , 4 . 5 hz ), ca . 6 . 8 ppm ( 2h , broad ); 13 c nmr ( cdcl 3 ) δ22 . 1 , 24 . 6 , 24 . 6 , 29 . 0 , 29 . 1 , 29 . 2 , 29 . 3 , 29 . 3 , 34 . 0 , 34 . 6 , 64 . 8 , 65 . 2 ( broad ), 69 . 6 , 161 . 0 , 179 . 6 ppm ; ir ( kbr ) 2971 , 2934 , 2916 , 2853 , 2142 , 1712 , 1114 , 1086 , 886 , 810 cm - 1 ; mass spectrum ( fab ) 284 . 1866 [ calc &# 39 ; d for c 15 h 26 no 4 ( m + h + ): 284 . 1862 ], uv ( methanol ) end absorption . using the methodology described for the determination of the biological activity of aerocavin , the biological activity of aerocyanidin was determined . the results of the agar dilution assays are : ______________________________________organism sc no . mic ( μg / ml ) ______________________________________staphylococcus aureus 1276 & lt ; 0 . 05staphylococcus aureus 2399 & lt ; 0 . 05staphylococcus aureus 2400 & lt ; 0 . 05streptococcus faecalis 9011 0 . 2streptococcus agalactiae 9287 & lt ; 0 . 05micrococcus luteus 2495 0 . 4escherichia coli 8294 & gt ; 50 . 0escherichia coli 10896 25 . 0escherichia coli 10909 1 . 6klebsiella aerogenes 10440 & gt ; 50 . 0klebsiella pneumoniae 9527 & gt ; 50 . 0proteus mirabilis 3855 1 . 6salmonella typhosa 1195 25 . 0shigella sonnei 8449 25 . 0enterobacter cloacae 8236 50 . 0pseudomonas aeruginosa 8329 & gt ; 50 . 0______________________________________ | 2 |
in the method of this invention , filter cake formed on the walls of a subterranean borehole is removed by contacting the filter cake with a breaker fluid comprising a persulfate . filter cakes are tough coatings that reduce the permeability of formation walls . formed during the drilling stage to limit losses from the well bore and protect the formation from possible damage by fluids and solids within the well bore , filter cake layers must be removed from the hydrocarbon - bearing formation so that the formation wall is restored to its natural permeability to allow for hydrocarbon production or cementing . filter cakes are typically formed with polymers that encapsulate particles or solids which form a bridge over the pores of the formation . drill - in fluids , including any bridging agents and polymers , especially polysaccharides , contained within the drilling fluid are well known in the art . in one preferred method of this invention , removing filter cake from a subterranean borehole , comprises drilling the borehole with a drill - in fluid comprising a polymer to form a filter cake . preferably , the borehole is drilled while circulating a mud therein which comprises a polymer . the polymer is selected from a water soluble organic polymer , a water dispersible organic polymer , a water soluble bio - polymer , a water dispersible bio - polymer and combinations thereof . for example , the polymer selected can be a cationic starch , a anionic starch or a nonionic starch . optionally , the drill - in fluid comprises finely divided solids dispersed therein to form a filter cake on surfaces of the borehole . other additives can be used for stabilizing and viscosifying . when the bore hole is ready for production , the filter cake must be removed to allow for permeability of the formation walls . to remove the filter cake , the filter cake is contacted with a mixture of a persulfate salt in a variable density brine . in one aspect , the persulfate salt mixture can further comprise a surfactant and / or a chelating agent . preferably , the persulfate salt is ammonium persulfate . alternatively , the persulfate salt is selected from an alkali metal persulfate , an alkaline earth metal persulfate and combinations thereof . the alkali metal persulfate can be selected from potassium persulfate , sodium persulfate , lithium persulfate and combinations thereof and the alkaline earth metal persulfate can be selected from calcium persulfate , magnesium persulfate , and combinations thereof . in one aspect the effective concentration of persulfate ranges from about 1 lb / bbl to about 50 lbs / bbl , preferably from about 4 lb / bbl to about 48 lbs / bbl . break time can be controlled by the concentration of the persulfate oxidizer within the brine and also varies with downhole temperature . increasing the concentration or at higher downhole temperatures results in increased oxidation activity . the variable density brine can be selected from nh 4 cl , nacl , kcl , cacl 2 , zncl 2 , and combinations thereof and , with these chloride brines , can have a density varying within a range of from about 8 . 3 lbs / gal . to about 12 . 8 lbs / gal , preferably within a range of from about 8 . 5 lbs / gal . to about 10 . 4 lbs / gal . downhole temperatures differ according to the depth and location of the formation . the filter cake removal fluid of this invention is optimally used at lower downhole temperatures . in one preferred method , the mixture is allowed to remain at the downhole temperatures ranging from 65 ° f . to 165 ° f . for a period of time effective to degrade the polymer filter cake , ranging from about 3 . 5 to about 48 hours or more , depending on the state of well operations at the time . more preferably , the temperature ranges from about 70 ° f . to 160 ° f . and the period of time the mixture remains in contact with the filter cake is at least 4 hours . the decomposed filter cake can then be flushed away with a low concentration organic or non - organic acid as commonly known in the art to increase permeability . in an alternative embodiment of this invention , the method of removing filter cake from a subterranean borehole comprises contacting the filter cake with a mixture of a persulfate salt in a variable density bromide or chloride brine . the brine can be selected from nh 4 cl , nh 4 br , nacl , nabr , kcl , kbr , cacl 2 , cabr 2 , zncl 2 , znbr 2 , and combinations thereof . in this preferred method , the mixture is allowed to remain at the downhole temperatures below 104 ° f ., preferably within a range of 65 ° f . to 104 ° f ., for a period of time effective to degrade the polymer filter cake . the persulfate salt is selected from ammonium persulfate , an alkali metal persulfate , an alkaline earth metal persulfate and combinations thereof . the density , however , varies within a range of from about 8 . 3 lbs / gal . to as high as about 18 lbs / gal . if a bromide brine is used . a preferred composition for a filter cake removal fluid can comprise a solution of a persulfate salt in a brine , the concentration of persulfate effective for oxidation at temperatures between 65 ° f . to 180 ° f ., preferably , between 65 ° f . to 165 ° f . preferably concentration of persulfate ranges from about 1 lb / bbl to about 50 lbs / bbl , preferably from about 4 lbs / bbl to about 48 lbs / bbl , and more preferably , the concentration ranges from 16 lbs / bbl to 48 lbs / bbl . the solution of a persulfate salt in a brine can have a density within a range of about 8 . 3 lbs / gal to about 12 . 8 lbs / gal . the persulfate salt is preferably selected from ammonium persulfate , an alkali metal persulfate , an alkaline earth metal persulfate and combinations thereof . preferably , the steps for this preferred method include : installing gravel pack screens and tool assemblies into the borehole . thereafter introducing sand in a non - viscosified carrier into the borehole ; and introducing a filter cake removal fluid in the well bore , in contact with a subterranean formation containing the hydrocarbons to be produced , for a duration effective to substantially remove the filter cake in the vicinity of the subterranean formation . the filter cake removal fluid preferably comprises a solution of a persulfate salt in a brine having a density within a range of about 8 . 3 lbs / gal to about 12 . 8 lbs / gal and the persulfate is effective for oxidation at temperatures between 65 ° f . to 165 ° f . fluid loss pills can be used to form the filter cake . in an alternative method of removing filter cake from an existing subterranean borehole in which a fluid loss pill is used , the method comprises placing a fluid loss pill into the borehole , the fluid loss pill having a polymer to form a filter cake . in this method the polymer is selected from a water soluble organic polymer , a water dispersible organic polymer , a water soluble bio - polymer , a water dispersible bio - polymer and combinations thereof . the filter cake is contacted with a mixture of a persulfate salt in a variable density brine . the persulfate is preferably selected from ammonium persulfate , alkali metal persulfate , alkaline earth metal persulfate and combinations thereof and the brine can be selected form nh 4 cl , nacl , kcl , cacl 2 , zncl 2 , and combinations thereof . in this method the mixture is allowed to remain at the downhole temperatures ranging from 65 ° f . to 165 ° f . for a period of time effective to degrade the polymer filter cake . alternatively the brine is selected from nh 4 cl , nh 4 br , nacl , nabr , kcl , kbr , cacl 2 , cabr 2 , zncl 2 , znbr 2 and combinations thereof and allowing the mixture to remain at the downhole temperatures ranging from 65 ° f . to 104 ° f . for a period of time effective to degrade the polymer filter cake . in another aspect , the mixture of persulfate salt in a variable density brine further comprises a chelating agent . high permeability , soft sandstone formations , often found in horizontal drilling , generally require some form of barrier for hole stability . gravel packing is used to improve hole stability in these conditions . during the practice of this invention one method of removing filter cake from a subterranean borehole , comprises drilling the borehole while circulating a mud therein which comprises a polymer , the polymer is selected from a water soluble organic polymer , a water dispersible organic polymer , a water soluble bio - polymer , a water dispersible bio - polymer and combinations thereof . following the drilling of a well , when fluid losses are acceptable for the proposed pumping pressures , gravel or sand packing can begin . first the drill - in fluid is displaced with a first clear fluid , which is otherwise similar to the drilling fluid . the well bore is maintained in a slightly overbalanced state . gravel pack screens and tool assemblies are run into the bore . during this stage , it is desirable to maintain the filter cake with as little fluid loss to the production formation as possible . following displacement of the drilling fluid , the well is gravel packed . in a preferred procedure , the gravel , preferably sized sand , about 20 - 30 u . s . mesh , is placed into a nonviscosified carrier , such as a brine . advantageously , the method of this invention comprises the simultaneous application of persulfate with the gravel pack . at the same time , or at a later time , persulfate can be added to the gravel pack . alternatively , persulfate can be added independently of the gravel pack and also used in systems that do not employ gravel packing . as the low viscosity fluid cannot transport a significant amount of solids , the sand concentrations are usually from about 60 g / l to 360 g / l and pump rates approach 1 m 3 / min . the hydrostatic overbalance that arises from the pumping pressure necessary to achieve these rates is desirable since the overbalance holds the filter cake in place . a filter cake removal fluid is then introduced in the wellbore , in contact with a subterranean formation containing the hydrocarbons to be produced , for a duration effective to substantially remove the filter cake in the vicinity of the subterranean formation . preferably , the filter cake removal fluid comprises a solution of a persulfate salt in a brine having a density within a range of about 8 . 3 lbs / gal to about 12 . 8 lbs / gal and effective for oxidation at temperatures between 65 ° f . to 165 ° f . the non - viscosified carrier for the sand can comprise the filter cake removal fluid . in the practice of this invention , other additives , such as clay treating additives , ph control agents , lubricants , non - emulsifying agents , iron control agents and the like can be included within the filter cake removal fluid or gravel pack fluid as desired . the following examples illustrate the use of persulfate salt in the breaking of filter cakes containing different polymers in different brines at relatively low temperatures . examples at four different temperatures are provided . tables illustrate the increase in break time achievable either by an increase in temperature ( table 1 ) or by an increase in breaker ( persulfate ) concentration ( tables 2 & amp ; 3 ). formulation # component ( quantities in grams / liters ) 1 2 3 water 419 . 14 419 . 1 419 . 14 nacl ( sg = 1 . 199 ) brine 621 . 42 621 . 4 621 . 42 cationic starch 13 . 70 — — anionic starch — 13 . 70 — nonionic starch — — 13 . 70 sodium thiosulfate 0 . 71 0 . 71 0 . 71 magnesium oxide 2 . 86 2 . 86 2 . 86 xanthan biopolymer 3 . 42 3 . 42 3 . 42 sized calcium carbonate # 1 * 42 . 86 42 . 86 42 . 86 sized calcium carbonate # 2 ** 42 . 86 42 . 86 42 . 86 shale stabilizer ( proprietary glycol blend ) 30 . 86 30 . 86 30 . 86 the nacl brine was a stock commercial product marketed by tetra technologies , inc . the cationic starch ( hps ) was cross - linked and commercially available from tetra technologies , inc . the other two starches available commercially were also cross - linked . the sodium thiosulfate and magnesium oxide were usp grade . the xanthan biopolymer is available from several suppliers . the sized calcium carbonate is available from tetra technologies under the trade designation tetra payzone ® carb - prime , and tetra payzone ® carb - ultra , respectively . the breaker or clean - up fluid for the examples below was a solution of ammonium persulfate ( 1 - 48 lb / bbl ) in a sodium chloride or bromide brine ( 1 . 162 g / ml ). break time was controlled by variation of breaker temperature of concentration as illustrated in tables 1 - 3 below . the following mixing procedure was followed for all laboratory tests . after the addition of the starch ( and before addition of the next ingredients ), the mixture was sheared with a high - shear ( silversen type ) mixer for 30 seconds , and then mixed at 500 rpm using a low - shear servodyne unit for 30 minutes . this shearing process is intended to simulate mixing with a high shear centrifugal pump , and then the slow mechanical rolling of a field mixing unit . the shearing / mixing procedure was repeated after the addition of the next three ingredients , the thiosulfate , magnesium oxide and xanthan . a third mixing for 30 minutes was run after adding the carbonates . rheological properties were then measured ( heating only the sample used for testing to 120 ° f . ), and the samples were “ hot - rolled ” at 149 ° f . in a baroid roller oven for 16 hours . after the ‘ hot rolling ’, the theological properties were again measured at 120 ° f ., and the samples were then tested for “ filter cake removal ” in the following manner . the permeability of a 10 - or 5 - microns ceramic disk was first determined in both directions of flow at 35 kpa and ˜ 68 ° f . f . next , a filter cake was built using a standard high temperature , high pressure cell ( hthp cell ). the 10 - or 5 - microns ceramic disk was used as the filtering medium with the cell filled with the test drill - in fluid . the filter cake preparations were run at test temperature over 24 hours , with a squeeze pressure of 2100 kpa applied to the fluid . the filtrate was collected and measured during this time . a filter cake was produced that had an initial spurt fluid loss as the filter cake is building , but then had a rapid decline as the filter cake limited further fluid loss . at the end of the cake building time ( 24 hrs ), the cell was cooled and the pressure released . the remaining fluid was drained from the cell , and the filter cake which had been formed was examined visually for uniformity . visually , the amount of corrosive by - products was less as compared to other breaker systems . following the visual examination , the breaker fluid was added to the hthp cell and the cell was pressurized ( usually to 700 pa ) and the temperature adjusted . after the breaker fluid had broken through the filter cake , the fluid , if any remained , was removed from the cell , and tests to establish the recovery of the permeability of the ceramic disk were performed . this part of the testing was run in the normal direction , with the disk ( and filter cake on it ) at the cell bottom and the treating fluid carefully poured in on top of it . this fluid was injected in the same direction as the drill - in fluid to simulate the injection of a clean - up fluid in field practice . consequently the permeability determined in this direction is called the recovered injection permeability . the test is repeated in the opposite direction , again at 35 kpa and ambient temperature (˜ 65 - 70 ° f . f ). this flow was in the production direction of an actual well and is called the recovered production permeability . a filter cake as described above was prepared using formulation # 1 . the cake was prepared over 24 hrs using a 1 . 16 g / ml nacl brine and 700 kpa differential pressure . after 4 hours , less than 4 ml of filtrate had been produced and the injection permeability was essentially zero . a breaker fluid was applied at 67 ° f . f and 700 kpa ( 32 lb / bbl ammonium persulfate ). the treating fluid broke through in 24 hours flowing at about 3 ml / hr . after about 2 hours additional time , the flow rate had increased to about 5 ml / min , and the test was terminated after 120 ml of the breaker fluid had been passed through the cell . the cell was allowed to cool and pressure was released . the filter cake was visually inspected and found to be composed of discrete carbonate particles with no evidence of starch or polymer . a recovered permeability test was run in the injection direction , with 3 % recovered permeability . recovered permeability testing in the production direction gave 64 % of the original permeability recovered . an acid flush ( 5 % solution of hcl in 1 . 162 g / ml nacl ) was poured into the cell and the cell was sealed to allow the acid to leak through by self generated pressure . this process was intended to simulate the spotting ( but not injection ) of acid in a balanced hydrostatic condition . immediately , the acid started to break through , and after ˜ 20 minutes all of the acid had passed through . the recovered permeability was 98 % in the production direction and 95 % in the injection direction . a test similar to that in example 1 was run , except formulation # 2 with an anionic starch rather than a cationic one was used . the total fluid loss was about 30 ml in 24 hrs . after 24 hrs the cell was opened and emptied of the drill - in fluid . breaker solution ( 120 ml ), same as that used in example 1 ( 32 lb / bbl persulfate salt ), was added to the cell . the breaker fluid started to break through in 24 hours with a flow rate of ˜ 3 . 0 gram / hr . the breaker treatment was terminated after 34 hrs , during which time 64 % of the breaker fluid had passed through the cell . the cell was allowed to cool and pressure was released . the filter cake was visually inspected and found to be composed of discrete carbonate particles with no evidence of any remaining starch or polymer . a recovered permeability examination run in the injection direction gave only 3 % recovered permeability . in the production direction , however , 66 % of the original permeability was recovered . the remaining filter cake was then treated with acid as in example 1 ( 5 % hcl in 1 . 162 g / ml nacl ). the recovered permeabilities were 97 % in the production direction and 95 % in the injection direction . using formulation # 3 , with a nonionic starch , filter cake build - up and treatment soaks were performed in the same manner as for examples 1 and 2 . treatment with the breaker fluid ( 32 lb / bbl persulfate salt ) used in examples 1 and 2 at ˜ 68 ° f . gave 5 % recovered permeability in the injection direction and 62 % in the production direction without acid treatment . using formulation # 1 , a filter cake was prepared at 104 ° f . and 2100 kpa . the breaker fluid ( 24 lb / bbl persulfate salt ) was applied as in previous examples but at 104 ° f . and 700 pa . the breaker fluid started to break through in 15 hours , flowing at about 2 . 5 gram / hr . after an additional 10 hours , the breaker treatment was terminated after 56 % of the treating fluid had been displaced through the cell . as in the previous example , the remaining filter cake was found to be composed of discrete carbonate particles with no evidence of starch or polymer . recovered permeabilities were 20 % in the injection direction and 78 % in the production direction . the recovered permeabilities after acid treatment were 100 % in both directions . using formulation # 1 a filter cake was prepared at 140 ° f . and 2100 kpa by the procedure described previously . the breaker fluid ( 24 lb / bbl breaker ) was applied to the filter cake at 135 ° f . and 700 kpa . after one hour the breaker fluid started to slowly break through , flowing at about ˜ 0 . 02 gram / min . after an additional 40 minutes , 137 ml of the fluid had passed through the cell and the run was terminated . inspection of the filter cake revealed the presence of only carbonate , no starch or polymer . recovered permeabilitites were 3 % and 54 % in the injection and production directions , respectively . treatment of the remaining cake with acetic acid ( 10 wt % in 1 . 162 g / ml nacl ) gave recovered permeabilities of 30 % and 64 % in the injection and production directions . using a modified formulation # 1 in which sodium bromide replaced sodium chloride , a filter cake was prepared at 158 ° f . and 2100 kpa by the procedure described previously . the breaker fluid ( 48 lb / bbl breaker in 1 . 162 g / ml nabr ) was applied to the filter cake at 158 ° f . and 700 kpa . after 4 . 25 hours the fluid had broken completely through the cake . inspection of the filter cake revealed the presence of only carbonate , no starch or polymer . recovered permeabilitites were 48 % and 81 % in the injection and production directions , respectively . treatment of the remaining cake with acetic acid ( 10 vol . % in 1 . 162 g / ml nabr ) gave recovered permeabilities of 100 % in both the injection and production directions . examples 7 - 9 were run with formulation # 1 at varying concentrations of breaker at 100 ° f ., and examples 10 and 11 at 160 ° f . see table 1 . a filter cake was prepared using formulation # 1 as described previously . an initial soak of 24 hours was tried using the filter cake was treated with a nacl brine ( 1 . 16 g / ml ) containing no breaker ( 0 . 0 lb / bbl ammonium persulfate ) at room temperature ( 65 ° f .- 70 ° f .) and 700 kpa differential pressure for 24 hrs . fluid loss was less than 4 ml up to 4 hours . after that time there was no more fluid loss and the injection permeability was essentially zero . the cell was loaded again with sodium bromide brine ( 1 . 16 g / ml ) and examined for 4 more hours . no additional breakthrough of fluid was noted . similar examination with a calcium chloride brine ( 1 . 16 g / ml ) for an additional 4 hours gave no fluid loss . the recovered permeability in both the injection and production directions was less than 2 %. the foregoing description is illustrative and explanatory of preferred embodiments of the invention , and variations in the size , shape , materials and other details will become apparent to those skilled in the art . it is intended that all such variations and modifications which fall within the scope or spirit of the appended claims be embraced thereby . | 2 |
many models orient from an observer &# 39 ; s point of study toward a subject . an important distinction of a nuanced or complex emotional experience is how contained they remain internally in the observed from beginning to between transitions or regardless of any outward acts they may inspire . in preferable embodiments , a non - transitory computer readable medium 1010 , a system with a memory 805 850 or a machine with a memory 920 , comprises either data structures , program instructions , or both for carrying out the methods and maintaining representations as described herein . because a component to a preferable embodiment of the present invention defines a representation of an immersive subjective experience first person , ideally , the present invention could first orient from the subject &# 39 ; s own sense of self outward through defined sensory spaces representing physical structures and distantly further into the illusory . fig1 is a third person depiction of a hierarchy of coordinate systems representing immersive first - person experiences of emotion as characterized in this example as a generic emotion sensation matrix with virtual defined sensory space 210 . the representation of emotion experience and component sensations may or may not feel in relation to center of consciousness 100 or attention — where center of one &# 39 ; s thoughts or feelings originate — in a preferable embodiment of the present invention . fig2 is a third person depiction representing one or more member of a hierarchy of coordinate systems characterized in this example as a virtual defined sensory space in the shape of a human head in a preferable embodiment of the present invention . for humans , center of consciousness 100 or attention can originate from the center of one &# 39 ; s thoughts or feelings . if aware of it at all , for hearing or visually dominant individuals , their perception may feel seated near the center of their head or forward into their line of vision . for people with closed eyes , vision impairment , kinesthetic dominant or emotive individuals , the idea of themselves may occasionally or consistently reside lower down toward the neck or into their body &# 39 ; s torso from the throat , heart , or gut . in modeling a recollection of the past , vision for the future , an altered state experience , psychological event , or abnormality , it is possible that sense of self may feel fully disassociated from the defined sensory spaces and , instead , seem outside or distantly located away into the illusory 140 . a preferable embodiment of the present invention would allow for stylistic representations of the emotion component sensations , defined and illusory 140 , and accommodate authentically for representing an entire static or dynamic experience as a biological model would with its virtually located representations of physical structures as what could be preferably characterized as a defined sensory space 210 acting as a bridge to perception . neuro - linguistic programming , an approach to communication , personal development , and psychotherapy , was created by richard bandler and john grinder in california , united states in the 1970s . bandler teaches how , as humans , when we experience an emotion or feeling , the sensations of that event can typically be located in a specific area of the body . from this study of neuro - linguistic programming , an individual &# 39 ; s body has been described as not separate from the brain but an extended part of the brain . as one example of a therapeutic case study , when an individual reports that they are frustrated , important questions to ask the subject may begin with , “ where ? where does the feeling start ? where do you feel it first in your body ? where does it move to ?” as observable in a moment of introspection , feelings are mobile and cannot remain static because they are always moving somewhere and in some direction . furthermore , with how the sensations of emotion seemingly move , you can use your imagination to move them faster . you can imagine slowing the emotion sensations down . you can also move the emotion sensations forward or backward . from this ability to identify our feelings and imagine them toward change , these immersive first - person sensations of emotion are not outside of our control . in fact , with influencing our experience of emotion one can mindfully identify and select their feelings . one can identify and leverage the sensations of feeling and emotion by first recognizing where in a subject &# 39 ; s body the feeling starts and where it goes to . discover the direction it spins inside the subject &# 39 ; s body and have them imagine the sensation spinning faster and faster for feelings to intensify . from this , we can gain greater control over our brains to both create powerful feelings inside us and model representations of the experience of emotion in a hierarchy of coordinate systems . in a preferable embodiment of the present invention , representations of first - person immersive emotion experiences and the component sensations that may define them could be at least characterized as known 120 or the sensations , feelings , and experiences that a subject is aware of ; understood 110 or the sensations , feelings , and experiences that a subject can identify and possibly understand as experiencing ; and ambient 130 or the sensations , feelings , and experiences that weave together and fill in remaining space of the subjective self &# 39 ; s fabric of reality . preferably , known 120 , understood 110 , ambient 130 or other sensations , feelings , and experiences may or may not relate to symbols or commonly accepted labels used by the subject &# 39 ; s peers or contemporaries . representations of known 120 , understood 110 , or ambient 130 sensations , feelings , and experiences , in a preferable embodiment of the present invention , may or may not hold a logical , direct , or indirect relationship with additional ambient 130 , known 120 , or understood 110 sensations , feelings , and experiences . preferably , known 120 can become understood 110 or ambient 130 ; understood 110 can blend or fade with known 120 or become ambient 130 ; and ambient 130 can act as the canvas on which the known 120 and understood 110 are painted . while in a preferable embodiment of the present invention , representations of ambient 130 , known 120 , and understood 110 sensations , feelings , and experiences may or may not act as a precursor , catalyst , result , or consequence of states , transitions , experiences , or other events or qualities concurrently , simultaneously , or sequentially before , during , or after being active or inactive . a preferable embodiment of the present invention could relate the representing characterizations of known 120 , understood 110 , and ambient 130 sensations , feelings , and experiences on a case appropriate scale ranging from likely , possible , or unlikely results of any combination of input and output data , emotion or self - concept data , or belief or preconception sets of rules . because of how a preferable implementation of these methods , systems , computer readable medium , and machine promote internal dialog with other states and systems within a model or available to a subject &# 39 ; s cognition , preferable alignment or calibration of what could be preferably characterized as a dynamic emotion sensation matrix could base its account from a representation of that center of subjective understanding as it relates to itself internally , its sensations of emotion , and its surrounding environment . a preferable embodiment of the present invention could support one or more dynamic emotion sensation matrix representation areas and their counterpart ( s ) concurrently , simultaneously , or sequentially as stand - alone units , grouped , or as parts of a whole . a preferable embodiment of the present invention could allow for measures and increments suited toward resolution granularity appropriate for the application of these methods , systems , computer readable medium , and machine needs , capabilities , or context . fig3 is a flow chart example for defining a representation of an immersive first - person experience of emotion characterized in this example as one or more emotion sensation instance ( s ), one or more emotion sensation event ( s ), and one or more emotion sensation experience ( s ) for modeling in a preferable embodiment of the present invention . while a preferable embodiment of the present invention could , through a graphical user interface , visually model the representations of sensations a subject experiences as guided or reported from introspection , one embodiment of the present invention could also gather data for model input from devices or computing environments measuring brain activity , vital statistics , heart rate , respiration , skin temperature , skin conductance , blood oxygenation , blood volume pulse , temperature , visual or electronic indicators , or state attributes throughout the nervous system , muscular system , lymphatic system , or endocrine system . with gathered data as raw or with translation , a preferable embodiment of the present invention could define data representations of a subject &# 39 ; s emotional state ( s ) for modeling , recreating , maintaining , or archive . fig4 illustrates an example for how representations of immersive first - person emotion experiences , in this example characterized as emotion experience components , relate to each other in a preferable embodiment of the present invention . a preferable embodiment of the present invention would structure complete representations of emotion experiences first from basic building block coordinate locations in the sensory spaces 410 . for the purpose of this disclosure of invention , a preferable characterization of a designated single coordinate location relating to emotion sensation in any available spaces could be an emotion sensation instance 230 , 250 , 420 , 560 , 640 . combined , in a preferable embodiment of the present invention , these emotion sensation instance 230 , 250 coordinate locations could be vectored , grouped , ordered , sequenced , or timed to complete what could be characterized as an emotion sensation event 240 , 430 , 570 , 650 . preferably , it is with the combination of emotion sensation instance 230 , 250 coordinate locations or their associations toward acting as emotion sensation event ( s ) 240 concurrently , simultaneously , or sequentially located throughout the sensory spaces that first define the tapestry of a greater emotion experience 350 , 440 , 580 , 655 and its transitions in the framework of emotion relevant sensory space . once an emotion sensation event 240 has been defined from component emotion sensation instance ( s ) 230 , 250 , a preferable embodiment of the present invention would allow for other types of properties , settings , or attributes to be applied or edited visually , programmatically , or through the dynamic or static recalculation or manipulation of values corresponding or otherwise . fig5 is a schematic illustration of an example system architecture for incorporating representations of immersive first - person emotion experiences , in this example characterized as emotion experience 440 , and component data with other data , calculation , or processing from application , system , or instance relevant computing environments in a preferable embodiment of the present invention fig6 is a schematic illustration of an example system architecture for incorporating representations of personality or disposition components 660 with emotion experience 440 processing in a preferable embodiment of the present invention . a preferable embodiment of the present invention could implement a visual design interface for editing the location or properties of instances , events , or other representing members from internal and third person perspectives . preferable features of a visual design interface for tasks like data entry , modeling , or editing could include paint brushes , erasers , vector or line drawings , selection , layers , and other tools similar to a graphic design or photo editing software application . preferable parameters like direction , velocity , acceleration or decay rate , width , depth into defined sensory space ( s ) or distance out toward the illusory 140 , thickness , strength or intensity , temperature and texture , or the types of sensations the emotion events yield — cool breeze to needles , tension or release , a weighted feeling pulling down or an increasingly rapid rushing sensation up , the air off of a hot prairie fire blowing below your skin , or other case appropriate analogy , metaphor , or mixes relating the external to the internal and the internal experience to its meanings or symbolisms for any or known 120 , understood 110 , or ambient 130 sensation ( s ) but now as location , state , property , or attribute data — could be defined to configure components of a preferable representing model for an emotion experience 350 , 440 , 580 , 655 . much like how emotion can trigger or evolve to other emotion experiences in biological models like humans or other species such as canines , a preferable embodiment of the present invention could model what could be ideally characterized as a representation of an emotion experience transition 450 independently or in concert with other data , calculation , or processing from application , system , or instance relevant computing environments . fig7 is a flow chart example of how incoming data can be filtered by representations of preconception 720 , belief 730 , and construct 740 items in one embodiment of the present invention . a preferable embodiment of the present invention could model representing emotion experience transitions 450 like the excitement of a subject moving toward an outcome and the sudden disappointment of receiving that result . preferably , input data could filter through representations of any subject &# 39 ; s self - concept 740 , preconceptions 720 , or belief 730 data constructs to dynamically guide representations of emotion experience transitions 450 like anger turning to sadness or a subject &# 39 ; s fear releasing into gratitude . from the result of modeling representations of emotion experiences as data values throughout static or dynamic sensory spaces , a preferable embodiment of the present invention could concurrently , simultaneously , or sequentially interact with other applications , systems , devices , or instance relevant computing environments to include subjective experience or emotion data enhanced interpretation to computer environment activity like processes , data storage , calculations , decision models , or learning strategies 530 , 620 . in a preferable embodiment of the present invention , implementation and integration of these systems , methods , data , calculation , or processing from application , system , or instance relevant computing environments could be performed or managed on a case by case basis with or without any or all available devices , components , or applications which perform the recited functions . in a preferable embodiment of the present invention , a data model or structure could include one or more of the following to depict what could be characterized as a representation of defined sensory space 210 , 410 , 550 , 630 : preferably , one spatial unit identifier value preferably named space_unit_id to depict the identity of a unique designated building block unit 220 of defined sensory space 210 . preferably , one identifier value preferably named space_id to depict identity of any set defined sensory space 210 that this unique unit of designated defined sensory space 220 contributes to . preferably , three spatial coordinate values preferably named space_coord_x , space_coord_y , and space_coord_z to depict spatial locations for this designated building block unit . preferably , zero , one , or more property values to depict the group , order , kind , type , property , settings , or status this unit contributes with in the defined sensory space 210 . preferably two date values preferably named space_date_begin and space_date_end to depict any start date or end date values for scheduling . preferably , zero , one , or more community identifier value ( s ) preferably named community_space_id to depict identity of the community within an environment universe of application , system , or instance relevant computing environments that this space may contribute to . preferably , defined sensory space 210 items can be a member of or parent to other defined sensory space 210 items . data : emotion sensation instance 230 , 250 , 420 , 560 , 640 in a preferable embodiment of the present invention , a data model or structure could include one or more of the following to depict what could be characterized as a representation of an emotion sensation instance 230 , 250 , 420 , 560 , 640 : preferably , one designated spatial unit emotion sensation instance 230 , 250 identifier value preferably named instance_id to depict an identity of a unique emotion sensation instance 230 , 250 unit . preferably , one event identifier value preferably named event_id to depict identity of any available event that this unique instance contributes to . preferably , three spatial coordinate values preferably named instance_coord_x , instance_coord_y , and instance_coord_z to depict spatial locations for this unit in a defined sensory space 210 or out into the illusory 250 . preferably , zero , one , or more property values to depict any vector information , group , order , kind , type , property , settings , or status this unit contributes with . preferably , two date values preferably named instance_date_begin and instance_date_end to depict any start date or end date values for scheduling . preferably , emotion sensation instance 230 , 250 items can be a member of or parent to other emotion sensation instance 230 , 250 items . in a preferable embodiment of the present invention , a data model or structure could include one or more of the following to depict what could be characterized as a representation of an emotion sensation event 240 , 430 , 570 , 650 : preferably , one emotion sensation event 240 identifier value preferably named event_id to depict an identity of a unique emotion sensation event 240 or a grouping of emotion sensation instance 230 , 250 . preferably , zero , one , or more property value ( s ) to depict any vector information , kind , type , property , settings , or status this unit or grouping ( s ) contributes with . preferably , two date values preferably named event_date_begin or event_date_end to depict any start date or end date values for scheduling . preferably , emotion sensation event 240 items can be a member of or parent to other emotion sensation event 240 items . in a preferable embodiment of the present invention , a data model or structure could include one or more of the following to depict a representation of an emotion experience 440 , 580 , 655 : preferably , one emotion experience identifier value preferably named experience_id to depict an identity of a unique emotion sensation experience : one or more as a grouping of emotion sensation event 240 or one or more unique emotion sensation instance 230 , 250 . preferably , zero , one , or more property value ( s ) to depict the group , order , kind , type , property , settings , or status this unit or grouping ( s ) contributes with . preferably , two date values preferably named experience_date_begin and experience_date_end to depict any start date or end date values for scheduling . preferably , emotion experience items can be a member of or parent to other emotion experience items . in a preferable embodiment of the present invention , a data model or structure could include one or more of the following to depict what could be characterized as a representation of an emotion experience transition 450 : preferably , one emotion transition identifier value preferably named transition_id to depict an identity of a unique transition between emotion sensation experiences , emotion sensation events 240 , or unique emotion sensation instance ( s ) 230 , 250 . preferably , zero , one , or more property value ( s ) to depict the group , order , kind , type , property , settings , or status of this transition within the sensory space . preferably two date values preferably named transition_date_begin and transition_date_end to depict any start date or end date values for scheduling . preferably , emotion experience transition 450 items can be a member of or parent to other emotion experience transition 450 items . in a preferable embodiment of the present invention , a data model or structure could include one or more of the following to depict what could be characterized as a representation of a construct with data that , preferably , could hold representation to subjectively held ideas like self - concept 740 , preconceptions 720 , or belief 730 : preferably , one construct identifier value preferably named construct_id to depict an identity of a unique construct . preferably , zero , one , or more property value ( s ) to depict the group , order , kind , type , property , weight , settings , or status of this construct within the sensory space . preferably two date values preferably named construct_date_begin and construct_date_end to depict any start date or end date values for scheduling . preferably , construct items can be a member of or parent to other construct items . data : community ; in a preferable embodiment of the present invention , a data model or structure could include one or more of the following to depict what could be characterized as a representation of a community . data that , preferably , could represent groups of defined sensory space 210 within an environment universe of application , system , or instance relevant computing environments : preferably , one community identifier value preferably named community_id to depict an identity of a unique community . preferably , zero , one , or more property value ( s ) to depict the parent , group , order , kind , type , property , settings , or status of this community within an environment universe of application , system , or instance relevant computing environments . preferably two date values preferably named community_date_begin and community_date_end to depict any start date or end date values for scheduling . preferably , community items can be a member of or parent to other community items . worlds await exploration and a history full of disclosures relevant to the areas of processing , interpreting , or incorporating modeled representations of emotion and subjective experience data prepares to be written . when interpreting or processing items in a virtual representation of subjective emotion experience 655 as a component to other data , calculation , or processing from application , system , or instance relevant computing environments 620 , in a preferable embodiment of the present invention , it could be beneficial to use the analogy of a wall in how the known 120 , understood 110 , and ambient 130 emotion sensations as a subject experiences them can often act as the only perceptible division between the idea of a subject &# 39 ; s self and the external . therefore , a preferable embodiment of the present invention could be viewed as a virtual container , a vehicle for transport , a complimentary feedback system , or a series of filters for other systems and methods relevant to data , calculation , processing or learning algorithms that may or may not occur within . | 6 |
