text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
referring now to the figures of the drawing in detail and first , particularly , to fig1 thereof , there is shown a construction 1 in which a first structure 4 and a second structure 5 , as they are represented for example in fig2 to fig6 , are to be sensed . positional information , i . e . a relative position between the first structure 4 and the second structure 5 , can be sensed by a position sensing device 2 . the positional information is stored in a position storing device or memory 3 and the position sensing device 2 can compare the stored positional information with the actually occurring positional information of the construction 1 in a comparison device 7 and the position sensing device 2 emits a corresponding signal s . in fig2 , there is provided a first layer 10 , in which a metallic contact 4 is provided as the first structure 4 . adjacent to this is a second layer 20 , in which a second metallic contact 5 is provided as the second structure 5 . the two contacts 4 , 5 butt against each other at the boundary layer . the contacts 4 , 5 may be two metallization levels of an electronic component or else contact areas of two components resting one on top of the other with their surfaces against each other . the position sensing device 2 is then capable of establishing by a resistance measurement the degree of overlap and consequently an item of positional information of the configuration . as revealed by fig3 , in that the configuration according to fig2 , is represented in a plan view , this may contain a displacement in two directions , which is a first displacement v 1 and a second displacement v 2 . in the case of a configuration of this type , it is admittedly difficult to ascertain the positional information by a resistance measurement . for this , it would be necessary to perform what are known as four - point measurements . the acquisition of positional information is made easier with the configuration according to fig4 . here , a multiplicity of first contacts 4 are provided , making contact with the second contact 5 of a larger surface area . by determining which of the first contacts 4 are touching the second contact 5 , the positional information can be obtained . similar in principle is the acquisition of the positional information with the configuration according to fig5 . here , the first contacts 4 are made to be of a size similar to that of the second contacts 5 . however , a different spacing is provided between the first contacts 4 and the second contacts 5 . consequently , when there is a misalignment of the first layer 10 with respect to the second layer 20 , it follows that the misalignment can be established by determining the contacts that are touching , in a way similar to a vernier . in fig6 , a second exemplary embodiment is represented . in this case , two transistors lying one behind the other of an eeprom cell 6 are represented by way of example . in a way corresponding to the previous exemplary embodiments , here the second structure 5 is provided , and functions as a gate 5 of a first transistor . for the generally known function of a transistor in an eeprom cell , what is known as a โ buried channel โ 4 is provided . for the functioning mode of the transistor it is envisaged that the buried channel 4 is disposed at the position indicated by dashed lines , so that a gate length l is formed . minimal inaccuracies in production can give rise to an offset ฮดl from its predetermined position to the left or right . this consequently gives an effective gate length e where e = l + ฮดl or e = l โ ฮดl . the effective gate length e can be measured and can be monitored for individual transistors . the operating mode of the individual configurations explained above is explained below . when the configuration is put into operation for the first time , the position sensing device 2 establishes the relative position between the first structure 4 and the second structure 5 . in this case , it is immaterial whether a resistance measurement , the sensing of individual contacts or the determination of an effective gate length is involved . the positional information consequently sensed is stored a single time in the position storing devices 3 . during the operation of the individual configuration it is checked whether the stored information coincides with the actual configuration . this can take place by the position sensing device 2 ascertaining the relative position between the first structure 4 and the second structure 5 each time the individual configuration is once again put into operation , and comparing it with the positional information stored in the position storing device 3 . if the two coincide , it may be provided for example that the signal s indicating that no manipulations have been performed on the configuration is emitted . alternatively , it may be provided that , if they do not coincide , a signal indicating the manipulation on the configuration is emitted . furthermore , it is also conceivable to dispense with the position storing device 3 . in such a case , the individual positional information would have to be stored by an external device when the individual configuration is put into operation for the first time and this information would have to be called up as soon as the configuration is operated once again . it can be easily appreciated that many further configurations that are not represented here but correspond to the idea of the present invention are conceivable . it has been found that the structures described yield accuracies for sensing the position in the ฮผm to sub - ฮผm range , depending on the extent of the structures involved . it is also possible to combine a number of structures , so that for example a coarse vernier and a fine vernier are provided . when a structure is removed , it is not possible to recreate the exact position . | 1 |
the present invention provides for the fusion of ct or mr images and ultrasound images . thus , biopsies , ablations or other procedures may be performed using an ultra sound device and benefiting from previously acquired ct or mr images . moreover , according to one embodiment a physician uses a tablet device such as an apple ยฎ ipad ยฎ to manually register ultrasound images to ct or mr images and may use such a device during a medical procedure . the manual registration process may be performed in a simple and intuitive manner . fig1 illustrates one example of a system . as shown in fig1 , a system 10 includes image software 12 which may be executed on a computing device 14 . the image software 12 may be used with images which are stored on media 14 . the media 14 may be any type of non - transitory machine readable storage medium such as solid state memory , magnetic memory , optical memory or otherwise . the image software 12 may also be used with images which are accessed from an image server . the image software may be an image processing application such as osirix or other application which may read imagery from medical equipment . one common format for such imagery is the dicom format . in one embodiment , the image software 12 is executed on a computing device and then selected images may be communicated to a tablet 20 or other computing device . it is contemplated that the image software 12 could also execute directly on the tablet 20 . as will be explained in further detail later herein , imagery used for fusion purposes ( such as ct or mr images ) may be loaded onto the tablet 20 . the tablet 20 may also be operatively connected to an ultrasound system . this may be a wired or wireless connection such as through a usb or network connection . in addition , the tablet may be mounted to the ultrasound system for convenience . the tablet is configured to display in real - time ultrasound imagery from the ultrasound system 22 . the ultrasound system 22 includes a probe 24 . in one example , ct scan images may be loaded onto the tablet device . in addition , ultrasound images may be acquired using the ultrasound system for image registration with the ct scan images . fig2 illustrates selection of a ct scan image as a part of a manual image registration process . as shown in fig2 , a series of ct scans are shown in a bottom row . a physician may select one of these images . as shown in fig3 , once one of the ct scan images is selected , a physician may select a corresponding ultrasound image . the physician may scroll through various images to select the corresponding ultrasound image . this process may be repeated multiple times . fig4 illustrates an example of another step in a manual image registration process . as shown in fig4 , a physician may trace the contour or boundaries of an organ , in this instance , a kidney . where a touchscreen display is used , a physician may simply trace the contour on the screen with their finger , although it is contemplated that digitizing tablets , mice , trackballs , joysticks , or other types of input devices may be used instead . alternatively , instead of having an operator draw the complete contour , the operator may select points instead associated with the organ and these points may be used to identify the organ and / or to draw the contour . fig5 illustrates an example of another step in the manual image registration process . as shown in fig5 , a physician may trace the contour of a region of interest ( such as a tumor or lesion ) in a manner similar to tracing the organ . similarly , the operator may select points associated with the region of interested ( such as a targeted tumor or lesion ). fig6 illustrates a real - time display of ultrasound imagery and corresponding ct scan imagery . as shown in fig6 real - time renal ultrasound imagery is shown which is registered to renal ct scan images . in real - time as the ultrasound imagery is updated the corresponding ct image may be updated accordingly so that the operator is always viewing the most relevant ct scan . a number of different algorithms may be used for this process . these include merely identifying which of the ultrasound images used for registration is closest to the currently displayed ultrasound image and then displaying the ct scan which corresponds to the ultrasound images used for registration . feature extraction of the organ or the region of interest may be performed to assist in this process . however , due to the manual registration process , the process is simplified relative to some type of process that attempts to perform automatic image registration . due to the manual image registration process the angle of the ultrasound probe should remain consistent in order to obtain the best alignment . fig7 illustrates an alert which may be provided during operation to indicate that the probe angle should be adjusted for best alignment . the alert may be provided various ways including visually and our audibly . fig8 illustrates that the user interface may provide for allowing a physician to re - register images at any time . if the software application has difficulty recognizing the ultrasound image ( due to suboptimal image quality for example ) which corresponds to the ct image or if the ultrasound operator becomes disoriented either to the position of the ultrasound probe on the patient &# 39 ; s body or the angle of the probe , the operator may scroll through the ct scan images quickly to locate the desired ct image slice to reorient himself . this will then bring up the contour image of the initial ultrasound image used for registration and the region of interest ( roi )/ targeted lesion . the operator may then adjust angle and position of the ultrasound to probe to match the landmarks marked at the beginning of the session . so during the actual procedure the ultrasound will be live and the ct images can be scrolled to change the contour / target . fig9 illustrates another example of a real - time display in which the contour of the kidney is shown . it is contemplated that it in some instances it may be helpful to overlay the contour of the organ or region of interest over the ultrasound imagery . fig1 illustrates a flow diagram of one example of a methodology for ultrasound and mr or ct fusion . a process 50 is shown . in step 52 , ct or mr images are obtained . in step 54 , ultra sound images are obtained . in step 56 the images are loaded onto a tablet device . in step 58 a manual image registration process is used . then in step 60 a ct scan image or mr image corresponding with real - time ultrasound imagery is displayed . in addition to using images associated with ct or mr , it is also contemplated that three - dimensional ( 3d ) models may also be used . 3d models may be created from dicom images or other types of images or image data . where 3d models are used , a 3d model may be displayed to the user and the user may select a cross - section of the 3d model to be used for registration processes . during operation , if an alignment issue is determined either manually by the user or automatically by the software the user may be given an opportunity to either adjust their probe or else choose a different cross - section of the 3d model to align with the ultrasound imagery . fig1 illustrates another example of a method which may be used . in the method of fig1 , 3d models are used . in step 72 , a 3d model or 3d rendering is obtained . the 3d model may be based on ct images or mr images or other acquired imagery . a 3d modeling or rendering program such as is known in the art may be used to generate the 3d model or rendering . in step 74 a physician may outline the organ and the region of interest on the 3d rendering . for example , the organ may be a kidney and the region of interest may be a lesion to be biopsied or treated . note that the physician may be given control of the 3d rendering to rotate , resize , or provide other functionality . in step 76 , the 3d rendering is de - segmented or otherwise processed to provide a set of slices but maintaining the outline or tracing made by the physician . although the size of the set of slices may vary , 30 or 40 slices provides a reasonable number . this outline or tracing may form an overlay which overlays the various images . next in step 78 the ultrasound images are acquired . in step 80 , the ct / mri slices may be synchronized with the ultrasound . note that the angle of insonation may be matched as a part of the synchronization process . in step 82 , the physician may outline the organ and region of interest on the ultrasound images . in step 84 , the physician may adjust image sizes ( s ) and manually register the ultrasound images to the ct or mr images . once the images are registered , it is contemplated that where a tablet device is used , it may be placed in a sterile bag such as is already commercially available . at this point , the live ultrasound may be performed to locate the mass for biopsy or treatment . once the optimal view for needle placement had been obtained , the operator may swipe the screen of the tablet device to select the appropriate overlay which best matches the live image . the operator may then hit a โ toggle โ button ( either a soft button or physical button ) on the tablet and bring up the corresponding ct or mr image . scrolling up frame by frame through the ct or mr images may be performed by adjusting the ultrasound probe slightly to move it cepahald or caudad ( toward the head or feet ) on the patient &# 39 ; s skin and pushing a โ button โ ( which may be a soft button or physical button ) to advance step by step ( level by level ) through the previously acquired ultrasound overlays and hitting a button to confirm the correct overlay . the corresponding ct or mr image may then be brought up on the tablet screen . a virtual needle may then be brought up on the ct or mr image which is adjustable by the operator to obtain the appropriate angle and depth . the needle trajectory visual guide or โ raster โ ( such as a dotted line ) may be selected to be displayed on the ultrasound overlay . the operator may then toggle between the ct or mr image and the ultrasound image with the raster or a split screen . optimally , the raster may be exported to the ultrasound machine as well and displayed on the ultrasound machine viewing screen , that way the operator would have a larger image of the ct or mr image on the tablet and the large ultrasound machine viewing screen to visualize all structures clearly . although various examples are described herein , it is to be understood that the present invention contemplates numerous options , variations , and alternatives . for example , detailed examples have been provided where the organ is a kidney and the region of interest contains a lesion . it is to be understood that this is merely one application . the kidney has a relatively simple shape structure with soft tissue tumors which can be biopsied or ablated ( such as through thermal ablation ). however , the system may be used for other organs . for example , in general surgery application , the present invention may be used in the biopsy and ablation of liver tumors , the biopsy and ablation of retroperitoneal tumors , the drainage of abdominal and retro peritoneal abscess , the drainage of biliary obstruction , the biopsy , needle localization , and cryoablation of breast cancer . other examples where the present invention may be used include in gynecology such as in the drainage of pelvic abscess and ovarian cysts . in addition , it is to be understood that various types of imagery may be used including ct imagery and mr imagery . it is to be further understood that 3d models may be generated from the ct imagery or the mr imagery and the 3d models may be used such that the ultrasound imagery is registered with the 3d model data . it is further to be understood that variations in the placement and relative placement of images being registered is contemplated . for example ultrasound images may be positioned above the mr / ct images or below the mr / ct images and the orientation of the images may be rotated based on the particular type of surgery being performed in order to provide the most convenient and intuitive view to the physician . | 0 |
the present disclosure is directed towards various embodiments of a message box , as well as features and aspects thereof , which can be used , among other uses , to present advertising to customers at drive - thru commercial establishments . the present detailed description is of the best currently contemplated modes of carrying out exemplary embodiments of the message box . it should be appreciated that the present description of the various embodiments , features and aspects of the message box is not to be taken in a limiting sense , but rather , is made merely for the purpose of illustrating the general principles of the various embodiments . in general , various embodiments provide a flashing message box adapted for use in presenting an advertisement to customers at drive - thru commercial establishments . the following elements are presented in the attached drawings and are defined more fully within the detailed description : 10 : is the overall environment and deployment of an embodiment of the message box . fig1 is a perspective view of a suitable environment for various embodiments of the message box . as illustrated , the message box 10 can be incorporated into a drive - thru menu screen or display 32 . embodiments of the message box comprise an led light source 12 or similar light source ; a graphic lens 16 that holds a message ; and a box enclosure 20 that contains the light source and lens . in exemplary embodiments ( fig2 , 3 ) the message box further comprises a light diffuser lens 14 that enhances the display of the graphic lens 16 , and a means to mount the box enclosure 20 in the selected site , for example , the menu board and ordering station 32 in a drive - thru restaurant 30 . the message box device 10 may also comprise a photocell or photo - sensor flasher circuit , which would control the led light source . for instance , the photocell may be interfaced to a controller or circuit such that depending on the readings from the photocell , the light source can be controlled . non - limiting examples of such control may include dimming the lights when the ambient light is low , brightening the lights when the ambient light is high ( i . e ., changing the light source inversely proportionate to the ambient light intensity around the box ), flashing the lights at different rates based on fluctuations in the ambient light , etc . the led light engine 12 ( fig7 ) can have a single led or rows of leds . led &# 39 ; s could be red or white / clear in color . alternatively , the light engine could be an lcd backlight source . the light engine is connected to a power source and , where necessary , a transformer . a programmable photocell flasher circuit controls the operation of the led light engine or similar light source . when used in outdoor locations , the led light engine 12 is weather resistant and is equipped with a damp location power supply . the photocell flasher circuit can be designed for incorporation into the pcb ( printed circuit board ) of the light engine . alternatively , it is incorporated into its own module wherein the photocell is placed on its own pcb and mounted separately at an opening 38 in the box enclosure 20 ( fig6 ) provided for that purpose . the photocell flasher circuit provides a programmable flash rate to the led light engine 12 as well as providing dimming capability of the light source . the flash rate can be selected . in an exemplary embodiment , the flash rate is a tested rate of 1 second on and 1 second off . the flash rate preferably alternates 3 times and pauses for 2 . 5 to 3 seconds . after the pause , then the flashing can resume or repeat for another cycle . if used in an outdoors installation , the photocell portion of the circuit provides that the light source is bright enough for excellent viewing of the message on the message panel 16 during daylight hours and dims for excellent viewing during night time hours . the ability to dim and brighten is also useful in inside installations where the ambient lighting conditions are variable . the photocell flasher circuit could have many variations to the design , as it is an electronic circuit . the most important functions are the programmable flash rate and the ability to dim and brighten the light engine for various ambient lighting conditions . the graphic lens 16 is a piece of anti - glare plastic , which holds and displays the message . the message is applied by a vinyl sticker application , a direct printing process , or alternatively , the graphic lens can sandwich the message between two graphic lenses . the graphic lens 16 has notches on the bottom of the panel that allow any flat object , such as a key or screwdriver to remove the lens for replacement . the preferred thickness of the graphic lens is from about 3 / 16 to 1 / 16 inches ; however the preferred size would be โ
inch . the graphic lens could be thinner or thicker depending on the various applications . full color graphics could also be applied to this design . various embodiments of the message box may also comprise a light diffuser lens 14 to provide maximum light diffusion to maximize the full graphic lens area . the diffuser lens is placed strategically in front of the light source for the optimum viewing of the message on the graphic lens 16 . depending on 20 the characteristics of the light engine , it would be possible to eliminate the diffuser and reduce costs . the components of the flashing message display are housed in a box enclosure 20 that has a number of specialized features . it has a small compact overall design that allows it to fit in existing drive - thru applications 28 and menu board systems 32 . graphic panel dimple stops 40 are illustrated on the two top edges and two bottom edges of the box 20 to hold the graphic panel 16 in place . these stops are rounded for easy movement of the graphic panel over them , and the box is designed to open up or stretch so that the graphic lens panel 16 can move over the dimple stops more easily . for instance , in one embodiment the box is designed to open in a jaw - like manner such that the lower or bottom edge gives more when pressure is applied during the insertion or removal of the lens panel 16 . to create this feature , the box may include a mechanical element that allows the jaw to open or , it may be manufactured to have some ability to be deformed , either by choice in material , structure design ( i . e ., thin material , slotted , etc ) or a combination of both . for instance , if slots are cut or included in the surface of the box , then flanges that can be forced out are created . in any of the variety of such embodiments , when pressure is applied to the box , such as when the lens 16 is being inserted , then the box slightly deforms to facilitate insertion of the lens 16 . when the pressure is then subsequently removed , the box returns to its normal position and thus securely holds the lens 16 in place . the dimple stop shape can be of a variety of shapes but , by making the dimples such that from the front to the rear and rear to the front the dimple is rounded as in a bell shape , the front panel can more easily be inserted and removed . as a non - limiting example , the dimple shape may be tubular and run along the top and bottom , or simply a protrusion , etc . but , in any of the various shapes , rounding the shape of the stops from front to rear and rear to front ( such as a bell shape ) advantageously allows the graphic panel to be removed and replaced easily . it should be appreciated that the dimples can be included on one or more surfaces of the box but , the illustrated embodiment shows the dimples on the inside of the lower and upper edges of the box . it should also be appreciated that in addition , or alternatively , to the dimples , other mechanisms may also be used to secure the lens 16 to the box . for instance , the faceplate 24 may include an opening that is smaller than the lens 16 and is used to hold the lens 16 to the box . other mechanisms such as clamps , springs , screws , etc . may also be used . it should be appreciated that various configurations and assemblies of the message box can be used in different embodiments . however , in the illustrated embodiment , the main enclosure 20 is opened on the front and back sides . the lip or rim 44 extends around the inner surface of the enclosure 20 and is proximate to the front of the box opening . the dimples 40 are positioned in front of the rim 44 at a distance sufficient to hold the lens 14 either against the lip 44 , or the diffuser 14 if the diffuser is installed between the lip 44 and the lens 16 . the light source 12 is installed behind the lip 44 . it should be appreciated that the light source 12 may include the other electronics , such as the processor , circuits , interface to power source , interface to sensors / detectors , etc or , a separate module containing the same be inserted into the enclosure . the strategically placed key slots 42 in the bottom sides of the box allow for an alternate way to remove the graphic panel . multiple and strategically placed fasteners 36 allow the enclosure to open up or stretch for easy graphic panel exchange . a photocell hole 38 allows the photocell to receive ambient outside light levels for proper light intensity setting of the light engine . internal lens stops 44 allow correct spacing for the diffuser lens 14 and graphic lens 16 placements . a face plate 24 on the front of the box enclosure allows for flush mounting installation on an existing order station or other enclosure . the box enclosure 20 could be made of aluminum formed construction , injection molding of aluminum or plastic , or any other appropriate forming process , as well as a vacuum forming process . however , the unique features of the box listed above would still need to apply for proper installation . the current mounting bracket design 18 , 22 , 24 and mounting screw locations 26 in the box give the most practical mounting application ; however , additional holes could be placed in the box for other mounting methods . a flush mount adapter kit provides various ways to install the box 20 in existing drive - thru menu boards 32 and order stations as well as other enclosures . brackets 18 , 22 , 24 align with the design of the box for multiple installation applications . depending on a specific installation application , other universal mounting kits could be made to connect with the existing box mounting methods . various embodiments of the message box could be made by a manufacturer with various skill sets known to those in the manufacturing arts : mechanical methods for the box design , and lens designers and electronics technicians for the photocell flasher and light source design . graphic design skills are also necessary for applying the message on the graphics panel . other embodiments , in which the power to supply the functions of the flashing message box is supplied by a solar panel and rechargeable battery source are contemplated . this arrangement would eliminate the need for a transformer directly connected to the light engine . in yet other embodiments , having a metal or plastic disk that would spin at a rate to reproduce the flashing effect could replicate the flashing message box , as could a computer programmed to provide a flashing voltage output . both of these possibilities would still need a flashing light source of some type with a photocell and would cause different installation requirements . the flashing message box could be used in many other applications , for example , banks , gas stations , food store end caps and isles , anywhere people gather and a store owner wants to get a message out to sell products . businesses want to sell more products to customers while they are in the drive - thru lanes 34 at fast food restaurants 30 , banks and gas stations , for example . there are plenty of distractions at these locations and the customers have a limited attention span . various embodiments of the flashing message box may deliver aprecise single message which is more apt to generate a positive reaction or , be more effective . the flashing message box provides an easy single message approach combined with a tested timed flash rate which gets the viewer to respond to the product advertised or offer presented . it is anticipated therefore that when the business owner has the device installed in their drive - thru location 28 with a message graphic displayed on it , those who read it will respond to it at a higher rate than to other advertising products . it should be understood , of course , that the foregoing relates to exemplary embodiments and that modifications may be made without departing from the spirit and scope of the invention as set forth in the following claims . in the description and claims of the present application , each of the verbs , โ comprise โ, โ include โ and โ have โ, and conjugates thereof , are used to indicate that the object or objects of the verb are not necessarily a complete listing of members , components , elements , or parts of the subject or subjects of the verb . in this application the words โ unit โ and โ module โ are used interchangeably . anything designated as a unit or module may be a stand - alone unit or a specialized module . a unit or a module may be modular or have modular aspects allowing it to be easily removed and replaced with another similar unit or module . each unit or module may be any one of , or any combination of , software , hardware , and / or firmware . the present invention has been described using detailed descriptions of embodiments thereof that are provided by way of example and are not intended to limit the scope of the invention . the described embodiments comprise different features , not all of which are required in all embodiments of the invention . some embodiments of the present invention utilize only some of the features or possible combinations of the features . variations of embodiments of the present invention that are described and embodiments of the present invention comprising different combinations of features noted in the described embodiments will occur to persons of the art . it will be appreciated by persons skilled in the art that the present invention is not limited by what has been particularly shown and described herein above . rather the scope of the invention is defined by the claims that follow . | 6 |
the following detailed description and appended drawings describe and illustrate various exemplary embodiments of the invention . the description and drawings serve to enable one skilled in the art to make and use the invention , and are not intended to limit the scope of the invention in any manner . in respect of the methods disclosed , the steps presented are exemplary in nature , and thus , the order of the steps is not necessary or critical . certain design principles to achieve the desired results are discussed in the succeeding paragraphs . fig1 of the accompanying drawings illustrates the behavior of the air and water slugs in a flexible pipe arrangement . for ease of understanding , we have considered the waves to be regular curves , such as in the case of a โ u tube manometer โ, connected in series 101 . let us also assume that , initially , water 102 is filled uniformly in all trough segments 101 a of the pipe 101 , with air 103 being trapped in crest segments 101 b . it can be seen that , since all the segments 101 a , 101 b are connected in series , any force applied at any point on the pipe 101 will be transmitted throughout the length of the pipe . thus , if some pneumatic pressure 104 is applied at one end of the pipe 101 , it will โ push โ all the water segments / slugs up preceding crests 105 ( against gravity ). in other words , a pressure head will be created , which will be equal to the sum total of all the height displacements of the water segments . fig2 a depicts an artist &# 39 ; s impression of the ffwec which describes an arrangement 201 depicting waves moving towards ashore 202 , reflected waves near shore (โ turbulence area โ) 203 , and a plurality of โ flexible pipes โ 204 connected at one end to a plurality of โ inlets โ 205 , respectively , further connected at opposite ends to a โ manifold โ 206 and the manifold 206 , by means of a pipe 207 or plurality thereof , in fluid communication with the โ pressure chamber โ or โ pneumatic accumulator โ 208 or plurality thereof . the pressure chamber 208 is further connected by means of โ air and water piping โ 209 to generators 210 or turbines . moorings 211 are provided at the โ inlets โ 205 ; supports 212 may be provided for the pipe 207 . at least one drain pipe 213 is connected to the chamber 208 ; and a grid power supply 214 is connected to the generators 210 . even though some of the systems above have been shown to be on shore , but could even be located offshore . likewise , pneumatic pressure could also be developed by pneumatic compressors instead of the pressure chamber . it would also be possible to develop power directly from the fluid flow from the โ outlet โ. the various pipes for fluid communication could also be in plurality . the aforesaid means and methods are preferred options and not the only possibilities . fig2 b is an enlarged view of the preferred embodiment of the invention essentially comprising the โ flexible pipe โ 204 connected at one end to the โ inlet โ 205 . an โ outlet โ or coupling 215 is attached to an opposite end of the pipe 204 and is further connected to components shown in fig2 . a โ suspension rod โ 218 extends downwardly from the โ inlet โ 205 and optionally includes a โ ballast / damper โ 219 and a mooring ring 220 . a mooring line 221 is attached