a simplified block diagram is illustrated in fig1 in which the structure and the operation of the pulse shaper are set forth . the data for the baseline pulse voltage , the voltage amplitude , and the rise and fall times for the leading and trailing edges of the pulses arrive over a data bus dab at preparation inputs of flip - flop memories 3 , 4 , 7 and 8 . four mutually - independent transfer clocks ut load the data into the corresponding flip - flop memories . the outputs of the flip - flop memories 3 , 4 , 7 and 8 respectively drive a digital / analog converter 1 , 2 , 5 and 6 , whereby the digital / analog converters 1 and 2 , for generating the amplitude and the base line pulse voltage generate respective binarily - graduated constant currents at their outputs and the digital / analog converters 5 and 6 determine the rise and fall times for the leading and trailing edges of the pulse . with the assistance of a resistor r169 , a current - proportional voltage amplitude is generated at the output of the digital / analog converter 2 , the voltage amplitude being supplied to an operational amplifier op8 . the base line voltage is emitted at the output of the operational amplifier op8 , which serves as an impedance converter . a current - proportional voltage likewise arises at a resistor r77 which is disposed at the output of the digital / analog converter 1 , the voltage controlling a constant current source comprising an operational amplifier op1 and a transistor t25 . the constant current generated at the collector of the transistor t25 flows through a resistor r82 . since the resistor r82 is connected at one side with the line for the base line voltage , its voltage drop is added , floating with respect to the base line voltage . an operational amplifier op6 , which is likewise connected as an impedance converter , senses this voltage and forms the amplitude voltage therefrom . by way of this circuit arrangement it is achieved that the programmed amplitude voltage always remains constant relative to the baseline voltage , i . e . when the baseline voltage changes , then the amplitude voltage also changes absolutely by the same amount . by way of a pair of zener diodes zd4 / dz3 or zd2 / zd1 , the base line voltage is applied to a wheatstone bridge 9 comprising a plurality of resistors r51 , r52 / r53 , r54 and r144 , r145 / r143 , r146 . in fig1 and 2 , the voltage in the diagonal branch of the wheatstone bridge 9 is tapped across a pair of operational amplifiers op12 / op10 or , respectively , op5 / op2 , whereby the operational amplifier op12 together with a transistor t65 and a operational amplifier op2 together with the transistor t23 respectively form a constant voltage source , the operational amplifier op10 with a transistor t71 and the operational amplifier op5 together with a transistor t24 , by contrast , operates as a constant current source by way of resistors of digital / analog converters 5 , 6 for the leading and trailing edges of the pulses . it is achieved by the above measures that the constant current at the collectors of the transistors t24 or , respectively , t71 change only with respect to the shift voltage u hub , but are not influenced by the variation of the base voltage u baseline . this is advantageous because , given variation of the shift voltage , the edge current should behave proportionally to the shift voltage according to where t f1 is the edge duration , c t is the capacitance of the capacitor c t and j fl is the charge current , if one wishes to obtain a shift - independent edge duration of the pulse . the basic value of the current - defining resistance r vfl / r rfl therefore , is set by the digital / analog converters 5 , 6 ; the shift - dependent current control occurs by way of the diagonal bridge voltages of the wheatstone bridge 9 to be described in greater detail below . pairs of transistors t67 / t68 and t27 / t28 form two differential current switches which are respectively supplied on their emitter side by way of the transistors t71 and t24 with the shift - dependent constant current . the transistors t68 and t28 are alternately driven via a trigger pulse aj , so that current flows either across the transistors t68 or across the transistor t28 . this current charges a capacitor c t until one of two amplitude limiting diodes d12 or d34 becomes conductive and diverts the current towards constant voltage sources comprising components t70 / op9 or , respectively , t30 / op7 . the above constant voltage sources are controlled across the resistors r89 and r148 directly by the pulse base voltage u baseline or , respectively , shift voltage u hub . further , the error of the amplitude limiter voltage caused by the parasitic forward voltage of the limiter diodes d12 and d34 is identified by way of pairs of diodes d33 and d11 and is compensated by the operational amplifiers op7 or , respectively , op9 . this is possible because , in the final analysis , the same current flows through the diodes d33 and d11 as flows through the limiter diodes d12 and d34 , the same forward voltage thus also occurs given diodes of the identical type . while by - passing the diodes d12 and d34 , the transistors t67 and t27 see to it that the constant voltage sources with the transistors t30 or , respectively , t70 are always loaded with the same current during the switching intervals as in the limiting case . by so doing , undesired voltage fades given load jumps are largely avoided due to the finite internal resistance at the constant voltage sources with the transistors t30 and t70 . the pulse shaper signal e1 which has been completely edited as to its pulse parameters and as it arrives at the input of the output stage , now lies at the capacitor c t . the output stage , for example , represents a bipolar voltage follower having the voltage transformation ratio 1 : 1 . when the trigger pulse is reversed ( see fig2 ), and when an input b58 is ` 1 ` and and input b59 is ` 0 `, then there applies ## equ1 ## b t . sbsb . 1 = gain of the transistor t 1 j c ( t 2 )= 0 , because the transistor t 2 is not conducting ## equ2 ## b t . sbsb . 43 = gain of the transistor t 43 j c ( t 42 )= 0 because the transistor t 42 is not conducting by way of the voltage drop at a pair of resistors r83 / r84 or , respectively , r132 / r133 , the above collector currents j c supply the differential drive signal for the transistors t26 , t27 , t28 , t29 or , respectively , t66 , t67 , t68 , t69 . the voltage drop at the resistors r47 and r136 forms the offset . the transistors t26 and t29 or , respectively , t66 and t69 respectively together form a differential current switch whose collector current is determined by the relationships : ## equ3 ## the collector currents j c of the transistors t26 and ( t66 ) cause a voltage drop at the resistors r85 and r134 , the voltage drop serving to generate an additional , dynamic cut - off voltage ( addition of the collector currents of the transistors t26 / t27 or , respectively , t66 / t67 ) at the diodes d12 and d34 in the case of transfer . were this measure not undertaken , then , in the limiting case , the respectively saturated , conductive limiting diode d12 or d34 , given slow edge rise times ( δ small reversal currents for the capacitor c t ), would more quickly discharge the capacitor c t in the first moment upon transfer than is desired by means of the programmed reversal current , which would lead to a non - linear edge shape . the semiconductor combination t27 / t28 and t67 / t68 is respectively interconnected with the transistors t24 and t74 to form a cascade stage , so that the following collector voltage derives : the transistors t24 and t71 respectively form constant current sources whose collector currents are determined by the relationships : ## equ4 ## thereby : b t . sbsb . 24 = gain of the transistor t 24 ; u op2 3 = input voltage at the operational amplifier op2 pin 3 ; u op5 3 = input voltage at the operational amplifier op5 pin 3 ; and r vfl = program resistance of the digital - to - analog converter 5 . ## equ5 ## thereby : b t71 = gain of the transistor t71 ; u op12 3 = input voltage at the operational amplifier op12 pin 3 ; u op10 3 = input voltage at the operational amplifier op10 pin 3 ; and in the above equations , the differential voltages u op2 3 - u op5 3 or , respectively , u op12 3 - u op10 3 are respectively automatically followed independently of the shift , in contrast thereto , the programmable resistors r vfl and r rfl must be externally pre - set by the program as quasi - static basic values . it is guaranteed by means of this re - adjustment that the edge current changes in the same measure relative to the shift voltage according to the relationship as already mentioned , the outputs of the digital / analog converter 5 , 6 function as resistors for the leading edge or , respectively , trailing edge programming . since the programming occurs over ten bits , each digital / analog converter , abbreviated as dau , contains 10 binarilly - staggered resistance values dau 5 : r 7 / r 11 / r 15 / r 19 / r 23 / r 27 / r 31 / r 35 / r 39 / r 43 dau 6 : r 94 / r 98 / r 102 / r 106 / r 110 / r 114 / r 118 / r 122 / r 126 / r 130 , dau 5 : t 4 / t 6 / t 8 / t 10 / t 12 / t 14 / t 16 / t 18 / t 20 / t 22 dau 6 : t 45 / t 47 / t 49 / t 51 / t 53 / t 55 / t 57 / t 59 / t 61 / t 63 . further , each of the two digital / analog converters must be constructed floating because of the readjustment . this occurs by means of the transistors : dau 5 : t 3 / t 5 / t 7 / t 9 / t 11 / t 13 / t 17 / t 19 / t 21 dau 6 : t 44 / t 46 / t 48 / t 50 / t 52 / t 54 / t 56 / t 58 / t 60 / t 62 . which respectively function as power source switches and thus reshape the ov - related input level of the ttl drive logic into a current shift of constant magnitude with , for example , ## equ6 ## where u tt1 ` 1 ` is the control voltage for a ttl circuit when the input is a binary &# 34 ; 1 &# 34 ;. this current serves as the base current for the transistor t4 , so that the transistor t4 becomes saturated and becomes conductive except for the residual voltage u ce . in the cut - off case , the resistors r4 and r6 clear the base charges in that they clamp the bases of the transistors t3 and t4 to emitter potential . the level converters of the remaining digital / analog converter bits operate analogously . the digital / analog converters for the basic voltage 2 and for the shift voltage 1 exhibit a current source output whose output currents are binarilly weighted . since the current source outputs must be loaded toward 0 volts , on the one hand , and , on the other hand , the currents must be converted into voltages with the necessary d . c . offset , it is necessary to insert a pair of operational amplifiers op1 or , respectively , op8 , whose output voltage behaves as follows : u aop 1 = j adau · r 78 +( 12 · r 78 )/ r 76 where j adau is the output current from the converter 1 , and ## equ7 ## where i adau is the output current from the converter 2 . the output voltage of the operational amplifier op8 can be directly employed as the pulse basic voltage , since the operational amplifier op8 simultaneously operates as an impedance converter and the output voltage is therefore sufficiently loadable . the output voltage of the operational amplifier op1 serves as the control voltage for the constant current source comprising the operational amplifier op3 and the transistor t25 , for whose output current there applies : ## equ8 ## thereby : u k 1 = output voltage of a constant voltage source k1 u op3 3 = input voltage at the operational amplifier op3 pin 3 the collector current j c of the transistor t25 flows through the resistor r82 which is in turn connected to the pulse basic voltage . the voltage at the input of an operational amplifier op6 is thus determined by the expression the operational amplifier op6 operates as a voltage follower and an impedance converter ; its output generates the shift voltage . the output voltage of the constant voltage source k1 can be slightly changed by a potentiometer p1 , whereby there is a possibility of setting the d . c . offset of the shift voltage relative to the pulse basic voltage . basic voltage and shift voltage control two wheatstone bridges whose diagonal voltages behave as follows : ## equ9 ## the above voltages respectively serve as guidance voltages for the edge current sources . the effects of temperature of the components are compensated by the arrangement of the components in a bridge circuit since the guidance voltages arise differentially . by way of the resistors r89 and r148 , respectively , the pulse voltage and the shift voltage directly control a respective constant voltage source comprising the components op7 / t30 or , respectively , op9 / t70 . these two voltage sources generate the limiting voltages for the amplitude limiting diodes d12 and d34 . after the limiter current either flows across the resistor r85 and the diode d12 , or across the resistor 134 and the diode d34 , there occurs an error with respect to the limiting voltage of : this error is compensated in that the same error voltage drop is intentionally generated at the resistor / diode combinations r44 / d11 or , respectively , r131 / d33 ( the same limiter current flows through these components ), and is communicated in equiphase to the inputs of the operational amplifier op9 or , respectively , op7 by an inverse feedback , via the resistors r87 / r88 or , respectively , r142 / r149 . the operational amplifiers thereby automatically adjust the respective limiting voltage by the amount of the error . the capacitors c4 , c5 , c6 , c10 , c11 , c12 , c13 , c14 serve for frequency compensation ; they prevent an oscillation given re - programming of the limiting voltages . the guidance voltages for the power supply of the output stage are tapped behind the zener diodes zd2 and zd4 . fig3 and 4 illustrate the digital portion 3 , 4 , 7 , 8 of the pulse shaper . the parameter data arrive in parallel at the preparation inputs of the d - flip flops j7 , j8 , j10 - j18 via the inputs a3 - a12 , b41 , b46 , b49 - b54 , b56 , b57 and by way of the inverter gates j2 , j3 , j4 , j19 , j23 , j24 . a transfer clock ( at the inputs a14 , a15 , b47 , b48 ) now controls ten repective parallel clodk inputs of the above d - flip - flops by a power inverter , the outputs of the d - flip - flops leading directly to the corresponding dau &# 39 ; s in the analog portion . so that the parameter data are properly accepted into the flip - flops , it is necessary that the respective transfer clock be no narrower than 20 ns and that a minimum preparation time of 20 ns of the parameter data with respect to the negative edge of the transfer clock not be fallen below . the change - over of the output resistance occurs via a relay i driven by the flip - flop j20 . given simultaneous activation of elembf21 - n and relrtakt - n , the flip - flop j20 is set , which effects the output resistance ≦ 3ω . given simultaneous activation of elembf22 - n and relrtakt - n , the flip - flop j20 is reset , whereby the output resistance 100ω is switched on . the pulse shaper output is fundamentally switched on or off with the relay ii via the flip - flop j20 . for this purpose , either elembf21 - n and relrtakt - n must be activated , which means connection of the pulse shaper output , or elembf24 - n and relrtakt - n must be activated , which means disconnection of the pulse shaper output . both flip - flops j20 are reset independent of the programming by a reset signal relrueck1 - p , i . e . the pulse shaper output resistance δ100ω and the pulse shaper output are switched off . the output pulse is distributed to five mutually independent output pins a50 , b11 , a58 , a55 and b10 by the relays iii , iv , v , vi and vii . the above relays are controlled by the flip - flops j5 and j6 , whereby the flip - flops j5 ( d - flip - flop ) accept the information of elembf - 21n - elembf - 24n via the transfer clock zelrtakt - n , in contrast whereto the flip - flops j6 is set or , respectively , reset by elembf19 - 9 , or respectively , elembf20 - n in coincidence to relrtakt - n . further , the flip - flop j6 can also be reset independently of the programming via relrueck2 - p . although i have described my invention by reference to particular illustrative embodiments thereof , many changes and modifications of the invention may become apparent to those skilled in the art without departing from the spirit and scope of the invention . i therefore intend to include within the patent warrented hereon all such changes and modifications as may reasonably and properly be included within the scope of my contribution to the art . | 7 |
in one narrower aspect , the invention involves a blend of at least two such elastomers which have crystalline melting points at least 25 ° c . apart , in which a compatibilizing agent is present which acts to permit smooth melt processing of the two elastomers at one common temperature . the two elastomers comprise a major portion of the blend , i . e ., over 50 % by weight . the compatibilizer is a polyester thermoplastic elastomer composition containing an antioxidant , such as a secondary aromatic amine . the compatibilizer of choice is &# 34 ; hytrel g - 30hs &# 34 ; available from the dupont company . the secondary aromatic amine in this formulation is apparently carried by a soft polyester thermoplastic elastomer , and apparently has some amide polymer contained in it . the amount of the compatibilizer present in the blends should be at least 1 percent by weight , and should range between 1 and 10 percent , preferably 2 - 5 percent . the blends can contain other additives , e . g . colorants , such as carbon black , pigments , stabilizers and the like . the thermoplastic polyester elastomers are available from several sources . the ones used in the examples were obtained from the dupont company under the trademark &# 34 ; hytrel &# 34 ; thermoplastic polyester elastomers . in general thermoplastic polyester elastomers are prepared from terephthalic acids or esters , a polyalkylene ether glycol , such as poly ( tetramethylene ether ) glycol and lower alkyl diols , such as 1 , 4 - butanediol . in general the elastomer chain has two types of recurring units , one type composed of the terephthalic acid and the glycol and the other of the terephthalic acid and the diol . by being able to blend and extrude or injection mold various polyester elastomers , a blend of desired properties can be obtained in the extrudate . in cable jacketing applications where the jacket must be both hard and flame retardant , the preferred blend of thermoplastic copolyester elastomers will be between 2 - 35 percent by weight of a hard elastomer having a durometer d hardness of at least 55 , and between 65 - 98 percent by weight of a mixture of a softer elastomer having a durometer d hardness of less than 50 that contains a flame - retardant . the softer polymer component also contains the compatibilizer which is premixed with the softer polymer in amounts of 1 - 10 percent by weight of the compatibilizer and 99 - 90 percent of the softer elastomer to make a total of 100 percent . this premixing can be carried out by melt processing , preferably by melt extrusion . in one preferred embodiment , the major elastomer in the blend will be a hard thermoplastic polyester elastomer having a durometer d hardness of at least 60 and the other will be a softer thermoplastic copolyester elastomer having a durometer hardness of less than 50 . in a more preferred embodiment , the hard elastomer is hytrel ® 7246 having a durometer hardness of 70d and the soft elastomer is hytrel htr 8088 having a nominal durometer hardness of 46d . in these embodiments , the blend is useful as a protective coating or jacketing around electrical cables or wires , as for example , round cable , ribbon cable or the like . once the premix is prepared , it is dry - blended with the other elastomer or elastomers by a suitable method , e . g ., drum rolling , or the like . the resulting blend can then be melt processed by extrusion or injection molding . melting points can be determined by differential scanning calormeter at the endotherm peaks . durometer d hardness can be measured as described in astm - 2240 - 85 using a pacific transducer corp . model h 3061 . 9 . 4 pounds ( 4 . 2 kg ) of a soft thermoplastic polyester elastomer ( hytrel ® htr 8068 which has a melting point of 169 ° c . and nominal durometer d hardness of 46d and which contains a flame - retardant was mixed by hand with 0 . 6 pounds ( 0 . 27 kg ) of a compatibilizing composition containing an antioxidant ( hytrel g30hs ) and then pelletized together through a one inch ( 2 . 54 cm ) extruder . 8 . 5 pounds ( 3 . 85 kg ) of the mixture was then mixed by hand with 1 . 2 pounds ( 0 . 54 kg ) of a hard thermoplastic polyester elastomer ( hytrel 5556 which has a melting point of 201 ° c . and a durometer d hardness of 55 ) which had been premixed by hand with 0 . 3 pounds ( 0 . 13 kg ) of a thermoplastic polyester elastomer containing carbon black ( hytrel 40cb ). the mixture so obtained was then extruded on a 1 1 / 2 inch ( 3 . 81 cm ) entwistle extruder onto an electrical cable . the extrudate was uniform in appearance and had good abrasion resistance . in this example , soft hytrel htr 8068 containing fire retardant and hytrel stabilizer g - 30hs were pelletized in the amounts shown in table 1 on a 1 inch ( 2 . 5 cm ) killian extruder . then hard hytrel 7246 and hytrel color concentrate were pelletized on the same extruder in the amounts shown in table 1 . the two pelletized mixtures were then extruded on a 1 1 / 2 inch ( 3 . 81 cm ) entwistle extruder onto a 1 inch ( 2 . 54 cm ) wide electrical cable . extrusion conditions are provided in table 2 . the cable was coated with polyurethane ( estane - 5703 ) adhesive prior to extrusion . table 1______________________________________soft hytrel 8086 6 . 9120 ( pounds ) heat stabilizer hytrel 30hs 0 . 2880 ( pounds ) hard hytrel 7246 0 . 6590 ( pounds ) color concentrate 40cb 0 . 1410 ( pounds ) hard hytrel / color concentrate % 9 . 1______________________________________ table 2______________________________________zone - 1 207 ° c . zone - 2 211 ° c . zone - 3 218 ° c . zone - 4 222 ° c . zone - 5 226 ° c . zone - 6 227 ° c . zone - 7 230 ° c . screw speed rpm 30______________________________________ abrasion resistance , flame retardancy and static dissipation were all good values , and the extruded polyester elastomer blends were all uniform in appearance with no discernable lumps . | 2 |
as noted above , compounds for inhibiting or preventing melanin formation in skin have been discovered for the treatment of various melanin - associated conditions . for example , the compound can be used as a “ vanity ” product , to lighten the skin of an individual , especially of dark skinned individuals . alternatively , the compound can be used to reduce uneven pigmentation marks and surface color irregularities , or to diminish pigmented skin blemishes such as freckles and age spots and hyperpigmentation - related medical conditions such as melasma , ochronosis , and lentigo . the compounds can also be used to lighten hair when applied to skin containing pigmented hair follicles , and to lessen postinflammatory hyperpigmentation resulting from trauma or invasive surgery from a face lift , laser treatment , or cosmetic surgery . the active or functional compounds can also be used to reduce skin pigmentation in normal skin adjacent to areas affected by vitiligo , thereby diminishing the contrast in color between normal and vitiligo affected skin . the invention thus provides a method for lightening mammalian skin that includes applying or otherwise administering an effective treatment amount of an active skin - lightening compound selected from a benzimidazole , a phenylthiourea , a phenylthiol , a bi - or multicyclic phenol , thiopheneamine , a benzothiamide , a phenylamine , or a pharmaceutically acceptable salt or ester thereof , optionally in a pharmaceutically acceptable carrier , to a mammalian subject in need thereof . the invention also includes a pharmaceutical composition for topical or general systemic administration , including oral , intradermal , transdermal , occlusive patch , intraveneous , and parenteral formulations , that includes an effective pigment inhibiting amount of the compound . the present invention is principally concerned with compositions that inhibit mammalian tyrosinase activity , and which thus have medicinal and / or cosmetic value . however , the present invention can also extend to compounds that inhibit melanin formation within melanocytes through mechanisms other than tyrosinase activity . many of the compounds also possess other activities that are beneficial when integrated into the compositions of the present invention . for example , many of the compounds also absorb uv light , and can thus be used to block the harmful effects of the sun &# 39 ; s rays . some of the compounds also possess antioxidant properties , and thus can inhibit oxidative damage to the skin , or contribute to the stability of the formulation . furthermore , although unrelated to skin pigmentation per se , some of the compounds of the present invention may also inhibit tyrosine hydroxylase ( th ). this enzyme is structurally dissimilar from tryosinase , but also catalyzes the formation of dopa from tysosine . th is critical for the formation of catecolamines . therefore , some of the compounds of the present invention which coincidentally inhibit th activity may have utility in reducing catecholamine biosynthesis , for instance for use as inhibitor “ probes ” in laboratory experiments where reduction in catacholamine pools is desirable . [ 30 - 32 ] in a first principal embodiment the compounds of the present invention are benzimidazolethiol and phenylthiourea related compounds represented by the following formula ( i ): a . r 1 is h or a valence for bonding ; d . r 4 , r 5 , r 4 , and r 7 are independently cr 8 , or n ; e . r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( vi ) — nhso 2 — c 1 - 3 alkyl , ( vii ) — nhco — c 1 - 5 alkyl , ( viii ) oxime , ( ix ) hydrazine , ( x ) — nr 9 r 10 , ( xi ) hso 2 , ( xii ) hso 3 , ( xiii ) thio - c 1 - 5 alkyl , ( xiv ) c 1 - 5 acyloxy , ( xv ) h 2 po 3 , ( xvi ) thiol , ( xvii ) — coor 9 , ( xviii ) c 1 - 5 alkynyl , or ( xix ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy ; g . r 10 is hydrogen , or c 1 - 5 alkyl optionally substituted with — oh ; i . r ′ is cr 8 , c ( r 8 ) 2 , n or nh , and forms a bond with r ″; ii . 1 or 2 of r 5 and r 6 are n or cor 10 other than coh , the remainder of r 4 , r 5 , r 6 and r 7 being ch ; and j . when r ″ is ch , r ′ is ch 3 or nh 2 . a first series of subembodiments of the first principal embodiment is defined when r 1 , r 2 , and r ′ are as defined above , r 4 , r 5 , r 6 , and r 7 are independently cr 8 , r ″ is ch , and : 1 ) r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 ) r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) cn , ( v ) — or 9 , ( viii ) — nr 9 r 9 , ( xi ) c 1 - 3 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 3 alkyl , — c 1 - 3 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 9 , c 1 - 3 thioether , or c 1 - 3 alkoxy , 3 ) r 8 is ( i ) hydrogen , ( ii ) halogen , ( v ) or 9 , ( viii ) — n 9 r 9 , ( xii ) thiol , or ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 ; 4 ) r 8 is c 1 - 3 alkyl ; 5 ) r 8 is or 10 or or 9 ; or 6 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , c ( cf 3 ), and c ( chchbr ). a second series of subembodiments of the first principal embodiment is defined when r 1 , r 2 , and r ′ are as defined above , r ″ is ch , and : 1 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( vi ) — nr 9 r 10 , ( vii ) c 1 - 5 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) — or 9 , ( iv ) — oh , ( v ) — nr 9 r 9 , ( vi ) thiol , or ( vii ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 ; 3 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r 8 is c 1 - 3 alkyl ; 4 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is or 9 , and 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch ; or 5 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , c ( cf 3 ), and c ( chchbr ), and 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch . a third series of subembodiments of the first principal embodiment is defined when r 1 and r 2 are as defined above , r ″ is ch , and : 1 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , and r ′ is nh 2 ; 2 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 or 3 of r 4 , r 5 , r 6 and r 7 are ch , and r ′ is nh 2 ; 3 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( v ) — or 9 , ( vii ) — oh , ( viii ) — nr 9 r 9 , ( xii ) thiol , or ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is nh 2 ; 4 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is c 1 - 3 alkyl , or 10 , or or 9 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is nh 2 ; 5 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , ccf 3 , and c ( chchpbr ), 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch ; and r ′ is nh 2 ; 6 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , and r ′ is ch 3 ; 7 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is ch 3 ; 8 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( v ) — or 9 , ( vii ) — oh , ( viii ) — nr 9 r 9 , ( xii ) thiol , or ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is ch 3 ; 9 ) r 4 , r 5 , r 6 , and r 7 are independently selected from c 8 , r 8 is r 8 is c 1 - 3 alkyl or or 9 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is ch 3 ; 10 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , ccf 3 , and c ( chchbr ), 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is ch 3 ; a fourth series of subembodiments of the first principal embodiment is defined when r 1 and r 2 are as defined above , r ″ is c , r ′ is n or nh , and : 1 ) 1 or 2 of r 5 and r 6 are cor 10 other than coh , the remainder of r 4 , r 5 , r 6 , and r 7 being ch ; 2 ) 1 or 2 of r 5 and r 6 are cor 9 other than coh , the remainder of r 4 , r 5 , r 6 , and r 7 being ch ; 3 ) 1 or 2 of r 5 and r 6 are n , the remainder of r 4 , r 5 , r 6 , and r 7 being ch ; 4 ) r 5 is cor 9 other than coh , and r 4 , r 6 , and r 7 are ch ; 5 ) r 6 is cor 9 other than coh , and r 4 , r 5 , and r 7 are ch ; or 6 ) r 5 and r 6 are cor 9 other than coh , and r 4 and r 7 are ch . a fifth series of subembodiments of the first principal embodiment are defined when r 1 and r 2 are as defined above , r ″ is c , r ′ is ch or ch 2 , and : 1 ) 1 or 2 of r 5 and r 6 are cor 10 other than coh , the remainder of r 4 , r 5 , r 6 , and r 7 being ch ; 2 ) 1 or 2 of r 5 and r 6 are cor 9 other than coh , the remainder of r 4 , r 5 , r 6 , and r 7 being ch ; 3 ) 1 or 2 of r 5 and r 6 are n , the remainder of r 4 , r 5 , r 6 , and r 7 being ch ; 4 ) r 5 is cor 9 other than coh , and r 4 , r 6 , and r 7 are ch ; 5 ) r 6 is cor 9 other than coh , and r 4 , r 5 , and r 7 are ch ; or 6 ) r 5 and r 6 are cor 9 other than coh , and r 4 and r 7 are ch . a first series of preferred species of the first principal embodiment are defined when r 1 and r 2 are as defined above , r ″ is c , r ′ is nh or n , and : 1 ) r 5 is coch 3 , and r 4 , r 6 , and r 7 are ch ; 2 ) r 6 is coch 3 , and r 4 , r 5 , and r 7 are ch ; 3 ) r 5 and r 6 are coch 3 , and r 4 and r 7 are ch ; a second series of preferred species of the first principal embodiment are defined when r 1 and r 2 are as defined above , r ″ is ch , r ′ is nh 2 , and : 1 ) r 4 , r 5 , r 6 , and r 7 are ch ; 2 ) r 4 is cch 3 , and r 5 , r 6 , and r 7 are ch ; 3 ) r 5 is cch 3 , and r 4 , r 6 , and r 7 are ch ; 4 ) r 6 is cch 3 , and r 4 , r 5 , and r 7 are ch ; 5 ) r 7 is cch 3 , and r 4 , r 5 , and r 6 are ch ; 6 ) r 4 is coch 3 , and r 5 , r 6 , and r 7 are ch ; 7 ) r 5 is coch 3 , and r 4 , r 6 , and r 7 are ch ; 8 ) r 6 is coch 3 , and r 4 , r 5 , and r 7 are ch ; 9 ) r 7 is coch 3 , and r 4 , r 5 , and r 6 are ch ; 10 ) r 4 is cf , and r 5 , r 6 , and r 7 are ch ; 11 ) r 5 is cf , and r 4 , r 6 , and r 7 are ch ; 12 ) r 6 is cf , and r 4 , r 5 , and r 7 are ch ; 13 ) r 7 is cf , and r 4 , r 5 , and r 6 are ch ; 14 ) r 4 is coh , and r 5 , r 6 , and r 7 are ch ; 15 ) r 5 is coh , and r 4 , r 6 , and r 7 are ch ; 16 ) r 6 is coh , and r 4 , r 5 , and r 7 are ch ; 17 ) r 7 is coh , and r 4 , r 5 , and r 6 are ch ; 18 ) 2 of r 4 , r 5 , r 6 are r 7 are cch 3 , and 2 of r 4 , r 5 , r 6 , and r 7 are ch ; 19 ) 2 of r 4 , r 5 , r 6 are r 7 are coch 3 , and 2 of r 4 , r 5 , r 6 , and r 7 are ch ; 20 ) 2 of r 4 , r 5 , r 6 are r 7 are cf , and 2 of r 4 , r 5 , r 6 , and r 7 are ch ; or 21 ) 2 of r 4 , r 5 , r 6 are r 7 are coh , and 2 of r 4 , r 5 , r 6 , and r 7 are ch ; a third series of preferred species of the first principal embodiment are defined when r ″ is ch , r ′ is ch 3 , and r 4 , r 5 , r 6 , and r 7 are as defined in any one of the second series of preferred species . in a second principal embodiment the compounds of the present invention are benzimidazoles and phenylthiourea related compounds represented by the following formula ( ii ): 1 ) r 1 is h ; 2 ) r 2 is selenium ; 3 ) r ″ is c or ch ; 4 ) when r ″ is c , r ′ is c ( r 8 ) 2 or nr 3 , and forms a bond with r ″; 5 ) when r ″ is ch , r ′ is ch 3 or nh 2 ; 6 ) r 4 , r 5 , r 6 , and r 7 are independently cr 8 , or n ; 7 ) r 3 is ( i ) substituted or unsubstituted alkyl , alkenyl , aryl , or heterocycle , ( ii ) — c 1 - 5 alkoxy , ( iii ) — oh , ( iv ) hydrogen , ( v ) c ( o )— c 1 - 3 alkyl , or ( vi ) —( ch 2 ) 1 - 5 c ( o ) nr 9 r 10 ; 8 ) r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( vi ) — nhso 2 — c 1 - 3 alkyl , ( vii ) — nhco — c 1 - 5 alkyl , ( viii ) oxime , ( ix ) hydrazine , ( x ) — nr 9 r 10 , ( xi ) hso 2 , ( xii ) hso 3 , ( xiii ) thio - c 1 - 5 alkyl , ( xiv ) c 1 - 5 acyloxy , ( xv ) h 2 po 3 , ( xvi ) thiol , ( xvii ) — coor 9 , ( xviii ) c 1 - 5 alkynyl , or ( xix ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy ; 9 ) r 9 is hydrogen or c 1 - 3 alkyl ; and 10 ) r 10 is hydrogen , or c 1 - 5 alkyl optionally substituted with — oh . a first series of subembodiments of the second principal embodiment are defined when r 1 , r 2 , r ′ and r ″ are as defined above , r 4 , r 5 , r 6 and r 7 are cr 8 , and : 1 ) r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy ; 2 ) r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 9 , ( viii ) — nr 9 r 9 , ( xi ) c 1 - 3 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 3 alkyl , — c 1 - 3 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 9 , c 1 - 3 thioether , or c 1 - 3 alkoxy ; 3 ) r 8 is ( i ) hydrogen , ( ii ) halogen , ( v ) — or 9 , ( viii ) — nr 9 r 9 , ( xii ) thiol , or ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 ; 4 ) r 8 is c 1 - 3 alkyl ; 5 ) r 8 is or 10 or or 9 ; or 6 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , ccf 3 , and c ( chchbr ). a second series of subembodiments of the second principal embodiment is defined when r 1 , r 2 , r ′ and r ″ are as defined above , and : 1 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( vi ) — nr 9 r 10 , ( vii ) c 1 - 5 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) — or 9 , ( iv ) — oh , ( v ) — nr 9 r 9 , ( vi ) thiol , or ( vii ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 ; 3 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r 8 is c 1 - 3 alkyl ; 4 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is or 9 , and 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch ; and 5 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , ccf 3 , and c ( chchbr ), and 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch . a third series of subembodiments of the second principal embodiment are defined when r 1 and r 2 are as defined above , r ″ is c , and : 1 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , and r ′ is nr 3 ; 2 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 or 3 of r 4 , r 5 , r 6 and r 7 are ch , and r ′ is nr 3 ; 3 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( v ) — r 9 , ( vii ) — oh , ( viii ) — nr 9 r 9 , ( xii ) thiol , or ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is nr 3 ; 4 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is r 8 is c 1 - 3 alkyl or or 9 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is nr 3 ; 5 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , ccf 3 , and c ( chchbr ), 2 or 3 of r 4 , r 5 , and r 7 are ch ; and r ′ is nr 3 ; 6 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r ′ is nr 3 , and r 3 is hydrogen , or c 1 - 5 alkyl optionally substituted with — oh ; 7 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , r ′ is nr 3 , and r 3 is hydrogen , or c 1 - 5 alkyl optionally substituted with — oh ; 8 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( v ) — or 9 , ( vii ) — oh , ( viii ) — nr 9 r 9 , ( xii ) thiol , or ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , r ′ is nr 3 , and r 3 is hydrogen , or c 1 - 5 alkyl optionally substituted with — oh ; 9 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is r 8 is c 1 - 3 alkyl or or 9 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , r ′ is nr 3 , and r 3 is hydrogen , or c 1 - 5 alkyl optionally substituted with — oh ; 10 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , ccf 3 , and c ( chchbr ), 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch ; r ′ is nr 3 ; and r 3 is hydrogen , or c 1 - 5 alkyl optionally substituted with — oh ; 11 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r ′ is nr 3 , and r 3 is hydrogen or c 1 - 3 alkyl ; 12 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , r ′ is nr 3 , and r 3 is hydrogen or c 1 - 3 alkyl ; 13 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( v ) — or 9 , ( vii ) — oh , ( viii ) — nr 9 r 9 , ( xii ) thiol or ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , r ′ is nr 3 , and r 3 is hydrogen or c 1 - 3 alkyl ; 14 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is r 8 is c 1 - 3 alkyl or or 9 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , r ′ is nr 3 , and r 3 is hydrogen or c 1 - 3 alkyl ; or 15 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , ccf 3 , and c ( chchbr ), 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch ; r ′ is nr 3 , and r 3 is hydrogen or c 1 - 3 alkyl . a fourth series of subembodiments of the second principal embodiment is defined when r 1 and r 2 are as defined above , r ″ is ch , and : 1 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , and r ′ is nh 2 ; 2 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) ( n , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is nh 2 ; 3 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( v ) — or 9 , ( vii ) — oh , ( viii ) — nr 9 r 9 , ( xii ) thiol , or ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is nh 2 ; 4 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is r 8 is c 1 - 3 alkyl or or 9 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is nh 2 ; 5 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , ccf 3 , and c ( chchbr ), 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch ; and r ′ is nh 2 ; 6 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , and r ′ is ch 3 ; 7 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , r ′ is nr 3 , and r ′ is ch 3 ; 8 ) r 4 , r 5 , r 6 , and r 7 are independently selected from cr 8 , r 8 is ( i ) hydrogen , ( ii ) halogen , ( v ) — or 9 , ( vii ) — oh , ( viii ) — nr 9 r 9 , ( xii ) thiol , or ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is ch 3 ; 9 ) r 4 , r 5 , r 6 , and r 7 are independently selected from c 8 , r 8 is r 8 is c 1 - 3 alkyl or or 9 , 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch , and r ′ is ch 3 ; and 10 ) r 4 , r 5 , r 6 , and r 7 are independently selected from ch , c ( oh ), c ( sh ), cnh 2 , c ( ch 3 ), c ( och 3 ), cf , ccf 3 , and c ( chchbr ), 2 or 3 of r 4 , r 5 , r 6 , and r 7 are ch ; and r ′ is ch 3 . a first series of preferred species of the second principal embodiment are defined when r 1 and r 2 are as defined above , r ″ is c , r ′ is nh , and : 1 ) r 4 , r 5 , r 6 , and r 7 are ch ; 2 ) r 4 is cch 3 , and r 5 , r 6 , and r 7 are ch ; 3 ) r 5 is cch 3 , and r 4 , r 6 , and r 7 are ch ; 4 ) r 6 is cch 3 , and r 4 , r 5 , and r 7 are ch ; 5 ) r 7 is cch 3 , and r 4 , r 5 , and r 6 are ch ; 6 ) r 4 is coch 3 , and r 5 , r 6 , and r 7 are ch ; 7 ) r 5 is coch 3 , and r 4 , r 6 , and r 7 are ch ; 8 ) r 6 is coch 3 , and r 4 , r 5 , and r 7 are ch ; 9 ) r 7 is coch 3 , and r 4 , r 5 , and r 6 are ch ; 10 ) r 4 is cf , and r 5 , r 6 , and r 7 are ch ; 11 ) r 5 is cf , and r 4 , r 6 , and r 7 are ch ; 12 ) r 6 is cf , and r 4 , r 5 , and r 7 are ch ; 13 ) r 7 is cf , and r 4 , r 5 , and r 6 are ch ; 14 ) r 4 is coh , and r 5 , r 6 , and r 7 are ch ; 15 ) r 5 is coh , and r 4 , r 6 , and r 7 are ch ; 16 ) r 6 is coh , and r 4 , r 5 , and r 7 are ch ; 17 ) r 7 is coh , and r 4 , r 5 , and r 6 are ch ; 18 ) 2 of r 4 , r 5 , r 6 are r 7 are cch 3 , and 2 of r 4 , r 5 , r 6 , and r 7 are ch ; 19 ) 2 of r 4 , r 5 , r 6 are r 7 are coch 3 , and 2 of r 4 , r 5 , r 6 , and r 7 are ch ; 20 ) 2 of r 4 , r 5 , r 6 are r 7 are cf , and 2 of r 4 , r 5 , r 6 , and r 7 are ch ; or 21 ) 2 of r 4 , r 5 , are r 7 are coh , and 2 of r 4 , r 5 , r 6 , and r 7 are ch ; a second series of preferred species of the second principal embodiment are defined when r ″ is ch , r ′ is nh 2 , and r 4 , r 5 , r 6 , and r 7 are as defined in any one of the first series of preferred species . a third series of preferred species of the present invention are defined when r ″ is ch , r ′ is ch 3 , and r 4 , r 5 , r 6 , and r 7 are as defined in any one of the first series of preferred species . in a third principal embodiment the compounds of the present invention are phenylthiol , phenylamine , and multicyclic - phenolic related compounds of the following structure ( iii ): 1 ) r 1 is ( ch 2 ) n sr 7 , ( ch 2 ) n nr 7 , or or 7 ; 2 ) n is 0 , 1 , 2 , or 3 , 3 ) r 2 , r 3 , r 4 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( vi ) — nhso 2 — c 1 - 3 alkyl , ( vii ) — nhco — c 1 - 5 alkyl , ( viii ) oxine , ( ix ) hydrazine , ( x ) — nr 9 r 10 , ( xi ) hso 2 , ( xii ) hso 3 , ( xiii ) thio - c 1 - 5 alkyl , ( xiv ) c 1 - 5 acyloxy , ( xv ) h 2 po 3 , ( xvi ) thiol , ( xvii ) — coor 9 , ( xviii ) c 1 - 5 alkynyl , or ( xix ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy , 4 ) alternatively , r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , pyridine , — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen , and —( ch ) n ″ — xh — wherein n ″ is 2 and x is as defined above ; 5 ) r 7 is ( i ) substituted or unsubstituted alkyl , alkenyl , aryl , or heterocycle , ( ii ) — c 1 - 5 alkoxy , ( iii ) hydrogen , ( iv ) c ( o )— c 1 - 3 alkyl , or ( v ) —( ch 2 ) m c ( o ) nr 9 r 10 ; 6 ) r 9 is hydrogen or c 1 - 3 alkyl ; 7 ) r 10 is hydrogen , or c 1 - 5 alkyl optionally substituted with — oh ; 8 ) m is 1 , 2 , 3 , 4 , or 5 ; and 9 ) provided that when r 1 is or 7 , r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , pyridine , — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen , and —( ch ) n ″ xh — wherein n ″ is 2 and x is as defined above . a first series of subembodiments of the third principal embodiment are defined when r 1 is ( ch 2 ) sr 7 , n is 0 , 1 , 2 , or 3 but preferably 0 , and : 1 ) r 2 , r 3 , r 4 , r 5 and r 6 are as defined above , and r 7 is hydrogen , c 1 - 5 alkyl optionally substituted with — oh , or c ( o ) c 1 - 3 alkyl ; 2 ) r 2 , r 3 , r 4 , r 5 and r 6 are as defined above , and r 7 is hydrogen , c 1 - 3 alkyl , or c ( o ) c 1 - 3 alkyl ; 3 ) r 2 , r 3 , r 4 , r 5 and r 6 are as defined above , and r 7 is hydrogen ; 4 ) r 2 , r 3 , r 4 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( viii ) — nr 9 r 10 , ( xi ) c 1 - 5 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , or ( xiv ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 9 , c 1 - 5 thioether , or c 1 - 5 alkoxy , or ( xv ) — nhco — c 1 - 5 alkyl ; and r 7 is as defined above ; 5 ) r 2 , r 3 , r 4 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 9 , ( viii ) — nr 9 r 9 , ( xi ) c 1 - 3 acyloxy , ( xii ) thiol , ( xiii ) coor 9 , ( xiv ) — c 1 - 3 alkyl , — c 1 - 3 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 9 , c 1 - 3 thioether , or c 1 - 3 alkoxy , or ( xv ) — nhco — c 1 - 3 alkyl ; and r 7 is as defined above ; 6 ) r 2 , r 3 , r 4 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( v ) — or 9 , ( viii ) — nr 9 r 9 , ( xii ) thiol , ( xiv ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 , or ( xv ) — nhco — c 1 - 3 alkyl ; and r 7 is as defined above ; 7 ) r 2 , r 3 , r 4 , r 5 and r 6 are independently selected from c 1 - 3 alkyl , or 9 , or — nhco — ch 3 aryl ; and r 7 is as defined above ; 8 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , pyridine , — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen , and —( ch ) n ″ xh — wherein n ″ is 2 and x is as defined above ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( vi — nr 9 r 10 , ( vii ) c 1 - 5 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy ; and r 7 is as defined above ; 9 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , pyridine , — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen , and — ch ) n ″ xh — wherein n ″ is 2 and x is as defined above ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 9 , ( vi ) — nr 9 r 9 , ( vii ) c 1 - 3 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 3 alkyl , — c 1 - 3 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 9 , c 1 - 3 thioether , or c 1 - 3 alkoxy , and r 7 is as defined above ; 10 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , pyridine , — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen , and —( ch ) n — x — wherein n ″ is 2 and x is as defined above ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) — or 9 , ( iv ) — nr 9 r 9 , ( v ) thiol , or ( vi ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 ; and r 7 is as defined above ; 11 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , pyridine , — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen , and —( ch ) n ″ xh — wherein n ″ is 2 and x is as defined above ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from c 1 - 3 alkyl or or 9 ; and r 7 is as defined above ; 12 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , and pyridine ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( vi ) — nr 9 r 10 , ( vii ) c 1 - 5 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy ; and r 7 is as defined above ; 13 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , and pyridine ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 9 , ( vi ) — nr 9 r 9 , ( vii ) c 1 - 3 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 3 alkyl , — c 1 - 3 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 9 , c 1 - 3 thioether , or c 1 - 3 alkoxy ; and r 7 is as defined above ; 14 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , or pyridine ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) — or 9 , ( iv ) — nr 9 r 9 , ( v ) thiol , or ( vi ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 ; and r 7 is as defined above ; 15 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from phenyl , cyclopentyl , cyclohexyl , pyrrole , furan , thiophene , pyrazole , or pyridine ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from c 1 - 3 alkyl or or 9 ; and r 7 is as defined above ; 16 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( vi ) — nr 9 r 10 , ( vii ) c 1 - 5 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy ; and r 7 is as defined above ; 17 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 9 , ( vi ) — nr 9 r 9 , ( vii ) c 1 - 3 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 3 alkyl , — c 1 - 3 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 9 , c 1 - 3 thioether , or c 1 - 3 alkoxy ; and r 7 is as defined above ; 18 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) — or 9 , ( iv ) — nr 9 r 9 , ( v ) thiol , or ( vi ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 ; and r 7 is as defined above ; 19 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from — x —( ch 2 ) n ′ — x — wherein n ′ is 1 and x is nitrogen , sulfur , or oxygen ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from c 1 - 3 alkyl or or 9 ; and r 7 is as defined above ; 20 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from —( ch ) n ″ xh — wherein n ″ is 2 and x is nitrogen , sulfur , or oxygen ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 10 , ( vi ) — nr 9 r 10 , ( vii ) c 1 - 5 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 5 alkyl , — c 1 - 5 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 10 , c 1 - 5 thioether , or c 1 - 5 alkoxy ; and r 7 is as defined above ; 21 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from —( ch ) n ″ xh — wherein n ″ is 2 and x is nitrogen , sulfur , or oxygen ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) no 2 , ( iv ) — cn , ( v ) — or 9 , ( vi ) — nr 9 r 9 , ( vii ) c 1 - 3 acyloxy , ( viii ) thiol , ( ix ) coor 9 , or ( x ) — c 1 - 3 alkyl , — c 1 - 3 alkenyl , aryl , heteroaryl , or heterocycle , optionally substituted with one or more of — oh , — sh , c ( o ) h , coor 9 , c 1 - 5 acyloxy , halogen , nr 9 r 9 , c 1 - 3 thioether , or c 1 - 3 alkoxy ; and r 7 is as defined above ; 22 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from — ch ) n ″ xh — wherein n ″ is 2 and x is nitrogen , sulfur , or oxygen ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from ( i ) hydrogen , ( ii ) halogen , ( iii ) — or 9 , ( iv ) — nr 9 r 9 , ( v ) thiol , or ( vi ) — c 1 - 3 alkyl or alkenyl optionally substituted with one or more of — oh , — sh , halogen , or nh 2 ; and r 7 is as defined above ; 23 ) ( a ) r 3 and r 4 , or r 4 and r 5 , combine to form a fused ring - structure which is cycloalkyl , aryl , or heterocyclic selected from —( ch ) n ″ xh — wherein n ″ is 2 and x is nitrogen , sulfur , or oxygen ; and ( b ) the remainder of r 2 , r 3 , r 5 and r 6 are independently selected from c 1 - 3 alkyl or or 9 ; and r 7 is as defined above ; a second series of subembodiments is defined when r 1 is ( ch 2 ) n sr 7 , n is 0 , 1 , 2 , or 3 , r 7 is c 1 - 5 alkyl optionally substituted with — oh , or c ( o ) c 1 - 3 alkyl ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . a subset of the second series of embodiments is defined when r 1 is sr 7 , r 7 is c 1 - 5 alkyl optionally substituted with — oh , or c ( o ) c 1 - 3 alkyl ; r 4 , is — nhco — c 1 - 3 alkyl ; and r 2 , r 3 , r 5 and r 6 are ch . a third series of subembodiments is defined when r 1 is ( ch 2 ) n sr 7 , n is 0 , 1 , 2 , or 3 , r 7 is c 1 - 3 alkyl , or c ( o ) c 1 - 3 alkyl ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . preferably , r 4 , is — nhco — c 1 - 3 alkyl ; and r 2 , r 3 , r 5 and r 6 are ch . a fourth series of subembodiments is defined when r 1 is ( ch 2 ) n sr 7 , n is 0 , 1 , 2 , or 3 , r 7 is hydrogen ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . preferably , r 4 , is — nhco — c 1 - 3 alkyl ; and r 2 , r 3 , r 5 and r 6 are ch . a fifth series of subembodiments is defined when r 1 is sr 7 , r 7 is c 1 - 5 alkyl optionally substituted with — oh ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . preferably , r 4 , is — nhco — c 1 - 3 alkyl ; and r 2 , r 3 , r 5 and r 6 are ch . a sixth series of subembodiments is defined when r 1 is sr 7 , r 7 is c 1 - 3 alkyl ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . preferably , r 4 , is — nhco — c 1 - 3 alkyl ; and r 2 , r 3 , r 5 and r 6 are ch . a seventh series of subembodiments is defined when r 1 is sr 7 , r 7 is hydrogen ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . preferably , r 4 , is — nhco — c 1 - 3 alkyl ; and r 2 , r 3 , r 5 and r 6 are ch . an eighth series of subembodiments is defined when r 1 is ( ch 2 ) n nhr 7 , n is 0 , 1 , 2 , or 3 , r 7 is c 1 - 5 alkyl optionally substituted with — oh ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . a ninth series of subembodiments is defined when r 1 is ( ch 2 ) n nhr 7 , n is 0 , 1 , 2 , or 3 , r 7 is c 1 - 3 alkyl ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . an tenth series of subembodiments is defined when r 1 is ( ch 2 ) n nhr 7 , n is 0 , 1 , 2 , or 3 , r 7 is hydrogen ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . an eleventh series of subembodiments is defined when r 1 is nhr 7 , r 7 is c 1 - 5 alkyl optionally substituted with — oh ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . a twelfth series of subembodiments is defined when r 1 is nhr 7 , r 7 is c 1 - 3 alkyl ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . a thirteenth series of subembodiments is defined when r 1 is nhr 7 , r 7 is hydrogen ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 4 th through 23d subembodiments of the first series of subembodiments . an fourteenth series of subembodiments is defined when r 1 is or 7 , r 7 is c 1 - 5 alkyl optionally substituted with — oh ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 8 th through 23d subembodiments of the first series of subembodiments . a fifteenth series of subembodiments is defined when r 1 is or 7 , r 7 is c 1 - 3 alkyl ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 8 th through 23d subembodiments of the first series of subembodiments . a sixteenth series of subembodiments is defined when r 1 is or 7 , r 7 is hydrogen ; and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of the 8 th through 23d subembodiments of the first series of subembodiments . a first series of species of the second principal embodiment are defined when r 1 is sh or sc ( o ) ch 3 , and : 1 ) r 2 is och 3 , and r 3 , r 4 , r 5 and r 6 are ch . 2 ) r 3 is och 3 , and r 2 , r 4 , r 5 and r 6 are ch . 3 ) r 4 is och 3 , and r 2 , r 3 , r 5 and r 6 are ch . 4 ) r 5 is och 3 , and r 2 , r 3 , r 4 and r 6 are ch . 5 ) r 6 is och 3 , and r 2 , r 3 , r 4 and r 5 are ch . 6 ) 2 of r 2 , r 3 , r 4 , r 5 , and r 6 are och 3 , and the remainder of r 2 , r 3 , r 4 , r 5 , and r 6 are ch . 7 ) r 2 is sch 3 , and r 3 , r 4 , r 5 and r 6 are ch . 8 ) r 3 is sch 3 , and r 2 , r 4 , r 5 and r 6 are ch . 9 ) r 4 is sch 3 , and r 2 , r 3 , r 5 and r 6 are ch . 10 ) r 5 is sch 3 , and r 2 , r 3 , r 4 and r 6 are ch . 11 ) r 6 is sch 3 , and r 2 , r 3 , r 4 and r 5 are ch . 12 ) 2 of r 2 , r 3 , r 4 , r 5 , and r 6 are sch 3 , and the remainder of r 2 , r 3 , r 4 , r 5 , and r 6 are ch . 13 ) r 2 is nhc ( o ) ch 3 , and r 3 , r 4 , r 5 and r 6 are ch . 14 ) r 3 is nhc ( o ) ch 3 , and r 2 , r 4 , r 5 and r 6 are ch . 15 ) r 4 is nhc ( o ) ch 3 , and r 2 , r 3 , r 5 and r 6 are ch . 16 ) r 5 is nhc ( o ) ch 3 , and r 2 , r 3 , r 4 and r 6 are ch . 