to the ring 220 . fig3 of the present invention depicts a โ flexible pipe โ 301 floating on waves , with water 302 and air 303 โ slugs โ in sustained flow . a water reservoir 309 connected to the outlet of the pipe 301 is located at an elevation towards the outlet side of the flow representing the extent of a pressure - head 304 on the flow , with the direction of wave motion being from left to right ( arrow 305 ). with no back pressure ( no water in the tank 309 ) the water โ slugs โ 302 remain in the troughs of the pipe 301 , and with water in the tank 309 , the slugs 302 are pushed up the preceding wave crests 306 to generate an increased pressure - head 308 on the flow . the basic embodiment in fig4 shows an โ inlet โ apparatus 420 comprising a single โ inflexible pipe โ 400 , at least one buoyancy tank 401 , which tank normally floats on the surface of a body of water represented by a wave 409 . through a mouth 402 of the pipe 400 both air and water can enter and an outlet 403 of the pipe is connected in fluid communication with a front end of a โ flexible pipe โ 404 . further , the apparatus 420 additionally and generally consists of a โ suspension rod โ 405 , either fixedly attached to the apparatus or hinged to it . in the former arrangement , the suspension rod 405 could have a โ ballast โ and / or โ damper 406 and a mooring ring 407 with an attached mooring line 408 , all suspended below the apparatus , for providing and enhancing stability to the assembly , particularly in a vertical axis 418 , that is to minimize the pitching motion of the assembly , while providing freedom to heave viz . along the vertical axis . these components if positioned below the buoyancy tank 401 minimizes the torque that would otherwise be created by the moment arm formed , due to the distance between a center of floatation โ f โ 415 and a center of gravity ( cg ) 416 . hence , both are kept aligned along the vertical axis 418 or nearest thereto . whereas , in the former case the โ inflexible pipe โ, i . e . the fore and aft axis of the inlet 400 , has a freedom to pitch around the lateral axis and as well to heave . the โ ballast โ 406 also acts as a โ damper โ, creating drag while moving up and down the waves . thus , if it is located away from the center of floatation โ f โ 415 , somewhere along the fore and aft axis of the inlet , it would cause torque , thereby making the mouth 402 of the โ inflexible pipe โ 400 pitch up and down while riding the waves ; which aspect is discussed subsequently herein below . it may be noted that , at the time of the โ zero start โ it would be necessary to push water into the mouth 402 of the โ inflexible pipe โ 400 , at the required velocity and volume . therefore , it would be necessary to have a relative motion between the horizontal component of the waves and the โ inflexible pipe โ 400 . this does not happen if the โ inlet โ 420 pitches along with the waves . the โ ballast โ 406 enhances stability of the โ inlet โ 420 in the vertical axis 415 , thereby minimizing the pitching motion , as required in some embodiments of the present invention . the โ flexible pipe โ 404 , which trails the apparatus 420 , provides the directional stability . as such , it remains nearly in an upright position and rightly aligned as it floats up and down the waves . the inlet 420 generally faces the oncoming waves 409 ( direction arrow 410 ) and is made to float at an appropriate distance from the ( swl ) by adjusting the buoyancy of the buoyancy tank 401 . under operating conditions , it typically enters near a trough 411 and exists at a crest 412 of the waves 409 as they pass ( for explaining the sequence , the wave 409 in the drawing is shown as stationary while the โ inlet โ 420 is shown in three positions , moving from right to the left ). when a wave 409 strikes the mouth 402 of the โ inflexible pipe โ 400 , the water which enters it is separated from the main water body , while continuing to move through it at the same wave velocity . the โ water phase โ 414 commences from the trough of an oncoming โ air phase โ 413 . thus , the alternating intake of water and air โ slugs โ is appropriately synchronized with the waves 409 . the entry ( crest 412 ) and exit ( trough 411 ) points vary depending upon factors , such as the back - pressure at the โ outlet โ 215 , wave conditions , the length of the โ flexible pipe โ 204 , etc . and is suitably controlled . the system could work without any controlling devices , under fair wave climatic conditions , with average efficiency and reliability . however , since the waves are not regular , provision for optimally controlling and regulating the air and water ingestion timing and volume have also been provided . the intake volume and timing of air and water โ slugs โ are controlled by altering the buoyancy and / or โ up - down โ tilting of the โ inlet โ along its lateral axis . buoyancy is increased or reduced by filling the buoyancy tanks with air or water , respectively . alternatively , the inlet 420 could also be pushed in and out of water by certain actuation means or with baffle arrangement . this enables ingestion of the โ slugs โ according to the wave condition . inlets having means for controlling and regulating the buoyancy , whereby the air and water ingestion timing and volume could be controlled to a certain degree , besides making it possible to ingest only water to sink the apparatus / system in bad weather or ceasing operations by ingesting only air and totally float it , are described in detail below . fig5 illustrates the above embodiment comprising an โ inlet โ apparatus 501 with at least one โ buoyancy tank โ 502 having a โ pneumatic duct โ 506 , a top end 506 a of which opens in a top portion of the โ buoyancy tank โ 502 . the duct 506 is connected through a hose 505 to the โ pressure chamber โ 208 ( fig2 ) with some control systems / devices 808 preferably located thereat , for varying the pneumatic pressure in the โ buoyancy tank โ 502 . by varying the pneumatic pressure in the โ buoyancy tank โ 502 , water is pushed in / out through a โ water breathing tube โ 507 , a top end of which is fixedly attached to the bottom of the โ buoyancy tank โ 502 and a lower end opening into the sea below , consequently varying the โ inlet โ 501 buoyancy , thereby controlling the air and water intake timing and volume . the rest of the arrangements of this embodiment remain similar to those described in fig4 above , including an โ inflexible pipe โ 503 , connected to a โ flexible pipe โ 504 , a โ ballast โ 508 optionally attached to the tube 507 , a mooring ring 509 attached at the bottom of the tube 507 , and a mooring line 510 attached to the ring 509 . in another embodiment , an โ inlet โ apparatus 601 , which is illustrated by fig6 , includes at least one โ inflatable buoyancy tank โ 602 which is directly connected with a pneumatic hose 605 as above , but without the โ pneumatic duct โ and โ water breathing tube โ ( the rest of the arrangements being similar to the previous embodiment described in the above paragraph ). the hose 605 terminates at a duct 606 inside the tank 602 . an โ inflexible pipe โ 603 is connected to a โ flexible pipe โ 604 , a bracket 607 attaches a suspension rod 608 to the pipe 603 , a โ ballast โ 609 is provisionally attached to the rod 608 , a mooring ring 610 is attached at a bottom end of the rod 608 , and a mooring line 611 is attached to the ring 610 . as can be appreciated , the buoyancy of the โ inlet โ apparatus 601 can be varied by inflating / deflating the โ inflatable buoyancy tank โ 602 . the inflatable variable buoyancy tank 602 could be , as shown in fig6 , a spherical shape or any other suitable shape and its principle operation also being similar in each case . in yet another embodiment illustrated by fig7 , an โ inlet โ apparatus 701 comprises at least two โ inflatable buoyancy tanks โ 702 , connected individually , in groups or jointly through respective hoses 705 and 706 with the โ pressure chamber โ 208 , or pneumatic compressors , which may be shore based and having the pneumatic pressure and controls and switching devices generally installed thereat . the โ inflatable buoyancy tanks โ 702 are suitably arranged on the โ inlet โ apparatus 701 , whereby the pitching , i . e . the angle of rotation around the lateral axis of the โ inlet โ apparatus and its buoyancy , can be controlled by varying the buoyancy of the โ inflatable buoyancy tanks โ 702 individually . also shown are an โ inflexible pipe โ 703 connected to a โ flexible pipe โ 704 , brackets 707 for attaching a โ suspension rod โ 708 and the pipe 704 to the pipe 703 , a โ ballast โ 709 attached to the rod 708 , a mooring ring 710 attached to an end of the rod 708 , and a โ center of flotation โ ( f ) 711 . the tanks 702 encircle the pipe 703 and also can be positioned on the rod 708 . if the โ damper โ 709 is located at a certain distance aft of the โ center of floatation โ ( f ) 711 ( instead of vertically below it as described at fig5 for instance , and the suspension rod 708 may be hinged to the apparatus so as to enable pitching , the drag caused by the โ ballast / damper โ 709 would create some torque , which would make the โ inlet โ 701 tilt / pitch โ up โ, with ( f ) as the fulcrum , while it rides up the waves , and vice versa . in this case , the water which would be in the โ inflexible pipe โ 703 during the โ water phase โ 414 ( fig4 ) would also be lifted up by the additional pitching motion of the โ inlet โ 701 , causing it to fill the empty โ flexible pipe โ 704 at โ zero start โ. the angle of rotation of the โ inflexible pipe โ 703 can be varied by changing the buoyancy of the respective buoyancy tanks 702 . in another embodiment , at least two โ rigid buoyancy tanks โ, similar in construction to the โ buoyancy tank โ 502 explained at fig5 above are used , instead of the inflatable buoyancy tank 602 of fig6 . the arrangement of the components and their functions is similar to that explained in fig7 above , including the โ inflexible pipe , the โ flexible pipe โ, the โ suspension rod , the โ ballast โ and the mooring ring . fig8 ( a ) through fig8 ( e ) are the schematic representations of hydro / pneumatically actuated inlet systems 800 having certain alternative components and controls . the systems enable more precise , quicker and positive control of the air / water phases 411 - 412 , as compared with the previous systems , whereat the โ inlet โ apparatus 420 typically entered near a trough 411 and existed at a crest 412 of the waves as they passed . the means and method of controlling those operations have already been described at fig5 to 7 . whereas , in embodiment depicted at fig8 ( a ) , an inlet 803 is sequentially lifted above 804 a and pushed below 804 b the water surface , with more precise timing . the higher pressure below water surface also helps in pushing water slugs into the inlet 803 and when it is lifted to a height , a โ head โ is also created , both factors help in forming distinct water slugs and also imparting velocity to them , particularly at the time of โ zero start โ. the device could additionally have a tilting mechanism . this system 800 includes a suspension means 801 , depicted as an inverted โ u โ frame , at least one buoyancy tank 502 attached to pylons 801 a on either side of the suspension means 801 . the buoyancy tanks 502 having control features similar to those described at fig5 through fig7 and the relevant paragraphs above ( not shown ). the inlet pipe 803 , which may have shapes and dimensions different from the other inlet pipes 401 , 501 , 601 , etc . disclosed herein , is attached to one end of a reciprocating mechanisms ; for instance levers , guides , scissor jack or lift , that is operated by linear actuator , for instance bellow or cylinder , typically cylinder 804 as shown in fig8 , further attached to the โ flexible pipe โ 204 , and its other end 804 to the horizontal beam 801 b of the suspension means . the inlet pipe 803 reciprocates along the vertical axis , by means of at least one linear actuator 804 , between fully retracted ( in air ) 804 a and fully extended ( in water ) 804 b positions . the linear actuator 804 could be pneumatic or hydraulic system , driven by air , oil or even sea water . pneumatic pressure is provided through hoses 505 in fluid communication with the linear actuator 804 and a compressed air source ( not shown ), such as the pressure chamber 208 . alternatively , the fluid could even be hydraulic oil or sea water driven by external pump . the reciprocating and rotary motions of the inlet pipe 803 are triggered by suitable sensing and control system 808 with inputs from the phase of the wave at the inlet pipe 803 , the back pressure at the โ outlet โ 215 , length of the โ flexible pipe โ 204 , wave conditions or wave climate , energy demand , etc . fig8 ( b ) depicts a rotary actuator 802 , mounted on inlet pipe 803 , attached to the lower end of the actuator 804 and , enables rotation of the inlet pipe 803 through certain degrees around the lateral axis โ รธ . fig8 ( c ) depicts yet another version of the hydro / pneumatically actuated inlet 800 . the โ baffle type โ inlet 805 system has two inlet pipes ; instead of a single inlet 803 previously described in the present invention , one each for water 806 and air 809 ingestion , respectively . air 807 a and water 807 b are alternately ingested through the respective pipes . a baffle 810 alternately closes either the air port 810 a or water port 810 b , while the opposite one automatically opens , thereby feeding the respective slugs into the flexible pipe 204 . an actuation system 813 , similar in construction to the cylinder actuator device 804 , is employed to operate the baffle valve 810 , through suitable up / down 812 linkage mechanism . the rest of the components remain similar to those described at fig8 ( a ) and 8 ( b ) above . the main difference between the โ baffle type โ inlet 805 system and the rest described in the present invention is that , the water 806 and air 809 ingestion pipes always remains under water and above water , respectively ; as shown in the diagram with โ water โ. in this embodiment , instead of pushing the inlet 803 in and out of water , either air 807 a or water 807 b , slugs are ingested with the baffle opening and closing the respective ports . this arrangement requires comparatively lesser time and force to alternate the between the two phases , besides causing minimal disturbance to the water flow . however , it also entails more number of moving components . while certain type of actuators 802 , 804 have been mentioned , any other type of actuator could be used . the phase of a wave at the inlet pipe 803 could be sensed by any of the various suitable sensors available for measuring wave heights , time period , etc . ( not shown ). in most of the previous inlet devices disclosed above , the phase velocity of a wave was being directly converted into flow of water slug . however , since the โ water ingestion phase โ 414 mostly commences near a trough 411 , where the velocity in the direction of flow is not only low , but could even be out of phase by 180 ยฐ. hence , there was a possibility of water slugs not getting enough โ push โ or kinetic energy to suddenly accelerate to the phase velocity at the right moment , particularly at the time of the โ zero start โ. to overcome this mismatch , it would be possible to first convert the kinetic energy at the crest of a wave into potential energy ; by topping up water in a reservoir or tank located at a height , storing it there , and then reconverting it into kinetic energy โ by accelerating a slug to the desired velocity , volume and wave phase , particularly at the time of โ zero start โ. some embodiments to enable the above sequence of operation are disclosed below . fig8 ( d ) discloses yet another embodiment of the automatic inlet ( 814 ) consisting a tank fed inlet 816 , with a tank 815 suitably attached on top of the tank fed inlet 816 and 815 being in fluid communication with the tank fed inlet 816 , through a telescopic pipe or flexible hose 817 of adjustable length . the tank fed inlet 816 is further in fluid communication with the flexible pipe 204 , via baffle 810 that opens / closes either the air port 810 a or water port 810 b ports , wherein the tank fed inlet 816 functions as in the case of the โ baffle type โ inlet 805 above . a channeled ramp is 818 attached to the tank 815 , such that its trailing edge is jointed in front and top of tank 815 and its front edge is near the swl . fig8 ( e ) is a version of the inlet system disclosed at fig8 ( d ) , consisting an inlet 819 , with a tank 815 suitably attached on top and in fluid communication with the inlet 819 , through a telescopic pipe or flexible hose 817 of adjustable length . the inlet 819 is further in fluid communication with the flexible pipe 204 , via a first baffle 810 that opens / closes either the air port 810 a or water port 810 b . the inlet 819 further having a second baffle 811 located in front of the first baffle 810 , wherein the second baffle 811 opens / closes either the ocean port 811 a or tank port 811 b , actuated by means of an actuating system 813 . in the ocean port โ open โ 811 a / tank โ closed โ position , water from the ocean can flow through the tank fed inlet 816 , via first baffle 810 , further into the flexible pipe 204 , as in the case of fig8 ( d ) , while the tank port 811 b would remain โ closed โ, and vice versa . when the ocean port 811 a is โ open โ/ tank port 811 b โ closed โ, the inlet 819 functions as inlet 805 , fig8 ( c ) . whereas , when tank port 811 b โ open โ/ ocean port 811 a โ closed โ, the inlet 819 functions as in the case of tank fed inlet 816 , fig8 ( d ) . further , a channeled ramp 818 is rotatably hinged 819 to the tank 815 and can be moved โ up โ 818 a /โ down โ 818 b by means of a similar actuating mechanism 813 . it 818 is lowered till its front