17 ) r 6 is nhc ( o ) ch 3 , and r 2 , r 3 , r 4 and r 5 are ch . a second series of preferred species are defined when r 1 is nh 2 , and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of species 1 - 17 of the first series of preferred embodiments . a third series of preferred species are defined when r 1 is nhc ( o ) ch 3 , and r 2 , r 3 , r 4 , r 5 and r 6 are as defined in any one of species 1 - 17 of the first series of preferred embodiments . in a fourth principal embodiment the compounds of the present invention are defined by structures ( iv ) or ( v ): 1 ) r 1 , r 2 , and r 3 are independently ( i ) substituted or unsubstituted alkyl , alkenyl , aryl , or heterocycle , ( ii ) hydrogen , ( iii ) c ( o )— c 1 - 3 alkyl , or ( iv ) —( ch 2 ) 1 - 5 c ( o ) nr 9 r 10 ; 2 ) r 9 is hydrogen or c 1 - 3 alkyl ; 3 ) r 10 is hydrogen , or c 1 - 5 alkyl optionally substituted with — oh ; 4 ) y and y ′ are independently oxygen or sulfur , 5 ) x is oxygen , sulfur , or nitrogen ; and 6 ) r 4 is c 1 - 5 alkyl , optionally substituted by — oh , or nr 9 r 9 . a first series of subembodiments of the fourth principal embodiment are defined by structure ( iv ) when y and y ′ are as described above , and : 1 . r 1 is hydrogen , and r 2 and r 3 are c 1 - 5 alkyl optionally substituted with — oh ; and 2 . r 1 is hydrogen , and r 2 and r 3 are hydrogen or c 1 - 3 alkyl . a second series of subembodiments of the fourth principal embodiment are defined by structure ( v ) when : 1 . x is sulfur , r 1 is hydrogen , and r 2 is c 1 - 5 alkyl optionally substituted with — oh ; 2 . x is sulfur , r 1 is hydrogen , and r 2 is hydrogen or c 1 - 3 alkyl ; 3 . x is sulfur , r 1 is hydrogen , r 2 is c 1 - 5 alkyl optionally substituted with — oh ; and r 4 is unsubstituted ( ch 2 ) 1 - 5 ; or 4 . x is sulfur , r 1 is hydrogen , r 2 is hydrogen or c 1 - 3 alkyl , and r 4 is unsubstituted ( ch 2 ) 1 - 3 . preferred species are defined for structure ( iv ) when y is sulfur , y ′ is oxygen , r 1 and r 2 are hydrogen , and r 3 is methyl , and for structure ( v ) when x is sulfur , r 4 is ethylene and r 1 and r 2 are hydrogen . the compounds of this invention can be optionally substituted with substituents that do not adversely affect the activity of the compound as a skin lightener . nonlimiting examples of substituents include , but are not limited to , alkyl ( including lower alkyl ), heteroalkyl , aryl , heterocyclic ( including heteroaryl and heterocycloalkyl ), halo , hydroxyl , carboxyl , acyl , acyloxy , amino , alkylamino , arylamino , alkoxy , aryloxy , alkylthio , alkylamido , nitro , cyano , sulfonic acid , sulfate , phosphonic acid , phosphate , or phosphonate , either unprotected , or protected as necessary , as known to those skilled in the air , for example , as taught in greene , et al ., protective groups in organic synthesis , john wiley and sons , second edition , 1991 . it will be understood that the present invention also covers “ prodrugs ” for such compositions , and pharmaceutically acceptable salts and esters thereof . in the present invention , one or all of three in vitro bioassays can be utilized to evaluate the efficacy and toxicity of candidate skin - lightening compounds . the three bioassays characterize the compounds with regard to mammalian tyrosinase enzyme inhibition ( cell free ), pigmentation in melanocyte cultured cells , and cytotoxicity of mammalian cultured cells . both cell - based pigmentation and cell - free enzymatic assays have been developed [ 5 , 6 , 25 ] using the mammalian melanocyte cell line , mel - ab , a c57bl / 6 mouse - derived cell line that produces high levels of melanin . [ 21 ] a distinct advantage of this approach is that humans share substantial sequence similarities in their genes ( dna ) and proteins ( such as tyrosinase ) with mice , relative to non - mammalian species ( e . g ., mushrooms ). so , mouse mel - ab melanocytes can serve as adequate surrogates for human melanocytes for many pharmacologic purposes . these adherent murine melanocytes are grown on tissue culture plastic in medium supplemented with fetal bovine serum , 12 - o - tetradecanoylphorbol - 13 - acetate ( tpa ) to stimulate cell division via down - regulation of protein kinase c , [ 22 , 23 ] and cholera toxin to stimulate adenylate cyclase activity in the absence of α - msh . [ 15 , 24 ] cellular lysates of mel - ab cells may be used as tyrosinase enzyme preparations . multi - well plate assays have been validated [ 5 , 6 , 25 ] for enzyme inhibition ( e . g ., dopa oxidation by colorimetric measurement or radiolabeled substrate incorporation into melanin ) and for pigmentation assays on cultured mel - ab cells . after 4 days of treatment of cultured cells , melanin content is determined using a spectrophotometer at 400 + nm . [ 6 , 25 ] this assay can detect an apparent loss in pigmentation resulting from either inhibition of de novo synthesis ( e . g . via inhibition of tyrosinase , or the adenylate cyclase pathway , or another pathway ) or a cytostatic / cytotoxic mechanism . it is therefore a broad primary screen . it is used in parallel with the tyrosinase enzymatic assay to determine whether an inhibitor of pigmentation at the cellular level is acting primarily at the enzyme level . to determine cytotoxicity , crystal violet or other staining methods may be used to quantify adherent cell numbers following a period of treatment by an agent hq is typically used as a positive control in the assay , since it exhibits an ic 50 in the low micrograms per milliliter range on mel - ab culture using this assay , albeit owing to cytotoxicity and not inhibition of pigmentation per se . [ 6 ] it should be noted that many inhibitors identified in cell - free enzymatic assays might have subsequent difficulties with toxicity or delivery in melanocyte cell - based assays . therefore , all three in vitro assays in combination provide an excellent characterization of candidate skin lightening compounds . a distinct advantage of the screening systems ( developed by the inventors of the present invention ) is the focus on mammalian tyrosinase , as opposed to non - mammalian enzymes often used by other investigators , such as mushroom tyrosinase . since the biochemical and pharmacologic characteristics of an enzyme or isozyme can vary dramatically between species of organisms ( e . g ., due to dissimilarities in primary , secondary , and tertiary structure ), it is highly preferable that candidate topical skin lighteners intended for human use be discovered based on their biochemical action against a mammalian source of the enzyme . mushroom tyrosinase ( and in some instances plant polyphenol oxidases ) has been used in the vast majority of prior inhibitor studies . [ 28 , 29 ] yet fungal tyrosinase exhibits substantial dissimilarities from mammalian tyrosinase ( s ), and is viewed as a substantially inferior strategy for pharmacologic screening . thus , the methods reported by the inventors of the present invention for screening against mammalian tyrosinase or within melanocytes is highly preferred over other possible screening strategies . [ 5 , 6 , 25 ] the substrate kinetic “ affinity ” of mammalian tyrosinase for l - tyrosine is approximately k m = 600 μm . a potentially effective candidate skin lightening agent is considered to be desirable , active , and / or functional if it renders 50 % inhibition of mammalian tyrosinase enzyme activity , at concentrations below half the enzyme &# 39 ; s “ affinity ” for tyrosine in cell - free enzyme extracts ( ic 50 ≦ 300 μm ) and pigment production in melanocyte cell cultures ( ic 50 ≦ 300 μm ). in preferred embodiments the agent has an ic 50 against tyrosinase in cell - free enzyme extracts of less then 200 , 100 , 50 , or 25 μm , and / or an ic 50 against pigment production in melanocyte cell cultures of less than 200 , 100 , 50 , or 25 μm . in addition , it is desirable for the compounds to exhibit minimal cytotoxicity , e . g ., thus retaining viability of 50 % or more of the cultured cells ( ic 50 ≧ 300 μm ), as evidenced by adherent cell number . in preferred embodiments the agent exhibits toxicity at greater than 500 , 750 , or 1000 μm . curto , e . v ., et al . ( 1999 ) [ 25 ] reports that methyl gentisate is an “ effective ” candidate skin - lightening agent based on in vitro bioassays , because it has an ic 50 of 11 . 2 ± 4 ( ug / ml ) against tyrosinase activity in cell - free assays , an ic 50 of 30 . 9 ± 5 ( ug / ml ) in melanocyte cell cultures , and melanocyte cytotoxicity ic 50 of 118 . 7 ± 12 ( ug / ml ). methyl gentisate thus poses a standard , against which the efficacy and cytotoxicity of other tyrosinase inhibiting compounds can be evaluated . by contrast to mg , hydroquinone is an inferior standard , exhibiting potent cytotoxicity and minimal enzymatic inhibition . [ 5 , 6 , 25 ] significantly , many of the particular compounds of this invention are comparable to or a more effective candidate skin lightening agents than methyl gentisate . thus , in another embodiment the invention provides methods for inhibiting pigment production that includes administering an effective treatment amount of a pigment inhibiting compound wherein ( i ) the compound inhibits tyrosinase activity equivalent to or greater than methyl gentisate in cell - free enzyme extracts from mammalian melanocyte or melanoma cells , when evaluated using either a colorometric dopa oxidation or a radiolabeled tyrosine or dopa substrate assay as described in curto , e . v ., et al . ( 1999 ) [ 25 ], or ( ii ) the compound inhibits de novo pigment production ( synthesis and / or accumulation ) equivalent to or greater than methyl gentisate when evaluated in cultured mammalian melanocyte or melanoma cells . curto , e . v ., et al . ( 1999 ) [ 25 ]. in a preferred embodiment the toxicity of the compound in mammalian melanocyte , melanoma , or other cell cultures is equivalent to or less than the toxicity of methyl gentisate . curto , e . v ., et al . ( 1999 ) [ 25 ]. in another embodiment computer - based molecular orbital predictions can aid in the understanding and predictability of structure - activity relationships , such that other effective compounds can be identified and evaluated . see sakurada , j ., et al ., “ kinetic and molecular orbital studies on the rate of oxidation of monosubstituted phenols and anilines by horseradish peroxidase compound ii .” biochemistry 29 : 4093 - 4098 ( 1990 ) [ 26 ]. the following definitions and term construction are intended , unless otherwise indicated : specific and preferred values listed below for radicals , substituents , and ranges , are for illustration only ; they do not exclude other defined values or other values within defined ranges for the radicals and substituents . alkyl , alkoxy , alkenyl , alkynyl , etc . denote both straight and branched groups ; but reference to an individual radical such as “ propyl ” embraces only the straight chain radical , a branched chain isomer such as “ isopropyl ” being specifically referred to . the term alkyl , as used herein , unless otherwise specified , refers to a saturated straight , branched , or cyclic , primary , secondary , or tertiary hydrocarbon of c 1 to c 10 , and specifically includes methyl , ethyl , propyl , isopropyl , cyclopropyl , butyl , isobutyl , t - butyl , pentyl , cyclopentyl , isopentyl , neopentyl , hexyl , isohexyl , cyclohexyl , cyclohexylmethyl , 3 - methylpentyl , 2 , 2 - dimethylbutyl , and 2 , 3 - dimethylbutyl . when the context of this document allows alkyl to be substituted , the moieties with which the alkyl group can be substituted are selected from the group consisting of hydroxyl , amino , alkylamino , arylamino , alkoxy , aryloxy , aryl , heterocycle , halo , carboxy , acyl , acyloxy , amido , nitro , cyano , sulfonic acid , sulfate , phosphonic acid , phosphate , or phosphonate , either unprotected , or protected as necessary , as known to those skilled in the art , for example , as taught in greene , et al ., protective groups in organic synthesis , john wiley and sons , second edition , 1991 , hereby incorporated by reference . the term lower alkyl , as used herein , and unless otherwise specified , refers to a c 1 to c 4 saturated straight , branched , or if appropriate , a cyclic ( for example , cyclopropyl ) alkyl group , including both substituted and unsubstituted forms . unless otherwise specifically stated in this application , when alkyl is a suitable moiety , lower alkyl is preferred . similarly , when alkyl or lower alkyl is a suitable moiety , unsubstituted alkyl or lower alkyl is preferred . the terms alkenyl and alkynyl refer to alkyl moieties , including both substituted and substituted forms , wherein at least one saturated c — c bond is replaced by a double or triple bond . thus , ( c 2 - c 6 ) alkenyl can be vinyl , allyl , 1 - propenyl , 2 - propenyl , 1 - butenyl , 2 - butenyl , 3 - butenyl , 1 - pentenyl , 2 - pentenyl , 3 - pentenyl , 4 - pentenyl , 1 - hexenyl , 2 - hexenyl , 3 - hexenyl , 4 - hexenyl , or 5 - hexenyl . similarly , ( c 2 - c 6 ) alkynyl can be ethynyl , 1 - propynyl , 2 - propynyl , 1 - butynyl , 2 - butynyl , 3 - butynyl , 1 - pentynyl , 2 - pentynyl , 3 - pentynyl , 4 - pentynyl , 1 - hexynyl , 2 - hexynyl , 3 - hexynyl , 4 - hexynyl , or 5 - hexynyl . the term “ alkylene ” refers to a saturated , straight chain , divalent alkyl radical of the formula —( ch 2 ) n —, wherein n can be 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , or 10 . as used herein , with exceptions as noted , “ aryl ” is intended to mean any stable monocyclic , bicyclic or tricyclic carbon ring of up to 8 members in each ring , wherein at least one ring is aromatic as defined by the huckel 4n + 2 rule . examples of aryl ring systems include phenyl , naphthyl , tetrahydronaphthyl , and biphenyl . the aryl group can be substituted with one or more moieties selected from the group consisting of hydroxyl , amino , alkylamino , arylamino , alkoxy , aryloxy , alkyl , heterocycle , halo , carboxy , acyl , acyloxy , amido , nitro , cyano , sulfonic acid , sulfate , phosphonic acid , phosphate , or phosphonate , either unprotected , or protected as necessary , as known to those skilled in the art , for example , as taught in greene , et al ., protective groups in organic synthesis , john wiley and sons , second edition , 1991 . the term heterocycle or heterocyclic , as used herein except where noted represents a stable 5 - to 7 - membered monocyclic or stable 8 - to 11 - membered bicyclic heterocyclic ring which is either saturated or unsaturated , including heteroaryl , and which consists of carbon atoms and from one to three heteroatoms selected from the group consisting of n , o , s , and p ; and wherein the nitrogen and sulfur heteroatoms may optionally be oxidized , and the nitrogen heteroatom may optionally be quaternized , and including any bicyclic group in which any of the above - defined heterocyclic rings is fused to a benzene ring . the heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure . nonlimiting examples of heteroaryl and heterocyclic groups include furyl , furanyl , pyridyl , pyrimidyl , thienyl , isothiazolyl , imidazolyl , tetrazolyl , pyrazinyl , benzofuranyl , benzothiophenyl , quinolyl , isoquinolyl , benzothienyl , isobenzofuryl , pyrazolyl , indolyl , isoindolyl , benzimidazolyl , purinyl , carbazolyl , oxazolyl , thiazolyl , isothiazolyl , 1 , 2 , 4 - thiadiazolyl , isooxazolyl , pyrrolyl , quinazolinyl , cinnolinyl , phthalazinyl , xanthinyl , hypoxanthinyl , thiophene , furan , pyrrole , isopyrrole , pyrazole , imidazole , 1 , 2 , 3 - triazole , 1 , 2 , 4 - triazole , oxazole , isoxazole , thiazole , isothiazole , pyrimidine or pyridazine , and pteridinyl , aziridines , thiazole , isothiazole , 1 , 2 , 3 - oxadiazole , thiazine , pyridine , pyrazine , piperazine , pyrrolidine , oxaziranes , phenazine , phenothiazine , morpholinyl , pyrazolyl , pyridazinyl , pyrazinyl , quinoxalinyl , xanthinyl , hypoxanthinyl , pteridinyl , 5 - azacytidinyl , 5 - azauracilyl , triazolopyridinyl , imidazolopyridinyl , pyrrolopyrimidinyl , pyrazolopyrimidinyl , adenine , n6 - alkylpurines , n6 - benzylpurine , n6 - halopurine , n6 - vinypurine , n6 - acetylenic purine , n6 - acyl purine , n6 - hydroxyalkyl purine , n6 - thioalkyl purine , thymine , cytosine , 6 - azapyrimidine , 2 - mercaptopyrmidine , uracil , n5 - alkyl - pyrimidines , n5 - benzylpyrimidines , n5 - halopyrimidines , n5 - vinyl - pyrimidine , n5 - acetylenic pyrimidine , n5 - acyl pyrimidine , n5 - hydroxyalkyl purine , and n6 - thioalkyl purine , and isoxazolyl . the heteroaromatic and heterocyclic moieties can be optionally substituted as described above for aryl , including substituted with one or more substituents selected from hydroxyl , amino , alkylamino , arylamino , alkoxy , aryloxy , alkyl , heterocycle , halo , carboxy , acyl , acyloxy , amido , nitro , cyano , sulfonic acid , sulfate , phosphonic acid , phosphate , or phosphonate , either unprotected , or protected as necessary , as known to those skilled in the art , for example , as taught in greene , et al ., protective groups in organic synthesis , john wiley and sons , second edition , 1991 . the heteroaromatic can be partially or totally hydrogenated as desired . as a nonlimiting example , dihydropyridine can be used in place of pyridine . functional oxygen and nitrogen groups on the heteroaryl group can be protected as necessary or desired . suitable protecting groups are well known to those skilled in the art , and include trimethylsilyl , dimethylhexylsilyl , t - butyldi - methylsilyl , and t - butyldiphenylsilyl , trityl or substituted trityl , alkyl groups , acyl groups such as acetyl and propionyl , methanesulfonyl , and p - toluenesulfonyl . the term acyl refers to a carboxylic acid ester in which the non - carbonyl moiety of the ester group is selected from straight , branched , or cyclic alkyl or lower alkyl , alkoxyalkyl including methoxymethyl , aralkyl including benzyl , aryloxyalkyl such as phenoxymethyl , aryl including phenyl optionally substituted with halogen , c 1 to c 4 alkyl or c 1 to c 4 alkoxy , sulfonate esters such as alkyl or aralkyl sulphonyl including methanesulfonyl , the mono , di or triphosphate ester , trityl or monomethoxytrityl , substituted benzyl , trialkylsilyl ( e . g . dimethyl - t - butylsilyl ) or diphenylmethylsilyl . aryl groups in the esters optimally comprise a phenyl group . the term “ lower acyl ” refers to an acyl group in which the non - carbonyl moiety is lower alkyl . the term alkoxy , as used herein , and unless otherwise specified , refers to a moiety of the structure — o - alkyl , wherein alkyl is as defined above . precursor : mono - or multiple - substituted benzene . most are commercially available or can be easily prepared from commercial compounds . the definition of benzene ring substituents r 1 , r 2 , r 3 and r 4 is given in formulas ( i ) and ( ii ) in section of summary of the invention . reactants : nitric acid , zinc , hydrochloric acid , carbon disulfide , methyl isothiocyanate , thiourea , sulfur , sodium diethyldithiocarbamate , selenourea . references : saxena , d . b . ; khajuria , r k ; suri , o . p . synthesis and spectral studies of 2 - mercaptobenzimidazole derivatives . j . heterocycl . chem ., 19 , 681 - 683 , ( 1982 ). the 1 , 2 - phenylenediamine derivatives ( v ) can be prepared by twice nitration / reduction reactions on substituted benzene ( i ), some substituents may need protection under above reaction conditions . cyclization of ( v ) with cs 2 , or ch 3 ncs , or thiourea , or s , or ( c 2 h 5 ) 2 ncs 2 na can give the desired 2 - mercaptobenzimidazole derivatives ( vi ). reaction of ( vi ) with r 5 x ( r 5 can be alkyl or acyl group ; x is cl , br , i ) can produce alkylated products ( viii ). 2 - benzimidazoline - selenium derivatives ( viii ) and ( ix ) can be synthesized similarly by reacting selenourea with ( v ). precursor : substituted benzene . most are commercially available or can be easily prepared from commercial compounds . the definition of benzene ring substituents r 1 , r 2 , r 3 , r 4 and r 5 is given in formulas ( i ) and ( ii ) in section of summary of the invention . references : rasmussen , c . r ; villani , f . j ., jr . ; weaner , l . e . ; reynolds , b . e . ; hood , a . r ; hecker , l . r —; nortey , s . o . ; hanskin , a . ; costanzo , m . j . ; et al . improved procedures for the preparation of cycloalkyl -, and arylalkyl -, and arylthioureas . synthesis , 6 , 456 - 459 , ( 1988 ). various arylthiourea compounds ( iv ) can be prepared by reaction of corresponding aniline ( iii ) with nh 4 scn or kscn in aqueous hcl solution . alkylation of ( i ) by r 6 x ( r 6 can be alkyl or acyl group ; x is cl , br , i ) can yield monoalkylated product ( vi ). by replacing kscn with ksecn , the selenium analogous ( v ) can also be prepared . precursor : substituted benzene . most are commercially available or can be easily prepared from commercial compounds . the definition of benzene ring substituents r 1 , r 2 , r 3 , r 4 and r 5 is given in formulas ( i ) and ( ii ) in section of summary of the invention . reactants : chlorosulfonic acid , dichlorodimethylsilane , zinc , cl ( ch 2 ) n cl ( n is 1 - 3 ), aluminum chloride , thiourea , sodium hydroxide . references : uchiro , h . ; kobayashi , s . non - aqueous reduction of aromatic sulfonyl chlorides to thios using a dichlorodimethylsilane - zinc - dimethylacetamide system . tetrahedron lett ., 40 , 3179 - 3182 , ( 1999 ). substituted arylsulfonyl chlorides ( i ) can be easily prepared from substituted aromatic compounds ( i ) by reaction with excess chlorosulfonic acid . reduction of ( ii ) with dichlorodimethylsilane / zinc will give desired phenylthiole derivatives ( iii ). the substituted phenylalkyl mercaptans ( vi ) can be prepared from the corresponding chloro compounds ( v ) which can be obtained from alkylation reaction of ( i ) ( friedel - crafts reaction ). both thiole compounds ( iii ) and ( vi ) can react with alkyl halide r 6 x to form the corresponding sulfides ( iv ) and ( vii ). precursor : substituted benzene . most are commercially available or can be easily prepared from commercial compounds . the definition of benzene ring substituents r 1 , r 2 , r 3 , r 4 and r 5 is given in formulas ( i ) and ( ii ) in section of summary of the invention reactants : nitric acid , zinc , hydrochloric acid , br ( ch 2 ) n br ( n is 1 - 3 ), aluminum chloride . the preparation of products ( ii ), ( iv ) and ( v ) is same as described previously . reaction of ( v ) with alkyl amine r 6 nh 2 ( r 6 is hydrogen or alkyl ) can give arylalkylamine derivatives ( vi ). precursor : substituted thiophene . most are commercially available or can be easily prepared from commercial sources . the definition of ring substituents r 1 , r 2 and r 3 is same as that given in formulas ( i ) and ( ii ) in section of summary of the invention . reactants : butyllithium , cl ( ch 2 ) n nme 2 ( n is 1 - 3 ), ethyl chloroformate . references : hallberg , a . ; gronowitz , s . on the reaction of some thienyllithium derivatives with 1 - chloro - 2 - dimethylaminoethane . chem . scr ., 16 , 42 - 46 , ( 1980 ). reaction of substituted thiophene with butyllithium can yield 2 - thienyllithium salt ( ii ), protection may be necessary for some substituents . substituted 2 - thiophenealkylamine ( iii ) can be prepared by reaction of ( a ) with 1 - chloro - 2 - dimethylaminoalkane . the products ( iii ), ( v ) and ( v ) can be converted to each other by alkylation / dealkylation reactions using alkyl halide r 4 x and clco 2 et , respectively . precursor : substituted benzene . most are commercially available or can be easily prepared from commercial compounds . the definition of benzene ring substituents r 1 , r 2 , r 3 , r 4 and r 5 is given in formulas ( i ) and ( ii ) in section of summary of the invention references : sastry , s . ; kudav , n . a . one - step synthesis of aromatic thio amides : reaction of aromatic compounds with potassium thiocyanate in polyphosphoric acid or sulfuric acid . indian j . chem ., sect b , 18b , 455 , ( 1979 ). benzothioamide derivatives ( ii ) can be prepared from substituted benzene ( i ) in one single step by reaction with kscn in polyphosphoric acid or sulfuric acid . the alkylated product ( iii ) can be obtained by using alkyl halide r 6 x ( x is cl , br , i ). in one embodiment , a compound of this invention is applied or administered to the skin during an appropriate period and using a sufficient number of dosages to achieve skin lightening . the concentration of active compound in the composition will depend on absorption , inactivation , and excretion rates of the compound as well as other factors known to those of skill in the art . it is to be noted that dosage values will also vary with the severity of the condition to be alleviated . it is to be further understood that for any particular subject , specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions , and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition . the active ingredient may be administered as a single dose , or may be divided into a number of smaller doses to be administered at varying intervals of time . topical and other formulations of these active and / or functional compounds are of utility in lightening skin pigmentation in humans and other animals . these formulations may be useful for pure cosmetic purposes , simply to obtain a lighter skin color for perceived beautification . the formulations also have medicinal value and can , for example , decrease hyperpigmentation of melasma , age spots , freckles , and other skin blemishes . the compounds of this invention act primarily by inhibiting mammalian melanocyte tyrosinase , the rate - limiting enzyme in the production of melanin from tyrosine and dopa . some compounds also absorb ultraviolet radiation ( uvr ), and may thus protect skin from uvr and photoaging . in addition , some compounds may be antioxidants that protect skin from oxidative damage , and / or may prevent oxidative decomposition of product formulations . if desirable these formulations could also be used to reduce pigmentation in hair , albeit during the biosynthesis of hair , by blocking pigment production within the melanocytes of hair follicles . the formulations would likely not affect the already emerged pigmented portions of hair , unlike a bleaching agent . the formulations useful in the present invention contain biologically effective amounts of the functional and / or active compound ( s ). a biologically effective amount of the active compound is understood by those skilled in the art to mean that a sufficient amount of the compound in the composition is provided such that upon administration to the human or animal by , for example , topical route , sufficient active agent is provided on each application to give the desired result . however , the biologically effective amount of the active compound is at a level that it is not toxic to the human or animal during the term of treatment . by a suitable biologically compatible carrier , when the compound is topically applied , it is understood that the carrier may contain any type of suitable excipient in the form of cosmetic compositions , pharmaceutical adjuvants , sunscreen lotions , creams , and the like . in one embodiment the active compound is administered in a liposomal carrier . the active compound is administered for a sufficient time period to alleviate the undesired symptoms and the clinical signs associated with the condition being treated , or to achieve the level of desired skin lightening . the individual dosage , dosage schedule , and duration of treatment may be determined by clinical evaluations by those of skill in the art . solutions or suspensions for topical application can include the following components : a sterile diluent such as water for injection , saline solution , fixed oils , polyethylene glycols , glycerin , propylene glycol or other synthetic solvents ; antibacterial agents such as benzyl alcohol or methyl parabens ; antioxidants such as ascorbic acid or sodium bisulfite ; chelating agents such as ethylenediaminetetraacetic acid ( edta ); buffers such as acetates , citrates or phosphates ; and agents for the adjustment of tonicity such as sodium chloride or dextrose . ph can be adjusted with acids or bases , such as hydrochloric acid or sodium hydroxide . suitable vehicles , carriers , or formulations for topical application are known , and include lotions , suspensions , ointments , oil - in - water emulsions , water - in - oil emulsions , creams , gels , tinctures , sprays , powders , pastes , and slow - release transdermal or occlusive patches . thickening agents , emollients , and stabilizers can be used to prepare topical compositions . examples of thickening agents include petrolatum , beeswax , xanthan gum , or polyethylene glycol , humectants such as sorbitol , emollients such as mineral oil , lanolin and its derivatives , or squalene . a number of solutions and ointments are commercially available , especially for dermatologic applications . the compounds can be provided in the form of pharmaceutically - acceptable salts . as used herein , the term “ pharmaceutically - acceptable salts or complexes ” refers to salts or complexes that retain the desired biological activity of the parent compound and exhibit minimal , if any , undesired toxicological effects . examples of such salts are ( a ) acid addition salts formed with inorganic acids ( for example , hydrochloric acid , hydrobromic acid , sulfuric acid , phosphoric acid , nitric acid , and the like ), and salts formed with organic acids such as acetic acid , oxalic acid , tartaric acid , succinic acid , malic acid , ascorbic acid , benzoic acid , tannic acid , pamoic acid , alginic acid , polyglutamic acid , naphthalenesulfonic acids , naphthalenedisulfonic acids , and polygalacturonic acid ; ( b ) base addition salts formed with polyvalent metal cations such as zinc , calcium , bismuth , barium , magnesium , aluminum , copper , cobalt , nickel , cadmium , and the like , or with an organic cation formed from n , n - benzylethylene - diamine or ethylenediamine ; or ( c ) combinations of ( a ) and ( b ); e . g ., a zinc tannate salt or the like . the compounds can be modified in order to enhance their usefulness as pharmaceutical compositions . for example , it is well know in the art that various modifications of the active molecule , such as alteration of charge , can affect water and lipid solubility and thus alter the potential for percutaneous absorption . the vehicle , or carrier , can also be modified to enhance cutaneous absorption , enhance the reservoir effect , and minimize potential irritancy or neuropharmacological effects of the composition . see , in general , arndt , et al . [ 27 ]. thus , the invention provides various formulations as topical skin lighteners containing the active and / or functional compounds described above . the invention further provides formulations as topical anti - oxidants containing the active and / or functional compounds described above . in still another embodiment the invention provides formulations as topical sunscreens containing the active and / or functional compounds described above . such formulations can be made in combination with other active and / or functional ingredients used in skincare products ( e . g . organic or inorganic sunscreen , antioxidant , anti - inflammatory , anti - erythema , anti - biotic , antimicrobial , humectant , or other ingredients ). other ingredients can be formulated with the compounds to augment their effect , including but not limited to vitamin c , vitamin e , magnesium ascorbyl phosphate , aloe vera extract , and retinoic acids . in addition , alpha - hydroxy acids can be included to speed up the skin lightening process by exfoliating surface colored skin . the compounds of the present invention can also be formulated for alternative routes of administration other than topical application , including but not limited to general systemic , oral , intradermal , transdermal , occlusive patches , intravenous , or parenteral administration , and pharmaceutical compositions known generally to those skilled in the art . the compounds can also be formulated along with other active and / or functional ingredients used in skincare products , depending on the intended use of the formulation . for example , the compounds can be formulated with organic or inorganic sunscreens , an antioxidant , an anti - inflammatory , an anti - erythema , an antibiotic , an antimicrobial , a humectant , or other ingredients . the active and / or functional compounds described above may also be of use in inhibiting tyrosinase - like enzymes from non - mammalian species , for instance for use in the food science industry for the inhibition of enzymatic browning . [ 28 , 29 ] inhibition of plant polyphenol oxidases by agents described here may coincidentally have activity against these non - mammalian enzymes . suitable formulations for spraying or treatment of fruits are known generally to those skilled in the art treatment by these formulations containing the enzyme inhibitors of the present invention might improve shelf life of plant or fungal foods . a first class of compounds based upon the template compound benzimidazolethiol ( lower left structure ) were tested for tyrosinase inhibition , cell culture pigment inhibition , and toxicity , by methods described in curto , e . v ., et al . ( 1999 ) [ 25 ]. results of the tests are given in table 1 . a second class of compounds based upon the template compound benzenethiol were tested for tyrosinase inhibition , cell culture pigment inhibition , and toxicity , by methods described in curto , e . v ., et al . ( 1999 ) [ 25 ]. results of the tests are given in table 2 . a third class of compounds based upon the template compound phenylthiourea ( lower left structure ) were tested for tyrosinase inhibition , cell culture pigment inhibition , and toxicity , by methods described in curto , e . v ., et al . ( 1999 ) [ 25 ]. results of the tests are given in table 3 . a fourth group of miscellaneous compounds of diverse structure were also tested for tyrosinase inhibition , cell culture pigment inhibition , and toxicity , by methods described in curto , e . v ., et al . ( 1999 ) [ 25 ]. results of the tests are given in table 4 . throughout this application , various publications are referenced . the disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims . 1 . hearing v j jr ., “ monophenol monooxygenase ( tyrosinase ): purification , properties , and reactions catalyzed .” methods enzymol 142 : 154 - 165 , 1987 . 2 . spritz r a et al ., “ genetic - disorders of pigmentation ,” adv hum genet 22 : 1 - 45 , 1994 . 3 . frenk e , “ treatment of melasma with depigmenting agents .” melasma : new approaches to treatment , pp . 9 - 15 . martin dunitz ltd ., london , 1995 . 4 . dooley t p , “ is there room for a moderate level of regularity oversight ?” in : drug discovery approaches for developing cosmeceuticals : advanced skin care and cosmetic products ( ed . hori w ), chap . 1 . 4 . international business communications , southborough , mass ., 1997 . 5 . dooley t p , “ topical skin depigmentation agents : current products and discovery of novel inhibitors of melanogenesis .” j . dermatol . treat . 8 : 275 - 279 , 1997 . 6 . dooley t p , et al ., “ development of an in vitro primary screen for skin depigmentation and antimelanoma agents .” skin pharmacol . 7 : 188 - 200 , 1994 . 7 . morse j l ( ed . ), “ an abridgment of the new funk & amp ; wagnalls encyclopedia ,” the universal standard encyclopedia , vol , 10 , pp . 3662 - 3663 . unicorn , n . y ., 1955 . 8 . budavari s ( ed . ), “ gentisic acid ,” merck index , 11 th edn , abstract no . 4290 , p . 688 . merck & amp ; co ., rahway , n . j ., 1989 . 9 . j - hua l , et al ., “ direct analysis of salicylic acid , salicyl acyl glucuronide , salicyluric acid and gentisic acid in human plasma and urine by high - performance liquid chromatography .” j . chromatogr . [ b ] 675 : 61 - 70 , 1996 . 10 . glatt h r , et al ., “ multiple activation pathways of benzene leading to products with varying genotoxic characteristics .” environ health perspect 82 : 81 - 89 , 1989 . 11 . glatt h r , “ endogenous mutagens derived from amino acids .” mutat res . 238 : 235 - 243 , 1990 . 12 . la du b n , “ alcaptonuria and ochronotic arthritis .” mol . biol . med . 8 : 31 - 38 , 1991 . 13 hearing v j , “ mammalian monophenol monooxygenase ( tyrosinase ): purification , properties , and reactions catalyzed .” methods enzymol . 142 : 154 - 65 , 1987 . 14 . spritz r a , et al ., “ genetic disorders of pigmentation .” adv . hum . genet . 22 : 1 - 45 , 1994 . 15 . hadley m e et al , “ melanotropic peptides for therapeutic and cosmetic tanning of the skin .” ny acad . sci . 680 : 424 - 39 , 1993 . 16 . sakai c et al , “ modulation of murine melanocyte function in vitro by agouti signal protein .” embo j . 16 : 3544 - 52 , 1997 . 17 . dooley t p , “ recent advances in cutaneous melanoma oncogenesis research .” onco . res . 6 : 1 - 9 , 1994 . 18 . bernmaman o , et al ., “ treatment and camouflaging of pigmentary disorders .” clin . dermatol . 6 : 50 - 61 , 1998 . 19 . zaumseil r - p , et al ., “ topical azelaic acid in the treatment of melasma : pharmacological and clinical considerations .” in : castanet j , frenk e , gaupe k et al ( eds ) melasma : new approaches to treatment . martin dunitz : london , pp 1640 , 1995 . 20 . schallreuter k u , “ epidermal adrenergic signal transduction as part of the neuronal network in the human epidermis .” j . invest dermatol . 2 : 3740 , 1997 . 21 . bennett d c , et al ., “ a line of non - tumorigenic mouse melanocytes , syngeneic with the b16 melanoma and requiring a tumour promoter for growth .” int . j . cancer 349 : 414 - 18 , 1987 . 22 . dooley t p et al ., “ polyoma middle t abrogates tpa requirement of murine melanocytes and induces malignant melanoma .” oncogene 3 : 531 - 6 , 1988 . 23 . brooks g et al ., “ protein kinase c down - regulation , and not transient activation , correlates with melanocyte growth .” cancer res . 51 : 3281 - 8 , 1991 . 24 . o &# 39 ; keefe e , et al ., “ cholera toxin mimics melanocyte stimulating hormone in inducing differentiation in melanoma cells .” proc . natl . acad . sci . usa 71 : 2500 - 4 , 1974 . 25 . curto , e . v ., et al ., “ inhibitors of mammalian melanocyte tyrosinase : in vitro comparisons of alkyl esters of gentisic acid with other putative inhibitors .” biochem . pharmacol . 57 : 663 - 672 , 1999 . 26 . sakurada , j ., et al ., “ kinetic and molecular orbital studies on the rate of oxidation of monosubstituted phenols and anilines by horseradish peroxidase compound ii .” biochemistry 29 : 4093 - 4098 , 1990 . 27 . arndt , et al ., “ the pharmacology of topical therapy ”, dermatology in general medicine , 1987 ; t . b . fitzpatrick , a . z . eisen , k . wolff , i . m . freedberg and k . f . austen , eds ., 3d ed ., mcgraw hill , inc ., new york , pp . 2532 - 2540 . 28 . lee , c . y . and whitaker , j . r . ( eds .) enzymatic browning and its prevention . pub . american chemical society , washington , d . c ., 1995 . 29 . lerch , k “ tyrosinase : molecular and active - site structure .” in lee , c . y . and whitaker , j . r . ( eds .) enzymatic browning and its prevention . pub . american chemical society , washington , d . c ., pp . 64 - 80 , 1995 . 30 . mishima , h ., et al ., “ fine structural demonstration of tyrosinase activity in the retinal pigment epithelium of normal and ptu - treated chick embryos .” albrecht von graefes arch . klin . exp . ophthalmol . 211 : 1 - 10 , 1979 . 31 . deja , t . p ., et al ., “ demonstration of tyrosinase in the adult bovine uveal tract and retinal pigment epithelium .” invest opthalmol . vis . sci . 17 : 511 - 514 , 1978 . 32 . higashi , y ., et al ., “ inhibition of tyrosinase reduces cell viability in catecholaminergic neuronal cells .” j . neurochem . 75 : 1771 - 1774 , 2000 . | 0 |
referring now to the drawings and , first , particularly to fig1 there is shown therein , in a diagrammatic view , a portion of a copy transfer device . this device has transport media 1 and 2 , which are formed as conveyor belts 3 and 4 . because fig1 is shown diagrammatically , the conveyor belts 3 and 4 are merely suggested in the drawing . in a first segment 5 , they are disposed parallel to one another , in a side - by - side arrangement . located thereon , likewise side by side and one after the other in rows , are products 6 and 7 , respectively , provided with a cross - fold . these products 6 and 7 arrive from a non - illustrated folder which has two feed paths . the conveyor belts 3 and 4 may have approximately the same width as the products 6 and 7 ( as shown ) or may be substantially narrower . preferably , there is one narrow belt in each side region of the products 6 and 7 . the conveyor belts 3 and 4 are formed as endless loops ; they operate on the principle of a run or strand , such as of a conveyor belt . by non - illustrated conventional means , the conveyor belts 3 and 4 are placed in the desired form for forming a transport path with straight and curved regions . for example , suitable slide ways may be provided , along which the conveyor belts 3 and 4 travel . various constructions of this kind are known from the prior art , so that this aspect need not be addressed in further detail . the arrows 8 indicate the direction of motion of the conveyor belts 3 and 4 . it is apparent that the conveyor belt 3 is moving along a path of motion 9 which has a rectilinear course . within the first segment 5 , the conveyor belt 4 likewise extends along a straight path parallel to the path of motion 9 of the conveyor belt 3 . in a second segment 10 , the conveyor belt 3 traverses a looping path 11 ; that is , the products 7 resting thereon execute a loop - the - loop motion wherein , upon arriving from the direction of the conveyor path 9 , they first rise and assume an upside down position in which they move counter to the motion of the path of motion and then , upon leaving the upside down position , they execute a downward motion . because the conveyor belt 4 in segment 10 has a continuous lateral offset , so that at the end of the looping path 11 it is congruent with and above the conveyor belt 3 , the products 6 and 7 are transferred to coinciding positions ; this means that they are located in congruent fashion , one above the other , in a third segment 12 adjoining the second segment 10 , and their folds are likewise congruently one above the other . by suitable means , the conveyor belt 4 which remains located between the products 6 and 7 in the third segment 12 is then removed , so that the products 6 and 7 are stacked directly on one another . if the conveyor belt 4 is realized as two thin belts located in the side regions of the products , this conveyor belt 4 can be removed by spreading apart the belts , thus releasing the product 7 . alternatively , it is also possible , for example , to reverse the conveyor belt 4 around a deflection roller , so that the product 7 slides downward from the belt and rests in congruent fashion on the product 6 . in fig2 a flapping - motion version is presented , which means that the products 6 and 7 are placed one on the other by a flapping motion . in principle , the same remarks made hereinabove regarding the exemplary embodiment of fig1 apply to this exemplary embodiment as well . however , the distinction exists that the two conveyor belts 3 and 4 , in the region where the copies are transferred , extend parallel and rectilinearly to one another in a side by side arrangement . while the product 6 remains lying on the conveyor belt 3 with its position unchanged , the product 7 is folded about a side edge extending in the direction of the path of motion 9 , by suitable means , such as a slide way , not shown , or moving conveyor means . a 180 ° flapping or hinged motion occurs so that the two products 6 and 7 rest on one another in congruent fashion . the cross - fold of the two products 6 and 7 is located either at the leading edge or the trailing edge of these products , which assures that the folds rest on one another after the flapping motion , as well . in the course of the flapping motion , assurance must be provided that the product 7 is moved far enough towards the product 6 that the side edges of the two products 6 and 7 coincide . the possibility exists , for example , of forming a transverse groove , in particular with a concave bottom , on the transfer device in the region of the opposed side edges of the products 6 and 7 ; the two side edges of the two products 6 and 7 enter this groove and as a result slide together and meet one another . the result is that a clean , congruent stacked position is attained . alternatively , it is possible for the product 6 to be folded as well ( not shown ), for example , for both products 6 and 7 each to be erected by a 90 ° motion , whereupon in this erected position they face one another in congruent fashion . thereafter , in the course of further transport or conveyance , the two products are folded or flapped together jointly , preferably through 90 °, in order to place them in a horizontal lying position . in the exemplary embodiment of fig3 a double inversion or turning action is explained . once again , the comments regarding the exemplary embodiments of fig1 and 2 apply accordingly wherever features which are in common with all of the embodiments exist . as in the exemplary embodiment of fig1 the conveyor belt 3 extends unchanged along a rectilinear path of motion 9 . in a first segment 13 , the conveyor belt 14 extends parallel to the conveyor belt 3 , in a side by side arrangement . a second segment 14 then follows , in which a double inversion or turning motion is carried out . in a third segment 15 , the conveyor belt 4 extends above and congruent with the conveyor belt 3 . further details of the double inversion or turning motion is offered hereinafter . located above the conveyor belt 4 in the second segment 14 is an inversion or turning bar 16 , which extends obliquely at an angle to the direction of the path of motion 9 . a second inversion or turning bar 18 , which extends parallel to the inversion bar 16 , is located above the conveyor belt 3 , likewise in the second segment 4 . the conveyor belt 4 , coming from below , wraps around the first inversion bar 16 and is thereby deflected transversely , preferably at an angle of 90 °, to the path of motion 9 . this takes place in a plane that is located higher than the level of the conveyor belts 3 and 4 in the region 13 . next , the conveyor belt 4 is then guided about the second inversion bar 18 in such a way that , once again , a 90 ° deflection takes place ; that is , the conveyor belt 4 is deflected downwardly and simultaneously back again in the direction of the path of motion 9 , so that the two conveyor belts 3 and 4 are located one above the other in congruent fashion . because of the oblique inversion or turning bars 16 and 18 , the direction of motion of the conveyor belt 4 is changed , preferably by 90 °, each time . at the same time , however , two 180 ° inversions of the belt 4 itself take place ; that is , the products 7 located on the belt 4 are inverted by 180 ° at each inversion bar 16 and 18 , so that a total motion of 360 ° occurs . the result is that the products 7 have the same position in the third segment 15 as in the first segment 13 , but are now located above and congruent with the products 6 . in the course of the further motion , the products 6 and 7 are then stacked on one another and can then be delivered jointly to a longitudinal folder . if the individual products 6 and 7 , respectively , follow one another too closely on the conveyor belts 3 and 4 , it is then possible for every other product arriving from the cross - folder to be diverted by a suitable shunt , and in this way for a further system to be created in which the two products 6 and 8 move side by side at half the frequency . in such a case , also , suitable provisions for bringing the products together should be made , in accordance with the exemplary embodiments of fig1 or 3 . the foregoing is a description corresponding in substance to german application p 43 32 516 . 5 , dated sep . 24 , 1993 , the international priority of which is being claimed for the instant application , and which is hereby made part of this application . any material discrepancies between the foregoing specification and the aforementioned corresponding german application are to be resolved in favor of the latter . | 1 |