edge is near the swl 818 b to enable overtopping of the tank 815 by moving waves , generally at the time of โ zero start โ and lifted โ up โ for continuous operation . since the velocity of the water slug entering the tank fed inlet 816 will be a function of the โ head โ โ h โ of the water level in the tank 815 above the tank fed inlet 816 , the desired slug velocity can be achieved by adjusting the โ head โ โ h โ, which can either be set manually , based on the average celerity in the area of deployment , or automatically by a servo mechanism ( not shown ), according to the inputs from sensing 808 devices . however , the latter option would increase the sophistication , with consequent cost escalation , o & amp ; m problems , etc . hence , the manual option is preferable , more so because the requirement of feeding water at some pressure and velocity would mostly at the time of โ zero start โ or kick - start . the rest of the arrangements are generally similar to those described at fig8 ( a ) through ( d ) above . the various structural components being generic in nature have not shown , to avoid clutter . a โ rod โ and โ ballast / damper โ arrangement 406 , 708 , 709 and 710 described at fig5 and fig7 is optionally attached to tank fed inlet 816 in line with the centre of gravity โ cg โ 416 . the ballast / damper 709 maintains the inlet system 805 d aligned in vertical position , along the vertical axis , and as well dampens the heaving motion as it rides the waves . the rationale for this has already been covered at the description of fig5 and 7 above . since the inlet system 805 d resists following wave motion , waves roll up the ramp and fill the tank 815 , where water is stored till let into the 816 by opening inlet port 810 b . it would also be possible to combine features of one embodiment with another . for instance , a larger diameter pipe or tank 815 could be attached at the front the tank fed inlet 816 of the inlet . when and lifted up and tilted backwards water would flow into the inlet 803 at the required velocity and timing . baffles 810 would be precluded . another feature of the invention is a โ flat - conical intake โ 900 ( hereinafter termed as the โ intake โ to distinguish it from the โ inlet โ 205 / 420 . it is a well - known fact that the larger pipe diameter the lesser the frictional loss , with the other factors remaining constant . due to this reason , where on one hand small diameter pipes are not suitable due to their higher frictional loss at the wave velocities expected in the ocean , on the other the large diameter pipes are ineffective when the wave heights are comparatively smaller . this is mainly because , in this case , ( a ) the mouth of the โ inlet โ may not completely enter a trough 411 and exit at a crest 412 , but remain partially in both , air and water most of the time . thus , integrated water slugs may not form , precluding development of the liquid seals which are essential for building up pressure , and ( b ) the large diameter โ inlet โ would take a longer time transiting through the air - water . during this period , both air and water would simultaneously enter the โ inlet โ 420 , creating a situation similar to the one described at the previous paragraph . the โ intake โ is meant to resolve these problems . fig9 depicts an โ intake โ 900 consisting of a hollow conical body 901 , a narrower mouth with rounded rectangular cross section 902 and a cylindrical outlet 903 to suit the flexible pipe 204 . the cross sectional area of the โ intake โ is maintained nearly constant all along its length and it smoothly blends from rounded rectangle to circular shape thereby providing better fluid dynamic characteristics . the intake could either be attached directly to the โ flexible pipe โ 204 , or mouth of the โ inlet โ 205 / 420 . the intake 900 assists in ingestion of water particularly in shallower wave climate . an additional feature of the invention includes an โ air - water separator โ 1000 . it may be possible to pump water up beyond a certain height in an arrangement which works on the principle of โ u tube manometer โ, such as the present invention , notwithstanding the amount of pressure that may be applied or is being generated by the โ flexible pipe โ. reference is made to fig1 . now , if the pneumatic pressure 104 is increased , the โ water slugs โ 101 a , that are already at the โ minimum water level โ 105 cannot be pushed up any further , but the โ liquid seals โ that were formed by the โ water slugs โ 101 a , will be breached and the air 103 that was trapped in the โ air slugs โ 105 will bubble out through the โ water slug โ 105 at โ minimum water level โ. some water from the โ water slugs โ 105 may also spill over into the adjacent trough segment . as a result of this , the pressure 106 will drop to some extent , and air will continue to escape as long as it is being pumped in . reference is also made to fig3 , โ slugs under pressure โ. in this case too , if a โ water slug โ 302 happens to go below its โ minimum level โ, the โ liquid seal โ would similarly be breached , consequently enabling the air pressure to escape . as the โ air slugs โ 303 get depleted , the buoyancy that was being provided by them would also decrease , resulting in sagging of the โ flexible pipe โ 204 between two adjacent โ air slugs โ 303 , causing them to merge . consequently , the โ flexible pipe โ 301 could sink . this phenomenon is more prominent in case the โ head โ 308 is more than the height of the โ water slug โ 306 , and the pipe diameter is also large ; for instance even 10 cm id whereas , it would be around a meter in diameter in the field conditions . as solution to this problem , the โ air - water separator โ 1000 is described below . fig1 depicts the โ air - water separator โ 1000 , viz . an apparatus attached at the discharge side of the โ flexible pipe โ 204 or โ manifold โ 206 or โ outlet โ 215 . water and air from the โ outlet โ 215 are pumped under pressure into the air - water separation tank 1002 and get segregated in it , with air and water flowing upwards and downwards , respectively , due to gravity . the fluids are further conveyed to the pressure chamber 208 and / or turbines / generators 210 , via the air 1003 and water 1004 pipes 209 , respectively . the air pressure is pumped by means of the air hose 1003 and injected into the pressure chamber 208 , through the โ air discharge nozzle โ 1005 , the mouth of which is located below the swl , at a given depth and termed as the โ differential pressure depth โ 1007 . the water level in the air - water separation tank 1002 is maintained at the โ differential pressure level โ 1010 , i . e . somewhere below the โ outlet โ 215 , irrespective of the pressure head h . this is because ; the air discharge nozzle โ 1005 is located at the โ differential pressure depth โ 1007 , viz . below the swl . the pressure required to displace water from the air discharge nozzle โ 1005 also acts on the top surface of the air - water separation tank 1002 , pushing the water in it down by an equal depth , i . e . to โ differential pressure level โ 1010 . the โ pressure chamber 208 โ and air - water separation tank 1002 hold slugs and column of water , respectively , in equilibrium , making it a closed system . the flow of water and air under pressure from the โ flexible pipe โ 204 , via the air - water separation tank 1002 , will build - up a pressure head โ h โ in the โ pressure chamber 208 , and get discharged through the water piping 209 to run the turbine 210 . the air bubbles injected into the โ pressure chamber โ 208 will increase the volume of the fluids in it and as well assist in enhancing the upward flow of the fluids , consequently increasing the pressure head โ h โ. thus , the pressure energy in the compressed air is also utilized . the principle of the โ air lift water . pump โ or โ geyser pump โ is applied in the case of case , with the exception that , the water to be lifted and the pneumatic pressure , both , are supplied from the same source , i . e . the โ flexible pipe โ. the air pressure / pneumatic is pumped back into the system , increasing the total efficiency or minimizing energy loss as well . fig1 a shows a selectively inflatable and deflatable tube 1300 attached to the โ flexible pipe โ 204 along a length of the flexible pipe , wherein the tube is coiled around the flexible pipe . the inflatable tube 1300 is inflated at the time of โ zero start โ and deflated when the system is running in a stable condition . by this method sagging during startup could be precluded . the pressure in the inflatable tube 1300 could also be varied between inflated deflated to depending on the operating conditions . a source of pneumatic pressure supplies pressured air to the tube , wherein when the tube is inflated by the pressured air , a buoyancy of the flexible pipe is increased to prevent the flexible pipe from sagging or sinking in the body of water . fig1 b shows pair of inflatable tubes 1300 externally and laterally attached on either side of the โ flexible pipe โ 204 along its length . on the left hand side of the drawing is a front view 1301 of the same . the inflatable tubes 1300 are inflated at the time of โ zero start โ and deflated when the system is running in a stable condition . by this method sagging during startup could be precluded . the pressure in the inflatable tubes 1300 could also be varied between inflated deflated to depending on the operating conditions . pneumatic pressure can be supplied from the pressure chamber ( 208 ) or an external source and controlled by a controlling means . fig1 c shows another embodiment which restrains the โ flexible pipe โ 204 from sinking beyond a preset depth / limit 1303 . in this case an inflatable / deflatable tube 1302 is disposed vertically above the โ flexible pipe โ 204 . the inflatable / deflatable tube 1302 is attached with the flexible pipe 204 by means of tethers 1308 , ropes or strands of the required length , for restraining the flexible pipe 204 from going below the depth / limit 1303 below the wave surface . for instance , if the length of the tethers 1303 is 1 m , the water segments will be restrained from going below this depth . pressure in the inflatable / deflatable tube 1302 can be varied to extend the depth / limit 1303 to some extent . pneumatic pressure is supplied to the inflatable / deflatable tube 1300 , 1302 from the โ pressure chamber โ 208 or any other external source . the pressure in the inflatable / deflatable tubes is controlled with control devices externality located . in the above case too , the selected depths 1303 can be varied in steps as described above . in another option for this embodiment , instead of the inflatable tube , inflatable / deflatable balloons are used . besides compressibility , the other significant factor that will affect the functioning of the ffwec is the rise in temperature due to compression , per charel &# 39 ; s law / gas law . however , it will mostly get absorbed by the water . conversely , at the time of expansion in the โ pressure chamber โ 208 generators 210 , the temperature will fall which could cause freezing , particularly when operating at low temperatures , such as in the higher latitudes . besides loss of energy / heat , more energy would have to be spent in heating the fluids to prevent freezing . therefore , to conserve energy the โ flexible pipe โ 204 is suitably insulated by wrapping it with thermal insulating material or providing built - in insulation . for mooring it is preferable to use mooring buoys , since the weight of the mooring line would be taken up by the buoys and not act on the โ inlet โ or system as such . the orientation of the flexible pipes is of significance for energy extraction . energy is progressively extracted by a โ flexible pipe โ. hence , if it is disposed directly along the wave direction , the maximum energy that it can absorb will be limited to the energy of the wave front acting on its cross section , i , e . area of the mouth of the pipe . whereas , if it is laid at certain angle to the wave direction , energy would be progressively absorbed as a wave travels along the length of the pipe . various other permutations and combinations of the same principle of operation and arrangements are also possible , but not mentioned herein in accordance with the provisions of the patent statutes , the present invention has been described in what is considered to represent its preferred embodiment . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope . | 5 |
a preferred embodiment of the invention is generally illustrated in fig1 - 3 , with fig1 illustrating use of the invention in connection with automobile data , and fig2 and 3 illustrating use in connection with a spa / pool application . persons of ordinary skill in the art will understand that the various components and methods can be of any suitable brand and nature , so long as they provide the desired functionality described herein . in general terms , the preferred embodiment of the invention includes a combination of hardware and software to allow real - time transmission of data being generated by a system ( even one such as the human body ), using a device such as a cellular telephone . the preferred embodiment permits remote viewing and communication / control with the site / application from which the data originates . persons of ordinary skill in the art will understand that the preferred cellular telephone component or device useful in the invention can be provided by programmable cellular telephones ( such as those discussed herein ), but could also be provided by other devices and technologies . wireless pagers as well as other technologies , can provide the preferred cellular networks that cover the vast majority of the planet , thereby making the invention easy to use , without the end - user having to create any communication infrastructure to get to and from the internet . preferably , the cellular telephone or similar device provides an internet communication interface , while connected ( via hardwiring or wirelessly ) to a โ live โ sensor / controller device in the monitored / controlled system . depending on the application , the sensor / controller device can be any of a wide range of devices , capable of reporting data , controlling the system , or both . also preferably , the invention includes a suite of hardware and software products provided for use on programmable cellular telephones or similar devices , such as the family of nextel / motorola java โข- powered phones ( e . g ., model i85s ). among other things , the invention preferably enables the cellular telephone to interface directly with a wide variety of devices , so that it can function as a service / diagnostic / monitoring device . in the preferred embodiment , the invention turns the phone into a powerful , highly configurable test tool . to enable the desired communication with a sensor / control device , the attached โ device โ preferably is in communication with the cell phone &# 39 ; s built - in serial port ( using appropriate serial communication parameters โ baud rate , stop bits , parity , etc ). if a particular attached โ device ( s )โ does not support a standard serial interface , an adapter apparatus ( such as a cable , connector , box , etc .) can readily be provided and used to suitably create a suitable โ serial โ connection between the cell phone and the โ device โ. ( note that the serial port on the cellular phone is traditionally used for a wired connection to a pc or laptop computer โ both for purposes of uploading software applications to the phone , as well as acting as a cellular modem connection to the internet , for the attached computer ). by way of example , in a specific embodiment such as the automotive application discussed herein , an adapter cable and suitable rs232 obd protocol conversion circuitry is required to establish communication between the phone and the vehicle &# 39 ; s industry โ standard โ j1962 obd connector . among other existing resources available to persons of ordinary skill in the art , the sae ( society of automotive engineers ) provides ample information to understand and construct such an adapter ( similar principles and resources can readily be used in fabricating and providing other adapters / hardware / software for applications other than automobiles obd data ). on a related point , persons of ordinary skill in the art will understand that , as other communication channels ( other than the serial ports now available on current cell phones ) become available , the invention can be readily practiced using those other โ non - serial โ interface channels from the device to the phone . the cellular telephone preferably also functions as an internet gateway , delivering all or selected available data , in real - time , to a website / server such as the vtti erm ( embedded resource manager ) server . the data can be permanently and securely stored in an on - line database there , accessed from any web browser by a user having sufficient permissions ( passwords , etc .). the erm viewer , fig3 provides a real - time graphical interface through a suite of java โข applets , allowing someone at a remote site ( such as a remote computer 10 , fig1 and 2 ) to โ see โ everything that the on - site service technician is seeing ( at , for example , location 20 , fig1 or location 30 , fig2 ), and , in some cases more ( see discussion elsewhere regarding the โ more โ that can be seen by a remote viewer , for virtually any application of the invention ). if desired , a cellular telephone can even be left โ permanently โ connected to the monitored device ( such as at locations 20 or 30 ), saving travel , hookup , and other time and expenses . remote commands preferably are supported through the erm control server delivering the appropriate command information to the remotely connected device through the cellular telephone . plotting applets