one embodiment of the present invention is based on the use , as an associative monomer , of a compound the structure of which satisfies the following formula ( i ): m and n are integers of less than 150 , at least one of which is non - zero , a and b designate alkyl groups which are different one from another , and having 2 to 4 carbon atoms , where group ao preferentially designates ethylene oxide , and group bo preferentially designates propylene oxide , r designates a linear or branched alkyl group containing 8 to 20 carbon atoms , and preferentially a linear alkyl group having 9 to 12 carbon atoms . such compounds have been identified as surfactants , and can be obtained by alkoxylation of an alkyl phenol and hydrogenation of the product obtained . reference may notably be made to the document u . s . pat . no . 6 , 111 , 146 which describes their synthesis . the resulting compounds are designated by the expression “ alkyl cyclohexanol alkoxylates ”. it is important to add that the final structure is not that of an alkyl phenol , and that the resulting product will not be categorized as such . the associative thickening agents which result from the polymerization of this monomer of formula ( i ), of at least one polylakylene glycol and at least one polyisocyanate , have no alkyl phenols ; in an unexpected and particularly advantageous manner , they enable a water - based paint to be thickened to a level of viscosity at least equal to that provided by heurs of the prior art containing alkyl phenols . it is even demonstrated that it is possible to obtain for the invention a rheological profile similar to that proposed by the products of the state of the art for alkyl phenols . a product has therefore successfully been developed which is at least equivalent , and which overcomes the problem relating to the use of alkyl phenols . thus , another object of the invention are hydrosoluble polyurethanes containing the following monomers : a ) of at least one polyalkylene glycol , and b ) of at least one polyisocyanate , and c ) of at least one monomer of formula ( i ) m and n are integers of less than 150 , at least one of which is non - zero , a and b designate alkyl groups which are different one from another , and having 2 to 4 carbon atoms , where group ao preferentially designates ethylene oxide , and group bo preferentially designates propylene oxide , r designates an alkyl group , whether linear or branched , containing 8 to 20 carbon atoms , and preferentially a linear alkyl group having 9 to 12 carbon atoms . when a polymer like the hydrosoluble polyurethanes above are referred to as containing a monomer or monomers , one of skill in the art understands that the monomer ( s ) is ( are ) present in the polymer in their polymerized form . however , for ease of reference the phrase containing the ( respective ) monomer or the like is used as shorthand . “ polyalkylene glycol ” is understood to mean a polymer of an alkylene glycol derived from an olefinic oxide . the polyalkylene glycol according to the present invention is , for example , polyethylene glycol , polypropylene glycol , polybutylene glycol or a polyalkylene glycol containing a proportion of an ethylene - oxy group and / or a proportion of a propylene - oxy group and / or a proportion of a butylene - oxy group . the polyalkylene glycol according to the present invention can , for example , include a dominant proportion of an ethylene - oxy group in association with a secondary proportion of a propylene - oxy group . specific examples of alkylene glycol polymers include : polyalkylene glycols having an average molecular weight of 1 , 000 , 4 , 000 , 6 , 000 , 10 , 000 and 20 , 000 g / mol ( in the case of polyethylene glycol called peg - 1000 , peg - 4000 , peg - 6000 , peg 10000 and peg 20000 ); polyethylene polypropylene glycols having a percentage of ethylene oxide of between 20 and 80 % by weight and a percentage of propylene oxide of between 20 and 80 % by weight . “ polyisocyanate ” is understood to mean a compound which includes at least 2 functional isocyanate groups — n ═ c ═ o . the manufacture of these polyurethanes , which belong to the family of heur - type thickening agents , is within the skill of the skilled man in the art , who can refer to the teaching of the documents cited above as the technological background of the present invention . according to one embodiment of the present invention , these polyurethanes result from the condensation of , expressed as a % by weight of each of the monomers , where the sum of these %&# 39 ; s is equal to 100 %: a ) 75 % to 99 . 5 % of at least one polyalkylene glycol , b ) 0 . 5 % to 10 % of at least one polyisocyanate and c ) 15 % to 99 . 5 % of at least one monomer of formula ( i ). according to one embodiment of the present invention , the polylakylene glycol constituting the polyurethane is polyethylene glycol , according to another embodiment of the present invention , this is a polyethylene glycol of molecular mass of between 2 , 000 g / mole and 20 , 000 g / mole , for example between 8 , 000 g / mole and 15 , 000 g / mole , or for example between 8 , 000 g / mole and 12 , 000 g / mole . according to one embodiment , the polyisocyanate constituting the polyurethane according to the invention is chosen from among toluene diisocyanate and its dimers and trimers , 1 , 4 - butane diisocyanate , 1 , 6 - hexane diisocyanate , isophorone diisocyanate , 1 , 3 - and 1 , 4 - cyclohexane diisocyanate , 4 , 4 ′ diisocyanatodicyclohexylmethane , 1 - methyl - 2 , 4 - diisocyanatocyclohexane and its blend with 1 - methyl - 2 , 6 - diisocyanatocyclohexane , the biuret of hexamethylene diisocyanate and its dimers and trimers and their blends . another object of the present invention are aqueous compositions containing water , at least one polyurethane according to the invention , together with at least one surfactant , and possibly at least one additive chosen from among a biocide , a solvent , an anti - foaming agent , a ph regulator , a coalescence agent , or their blends . a “ biocide ” is understood to mean a chemical substance intended to destroy , repel or make harmless harmful organisms , to prevent their action , or to oppose them in any other manner , through a chemical or biological action . a “ surfactant ” or “ surfactant agent ” is understood to mean a non - ionic molecule consisting of at least a hydrophilic part and of at least a hydrophobic part . an “ anti - foaming agent ” is understood to mean a substance or a formulation intended to destroy air bubbles within a homogenous or heterogeneous liquid medium ( or at its surface ), or to prevent their formation . a “ ph regulator ” or “ ph regulating agent ” is understood to mean a chemical compound which enables the ph to be adjusted to the expected value . for example , the ph regulating agent can increase the ph ; this is the case with bases , such as naoh . alternatively , the ph regulating agent can reduce the ph ; this is the case with acids . a “ coalescent agent ” is understood to mean an agent used in paints which enables the minimum film formation temperature ( mfft ) of paint to be reduced to a temperature suitable for the desired condition ( s ) of application ( for example a tmff of 5 ° c . for outside application ). as an example of a coalescent agent according to the invention , propylene glycol , butyl glycol , 2 , 2 , 4 - trimethyl - 1 , 3 - pentanediol monoisobutyrate or 2 , 2 , 4 - trimethyl - 1 , 3 - pentanediol diisobutyrate may be cited . according to one embodiment , the aqueous compositions of the invention contain , expressed as a % by weight of each of their constituents , where the sum of these % s is preferably equal to 100 %: 1 ) 5 % to 45 % of at least one polyurethane according to the invention , 2 ) 5 % to 30 % of at least one surfactant , 3 ) 25 % to 75 % of water , 4 ) 0 to 5 % of at least one additive chosen from among a biocide , a solvent , an anti - foaming agent , a ph regulator , a coalescence agent and their blends . another object of the present invention consists in the use of the said polyurethanes and of the said compositions , as thickening agents in aqueous formulations , where the said formulations are for example chosen from among water - based paints , lacquers , varnishes , paper coatings , cosmetic formulations and detergent formulations . another object of the present invention lies in the aqueous formulations containing the thickening agents or polyurethanes and the compositions according to the invention , where the said formulations are for example chosen from among water - based paints , lacquers , varnishes , paper coatings , cosmetic formulations and detergent formulations . a final object of the present invention consists of a method for preparing a polyurethane according to the invention , consisting of a condensation of its different constituents . the following examples enable the invention to be better understood , without however limiting its scope . this example illustrates the manufacture of a water - based paint , in which a thickening agent of the prior art containing an alkyl phenol having 15 carbon atoms and a thickening agent according to the invention , the r group of which is a linear alkyl chain having 9 carbon atoms , are used : the corresponding hydrophobic group therefore contains 15 carbon atoms in this case . this test illustrates the prior art . this corresponds to the use of an aqueous composition with 17 . 5 % by dry weight of a polymer containing grafted alkyl phenols , which is acrysol ™ sct - 275 sold by the company dow ™. this test illustrates the prior art . this corresponds to the use of an aqueous composition containing 17 . 5 % by dry weight of a polymer consisting of , expressed as a % by weight of each of its monomers : a ) 75 % of polyethylene glycol of molecular mass by weight equal to 10 , 000 g / mole , b ) 5 % of isophorone diisocyanate , c ) 15 % by weight of a monomer of formula ho —( oe ) n - r where oe is ethylene oxide , n is equal to 25 and r is the alkyl phenol group having 15 carbon atoms . this test illustrates the invention . this corresponds to the use of an aqueous composition containing 17 . 5 % by dry weight of a polymer consisting of , expressed as a % by weight of each of its monomers : a ) 75 % of polyethylene glycol of molecular mass by weight equal to 10 , 000 g / mole , b ) 5 % of isophorone diisocyanate , c ) 15 % by weight of a monomer of the following formula where m = 0 and n = 25 and r designates the linear alkyl group having 9 carbon atoms . in each of the tests no . 1 to 3 , 70 . 6 grams of mowilith ™ ldm 1871 , 193 . 8 grams of bipermuted water and 32 grams of the composition to be tested are introduced into the beaker . the ph is adjusted by using ammonia ( 28 %) to a value of between 8 . 6 and 8 . 9 . at 25 ° c ., the brookfield ™ viscosity at 10 and 100 revolutions per minute ( μ bk10 and μ bk100 ) and the stormer ™ viscosity ( μ s ) of the paint are measured . m and n are integers of less than 150 , at least one of which is non - zero , a and b designate alkyl groups which are different one from another , and having 2 to 4 carbon atoms . r designates a linear or branched alkyl group containing 8 to 20 carbon atoms . 2 — a polyurethane according to embodiment 1 , wherein the ao group designates ethylene oxide , and the bo group designates propylene oxide . 3 — a polyurethane according to embodiment 1 , wherein r designates a linear alkyl group having 9 to 12 carbon atoms . 4 — a polyurethane according to embodiment 1 , wherein the polyalkylene glycol is polyethylene glycol . 5 — a polyurethane according to embodiment 1 , wherein the polyalkylene glycol is a polyethylene glycol of molecular mass by weight of between 2 , 000 g / mol and 20 , 000 g / mol . 6 — a polyurethane according to embodiment 1 , wherein the polyalkylene glycol is a polyethylene glycol of molecular mass by weight of between 8 , 000 g / mol and 15 , 000 g / mol . 7 — a polyurethane according to embodiment 1 , wherein the polyisocyanate is selected from the group consisting of toluene diisocyanate and its dimers and trimers , 1 , 4 - butane diisocyanate , 1 , 6 - hexane diisocyanate , isophorone diisocyanate , 1 , 3 - and 1 , 4 - cyclohexane diisocyanate , 4 , 4 ′ diisocyanatodicyclohexylmethane , 1 - methyl - 2 , 4 - diisocyanatocyclohexane and its blend with 1 - methyl - 2 , 6 - diisocyanatocyclohexane , the biuret of hexamethylene diisocyanate and its dimers and trimers , and mixtures thereof . 8 — a polyurethane according to embodiment 1 , wherein the hydrosoluble polyurethane does not comprise an alkyl phenol . 9 — an aqueous composition comprising water , a hydrosoluble polyurethane according to embodiment 1 , and a surfactant . 10 — an aqueous composition according to embodiment 9 , further comprising an additive selected from the group consisting of a biocide , a solvent , an anti - foaming agent , a ph regulator , a coalescence agent , and mixtures thereof . 11 — a composition according to embodiment 9 , comprising , expressed as a % by weight of each of its constituents , where the sum of these % s is equal to 100 %: 1 ) 5 % to 45 % of said polyurethane , 2 ) 5 % to 30 % of said surfactant , 3 ) 25 % to 75 % of water , and 4 ) 0 to 5 % of at least one additive selected from the group consisting of a biocide , a solvent , an anti - foaming agent , a ph regulator , a coalescence agent , and mixtures thereof . 12 — a method for thickening an aqueous formulation , comprising incorporating the hydrosoluble polyurethane of embodiment 1 in said aqueous formulation . 13 — the method according to embodiment 12 , wherein aqueous formulation is selected from the group consisting of water - based paints , lacquers , varnishes , paper coatings , cosmetic formulations and detergent formulations . 15 — a method for preparing a hydrosoluble polyurethane of embodiment 1 , comprising condensing a ), b ), and c ). as used herein the terms composed of , contains , containing , and terms similar thereto , when referring to the ingredients , parts , reactants , etc ., of a composition , component , etc ., to method steps , etc ., mean , in their broadest sense , “ includes at least ” ( i . e ., comprises ) but also include within their definition all those gradually restricted meanings until and including the point where only the enumerated materials or steps are included ( e . g ., consisting essentially of and consisting of ). the above written description of the invention provides a manner and process of making and using it such that any person skilled in this art is enabled to make and use the same , this enablement being provided in particular for the subject matter of the appended claims , which make up a part of the original description . as used herein , the phrases “ selected from the group consisting of ,” “ chosen from ,” and the like include mixtures of the specified materials . the term “ mentioned ” notes exemplary embodiments , and is not limiting to certain species . as used herein the words “ a ” and “ an ” and the like carry the meaning of “ one or more .” all references , patents , applications , tests , standards , documents , publications , brochures , texts , articles , etc . mentioned herein are incorporated herein by reference . where a numerical limit or range is stated , the endpoints are included . also , all values and subranges within a numerical limit or range are specifically included as if explicitly written out . the above description is presented to enable a person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the preferred embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention . thus , this invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . in this regard , certain embodiments within the invention may not show every benefit of the invention , considered broadly . | 2 |
referring now to the drawings and to fig1 and 2 , in particular , an upright water extraction cleaning machine 12 is shown which comprises a base assembly 14 , an upper housing 16 pivotally mounted to the base assembly 14 , a handle 18 extending upwardly from the upper housing 16 , and a tank assembly 20 mounted to and supported by both the handle 18 and upper housing 16 . the base assembly 14 comprises a foot or base member 24 , a pair of rear wheels 26 , 28 mounted to the rear of the foot member 24 , and a recovery tank 30 removably supported on the foot member 24 . a pair of over - center latches 32 are provided , one on each side of the foot member 24 , and are adapted to cooperate with a pair of projections 34 ( fig1 ), one provided on each side of the recovery tank sidewall for locking the recovery tank 30 to the foot member 24 . a handle 36 is pivotally mounted to the recovery tank 30 for carrying the tank . as described further below , the tank assembly 20 comprises a clean water tank 42 and a detergent tank 44 which nests inside the front surface of the clean water tank 42 . a pair of over - center latches 46 are provided , one on each side of the sidewall of the upper housing 16 . the latches 46 are adapted to cooperate with a pair of projections 48 ( fig5 ), one of which is provided on each of the sidewalls of the clean water tank 42 , for locking the tank assembly 20 to the upper housing 16 and handle 18 . an accessory hose storage rack 50 is mounted to the rear surfaces of the handle 18 and upper housing 16 . the rack 50 includes an upper portion 51 and a lower portion 53 and is adapted to support and store an accessory hose 52 when the hose is not in use . an accessory hose mounting member 62 is mounted on one end of the hose 52 and is received in a c - shaped clip 66 provided on the upper end of the rack 50 . the flexible body of the hose 52 is wrapped around the upper and lower portions 51 , 53 of the storage rack 50 . a grip tube 64 is mounted on the other end of the hose 52 and is snapped into the c - shaped clip 66 integrally molded into the rack 50 . in this position , the entire length of the accessory hose 52 is supported on the rack 50 and is easily transported with and stored on the cleaning machine 12 . preferably , the accessory hose 52 remains on the rack at all times , except when the hose 52 is in use . a double c - shaped clip 67 ( fig2 ) can be provided at one or more locations to clamp adjacent portions of the hose 52 together when the hose is stored on the machine . the double c - shaped clip 67 can be removed from the hose when the hose is unwrapped for use . the grip tube 64 of the accessory hose 52 is adapted to receive cleaning tools such as the upholstery tool 68 shown in fig1 and 2 . however , any number of a variety of cleaning tools can be received on the grip tube 64 such as a crevice spray tool as seen in u . s . patent application ser . no . 08 / 574 , 769 which is expressly incorporated herein by reference or , alternatively , a window washing tool as seen in u . s . patent application ser . no . 08 / 683 , 608 which is also expressly incorporated herein by reference . a closed loop grip 58 is provided at the terminal end of the handle 18 and a trigger 60 is pivotally mounted to the handle 18 inside the closed loop grip 58 . as described further below , the trigger 60 is used to control the distribution of cleaning solution from the base assembly 14 . a releasable latch 40 is mounted to the base assembly 14 and is adapted to retain the handle 18 and upper housing 16 in the upright , stored position as seen in fig1 and 2 . the handle 18 can be tilted rearwardly by grasping the handle 18 and depressing the latch 40 relative to the base assembly 14 . with the latch 40 depressed , the handle is then tilted rearwardly with respect to the base assembly 14 . a three - position electrical switch 54 is mounted to the rear of the handle 18 . the three positions of the switch are as follows : ( a ) all systems off , ( b ) the “ pre - treat ” position in which both the cleaning solution pump and agitation brush are on but the vacuum motor is turned off , and ( c ) the “ cleaning position ” in which the vacuum motor , agitation brush , and cleaning solution pump are all on . an electrical cord 56 extends outwardly from the upper housing 16 and is electrically connected to the three - position switch 54 . a pair of opposed cord wraps 70 , 72 are provided on the upper and lower portions 51 , 53 of the storage rack 50 for containing the electrical cord 56 when the machine 12 is not in use . a large number of the operative components of the machine 12 are mounted to or provided inside the upper housing 16 and handle 18 . as noted previously , the tank assembly 20 is supported on the handle 18 and upper housing 16 . a vacuum motor 74 and impeller fan 76 are mounted in the round , bulbous lower portion of the upper housing 16 . the upper portion of the upper housing supports a large number of components of the water distribution system such as the solution pump mixing valve which will be described in greater detail , below . [ 0047 ] fig3 shows the pivot mounting and locking assembly of the upper housing 16 to the base assembly 14 . in this side - elevational view , the wheel 26 is shown in phantom lines to reveal the pivot mounting and locking assembly of these two elements . the pivot mounting itself is identical for both the right and left sides of the upper housing 16 , and therefore , only the left side will be described in detail . the foot or base member 24 includes an upwardly extending rear support member 80 with a semi - circular bearing surface 82 integrally formed therein . a substantially circular boss 84 extends outwardly from the sidewall 86 of the upper housing 16 and is adapted to be received in the bearing surface 82 . a retention member 88 having an integrally molded substantially semi - circular bearing surface 90 formed therein is adapted to be secured to the top surface of the support member 80 , thereby capturing the outwardly extending boss 84 of the upper housing 16 between the opposed semi - circular bearing surfaces 82 , 90 . the a projection 92 formed on the retention member 88 fits within a groove of the foot member 24 . the rear portion 89 of the retention member can be secured to the foot member 24 through a screw - type fastener 91 passing through the projection 92 and into the foot member 24 . a front portion 96 of the retention member 88 has a pair of tabs 102 ( only one of which is shown ) extending downwardly therefrom . a free end of each tab 102 includes a barb 104 that snaps within a corresponding groove ( not shown ) in the foot member 24 to secure the front portion 96 of the retention member 88 to the foot 24 . referring now to fig3 and 3a , a locking assembly 105 is preferably located on the left side of the cleaning machine 12 , although it is to be understood that the locking mechanism can alternatively or in addition be arranged on the right side . the locking assembly 105 includes a foot engagement section 107 and a stem 109 formed integrally with the foot engagement section 107 . a pivot pin 101 extends through a tab 111 on the retention member 88 and the stem 109 to pivotally attach the foot engagement section 107 to the base member 24 . a flat spring 113 is integrally formed with the stem 109 with a free end 127 thereof abutting an upper surface of the retention member rear portion 89 . the spring 113 biases the foot engagement section 107 toward the front portion 96 . a locking extension 115 includes a flat locking surface 117 and a bearing surface 119 . the base member 24 includes a semi - cylindrical laterally extending protrusion 125 which is located on the side wall 86 with a flat locking surface 121 and a curved bearing surface 123 . in the normally upright position , as shown in fig3 the flat locking surfaces 117 , 121 abut each other or are in close proximity to each other . if a user attempts to rotate the handle 18 with respect to the foot member 24 , the locking surfaces 117 , 121 engage and prevent relative rotation of the handle and foot member . when the foot engagement portion 107 is depressed , as shown in phantom line , the locking extension 115 rotates away from the protrusion 125 until the locking surfaces are no longer in facing relationship . in this position , the handle 18 can be rotated with respect to the base member 24 . when the handle is rotated to the upright position , the bearing surface 119 engages the bearing surface 123 to rotate the foot engagement portion 107 against the bias of spring 113 until the locking extension 115 is clear of the protrusion 125 and the locking surfaces 117 , 121 are again in facing relationship . as described further below in relation to fig9 the preferred embodiment of the cleaning machine 12 incorporates a rotatably mounted agitation brush which receives the force of rotation from a brush motor mounted to the foot member 24 . in any position other than the off position for the switch 54 , electrical current is supplied to the brush motor for rotating the agitation brush . however , when the accessory hose 52 is being utilized , or when the handle 18 is merely in the upright position and the switch is in either the pretreat or cleaning position , it is undesirable to permit continued rotation of the agitation brush . therefore , an interrupt switch 98 is provided in the electrical circuit between the brush motor and the source of electricity . the switch 98 is mounted to the foot member 24 and adapted to cooperate with a projection 100 extending outwardly from the front , bottom surface of the upper housing 16 . in the position as shown in fig3 the projection 100 bears against the switch 98 , thereby opening the electrical circuit between the source of electricity and the agitation brush . therefore , the brush will not rotate , regardless of the position of the three - position switch 54 . upon rearward titling movement of the handle 18 and upper housing 16 relative to the base assembly 14 , the projection 100 will pivot out of contact with the interrupt switch 98 mounted on the foot member 24 . once the projection 100 has moved out of contact with the switch 98 , then the switch 98 will assume a closed position and complete the circuit between the source of electricity and the brush motor , assuming that the three - position electrical switch 54 is in any position other than off . alternatively , the relative position of the switch and projection can be reversed so that the switch is mounted on the upper housing and selectively contacts a projection mounted on the foot member 24 . instead of the projection 100 , a spring and biased pin can be mounted to the upper housing or foot member 24 in order to provide additional travel for actuating the switch 98 . when the pin is mounted to the foot member , the switch is preferably mounted to the upper housing . in an alternative arrangement , the switch 98 can be replaced by an on / off switch that is mounted at a convenient location on the cleaning machine 12 for actuation by a user . with the upper housing 16 and handle 18 pivotally mounted to the base assembly 14 , the water extraction cleaning machine can be used in a manner similar to an upright vacuum cleaning machine . in other words , the operator can grasp the closed loop grip 58 and manipulate the base assembly 14 forward and backward over the surface being cleaned . with reference now to fig3 b , a pivot mounting and locking assembly 105 ′ according to a second embodiment is illustrated , wherein like parts in the previous embodiment are represented by like numerals . as with the assembly 105 , the assembly 105 ′ is preferably located on the left side of the cleaning machine 12 , although it is to be understood that the locking mechanism can alternatively or in addition be arranged on the right side . the locking assembly 105 ′ includes a foot engagement section 107 ′ and a stem 109 ′ formed integrally with the foot engagement section 107 ′. as in the previous embodiment , a pivot pin 101 extends through a tab 111 on the retention member 88 and the stem 109 ′ to pivotally attach the foot engagement section 107 ′ to the base member 24 . a flat spring 113 ′ is integrally formed with the stem 109 ′ with a free end 127 ′ thereof abutting an upper surface of the retention member rear portion 89 . the spring 113 ′ biases the foot engagement section 107 ′ toward the front portion 96 . a lever arm 115 ′ is integrally molded with , or otherwise rigidly attached to the stem 109 ′ and extends outwardly and downwardly therefrom . a pin 155 projects from the outer free end 157 of the lever arm 115 ′ and rides in a slot 159 of a locking plate 161 . the locking plate 161 is pivotally attached to the base member 24 through a pivot pin 163 and includes a hook - shaped locking portion 165 with an inner hook surface 169 . the base member 24 includes a cylindrical laterally extending protrusion 125 ′ which is located on the side wall 86 . in the normally upright position , as shown in fig3 b , the inner hook surface contacts an outer surface of the protrusion 125 ′ to prevent relative rotation of the handle and foot member . when the foot engagement portion 107 ′ is depressed , as shown in phantom line , the pin 155 rides in the slot 159 of the locking plate 161 and forces the locking plate to pivot in a direction opposite to the pivoting direction of the foot engagement portion 107 ′. the hook - shaped locking portion 165 rotates away from the protrusion 125 ′ until it is clear of the protrusion . in this position , the handle 18 can be rotated with respect to the base member 24 . the locking plate then rotates to its original position under bias from the spring 113 ′. when the handle is rotated to the upright position , the inner surface 169 catches the protrusion 125 ′ and forces the plate ( and foot engagement portion ) to rotate against the bias of the spring 113 ′ until the protrusion 125 ′ is seated in the hook - shaped locking portion 165 . [ 0056 ] fig4 is a schematic representation of the cleaning solution distribution system for the preferred embodiment of the cleaning machine . generally , clean water and detergent are drawn from the respective tanks 42 , 44 to a mixing valve 110 through the operation of a pump 112 . the pump 112 then conducts the pressurized cleaning solution to spray nozzles 114 provided on the base assembly 14 or to the trigger valve 108 of the accessory hose 52 through an accessory hose solution tube mounting 116 provided on the front wall of the upper housing 16 and an accessory hose tube connector 106 mounted on the end of the hose 52 opposite the cleaning tool 68 . turning now to the specific structure of the cleaning solution distribution system , as seen in fig4 - 6 , both the clean water tank 42 and the detergent tank 44 include one - way valve mechanisms 122 on the bottom surfaces thereof which cooperate with tank seat assemblies 150 provided on the upper surface of the upper housing 16 to control the flow of fluid from the tank to the other components of the distribution system . the structure of the one - way valves 122 and tank seat assemblies 150 is identical , and therefore , only the structure of the clean tank valve 122 and seat assembly 150 will be described in detail . the bottom wall of the clean tank 42 has a downwardly extending threaded boss 118 with an aperture extending therethrough . a threaded cap 120 is rotatably received on the boss 118 , and mounts a one - way valve member 122 enclosing the aperture of the boss . the valve member 122 comprises a hollow valve body 124 having a downwardly extending connector boss 126 with a fluid flow aperture 128 extending therethrough . a flexible rubber seal 130 fits around the boss 126 and is adapted to engage an inner surface 151 of the tank seat assembly 150 when the valve member is installed thereon . a gasket 132 , a release rod or plunger 138 and a compression spring 136 are located within the valve body 124 and held in position by a spring housing 134 . a lower end of the spring housing 134 can be securely attached to the inside of the hollow valve body through ultrasonic welding , adhesives , or other well known means . the spring housing 134 preferably has a plurality of apertures 144 to permit the flow of fluid from the tank therethrough . a screen 146 is attached to an upper end 148 of the spring housing 134 to filter out large particles of foreign material that may be present in the fluid . an outer shoulder 145 on the valve body receives an annular gasket 147 that seals around the lower edge of the boss 118 of each tank . the release rod 138 has an annular flange 140 that seats against the gasket 132 under a biasing force from the spring 136 to prevent the flow of fluid from the tank when it is separated from the tank seat assembly 150 . preferably , the bottom of the release rod 158 is flush with the bottom of the connector boss 126 , or slightly thereabove to prevent inadvertent valve opening when the tank is placed right side up on a surface . the tank seat assembly 150 comprises a seat member 152 having a substantially circular flange 154 extending upwardly and downwardly from a base plate 156 . a central projection 158 extends upwardly from the base plate 156 , and a plurality of fluid apertures 160 are formed in the base plate 156 intermediate the central projection 158 and the circular flange 154 . a reservoir 162 is mounted to the seat member 152 beneath the fluid apertures 160 , and a conventional hose mounting 164 extends outwardly from the reservoir 162 . a conventional hose 166 is mounted to the hose mounting 164 and fluidly connects the reservoir to the mixing valve 1 10 which is then fluidly connected to the pump 112 . the preferred embodiment of the seat assembly 150 also includes a one - way umbrella valve 167 to prevent the back flow of solution from the reservoir 162 past the base plate 156 , which may occur when the liquid level in one supply tank is higher than the liquid level in the other supply tank . the one - way valve comprises an elastomeric umbrella valve member 168 having a central stem 170 extending from one side thereof which is received in an appropriate aperture 172 of a support disc 174 . the disc 174 is supported in a suitable recess 176 provided in the seat member 152 . the disc 174 has a plurality of flow apertures 178 provided therein , all of which are adapted to be covered by the umbrella valve 168 . when either positive fluid pressure is exerted on to the top surface of the umbrella valve 168 , or negative fluid pressure is created in the reservoir 162 positioned beneath the valve member 168 , then the outer radius of the body of the umbrella valve 168 will deflect downwardly to permit the flow of fluid from the seat member 152 to the reservoir 162 . as described further below , the tanks are received on the handle 18 and upper housing 16 by vertical movement of the tank assembly 20 with respect to the upper housing 16 . eventually , the one - way valves 122 of the tanks will be telescopically received inside the tank seat assemblies 150 so that the central projection 158 extends upwardly through the boss 126 of the one - way valve a sufficient distance to dislodge the rod 138 from the aperture 128 , thereby permitting the flow of fluid through the one - way valve and into the tank seat assembly 150 . when the tank is lifted vertically with respect to the upper housing 16 , the central projection 158 will be telescopically removed from the aperture 128 , and the spring 136 will bias the rod 138 of the one - way valve back into sealing position to prevent the inadvertent flow of fluid through the one - way valve . the tank assembly 20 is configured for easy refilling of the tanks and securing the tanks to the upper housing 16 and handle 18 . the clean water tank 42 has an integrally molded carrying handle 184 and a cap 186 closing a fill opening aperture 188 formed on the top wall of the tank . a protrusion 187 is integrally molded with the bottom of the clean water tank and fits within a corresponding depression ( not shown ) in the upper housing 16 . the outer wall of the protrusion facilitates alignment of the tank assembly 20 with the upper housing 16 . the inner volume of the protrusion can be filled with detergent that will be mixed in a predetermined ratio when the tank 42 is subsequently filled with water , in the event that the detergent tank 44 and mixing valve are not used . the cap 186 can be quickly and easily removed for filling the tank 42 with clean water . as noted above , the clean water is discharged through the boss 126 and one - way valve mechanism 122 provided on the bottom wall of the clean water tank 42 . a vent opening 182 extends through the upper wall of the tank 42 to allow entry of air when water is removed from the tank from the valve mechanism 122 . if the plunger 138 becomes stuck during operation , the vent opening 182 prevents siphoning if liquid should leak past the plunger . the detergent tank 44 nests into a recess 190 accessible through the front wall 192 of the clean water tank 42 . preferably , the recess 190 is formed in the front , bottom edge of the clean water tank and is defined by a pair of opposed sidewalls 194 , a rear wall 196 , and a top wall 198 . a pair of substantially horizontal projections 200 are provided on the sidewalls 194 of the recess 190 . these projections 200 are adapted to cooperate with a pair of substantially complimentary grooves 202 formed in the sidewalls 204 of the detergent tank 44 for mounting the tanks to one another . the detergent tank 44 is removed from the clean water tank 42 by sliding the detergent tank 44 forward , parallel to the axis of the projections 200 and grooves 202 , until the detergent tank 44 is removed from the recess 190 . the detergent tank 44 must be refilled by unscrewing the cap 120 of the one - way valve assembly and removing the valve member 122 to permit refilling of the tank 44 through the boss aperture . the detergent tank 44 has an umbrella valve 203 ( fig5 ) that fits within a venting aperture 205 on the tank 44 to prevent fluid leakage when the tank is inverted for refilling . the umbrella valve 203 is preferably similar in construction to the one - way umbrella valve 167 in fig6 . once the tank 44 has been refilled , the one - way valve member 122 and cap 120 are replaced , the tank 44 is inverted , and then slid into the recess 190 of the clean water tank 42 . as noted briefly above , the tank assembly 20 is preferably slidably mounted to the handle 18 . the rear wall of the clean water tank 42 includes a u - shaped groove 210 which is substantially complementary to the front portion of the handle 18 . the groove 210 is defined by a pair of opposed sidewalls 212 and a front wall 214 . the sidewalls 212 include a pair of linear grooves 216 which are complementary to a pair of linear projections 218 formed on sidewalls 220 of the handle 18 . the handle projections 218 extend only a portion of the length of the handle 18 . the tank assembly 20 is slidably received on the handle 18 by positioning the tank assembly 20 vertically above the upper housing 16 so that the projections 218 and grooves 216 are aligned with one another . then the tank assembly 20 is lowered so that the tank assembly 20 is slidably received on the handle 18 and the grooves 216 receive the projections 218 . the tank assembly 20 is fully received on the handle 18 when the one - way valve assemblies of the tanks 20 engage the seat assemblies 150 provided on the top wall of the upper housing 16 . the tank seat assemblies 150 are not rigidly mounted horizontally in order to allow alignment of the two tank outlets , which would otherwise cause leaks . once the tank assembly is in this position , the latches 46 can then be pivoted onto the projections 48 for locking the tank assembly 20 to the handle 18 and upper housing 16 . returning to the solution flow schematic diagram seen in fig4 the mixing valve 110 is positioned intermediate the tank seat assemblies 150 and the solution pump 112 . preferably , the mixing valve is a variable mixing valve 110 to accommodate differing mixtures of detergent and clean water . as seen in fig4 , and 8 , the variable mixing valve 110 comprises a valve body 230 having a clean water inlet 232 which is fluidly connected to the clean water tank seat assembly 150 by the hose 166 and a detergent inlet 236 which is fluidly connected to the detergent tank seat assembly 150 by a hose 238 . a solution outlet 240 is also formed on the valve body 230 and is adapted to conduct the clean water and detergent mixture from the mixing valve 110 to the pump 112 through a hose 242 . the valve body is formed from an end cap 244 , a central body portion 246 , and an end inlet member 248 mounted to the end of the central body portion 246 opposite the end cap 244 . a plunger 250 extends through an aperture in the end cap 244 such that a shaft 251 of the plunger 250 is received inside the central body portion 246 and the end inlet member 248 and a portion of the shaft extends outwardly from the end cap 244 . a cam follower 252 is formed at the outer end of the shaft 251 and is adapted to ride along a contoured cam surface 272 of a cam 270 , as seen in fig7 . a plunger head includes a collar 254 that is positioned along the length of the shaft of the plunger 250 and has an annular groove 256 formed therein that receives an o - ring 258 . the collar 254 and o - ring 258 are adapted to create a fluid seal inside the circular valve body and in cooperation with the central body portion define a mixing chamber 260 therein . an o - ring 262 is provided in the central body portion 246 immediately adjacent the end inlet member 248 . the o - ring 262 cooperates with the plunger 250 to effectively seal the end inlet member 248 and detergent inlet 236 from the mixing chamber 260 , depending upon the axial position of the plunger 250 within the valve body 230 . the plunger 250 forms a valve stem 263 at one end with a tapered groove 264 which extends along the surface of the plunger valve stem 250 , preferably passing through the end wall of the plunger 250 , and is tapered so that the groove 264 has a greater cross - sectional area immediately adjacent the end than it does a spaced distance therefrom . the valve stem 263 is positioned in the detergent inlet 236 opening to control the flow of detergent therethrough . the purpose of the tapered groove 264 is to accommodate varying flow rates of detergent through the opening in the detergent inlet 236 into the mixing chamber 260 of the valve body 230 . a control knob 266 is mounted on the front wall 268 of the upper housing 16 for controlling the water / detergent ratio in the cleaning solution delivered to the pump 112 . the cam 270 is mounted to the rear surface of the knob 266 , and the cam 270 is positioned so that the terminal end of the plunger 250 bears against the contoured surface 272 of the cam 270 . fig7 and 8 depict the two extreme ranges of solution mixtures in the preferred embodiment of the cleaning machine 12 . fig7 shows the plunger 250 extended outwardly from the valve body 230 the maximum distance . in this position , the maximum length of the tapered groove 264 is extended into the mixing chamber 260 of the valve . therefore , the maximum amount of detergent will be drawn into the mixing chamber 260 and ultimately discharged to the pump 112 . [ 0072 ] fig8 depicts the other extreme position in which the plunger 250 is positioned so that the entire length of the tapered groove 264 is withdrawn from the mixing chamber 260 so that there is no fluid flow communication between the detergent inlet 236 and the mixing chamber 260 . therefore , only clean water will be directed to the pump 112 . as is evident , the contoured surface 272 of the cam 270 permits an infinite number of detergent to water mixing ratios between the two extremes shown in fig7 and 8 . in the preferred embodiment , the knob 266 and cam 270 are received in only one of three positions , the water only or “ rinse ” position as seen in fig8 a maximum detergent to water mixing ratio as seen in fig7 or a standard mixing ratio half - way between the extremes shown in fig7 and 8 . in use , the knob 266 is intended to be positioned at the standard mixing ratio position for the vast majority of cleaning operations . when a high traffic or heavily stained area is encountered , the knob 266 can be rotated to the maximum detergent position as seen in fig7 . if a final clean water rinsing operation is desired , then the knob 266 can be rotated to the water only position as seen in fig8 . the incorporation of the variable mixing valve 110 permits varying the water / detergent mixture ratios to accommodate a wide variety of cleaning situations . with reference again to fig4 and as noted above , the pump 112 is positioned downstream from the variable mixing valve 110 . when the pump 112 is energized and primed , the pump 112 will draw fluid from the mixing valve 110 and tank seat assemblies 150 at the prescribed ratio . although different pump types can be used , the pump 112 preferably does not self - prime . some means , therefore , should be incorporated to assist priming of the pump 112 . the fluid flow system in fig4 includes a pump priming valve 280 which is preferably mounted vertically above the pump 112 , the tank seat assemblies 150 in the base of the handle 18 , and the water level in the tank 42 . the pump priming valve 280 includes an inlet port 282 that is fluidly connected to the outlet of the pump 112 and a fluid outlet port 284 that is fluidly connected to the impeller fan chamber of the vacuum motor 74 ( fig2 ), or a portion of the recovery tank that is exposed to vacuum pressure . the pump priming valve 280 comprises a hollow valve body having an inner chamber 286 . preferably , a small shoulder 292 with a central aperture 294 is formed inside the valve body . an elongate plunger 290 having a conical rubber sealing tip 296 is received for reciprocal movement inside the ball chamber . the priming valve 280 may also include a vent aperture ( not shown ) to prevent potential siphoning . in operation , the pump 112 will be primed with the fluid from the solution tanks by turning the pump 112 on and the vacuum motor 74 on . the vacuum motor 74 will exert negative pressure on the fluid outlet of the pump 112 through the pump priming valve 280 thereby drawing any air out of the pumping chamber ( not shown ) between the pump inlets and the solution tanks therethrough . the air will be drawn through the pump priming valve 280 into the vacuum impeller fan chamber or into the recovery tank 30 . preferably , the weight and dimensions of the plunger 290 is coordinated with the amount of negative air pressure applied to the pump priming system from the vacuum motor so that the negative air pressure applied to the fluid chamber 286 is insufficient , by itself , to draw the plunger 290 upwardly and seal the outlet of the pump priming valve . as the vacuum motor 74 operates to draw the air from the system , it is likely that some fluid will enter the pump priming valve 280 . preferably , the size of the elongated fluid chamber 286 is dimensioned to accommodate a sufficient amount of fluid to permit full priming of the pump 112 . eventually , the fluid level will rise inside the pump priming valve 280 and fluid will enter the ball chamber 286 . the plunger 290 is preferably formed of a material and dimension such that the fluid alone does not cause the plunger to rise in the chamber . however , the combined pulling force from the negative air pressure and the pushing force from the rising liquid inside the chamber acting on the plunger causes the plunger to rise until the sealing tip 296 bears against the shoulder 292 and seals the aperture 294 to prevent solution from flowing therefrom . once this seal has established , the pump should be sufficiently primed for normal operation . following the pump priming valve 280 , the pressurized solution is simultaneously directed to the accessory hose solution tube mounting 116 and a conventional trigger valve 300 . as seen in fig4 and 5 , the trigger valve 300 is positioned in the base of the handle 18 immediately below the bottom end of an actuator rod 302 . the rod 302 extends upwardly to pivotally interconnect with the trigger 60 provided in the closed loop grip 58 of the handle 18 . in the preferred embodiments , multiple actuator rods 302 are interconnected to traverse the distance between the trigger 60 and the trigger valve 300 . upon squeezing of the trigger 60 relative to the closed loop grip 58 , the actuator rods 302 are displaced downwardly to squeeze the plunger 304 of the conventional trigger valve 300 and permit the flow of fluid therethrough . with the trigger valve 300 in the open position , pressurized fluid flows through a conventional conduit 306 to a pair of spray tips 114 mounted to the foot member 24 immediately adjacent the agitation brush . preferably , the spray tips 114 are adapted to create a fan - shaped spray pattern which traverses substantially the entire width of the agitation brush and suction nozzle opening . turning now to the fluid recovery system , the vacuum motor 74 and impeller fan 76 generate negative air pressure which is communicated from the upper housing 16 to the base assembly 14 for recovery of used solution and dirt . as shown in fig9 and 10 , the working air flow path for on - the - floor cleaning begins at the suction nozzle opening 316 provided at the front , forward edge of the base assembly 14 . preferably , the suction nozzle opening is defined by a front plate member 318 and a rear plate member 320 which are mounted to one another and which also define the initial working air flow conduit 322 . the suction nozzle opening 316 extends the entire width of the base assembly 14 and the plate members 318 , 320 . a pair of sidewalls 324 are integrally formed into the rear plate member to define the sides of the initial flow conduit . preferably , the sidewalls 324 taper upwardly and inwardly ( see fig1 ). the initial flow conduit 322 terminates at an outlet 326 positioned along the top edges of the plate members and sidewalls . in view of the fact that the sidewalls of the flow conduit taper upwardly and inwardly , the length of the outlet of the initial suction flow conduit is less than the length of the suction nozzle opening and the width of the base assembly 14 . preferably , an elastomeric gasket 328 is mounted to the top edges of the front and rear plates 318 , 320 and surrounds the outlet 326 . from the initial flow conduit 322 , the air / water / debris mixture flows into recovery tank 30 which is an assembly of a bottom member 308 and a top member 310 having a top wall 364 , a pair of sidewalls 366 , and a rear wall 368 . the working air flows from the initial flow conduit 322 to an intermediate working air flow conduit 330 which is defined by a depression 332 formed in the top wall 364 of the recovery tank 30 and a cover plate 336 secured thereto . the depression 332 comprises a bottom wall 338 and a pair of opposed sidewalls 340 . preferably , the sidewalls 340 initially taper inwardly from the inlet 342 of the intermediate working air conduit a short distance and then ultimately extend parallel to one another approaching the outlet 344 of the intermediate working air conduit 330 . preferably , the cover plate 336 is formed of a transparent , plastic material , and the top wall 364 and sidewalls 346 of the recovery tank 30 are formed of a smokey , translucent material . utilizing these materials and the structure of the intermediate flow conduit 330 , the user can easily observe the dirt and water passing up through the intermediate flow conduit 330 and also easily observe the fluid level inside the recovery tank 30 . the outlet 344 of the intermediate flow conduit 330 is positioned immediately adjacent an air / water separator baffle 350 which is integrated into the recovery tank 30 and is formed by a downwardly extending rear wall 352 , a pair of parallel , downwardly extending sidewalls 354 , and a bottom wall 356 extending forwardly from the rear wall 352 . a sealing pocket 429 is integrally formed along the rear wall 352 . with this structure , the working air flow enters the hollow interior of the recovery tank 30 and is immediately redirected approximately 180 ° to travel forwardly and downwardly into the tank interior away from the tank outlet 382 . the water and dirt will enter the air / water separator baffle 350 and strike the various walls of the baffle 350 and fall downwardly into the tank . in addition to the redirection of the working air flow as it enters the tank 30 , the effective cross - sectional area of the working air conduit is dramatically increased as the air / water mixture passes from the intermediate working air conduit into the air / water separator baffle and the recovery tank . this sudden increase in cross - sectional area results in a significant drop in velocity for the working air , thereby assisting in the separation of dirt and water from the air . a fluid containment baffle 370 is mounted inside the hollow interior of the recovery tank 30 and is intended to prevent excessive sloshing of the recovered dirt and liquid and also contain any foam generated inside the tank . the baffle 370 comprises a front , downwardly extending portion 372 and a rear downwardly extending portion 374 which are spaced from one another but interconnected to one another by multiple stringers 376 . the stringers 376 and edges of the front 372 and rear portions 374 define fluid apertures 378 therebetween . preferably , the baffle 370 is mounted to the rear wall 368 , sidewalls 366 , and top wall 364 of the top member 310 a spaced distance from the bottom member 308 . preferably , the fluid flow apertures 378 are positioned immediately below the air / water separator 350 so that as the dirt and water drop therefrom , they pass through the apertures 378 into the lowermost portion of the recovery tank 30 . the front 372 and rear 374 portions of the baffle 370 are contoured to prevent excessive sloshing of the recovered liquid during movement of the cleaner 12 . for example , when the user is moving the base assembly 14 forward and then reverses the direction and pulls the base assembly 14 rearwardly , the water and dirt present within the tank will surge toward the front of the recovery tank 30 . the water will strike the sloping top wall 364 of the recovery tank 30 and be deflected rearwardly . any water which may be deflected upwardly will strike the downwardly extending front portion 372 of the baffle 370 and , therefore , be deflected downwardly to the lowermost portion of the recovery tank 30 . the downwardly extending rear portion 374 of the baffle 370 will similarly deflect fluid downwardly . the baffle 370 serves to prevent excessive sloshing of fluid in the tank and also provides the added benefit of containing any foam which may build up in the tank beneath the baffle 370 spaced away from the air / water separator baffle 350 and fluid outlet . an air flow outlet stand pipe 380 is integrally formed into the bottom member 308 and is provided at the rear of the recovery tank 30 . the stand pipe extends upwardly to a point adjacent the uppermost portion of the recovery tank 30 , opposite the outlet of the air / water separator baffle 350 . in addition , an inlet opening 382 of the stand pipe 380 is positioned vertically above the baffle 370 . with this structure , the substantially dry air exiting the air / water separator 350 will pass around the bottom 356 and sidewalls 354 of the air / water separator 350 and through the inlet opening 382 of the stand pipe 380 whereas the dirt and water will fall through the baffle apertures 378 into the lowermost portion of the recovery tank 30 . a manifold chamber 384 is formed at the bottom of the stand pipe 380 and defined by the bottom member 308 and the foot member 24 . preferably , an elastomeric gasket 388 is mounted to the top of the manifold chamber 384 to create a substantially air - tight seal between the bottom of the stand pipe 380 and the manifold chamber 384 . the manifold chamber 384 is shown integrally molded to the base member 24 . preferably however , the manifold chamber 384 is formed separately from the base member 24 and includes downwardly extending hooks ( not shown ) that engage with cantilevered arms ( not shown ) on the base member 24 . the hooks are shaped to contact an upper surface of the arms and flex the arms downwardly when the manifold chamber 384 is installed . a locking surface ( not shown ) on the hooks then engages a lower surface of the arms to lock the manifold chamber 384 to the base member 24 . a flexible conduit hose 386 extends from one end of the manifold to the impeller fan chamber mounted in the lower portion of the upper housing 16 . in view of the fact that the upper housing 16 pivots with respect to the foot member 24 and recovery tank 30 , the conduit 386 is preferably formed of a pliable , yet durable material . a float 390 is provided inside the recovery tank 30 to prevent overfilling of the recovery tank 30 with fluid . the float 390 comprises a buoyant base 392 and a closure plate 394 interconnected to one another by a support plate 396 . the closure plate 394 is dimensioned to fully seal the inlet opening 382 of the stand pipe 380 and prevent the flow of air or liquid therethrough . the float 390 is limited primarily to vertical movement with respect to the recovery tank 30 , with the closure plate positioned above the fluid containment baffle 370 and the buoyant base 392 positioned below the fluid containment baffle 370 . the fluid containment baffle 370 also includes an aperture 398 through which the stand pipe 3 80 extends . in addition , a narrow slot 400 is also provided in the rear portion 374 of the fluid containment baffle 370 through which the support plate 396 of the float 390 extends . in the assembled position , the closure plate 394 is positioned above the fluid containment baffle 370 and the buoyant base 392 is positioned below the baffle 370 . movement of the float is constrained because the buoyant base is captured in a float cage defined by the front wall 402 of the stand pipe 380 , a pair of l - shaped walls 404 , 406 ( fig1 ) extending up from the bottom member 308 , a substantially planar wall 408 extending upwardly from the bottom member 308 intermediate the two l - shaped wall members 404 , 406 and the rear portion 374 of the fluid containment baffle 370 . multiple slots 412 or fluid flow apertures are provided between the wall members 404 , 406 , 408 and the stand pipe 380 so that fluid will quickly and easily flow into the float cage defined by these elements . as the fluid within the tank and the float cage rises , the float 390 will also rise until eventually , the closure plate 394 nears the inlet opening 382 of the stand pipe 380 . the closure plate 391 is sufficiently drawn against the stand pipe opening 394 by the suction from the vacuum motor 74 to close the air flow therethrough as illustrated by the phantom lines in fig9 . once this happens , the pitch of the operating vacuum motor 74 is sufficient to warn the user that the recovery tank 30 is full and must be emptied . the cover plate 336 has a triangular - shaped accessory hose flow aperture 422 and a lock aperture 428 . a cover closure cap 420 has a spring arm 446 with a barb 448 which seats beneath the wall of the cover plate 336 at the lock aperture 428 when the cover cap 420 is seated over the aperture 428 . a pair of retaining projections 423 extend rearwardly from a front edge of the aperture 422 into recesses 