allow for web - based viewing of all logged data , over any specified time interval , providing great flexibility in analysis . in a preferred configuration for automotive on board diagnostics , fig1 the cellular telephone is programmed to communicate with any vehicle through the obd connector , a connector that is required on all vehicles sold in the us since 1996 ( typically , the vehicle &# 39 ; s connector is located under the dashboard , making it fairly simple to connect and use the cell phone in this application , and thereby to even be able to gather data while actually driving somewhere and under varying conditions , as discussed herein ). persons of ordinary skill in the art will understand that many aspects and benefits of the invention can be practiced and realized by custom data connectors / collectors interfacing with the cellular telephone , rather that a โ standard โ connector such as the obd . even though the telephone &# 39 ; s programming preferably is standard to interface with the obd , that programming can be customized as may be needed / desired in any particular application . as for the preferred hardware to connect to the obd connector on any particular vehicle , there currently are three configurations of obd adapter blocks needed to cover all types of vehicles ( one works on ford vehicles , one on gm , and one for all other vehicles ). as indicated elsewhere , if bluetooth or other short - range wireless communication technology is incorporated into the obd โ connection โ on board the vehicle , the cellular phone can be configured ( with proper hardware and software ) to receive that wireless signal , rather than use any โ adapter block โ at all . preferably , the obd viewer software suite uses the obd connector connection to communicate a host of information , including diagnostic trouble codes ( dtc &# 39 ; s ), real - time vehicle performance data , and sensor status . the obdconnect java โข midlet preferably delivers all the incoming obd data to the cellular telephone user , again , through a series of display forms ( see fig3 ). further support preferably is provided for graphing of selected real - time data ( rpm , vehicle speed , intake temp , ignition time , etc ) through a series of icons on the forms or other suitable user interface . for the remote display , a browser - based java โข applet preferably provides a custom graphical user interface , delivering the information to the โ remote โ observer in a familiar โ gauge cluster โ display , along with any current diagnostic trouble codes ( dtcs ), vehicle identification number , and all available contact information for that particular individual . support for remotely controlling parameters within the engine control module ( ecm ) is provided through the erm control suite ( including the ability for a service center to reset dtc &# 39 ; s ). in a preferred pool / spa service tool configuration ( fig2 ), the cellular telephone is programmed to communicate with the on - board microprocessor powering the pool / spa control ( preferably in the form of a serial port on the pool / spa control , for which relevant communication specifications are typically available from each individual manufacturer โ as mentioned above for the obd data specifications )โ supplying detailed operational and diagnostic information . preferably , the spaconnect โข java โข midlet delivers all the incoming data to the on - site service technician through a series of display forms shown on the cell phone . control is supported through a series of icons on those forms , representing the different functions found on a pool or spa control ( jets on / off , blower on / off , spa lite on / off , filter settings , etc ). for the remote viewer / display , a browser - based java โข applet provides a customized graphical user interface , delivering the information to the โ remote โ observer in a clear and concise fashion โ with support for many sophisticated command and diagnostic routines . persons of ordinary skill in the art will understand that , among other things , the invention can include real - time downloading of new or updated firmware for the system being controlled / monitored ( in addition to downloads of applications and new software to the phone itself ), via the web โ using the cell phone . persons of ordinary skill in the art will understand that the preferred apparatus and methods of the invention can be used in many other applications , systems , and processes . in addition , if desired , a preferred single cellular telephone can simultaneously hold programming so that it is capable of functioning in a plurality of such applications , without further or multiple downloads of programming ( such as java applets ) to the cellular phone . the number of programs / devices with which the cellular phone is capable of interfacing / monitoring / controlling is limited by the memory storage within the cellular phone , but current phones could readily hold 10 - 15 such programs , and future ( increased memory ) phone devices will presumably be able to hold even more . consequently , and by way of example , one telephone preferably could be used ( at the user &# 39 ; s election , and subject to the user &# 39 ; s control ) for ( 1 ) communication with devices at the user &# 39 ; s home ( such as a spa / pool / kitchen equipment / heater / ac / lights ), ( 2 ) to send data to the user &# 39 ; s doctor ( regarding the user &# 39 ; s health and / or vital signs or other diagnostic information ), and ( 3 ) to communicate data about the user &# 39 ; s automobile ( such as to a car dealer or service shop ). thus , a single user could be a pool / spa service technician ( using the phone in connection with onsite service work ), who also is a cardiac rehab patient ( using the phone to provide alerts and data to his health care center ), who also likes keeping an eye on the diagnostic codes are on his or her car ( using the phone as described above to monitor the car &# 39 ; s obd data ). with current operating systems , and serial port limitations , only one such application can be run at any given time , although future operating systems and connectivity mechanisms ( including bluetooth ), may permit multiple systems to be monitored / controlled simultaneously by a single telephone . in addition , for those embodiments using a cellular telephone , there is no need for the user ( such as a field technician ) to buy yet another costly , separate piece of communication equipment ( and to pay monthly service / access fees for the cellular or other communication service ). instead , the user can leverage the investment they have already made in their cellular telephone . further leveraging the internet access provided by the invention , such as through cellular telephones using the nextel network , the invention can deliver a whole host of services ( data logging , remote access , automatic alerts , etc .) that are not possible using other devices or technologies , let alone across such a wide array of applications . thus , the present invention provides numerous advantages over any existing technology of which the inventor is aware . for example , regarding the gecko electronics palm os โข- based spa tool ( pocket - tek ) discussed above , the invention can not only provide all the functionality of the gecko tool , but provides a remote user or users with a real - time remote window into all of the data an onsite user can see , and more . by way of example , if the onsite user is using a currently available cellular telephone with its relatively small display screen ( approximately 100 ร 85 pixel black / white display ), the โ remote engineer / tech support / observer โ person ( viewing the data / system on a relatively much larger display such as a pc ) can โ see โ more than can be displayed in the smaller cell phone display . the โ remote โ viewing device ( such as a pc ) is therefore capable of more as a user interface device than is the cell phone . for instance , the โ remote observer โ preferably can access any / all historical data and have it displayed on the โ remote viewing device โ in the form of a graphical history plot , and can even print it out . as cell phones and similar devices advance , the differences in capability ( between the somewhat โ limited โ interface of current cell phones versus the more capable interface of current pcs ) may diminish , but other benefits of the invention will continue . similarly , in the arena of automotive scan tools , the invention can provide a service technician ( whether a car dealer , a service center , a gas station , or otherwise ) or even a car owner himself with all the functionality of the existing tools mentioned above , but ( as with the spa tool ) with a suite of internet technology tools to provide a real - time remote window into all the data the on - site person is seeing , and more ( similar to the โ more โ discussed above ). perhaps more importantly , the invention permits the user , technician , or even the manufacturer to take a โ test drive โ at any time , with the vehicle continuously transmitting all on - board diagnostic data to any selected destination , such as a secure internet website . the data can be stored there or viewed in real time , and in any case can include a mechanism for โ tagging โ the data at relevant points in time โ for those nasty โ only - happens - when - i &# 39 ; m - driving โ glitches , noises , and rumbles โ so that the service technician can easily see what was going on at the time of the problem . additional applications of the invention in the automobile industry are virtually unlimited . lube shops can use the invention to provide vehicle diagnostic scans with almost no expense on software or hardware infrastructure โ hypothetically charging an extra fee for a 27 - point diagnostic scan . likewise , independent service shops can have access to all current manufacturers &# 39 ; data , without the purchase of a separate scantool ( approximately $ 2500 each currently ) from every auto maker , with no need for make - model - specific software . the low cost of equipment ( a nextel - type phone plus an obd adapter ) allows the shop to purchase only one scan tool , or at most , one per auto bay , and to use the tool out in the parking lot , on - site ( if called out to a vehicle that has stopped running ), or the like . the speed , efficiency , and quality of service can be improved , because all manufacturer - specific data can be displayed in their โ current โ form , as well as permitting the immediate selection and display ( back to the service technician ) of any recalls , warnings , or similar information relevant to the vehicle being tested , all via the erm internet server . in some or many of these situations , the โ remote โ viewer might actually be right beside the vehicle in the auto bay where it is being serviced , in the form of a pc logged onto the internet server site that is receiving the real - time data from the vehicle . yet another application of the invention regarding automobiles is automobile racing . sports such as nascar can create a revenue stream where one currently does not exist , and provides an off - track โ fan โ experience , by monitoring and displaying relevant data from various race cars over the internet , to subscribing customers . race car fans can thereby have a much deeper insight and involvement in the race they are watching , or the broadcast of the race may be displayed in an adjacent window in the fan &# 39 ; s browser , etc . automobile dealer service centers can achieve a better quality and more efficient result , as well as a faster turnover rate for their auto bays and equipment . the invention permits the service center access to vehicle diagnostic information / trip data prior to the customer &# 39 ; s arrival , thereby allowing the dealer to get a better handle on the potential problem , check parts availability , etc . loyalty to the dealer can be increased as well , if ( for example ) at the time of new / used vehicle purchase , the buyer is shown a demo of the invention application running on the cellular phone โ highlighting the active role the dealer service center can play in the care and maintenance of the buyer &# 39 ; s car . as indicated above , car owners can use the invention to perform diagnostic scans on their cars at any time , saving between $ 50 -$ 150 a pop ( depending on where / when the scan / servicing would otherwise be done ), and also creating accountability for any repairs that are eventually made to the car . car owner end - users of the invention normally will require very minimal integration / support to adopt and use the invention . by way of example , each user can register online ( through either a website such as the nascar site , snap - on , etc . or directly on the invention &# 39 ; s internet server website ), where they will setup an account , and ultimately create their own personal car web page โ with live view , and history display . all support to the car owner can be handled through the respective web site โ via faq &# 39 ; s , tutorials , and problem report forms . as also mentioned above , historical data can also be archived and retrieved ( such as in an on - line database maintained on the internet or otherwise ) for any of the applications ( automobile or otherwise ) discussed herein . the availability of this information can permit much more effective use of time and resources . in the field of medical / health monitoring / reporting / analysis , again there are many companies providing localized solutions , where the burden of monitoring is put on the enduser ( to monitor , store , and / or upload the relevant vital signs or other data ). among the benefits of the present invention are : ( 1 ) it can provide a real - time , continuous uplink of the monitored data via the patient &# 39 ; s cellular telephone , securely delivering all the encrypted medical monitoring data for viewing by a physician or other medical personnel from any available web browser ; ( 2 ) in that same web browser , the medical personnel may also instantly pull up not only the real - time data that is being generated by the patient , but also a graphical history of the patient &# 39 ; s data ; ( 3 ) support for โ alert โ or warning / dangerous conditions can also generate a real - time message / alert ( such as an email and / or page ) to the physician or appropriate medical personnel in the event of a serious condition ; and ( 4 ) these and other aspects of the monitoring can be configurable through the web - based interface . by way of example , the telephone can be configured to interface with a commercially available heart rate monitor and temperature sensor for remote monitoring of โ discharged โ hospital patients ( an example would be a cardiac rehab patient who has recently undergone bypass surgery , and has been discharged by his hmo , but put on a โ restricted activity โ regimen ). using the invention , the hospital can keep close tabs on the patient , including setting alerts that trigger if the patient &# 39 ; s heart - rate exceeds a predetermined threshold . all data can be permanently logged into an online database , so that the physician is able to retrieve it for immediate analysis from any location ( hospital , home , vacation , office , hotel room , etc . ), thus providing a truly new level of patient care . further regarding benefits of the invention in health / medical applications , in embodiments in which the data is delivered from the patient using a network such as nextel &# 39 ; s , the patient can simply wear their chest strap heart - rate sensor ( or other sensing device ) connected to their cellular telephone , and the data will be continuously transmitted in real time . so long as the telephone is turned on , you do not have to โ dial up โ or call a number ; the data can find its way to a desired website or location such as the erm / rackspace server ( see fig1 and 2 ). the patient is free to move about ( take a walk , go to the store , return to the clinic for an exam ) all with complete monitoring of their vitals . persons of ordinary skill in the art will understand that , in the preferred embodiment the cellular telephone component of the invention is used as a local / on - site service / diagnostic tool , including using the cellular telephone &# 39 ; s display screen . although other technologies use a cellular telephone as a โ modem โ or otherwise use wireless modems to transmit data , the inventor is not aware of a cellular telephone previously being used as a local / service / diagnostic tool , especially while also being used as an โ internet data pipe โ. in addition to the benefits of the cellular telephone device providing an โ internet data pipe โ and / or a cellular telephone connection to transmit the data / control commands , persons of ordinary skill in the art will understand that the preferred cellular phone of the invention preferably can provide many of the benefits herein even without any such connection from the phone to the internet or to a cellular network . by way of example , even in such a โ non - broadcasting โ mode , the cellular phone can be used as a programmable , portable local / service / diagnostic tool , providing a user - friendly interface by which a service technician can extract relevant data , issue commands to the controlled / monitored system , etc . under such conditions , the remote viewer would not be receiving data , but the local service technician can benefit from a powerful tool not presently available to him . also under those conditions , the cell phone preferably is capable of storing the data for subsequent transmission ( such as via the internet or the cellular connection ). [ 0065 ] fig5 illustrates a block diagram of a preferred remote monitoring and control system for a network of embedded sensors and control devices . the erm technology provides an end - to - end solution , encompassing everything required for remote monitoring and control โ from the erm sensor node , the erm gateway , to the erm server , providing a central gateway for all end - user access . [ 0066 ] fig6 depicts the data - flow of the preferred software architecture for the present invention โ from the erm sensor node , the embedded gateway , then central server , and the end - user &# 39 ; s web browser . ( note that all connections to the internet preferably are originated by the remote gateway โ thereby thwarting any remote attacks ). persons of ordinary skill in the art will understand that the erm server can be suitably practiced on any number of computing platforms . a preferred embodiment is a 750 mhz pentium iii computer , preferably running redhat linux version 7 . 