425 in a depending flange 421 of the cover cap 420 when the cover cap 420 is seated over the aperture 428 . the cap 420 can thus pivot about the projections 423 as the cap is fastened over and removed from the aperture 422 . the recovery tank 30 is quickly and easily emptied by first tilting the handle 18 and upper housing 16 rearwardly . then , the latches 32 are disengaged from the projections 34 on the recovery tank 30 . the user grasps the handle 36 and merely lifts the tank 30 from the foot member 24 and transports it to an appropriate site for emptying the tank 30 . the tank 30 can also be removed from the foot member 24 without tilting the handle 18 and upper housing 16 . in any event the tank 30 can then be emptied by removing a cap 414 mounted to the drainage aperture 416 provided on the rear wall 368 of the tank 30 . once the tank 30 has been emptied , the cap 414 is replaced , the tank 30 is lowered down onto the foot member 24 , and finally , the latches 32 are snapped over the projections 34 to lock the tank to the base assembly 14 . as seen in fig2 the entirety of the accessory hose 52 is contained on the accessory hose storage rack 50 when the cleaning machine 12 is used for on - the - floor cleaning or when the machine is being stored . when it is desired to use the accessory hose 52 , the user unsnaps the grip tube 64 from the c - shaped clip 66 of the hose rack 50 and unwinds the hose therefrom and then removes the accessory hose mounting member 62 from its corresponding c - shaped clip on the storage rack 50 . next , the user removes the cap 420 ( fig1 ) from the recovery tank cover plate 336 , exposing the accessory hose flow aperture 422 and inserts the accessory hose mounting member 62 therein . the mounting member 62 comprises an elbow - shaped rigid conduit 424 which receives the flexible hose on one end thereof and a triangular shaped mounting plate 426 on the other end thereof . as seen in fig1 and 12 , the accessory hose flow aperture 422 is preferably formed directly above the air / water separator baffle 350 when the cover plate 336 is mounted to the top member 310 of the recovery tank 30 . the lock aperture 428 is also formed in the cover plate 336 , directly adjacent the accessory hose flow aperture 422 . the accessory hose mounting member 62 comprises a flange 430 which extends downwardly from the triangular support plate 426 . the flange 430 is substantially complementary to the inside edge of the aperture 422 and is adapted to be snugly received therein . a baffle wall 432 extends downwardly along the front edge of the triangular flange 422 and has a recess 432 a which receive the projections 423 . the baffle 432 extends substantially the entire width of the intermediate working air conduit 330 and extends downwardly a sufficient distance to contact the bottom wall 338 of the conduit to thereby effectively seal the intermediate flow conduit 330 from the air / water separator baffle 350 and the vacuum motor 74 . therefore , substantially all of the working air drawn into the recovery tank 30 comes from the accessory hose 52 when the accessory hose 52 is mounted to the base as illustrated in fig1 . the accessory hose mounting member 62 is retained in the aperture 422 by a u - shaped spring arm 434 which is received in the lock aperture 428 and a sealing pocket 429 located immediately below the aperture 428 . the sealing pocket 429 is integrally formed with the rear wall 352 of the baffle 350 and includes a front wall 431 and a pair of side walls 433 extending between the front wall 431 and the baffle rear wall 352 . the spring arm 434 comprises a pair of opposed legs 436 , 438 connected to each other through a central bight portion 435 . the leg 436 extends downwardly from the triangular - shaped support plate . a locking barb 440 is provided on the outside edge of the free leg 438 and a projection 442 is provided at the terminal end of the free leg 438 . in use , the bight portion of the u - shaped arm 434 is initially inserted into the lock aperture 428 . as the spring arm 434 is received in the aperture 428 and sealing pocket 429 , the locking barb 440 bears against one edge of the aperture 428 , thereby flexing the free leg 438 inwardly toward the other leg 436 . eventually , the locking barb 440 will drop below the inside edge of the cover plate 336 at the aperture 428 and the resilient u - shaped spring arm 434 will spring outwardly to seat the barb beneath the cover plate 336 edge . the edge of the cover plate 336 at the aperture 428 will be captured between the outer projection 442 and the locking barb 440 of the spring arm 434 . when the user desires to remove the accessory hose mounting member 62 from the aperture 422 , the user squeezes the free leg 438 toward the inner leg 436 a sufficient distance to bring the locking projection 440 out of contact with the aperture edge . then , the user lifts the mounting member 62 a sufficient distance to withdraw the spring arm 434 , triangular - shaped flange 430 and baffle 432 from the aperture 422 . finally , the user repositions the cap 420 in the aperture 422 thereby effectively sealing the aperture 422 . as seen in fig9 and 10 , the structure of the cap 420 is quite similar to the accessory hose mounting member 62 in that it includes an identical spring arm 446 and a substantially complimentary triangular flange extending downwardly therefrom . one key distinction is that the cap 420 does not include the downwardly extending baffle wall which seals the intermediate working air flow path 330 . the preferred embodiment of the cleaning machine 12 includes a rotatively mounted agitation brush which is adapted for easy and instantaneous vertical adjustment . as seen in fig9 and 13 , the agitation brush assembly comprises a brush dowel 450 fixedly mounted on a shaft 452 . the ends of the shaft 452 are received in bearings 454 which in turn are press - fit into inwardly extending bosses 456 provided on a pair of opposed articulating arm members 458 . alternatively , stub shafts ( not shown ) can extend from the arm members 458 and the shaft 452 can be replaced with bearings similar to 454 for rotational installation of the dowel 450 on the arm members 458 . each arm member 458 comprises a back plate 460 with a pivot pin 462 provided at the rear of the plate 460 and a limit arm 464 provided at the front of the plate 460 . in addition , a laterally extending belt guard 466 is preferably integrally formed with the articulating arm 458 . the belt guard 466 extends laterally inwardly enough to cover the drive belt 468 in the assembled position . the belt guard 466 protects the belt 468 from threads and other foreign material becoming lodged therein and also protects the carpet or other surface positioned below the base assembly 14 from the rotating belt 468 . the drive belt 468 extends around a pulley 470 mounted at one end of the brush dowel 450 and a drive shaft and pulley 472 of the brush motor 474 . the pivot pins 462 of the arm member 458 are captured between a bearing surface 476 integrally formed into the bottom of the foot member 24 and a retaining member 478 having a bearing surface 480 formed thereon . the pivot pin 462 is captured between the bearing surfaces 480 , 476 of the retaining member 478 and the foot member 24 . the retaining member 478 is secured to the foot member 24 by a conventional fastener , such as a screw 482 . the limit arms 464 provided at the front of the retaining members 478 are preferably integrally molded with the retaining members and are adapted to limit the downward movement of the brush assembly relative to the foot member 24 . each limit arm 464 has a forwardly extending barb 484 provided at the terminal end of the arm 464 . in the operative position , the barb 484 is positioned above a rearwardly extending projection 486 provided on the foot member 24 . as seen in fig9 as the agitation brush assembly extends further and further downward , the barb 484 on the end of the limit arm 464 will contact the projection 486 and prevent any further downward movement . with this floating agitation brush assembly , the cleaning machine 12 according to the invention can almost instantaneously adapt to varying carpet naps or other inconsistencies on the surface being cleaned . the brush arms also allow the rotating brush to drop below the normal floor plane to provide contact with the floor when a bare floor cleaning attachment raises the suction nozzle opening height from the floor . as an alternative to the floating , rotatably mounted agitation brush as seen in fig9 and 13 , a floating strip agitation brush 490 could be incorporated in the cleaning machine 12 , as seen in fig1 . the floating strip agitation brush 490 is easily adapted for incorporation into the cleaning machine 12 . in this embodiment , the strip brush 490 comprises a linear brush body 492 with bristles 494 extending downwardly therefrom and a pair of integrally molded arms 496 . each of the arms 496 is formed by a pair of opposed plates 498 , 500 and a pivot pin 502 extending between the rear most edge of the opposed plates 498 , 500 . the pivot pins 502 in this embodiment are secured to the foot member 24 in the same manner as the pivot pins 462 shown previously in fig1 . namely , the pivot pins 502 are captured between the bearing surface 476 of the foot member 24 and the bearing surface 480 formed on the retention member 478 which is securely fastened to the foot member 24 by conventional fasteners 482 . with this structure , the strip brush 490 can move vertically in response to changes in the carpet nap or other inconsistencies in the surface being cleaned . as described above with respect to fig1 the accessory hose solution tube mounting 116 is used primarily for connecting an accessory nozzle , such as found in the upholstery tool 68 in order to provide cleaning solution to the surface being cleaned . it is contemplated , however , that an elongate spray wand can be provided as an accessory attachment for the solution tube mounting 116 . the detergent tank 44 could hold an insecticide solution that is mixed with water or other liquid from the clean water tank 42 in an adjustable ratio for the treatment of fleas or ticks , as an example . in use , the vacuum motor 74 and the brush motor 474 would be turned off , with the solution pump 112 turned on to deliver the insecticide solution to a surface . alternatively , the clean water tank 42 could hold the insecticide solution or some other solution that is to be directly applied to a surface . the water extraction cleaning machine according to the invention overcomes several of the problems of the prior art . namely , the cleaning machine is easily adapted for a variety of cleaning operations . for example , the detergent to water mixture ratio can be altered nearly instantaneously . in addition , the height of the agitation brush with respect to the suction nozzle opening changes immediately in response to changes in the carpet nap and other inconsistencies in the surface being cleaned . the cleaning machine according the invention also provides easy and convenient means for filling and emptying the clean water and detergent tanks . similarly , the recovery tank can be quickly and easily removed for emptying or cleaning . finally , the accessory hose intended for use with the cleaning machine according to the invention is preferably stored on the machine at all times when not in use . this minimizes the storage space required for the machine and accessories and simultaneously ensures that the user has all attachments and accessories contained on the machine , regardless of where the machine is being used . reasonable variation and modification are possible within the spirit of the foregoing specification and drawings without departing from the scope of the invention . | 1 |
as will be appreciated by one skilled in the art , embodiments of the present invention may be embodied as a system , method or computer program product . accordingly , embodiments of the present invention may take the form of an entirely hardware embodiment , an entirely software embodiment ( including firmware , resident software , micro - code , etc .) or an embodiment combining software and hardware aspects that may all generally be referred to herein as a “ circuit ,” “ module ” or “ system .” furthermore , embodiments of the present invention may take the form of a computer program product embodied in any tangible medium of expression having computer usable program code embodied in the medium . any combination of one or more computer usable or computer readable medium ( s ) may be utilized . the computer - usable or computer - readable medium may be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a non - exhaustive list ) of the computer - readable medium would include the following : an electrical connection having one or more wires , a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , a portable compact disc read - only memory ( cdrom ), an optical storage device , a transmission media such as those supporting the internet or an intranet , or a magnetic storage device . note that the computer - usable or computer - readable medium could even be paper or another suitable medium , upon which the program is printed , as the program can be electronically captured , via , for instance , optical scanning of the paper or other medium , then compiled , interpreted , or otherwise processed in a suitable manner , if necessary , and then stored in a computer memory . in the context of this document , a computer - usable or computer - readable medium may be any medium that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer - usable medium may include a propagated data signal with the computer - usable program code embodied therewith , either in baseband or as part of a carrier wave . the computer usable program code may be transmitted using any appropriate medium , including but not limited to wireless , wireline , optical fiber cable , rf , etc . computer program code for carrying out operations of the present invention may be written in any combination of one or more programming languages , including an object oriented programming language such as java , smalltalk , c ++ or the like and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the program code may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). the present invention is described below with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ) and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer program instructions . these computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer program instructions may also be stored in a computer - readable medium that can direct a computer or other programmable data processing apparatus to function in a particular manner , such that the instructions stored in the computer - readable medium produce an article of manufacture including instruction means which implement the function / act specified in the flowchart and / or block diagram block or blocks . the computer program instructions may also be loaded onto a computer or other programmable data processing apparatus to cause a series of operational steps to be performed on the computer or other programmable apparatus to produce a computer implemented process such that the instructions which execute on the computer or other programmable apparatus provide processes for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . the present invention relates to identifying a set of data items based on both relevance and diversity . in embodiments of the invention , these data items are selected based on a graph of a larger set of data items , and embodiments of the invention provide a scalable algorithm ( linear with respect to the size of the graph ) that generates a provably near - optimal top - k ranking list . in embodiments of the invention , this algorithm has a clear optimization formulation , finds a provable near - optimal solution , and enjoys linear scalability . table i lists the main symbols used in this description of the invention . in the description below , we consider the most general case of directed , weighted , irreducible unipartite graphs . we represent a general graph by its adjacency matrix . in practice , we store these matrices using an adjacency list representation , since real graphs are often very sparse . we represent a general graph by its adjacency matrix . following the standard notation , we use bold upper - case for matrices ( e . g ., a ), bold lower - case for vectors ( e . g ., a ), and calligraphic fonts for sets ( e . g ., i ). we denote the transpose with a prime ( i . e ., a ′ is the transpose of a ). for a bipartite graph with adjacency matrix w , we can convert it to the equivalent uni - partite graph : we use subscripts to denote the size of matrices / vectors ( e . g ., a n × n means a matrix of size n × n ). when the sizes of matrices / vectors are clear from the context , we omit such subscripts for brevity . also , we represent the elements in a matrix using a convention similar to matlab , e . g ., a ( i , j ) is the element at the i th row and j th column of the matrix a , and a (:, j ) is the j th column of a , etc . with this notation , we can represent a sub - matrix of a as a ( i , i ), which is a block of matrix a that corresponds to the rows / columns of a indexed by the set i . in the description below , we focus on personalized pagerank since it is one of the most fundamental ranking methods on graphs , and has shown its success in many different application domains in the past decade . formally , it can be defined as follows : where p is an n × 1 personalized vector ( p ( i )≧ 0 , σ i = 1 n p ( i )= 1 ). sometimes , we also refer to p as the query vector , c ( 0 & lt ; c & lt ; 1 ) is a damping factor ; a is the row - normalized adjacency matrix of the graph ( i . e ., σ j = 1 n a ( i , j )= 1 ( i = 1 , . . . , n ); and r is the n × 1 resulting ranking vector . note that if p ( i )= 1 / n ( i = 1 , . . . , n ), it is reduced to the standard pagerank ; if p ( i )= 1 and p ( j )= 0 ( j ≠ i ), the resulting ranking vector r gives the proximity scores from node i to all the other nodes in the graph . in order to simplify the description of our upcoming method , we also introduce matrix b : where 1 1 × n is a 1 × n row vector with all elements set to 1s . intuitively , the matrix b can be viewed as the personalized adjacency matrix that is biased towards the query vector p . in turns out that the ranking vector r defined in eq . ( 1 ) satisfies r = br . in other words , the ranking vector r is the right eigenvector of the b matrix with the eigenvalue 1 . it can be verified that b is a column - wise stochastic matrix ( i . e ., each column of b sums up to 1 ). by perron - frobenius theorem , it can be shown that 1 is the largest ( in module ) simple eigenvalue of the matrix b ; and the ranking vector r is unique with all non - negative elements since the graph is irreducible . aspects of the invention provide ( 1 ) a goodness measure to quantify the quality of a given top - k ranking list that captures both the relevance and the diversity ; and ( 2 ) given the goodness measure , an optimal or near - optimal or near - optimal algorithm to find a top - k ranking list that maximizes such goodness measure in a scalable way . with the above notations and assumptions , these problems can be formally defined as follows : given : a large graph a n × n , the query vector p , the damping factor c , and a subset of k nodes s ; output : a goodness score f ( s ) of the subset of nodes s , which measures ( a ) the relevance of each node in s with respect to the query vector p , and ( v ) the diversity among all the nodes in the subset s . given : a large graph a n × n , the query vector p , the damping factor c , and the budget k ; find : a subset of k nodes s that maximizes the goodness measure f ( s ). an aspect of an embodiment of the invention is to define a goodness measure to quantify the quality of a given top - k ranking list that captures both the relevance and the diversity . we first discuss some design objective of such a goodness measure ; and then present a solution followed by some theoretical analysis and discussions . as said before , a good diversified top - k ranking list should balance between the relevance and the diversity . the notion of relevance is clear for personalized pagerank ,— larger value in the ranking vector r means more relevant with respect to the query vector p . on the other hand , the notion of diversity is more challenging . intuitively , a diversified subset of nodes should be dis - similar with each other . take the query ‘ find the top - k conferences for dr . y . from the author - conference network ’ as an example . dr . y yu is a professor at a university , and his recent major research interest lies in databases and data mining . he also has broad interests in several related domains , including systems , parallel and distributed processing , web applications , and performance modeling , etc . a top - k ranking list for this query would have high relevance if it consists of all the conferences from databases and data mining community ( e . g ., sigmod , vldb , kdd , etc .) since all these conferences are closely related to his major research interest . however , such a list has low diversity since these conferences are too similar with each other ( e . g ., having a large overlap of contributing authors , etc .). therefore , if we replace a few databases and data mining conferences by some representative conferences in his other research domains ( e . g ., icdcs for distributed computing systems , www for web applications , etc . ), it would make the whole ranking list more diverse ( e . g ., the conferences in the list are more dis - similar to each other ). furthermore , if we go through the ranking list from top down , we would like to see the most relevant conferences appear first in the ranking list . for example , a ranking list in the order of ‘ sigmod ’, ‘ icdcs ’, ‘ www ’ is better than ‘ icdcs ’, ‘ www ’, ‘ sigmod ’ since databases ( sigmod ) is a more relevant research interest for dr . y , compared with distributed computing systems ( icdcs ), or web applications ( www ). in this way , the user can capture dr . y &# 39 ; s main research interest by just inspecting a few top - ranked conferences / nodes . this suggests the so - called diminishing returns property of the goodness measure — it would help the user to know better about dr . y &# 39 ; s whole research interest if we return more conferences / nodes in the ranking list ; but the marginal benefit becomes smaller and smaller as we go down the ranking list . another implicit design objective lies in the algorithmic aspect . the proposed goodness measure should also allow us to develop an effective and scalable algorithm to find an optimal ( or at least near - optimal ) top - k ranking list from large graphs . to summarize , for a given top - k ranking list , we aim to provide a single goodness score that ( 1 ) measures the relevance between each individual node in the list and the query vector p ; ( 2 ) measures the similarity ( or dis - similarity ) among all the nodes in the ranking list ; ( 3 ) exhibits some diminishing returns property with respect to the size of the ranking list ; and ( 4 ) enables some effective and scalable algorithm to find an optimal ( or near - optimal ) top - k ranking list . let a be the row - normalized adjacency matrix of the graph , b be the matrix defined in eq ( 2 ), p be the personalized vector and r be the ranking vector . for a given ranking list s ( i . e ., s gives the indices of the nodes in the ranking list ; and | s |= k ), a goodness measure in an embodiment of the invention is formally defined as follows : we can also represent f ( s ) by using the matrix a instead : f ( s ) = 2 ∑ i ∈ s r ( i ) - c ∑ i , j ∈ s a ( j , i ) r ( j ) - ( 1 - c ) ∑ j ∈ s r ( j ) ∑ i ∈ s p ( i ) where c is the damping factor in personalized pagerank , and 1 1 ×| s | is a row vector of length | s | with all the elements set to 1s . it can be shown that it is equivalent to eq . ( 3 ). notice that the goodness measure in eq . ( 3 ) is independent of the ordering of the different nodes in the subset s . if we simply change the ordering of the nodes for the same subset s , it does not affect the goodness score . however , as discussed below , we can still output an ordered subset based on the diminishing returns need when the user is seeking a diverse top - k ranking list . let us analyze how the proposed goodness measure of eq . ( 3 ) meets the design objective discussed above . there are two terms in eq . ( 3 ), the first term is twice the sum of the ranking scores in the ranking list . for the second term , recall that b can be viewed as the personalized adjacency matrix with respect to the query vector p , where b ( i , j ) indicates the similarity ( i . e ., the strength of the connection ) between nodes i and j . in other words , the second term in eq . ( 3 ) is the sum of all the similarity scores between any two nodes i , j ( i , j ∈ s ) in the ranking list ( weighted by r ( j )). therefore , the proposed goodness measure captures both the relevance and the diversity . the more relevant ( higher r ( i )) each individual node is , the higher the goodness measure f ( s ). at the same time , it encourages the diversity within the ranking list by penalizing the ( weighted ) similarity between any two nodes in s . the measure f ( s ) of eq . ( 3 ) also exhibits the diminishing returns property , which is summarized in theorem 1 below . the intuitions of theorem 1 are as follows : ( 1 ) by p1 , it means that the utility of an empty ranking list is always zero ; ( 2 ) by p2 , if we add more nodes into the ranking list , the overall utility of the ranking list does not decrease ; and ( 3 ) by p3 , the marginal utility of adding new nodes is relatively small if we already have a large ranking list . theorem 1 . diminishing returns property of f ( s ). let φ be an empty set , i , j , r be three sets s . t ., i ⊂ j , and r ∩ j = φ . the following facts hold for f ( s ): proof of p1 . it is obviously held by the definition of f ( s ). proof of p2 . let t = j \ i . substituting eq . ( 3 ) into f ( j )− f ( i ) and canceling the common terms , we have recall that the matrix b is a column - wise stochastic matrix ( i . e ., each column of b sums up to 1 ). the first half of eq . ( 4 ) satisfies the last equality in eq . ( 6 ) is due to the fact that r = br , and each element is r is non - negative . putting eq . ( 4 )-( 6 ) together , we have that f ( j )≧ f ( i ), which completes the proof of p2 . proof of p3 . again , let t = j \ i . substituting eq . ( 4 ) into ( f ( i ∪ r )− f ( i ))−( f ( j ∪ r )− f ( j )) and canceling the common terms , we have therefore , we have that f ( i ∪ r )− f ( i )≧ f ( j ∪ r )− f ( j ), which completes the proof of p3 . in eq . ( 3 ), the coefficient ‘ 2 ’ balances between the relevance ( the first term ) and the diversity ( the second term ). if we change the coefficient ‘ 2 ’ to a parameter w , we have the following generalized goodness measure : we have the following corollary for this generalized goodness measure . it says that as long as the weight w ≧ 2 , the generalized goodness measure g ( s ) still exhibits the diminishing returns property . this gives our method extra flexibility if the user wants to put more emphasis on relevance for some applications . corollary 2 . generalized goodness measure . let φ be an empty set : i , j , r be three sets s . t . i ⊂ j , and r ∩ j = φ . for any w ≧ 2 , the following facts hold for g ( s ): p3 : g ( s ) is submodular , i . e ., g ( ∪ )− g ( )≧ g ( ∪ )− g ( ). in this section , we address problem 2 . here , given the initial query vector p and the budget k , we want to find a subset of k nodes that maximizes the goodness measure defined in eq . ( 3 ). we would like to point out that although we focus on eq . ( 3 ) for the sake of simplicity , the proposed algorithm can be easily generalized to eq . ( 7 ) where the user wants to specify the weight w for the relevance . problem 2 is essentially a subset selection problem to find the optimal k nodes that maximize eq . ( 3 ). theorem 1 indicates that it is not easy to find the exact optimal solution of problem 2 — it is np - hard to maximize a monotonic submodular function if the function value is 0 for an empty set . for instance , a straight - forward method would take exponential enumerations to find the exact optimal k nodes , which is not feasible in computation even for a medium size graph ( e . g ., with a few hundred nodes ). we can also formulate problem 2 as a binary indicator vector ( x ( i )= 1 means node i is selected in the subset s , and 0 means it is not selected ). problem 2 can be expressed as the following binary quadratic programming problem : subject to : x ( i ) ∈ { 0 , 1 } ( i = 1 , … n ) ∑ i = 1 n x ( i ) = k ( 8 ) where d =( b − 2i n × n ) diag ( r ), i n × n is an identity matrix of size n × n , and diag ( r ) is a diagonal matrix with r ( i , i )( i = 1 , . . . , n ) being the diagonal elements . fig1 ( a ) shows an algorithm used in an embodiment of the invention , and fig1 ( b ) illustrates the operation of this algorithm . with reference to fig1 ( a ), in step 1 of the algorithm , we compute the ranking vector r ( e . g ., by the power method , etc .) then after some initializations ( steps 2 - 5 ), we select k nodes one - by - one as follows . at each time , we compute the score vector s in step 7 . then , we select one node with the highest score in the vector s and add it to the subset s ( steps 8 - 9 ). after that , we use the selected node to update the two reference vectors u and v ( steps 10 - 11 ). note that ‘{ circle around ( x )}’ denotes the element - wise product between two matrices / vectors . intuitively , the score vector s keeps the marginal contribution of each node for the goodness measure given the current selected subset s . from step 7 , it can be seen that at each iteration , the values of such marginal contribution either remain unchanged or decrease . this is consistent with p3 of theorem 1 — as there are more and more nodes in the subset s , the marginal contribution of each node is monotonically non - increasing . it is worth pointing out that we use the original normalized adjacency matrix a , instead of the matrix b in alg . 1 . this is because for many real graphs , the matrix a is often very sparse , whereas the matrix b might not be . to see this , notice that b is a full matrix if p is uniform . in the case b is dense , it is not efficient in either time or space to use b in alg . 1 . in alg . 1 , although we try to optimize a goodness measure that is not affected by the ordering of different nodes in the subset , we can still output an ordered list to the user based on the iteration in which these nodes are selected — earlier selected nodes in alg . 1 are placed at the top of the resulting top - k ranking list . this ordering naturally meets the diminishing returns need when the user is seeking for a diverse top - k ranking list as we analyzed above . in the discussion below , we analyze the optimality as well as the complexity of algorithm 1 . this discussion shows that this algorithm leads to a near - optimal solution , and at the same time it enjoys linear scalability in both time and space . the optimality of algorithm 1 is given in lemma 1 , below . according to this lemma , this algorithm is near - optimal — its solution is within a fixed fraction ( 1 − 1 / e ≈ 0 . 63 ) from the global optimal one . given the hardness of problem 2 , such near - optimality is acceptable in terms of optimization quality . lemma 1 . near - optimality let s be the subset found by alg . 1 : | s |= k ; and s *= argmax | s |= k f ( s ). we have that f ( s )≧( 1 − 1 / e ) f ( s *), where e is the base of the natural logarithm . proof . let t be the subset found at the end of the t th ( t = 1 , . . . , k − 1 ) iteration of alg . 1 . at step 7 of the ( t + 1 ) th iteration , for any node i ∉ t , we have that for any node i ∉ t , plugging eq . ( 3 ) into f ( t ∪{ i })− f ( t ) and canceling the common terms , we have that therefore , we have that s ( i )= f ( t ∪{ i })− f ( t ). in other words , at step 8 of each iteration of alg . 1 , we always select a node with the highest marginal increase of the goodness measure . by theorem 1 , the goodness measure f ( s ) is a non - decreasing submodular function with f ( φ )= 0 . according to a . krause and c . guestrin , beyond convexity — submodularity in machine learning , ( in icml , 2008 ), we have that f ( s )≧( 1 − 1 / e ) f ( s *), which completes the proof . the time complexity of the proposed dragon is given in lemma 2 . according to lemma 2 , our dragon has linear time complexity with respect to the size of the graph . therefore it is scalable to large graphs in terms of computational time . lemma 2 . time complexity . the time complexity of alg . 1 is o ( m + nk ). we would like to point out that the alg . 1 can be further sped up . firstly , notice that the o ( m ) term in lemma 2 comes from computing the ranking vector r ( step 1 ) by the most commonly used power method . there are a lot of fast methods for computing r , either by effective approximation or by parallelism . these methods can be naturally plugged in alg . 1 , which might lead to further computational savings . secondly , the o ( nk ) term in lemma 2 comes from the greedy selection step in steps 6 - 12 . thanks to the monotonicity of f ( s ) as we show in theorem 1 , we can use the similar lazy evaluation strategy as j . leskovee , a . krasue , c . guestrin , c . faloutsos , j . m . vanbriesen , and n . s . glace , cost - effective outbreak detection in networks , ( in kdd , pages 420 - 429 , 2007 ), to speed up this process , without sacrificing the optimization quality . the space complexity of alg . 1 is given in lemma 3 . according to lemma 3 , alg . 1 has linear space complexity with respect to the size of the graph . therefore it is also scalable to large graphs in terms of space cost . lemma 3 . space complexity . the space complexity of alg . 1 is o ( m + n + k ). in the discussion below , we provide empirical evaluations for algorithm 1 . these evaluations mainly focus on ( 1 ) the effectiveness and ( 2 ) the efficiency of algorithm 1 . we use the dblp publication data to construct a co - authorship network , where each node is an author and the edge weight is the number of the co - authored papers between the two corresponding persons . overall , we have n − 418 , 236 nodes and m = 2 , 753 , 798 edges . we also construct much smaller co - authorship networks , using the authors from only one conference ( e . g ., kdd , sigir , sigmod , etc .). for example , kd is the co - authorship network for the authors in the ‘ kdd ’ conference . these smaller co - authorship networks typically have a few thousand nodes and up to a few tens of thousands edges . we also construct the co - authorship networks , using the authors from multiple conferences ( e . g ., kdd - sigir ). for these graphs , we denote them as sub ( n , m ), where n and m are the numbers of nodes and edges in the graph , respectively . there is a damping factor c to compute the personalized pagerank , which is set to be c = 0 . 99 . in the discussion herein , we use the power method to compute the pagerank . we adopt the same stopping criteria as [ h . tong , c . faloutsos , and j .- y . pan , fast random walk with restart and its applications . in icdm , pages 613 - 622 , 2006 . ]: either the l 1 difference of the ranking vectors between two consecutive iterations is less than a pre - defined threshold ( 10 − 9 ), or the maximum number of iteration steps ( 80 ) is reached . there are no additional parameters in alg . 1 . for the remaining parameters of those comparative methods , they are set as in their original papers , respectively . for the computational cost and scalability , we report the wall - clock time . all the experiments ran on the same machine with four 2 . 5 ghz amd cpus and 48 gb memory , running linux ( 2 . 6 kernel ). for all the quantitative results , we randomly generate a query vector p and feed it into different methods for a top - k ranking list with the same length . we repeat it 100 times and report the average . there does not appear to be any universally accepted measure for diversity . in [ q . mei , j . guo , and d . r . radev , divrank : the interplay of prestige and diversity in information networks . in kdd , pages 1009 - 1018 , 2010 . ], the authors suggested an intuitive notion based on the density of the induced subgraph from the original graph a by the subset s . the intuition is as follows : the lower the density ( i . e ., the less 1 - step neighbors ) of the induced subgraph , the more diverse the subset s . here , we generalize this notion to the t - step graph in order to also take into account the effect of those in - direct neighbors . let sign (.) be a binary function operated element - wise on a matrix , i . e ., y = sign ( x ), where y is a matrix of the same size as x , y ( i , j )= 1 if x ( i , j )& gt ; 0 , y ( i , j )= 0 otherwise . we define the t - step connectivity matrix c t as c t = sign ( σ i = 1 t a i ). that is , c t ( i , j )= 1 ( 0 ) means that node i can ( cannot ) reach node j on the graph a within t - steps / hops . with this c t matrix , we define the diversity of a given subset s s eq . ( 12 ). here , the value of div ( t ) is always between 0 . 5 and 1 — higher means more diverse . if all the nodes in s are reachable from each other within t - steps , we say that the subset s is the least diverse ( div ( t )= 0 . 5 ). on the other extreme , if all the nodes in s cannot reach each other within t - steps , the subset s is the most diverse ( div ( t )− 1 ). for the task of top - k ranking , the notion of diversity alone , though important , might not be enough for the information need . for example , if we simply randomly select k nodes as the top - k ranking list , these k nodes might not be connected with each other at all given that the length of the ranking list k is usually much smaller than the number of nodes n in the graph . therefore , it has a high diversity . however , it is unlikely that such a ranking list can well fit the user &# 39 ; s information need since each of them might have very low relevance score . in other words , a diversified top - k ranking list should also have high relevance . that said , we will mainly focus on evaluating how different methods balance between the diversity and the relevance . notice that the relevance score for each individual node is often very small on large graphs ( since the l 1 norm of the ranking vector is 1 ). to make the two quantities ( diversity vs . relevance ) comparable with each other , we need to normalize the relevance scores . let ŝ be the top - k ranking list by the original personalized pagerank , we define the normalized relevance score for a given subset s (| s |= k ) s eq . ( 13 ). since the personalized pagerank always gives the k most relevant nodes , the rel defined in eq . ( 13 ) is always between 0 and 1 — higher means more relevant . let us start with an illustrative example to gain some visual intuitions . in fig2 , we show a fictitious co - authorship network 20 , where each node corresponds to an author ( e . g ., john , smith , etc . ), and the edge weight is the number of the co - authored papers . there are three communities in this network ( e . g ., dm , db and ir ). from fig2 , we can see that node 1 has very strong connections to the dm community . in other words , sm might be his / her major research interest . in addition , s / he also has some connections to the ir and db communities . given the budget k = 3 , personalized pagerank returns all the three nodes ( nodes 2 , 3 and 5 ) form dm community which is consistent with the intuition since personalized pagerank solely focuses on the relevance . in contrast , alg . 1 returns nodes 2 , 6 and 10 , each of which is still relevant enough to the query node 1 . at the same time , they are diversified from each other , covering the whole spectrum of his / her research interest ( dm db , and ir ). we also conduct case studies on real graphs . we construct a co - authorship networks from sigir ( the major conference on information retrieval ) and icml ( the major conference on machine learning ). we issue a query to find the top - 10 co - authors for prof . yy . the results are shown in table iii . we compare it with the original personalized pagerank . yy is a professor , and she has broad interest in information retrieval and machine learning . from fig2 , we have the following observations . firstly , both alg . 1 and personalized pagerank share the same authors for the top - 3 returned authors , indicating that alg . 1 also captures those highly relevant authors with respect to the querying author . secondly , alg . 1 returns a more diverse list of authors . for example , although ex 7 is not a co - author of yy , they share a lot of research interest in information retrieval , and have a lot of indirect connections through other ir people . in contrast , the existence of some authors in the ranking list by personalized pagerank is somehow redundant , in terms of helping the user to understand prof . yy &# 39 ; s whole collaboration network . for example , consider prof . agh . although , he has a lot of co - authored papers with yy , they are also co - authored with rv . therefore , given that jz and rj are already in the ranking list , his existence does not provide much marginal information about yy &# 39 ; s collaboration network . as a quantitative indicator , the average degree of induced subgraph by alg . 1 is only 2 . 8 , which is much lower ( i . e ., more diverse ) than that by personalized pagerank . finally , notice that for some authors , although they show up in both lists , their positions in the ranking list are different . for example , jyn shows at the 4 th and the 8 th positions in the two ranking lists , respectively . this is because jyn makes the top - 4 authors more diverse compared with thp , although its individual relevance score is lower than the latter . we compare alg . 1 with arw and rrw , both of which also aim to improve the diversity of personalized pagerank . we skip the comparison with mmr for brevity since it has been shown that its performance is not as good as rrw for the graph - type data . for rrw , it has two variants based on different approximation methods it actually uses : the one based on the cumulative estimation ( referred to as ‘ rrw - a ’) and the other one based on the pointwise estimation ( referred to as ‘ rrw - b ’). first , let us compare how different methods balance between the relevance and the diversity . fig3 shows the results on the nips co - authorship network . we test with different budgets ( k = 10 , 20 , 30 , 40 , 50 , 100 ). in fig3 ( a ), div ( 1 ) means that we only consider 1 - step neighbors to measure the diversity ( i . e ., setting t = 1 in eq . ( 12 )). in fig3 ( b ), div ( 2 ) means that we consider both 1 - step and 2 - step neighbors ( i . e ., setting t = 2 in eq . ( 12 )). we only present the results by rrw - a since rrw - b gives similar results . from fig3 , we can see that all the three methods are effective to improve the diversity . the alg . 1 achieves a better balance between the relevance and the diversity . for arw , although it gives the highest diversity score , its ( normalized ) relevance score is too low — only about half of the other two methods . this is because in arw , only the first node is selected according to the relevance ; and all the remaining ( k − 1 ) are selected by diversity . as for rrw - a , both its relevance and diversity scores are lower than alg . 1 . it is interesting to notice from fig3 ( b ) that the diversity of rrw - a drops a lot when it is measured by within 2 - step neighbors ( i . e ., div ( 2 )). this is consistent with the intuition of rrw . in rrw ( both rrw - a and rrw - b ), it achieves the diversity by encouraging 1 - step neighboring nodes to compete with each other . consequently , the density of its within 1 - step induced subgraph might be low ( i . e ., high diversity ), but it is not necessarily the case for the within t - step ( t ≧ 2 ) induced subgraph . in order to test how the overall performance of different methods varies across different data sets , we take the average between relevance and diversity scores . the results are presented in fig4 ( a )- 4 ( d ), using four different co - authorship networks ( sigmod , nips , sigir , siggraph ). for the space limitation , we omit the results when the diversity is measured by within 1 - steps neighbors , which is similar as the results by within 2 - steps neighbors . it can be seen that alg . 1 consistently performs the best . in the discussion below , we evaluate the effectiveness and the efficiency of algorithm 1 in terms of maximizing the goodness measure f ( s ). we compare it with the exponential enumeration and the binary quadratic programming methods discussed above . we also compare it with two other heuristics . the first method ( referred to as ‘ heuristic1 ’) starts with generating a candidate pool ( e . g ., the top 10 × k most relevant nodes ), picks one seed node , and then repeatedly adds the most dis - similar ( measured by a ) node into the ranking list from the candidate pool . the second method ( referred to as ‘ heuristic2 ’) also starts with generating a candidate pool , puts all the nodes from candidate pool in the list , and then repeatedly drops a most similar ( measured by a ) node from the list . first , let us evaluate how the different methods balance between the optimization quality ( measured by f ( s ) and the speed ( measured by wall - clock time ). fig5 shows the results from the co - authorship network of nips and kdd conferences with the budget k = 20 , where f ( s ) is normalized by the highest one among different methods . it can be seen that alg . 1 is the best — it leads to the highest optimization quality ( i . e ., highest f ( s )) with the least amount of wall - clock time . notice that the y - axis is in logarithm scale . we also conducted experiments on the co - authorship network constructed from multiple conferences . fig6 ( a ) and 6 ( b ) show the results on these data sets with the budget k = 20 . here sub ( n , m ) means a co - authorship network with n nodes and m edges . we stop the program if it takes more than 100 , 000 seconds ( i . e ., more than 1 - days ). in fig6 ( a ), the results from using algorithm 1 , heuristic 1 , heuristic 2 , lin - qp and lte - bip are shown at 60 a , 60 b , 60 c , 60 d and 60 e respectively . in fig6 ( b ), the results from using algorithm 1 , heuristic 1 , heuristic 2 , lin - qp and lte - bip are shown at 62 a , 62 b , 62 c , 62 d and 62 e respectively . it can be seen from fig6 ( a ) and 6 ( b ) that alg . 1 is consistently best across all the different data sets — it leads to the highest optimization quality ( i . e ., highest f ( s ) for ‘ lin - qp ’ is missing for sub ( 24k , 114k ) because it fails to finish within 100 , 000 seconds . this indicates that it is not feasible for large graphs . for the smaller graphs , ‘ lin - qp ’ leads to slightly lower f ( s ) than alg . 1 ; but it requires 3 - 5 orders of magnitude wall - clock time . for all the other comparative methods , they lead to worse optimization quality with longer wall - clock time . we also evaluate the scalability of alg . 1 . when we evaluate the scalability with respect to the number of the nodes in the graph , we fix the number of edges and vice versa . the results in fig7 ( a ) and 7 ( b ) are consistent with the complexity analysis discussed above — alg . 1 scales linearly with respect to both n and m , which means that it is suitable for large graphs . a computer - based system 100 in which embodiments of the invention may be carried out is depicted in fig8 . the computer - based system 100 includes a processing unit 110 , which houses a processor , memory and other systems components ( not shown expressly in the drawing ) that implement a general purpose processing system , or computer that may execute a computer program product . the computer program product may comprise media , for example a compact storage medium such as a compact disc , which may be read by the processing unit 110 through a disc drive 120 , or by any means known to the skilled artisan for providing the computer program product to the general purpose processing system for execution thereby . the computer program product may comprise all the respective features enabling the implementation of the inventive method described herein , and which — when loaded in a computer system — is able to carry out the method . computer program , software program , program , or software , in the present context means any expression , in any language , code or notation , of a set of instructions intended to cause a system having an information processing capability to perform a particular function either directly or after either or both of the following : ( a ) conversion to another language , code or notation ; and / or ( b ) reproduction in a different material form . the computer program product may be stored on hard disk drives within processing unit 110 , as mentioned , or may be located on a remote system such as a server 130 , coupled to processing unit 110 , via a network interface such as an ethernet interface . monitor 140 , mouse 150 and keyboard 160 are coupled to the processing unit 110 , to provide user interaction . scanner 180 and printer 170 are provided for document input and output . printer 170 is shown coupled to the processing unit 110 via a network connection , but may be coupled directly to the processing unit . scanner 180 is shown coupled to the processing unit 110 directly , but it should be understood that peripherals might be network coupled , or direct coupled without affecting the performance of the processing unit 110 . while it is apparent that the invention herein disclosed is well calculated to fulfill the objectives discussed above , it will be appreciated that numerous modifications and embodiments may be devised by those skilled in the art , and it is intended that the appended claims cover all such modifications and embodiments as fall within the true spirit and scope of the present invention . | 6 |