0 or above , with a high - speed internet connection . the preferred software infrastructure can be broken down into four ( 4 ) categories : 1 . ermmonitor โ java program , which handles incoming data from erm installations ( tim &# 39 ; s ), alerts , data storage in the database , and all โ live โ web browser connections . 2 . ermcontrol โ java program , which handles โ control โ connections from web browser applet ( s ), queuing up and serving commands to erm installations ( tini &# 39 ; s ). 3 . webscripts โ linux cron jobs , which run periodically to generate dynamic web content including cell phone pages , web statistics , and alert / error logs . 4 . database โ a mysql db running on the same linux box , maintaining a central repository for all incoming data . in the preferred embodiment of the invention , all site - specific configuration information is accessed through web pages on the erm server , using cgi / perl scripts , providing end - user access to things like name , address , phone , e - mail , pager , password , as well as access to user - specific / selectable options โ cell phone page , alerts , etc . [ 0073 ] fig7 is a software flowchart for a preferred ermmonitor application , which runs on the evcm server โ accepting udp datagrams from the remote embedded gateway devices . the udp datagram is processed based on the stored configuration information โ individually extracting each remote data block . the ermmonitor application preferably then forwards the latest data to each of three ( 3 ) threads : 1 . log file / database storage ; 2 . alert generation / e - mail notification ; and 3 . browser applet server . [ 0074 ] fig8 is a software flowchart for a preferred ermcontrol application , which runs on the erm server โ managing control to and from the remote embedded control devices . tcp socket connections from web browser java applets are accepted โ providing a secure mechanism for authentication and authorization , prior to accepting any requested commands . tcp socket connections are also accepted from the remote embedded gateway ( s ), where individual commands are extracted from the controlqueue maintained on the erm server . the apparatus and methods of my invention have been described with some particularity , but the specific designs , constructions and steps disclosed are not to be taken as delimiting of the invention . obvious modifications will make themselves apparent to persons of ordinary skill in the art , all of which will not depart from the essence of the invention and all such changes and modifications are intended to be encompassed within the appended claims . | 7 |
referring now more particularly to fig1 to 3 of the drawings which show our presently preferred mode of carrying out the invention with a hook - shaft 1 shown in cross - section positioned within a bushing 11 which is provided with lubrication inlet 2 and lubrication outlet 3 , spaced from each other . positioned between lubrication inlets 2 and 3 is a hook shaft oil inlet 23 within bushing 11 . the arrows in inlet 2 and outlet 3 show the direction of flow . oil flows into inlet 2 in a direction transverse to hook shaft axis 5 , and out from outlet 3 through oil - flow paths or conduits 31 , 32 and 33 . conduits 31 and 33 are transverse to hook shaft axis 5 , and conduit 32 is substantially parallel to hook shaft axis 5 . hook - shaft 1 is provided with a hollow interior and has a reduced area portion 4 positioned between hook - shaft inlet 23 and hook - shaft outlet 22 . oil from lubrication inlet 2 passes through wick 13 in inlet 2 and flows between bushing 11 and hook shaft 1 to inlet 23 through shaft 19 to hook shaft outlet 22 to outlet 3 through conduits 31 , 32 and 33 . in fig1 to 3 , one end of the hollow channel is closed off by an adjustment screw 14 having its head closing off the left - hand side of the hook - shaft , as shown in the drawing , and its shank or shaft portion 19 extending through the interior of the hook - shaft and being sufficiently narrowed to extend past the reduced area portion 4 . the other side of hook - shaft 1 is provided with a closure wall and closure member 15 having an oil supply channel 6 . the oil supply channel 6 has a longitudinal axis which is eccentric to or displaced from the axis of hook shaft 1 . in this embodiment oil - supply - channel 6 is neither co - axial with nor aligned with longitudinal axis 5 as will be explained subsequently during the explanation of the operation . as a further feature of the invention , a plug of porous foam material 7 is placed within a bore 26 of the hook - shaft 1 , and is held in place against closure member 15 by means of pressure member 18 carried at the end of shaft 19 coupled with screw 14 . screw 14 cooperates with the interior of hook - shaft 1 at the left - end 20 thereto as viewed in the drawing to maintain porous material 7 juxtaposed to closure member 15 . depending on the pressure on the porous material , the oil supply to the oil supply channel can be regulated . outer portion of hook - shaft 1 is provided with a spiral undercut 12 which works in connection with bushing 11 as a pump . referring now more particularly to fig4 and 5 , which show another embodiment of the invention , like parts will be designated by adding the number 200 , and as shown , hook - shaft 201 is provided with closure member 215 having an eccentric oil supplying channel 206 . porous material 207 is shown somewhat differently from porous material 7 and an insert part 208 is provided . the porous material is held against the closure member 215 by means of pressure member 218 which is shown with a pointed end 229 . pressure member 218 is connected with shaft 219 . in order to maintain the porous material raised above the bottom portion 227 of interior bore 226 of the hollow shaft 201 , there is insert part 208 . insert part 208 can be made from metal , plastic or any other type of solid material . the purpose of insert part 208 is to prevent the porous material 207 from soaking up oil which collects in the bottom of the hollow hook - shaft , if the machine is stopped in the position shown in fig3 . referring now more particularly to fig6 and 7 of the drawings , there is shown a hook - shaft 401 which is closed at end 424 . closed end 424 is provided with an oil supply channel 406 co - axially positioned and aligned with the longitudinal axis 405 of hook - shaft 401 and provided with a spring 410 wound about the outer circumferential surface of porous material 407 . it is to be understood that there is an oil inlet and an outlet ( not shown ) similar to that shown in fig1 and 2 . shaft 419 contains pressure member 418 to hold porous material 407 under pressure and in place against the inner portion 425 of closed end 424 , and to press or depress porous material in order to control oil supply to oil supply channel 406 . fig1 to 3 show a cross - sectional view of the hook - shaft 1 with bushing 11 . spiral groove 12 cut into the outer surface of the hook - shaft 1 causes oil to be pumped from wick 13 which is inserted in inlet 2 of bushing 11 and connected with oil reservoir 9 and hook - shaft inlet 23 into hollow hook - shaft 1 through outlet 22 , while the machine is running . the centrifugal force distributes the oil as a thin film onto the inner surface 26 of hook - shaft 1 . the decreased diameter of hook - shaft 1 in the reduced area 4 works as a control for the quantity of oil available for hook oiling . the spiral undercut 12 , as best seen in fig1 and 2 is triangular . the spiral on the outer surface of the hook - shaft pumps oil from inlet 2 through hook - shaft inlet 23 into hollow hook shaft 1 . if the oil film becomes too thick , excessive oil crawls over the shoulder in reduced area 4 towards hook - shaft outlet 22 and flows back through outlet 3 to an oil reservoir ( not shown ); another part of this oil is immediately transported by spiral 12 to inlet 23 and then back into the hollow hook - shaft . therefore , the fig1 to 3 embodiment achieves a constant amount of oil available for hook oiling depending on the location of reduced area 4 and the decreased diameter thereof . furthermore , the inner surface 26 of the hook - shaft 1 can be roughened or provided with grooves in order to control crawling - speed of the oil . the oil crawls due to centrifugal force to the oil - supply - channel 6 and finally reaches the hook . the oil supply to the hook also depends on the diameter of the oil - supply - channel 6 and its location . as the hook - shaft 1 revolves , the spiral 12 on its outer surface 21 pumps oil through the inlet 23 into the hollow hook - shaft . the pump effect is stronger than the centrifugal force . as soon as the oil enters the hollow hook - shaft , an oil film develops under the centrifugal force on the inner surface 26 . the oil , therefore , is driven along the inner surface of the hook - shaft to the left and the right of inlet 23 ( see fig1 ). the barrier in area 4 stops the oil from crawling to the left . therefore , the oil film becomes thicker until the thickness of the oil film exceeds the barrier in area 4 and crawls to outlet 22 ( the reason for this crawling effect is the centrifugal force ). depending on the increased diameter of the hollow hook - shaft in area 4 ( design parameter ), the thickness of the oil film can be factory set . the speed with which the oil crawls on the inner surface of the hook - shaft , under the influence of the centrifugal force , depends on the inner surface 26 of the hook - shaft . therefore , a means to control the crawling speed of the oil is to roughen the inner surface 26 or provide it with spiral grooves . the above - described design therefore assures a constant thickness of the oil film in the hook - shaft . depending on the location of the oil supply channel 6 , a design parameter , and the set thickness of the oil film , the amount of oil with which the hook is supplied can be a factory set design parameter . however , this embodiment of the idea does not allow to adjust the oil supply . by inserting a piece of porous material 7 which can be pressed or depressed , the oil supply can be adjusted . in this embodiment , during machine standstill , the porous material 7 soaks up the oil which collects in the lower part of the inner hook - shaft . a solution is to stop the machine in a position where the oil supply channel is located in the upper part of the hook - shaft and an insert part 208 is arranged in the lower part of the hook - shaft to prevent the porous material from soaking up oil during machine standstill . the fig1 to 3 embodiment of the invention , as noted , also works quite well without the block of porous material 7 . however , it is preferred to use the block of porous material 7 . it is important , when the sewing machine is stopped , that the oil - supply - channel 6 be located in the upper part of the hook - shaft 1 as shown in fig1 . this maintains the oil which collects when the machine is stopped in the lower part of the hook - shaft 1 and prevents the oil from flowing through the oil - supply - channel 6 . the block of porous material 7 which can be pressed by adjustment screw 14 operates as an oil - supply adjustment device in the fig1 embodiment . when adjustment screw 14 and porous material 7 are pressed together , less oil is supplied to the hook and when released more oil is supplied . this adjustment device for certain purposes may not provide sufficient control and may cause porous material 7 to soak up oil when the machine stops , and therefore the hook may be supplied with excessive oil when the machine starts again . the rough surface 426 ( fig6 ) is the result of machining a very fine spiral groove along the inside surface of the hollow hook - shaft 401 . the spirals on the inside and the rough surface of the inside of shaft 1 , 201 or 401 allow a more precise control of the oil flow in the inside of the hollow hook - shaft . an improved embodiment for an adjustment device according to the invention is shown in fig4 and 5 . in this embodiment , insert part 208 maintains and prevents porous material 207 from touching the oil which collects in the lower part or portion of the hook - shaft 1 when the sewing machine stops . for this purpose , insert part 208 plays an essential part . the two design possibilities permit the supplying of the hook - shaft with oil during the entire sewing machine operation cycle . in fig6 and 7 , the block of porous material 7 which is designated 407 is surrounded by spring 410 according to the invention . certain parts are omitted from fig6 and 7 but , if they were shown , they would be designated with numbers in the 400 range . this arrangement assures that the porous material 407 regains its original shape after the screw 14 in fig1 which would be designated 414 in fig6 and 7 , is screwed outwards so that the soaking of oil is performed faster and referring to pollution of the oil the required function of the porous material 407 provided for increased time of usage . an additional spring 410 which surrounds the porous material 407 assures that the material depresses properly and increases the outer surface of the porous material . the embodiment shown in fig6 and 7 shows the oil channel 406 located concentrically with the hook - shaft axis 405 . with the oil supply channel 406 located as described , oil will only be supplied to the hook during the start phase . during the running phase , the centrifugal force presses the oil against the inner surface of the hook - shaft and , therefore , no oil will be supplied through oil channel 406 . this embodiment can therefore only be used in machines with a short sewing cycle . however , a positioning of the oil channel after machine stop is not necessary . the fig6 and 7 embodiment is primarily intended for an adjustment device according to the invention which supplies the hook with oil only during machine start so that it will be sufficient for a short operation cycle . oil - supply - channel 406 is arranged concentrically to the hook - shaft - axis 405 . during machine stoppage , the porous material 407 soaks up oil and supplies the hook with oil during the machine &# 39 ; s start - up time . during machine operation , the hook is not supplied with oil . therefore , this device should primarily and preferably only be installed in machines with a relative short operation cycle . while there has been shown what is considered to be the preferred embodiments of the invention , it will be obvious to those skilled in the art that various changes and modifications may be made therein without departing from the scope of the invention . | 3 |
generally speaking , the present inventive method for testing and assessing adhd is based upon earlier findings that indicated that the highest degree of differentiation between adhd patients and non - adhd controls was noted at the vertex [ 29 ]. therefore , the cz cranial site was selected for placement of the active electrode in performing the qeeg assessment . prior studies [ 24 , 30 ] had also indicated that differentiation between groups occurred when participants were involved in scholastic tasks ( e . g ., reading , listening , drawing ), as would have been expected . therefore , the difficulty sustaining attention during completion of these types of tasks ( as manifested on the qeeg testing ) provides a neurometric index for identifying the presence and degree of adhd . referring to fig1 the testing apparatus of this invention is illustrated . a vga monitor 14 is used to observe the testing being performed . the monitor 14 is connected to a personal computer 19 , having a minimum 486 operating system . the computer 19 is connected to a digital processing card 18 ( contained in an autogenics a - 620 instrument ) and an analog - to - digital converter 17 ( stoelting autogenics part no . 7000 - 08 ) that is connected to a single channel , dual frequency eeg 16 ( autogenics a - 620 eeg instrument ). the computer 19 is also connected to a computer storage site 20 containing the normative index data base . the basis of this invention involves obtaining qeeg recordings using the single channel eeg recording device 16 . the computer 19 is programmed to select and statistically analyze specific eeg frequency bands . the eeg 16 and the associated software for programming the computer 19 consist of an autogenics a - 620 electroencephalograph with associated assessment software provided by the stoelting - autogenics company located in wood dale , ill . the individual 15 is connected to the single channel eeg device 16 via a monopolar ( referential ) eeg cable with junction box ( autogenics part no . 800 - 032 m ), not shown . this system provides clinicians with a quantitative analysis of electrophysiological recordings in two frequency bands : theta ( 4 - 8 hz ) and beta ( 13 - 21 hz ). four short periods ( 90 seconds each ) of digitized eeg are obtained . a fast fourier transformation algorithm , commonly utilized in this field , is used to process the signals and transform them into the data required for evaluation of adhd . referring to fig2 a and 2b , a flow chart 100 depicts the sequential steps of the testing method for quantitatively diagnosing and evaluating adhd in individuals using the apparatus shown in fig1 . the individual being tested is prepared , step 101 , and the eeg electrode is attached to the scalp at cranial site cz , step 102 . thereafter , ear electrodes are attached to the individual &# 39 ; s ear lobes , step 103 . impedance and offset potentials are obtained , step 104 . particular eeg frequency bands are then selected for the adhd assessment , step 105 . the eeg signals are amplified and digitized , step 106 during a 90 second period , in which the individual maintains an eyes open fixed gaze . then a fourier analysis of the signals is obtained , step 107 . the signal is analyzed for muscular and ocular movement artifact , step 108 . the computer 19 ( fig1 ) then processes the data and calculates the electrophysiological power ( pw ) recorded at 4 - 8 hz and 13 - 21 hz , step 109 , as well as a ratio of power ( theta / beta ) at these frequencies , step 110 . the individual is then given a number of tasks requiring attention . from a first test , step 111 , an attention ratio ( theta / beta power ratio ) is obtained . additional attention tasks are given to the individual , step 111 , which require repetition of steps 105 through 110 , as shown by exit line 112 and flow chart connector b . thereafter , the overall neurometric index is computed , step 113 . the tested index obtained in step 113 is then compared to a normative database index that has been determined during investigations conducted by the inventors , step 114 . the following is a more detailed step - by - step description of a typical test procedure used in this invention . 1 . the vertex ( cz ) is located using the international 10 - 20 system of electrode placement . 2 . the area is cleaned using omni prep ( or equivalent ) and isopropyl alcohol . a small amount of conductive paste ( e . g ., ten 20 ) is applied to the scalp and a grass gold disc electrode with hole ( e5gh ) and the sensor are attached to the scalp . a similar cleaning procedure is used for preparing the ear lobes . one pair of gold disc electrodes in ear clip ( grass e34d ) is attached to each ear lobe . quality of preparation is assessed via an autogenics electrode tester . impedance reading is set below 10 kohms . offset potential is set below 10 mv before recordings are obtained . 3 . band frequencies are selected with 4 - 8 hz defined as theta and 13 - 21 hz defined as beta . once the sensors are tested and band frequencies defined , the individual &# 39 ; s electrophysiological activity at cz is recorded during the following 90 second tasks : a ) eyes fixed baseline : the patient is seated in front of the computer monitor display and instructed to focus his / her gaze on the monitor &# 39 ; s &# 34 ; on / off &# 34 ; indicator light . eeg recordings are obtained for 90 seconds . after the task is completed , the eeg record is reviewed in two second intervals (&# 34 ; epochs &# 34 ;) in order to manually filter out epochs containing excessive emg artifact ( e . g ., body movement , eye rolls or blinks ). a minimum of 15 low artifact epochs ( i . e ., no evidence of eye rolls / blinks and peak emg output below 15 mv ) is required for completion of this task . b ) silent reading : the next 90 second task is reading . material that is age or grade appropriate is selected from school reading texts , reading tasks from the kaufman test of educational achievement , the peabody individual achievement test , or other age - related reading tests , and the material is read silently by the patient . again , after completion of this task , the eeg is reviewed in two second intervals to eliminate epochs with excessive emg activity or eye movement / blink artifact . a minimum of 15 low artifact epochs is required for completion of this assessment task . c ) listening : a 90 second listening task occurs next . age appropriate material is selected and read by a clinician , as described for task ( b ), above . eeg review is conducted , as with tasks ( a ) and ( b ). d ) drawing : a stable drawing surface is placed in front of the individual . the person is instructed to copy geometric figures from one of the following tests : beery - bender gestalt , benton visual retention test , mccarthy scales of child development . electrophysiological activity is recorded for 90 seconds with review , as for the aforementioned tasks . after the data is collected , a statistical analysis is performed . the analysis is first conducted by task and a ratio of electrophysiological power produced and recorded at 4 - 8 hz is divided by the power recorded at 13 - 21 hz . a separate ratio is calculated for each task . finally , an average ratio for the four tasks is calculated and an attentional index is derived . it is this attentional index that is used for comparison with the normative database . the specifications of the equipment used in the development of the current invention were as follows : signal acquisition was obtained using the aforementioned a - 620 eeg device . input was single channel , dual frequency . gain was 50 , 000 . noise was less than 1 mv pp , referred to input . differential input impedance was 200 kohms . common mode rejection ratio was greater than 100 db . amplitude range was 1 - 100 mv , rms . eeg frequency bands that could be recorded with this equipment ranged from 1 . 0 hz to 32 hz . sampling rate was 128 . a / d resolution was 12 bits ( 0 . 05 mv ). emg was also recorded with the a - 620 eeg device ( band pass frequency was 100 - 300 hz , fixed ). computer requirements were a pc , the minimum requirement being a 486 machine . in order to assess the ability of this invention to meet the standards for a valid and reliable assessment process , a series of studies have been conducted by the inventors [ 30 ]. although in the initial study [ 24 ], the inventors established a database founded on a qeeg examination of 482 individuals , cross validation , construct validation and test - retest reliability studies were required . for these reasons , five additional studies were conducted [ 30 ]. in the first study , the inventors compared the qeeg derived attentional index of 96 individuals diagnosed with adhd and 33 &# 34 ; non - clinical &# 34 ; controls , none of whom had participated in the initial validation study . this study was intended as a cross - validation study with non - clinical controls . anova results indicated significant differences between the two groups ( adhd vs . control ), with cortical slowing noted in members of the adhd , inattentive and the adhd , combined groups . using the critical values for cortical slowing established in the normative study as the basis for classification as adhd or non - adhd , 93 % of the individual participants were accurately classified . next , the qeeg derived attentional index was examined in 155 participants . of these individuals , 129 were classified as adhd , using the selection criteria developed in the initial study [ 24 ]; 13 individuals were classified with depressive disorders and 13 were classified with an oppositional defiant disorder based on rating scales and dsm - iv criteria . none of these individuals had participated in the initial validation study . significant differences were again noted in the results of the qeeg data , with cortical slowing only noted in the adhd groups . classification as adhd or non - adhd was accurate for 94 % of the participants . it was considered significant that the results of this study demonstrated that common co - morbid conditions , such as depression and oppositional defiant disorders , are not characterized by cortical slowing on the eeg . it was also considered significant that the absence of cortical slowing in the qeeg &# 39 ; s of patients diagnosed with oppositional defiant disorders and depression is consistent with pet and spect findings . amen and carmichael [ 31 ], using spect , reported increased activity in the anterior medial aspects of the frontal lobes in patients diagnosed with oppositional defiant disorder . previously , hollander [ 32 ], machlin [ 33 ], mordahl [ 34 ] and swedo [ 35 ] reported a similar pattern of increased metabolic activity , bilaterally , in the anterior medial portions of the frontal lobes on pet and spect examinations of patients diagnosed with affective disorder . as in the inventors &# 39 ; qeeg studies , cortical slowing was not observed in pet or spect procedures examining patients diagnosed with an affective or oppositional disorder . in order to assess the &# 34 ; construct &# 34 ; validity of their qeeg process , the inventors next examined the degree of diagnostic agreement between classification based on the attentional index and that derived from a cpt ( the test of variables of attention ). in this study 155 individuals were examined ( the same participants as described above ). as reported previously , 129 of these participants were classifiable with adhd , the remainder as either depressed or with oppositional defiant disorder . agreement between classification determined by the cpt and the qeeg was noted in 88 % of the participants . the degree of agreement was significant ( p & lt ; 0 . 001 ). in the fourth study , 83 participants classifiable as adhd using the previously described selection criteria and 18 clinical controls ( 9 with depressive disorders , 9 with oppositional defiant disorder ) were evaluated with the qeeg screening procedure as well as the addes . consistency between the two measures was assessed . the rate of agreement was 83 % ( p & lt ; 0 . 001 ). overall , the results of the construct validation studies provided further support for the qeeg measure as a laboratory test for adhd . finally , the inventors reported a test - retest reliability study of 55 individuals who met research criteria for classification as either adhd , inattentive or combined types . these individuals were evaluated on two occasions . during each assessment session , the qeeg scanning procedure for adhd was conducted over four conditions ( eyes open baseline , reading , listening , drawing ). each condition was 90 seconds in duration . an attentional index was calculated as in previous studies and the consistency of this index over the two testing sessions ( conducted 30 days apart ) was calculated . the correlation coefficient ( r = 0 . 96 ) revealed a significant level of consistency ( p & lt ; 0 . 01 ) between the two qeeg - derived attentional indices . barkley , r . a . ( 1998 ). attention - deficit hyperactivity disorder : a handbook for diagnosis and treatment , ( 2nd edition ). new york : guilford press . american psychiatric association . ( 1994 ). diagnostic and statistical manual of mental disorders , ( 4th edition ). washington , d . c . : author . zametkin , a . j ., ernst , m ., & amp ; silver , r . ( 1998 ). laboratory and diagnostic testing in child and adolescent psychiatry : a review of the past 10 years . journal of the american academy of child and adolescent psychiatry , 37 , 464 - 472 . barkley , r . a ., mcmurray , m . b ., edelbrock , c . s ., & amp ; robbins , k . ( 1990 ). the side effects of ritalin : a systematic placebo controlled evaluation of two doses . pediatrics , 86 , 184 - 192 . swanson , j . m ., mcburnett , k ., christian , d . l ., & amp ; wigal , t . ( 1995 ). stimulant medications and the treatment of children with adhd . in t . h . ollendick & amp ; r . j . prinz ( eds . ), advances in clinical child psychology ( vol . 17 , pp . 265 - 322 ). new york : plenum . achenbach , t . m ., & amp ; edelbrock , c . s . ( 1983 ). manual for the child behavior profile and child behavioral checklist . burlington , vt . : author . conners , c . k . ( 1969 ). a teacher rating scale for use in drug studies with children . american journal of psychiatry , 126 , 884 - 888 . dupaul , g . j . ( 1990 ). the adhd rating scale : normative data , reliability and validity . worcester : university of massachusetts medical center . mccarney , s . b . ( 1989 ) attention deficit disorders evaluation scale . columbia , mo . : hawthorne . conners , c . k . ( 1994 ). conners &# 39 ; continuous performance test manual . toronto : multi - health systems , inc . greenberg , l . m . ( 1994 ). t . o . v . a . continuous performance test manual . los alamatos , calif . : universal attention disorders . blondis , t . a ., accardo , p . j ., & amp ; snow , j . h . ( 1989 ). measures of attention deficit : i . questionnaires . clinical pediatrics , 28 , 222 - 228 . corkum , p . v ., & amp ; siegel , l . s . ( 1993 ). is the continuous performance task a valuable research tool for use with children with attention - deficit - hyperactivity disorder ? journal of child psychology & amp ; psychiatry & amp ; allied disciplines , 34 , 1217 - 1239 . casey , b . j ., castellanos , f . x ., giedd , j . n ., marsh , w . l ., hamburger , s . d ., schubert , a . b ., vauss , y . c ., vaituzis , a . c ., dickstein , d . p ., sarfatti , s . e ., & amp ; rapoport , j . l . ( 1997 ). implication of right frontostriatal circuitry in response inhibition and attention - deficit / hyperactivity disorder . journal of the american academy of child and adolescent psychiatry , 36 , 374 - 383 . zametkin , a . j ., nordahl , t . e ., gross , m ., king , a . c ., semple , w . e ., rumsey , j ., hamburger , s ., & amp ; cohen , r . m . ( 1990 ), cerebral glucose metabolism in adults with hyperactivity of childhood onset . new england journal of medicine , 323 , 1361 - 1366 . amen , d . g ., paldi , j . h ., & amp ; thisted , r . a . ( 1993 ). evaluating adhd with brain spect imaging . journal of the american academy of child and adolescent psychiatry , 32 , 1081 - 1091 . hynd , g . w ., hern , k . l ., novey , e . s ., eliopulos , d ., marshall , r ., gonzalez , j . j ., & amp ; voeller , k . k . ( 1993 ). attention deficit hyperactivity disorder and asymmetry of the caudate nucleus . journal of child neurology , 8 , 339 - 347 . semrud - clikeman , m ., filipek , p . a ., biederman , j ., steingard , r ., kennedy , d ., renshaw , p ., & amp ; bekken , k . ( 1994 ). attention - deficit hyperactivity disorder : magnetic resonance imaging morphometric analysis of the corpus callosum . journal of the american academy of child and adolescent psychiatry , 33 , 875 - 881 . castellanos , f . x ., giedd , j . n ., eckburg , p ., marsh , w . l ., vaituzis , c ., kaysen , d ., hamburger , s . d ., & amp ; rapoport , j . l . ( 1994 ). quantitative morphology of the caudate nucleus in attention deficit hyperactivity disorder . american journal of psychiatry , 151 , 1791 - 1796 . castellanos , f . x ., giedd , j . n ., marsh , w . l ., hamberger , s . d ., vaituzis , a . c ., dickstein , d . p ., sarfatti , s . e ., vauss , y . c ., snell , j . w ., lange , n ., kaysen , d ., krain , a . l ., ritchie , g . f ., rajapakse , j . c ., & amp ; rapoport , j . l . ( 1996 ). quantitative brain magnetic resonance imaging in attention - deficit hyperactivity disorder . archives of general psychiatry , 53 , 607 - 616 . mann , c . a ., lubar , j . f ., zimmerman , a . w ., miller , b . a ., & amp ; nuenchen , r . a . ( 1992 ). quantitative analysis of eeg in boys with attention deficit / hyperactivity disorder ( adhd ). a controlled study with clinical implications . pediatric neurology , 8 , 30 - 36 . chabot , r . a ., & amp ; serfontein , g . ( 1996 ). quantitative electroencephalographic profiles of children with attention deficit disorder . biological psychiatry , 40 , 951 - 963 . monastra , v . j ., lubar , j . f ., linden , m ., vandeusen , p ., green , g ., wing , w ., phillips , a ., & amp ; fenger , t . n . ( 1998 ). assessing adhd via quantitative electroencephalography : an initial validation study . neuropsychology , in press . lubar , j . f . ( 1997 ) neocortical dynamics : implications for understanding the role of neurofeedback and related techniques for the enhancement of attention . applied psychophysiology and biofeedback , 22 , 111 - 126 . sterman , m . b . ( 1996 ). physiological origins and functional correlates of eeg rhythmic activities : implications for self - regulation . biofeedback and self - regulation , 21 , 3 - 33 . lubar , j . f ., bianchini , k . i ., calhoun , w . h ., lambert , e . w ., brody , z . h ., & amp ; shabsin , h . w . ( 1985 ). spectral analysis of eeg differences between children with and without learning disabilities . journal of learning disabilities , 18 , 403 - 408 . cooley , j . w ., & amp ; tukey , j . w . ( 1965 ). an algorithm for the machine calculation of complex fourier series . mathematics of computation , 19 , 267 - 301 . lubar , j . f ., swartwood , m . o ., swartwood , j . n ., & amp ; timmermann , d . l . ( 1996 ). quantitative eeg and auditory event - related potentials in the evaluation of attention - deficit / hyperactivity disorder : effects of methylphenidate and implications for neurofeedback training . journal of psychoeducational assessment ( monograph : assessment of attention - deficit / hyperactivity disorders , pp . 143 - 204 ). monastra , v . j ., lubar , j . f ., & amp ; linden , m . ( 1998 ). assessing adhd via quantitative electroencephalography : test validation and reliability studies . presented at ch . a . d . d .&# 39 ; s tenth annual conference , new york . paper in preparation . amen , d . g ., & amp ; carmichael , b . a . ( 1997 ). oppositional children similar to ocd on spect : implications for treatment . journal of neurotherapy , 2 , 1 - 7 . hollander , e . ( 1992 ). hyperfrontality and serotonin in ocd . presented at the annual meeting of the american psychiatric association . machlin , s . r ., harris , g . j ., peralson , g . d . ( 1991 ). elevated medial - frontal cerebral blood flow in obsessive - compulsive patients : a spect study . american journal of psychiatry , 148 , 1240 - 1242 . nordahl , t . e ., benkelfat , c ., & amp ; semple , w . e . ( 1989 ). cerebral glucose metabolic rates in obsessive compulsive disorder . neuropsychopharmacology , 2 , 23 - 38 . swedo , s . e ., schapiro , m . b ., & amp ; grady , c . l . ( 1989 ). cerebral glucose metabolism in childhood onset obsessive compulsive disorder . archives of general psychiatry , 46 , 518 - 523 . since other modifications and changes varied to fit particular operating requirements and environments will be apparent to those skilled in this scientific field , the invention is not considered limited to the example chosen for purposes of disclosure and covers all changes and modifications which do not constitute departures from the true spirit and scope of this invention . having thus described the invention , what is desired to be protected by letters patent is presented in the subsequently appended claims . | 0 |