the invention , shown in various embodiments of fig1 - 9 is a disposable non - invasive patch for detection of intermittent cardiac abnormalities . the patch 10 is thin , flat , and flexible for placement on the chest area 2 of a person 1 whose heart is being examined for possible abnormality . the sensor patch relies on a surface electrocardiogram ( ecg ) for detecting and analyzing non - invasively the electrical activity of the heart . the smart patch is fully self - contained and self - powered . the patch analyzes the ecg for an extended period of time depending on the application . patterns of ecg abnormalities are recorded automatically and a report is generated by the patch and transmitted to a reporting device directly . the sensor patch is low cost for disposable applications and self - administration . referring to the embodiment of fig2 and 3 , the sensor patch 10 comprises three ecg electrodes 21 , 22 , and 23 , an ecg amplifier 31 , a processor 33 , and a battery 35 . the processor 33 is typically a microprocessor or a digital signal processor for performing numerical computation on data obtained from an analog - to - digital converter 32 . the sensor patch 10 also incorporates a memory 34 , referring generally here to all types of solid - state memory for storage of program data and acquired ecg data . a record switch 50 allows the user to record a cardiac event whenever felt . the electronic assembly of the patch is formed of a flexible circuit substrate 20 with trace extensions to the electrodes 21 , 22 , 23 , and to the battery 35 . conductive gel 25 , 26 covers the electrodes 21 , 22 , respectively , as well as the other electrode not shown in the view of fig3 . the conductive gel 25 and 26 contacts the person &# 39 ; s skin directly to conduct surface ecg potentials to the electrodes and subsequently to the ecg amplifier 31 . the electrodes may be pre - gelled as shown or alternately made for dry contact ( not shown ) with electrodes directly contacting the skin . a non - conductive pad 27 electrically separates the electrodes and may comprise an adhesive gel , i . e . hydrogel , for enhancing adhesion of the patch 10 to the skin . the non - conductive pad 27 may also be made of soft low - durometer rubber or elastomeric material . the patch 10 also comprises a thin substrate 28 for providing structural support . the substrate 28 is made of soft flexible sheath material , such as polyurethane , cotton , cloth or made from the same material as the pad 27 . the thickness of the patch device 10 ( not shown to scale for clarity ) is preferably in the range of 1 . 5 and 2 . 5 mm , but preferably no more than 3 mm . non - conductive waterproof adhesive 39 present at the perimeter of the interior side of the patch prevents water entry and provides long term adhesion to the skin . the waterproof skin adhesive 39 prevents contamination of electrodes thus maintaining long - term integrity of the skin - electrode electrical conductivity . this is critical for providing long term function of the monitor patch while allowing the user to be exposed to water such as during bathing and swimming . the substrate 28 , adhesive 39 and other materials used in the design of the patch are preferably air permeable with respect to the skin in order to prevent moisture accumulation and contamination due to perspiration . anti - microbial and anti - bacterial agents are preferably incorporated in the design of the patch , particularly at the skin contact areas , to prevent contamination of the patch and infection of the skin during the extended wear of the device . in the preferred embodiments , the patch is self - adhered . a porous and / or air permeable waterproof cover 29 protects the outer surface of the patch from external water exposure while allowing drying of the skin . in the embodiments of fig2 - 3 , the extended wear heart monitor patch 10 comprises three ecg electrodes for placement on the heart area 3 as shown in fig1 . the electrodes are arranged to provide a modified three - lead configuration with the electrodes 21 , 22 , 23 representing right arm ( ra ), left arm ( la ) and left leg ( ll ) leads as in standard ecg instrumentation . this configuration results in standard , direct lead measurements lead - i , lead - ii , lead - iii . other electrode placements and lead configurations are possible . for example , fig4 - shows a band - shaped patch 11 with a two - electrode embodiment , e 1 and e 2 , for sensing the surface ecg . a multi - color led 40 is used to indicate heart activity and event detection . the invented patch is particularly suited to detect infrequent and rare events such as atrial fibrillation and syncope . these events often elude conventional ecg instruments . since the invented patch is waterproof and can be worn continuously , even during showering and swimming , cardiac events are readily detected and documented . the detection occurs automatically and optionally manually . automatic detection and recording occurs by continuously monitoring and analyzing ecg data by the processor 33 . manually recording is provided by an optional switch 50 , which is activated when the patient becomes aware of a cardiac episode . the activation of the switch 50 triggers a recording session of a predetermined length , for example 3 minutes prior activation plus 2 minutes post activation . this method ensures detection and recording of even the most transient episodes such as syncope , which is accompanied by a temporary loss of consciousness . real - time ecg analysis in the invention performed by the processor 33 allows for automatic detection of cardiac abnormalities . these events can be detected by comparing the characteristics of sensed ecg with predetermined limits and patterns . for example , shifts in certain segments of the ecg , such as the st - segment , qt interval and qrs width , can be used to determine and record a cardiac event . by focusing on recording mostly cardiac events , memory size is reduced for producing smaller and more wearable device than those of conventional monitors . the detection of a heart abnormality is indicated by a optional indicator . in the embodiment shown in fig1 - 3 , a light emitting diode ( led ) indicator 36 is provided . the indictor many be multi - colored to indicate different levels of indication . for example , a blinking green led light can indicate a normal heart function and while a red led light indicates a cardiac event condition . the led can also be used to indicate proper path operation during the collection of ecg data . for example , the led can be flashing in synchrony with qrs pulses upon proper placement of the smart patch and upon detection of ecg signals . other possible indicators include audible transducers , such as a buzzer ( not shown ) or a speaker ( not shown ; and other visual indicator types , such as a liquid crystal display ( lcd ) 38 as shown in fig5 . the advantage of an lcd indicator is to communicate more clearly the operation of the patch and condition detected . a key feature of the invention in the preferred embodiment is integrating in a single low cost patch the combination of ecg analysis and detection of cardiac events . fig5 shows a 4 - electrode embodiment of the patch including a right leg ( rl ) electrode . fig6 & amp ; 7 show a nine - electrode patch 12 arranged in a “ c ” configuration . the electrodes are arranged to obtain modified twelve - lead measurements , excluding the v 6 lead . this and other multi - lead configurations provide multi - axis or vectorcardiograph capability for improved diagnostics . the electrodes 21 , 22 , 23 , 24 offer bipolar frontal plane ecg ( lead - i , ii , and iii ) while electrodes 45 , 46 , 47 , 48 , and 49 offer unipolar precordial ecg , generally representing the horizontal plane , for leads v 1 , v 2 , v 3 , v 4 , and v 5 , respectively . the “ c ” patch encompasses the left breast 6 having an upper segment 42 , lower segment 43 , and sternum segment 44 . the “ c ” patch 12 is particularly suitable for fitting on a female 5 as shown in fig7 . these and other electrode configurations are possible , as will become obvious to those skilled in the art of ecg measurements . because the electrodes are integrated within the patch of the invention , motion artifact is significantly reduced when compared to standard ecg with separate electrodes and cabling . furthermore , the integrated patch allows for inconspicuous , convenient long - term ambulatory applications . multi - lead patch configurations are particularly suited for diagnostic monitoring extended beyond 24 to 48 hours offered by conventional holter monitors . this is possible by the present invention for at least three reasons . first , the invented patch is flexible and more comfortable to wear . second , there is no need for large memory used for continuous recording in holter monitors , since only relevant ecg data is recorded . third , the patch is waterproof thus can be worn continuously without removal . signal processing by processor 33 is particularly suited for performing signal averaging to enhance certain details of the sensed ecg . signal - averaged ecg involves the averaging of a large number of ecg periods , particularly for qrs , st or qt segments , to enhance the detection of small fluctuations . a unique feature of the present invention is the wireless transmission of preformatted report to a reporting device such as a printer or a wireless network . this allows for generation of a cardiac test report 53 without resorting to any specialized instruments . fig8 shows the invented patch 10 having an infrared led 37 for sending infrared signal 52 to a printer 51 for printing a cardiac report 53 . many standard printers are currently equipped with wireless sensors and respond to standard wireless protocols , such as irda ( infrared data association ). an optocoupler tranceiver , incorporating an infrared led and an optocoupler sensor , allows for bi - directional wireless communication of the patch with a reporting device . similarly , using radio frequency ( rf ) transmitter ( not shown ), a report can be sent to a wireless printer or wireless network using standard rf protocols such as bluetooth ® and ieee802 ®. with this method , a user or clinician can place the patch in proximity to a wireless reporting device for obtaining a cardiac report 53 . this report is generated internally by the processor 33 and sent wirelessly , either automatically when in proximity to a reporting device , or manually by activating a switch . for example by incorporating a reed - switch in the patch ( not shown ), which can be activated by a magnet placed in proximity to the patch when printing or reporting is desired . the cardiac report in this preferred embodiment is automatically generated and formatted by the processor 33 of the invented patch . prior art reporting involves transmission of either raw ecg data or summary data for graphical formatting by a computer or microprocessor based device prior to sending to a printer or a display device . the invented patch performs the analysis and formatting of results internally and sends directly to a generic printer or a generic internet browser such as microsoft ® internet explorer . in the later case , a capture screen is sent to the browser application by the invented patch . once the capture screen is loaded , a report can then be printed or relayed to a medical monitoring station via the internet . the ability to generate a cardiac report wirelessly and directly to a generic reporting device , as provided by the present invention in a preferred embodiment , simplifies the delivery of heart health care services . for example , an individual suspecting a cardiac abnormality , can purchase a disposable ecg patch and generate a report using standard printer available in most homes . a report can also be generated and broadcast to a wireless network . to ensue privacy , an access code can be provided with each patch for entering into the capture screen prior to viewing , printing , or forwarding to remote monitoring station . similarly , non - cardiac medical practice , such as primary physician , family physician , nursing center , etc . can not perform a basic cardiac test and obtain a report without resorting to any specialized instruments or training . ecg data can also be sent to a remote location via standard trans - telephonic methods ( not shown ) whereby a telephone line adapter device can be used to send translate ecg reports from the patch to the telephone line . the adapter unit can communicate wirelessly to the patch via infrared or rs signals and subsequently dial the reporting center and transmit the cardiac report thereto . an ecg report may also be retrieved by an interrogation device as shown in fig9 ( not to scale ). in this example , optical signal 19 representing ecg data from an infrared led 37 incorporated within the disposable patch 10 is sent to an optical receiver 18 incorporated in the interrogation wand 16 of the external interrogation device 15 . the activation of the data transmission is preferably automatic . for example , a magnetic field 14 from a magnet 17 within the interface 16 triggers an activation sensor 41 , i . e . a reed - switch , to initiate the ecg data transmission . activation can also be by manual means , such as by pressing an electromechanical switch ( not shown ) incorporated onto the flexible substrate 20 . the wireless transmission of cardiac data may be accomplished in numerous ways and methods known in the field of medical devices and wireless data transmission . this includes optical means as shown above , radio frequency ( rf ), magnetic , ultrasonic , and acoustic transmission . inductive coupling through a coil ( not shown ) can also be used to transmit data , as well as for powering the patch externally during the transmission . although the invention is described herein with reference to the preferred embodiment , one skilled in the art will readily appreciate that other applications may be substituted for those set forth herein without departing from the spirit and scope of the present invention . accordingly , the invention should only be limited by the claims included below . | 0 |
it has been found that commercially available spray dryer nozzles , geometries , and circulation patterns can be used in methods of producing powders with high volatile retention and high flavor intensity , even when drying for an extended amount of time . in particular , when a conventional spray dryer is used with an inlet temperature of less than 100 ° c . and a dew point − 10 ° c . to 5 ° c ., higher levels of volatile compounds can be retained . because of the increased efficiency of the method described herein , drying of flavor compositions containing volatile compounds can be achieved at relatively low temperatures compared to conventionally used methods . the resulting spray - dried flavor composition has high intensity flavor and has a high flavor / fragrance quality that is authentic to the natural source . surprisingly , these flavor compositions maintain high flavor intensity and flavor / fragrance quality in various end - use applications after long - term storage . the invention also provides a stable spray - dried flavor composition produced by spray drying a flavor that that contains volatile compounds in a spray dryer having an inlet temperature of less than 100 ° c . and an air inlet dew point − 10 ° c . to 5 ° c ., wherein the volatile compounds are present in the spray - dried flavor composition in an amount that is at least 20 % of the volatile compounds originally contained in the flavor . for the purpose of this invention stability is defined as a flavor quality and intensity that remains acceptable for use in end use applications . preferably , a stable spray - dried flavor composition has a shelf - life of up to three years depending on storage conditions . consumer data , as demonstrated in the examples herein , showed statistically significant preference for the flavors composition of the present invention . the consumer preferred quality of the flavor composition is further supported by the attributes selected by consumers to describe the flavor quality of the prototypes . therefore , the present invention is a spray - dried flavor composition and a method for producing such a composition . in accordance with the present invention , a spray - dried flavor composition containing one or more volatile compounds is produced by spray drying a flavor in a spray dryer with an inlet temperature of less than 100 ° c . and a dew point − 10 ° c . to 5 ° c . so that a dry powder is obtained . in certain embodiments , the resulting spray - dried composition is further dried in a fluidized bed . as a result of the instant method , the spray - dried flavor composition retains at least 20 % of the volatile compounds originally contained in the flavor . unless otherwise specified , a flavor of the invention is a flavor that contains one or more volatile compounds . a variety of flavors can be used in accordance with the present invention . flavor may be chosen from synthetic flavor and flavoring aromatics , and / or oils , oleo resins and oil extracts derived from plants , leaves , flowers , fruits , and combinations thereof . representative flavor oils include , but are not limited to , spearmint oil , cinnamon oil , peppermint oil , clove oil , bay oil , thyme oil , cedar leaf oil , oil of nutmeg , oil of sage , and oil of bitter almonds . also useful are artificial , natural or synthetic fruit flavors such as vanilla , chocolate , coffee , cocoa and citrus oil , including lemon , orange , grape , lime and grapefruit , and fruit essences including apple , pear , peach , strawberry , raspberry , cherry , plum , pineapple , apricot and so forth . these flavors can be used individually or in admixture . the volatile compounds of the instant flavor may include , but are not limited to , acetaldehyde , dimethyl sulfide , ethyl acetate , ethyl propionate , methyl butyrate , and ethyl butyrate . flavors containing volatile aldehydes or esters include , e . g ., cinnamyl acetate , cinnamaldehyde , citral , diethylacetal , dihydrocarvyl acetate , eugenyl formate , and p - methylanisole . further examples of volatile compounds that may be present in the instant flavor oils include acetaldehyde ( apple ); benzaldehyde ( cherry , almond ); cinnamic aldehyde ( cinnamon ); citral , i . e ., alpha citral ( lemon , lime ); neral , i . e ., beta citral ( lemon , lime ); decanal ( orange , lemon ); ethyl vanillin ( vanilla , cream ); heliotropine , i . e ., piperonal ( vanilla , cream ); vanillin ( vanilla , cream ); alpha - amyl cinnamaldehyde ( spicy fruity flavors ); butyraldehyde ( butter , cheese ); valeraldehyde ( butter , cheese ); citronellal ( modifies , many types ); decanal ( citrus fruits ); aldehyde c - 8 ( citrus fruits ); aldehyde c - 9 ( citrus fruits ); aldehyde c - 12 ( citrus fruits ); 2 - ethyl butyraldehyde ( berry fruits ); hexenal , i . e ., trans - 2 ( berry fruits ); tolyl aldehyde ( cherry , almond ); veratraldehyde ( vanilla ); 2 , 6 - dimethyl - 5 - heptenal , i . e ., melonal ( melon ); 2 - 6 - dimethyloctanal ( green fruit ); and 2 - dodecenal ( citrus , mandarin ); cherry ; or grape and mixtures thereof . the composition may also contain taste modulators and artificial sweeteners . the physical , chemical , and odor properties of selected volatile compounds are presented in table 1 . the instant invention is particularly useful in processing flavors with volatile compounds having a boiling point of less than 200 ° c ., less than 150 ° c ., less than 120 ° c ., less than 100 ° c ., less than 80 ° c ., less than 60 ° c ., less than 40 ° c ., less than 20 ° c ., or less than 0 ° c . using such flavors , higher levels of volatile compounds are retained , which results in a sensory perceivable difference over conventional drying processes . in certain embodiments , the invention further includes the use of a carrier material to enhance processing productivity and flavor intensity . such carriers can include any sugar , sugar derivatives , modified starch , proteins , celluloses , salts , dextrins , gums , sugar alcohols , polyols , peptides , acids , carbohydrates or hydrocolloids . particular examples of suitable materials include sugars such as sucrose , glucose , lactose , levulose , trehalose , fructose , maltose , ribose , dextrose , isomalt , sorbitol , mannitol , xylitol , lactitol , maltitol , pentatol , arabinose , pentose , xylose , galactose ; hydrogenated starch hydrolysates ; maltodextrins or dextrins ( soluble fiber ); hydrocolloids such as agar or carrageenan ; gums ; polydextrose ; proteins such as soy and whey protein isolates and hydrolyzates , and sodium caseinates ; and derivatives and mixtures thereof . the carrier can be selected based upon , amongst other factors , the desired flavor , authentic taste and intensity to be achieved . in some embodiments , the flavor and optional carrier material are dissolved or emulsified in a solvent and subsequently spray - dried . in some embodiments , the solvent is water . in other embodiments , the solvent is not water . in yet further embodiments , the solvent is a volatile solvent . in still other embodiments , the solvent is a mixture of water and a volatile solvent . as is known in the art , a volatile solvent is a nonaqueous liquid with solvent properties with the characteristic of evaporating readily at room temperature and atmospheric pressure . volatile solvents of particular use in accordance with the present invention include , but are not limited to , ethanol , ethyl acetate , acetone . flavor emulsions can be prepared according to standard preparation procedures . briefly , the practice involves dispersing and dissolving the dry carrier materials in solvent until free of lumps . when using water as the solvent , it may be desirable to warm the water ( e . g ., to approximately 50 ° c .) prior to adding the carrier material . the flavor is then added under constant agitation until a homogeneous mixture is obtained . the emulsion may be further subjected to high shear or homogenized to reduce oil droplet size prior to spray drying . in certain embodiments , the emulsion contains between 40 % and 70 % dry solid material ( including the flavor ), or more preferably between 55 % and 65 % dry solid material ( including the flavor ). the amount of dry solid material can be adjusted by using more or less water depending on the solubility of the carrier material and various factors related to efficient operation of the spray dryer . for example , the type and amount of carrier , amount of water , and / or amount of flavor can be adjusted so that the resulting emulsion has a viscosity suitable for feeding into a spray dryer to provide liquid droplets having a mean particle size ( mean volume diameter ) of between 10 μm and 200 μm . for example , when using spray nozzles , such as a three - fluid nozzle and a four - fluid nozzle , the viscosity of the feed slurry is preferably 500 cps or less , preferably 200 cps or less , and more preferably 80 cps or less . for a rotary atomizer ( rotary disk ), the viscosity is preferably 70 , 000 cps or less . moreover , the feed slurry ( i . e ., emulsion ) can be heated ( e . g ., to near the inlet temperature ) or cooled ( e . g ., to 15 ° c .) immediately before adding it to the spray dryer to modify fluidity . in addition , certain flavors , especially those that are more water - soluble , act as plasticizers thereby making processing more difficult due to stickiness . in this respect , the ratios of carrier materials can be modified . therefore , various factors can be appropriately selected or modified for use in combination with different spray dry apparatuses . in addition to the flavor and carrier material , an emulsifier or surfactant can also be used in the production of the instant spray - dried flavor composition . examples of suitable emulsifiers or surfactants include , but are not limited to , lecithins , sucrose esters , proteins , gums , soap - bark extract , saponins , and the like . moreover , a variety of solvents can be used in the instant spray - dried flavor composition . such solvents include , volatiles and nonvolatiles but are not limited to alcohol ( e . g ., ethanol ), ethyl acetate , acetone , triglycerides , vegetable oils , animal fats , and triacetin . commercially available spray dryers can be used as in the practice of the present invention . for example , a spray dryer with a vertical parallel flow function can be used . the spray dryer should be a system with a dehumidifying and drying function . for example , a spray dryer capable of blowing a high volume of desiccated air with a dew point of less than 5 ° c . is particularly preferable . for a spray dryer with no dehumidifying and drying function , the spray dryer is inevitably arranged with a dry dehumidifier , e . g ., a honeycomb - type rotary dehumidifier ( e . g ., nichias corporation or sweden proflute corporation ). suitable spray dryers include the micromist spray dryer and the hybrid granulator series manufactured by fujisaki electric co ., ltd . ; the fluidized spray dryer fsd with internal fluid bed as manufactured by niro corporation ; the fluid granulation spray dryer and l - 8 type spray dryer manufactured by ogawara ( japan ); the dl - 21 type and gb - 21 type spray dryers manufactured by yamato scientific co ., ltd ., and anhydro spray bed dryer manufactured by spx corporation . in particular embodiments , the spray dryer is capable of generating liquid droplets ( particles ) having a mean particle size ( mean volume diameter ) of between about 10 μm to about 200 μm . specifically , it is preferred to carry out spray drying with a spray dryer with a spray nozzle capable of generating a large volume of liquid droplets having a mean particle size of between about 10 μm to about 200 μm , preferably about 20 μm to about 150 μm , and more preferably about 30 μm to about 100 μm . when the liquid droplets are dried , a dry powder having a mean particle size ( mean volume diameter ) of about 10 μm to about 100 μm is preferred for retention of the flavor oil . among the operation conditions of the spray drying apparatus , in certain embodiments the outlet temperature of the spray drying apparatus is between 20 ° c . and 60 ° c ., preferably 30 to 60 ° c ., and more preferably 40 to 60 ° c . for the purposes of this invention , the outlet temperature of the spray dryer means the product temperature of the dry powder in the vicinity of the powder collection part of the spray dryer . for the spray dryer of the vertical parallel flow type , the outlet temperature means the temperature ( exhaust gas temperature ) at the exhaust part thereof . in other embodiments of this invention , the average inlet air temperature of the spray drying apparatus is less than 100 ° c . in certain embodiments , the average inlet air temperature of the spray drying apparatus is in the range of 40 ° c . to 99 ° c ., more preferably 60 ° c . to 99 ° c . and most preferably 80 ° c . to 99 ° c . for the purposes herein , the average inlet air temperature is a sum total of all inlet air streams , e . g ., main chamber inlet air and the inlet air to the fluid bed ( s ). as a particular feature of the instant invention , it is desirable that production parameters including temperature , pressure and humidity , are controlled to achieve an air inlet dew point in the range of − 10 ° c . to 5 ° c . in particular embodiments , the air inlet dew point of the spray drying apparatus is 5 ° c . or less , preferably 0 ° c . or less , more preferably is − 5 ° c . or less , and most preferably − 7 . 5 ° c . or less . as is known in the art , dew point temperature is a function of air temperature and % rh and can be determined using a psychrometric chart or calculator . dew point temperature is important as it corresponds directly to the actual amount of water in the air on a mass basis . once the spray - dried flavor composition is dried or partially dried in the spray drier , the resulting powder can be used in the production of food product , pharmaceuticals , consumer products and the like . alternatively , particular embodiments feature the additional step of further drying the spray - dried flavor composition in a fluid - bed chamber attached at the outlet of the spray dryer . accordingly , certain embodiments feature the use of an integrated fluid - bed spray dryer to produce the instant spray - dried flavor composition . this secondary drying can , e . g ., further remove entrapped solvent , residual moisture , and / or water of molecular hydration , to provide a composition of powder particles with significantly lower moisture content that is stable in storage , e . g ., for extended periods at ambient temperatures . in accordance with this embodiment , the temperature of the air supplying the fluid - bed unit is maintained at or below the outlet temperature of the spray dryer in order to maintain the benefit of volatile flavor retention . thus , the inlet temperature of the fluid - bed unit is between 40 ° c . and 99 ° c ., preferably 50 to 95 ° c ., and more preferably 60 to 90 ° c . ; and the inlet dew point is in the range of - 10 to 5 ° c . in some embodiments , the fluid - bed has a single zone . in other embodiments , the fluid - bed unit has one , two , three or more zones , wherein each zone has a different temperature and air flow rate . in certain embodiments , the fluid - bed unit has three zones , each varying in temperature by at least 10 ° c . in particular embodiments , the fluid - bed unit has three zones , each varying in temperature by 10 ° c . to 20 ° c . by way of illustration , dry powder from a spray dryer with an outlet temperature of 60 ° c . could have a first fluid - bed zone at 60 ° c ., a second bed zone of 45 ° c . and a third zone of 25 ° c . secondary drying can continue , e . g ., for about 5 minutes to about 5 hours , or about 10 minutes to about 1 hour , and most preferably about 20 to 40 minutes until residual moisture is reduced to a desired level . in particular embodiments , secondary drying continues until the residual moisture of the powder particles is below 5 percent . as used herein , “ dry ,” “ dried ,” and “ substantially dried ” encompass those compositions with from about 0 % to about 15 % water . preferably , the instant composition will have a water activity of 0 . 1 to 0 . 6 , or more desirably 0 . 2 to 0 . 5 , and most preferably from 0 . 2 to 0 . 4 wherein said levels of dryness can be achieved with or without secondary drying . drying can also occur in the total or partial absence of ambient air . in this respect , drying can occur in the presence of co 2 or other drying gases ( e . g ., nitrogen ). accordingly , in particular embodiments , the air of the spray dryer is partially or wholly composed of carbon dioxide or nitrogen . in accordance with this embodiment , partial carbon dioxide or nitrogen is intended to mean a level in the range of 80 - 99 % carbon dioxide and / or nitrogen . once the spray - dried flavor composition reaches the desired level of dryness , it can be used in a variety of consumer , food , or pharmaceutical products . in particular , the instant spray - dried flavor composition finds application in gums , confections , oral care products , beverages , snacks , dairy products , soups , sauces , condiments , detergents , fabric softeners and other fabric care products , antiperspirants , deodorants , talc , kitty litter , hair care and styling products , personal care products , air fresheners , cereals , baked goods and cleaners . in specific embodiments , the instant spray - dried flavor composition is used in flavoring chewing gum and beverages . additionally , the spray - dried powder may be further processed by extrusion , coating , agglomeration , blending , compaction to impart additional functionality or benefits . while the instant invention is described in terms of the spray drying technique , the instant invention can employ other drying technologies or processes wherein the use of low humidity and temperature conditions result in improved product quality through volatile retention . other modifications of this invention will be readily apparent to those skilled in the art . such modifications are understood to be within the scope of this invention . as used herein , all percentages are weight percent unless otherwise noted , l is understood to be liter , kg is understood to be kilogram , and g to be gram . in addition , the amounts , sizes , temperatures and percentages provided herein are understood to include exact numbers and approximations . the following examples are provided as specific embodiments of the present invention . a comparison between modified formulas and conventional control formulas was conducted . exemplary control and modified formulas of dry flavor powders are listed in table 2 . control powders were produced by a conventional process conditions and modified powders were produced by the instant modified process ( fig5 ), according to the conditions listed in table 3 . in both cases , a conventional spray dryer without an integrated fluid - bed was used . using gc - fid ( gas chromatography - flame ionization detector ) analysis , the volatile profile of the orange flavor formulations in example 1 was determined . this analysis indicated that the retention of specific volatile materials for the modified powder compared to the level in the emulsion were approximately 72 %, 75 %, and 52 % for ethyl propionate , ethyl butyrate , and acetaldehyde , respectively . table 4 indicated the ratio of volatiles retained in the modified powder in comparison to the control powder . sensory tests showed benefit of the modified powder over the control powder in a beverage tasting solution ( significantly greater overall aroma and orange flavor ; fig1 ) and in chewing gum ( significantly greater orange flavor intensity at the 30 and 60 second intervals ; fig2 ) . using gc - fid analysis , the volatile profile of the berry flavor formulations in example 1 was determined . this analysis indicated that the retention of specific volatile materials for the modified powder compared to the level in the emulsion were approximately 24 %, 35 %, and 87 % for dimethyl sulfide , ethyl acetate , and ethyl butyrate , respectively . table 5 indicated the ratio of volatiles retained in the modified powder in comparison to the control powder . sensory tests showed benefit of the modified powder over the control powder in a beverage tasting solution ( significantly greater berry aroma and flavor , among others ; fig3 ) and in chewing gum ( significantly greater berry flavor intensity at the 30 and 60 second intervals ; fig4 ). to determine the effect of dryer process temperatures on the physical properties and flavor quality of a citrus flavor , different spray dryer air inlet and outlet temperatures were utilized . the resulting volatile compound content , and flavor strength and aroma as determined by an expert panel are presented in table 6 . in addition to the above results , both spray - dried compositions exhibited free - flowing properties after 7 weeks at 40 ° c . in a closed container . these results indicate that an air inlet temperature below 100 ° c . reduces loss of volatile flavor compounds , provides improved sensory intensity , while maintaining water activity of the product at a level that prevents caking when exposed to above ambient temperatures . the stability of apple and mint flavors in chewing gum were evaluated . flavor compositions were spray - dried in accordance with the instant method , incorporated into chewing gum , and the stability of the flavor was evaluated by an expert panel after storage at 32 ° c . for 2 or 12 weeks or 21 ° c . for 12 weeks . the results of prototype apple - flavored gum , as compared to a control , are presented in table 7 and fig6 . the control samples were spray dried flavors processed using conventional drying conditions . the analysis presented in table 7 indicates that the apple flavor produced by the instant method was as stable as a conventional spray - dried composition at 21 ° c . ( 12 weeks ) or 32 ° c . ( 12 weeks ). however , the impact of the apple flavor produced by the instant method was stronger after storage at 32 ° c . for 12 weeks than that of the conventional spray - dried composition stored at 21 ° c . for 12 weeks . the results of prototype mint - flavored gum , as compared to a control , are presented in table 8 . the analysis presented in table 8 indicates that the mint flavor produced by the instant method was as stable as a conventional spray - dried composition at 21 ° c . ( 12 weeks ) or 32 ° c . ( 12 weeks ). however , the impact of the mint flavor produced by the instant method was stronger after storage at 32 ° c . for 12 weeks than that of the conventional spray - dried composition stored at 21 ° c . for 12 weeks . overall , the results of this analysis indicated that the desirable sensory attributes of apple and mint flavors were better maintained in chewing gum using the prototype flavor over 12 weeks at 32 ° c . the stability of raspberry flavor in powdered soft drink mix was evaluated . a raspberry flavor composition was spray - dried in accordance with the instant method , incorporated into a powdered soft drink mix , and the stability of the flavor was evaluated by an expert panel after storage for 8 weeks at 38 ° c . the results of the prototype soft drink mix containing the instant spray - dried flavor composition , as compared to a control , are presented in table 9 . the control sample was a spray dry flavor processed using conventional drying conditions . spray - dried flavor compositions , prepared in accordance with the instant method , were incorporated into savory broths and attributes of the broths were assessed by a panel of consumers . the attributes of the prototype broths , as compared to a control , are presented in table 10 . the control broths were prepared from spray dry flavors processed using conventional drying conditions . consumer data showed statistically significant preference for the prototype flavors . this is further supported by the attributes selected by consumers to describe the flavor quality of the prototypes . the stability of various flavor prototypes in high barrier packaging ( freshtek ) was assessed after storage for 6 , 12 , or 18 weeks at 40 ° c . the attributes of the prototype powders are presented in table 11 . | 0 |
fig1 illustrates an exemplary computer system 10 . the system 10 includes a workstation 12 having a keyboard 14 and cursor control device 16 , which is shown in the form of a mouse . the workstation 12 is connected to a scanner 18 , a printer 19 , and a multi - function device 20 . the multi - function device 20 may be an aio device as described above . alternatively , the multi - function device 20 may be a device that combines only printing and scanning functionality and no other . in addition , although shown as a peripheral connected to the workstation 12 , the multi - function device 20 could operate as a stand - alone device . for example , using the scanning functionality of the multi - function device 20 , a user could scan an image into the memory ( discussed below ) of the multi - function device 20 and then print multiple copies of that image using the printing components of the device 20 . none of these acts would require interaction with the workstation 12 . as should also be apparent , the system 10 could be configured to include multiple workstations , scanners , multi - function devices , and other devices not shown . routers , switches , or network connections allowing the scanners , multi - function devices , and other components to communicate with the multiple workstations could also be included . in addition , the various connections between elements of the system 10 could include both wired and wireless connections as well as local area network and wide area network connections . fig2 illustrates an interface or operator panel 30 for the multi - function device 20 . the operator panel 30 includes a graphical display 32 , and a keypad 34 having a variety of input buttons . the keypad 34 includes a cursor control portion having a decrement or left arrow button 36 , an options button 37 , an increment or right arrow button 38 , and a select button 39 . the keypad 34 also includes a number of copies button 40 , a reduce / enlarge button 41 , and a copy quality button 42 . in addition , the keypad 34 includes two start copy buttons : a color copy button 43 and a black and white copy button 44 . the keypad 34 also includes a photo control section 49 having a photo options button 50 and a photo copy button 52 . adjacent the photo control section 49 is a scanning control section 54 having a destination selection button and 55 and a start capture button 57 . finally , the keypad 34 includes a fax control section 59 with a start fax button 61 and a device control section 63 having a stop / clear button 65 and a power button 67 with an indicator led 69 . in the example shown in fig2 , the graphical display 32 is a 2 line by 16 characters / line alphanumeric panel . graphical displays of different sizes , particularly larger displays , could be used in place of the display shown . in one embodiment , the multi - function device 20 may be configured such that , at power up , the display 32 generates a default message such as the following : in the discussion that follows , reference will be made to the exemplary display on the graphical display 32 based on the following key : the left arrow character , , will be represented with a left arrow , & lt ;; the right arrow character , , will be represented with a right arrow , & gt ;; a double slash , //, is used to indicate a division of the text on line 1 of the 2 line display from the text on line 2 of the exemplary display ; and left and right brackets , [ and ], surround any variable value in the menu setting . for example , the default message shown above may , using the key above , be written as : if a user pushes or selects the destination selection button 55 in the scanning control section 54 , a message is displayed in the graphical display 32 prompting the user to select a destination for images that are scanned when the start capture button 57 ( which is labeled as “ start scan ” in fig2 ) is pressed . when the destination selection button 55 ( which is labeled as “ e - mail file software ” in fig2 ) is selected , the graphical display 32 displays the following : where the text in the “ programmed capture - to destination ” field encompasses the last selected destination . for example , the graphical display could present the following information : in one embodiment of the invention , the multi - function device 20 may be configured so that a list of programmed capture - to destination applications is loaded in a menu associated with the destination selection button 55 . loading of the menu may occur , for example , automatically at the time the driver software for the multi - function device is installed on the workstation 12 . it is also possible that the list could be manually updated using , for example , interface screens generated by the driver software . some exemplary destination options that could be included are “ e - mail ,” “ file ,” and “ software .” as should be apparent , the “ e - mail ” option allows a user to designate an e - mail program as a destination . the “ file ” option allows a user to designate a file as a destination . and , the “ software ” option allows the user to designate a program , which may be loaded on the workstation , as a destination . in one embodiment , the “ e - mail ” option may be a default option . in addition to the “ e - mail ,” “ file ,” and “ software ” options , additional destination options may be provided . these options may be “ global ” functions . as used herein , “ global ” means that the selected option or function applies to all situations or jobs . in addition , “ global ” functions may be referred to as those functions that may be executed when the device 20 is operated in a stand - alone manner . for example , a “ software ” destination may be associated with an application program that is available only on the workstation 12 . under such circumstances the “ software ” destination is unavailable when the device 20 is operating in a stand - alone mode . although not a requirement , many of the exemplary “ global ” functions are not dependent on the device 20 communicating with the workstation 12 . whether global or not , the additional options may include “ watermark ,” “ header / footer ,” “ border / frame ,” and “ fax / coversheet .” as with the “ e - mail ” and other options discussed above , the additional options are associated with destinations that generally correspond to their names . for example , selection of the “ watermark ” option designates a scanned image as one that will be used as a watermark . once the driver and the destination menu are loaded , any additional destination options such as those that the user manually enters or those that are automatically downloaded by the installed driver when the multi - function device 20 is connected to a workstation 12 or another device capable of providing additional destination options are included in the destination menu . these additional destinations may be downloaded from the workstation 12 to the device 20 via a string of characters . additional destination options may include microsoft paint , microsoft word , microsoft excel , and microsoft powerpoint software ; other drawing , word processing , spreadsheet or presentation programs , clipboard applications ; and custom applications . the left arrow button 36 and right arrow button 38 are used to scroll through or display the destination options . when a desired destination option is displayed on the display 32 , the user may activate the select button 39 . the destination selection button 55 is disabled when scanning commences and during print jobs . the device 20 may be designed so that pressing the select button 39 causes the graphical display 32 to read : in one embodiment of the invention , the device 20 may be programmed or otherwise configured to display only those destination options that are available . thus , for example , when the device 20 is disconnected from the workstation 12 ( or operating in stand - alone mode ) it may be configured to display only the destination options that are independent of the workstation or other external devices . in one embodiment , these options include the global capture - to destination options . unless an error or prohibited condition exists , when the start capture button 57 ( labeled as “ start scan ” in fig2 ) is activated , a scan or capture is initiated . the destination of the data that is captured during the operation is the destination that has been selected by the user from the destination list displayed on the display 32 . generally , the scan is performed in accordance with current scan settings programmed into the device 20 . these settings may be default settings set at the time of manufacture or settings modified by the user . conditions under which a scan operation might be prohibited include selection of a destination that requires interaction with the workstation 12 or other external devices when the device 20 is operating in a stand - alone mode . the device 20 may be configured such that when a prohibited or error condition occurs an appropriate error message is displayed . for example , if a user presses the start capture button 57 in a case where an application on the workstation 12 is the destination and the device 20 is disconnected from the workstation or the workstation is not on , an error message such as fig3 illustrates hardware 71 that may be used in the multi - function device 20 or another peripheral such as the scanner 18 or printer 19 . in the exemplary configuration shown , the hardware 71 includes a display and keyboard module 73 , an i / o module 75 , a processor 77 , and a memory module 79 . the memory module 79 may contain non - volatile memory such as one or more forms of rom , ram or media cards , one or more disk drives , other memory , or combinations of the foregoing . fig4 illustrates the possible contents of the memory module 79 or a portion thereof . as illustrated in fig4 , the memory module 79 contains software . the software is illustrated as having four portions : a user interface 83 , an image capturer 85 , an image processor 87 , and a print engine 89 . in various implementations , the software may be configured in such a way that it does not include four distinct portions . functional features could be combined in a variety of ways . however , in at least some embodiments , the user interface 83 includes instructions for generating output on the display 32 , the image capturer 85 includes instructions for capturing data from a capture device such as an array of charge - coupled devices (“ ccd ”) or contact image sensor (“ cis ”) or the like . the image processor 87 may include instructions for processing image data such as combining foreground and background images and the print engine 89 may include instructions for converting data into a format that is suitable for use by a printer . the memory module 79 is not limited to the components listed and may contain other applications and data used to support the multi - function device 20 . software used in devices such as the device 20 , scanner 18 , and printer 19 to carry out basic operations such as scanning , printing , and faxing is well known and , therefore , not described . fig5 represents a diagram of a non - volatile memory portion 91 of the memory module 79 . the memory portion 91 contains locations for varying types of stored data . a background section 93 holds background objects or images and a program section 95 holds application programs such as the user interface 83 , the image capturer 85 , the image processor 87 , and the print engine 89 . the memory module 79 may contain more designated sections to store data although it is not required . fig6 and fig6 a illustrate an exemplary background data or image capture process carried out by the device 20 when a user selects a global capture - to function . as may be seen by referring to fig6 , the process begins at block 100 where any required hardware and software initializations are performed to calibrate and prepare the system for use . the graphical display 32 is initially in a default condition , as shown in block 102 . the processor 77 ( executing the software described above ) periodically queries or scans the operator panel 30 to determine whether a button is pressed or selected ( block 104 ). if a button is not selected , the processor 77 continues to display the default screen on the graphical display 32 ( block 102 ). if a button is selected , the processor 77 determines whether the destination selection button 55 is pressed ( block 106 ). if the destination selection button 55 is pressed , the processor 77 directs the graphical display 32 to display the most recently selected capture - to destination ( block 108 ). the processor 77 then inquires as to whether the left arrow button 36 or the right arrow button 38 is pressed ( block 110 ). if either button is pressed the processor 77 instructs the graphical display 32 to display the previous or next capture - to destination from the preprogrammed list of destinations as indicated in block 112 , and the processor 77 continues to check for further input from the operator panel 30 ( block 110 ). if neither the left arrow button 36 or the right arrow button 38 is pressed , the processor 77 determines whether the select button 39 is pressed ( block 113 ). if the select button 39 is pressed the processor 77 sets the capture - to destination to the destination currently displayed on the graphical display 32 , as indicated in block 114 . the process proceeds to block 116 where the graphical display 32 presents the message : the processor 77 then displays the default message , as shown in block 102 . if the select button 39 is not pressed the processor simply displays the previously set capture - to destination ( block 108 ). if the destination selection button is not pressed the processor 77 determines whether the start capture button 57 is pressed , as shown at block 118 . if the start capture button 57 is pressed , the processor 77 disables the destination selection button 55 ( block 120 ) and causes the display of the currently selected capture - to destination on the graphical display 32 ( block 122 ). the processor 77 must then decide , depending on the chosen capture - to destination , how to process and where to export or save the captured image . the processor 77 first inquires as to whether the capture - to destination is set to “ watermark ” ( block 124 ). if “ watermark ” is the selected capture - to destination , the image capturer 85 captures the image ( block 126 ), and the image processor 87 crops or otherwise processes the image as needed ( block 128 ). although not shown in fig6 , the program may be adapted to allow the user to select the masked intensity of the image , such as 5 %, to be used for the watermark . the processor 77 then stores the captured image in the background section 93 of the memory portion 91 of the memory module 79 . finally , the processor 77 enables the destination selection button 55 ( block 132 ) and then resumes displaying the default message ( block 102 ). if a “ watermark ” destination is not the selected capture - to destination , the processor 77 determines whether the capture - to destination is a “ header / footer ” destination , as shown in block 134 of fig6 a . if the capture - to destination is a “ header / footer ” destination , the image capturer 85 attains the header and footer section from the provided image , for example , the top one inch and bottom one inch of the image ( block 136 ). although not shown in fig6 a , the program may be adapted to allow the user to select the amount of the image to be used for the header and footer sections . since only the header and footer of the provided image will be reproduced on subsequent output , only the header and footer sections of the provided image need to be captured . it would also be possible to capture the entire image and process it later on to obtain the header and footer sections . the captured image is then stored in the background section 93 of the memory portion 91 of the memory module 79 ( block 138 ). generally , images associated with a function other than the “ watermark ” destination are stored at full or 100 % intensity . finally , the processor 77 enables the destination selection button 55 ( block 132 ), and returns to displaying the default message ( block 102 ). if a “ header / footer ” destination is not the selected capture - to destination , the processor 77 determines whether a “ border / frame ” destination is the selected capture - to destination ( block 140 ). if the selected capture - to destination is a “ border / frame ” destination , the image capturer 85 acquires the circumference of the image , for example the top one inch , bottom one inch , left one inch , and right one inch of the presented image ( block 142 ). since only a border or frame of the provided image will be added to future output , only the area corresponding to that area needs to be captured and retained . again , although not shown in fig6 a , the program may be adapted to allow the user to select the amount of the image to be used for the border / frame sections . the processor 77 then stores the captured image in the background section 93 of the memory portion 91 of the memory module 79 ( block 144 ). finally , the processor 77 enables the destination selection button 55 ( block 132 ), and returns to displaying the default message ( block 102 ). one use for the “ border / frame ” feature is to scan a return address to be used in printing information on an envelope . if a “ border / frame ” destination is not the selected capture - to destination , the processor 77 inquires as to whether a “ fax / coversheet ” destination is the selected capture - to destination ( block 146 ). if a “ fax coversheet ” destination is the selected capture - to destination , the processor 77 instructs the image capturer 85 to secure the upper portion , for example the upper 33 %, of the imported image ( block 148 ). only the upper section needs to be attained and saved since it will be used as a fax coversheet added with upcoming output . next , the processor 77 enables the destination selection button 55 ( block 132 ), and displays the default message ( block 102 ). finally , if a “ fax coversheet ” destination is not the selected capture - to destination , it is assumed that the captured image will not be processed and stored in the background section 93 of the memory portion 91 of the memory module 79 of the multi - function device 20 . the processor 77 , however , must first check if the multi - function device 20 is attached to a workstation 12 or a device with an appropriate interface ( block 152 ). if no connection is available , the message will be displayed on the graphical display 32 ( block 158 ), and the processor 77 will enable the destination selection button 55 ( block 132 ) and again display the default message ( block 102 ). if the multi - function device 20 is connected to a workstation 12 or a device capable of interfacing to a workstation , the captured image , captured by the image capturer 85 at block 154 , will be stored or exported to the specified capture - to destination as shown in block 156 . after storing the image , the processor 77 will enable the destination selection button 55 ( block 132 ) and return to block 102 where the processor 77 displays the default message again ( block 102 ). the capture - to destinations where the multi - function device 20 stores and uses the captured image as background indicia for forthcoming output are not limited to the ones presented . other destination formats may be created and added as needed . referring now to fig7 , the process for producing output commences with a start block 160 . the graphical display 32 displays a default message and the processor 77 awaits instruction either from the operator panel 30 , the workstation 12 , or any other device with an appropriate interface . the processor 77 continually checks for output requests , as shown at block 162 . if no request is found , the processor 77 continues to display the default message on the graphical display 32 ( block 160 ). if a request is found , the processor 77 first disables the destination selection button 55 ( block 163 ) and proceeds to determine if background indicia have been specified for all output . at block 164 the processor 77 examines the selected capture - to destination and first checks if it is set to a “ watermark ” destination . if the selected capture - to destination is a “ watermark ” destination the processor 77 merges the requested output with a lower masked intensity version , such as 10 %, of the image stored in the background section 93 of the memory portion 91 of the memory module 79 ( block 166 ). the reduced intensity allows the stored image to appear as a watermark embedded with the requested output that is created as shown in block 168 . alternatively at block 170 , the processor 77 queries whether the selected capture - to destination is set to a “ header / footer ” destination . if the processor 77 finds the selected capture - destination to be set to a “ header / footer ” destination , the output is reduced to fit and centered within the stored “ header / footer ” image ( block 172 ). the device 20 , as shown at block 168 , then produces the combined output . if the selected capture - to destination is not set to a “ watermark ” or a “ header / footer ” destination , the processor 77 checks if the capture - to destination is set to a “ border / frame ” destination ( block 174 ). if this is the case , the sent output is reduced to fit , centered , within the stored “ border / frame ” image ( block 176 ). the final output is then produced at block 168 . if the capture - to destination has not been set to any of the previously checked destinations , the processor 77 checks if the capture - to destination is set to a “ fax / coversheet ” destination ( block 178 ). if the capture - to destination is indeed set to a “ fax / coversheet ” destination the processor 77 scales the requested output to 66 % the original size and merges it , centered , below the “ fax / coversheet ” indicia stored in the background section 93 of the memory portion 91 of the memory module 79 ( block 180 ). the “ fax / coversheet ” image combined with the original output is then created at block 168 . although 33 % and 66 % of the page size are exemplary embodiments for providing the facsimile transmission information and the information to be faxed , respectively , other proportions may be used . for example , the typical transmission information found on a fax coversheet , such as sender and recipient names , telephone numbers , facsimile numbers , date and number of pages can be placed in a header or footer or in a region smaller than 33 % of the height of the page with the other information to be sent being correspondingly scaled to fit on the remainder of the page . finally , if no matching capture - to destination has been discovered of those previously listed , it is assumed that no background image is to be combined or merged with the desired output . the output is simply produced at block 168 . after any output is produced , with background images or without , the processor 77 enables the destination selection button 55 ( block 182 ) and returns to displaying the default message ( block 160 ). once a capture - to destination requiring the addition of background indicia has been set , all future output may contain , in addition to the original data , the stored background in a format designated by the specific capture - to destination value , until either a settings timeout occurs , which cancels all non - default programmed settings , or a capture - to destination is chosen which does not require the addition of a stored background image to all outputs . a “ cancel background ” capture - to destination may also be added to the list of possible destinations that the user can select by using the destination selection button 55 . the multi - function device 20 may also have a reset option which would clear any saved background images . in another embodiment of the invention , a set of peripherals , not housed in the same device , could be configured to perform similar capture - to functionality otherwise provided by the multi - function device 20 . the scanner 18 and the printer 19 illustrated in fig1 could be organized in such a way that the printer 19 could receive and store images captured by the scanner 18 , and the printer 19 could use the saved images as background indicia . any device that can output images capable of being captured by another device , such as a workstation or a digital camera , could replace the scanner 18 . any device that creates output and is capable of holding received data in memory could replace the printer 19 , including a fax machine and a photocopier . the functionality to create , process , and use background images in both the stand - alone multifunction device 20 embodiment and the embodiment utilizing the coupling of a number of single - operation devices , such as the scanner 18 and the printer 19 , configured to operate like the multifunction device 20 , could be implemented in software , hardware , or a combination thereof . various features and advantages of the invention are set forth in the following claims . | 7 |
fig1 shows the holder 1 of the fastening device . the holder 1 consists of an essentially rectangular plate , articulated into a middle segment 2 and two end segments 3 forming the narrow ends . the end segments 3 are each attached to the middle segment 2 by a blunt - edged elevated step 4 on top of the holder 1 . consequently , the top of the middle segment 2 , viewed from above , lies deeper than the adjacency surfaces 5 , formed by the tops of the end segments 3 , for the cable tree to be fastened to the holder 1 . the steps 4 facing each other on top of the holder 1 correspond to back - to - back steps 6 on its under side . opposed to the steps 6 , there are projections 7 configured at the outer corners of the end segments 3 . the steps 6 and the projections 7 serve to secure the lateral position of tapes slung or wound about the cable tree and around the end segments in order to fasten the former . for better adaptation of the holder 1 to the peripheral contour of a cable tree 29 , the end segments 3 and the middle segment 2 are provided with a curvature concave upwards , whose axis of curvature lies on the longitudinal centerline of the holder 1 . for fastening the holder 1 , the middle segment 2 on its under side comprises two spring fingers 8 projecting downward . the fingers 8 are arranged symmetrical to a longitudinal median plane dividing the holder 1 , and at their opposed sides , they each have a catch 9 with a locking surface 10 facing the middle segment 2 and a ramp surface 11 turned away from the middle segment 2 . the fingers 8 together form a first coupling part 12 of a two - part snap coupling . the fingers 8 are elastically deformably connected to the middle segment 2 of the holder 1 . as may be seen in fig3 , the middle segment 2 comprises four parallel slits 13 piercing it completely . the slits 13 form two outer webs 14 and a middle web 15 . a finger 8 is attached to each of the outer webs 14 . the webs 14 form elastically deformable elements that yield springingly when a force bringing them closer to each other is applied to the free ends of the fingers 8 . this makes possible a springing compression of the fingers 8 for plugging the snap coupling together . fig2 shows a fastening element 16 intended for connecting the holder 1 to a part , in particular of sheet metal , not shown in detail . the fastening element 16 has a holding pin 17 insertable in an opening of a part and there retainable by means of a catch element 18 . on the holding pin 17 , a plate - like flange 19 is arranged . the flange 19 serves to support the fastening element 16 in the part . it may in addition be provided with an annular sealing lip 20 of softer material , in order to be able to tightly close the opening in the part that receives the holding pin . on the side away from the holding pin 17 , a rectangular frame 22 is fastened to the flange 19 by means of two struts 21 , said frame extending essentially in a plane parallel to the flange 19 . the frame 22 forms the second coupling part of the two - part snap coupling 23 . the struts 21 are arranged on the longer sides of the frame 22 . the frame 22 comprises a rectangular framed opening 24 . the width of the framed opening 24 is smaller than the distance between the struts 21 . in this way , on the under side of the longer sides 25 of the frame 22 , towards the flange 19 , an adjacency surface 26 is formed , receding in the manner of an undercut relative to the framed opening 24 and intended for adjacency of the locking surfaces 10 with the catch projections 9 of the fingers 8 . the width of the framed opening 24 corresponds substantially to the distance between the sides , turned away from each other , of the fingers 8 of the holder 1 . in the framed opening 24 , symmetrical with respect to the center of the opening , projections 27 are attached to the sides 25 , their distance being somewhat greater than the width of the fingers 8 measured in a lengthwise direction of the holder 1 . on their outer sides turned away from each other , the legs 25 bear parallel ledges 28 , whose spacing corresponds essentially to the width of the middle segment 2 of the holder 1 . the ledges 28 are intended to secure the holder 1 against rotation . for assembly with the fastening element 16 , the holder 1 is placed on the frame 22 with longitudinal axis oriented parallel to the latter , and pressed against the fastening element 16 by fingers 8 turned towards the framed opening 24 . the fingers 8 thus slide over the sides 25 by the ramp surfaces 11 of the catches 9 , and are thereby pressed together . as soon as the holder 1 reaches the position shown in fig4 and rests on the frame 22 , the sides 25 release the catches 9 , whereby the latter snap into the locking position shown in fig4 , in which their locking surfaces 10 rest against the adjacency surfaces 26 and fix the holder 1 to the fastening element 16 . the ledges 28 thus laterally embrace the middle segment 2 and thereby secure the holder 1 against rotation . the holder 1 may be connected to the fastening element 16 either centrally or , insofar as the length of the framed opening 24 permits , eccentrically . if the holder , as shown in fig3 and 4 , is mounted centrally , then it is secured in that position by bearing of the fingers 8 on the projections 27 . by a force acting on the holder 1 in lengthwise direction , however , the supporting resistance of the projections 27 can be overcome , and the holder 1 shifted relative to the fastening element 16 . in this way , deviations of location between the position of the holder 1 on a cable tree and the opening in the part accommodating the fastening element 16 can be compensated . | 1 |
the drift pin cap 10 of the present invention is best shown in fig1 and 2 as including a generally cylindrical cap body 12 having a height of approximately two to three inches ( 2 ″ to 3 ″) and an outer diameter of approximately two and one - half inches ( 2½ ″). in the preferred embodiment the drift pin cap 10 would be constructed of uhmw polyethylene (“ uhmw ”). uhmw is a lightweight and long wearing polyethylene material that is ideal for this particular application and although the friction - reducing properties of the material have been known , the use of the material in the apparatus and method of the present invention has not been taught or suggested to the inventor &# 39 ; s knowledge . the uhmw material has additional properties which lend themselves to use in the present invention , such as it being relatively easy to work with , i . e . requires no special handling techniques , and can be manufactured to meet the shapes and sizes which are preferred in the present invention . ultra high molecular weight polyethylene ( uhmw ) is light weight ( ⅛ the weight of mild steel ), high in tensile strength , and as simple to machine as wood . uhmw is self - lubricating , shatter resistant , long - wearing , abrasion and corrosion resistant . of course , there may be other such durable and easily worked materials with similar splaying , fracturing , and splintering preventing qualities which are not presently known , but are to be understood as being included in the present disclosure . the lower end of the cap body 12 of the drift pin cap 10 is referred to as the pin insertion end 14 . formed adjacent to the pin insertion end 14 and extending into the cap body 12 is a pin receiving cavity 16 . the pin receiving cavity 16 is formed by boring a polygonal , cylindrical , hemispherical , rectangular , square or triangular hole into the cap body 12 approximately one to two inches ( 1 ″ to 2 ″) in depth and approximately one and one - half inches ( 1½ ″) in diameter , depending on the diameter and shape of the striking end of the drift pin . the pin receiving cavity 16 is of generally smaller diameter than that of the cap body 12 and would preferably be formed via the use of a drill bit or like device , although it may be formed by injection molding process or other such production methods , any of which would be suitable for use with the present invention . the operation of the pin receiving cavity 16 may be understood upon reference to fig1 and 2 in which the pin receiving cavity 16 accepts the upper end 102 of the drift pin 100 and the diameter of the pin receiving cavity 16 creates a tight fit around the upper end 102 of the drift pin 100 thus preventing the drift pin cap 10 from becoming dislodged upon impact of the driving device such as a sledge hammer ( not shown ). of course , the drift pin 100 shown in fig1 is not drawn to scale and should be understood to be only representative of the placement of the drift pin cap 10 on the drift pin 100 . located at the upper end of the cap body 12 of the drift pin cap 10 is the striking surface 18 . in the preferred embodiment , the striking surface 18 is a generally flat surface adapted for receiving impact from a driving device and transferring the impact force through the drift pin cap body 12 into the drift pin 100 thereby driving the drift pin into the holes on the joint bar ( not shown ) and aligning the rail holes ( not shown ). although fig1 shows the striking surface 18 as being generally smooth and flat , it should be noted that the striking surface 18 may be slightly rounded or may be pebbled , scored or the like resulting in increased friction between the driving device and the striking surface 18 . formed between the striking surface 18 and the cap body 12 is an upper circumferential chamfer 20 . the upper circumferential chamfer 20 is approximately one - sixteenth inches ({ fraction ( 1 / 16 )}″) in width and is formed through beveling or sanding the edge formed between the striking surface 18 and the cap body 12 thereby decreasing the angle between the striking surface 18 and the outer side wall of the cap body 12 . the upper circumferential chamfer 20 improves upon the prior art in that the upper circumferential chamfer 20 will decrease the amount of damage to the drift pin cap 10 resulting from an off - center strike by the driving device upon the striking surface 18 . fig3 and 4 disclose a second preferred embodiment of the present invention . in this embodiment , the pin insertion end 14 of the drift pin cap 10 ′ is tapered and the tapered portion is approximately five - eights inches ( ⅝ ″) in length . the tapered portion of the pin insertion end 14 permits additional distortion of the side wall of the drift pin cap 10 ′ to facilitate a snugger fit of the drift pin cap 10 ′ on the drift pin 100 . fig5 represents a third preferred embodiment of the present invention . in the embodiment of fig5 , the drift pin cap 10 ″ has a height of approximately seven inches ( 7 ″) and further includes a cap neck 13 formed between and connecting the pin insertion end 14 and the striking surface 18 of the drift pin cap 10 ″. the cap neck 13 is approximately three inches ( 3 ″) in height and has a diameter of approximately two and one - half inches ( 2½ ″). the cap neck 13 allows the operator to easily grasp and manipulate the drift pin cap 10 ″ and drift pin 100 . adjacent to and below the cap neck 13 is the pin insertion end 14 . in this embodiment , the pin insertion end 14 is preferably a circumferential bulbous ring of approximately one inch ( 1 ″) in height , approximately three inches ( 3 ″) in diameter , and would include a connecting shoulder 17 between cap neck 13 and pin insertion end 14 which extends at an angle of approximately one hundred degrees ( 100 °). formed adjacent to the pin insertion end 14 and extending into the cap neck 13 is the pin receiving cavity 16 . the pin receiving cavity 16 in this embodiment is deeper than in the previous embodiments due to the elongated cap neck 13 . the pin receiving cavity 16 is formed as per the previous embodiments , via drilling or manufacture , but the length of the cap neck 13 allows for a deeper hole , approximately three inches ( 3 ″), creating the pin receiving cavity 16 . the pin receiving cavity 16 of this embodiment can , therefore , accept a longer portion of the upper end 102 of the drift pin 100 thereby increasing the stability of the drift pin cap 10 on the drift pin 100 . on the upper end of the cap neck 13 is formed the cap head 17 . the cap head is approximately two inches ( 2 ″) in height and has a diameter of approximately three inches ( 3 ″). atop the cap head 17 is the generally flat striking surface 18 . the cap head 17 creates a striking surface 18 that is approximately less than three inches ( 3 ″) when the circumferential chamfer 20 is formed . the method of the present invention is generally as follows . the operator of the device would first position the drift pin cap 10 atop the drift pin 102 inserting the upper end 102 of the drift pin 102 into the pin receiving cavity 16 thereby forming a snug fit between the upper end 102 of the drift pin 100 and the pin receiving cavity 16 . the operator would place the drift pin cap 10 and drift pin 102 in the desired position aligning the drift pin 100 within the joint bar holes into which the drift pin 100 is to be driven . the operator would then swing a driving device such as a sledgehammer as to impact the striking surface 18 of the drift pin cap 10 and drive the drift pin 100 into the holes on the joint bar thereby aligning the holes in the rails ( not shown ). the operator would impact the striking surface 18 of the drift pin cap 10 as many times as necessary to align the rail holes . the operator would remove the drift pin 100 and drift pin cap 10 from the joint bar and rail holes and insert the track fastening device ( not shown ). the present invention is composed of polyethylene which is superior to the metal in that the polyethylene is not as malleable and does not deform to the extent of metal . the rigidity of the polyethylene and the upper circumferential chamfer 20 of the drift pin cap 10 prevents even an off - center impact upon the striking surface 18 from damaging the drift pin cap 10 . as a result , the drift pin cap 10 will prevent the collision between the driving device and the metal drift pin thus resulting in no shrapnel being emitted which could injure the operator . likewise , the drift pin cap 10 does not disintegrate like the rubber used in caps in the prior art . the drift pin cap 10 will remain in its general form thus eliminating the contact between the driving device and the drift pin resulting in little or no shrapnel . another improvement the current invention displays over the prior art is its recoil preventing qualities due to its polyethylene composition . the present invention absorbs the energy created by the driving device impacting the striking surface 18 thereby lessening the recoil that has been seen in the rubber and metal materials used in the prior art . as a result of the recoil preventing qualities the operator is at less risk of becoming injured due to recoil of the driving device . the shape and design of the present invention also decreases the possibility of the cap 10 becoming dislodged and causing injury to the operator . the pin receiving cavity 16 of the drift pin cap 10 , as seen in fig1 and 2 , is created as to fit snugly around the upper end 102 of the drift pin 100 thus decreasing the possibility of the drift pin cap 10 from becoming dislodged . in fact , it is intended that the drift pin cap 10 will remain snugly atop the drift pin 100 during the useful life of the drift pin 100 . additionally , the outer diameter of the drift pin cap 10 can protect an operator &# 39 ; s hands from being struck by the driving device . the operator may place his hand under the pin insertion end 14 of the present invention and the diameter of the drift pin cap 10 will partially protect the hand by deflecting the driving device . it is to be understood that numerous modifications , additions , and substitutions may be made to the present invention which are intended to fall within the broad scope of the above description . for example , the exact shape , size , and construction materials used in the present invention may be modified and / or changed so long as the functionality of the invention is not impaired or degraded . additionally , the broad scope of the present invention is contemplated to cover its use in conjunction with other applications . for example , the present invention may be modified to fit stakes , spikes , dowels , chisels , wedges or the like to be driven in a plurality of substrates such as dirt , concrete , gravel , or like substrates . in fact , although the present invention has been described as a “ drift pin cap ”, it should be noted that it will likely be referred to in connection with whatever tool it is being used with , for example , if it were to be used with a wedge , it might be referred to as a “ wedge cap ,” a “ stake cap ” if used with a stake , and so on . in such applications , it may be necessary to attach the cap to the tool by a strap or clamp , or by gluing or epoxying the cap thereto , although such application would be understood by one skilled in the prior art . furthermore , the polyethylene component of the present invention is found to be superior to other materials used in the industry and is particularly well - suited for uses described by this invention . there has therefore been shown and described a drift pin cap and method for using same 10 which accomplishes at least all of its intended purposes . | 8 |
in a preferred arrangement , the capture means comprises a pair of jaws able to move between a closed position sufficient to hold the capsule and a spread position to release the capsule . the pair of jaws is preferably openable elastically by spreading them apart by means of a nose that activates said jaws by a relative movement of said nose with respect to a spreading area of the jaws . the jaws preferably offer bearing surfaces on which the capsule can at least partly rest , to enable it to be transferred without damaging it . in a preferred embodiment , the pair of jaws is mounted so as to be rotatable so that it can move between the storage system and the brewing system . in order to allow precise coordination between the capture means and the brewing system , the pair of jaws is able to move relative to the nose to release the capsule by the thrust of at least one thrust member moving in combination with a moving part of the brewing system when the brewing means closes around the capsule . in a preferred configuration , the used capsule is removed after brewing by the same capture means as was used to place the capsule in the brewing system . for this purpose the jaws are openable in an ejection area after the contents of the capsule have been brewed , and after the capture means has been moved to an intermediate area between the brewing area and the loading area . the spreading apart of the jaws in the ejection area to release the used capsule is preferably effected by cam means which is operatively associated with the nose for spreading apart the jaws in the ejection area to release the used capsule by moving the nose . such a cam means is operable cyclically according to the movement of the capture means and its position . this simplifies the control of the opening and closing of the jaws . the invention also relates to a method of selecting and loading a capsule that includes contents for the preparation of a drink in a brewing system from a storage area comprising several sets of capsules . one aspect of this method comprises capturing a capsule individually from a set , moving the capture means between the storage area and the brewing system in to at least two positions , including a first or reception position in which the capsule can be held and supported by the capture means for transfer , and a second or release position in which the capture means can be opened to release the capsule from the capture means into the brewing system ; and releasing the capsule into a brewing system for brewing of its contents . another aspect of the method comprises selecting and capturing one capsule from one of the sets of capsules , transferring the selected and captured capsule to a brewing system , releasing the capsule into the brewing system , closing the brewing system around the capsule , and brewing the contents of the capsule in the brewing system . the method is characterized in that the capsule is captured and then released into the brewing system , the latter being able to close around the capsule . in one preferred embodiment , the capsule is released into the brewing system via capture means in a movement of disengagement that causes no mechanical interaction between the brewing system and the capture means . the capsule is preferably released by the capture means by deposition of the capsule onto a reception part of the brewing system resulting from a movement of vertical approach and lateral disengagement of the capture means . this gives precise positioning of the capsule in the brewing system allowing an autonomous brewing system to close around the capsule . in another preferred embodiment , the used capsule is recovered , transferred to an ejection area , and released again . in addition , the capsule in the brewing system is coordinated with the closure of the system and , in reverse , the recovery of the used capsule from the brewing system is coordinated with the re - opening of the brewing system . the brewing device according to the invention shown in fig1 is a machine for dispensing coffee and / or other drinks for preparing drinks by brewing a food substance contained in capsules with preinserted ingredients . the device comprises a cabinet 10 of both attractive and functional shape which contains the essential elements of the brewing , selection and actuation system of the device . at the back of the cabinet is a storage system 2 with a plurality of tubes 20 , 21 , 22 and 23 containing sets of capsules for brewing . the front of the cabinet is a service area 11 comprising a stable support 12 for holding one or more receptacles for collecting the drink . a control panel 13 is provided at the front of the cabinet and has drink - selecting buttons corresponding to the different choices of capsules available in the storage device . some buttons may also correspond to certain possible mixtures obtained by means of more than one selected capsule . the device is supplied with electricity by an electric power line 15 and with water by a water pipe 16 . referring to fig2 to 5 , the device according to the invention comprises a main base 30 on which is mounted a storage system 2 in the form of a carousel comprising several refilling tubes 20 - 23 standing vertically and arranged together in a closed orbital arrangement . each tube forms a vertically oriented internal space suitable for housing a set of capsules stacked freely on top of each other in the refilling tube . the refilling tubes may be connected to each other to form a relatively rigid assembly when the carousel is rotated . for this purpose each tube is connected longitudinally on either side to its neighboring tubes by connecting webs 24 . as shown in fig5 , the refilling tubes are connected together at their lower base by a central connection means 25 which extends downwards by a central axial rod 26 connected rotationally to the base 30 . drive means 27 are used to turn the central shaft 26 . these means may include , as shown in fig5 , meshing wheels 270 , 271 and an electric motor 272 , the latter being connected to the base 30 . in one possible variation , the drive means may include a cam of the geneva wheel mechanism type whose function is to produce one precise rotation per quarter of a revolution of the refilling tubes . to make the assembly stable and keep the capsules in the tubes in the storage position , a tube supporting means 28 is provided on which the central connection means 25 rests . the tube support means 28 is a stationary supporting plate mounted on the main base 30 by spacer means ( not shown ). the central shaft of the carousel 26 passes in a sliding manner through the supporting plate 28 to allow the carousel , that is the assembly formed by the refilling tubes 20 - 23 and their connection means 25 , 26 , to be rotatable about a central vertical axis o relative to the supporting plate 28 , which is stationary relative to the base 30 . the refilling tubes 20 - 23 can therefore be moved about a circular path i orbiting about the axis o as shown schematically in fig6 . the tubes are thus able to move between a configuration in which the capsules are supported by the supporting plate 28 and a preselection configuration corresponding to a recess 29 formed in the supporting plate 28 , which recess 29 intersects a given arc of the orbital path i . the recess 29 thus provides a lower opening in the supporting plate 28 for one of the set of refilling tubes — which happens to be tube 22 in the example of fig6 . fig5 to 8 illustrate the capture means 4 used to capture a preselected capsule in the storage system 2 . the expression “ preselected capsule ” means a capsule 90 at the bottom of the tube positioned over the recess 29 . the capture means 4 comprises a shut - off plate 40 with an opening 41 of sufficient size for a capsule situated over it to pass freely through it . below this plate 40 is a hinged component that can adopt at least two positions , including a retention position for retaining the capsule and a release position for releasing the capsule . such a component is preferably a pair of jaws 42 which moves integrally with the shut - off plate about a central axis of rotation o ′ parallel with and offset from the axis o of the carousel . for this purpose the jaws 42 and the plate 40 are mounted on a central rod 46 . the shut - off plate and the jaws are rotated by means of a drive assembly comprising a motor 43 which drives by means of a belt 44 a central pinion 45 which in turn is integral with the rod 46 , as shown in fig3 . it will be understood that the capture means 4 , intentionally simplified in fig6 , can travel around a second circular path i ′ which intersects the first circular path i of the storage system 2 . more exactly , the essential capture components which are the opening 41 and the jaws 42 move together along the path i ′ in such a way that at the moment of capture they lie in the recess 29 of the tube supporting plate 28 . for this purpose the shut - off plate 40 covers the recess 29 , thereby holding back the stack of capsules in the tube in position in the recess 29 until the moment when its discrete opening 41 is aligned with the preselected tube , that is to say in the intersection of the orbital paths i - i ′. the capture system 4 will now be described in more detail . as shown in fig8 , the jaws 42 of this system are held closed by a spring 47 . the spring acts in compression on the opposing parts 420 , 421 of the gripping members 422 , 423 of the jaws in such a way as to push these members towards each other and thus offer a supporting ledge 48 for the capsule 90 . beneath the jaws 42 are actuating means 5 for opening and closing the jaws . the actuating means slide up and down inside a casing 54 mounted on the base 30 ( visible in fig5 and 7 ). the rod 46 is itself mounted rotatably in the base of the casing at one end and extends upwards to participate in driving the brewing device as will be explained below . the jaws 42 are kept pressed against the underside of the shut - off plate 40 by a compression spring 59 housed in the casing . due to the compression of the spring and in the absence of a reverse load pushing on the jaws , the jaws 42 remain effectively in contact with the shut - off plate 40 . as will be explained below , a pushing force on the jaws 42 is then used to open the jaws under certain conditions . the actuating means 5 for actuating the capsule capture system comprises a tubular component or cylinder 50 guided translationally up and down a cylindrical base 49 of the jaws by a tongue - and - groove guidance means 51 . the cylinder 50 is therefore able to move translationally up and down the lower base 49 of the jaws but is prevented from rotating relative to it . the top of the cylinder ends in a nose 52 which is aligned between the jaws 42 as shown in fig9 . the nose 52 acts on a spreading zone 424 of the jaws at the base of the jaws . at the other end of the cylinder , the cylinder engages with the casing by means of a cam mechanism 55 that enables the cylinder 50 to move up and down in a cyclical manner with each revolution of the capture means 4 about the rod 46 of axis o ′. the mechanism 55 comprises a cam surface 56 formed within the tubular section of the cylinder and acted upon by a fixed radial pin 57 inside , and integral with , the casing 54 . the cam surface 56 possesses a recessed part 580 as shown in fig8 in which the pin 57 applies no pressure , and a relief part 581 opposite the recessed part 580 in which the pin does apply pressure . when the cylinder is turned so that the recessed part 580 is over the pin 57 , the cylinder remains in the down position and its nose 52 applies no spreading force on the jaws , so they remain closed . this position corresponds to the capsule capture position of fig7 and 8 and also to the transfer position . on the other hand , when the cylinder is turned so that the relief part is in contact with the pin 57 , the cylinder is pushed up by the pressure of the pin on the relief part so that the nose exerts a spreading force on the jaws . this position corresponds to the situation of ejection of a capsule after brewing as will be explained later in detail . as shown in fig3 to 5 , the device is provided with a brewing system 7 situated on the opposite side of the rotational rod 46 of axis o ′ of the capture means from the storage system 2 . the brewing system is provided with a brewing assembly composed of a brewing head or moving block 70 . the block 70 is formed of an open cavity 79 , also referred to as the “ bath ”, comprising spikes for piercing the capsule and a hot - water inlet ( not shown ). the brewing system 7 also possesses a stationary extraction base 71 comprising a brew dispensing member 72 . this member 72 , as known per se , is mounted directly on the base 30 . it possesses a pressure distributing plate 74 necessary for opening the capsule and a pipe 75 through which the liquid brew flows out . the block 70 moves translationally up and down both the rod 46 and also an additional rod 86 . a central motor 76 mounted on a frame 78 connected to the rods 46 , 86 opens and closes the block 70 relative to the stationary brewing member 72 via a gear system 77 designed to distribute the driving forces of the motor on both sides of the rods 46 , 86 . lastly , the brewing device 7 comprises thrust members 790 , 791 connected to the lower part of the moving frame 78 , its purpose being to open the jaws 42 when the latter are moved with a capsule into the brewing device to release their capsule . for this purpose the thrust members 790 , 791 have the structure of rods , each of which is designed to apply a force to one of the jaws as the upper brewing subassembly 70 descends to close the capsule from the top . it is to be observed that the shut - off plate 40 contains holes 401 , 402 visible in fig2 allowing the thrust members 790 , 791 to pass through it . the thrust members 790 , 791 act on the jaws in such a way as to coordinate their opening with the closing of the brewing device triggered by the descent of the moving brewing block 70 . at the bearing end of each thrust member 790 , 791 there is advantageously a small wheel oriented in the direction of the opening / closing movement of the jaws so that the jaw movement is not impeded . the invention will now be described in its operation in order to explain more clearly the role of each component and the manner in which these components interact . the consumer chooses a drink by pressing one of the buttons on the control panel 13 of the main cabinet of the device ( fig1 ). the signal corresponding to the selection is sent to a central control system ( not shown ) of the device , which processes this signal and orders the storage system 2 to move . the identification of the tube corresponding to the selection can be processed in a variety of different ways . in a preferred embodiment , identification is by an electronic code carried on each tube which is readable by a reader within the device . the code may be a bar code , a radio frequency code (“ rfid ”), or any other equivalent coding means capable of holding identification information about the type of capsules contained in the tube . another means of identification may be a system for identifying colors by means of one or more color sensors located where the tubes pass . the tubes may be transparent and may contain colored capsules which are identified by the sensors as the tube passes by . a simpler means of identification would be to initialize the tubes and then count ahead by means of a counter . the identification means may also include microswitches or electromagnets for stopping the motor . the carousel is turned by the motor 272 controlled by the controller until the moment when the identified and selected tube arrives at the point of intersection i - i ′. the controller stops the motor and the selected tube is in the preselection position . if the choice corresponds to a capsule corresponding to a tube already in the preselection position , the controller recognizes this fact and the motor 272 is not started . 2 . capturing a capsule and transferring it to the brewing system : in the next step , the capture system 4 is moved in response to a command from the controller from an ejection position , which will be detailed below , to a position in which the capsule situated inside the preselected tube is captured . for this purpose the controller starts the motor 43 which then drives the shut - off plate 40 and the jaws 42 together to the capture position . the capture position corresponds to the position in which the discrete opening 41 of the shut - off plate 40 coincides vertically with the bottom opening of the preselected tube . once in this position , the controller stops the motor 43 . the bottommost capsule 90 inside the tube falls under gravity through the opening and is caught by the contact edges 48 on the pair of jaws 42 situated beneath it . the jaw is in this case in the closed position . for this purpose the cylinder 50 is in the down position as shown in fig8 , the recessed part 580 of the cam surface being turned towards the fixed pin 57 inside the casing . it should be noted that the space between the jaws and the shut - off plate 40 is just sufficient for the thickness of one capsule . the other capsules situated inside the tube are thus still stacked on top of the captured capsule . the shut - off plate 40 acts as a separator after rotation between the captured capsule and the rest of the stack contained inside the tube . it would be conceivable to add an additional separator to allow the descent of the selected capsule through the shut - off plate without having to support the weight of the whole stack . this facilitates the descent and reduces the risk of blockage . the next step is to transfer the capsule captured by the jaw to the brewing system . for this purpose the capture system 4 is rotated again by the motor 43 under the command of the controller . fig1 to 12 illustrate the step of releasing a capsule into the brewing system . the capsule is moved by the jaws 42 until it is over the stationary lower brewing block 71 . the motor 43 is then stopped . the motor may be stopped by microswitches or any equivalent means familiar to those skilled in the art . the controller then causes the upper moving brewing block 70 to descend by starting the motor 76 . the rotation of the motor shaft turns the gears 77 which then move the block 70 down the rods 46 , 86 which are threaded for at least part of their length in order to engage with screwthreads in the bores of the side gears . the descent of the moving block 70 causes the thrust rods 790 , 791 to pass through the holes 401 , 402 in the shut - off plate until the jaws 42 come open . when the jaws are thus acted upon by the bearing members 790 , 791 , they move down away from the supporting plate 40 and into contact with the nose 52 of the actuating means 5 . the jaws are pushed down , compressing the spring 59 inside the casing . the contact of the jaws against the nose has the effect of opening them and therefore releasing the capsule into the extraction device as shown diagrammatically in fig1 and 12 . the release occurs as the jaws 42 move vertically towards the bearing surfaces 710 of the fixed lower brewing block 71 . the jaws 42 therefore move both down a and apart b enabling them to disengage from the brewing block as shown in fig1 . the closure of the brewing system by the block 70 thus occurs simultaneously with the movement of the jaws . it should be observed that the dimensions of the moving block 70 allow it to pass through the opening 41 in the shut - off plate without difficulty . it should also be observed that the jaws 42 are pushed in the direction a until their contact surface 48 is below the contact plane p of the capsule corresponding to the reception surface 710 of the lower block . the jaws are now in the waiting position until brewing is completed . the capsule is now gripped between the upper moving block 70 and the lower stationary block 71 . the capsule preferably has lateral edges which are gripped at the interface between the two brewing blocks . the capsule is therefore taken over entirely by the brewing system without significant mechanical interaction between the capsule and the capture means at this stage . the brewing system can be made completely leaktight by a sealing means such as o - rings or the like ( not shown ). the process of brewing the contents of the capsule is known per se . there is no need to describe the principle in detail . a detailed description of the brewing principle will be found in u . s . pat . nos . 5 , 826 , 492 , 5 , 649 , 472 and 5 , 762 , 987 , as preferred examples . the teaching of these patents is introduced in relation to the manner of brewing in the present application to the extent necessary by reference thereto . 5 . recapturing the capsule from the brewing system , and transferring and ejecting it : once the brewing procedure is over , the used capsule is recovered by the jaws 42 due to the opening of the moving brewing block 70 . the controller starts the motor in the opposite direction of rotation of the gears 77 , causing the moving block 70 to move upwards . in the reverse of the closing process , the movement of the block 70 carries the thrust rods 790 , 791 upwards , removing the pressure from the jaws . the jaws move back into position underneath the shut - off plate due to the elastic relaxation of the compression spring 59 acting on the jaws . the upward movement of the jaws in the opposite direction to direction a , combined with their closing movement in the opposite direction to direction b , as in fig1 , picks up the edges of the capsule , captures it and lifts it off the lower brewing block 71 . the next step is to transfer the used capsule to an ejection area . the ejection of the capsule is illustrated in fig1 to 15 . for this purpose the controller starts the motor 43 , which rotates the capture system 4 away from the brewing area 7 towards the ejection area 8 of the system . when the opening 41 of the shut - off plate is vertically over this area , indicated in the example illustrated by an opening 80 in the main frame 30 , the motor 43 stops . in the transfer towards this zone , the rotation about the axis o ′ leads the cylinder 50 to rise due to the contact created between the stationary pin 57 and the relief portion 581 of the cam surface as shown in fig1 . as it rises , the nose 52 of the cylinder pushes the jaws apart , dropping the capsule 20 . a collecting box can advantageously be placed in the device below the ejection area . the capsule is thus removed after its contents have been brewed without it being necessary to extract it from the brewing system either manually or by an ejection system built into the brewing system . in this configuration the capture system is ready to be used in a new selection cycle . the invention described above in relation to a preferred embodiment can encompass numerous variants and modifications within the reach of those skilled in the art , without thereby departing from the scope of the claims which follow . | 0 |
fig2 shows a user equipment ue in the form of a wireless communication device 20 , for example a radiotelephone , a pda or laptop , arranged to operate in accordance with the 3gpp wireless communication standard . the wireless communication device 20 includes an antenna 21 , a receiver 22 , a first processor 23 , a second processor 24 and an output device 25 . the antenna 21 is coupled to the receiver 22 , which are arranged to receive a wideband code division multiple access wcdma rf wireless communication signal that is in accordance with the 3gpp standard , as is well known to a person skilled in the art . the received signals that are generated by the receiver 22 are provided to the first processor 23 in the form of a stream of data samples ( i . e . a data sequence ). the first processor 23 is arranged to despread , descramble , demodulated and decode the stream of data samples to recover the original information generated by the transmitting device , for example a base station , as described below . although the first processor 23 and receiver 22 are shown to form separate logical elements they can also be combined to form a single element . alternatively , a single processor could perform the functions of the first processor 23 and second processor 24 . upon successful decoding of a hs - scch ( i . e . the successful decoding of the codeword corresponding to the estimate of the 8 information bits that forms the first part of the hs - scch ) the decoded information bits are provided to the second processor 24 to allow recovery of data transmitted on the hs - dsch . the second processor 24 is coupled to an output device 25 . the wireless communication device 20 will typically include other well known features , which are well known to a person skilled in the art and as such will not be describe any further for the purposes of the present embodiment . as shown in fig3 , the first processor 23 includes a despreading and descrambling module 30 coupled to a decoder 31 where the decoder 31 includes a correlator 32 , a selector 33 , a comparator 34 and an optional memory element 35 . the despreading and descrambling module 30 is arranged to despread and descramble the received stream of data samples to generate the sequence of 40 samples corresponding to the 40 - bit codeword generated by the transmitting element in the transmitting device , as described above . the module may include additional processing to improve the receiver performance in the presence of a multipath channel , as is well known to a person skilled in the art . in contrast to the prior art technique of decoding in which a received data sequence is processed in accordance with the viterbi or yi algorithm , the present decoder 31 , as described in detail below , operates on the basis of comparing a received sequence with all possible 40 - bit transmitted codewords . for the purposes of the present embodiment in which only 8 unique information bits are encoded and transmitted in the first part of a hs - scch , only 2 8 = 256 possible codewords could be applicable / intended for a specific ue . accordingly , a data sequence received by the decoder 31 via the despreading and descrambling module 30 is correlated using the correlator 32 with codewords that could be intended for the ue , which as stated above for the purposes of the present embodiment will be 256 codewords . as such , for the present embodiment the correlator 32 includes a bank of 256 parallel correlators ( not shown ) where each one of the bank of 256 correlators correlates one of the 256 possible codewords with the received data sequence . although the current embodiment describes the use of a correlator 32 having a bank of 256 parallel correlators , alternative correlators could be used , for example a single correlator in which serial correlations are performed . additionally , codewords having more or less than eight information bits could also be decoded where the number of correlations to be performed would vary accordingly . for example , for a codeword corresponding to 6 information bits only 2 6 ( i . e . 64 ) correlations would need to be performed for each received data sequence . coupled to the correlator 32 is a memory 35 for storing the 256 possible codewords where the 256 possible codewords are computed offline and stored in the memory 35 prior to operation of the decoder 31 . alternatively , other means for providing the possible codewords to the correlator 32 are possible , for example a codeword generator ( not shown ) that is arrange to generate the codewords in a similar fashion to the codeword generator in the transmitting device , as described above . as each codeword is represented by 40 bits ( i . e . 5 bytes ) and the memory is arranged to store 256 codewords , the memory 35 will typically be required to store at least 1280 bytes of information . accordingly , the size of the memory 35 will typically be dependent upon the number of possible codewords that could be intended for a ue . in the preferred embodiment of the present invention , 256 correlations are performed for each received sequence . therefore , the total number of operations performed by the correlator 32 is in the order of 10 , 751 ( i . e . 256 × 40 = 10 , 240 operations of sign change and accumulate , plus 511operations of compare and store ). in comparison , more than 28 , 672 operations would be required to perform decoding using the yi algorithm ( the basic viterbi algorithm for decoding the rate ⅓ , constraint length 9 convolutional code requires ( 2 × 256 × 3 + 256 )× 16 operations ). the number of operations to be performed by the decoder 31 will vary according to the number of correlations that need to be performed . however , the number of operations to be performed using the yi algorithm will vary in a different proportion with the number of information bits . as such , there will be a threshold , for the number of codeword information bits , that will determine whether decoding via correlation of codewords or by the use of the yi algorithm will result in fewer operations when performing decoding . in the present embodiment , where part 1 of the hs - scch has 8 information bits the number of correlations is fixed at 256 , and consequently the present embodiment has a computational advantage over the yi algorithm . however , the decoder 31 could be arranged to switch between decoding via correlation of codewords , as described herein , and a viterbi based algorithm , such as the yi algorithm , based upon the number of received data samples , corresponding to a codeword , that need to be decoded . the correlator 32 is arranged to generate an output value for each correlation where the output value is indicative of the likelihood that the codeword being correlated with the received sequence is the transmitted codeword . for the purposes of the present embodiment , the output value generated by each one of the bank of 256 correlators are related to the natural logarithm of the probability of the correlated codeword being the particular codeword that was transmitted by the transmitting device , conditioned to the received data sequence . in the present embodiment , the selector 33 is arranged to receive each of the correlation output values and select the two largest correlation values ( i . e . the two values that correspond to the two most likely transmitted codewords ). the selector 33 is then arranged to subtract the second largest correlator output value from the largest output value to produce a resulting value where the resulting value provides an approximation to the log likelihood ratio for the specific codeword that produced the largest correlation output value when correlated with the received data sequence . the resulting value ( i . e . the approximation of the log likelihood ratio ) is provided to the comparator 34 for comparison with a threshold value to provide a decoding reliability indicator . the threshold value is selected to provide an indication of the likelihood that the codeword that has been correlated with the received sequence to produce the largest correlation output value ( i . e . the most likely transmitted codeword ) is the same as the actual transmitted codeword , i . e . that a successful decoding has occurred . as such , the probability of correctly identifying whether a successful decoding has been performed is dependent on the setting of the threshold value . for example , if the threshold value is set too high then only a subset of possible successful decodings will be identified . however , if the threshold value is set too low then unsuccessful decodings may inadvertently be identified as successful decodings . as such , the setting of the threshold value is dependent upon the acceptable error rate for the decoder 31 . for example , fig4 provides an illustration of the detection probability ( i . e . the y axis ) and false alarm probability ( i . e . x axis ) performance obtained with the present embodiment of the invention . the present embodiment has the same detection probability / false alarm probability performance as that demonstrated using the prior art yi algorithm technique while , as stated above , using considerably fewer operations for decoding a codeword containing information bits less than a given number . if the comparator 34 makes a determination that the calculated approximation of the log likelihood ratio is greater than the specified threshold value ( i . e . a successful decoding has been deemed to have occurred ), the 8 information bits that correspond to the codeword having the largest correlator output value are provided to the processor 24 for processing the appropriate data transmitted on the hs - dsch . if the comparator 34 makes a determination that the calculated approximation of the log likelihood ratio is less than the specified threshold value ( i . e . an unsuccessful decoding has occurred ) the wireless communication device 20 continues to monitor the hs - scch channels without attempting to receive data over the hs - dsch . we note that , in an alternative implementation of the present invention , the detection process may be based on more than two and up to all correlation values produced by the correlator 32 . it will be apparent to those skilled in the art that the disclosed subject matter may be modified in numerous ways and may assume embodiments other than the preferred forms specifically set out as described above , for example the decoding of channels other than hs - dsch and hs - scch could be performed and the decoding could be performed on data transmitted according to wireless communication standards other than 3gpp . | 7 |
a description of the two - mask igfet process follows . an igfet fabrication process with only two masking steps is achieved by using a first masking - etching step to simultaneously define gate , source and drain regions and a second masking - etching step merging the operations for opening of contact holes with the formation of an interconnection pattern . referring to fig1 a and 1b , a semiconductor substrate 1 is of a first conductivity type doping having at least one planar surface . the doping should be p type if n channel igfets are desired and conversely n type for p channel igfets . for illustrative purposes , the disclosure herein is directed towards fabricating n channel igfets ; however , it is recognized that the disclosed techniques can also be applied to the fabrication of p channel igfets . a suitable doping density for the substrate is 5 × 10 15 cm - 3 . a thick layer 2 of silicon oxide is grown on the surface of the semiconductor substrate to about 6500 angstroms by means of thermal oxidation or other methods well known in the art . a first mask is next used with conventional photolithographic and etching techniques to open windows 4 , 6 and 8 for the source , gate and drain regions , respectively . an alternative technique starts by successively forming layers of silicon oxide and nitride on the wafer . a first mask is then used such that subsequent etching leaves nitride portions wherever windows 4 , 6 and 8 are desired . these nitride portions function as oxidation masks which localize the growth of the thick oxide layer 2 to the field regions of the structure . with this alternative technique , the threshold voltage of the field region can be raised by a pre - oxidation blanket implant of p - type ions blocked out from gate , source and drain regions by the nitride layers . in either approach , these windows must expose the surface of the substrate 1 so that gate - quality thin oxide layers can be grown therein , with layer 10 eventually forming the gate structure and layers 12 and 14 covering the regions wherein source and drain regions are to be formed . in order to stabilize both thin and thick oxide , a thin layer of phosphosilicate glass ( psg ) is deposited during the growth of the thin oxide layer . a blanket ion - implant can be performed at this stage to adjust the threshold voltage associated with layer 10 . fig2 shows a layer of polysilicon 16 disposed over the entire surface . this layer does not have to be excessively thick or heavily doped since its sheet resistance will be lowered by the subsequent formation of a metal silicide layer . a thickness in the range from 2000 angstroms to 5000 angstroms suffices . thereafter , another layer 18 , suitable for a diffusion or ion - implantation mask , is deposited such as silicon nitride . clearly , the thickness of layer 18 depends on its use , masking ion - implantation calling for the largest thickness of about 2000 angstroms . both layers 16 and 18 can be deposited by a number of methods such as chemical vapor deposition , evaporation or sputtering which are well known in the art and a detailed discussion of which is not deemed necessary . the wafer is then ready for a second masking and associated etching operations . if conventional wet methods are used to etch the aforementioned layers 16 and 18 , an additional top - lying oxide layer to function as an etching mask during the stripping of nitride layer 18 is needed to avoid photoresist adhesion problems . these problems are eliminated if plasma or reactive ion etching methods are used . for convenience , these methods will be referred to as dry etching . this technique not only simplifies the process of etching nitride layer 18 and polysilicon layer 16 but also produces minimal undercutting . the latter feature is of interest to the disclosed invention to prevent the formation of voids when contacts are made to diffused regions by replacing the etched layers 12 and 14 with a silicide layer . thus , dry etching is preferably used after the second masking operation . the second masking produces a pattern on a top lying photoresist layer , not shown in fig3 a . the pattern is disposed over the field regions and extends over regions 4 , 6 and 8 which are completely encompassed if they are to become part of gate regions or partially overlapped if they are located over intended source and drain regions . with this photoresist pattern covering nitride layer 18 , the wafer is ready for placement in a vacuum chamber where a flourine based plasma etches both the nitride layer 18 and the polysilicon layer 16 . the remaining double - layered pattern is shown in fig3 a and 3b as forming gate electrode 20 and interconnections 22 and 24 . this pattern can be better appreciated by referring to fig3 c where for the sake of clarity the nitride layer 18 is not shown . the interconnection line 19 partially covers the thin oxide layer 11 , overlying a portion of the substrate wherein a drain region will be formed , and extends over the thick oxide layer 2 to form the gate electrode 20 of the two adjacent devices defined by gate regions 6 and 7 . the intersection of interconnection lines 22 and 24 with the thin oxide regions 12 and 14 respectively define windows 26 and 28 shown in fig3 b . doping impurities are subsequently deposited through windows 26 and 28 and silicide contacts are formed therein , afterwards . the unmasked thin oxide regions 30 and 32 are first stripped by dry etching if the doping impurities for the subsequent diffusion are deposited by thermal means . if they are ion - implanted , it is advantageous to keep layers 30 and 32 to minimize the occurrence of channeling . after deposition of n - type impurities , a drive - in cycle forms source regions 34 and 35 , drain regions 36 and 37 and crossunder 38 which are shown by fig4 a and 4b . crossunders such as 38 are formed by merging the nearest edges of at least two adjacent diffused regions . thus , crossunder 38 is formed by merging the nearest edges of the diffused source regions 34 and 35 . the availability of diffused crossunders enhances the wiring density of the top - lying interconnection grid by permitting the layout of lines along intercepting directions as illustrated by lines 19 and 22 of fig3 b and 3c . a crossunder must be long enough to accommodate about twice the minimum pitch used to layout minimum width polysilicon lines . this pitch is mainly determined by photolithographic resolution and etching tolerances . for a dry - etched 2 . 5 - micrometer - wide line such as 19 , the diffused regions 34 and 35 must be driven in to a depth between 5 and 6 micrometers to form crossunder 38 and overlap the nearest edges of the gate thin oxide region 10 . the first mask positions gate region 6 with respect to source and drain windows 4 and 8 and gate region 7 with respect to source and drain windows 3 and 9 so that a minimum overlap is obtained between layer 10 and regions 34 and 36 . the drive - in cycle is done in a nonoxidizing ambient to avoid growing a thick oxide layer on the exposed polysilicon sidewalls 40 and contact regions 26 and 28 . next , all of the remaining nitride layer 18 and doped glass and / or oxide layers covering contact windows 26 and 28 are respectively etched using warm phosphoric acid and reactive plasma . the wafer is now ready for deposition of a layer of silicide forming metal such as platinum , palladium or hafnium at least twice as thick as the thin oxide layers 12 and 14 . any one of the well known methods such as electron beam or filament evaporation can be used to deposit metal layer 42 as shown in fig5 which is then annealed sufficiently long at the temperature required to completely transform the original metal layer 42 into a stable platinum silicide layer 44 . as fig5 shows , since the metal layer 42 is thicker than the thin oxide layers 12 and 14 , a silicide layer 44 in fig6 is obtained which bridges the gap between the surface of the source - drain regions 34 and 36 and the polysilicon sidewalls 46 . formation of voids between silicide layer 44 and the thin oxide sidewalls 48 is prevented by using dry - etching techniques which produce little undercutting of the thin oxide layers 12 and 14 . preferred metals for layer 42 are platinum , palladium and hafnium since their reactions with silicon are self - limited to the exposed silicon surfaces , leaving unreacted the portion of the metal layer 42 covering exposed oxide surfaces 40 . a 1000 angstrom thick platinum layer requires annealing at 700 ° c . for 15 minutes to form a 2000 angstrom thick platinum silicide layer . the unreacted metal covering the thick oxide layer 2 is then removed by a maskless etch in hot aqua regia which does not attack oxide layer 2 or silicide layer 44 . the sheet resistance of the polysilicon lines is reduced down to the range between 1 and 4 ohms per square . the completed device structure with interconnections is shown in fig6 . the completed structure has self - alignment features which follow from using a single mask to simultaneously define more than one device region . the first mask defines regions for the gate 6 , source 4 and drain 8 , so that the thin oxide gate region 10 is self - aligned with respect to the windows for the source 26 and drain 28 and the respective diffused regions 34 and 36 deposited therethrough . however , since the gate electrode 20 is defined with the second mask , some area - consuming tolerance must be allowed in order to insure its alignment with respect to the gate thin oxide region 10 . interconnections 22 and 24 are self - aligned with respect to their corresponding contact windows 26 and 28 since they are all defined by the second mask . as explained in connection with fig4 b , the relative position between the windows for the gate 6 , source 4 and drain 8 , is determined by the length of the crossunder 38 which restricts the reduction in device area that can be realized through self - alignment . these restrictions can be removed by substituting crossunders with a second interconnection level to match and surpass the wiring density obtained with the former . to realize this interconnection enhancement , the process must be expanded by two masking operations and the metal silicide layer 44 must be stable under the hot processes conventionally used to deposit an intermediate insulating layer supporting the second interconnection level . one such method is chemical vapor deposition ( cvd ) which calls for temperatures between 750 ° and 800 ° c . in addition , this may be followed by a phosphosilicate glass ( psg ) deposition for oxide stabilization at temperatures between 750 ° and 900 ° c . hafnium and platinum silicide have been shown to be stable for annealing cycles at these temperatures . the structure of fig7 has been fabricated following the steps leading to fig6 except that merged diffusions have not been used to form crossunders . the process is then continued by forming a layer 50 of cvd oxide over the wafer and toped by psg . a third mask is used with conventional etching to open via holes 52 which expose the silicide layer 44 wherever it is to be contacted by the second interconnection level . next , a low temperature deposition is made to form an aluminum layer which comes into contact with silicide layer 44 through via holes 52 . a subetch operation then yields a second interconnection level pattern 54 . the process is completed with the usual aluminum annealing . the structure of fig7 possesses two features which promote the efficient use of wafer area . first , the absence of crossunders permits full utilization of self - alignment between source , gate and drain windows to reduce device area and second , the silicide layer 44 lowers the sheet resistance of polysilicon lines 16 by at least a decade so that first level interconnection lines can be made narrower than the plain polysilicon lines used by the prior art . these features can be employed by efforts directed toward reducing device size and interconnection linewidths ; goals which lead to both high circuit density and manufacturing yield . another approach to enhancing device and wiring density of the structure of fig6 is to use continuous diffused lines for a first interconnection level instead of crossunders . this approach requires modifications of the two - mask process revolving around the addition of one extra mask ; hence it is referred to as the three - mask process . the following description of the preferred embodiment primarily dwells upon the dissimilarities between the two processes . to emphasize their similarities the numeral designations are repeated except for distinguishing primes . the additional mask is used for a first masking - etching operation on the thick oxide layer 2 &# 39 ; which yields the structure of fig8 . this structure has windows 4 &# 39 ; and 8 &# 39 ; which define source and drain regions , as in fig1 . however , window 4 &# 39 ; defines in addition to a source , a first level interconnection pattern as will become apparent in fig1 . these windows expose the substrate 1 &# 39 ; for the deposition thereon of n - type impurities which are then thermally driven in to form source , drain and interconnection regions 34 &# 39 ;, 36 &# 39 ; and 37 , respectively . simultaneously with this drive - in cycle , the oxide is reformed in the openings 4 &# 39 ; and 8 &# 39 ; to obtain a planar surface as discussed by u . s . pat . no . 3 , 899 , 372 assigned to the same assignee as that of the present invention . next , a second masking operation is used in conjunction with conventional etching techniques to open the windows shown in fig9 which locate the gate region 6 &# 39 ; and contact windows 26 &# 39 ; and 28 &# 39 ; for the source and drain , respectively . in addition , a contact window 29 for the substrate 1 &# 39 ; can also be opened , an option not available with the two - mask process . in fig1 , layers of thin oxide 10 &# 39 ;, 12 &# 39 ;, 14 &# 39 ; and 15 are respectively grown in these openings followed by the deposition of polysilicon layer 16 &# 39 ; over the wafer . since all required diffused regions have already been formed , nitride layer 18 of the two - mask process can be dispensed with . at this stage of the process , the structure of fig1 is about equivalent to that of fig2 a for the two - mask process except for the absence of diffused regions in the latter . it follows then that the remaining process steps , leading to a second interconnection level consisting of polysilicon - silicide lines and gate electrodes , are the same as those used for the two - mask process . the completed structure is shown in fig1 . because of the additional masking step , the gate region 10 &# 39 ; is not self - aligned with respect to windows for the source 4 &# 39 ; and the drain 8 &# 39 ;, as in the two - mask case . however , self - alignment between the silicide - polysilicon lines and contact holes to the diffused drain region 36 &# 39 ; and interconnection level 37 is preserved . while the invention has been particularly shown and described with reference to the preferred embodiment thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details may be made therein without departing from the spirit and scope of the invention . | 7 |
fig1 and 2 are simulated electrocardiograms illustrating operation of the device as it operates to determine whether a pacing regimen is likely to successfully terminate a tachycardia . r - waves 10 and 12 , indicative of the ongoing tachycardia are separated by an interval t1 , corresponding to the rate of the detected tachycardia . a short series of anti - tachycardia pacing pulses 14 and 16 are delivered , separated by intervals t2 , which are determined as a function of the duration of intervals t1 separating preceding r - waves during the tachycardia . in order to determine whether a series of overdrive pacing pulses separated by intervals t2 is likely to be effective , the device waits after delivery of the second pulse 16 and measures the time t3 to the next spontaneous r - wave 18 . either immediately following spontaneous r - wave 18 , or following a short sequence of additional spontaneous r - waves 20 and 22 , the device delivers a second series of a greater number of anti - tachycardia pacing pulses 24 , 26 , 28 and 30 separated by intervals t2 . the device then suspends delivery of the anti - tachycardia pacing pulses and measures the return cycle t4 . depending upon the relationship of return cycle t4 and t3 , the device then either continues delivery of pacing pulses separated by intervals t2 or switches to different therapy . in particular , if return cycle t4 is not greater than return cycle t3 , by a pre - defined increment e . g . & gt ; 0 to 200 ms , a new anti - tachycardia pacing pulse regimen may be initiated preferably having an inter - pulse interval somewhat less than t2 . the new pacing therapy may be initiated immediately or following a few spontaneous depolarizations in order that the inter - depolarization intervals of the tachycardia can be re - measured . alternatively , charging of the high voltage output capacitors of the device may be initiated in order to allow delivery of a cardioversion shock . if the second return interval t4 is greater than return interval t3 by the defined increment , the device resumes delivery of anti - tachycardia pacing pulses separated by time intervals t2 . the device may then simply deliver the entire programmed number of anti - tachycardia pacing pulses for the pacing regimen . if the pacing regimen as programmed extends over or a relatively large number of pulses , the device may optionally measure the return cycle an additional time , repeating the process described above , prior to delivery of the entire programmed number of pacing pulses or initiating deliver of a new therapy . fig3 is a block , functional diagram of an illustrative embodiment of a cardioverter / pacemaker according to the present invention . as illustrated , the device is embodied as a microprocessor based stimulator . however , other digital circuitry embodiments and analog circuitry embodiments are also believed to be within the scope of the invention . for example , devices having general structures as illustrated in u . s . pat . no . 5 , 251 , 624 issued to bocek et al ., u . s . pat . no . 5 , 209 , 229 issued to gilli , u . s . pat . no . 4 , 407 , 288 , issued to langer et al , u . s . pat . no . 5 , 662 , 688 , issued to haefner et al ., u . s . pat . no . 5 , 855 , 893 , issued to olson et al ., u . s . pat . no . 4 , 821 , 723 , issued to baker et al . or u . s . pat . no . 4 , 967 , 747 , issued to carroll et al ., all incorporated herein by reference in their entireties may also be usefully employed in conjunction with the present invention . similarly , while the device of fig3 takes the form of a ventricular pacemaker / cardioverter , the present invention may also be usefully be employed in a device having atrial pacing and cardioversion capabilities . fig3 should thus be considered illustrative , rather than limiting with regard to the scope of the invention . the primary elements of the apparatus illustrated in fig3 are a microprocessor 100 , read only memory 102 , random access memory 104 , a digital controller 106 , input and output amplifiers 110 and 108 respectively , and a telemetry / programming unit 120 . read only memory stores the basic programming for the device , including the primary instruction set defining the computations performed to derive the various timing intervals employed by the cardioverter . random access memory 104 serves to store variable control parameters , such as programmed pacing rate , programmed cardioversion intervals , pulse widths , pulse amplitudes , and so forth which are programmed into the device by the physician . random access memory 104 also stores derived values , such as the stored time intervals separating tachyarrhythmia pulses and the corresponding high rate pacing interval . reading from random access memory 104 and read only memory 102 is controlled by rd line 146 . writing to random access memory 104 is controlled by wr line 148 . in response to a signal on rd line 146 , the contents of the random access memory 104 or read only memory 102 designated by the then present information on address bus 124 are placed on data bus 122 . similarly , in response to a signal on wr line 148 , information on data bus 122 is written into random access memory 104 at the address specified on the address bus 124 . controller 106 performs all of the basic control and timing functions of the device . controller 106 includes at least one programmable timing counter , initiated on ventricular contractions , and timing out intervals thereafter . this counter is used to generate the basic timing intervals referred to above and to measure intervals ending in intrinsic depolarizations . on time out of the pacing escape interval or in response to a determination that a cardioversion or defibrillation pulse is to be delivered , controller 106 triggers the appropriate output pulse from output stage 108 , as discussed below . following generation of stimulus pulses controller 106 generates corresponding interrupts on control bus 132 , waking microprocessor 100 from its sleep state , allowing it to perform any required mathematical calculations , including all operations associated with evaluation of return cycle times and selection of anti - tachyarrhythmia therapies according to the present invention . the timing counter in controller 106 also times out a ventricular refractory period , as discussed below . the time intervals which the timing counter in controller 106 counts prior to time - out are controlled via data from ram 104 , applied to the controller 106 via data bus 122 . controller 106 also generates wake - up interrupts for microprocessor 100 on the occurrence of sensed ventricular contractions . on occurrence of a sensed ventricular contraction , in addition to an interrupt indicating its occurrence placed on control bus 132 , the then current value of the timing counter within controller 106 is placed onto data bus 122 , for use by microprocessor 100 in determining whether a tachyarrhythmia is present and for determining the intervals separating individual tachyarrhythmia beats . output stage 108 contains a high output pulse generator capable of generating cardioversion pulses of at least 0 . 1 joules , to be applied to the patient &# 39 ; s heart via electrodes 134 and 136 , which are typically large surface area electrodes mounted on or in the heart or located subcutaneously . other electrode configurations may also be used , including three or more electrodes arranged within and around the heart . typically the high output pulse generator includes high voltage capacitor , a charging circuit and a set of switches to allow delivery of monophasic or biphasic cardioversion or defibrillation pulses to the electrodes employed . output circuit 108 also contains a pacing pulse generator circuit which is also coupled to electrodes 138 , 140 and 142 , which are employed to accomplish ventricular cardiac pacing by delivery of pulses between electrode 138 and one of electrodes 140 and 142 . electrode 138 is typically located on the distal end of an endocardial lead , and is typically placed in the apex of the right ventricle . electrode 140 is typically an indifferent electrode mounted on or adjacent to the housing of the cardioverter defibrillator . electrode 142 may be a ring electrode located on an endocardial lead , located slightly proximal to the tip electrode 138 , or it may be a far field electrode , spaced from the heart . output circuit 108 is controlled by control bus 126 , which allows the controller 106 to determine the time , amplitude and pulse width of the pulse to be delivered and to determine which electrode pair will be employed to deliver the pulse . sensing of ventricular depolarizations is accomplished by input amplifier 110 , which is coupled to electrode 138 and one of electrodes 140 and 142 . signals indicating both the occurrence of natural ventricular contractions and paced ventricular contractions are provided to the controller 106 via bus 128 . controller 106 passes data indicative of the occurrence of such ventricular contractions to microprocessor 100 via control bus 132 in the form of interrupts , which serve to wake up microprocessor 100 , so that it may perform any necessary calculations or updating of values stored in random access memory 104 . optionally included in the device is a physiologic sensor 148 , which may be any of the various known sensors for use in conjunction with implantable stimulators . for example , sensor 148 may be a hemodynamic sensor such as an impedance sensor as disclosed in u . s . pat . no . 4 , 865 , 036 , issued to chirife or a pressure sensor as disclosed in u . s . pat . no . 5 , 330 , 505 , issued to cohen , both of which patents are incorporated herein by reference in their entireties . alternatively , sensor 148 may be a sensor of demand for cardiac output such as an oxygen saturation sensor as disclosed in u . s . pat . no . 5 , 176 , 137 , issued to erickson et al . or a physical activity sensor as disclosed in u . s . pat . no . 4 , 428 , 378 , issued to anderson et al ., both of which patents are incorporated herein by reference in their entireties . sensor processing circuitry 146 transforms the sensor output into digitized values for use in conjunction with detection and treatment of arrhythmias . external control of the implanted cardioverter / defibrillator is accomplished via telemetry / control block 120 which allows communication between the implanted cardioverter / pacemaker and an external programmer . any conventional programming / telemetry circuitry is believed workable in the context of the present invention . information entering the cardioverter / pacemaker from the programmer is passed to controller 106 via bus 130 . similarly , information from the cardioverter / pacemaker is provided to the telemetry block 120 via bus 130 . fig4 a and 4b are functional flow charts illustrating the operation of the device shown in fig3 . these flow charts are intended to illustrate the functional operation of the device , and should not be construed as reflective of a specific form of software or hardware necessary to practice the invention . it is believed that the particular form of software will be determined primarily by the particular system architecture employed in the device and by the particular detection and therapy delivery methodologies employed by the device , and that providing software to accomplish the present invention in the context of any modern implantable anti - tachycardia pacemaker or implantable pacemaker / cardioverter , given the disclosure herein , is well within the abilities of one of skill in the art . fig4 a is a functional flow chart illustrating the over - all operation of the device in conjunction with practicing the present invention . at 200 , the device detects the occurrence of a tachycardia and it determines the first inter - pulse interval t2 for the first scheduled anti - tachycardia pacing regimen . this interval may be a percentage of the average interval separating the spontaneous depolarizations during detected tachyarrhythmia , e . g . about 90 %. the device then delivers a sequence of n pulses at 204 , where the value of n may be , for example , two to four pulses . at 206 , after delivery of the nth pulse , the return cycle is measured . while it is not believed likely that the tachycardia has terminated , the device nonetheless checks at 208 to determine if it has terminated . detection of termination of the tachycardia may occur , for example in response to a measured return cycle of greater than a defined duration or in response to a measured return cycle of greater than a defined duration followed by one or more spontaneous r - waves separated by intervals greater than the defined duration . if the tachycardia has terminated , the device returns to normal operation . if the return interval is not indicative of termination of tachycardia , the device delivers a sequence of n + x pulses at 212 , where x is typically 1 to 3 . the device checks again at 214 to determine whether the tachycardia has terminated . if not , the device compares the measured return cycle to the previously measured return cycle . in the event that the return cycle has increased or increased by more than a preset increment , for example 0 to 200 milliseconds , the device delivers the entire series of pulses programmed for the pulse regimen at 222 . if the device then detects termination of the tachycardia at 224 , the device returns to normal operation at 228 . if termination is not detected at 224 , the device schedules the next available therapy , which may be a new pacing regimen or a cardioversion pulse and returns to normal operation at 228 to await re - detection of the tachycardia or detection of termination of the tachycardia . in the event that following delivery of the series of n + x pulses , an increased return cycle is not detected at 216 , the device checks at 218 to determine whether a delivery of a subsequent series of anti - tachycardia pacing pulses is consistent with the programming . additionally or alternatively , if the device includes a hemodynamic sensor , delivery of a subsequent set of anti - tachycardia pacing pulses may be prevented in response to detection of hemodynamic compromise . if a subsequent series of pacing pulses is not to be delivered , a cardioversion shock or other therapy may be scheduled at 226 . if the device programming and / or the hemodynamic sensor allows , however , the device may proceed directly to deliver pacing pulses according to the next scheduled pacing pulse regimen , having modified pulse parameters , in this case an reduced inter - pulse interval as defined at 220 . the device may either simply deliver the entire series of pacing pulses as programmed for the next scheduled pacing regimen or , as illustrated , may attempt to determine whether pacing pulses according to the new regimen are likely to terminate the tachycardia as a prerequisite to delivery of the entire pacing regimen . fig4 b illustrates alternative methods of operation according to the present invention . in a first alternative , following a determination that the required increase in return cycle did not occur at 216 ( fig4 a ), the device delivers a series of n + y pulses at 230 , where y has a value greater than x , and checks for termination of the tachycardia at 232 , returning to normal operation at 228 ( fig4 a ). if the tachycardia has not terminated , the device checks at 234 to determine whether the required increase in return cycle length has occurred . if so , the device delivers the entire pacing regimen at 222 ( fig4 a ). if not , the device will check at 218 ( fig4 a ) to determine whether a subsequent pacing regimen is to be delivered . in a second alternative embodiment , the step of delivering n + y pacing pulses at 230 may occur following a determination that the required increase in return cycle did occur at 216 ( fig4 a ). | 0 |
while the description sets forth various embodiment specific details , it will be appreciated that the description is illustrative only and should not be construed in any way as limiting the invention . furthermore , various applications of the invention , and modifications thereto , which may be apparent to those who are skilled in the art , are also encompassed by the general concepts described herein . for example , any of the structures in the devices illustrated or described in the patent documents incorporated herein by reference may be combined with or used instead of the structures disclosed herein . fig1 illustrates a male luer connector 10 with a luer end 12 and a luer lock 14 approaching a female connector 16 . the female connector 16 has a proximal end 18 , a distal end 20 , with a male luer 22 on its distal end . the distal end 20 may further include a luer lock . the female connector 16 includes a housing 24 . fig2 illustrates a perspective view of the female connector 16 . the proximal end 48 of a flexible element 26 is illustrated . the flexible element 26 may include an orifice 27 that is normally closed until a distally directed force is applied to flexible element 26 . fig3 illustrates a perspective view of the connector 16 in which the male luer 22 on the distal end 20 of the connector is visible . fig4 is an exploded perspective view of the connector 16 of fig2 . some of the internal components of connector 16 are illustrated , such as flexible element 26 and rigid element 28 . in some embodiments of the assembled configuration , an inner rigid element 30 is provided and can fit within a cavity 32 inside of flexible element 26 . orifice 27 is shown closed in this exploded perspective view . in some embodiments , orifice 27 is open when flexible element 26 is separate from housing 24 . in some embodiments , contact between the inner cavity of the housing 24 and portions of the proximal end 48 of flexible element 26 upon insertion of flexible element 26 into housing 24 may cooperate to substantially close orifice 27 such that the fluid flow path through connector 16 is impeded . fig5 illustrates a perspective view of rigid element 28 having a proximal end 31 and a distal end 33 . distal end 33 may include radially projecting elements 35 . radial elements 35 interact with corresponding features in the internal wall of housing 24 to secure rigid element 28 within housing 24 upon assembly of the connector 16 . radial elements 35 extending along the longitudinal axis of connector 16 may interact with housing 24 to inhibit rotation of rigid element 28 inside of housing 24 when connector 16 is manipulated , for example when a female connector is attached to the distal end 20 of connector 16 . in some embodiments , inner rigid element 30 has multiple openings . for example , openings 34 can be used to permit fluid to flow into an internal passage or fluid - flow path 36 inside of inner rigid element 30 . in some embodiments , two openings 34 are disposed on opposite sides of inner rigid element 30 . additional openings similar to opening 34 can also be provided . in some embodiments , an opening can be provided at the proximal end 31 of inner rigid element 30 . in some embodiments , one or more of openings 34 and 38 are combined ( i . e ., the same openings ( s ) are configured to receive fluid and to receive one or more protrusions 52 ( see fig7 a ). inner rigid element 30 may be blunt , pointed , opened - ended , closed - ended , or shorter or longer , or wider or narrower than shown here . inner rigid element 30 may have many different shapes . for example , it may be configured as a tube - like structure as shown , configured as a sleeve with one or more longitudinal openings or slits extending partially along the length of the sleeve or along the entire length of the sleeve , or the inner rigid element 30 may be eliminated entirely . inner rigid element 30 may be in a fixed position inside of the housing 24 or it may be moveable or floating inside of the housing 24 . in the absence of inner rigid element 30 , one or more fluid openings may be provided at or near a distal region of the cavity inside the housing to convey fluid within the housing cavity to the male end of the connector . in some embodiments , one or more openings 38 are provided in inner rigid element 30 , and may be located in a direction distal from opening 34 . as will be described below , in some embodiments , opening 38 is intended to receive a protrusion on an internal surface of flexible element 26 when the connector 16 is in the closed configuration ( see fig8 a ). in some embodiments , opening 38 is adapted to receive fluid flow . where opening 38 is used to facilitate fluid flow through inner rigid element 30 , opening 34 may or may not be included . fig6 a and 6b illustrate orthogonal cross - sections of rigid element 28 taken in a vertical plane . in some embodiments , as illustrated , the proximal edges 40 , 42 of openings 34 , 38 can be flat and substantially horizontal , and the distal edges 44 , 46 of openings 34 , 38 can be slanted or beveled . as illustrated , the fluid - flow path 36 may extend from the proximal end of the inner rigid element 30 along a generally axially - oriented linear path to the male end 22 . in some embodiments , as illustrated , the fluid - flow path 36 in the distal region of the inner rigid element 30 is generally non - tortuous ; for example , the fluid - flow path 36 may not turn in a direction that is perpendicular to or substantially non - parallel with the axis of the inner rigid element 30 , and / or it may not include fluid - exiting side openings in the distal region of the inner rigid element 30 . such a fluid - flow path may provide a higher fluid flow rate and create less turbulence in the fluid flow ( which can be especially advantageous when the fluid includes blood cells ). fig7 a and 7b illustrate orthogonal cross - sections of flexible element 26 taken in a vertical plane . flexible element 26 can be longitudinally compressed and / or moved by a force applied to the proximal end 48 toward the distal end 50 . a plurality of inwardly projecting elements 52 are provided in an internal cavity 32 of flexible element 26 . in some embodiments , there is one such protrusion 52 . in the illustrated embodiment , there are two protrusions 52 . in some embodiments , there can be multiple openings 38 , some of which can be positioned along different regions of inner rigid element 30 , and there can be additional corresponding protrusions 52 that can be designed to selectively fit within or be withdrawn from one or more openings 38 . in some embodiments , as shown , the internal edges or faces 53 of the opposing protrusions 52 can be positioned and oriented to contact each other and / or be close to each other when the connector 16 is in a substantially closed position . the protrusions 52 can extend into the inner rigid element 30 at an intermediate position within the fluid - flow path 36 of the inner rigid element 30 . in some embodiments , the wall of the inner rigid element 30 is not positioned between the opposing edges or faces 53 of the protrusions 52 in the substantially opened position . openings 38 can have a variety of different shapes and sizes . for example , one or more of openings 38 can be round , square , rectangular , trapezoidal , elliptical , etc . opening 38 can be larger than opening 34 . in some embodiments , opening 38 can be approximately at least one - fifth , one - quarter , one - third , one - half , or more of the length of inner rigid element 30 . protrusions 52 can also have a variety of different shapes and sizes , which may correspond to or be different from the shapes and / or sizes of openings 38 . as shown , the protrusions 52 can be substantially planar . in some embodiments , the volume of the one or more protrusions 52 can be approximately equivalent to or greater than the volume in the proximal region of the connector adapted to receive the luer 12 . in some embodiments , upper or proximal edges 54 of protrusions 52 can be slanted and / or beveled . similarly , lower or distal edges 56 of protrusions 52 can be also slanted and / or beveled . slanting or beveling these surfaces may facilitate fluid flow through the connector 16 and may minimize turbulence in the fluid flow . in general , the shape , materials , and structure of rigid element 28 and flexible element 26 can be selected to allow protrusions 52 to be positioned within openings 38 when the connector is closed , and protrusions 52 can be completely or partially withdrawn from openings 38 when the connector is opened . when the connector 16 is in the substantially closed position , the inward protrusions 52 function so as to reduce the fluid space within the connector 16 and the fluid flow path as compared to when the connector 16 is in the substantially open position . in some embodiments , flexible element 26 can be made of silicon , and the remaining components of connector 16 can be made of a polymer material such as polycarbonate . a proximal region 58 of flexible element 26 can include a portion with an increased wall thickness or a structure ( or materials of composition ) that contribute to the proximal region 58 being stiffer or harder than the portion of the flexible element 26 that flexes during compression . by providing increased stiffness or hardness for the proximal region 58 , there is a lower likelihood that fluid within the valve will be forced back into the fluid path 32 inside of flexible element 26 as flexible element 26 expands to its original height when the valve is closed . moreover , in some embodiments , a proximal portion 60 of fluid pathway 32 inside the flexible element 26 has a horizontal cross - sectional area that is substantially less than the horizontal cross - sectional area of a region in the fluid path 36 of element 28 , so that fluid flow out of the distal end of the connector is encouraged and retrograde fluid flow toward the proximal end of the connector is discouraged . in some embodiments , orifice 27 extends along an axis substantially perpendicular to inward projections 52 , as shown in fig7 a . in other embodiments , orifice 27 extends along substantially the same plane as projections 52 . as shown in fig7 a and b , proximal portion 60 may include a non - rotationally symmetrical cross - sectional diameter . in some embodiments , the proximal portion 60 has smaller cross - sectional diameter in the plane perpendicular to orifice 27 and a larger cross - sectional diameter in the plane of orifice 27 . in some embodiments , portions of proximal portion 60 have a substantially rectangular cross - sectional area . fig8 a illustrates a vertical cross - section of the male luer 10 and female connector 16 illustrated in fig1 . in fig8 a and 8b , a portion of rigid element 28 is positioned within the internal cavity 32 of flexible element 26 . inward protrusions 52 are positioned within openings 38 , and more particularly , in the fluid flow path through connector 16 . fluid flow within connector 16 is substantially occluded . the proximal end 48 of flexible element 26 may be swabbable with antiseptic in a sweeping motion across the proximal end 18 of the connector 16 , and the proximal end 48 may extend above the housing , may be substantially flush with the housing , or may be recessed within the housing . fig9 a and 9b illustrate an embodiment of the female connector 16 after it is connected to the male luer connector 10 in orthogonal vertical cross - sections . in some embodiments , flexible element 26 can be compressed and / or moved by a distally directed force applied by the male luer 12 . as shown , a portion of inner rigid element 30 can extend in a proximal direction beyond orifice 27 during compression . in some embodiments , inner rigid element 30 does not extend further in a proximal direction than the proximal end 48 of the flexible element 26 when compressed . in some embodiments , orifice 27 may automatically open to allow fluid flow through the connector 16 upon insertion of the male luer connector 10 into connector 16 . in fig9 a and 9b , the medical connector 16 is substantially open to fluid flow between the male luer 10 and the distal end 20 of the female connector 16 . as shown in fig9 a , the protrusions 52 can be partially or completely withdrawn from the openings 38 so that the volume inside of the fluid path 36 during the open stage of the connector 16 is substantially larger than the fluid volume inside of the fluid path 36 when the connector 16 is closed ( see , e . g ., fig8 a ). this can diminish , or eliminate , retrograde fluid flow from the patient toward the proximal end 18 of the connector 16 , or even produce a positive flow of fluid upon closure in the direction of the distal end 20 of the connector 16 and toward the patient . in some embodiments , proximal region 58 resists compression to a greater extent than a region on flexible element 26 positioned distal from the region 58 during the insertion of the mail luer connector 10 into the female connector 16 . proximal region 58 can substantially maintain its height , before and after compression and / or movement , as fluid flow is enabled through the connector 16 , which may reduce any vacuum effect in this portion of flexible element 26 . the foregoing description is provided to illustrate certain examples . the inventive concepts , principles , structures , steps , and methods disclosed herein can be applied to the devices and methods disclosed in the attached patents and in many other types of medical connectors . | 0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.