fig1 is a block diagram of a preferred embodiment of the led controller according to the present invention . as shown in fig1 , the led controller 10 comprises a sensing unit 11 , a control unit 12 , and a driving unit 13 . the sensing unit 11 can detect the luminous intensity of a led ( within the driving unit 13 and not shown in fig1 ), and output a corresponding sensing signal . in one embodiment , the sensing unit 11 employs a photodiode ( not shown ) to detect the luminous intensity . the control unit 12 , coupled to the sensing unit 11 , can determine if the luminous intensity of the led reaches a predetermined value according to the sensing signal . then , the control unit 12 outputs a control signal to the driving unit 13 . when the intensity reaches the predetermined value , the control unit 12 remains to output the original control signal such that the driving unit 13 can keep the luminous intensity at the predetermined value . however , when the intensity deviates from the predetermined value , the control unit 12 would adjust the control signal such that the driving unit 13 can change the luminous intensity ( described later ). in one embodiment , the color of the led is one of red , green and blue , and the led is used to mix white light . in the colorimetry suggested by the commission international de l &# 39 ; eclairage ( cie ), white can be represented as a linear combination of red , green and blue . thus , the predetermined value can be generated according to the cie colorimetry . for example , if the color of the led is blue , the proportion of blue in the above linear combination can be used as the predetermined value . after adjusting the luminous intensity to the predetermined value , the control unit 12 can further determine if the led is aging by comparing the control signal and the subsequent sensing signal . that is , the control unit 12 can record the values of the control signal and the corresponding ideal values of the sensing signal in a table . when the โ actual โ value of the sensing signal is lower than the ideal value over a default degree , it means that the led intensity does not reach the expected value , and then the led can be judged as aging . if the led is aging , its intensity is subject to deviate from the predetermined value . thus , the control unit 12 would require the sensing unit 11 to perform detection again after a shorter time . on the other hand , if the led is not aging , its intensity is not subject to deviate from the predetermined value . thus , the control unit 12 would require the sensing unit 11 to perform detection again after a longer time . fig2 is a block diagram showing a preferred embodiment of the control unit 12 of fig1 . in fig2 , the control unit 12 comprises an analog - to - digital converter ( adc ) 121 , a microprocessor 122 and a memory 123 . the adc 121 can convert the above analog sensing signal into a digital response value of the luminous intensity . the memory 123 can record the correspondence between the value of the control signal and the ideal response value , and the correspondence can be used to judge if the led is aging . the microprocessor 122 , coupled to the adc 121 and the memory 123 , can execute related operations to determine whether the led intensity reaches the predetermined value according to the actual response value provided by the adc 122 . besides , the microprocessor 122 accesses the memory 123 and calculates the difference between the actual and ideal response values , thereby judging if the led is aging . the driving unit 13 is coupled to the control unit 12 , and drives the led according to the control signal provided by the control unit 12 . fig3 is a block diagram showing a preferred embodiment of the driving unit 13 of fig1 . in fig3 , the driving unit 13 comprises a led unit 131 , a first adjusting unit 132 and a second adjusting unit 133 . in this embodiment , the control signal includes a driving signal , a pwm signal and a switch signal . the led unit 1 131 includes the led and associated control circuit , and switches between a โ light - on โ state and a โ light - off โ state according to the switch signal . also , the led unit 131 can receive the driving signal and drive the led to emit a corresponding luminous intensity . the first adjusting unit 132 receives the pwm signal and generates a corresponding adjusting signal to the led unit 131 , thereby adjusting the luminous intensity of the led . by changing the pulse width of the pwm signal , various adjusting signals can be generated to adjust the intensity by different degrees . the second adjusting unit 133 generates a feedback signal to the control unit 12 , and then the control unit 12 generates the corresponding driving signal according to the feedback signal . thus , by adjusting the feedback signal , the driving signal can be changed , and the led intensity can further be adjusted . besides , the second adjusting unit 133 can accelerate discharge for the led when the led unit 131 switches from the light - on state to the light - off state , thereby enabling a more rapid and precise switch . fig4 is a detailed circuit diagram of the driving unit 13 of fig3 . in fig4 , the led unit 131 comprises : a led for receiving the driving signal , a n - channel metal oxide semiconductor ( nmos ) q 1 coupled to the led and used as a switch , and a resistor r 1 with one end coupled to ground and the other to the drain of q 1 . the first adjusting unit 132 comprises : an operational amplifier op 1 with a non - inverting input , an inverting input and an output , wherein the inverting input receives the pwm signal and the non - inverting input is coupled to ground ; a resistor rd coupled between the non - inverting input and the output ; and a resistor rs coupled between the output and the led unit 131 . the adjusting unit 133 comprises : a power source vcc , a resistor r 2 coupled to vcc , a pmos q 2 used as a switch , a variable resistor r 3 coupled to vcc and the source of q 2 , and a resistor r 4 coupled between the sources of q 1 and q 2 . as shown in fig4 , the switch signal is applied to the gates of q 1 and q 2 such that q 1 and q 2 are not connected simultaneously . when q 1 is connected , q 2 is disconnected . at this time , a current is generated by the driving voltage v i ( i . e . the driving signal ) to flow through the led , and the led is in the light - on state . the first adjusting unit 132 uses op 1 to convert the pwm signal provided by the control unit 12 into a corresponding current and sends it to the led unit 131 , thereby generating a fine - tuning effect on the current flowing through the led . in addition , the second adjusting unit 133 feedbacks a voltage value v f ( i . e . the feedback signal ) to the control unit 12 so as to generate the corresponding driving voltage v i . compared to the first adjusting unit 132 , the second adjusting unit 133 performs a rough tuning on the led current . on the other hand , when q 2 is connected , q 1 is disconnected . at this time , the connected q 2 provides a discharge path to accelerate the discharge of the led , thereby achieving the effect of rapid switch mentioned above . fig5 is a flow chart of a preferred embodiment of the led control method according to the present invention . as shown in fig5 , the flow comprises the steps of : 51 generating a control signal to drive a led ; 52 sensing a luminous intensity value of the led ; 53 determining whether the luminous intensity value reaches a predetermined value , if yes then jumping to step 55 , otherwise proceeding to step 53 ; 54 adjusting the control signal and jumping to step 52 ; 55 determining whether the led is aging , if no then jumping to step 57 , otherwise proceeding to step 56 ; 56 waiting a first time and jumping to step 52 ; and 57 waiting a second time and jumping to step 52 . if the step 53 determines that the luminous intensity value does not reach the predetermined value , the steps 52 to 54 are executed repeatedly until the intensity value reaches the predetermined value . in one embodiment , the color of the led is one of red , green and blue , and in the step 53 , the predetermined value is generated according to the cie colorimetry . besides , if the luminous intensity value reaches the predetermined value , then the step 55 is executed to determine whether the led is aging . this determination is performed by comparing the control signal and the subsequent luminous intensity value . if the led is aging , a shorter first time is waited ( step 56 ) and then the step 52 is executed again to perform detection . if the led is not aging , a longer second time is waited before the step 52 is executed again ( step 57 ). while the present invention has been shown and described with reference to the preferred embodiments thereof and in terms of the illustrative drawings , it should not be considered as limited thereby . various possible modifications and alterations could be conceived of by one skilled in the art to the form and the content of any particular embodiment , without departing from the scope and the spirit of the present invention . | 7 |
fig1 illustrates a rectangular microwave circuit board 10 which may be tested by means of the present invention . board 10 has a rectangular shape of dimensions l ร w and consists of a sheet 12 of dielectric material that has been clad with thin layers 14 , 16 of copper or other conducting material . the copper cladding 14 , 16 completely covers the top and bottom of sheet 12 , leaving it exposed only along the edges of the board . sheet 12 has thickness t that typically is in the range of 0 . 01 - 0 . 3 inches . the thickness t has been exaggerated in fig1 and is typically smaller than dimensions l and w by an order of magnitude or more . the copper cladding layers 14 , 16 typically have thicknesses in the range 0 . 0007 - 0 . 0027 inches . for practical microwave applications , dielectric sheet 12 must consist of a low loss , environmentally stable substrate . a common material is fiberglass impregnated with a polytetrafluoroethylene resin , which has a dielectric constant of about 2 . 5 . the techniques of the present invention are , however , not limited to any particular substrate . fig2 illustrates the use of microwave circuit boards in the construction of a microwave antenna . the antenna , shown in partial cross section , consists of microwave circuit boards 20 and 30 and radome 40 stacked together in a generally parallel fashion . the direction of radiation from the antenna is indicated by the arrows . microwave energy is fed to the antenna through a coaxial cable 42 which includes a central conducting element 44 . microwave circuit board 20 consists of dielectric sheet 22 and copper cladding layers 24 , 26 . similarly , board 30 consists of dielectric sheet 32 and copper layers 34 , 36 . randome 40 is typically an inert plastic material whose function is insulation . copper layer 36 of board 30 is etched in a manner dictated by the desired radiation pattern . the copper elements remaining in layer 36 after the etching process are indicated by numeral 37 . microwave energy injected via conducting element 44 travels through microwave circuit boards 20 and 30 to elements 37 , and then is radiated into space . the manner in which power from element 44 is divided among elements 37 is controlled by the etching patterns on facing copper layers 26 and 34 . these layers are commonly eteched in matching and aligned patterns , as indicated in fig2 . an important factor in antenna design is the phase delay experienced by the microwave energy in traveling from conducting element 44 to radiating elements 37 . when the wavelength of the radiation is greater than the thickness of boards 20 and 30 ( tem propagation , with the electric field perpendicular to the plane of the board ), the phase velocity through the dielectric sheet is given by : where c is the velocity of light in a vacuum , and e is the dielectric constant of sheets 22 and 32 . it is therefore apparent that unknown variations in dielectric constant can have a significant impact on antenna circuit design . while knowledge of the average dielectric constant for a board is of some value , it does not help the engineer deal with the problem of local anomalies , which , for example , could cause one of the elements 37 to be out of phase , seriously detracting from antenna performance . the present invention provides an efficient method for detecting such anomalies , before the cost of etching the copper layers has been incurred . boards that do not meet design tolerances can then be rejected or used for less critical applications . fig3 depicts in schematic form the testing of microwave circuit board 50 according to the present invention . board 50 is similar to board 10 shown in fig1 and includes a dielectric sheet 51 indicated in the cutaway portion of fig3 . the method of the present invention comprises measuring values related to the mean dielectric constant along paths 60 - 67 and 68 - 72 through sheet 51 . the measurements are made by means of microwave energy injected along the paths by transmitting horn 52 , which energy is detected by receiving horn 53 . transmitting horn 52 is illustrated schematically as including a feed element 54 and exit aperture 56 . similarly , receiving horn 53 includes entrance aperture 57 and pickup element 55 . details of a preferred horn construction are described more fully below . in fig3 transmitting horn 52 is positioned such that it is capable of injecting a beam of microwave energy edgewise into dielectric layer 51 of board 50 along path 60 , with an effective aperture or beam width b . receiving horn 53 is positioned in alignment with transmitting horn 52 , such that it is capable of receiving microwave energy traveling along path 60 with an effective entrance aperture also equal to b . the distance at which the divergence of radiation from aperture 56 begins to become significant is given by : ## equ1 ## where b is the width of aperture 56 , ฮป is the wavelength of the radiation , and e is the dielectric constant of sheet 51 . negligible beam divergence can be achieved by proper selection of these parameters . thus , for a board 18 inches wide having a dielectric constant of about 2 . 5 , one might choose b = 3 inches , ฮป = 2 / 3 inches ( 18 ghz ), giving a value for d of about 21 inches . the wavelength of the radiation is also selected so that the principal mode of propagation is tem . under such circumstances , equation 1 holds , and there is a known relationship between dielectric constant and wave velocity . to assure that the tem mode predominates , the wavelength should be greater than the thickness of sheet 51 and preferably greater than twice such thickness . for purposes of the present invention , it is assumed that knowledge of the wave velocity through a material is equivalent to knowledge of the dielectric constant of that material . after the mean dielectric constant or other appropriate value has been measured for path 60 , horns 52 , 53 and / or board 50 are repositioned such that path 61 is aligned between the horns , and a similar measurement is made . this process is repeated for paths 62 - 67 . board 50 is then rotated 90 ยฐ with respect to the horns , and the process is continued for paths 68 - 72 . the accumulated values for rows 60 - 67 and columns 68 - 72 are then compared with one another , and the amount of variability is determined . particular comparison methods are discussed below . it is to be understood that the use of eight rows and five columns in fig3 is for illustration only , and that in general the number of rows and columns will depend upon the precision required in a particular application . for paths immediately adjacent the edges of the board ( e . g ., paths 60 , 67 , 68 and 72 ), it will at times be preferable to cover such edges with energy absorbing means ( not shown ) to prevent unwanted reflections . although not a requirement of the present invention , the use of a series of side by side paths of equal width will usually be preferred . if there are gaps between paths , then there will be a chance of missing an area containing an anomaly . overlapping paths may be used , but they require more effort and are generally unnecessary . if the board dimensions are not integer multiples of the aperture width b , then some small overlap will be needed to fully scan the board . paths may vary in width , but constant width paths are more convenient since they permit scanning of an entire board with a single pair of horns . fig4 illustrates the testing of a nonrectangular microwave circuit board 75 according to the method of the present invention . microwave energy is injected from transmitting horn 78 to receiving horn 79 along path 74 via a pair of adapter prisms 76 and 77 , respectively . the prisms are generally constructed of microwave circuit board material having a thickness and dielectric constant as close as possible to board 75 , so that reflections at the interfaces between the adapters and the board are minimized . as illustrated in fig5 adapter prisms may also be used to probe boards along nonperpendicular paths . in fig5 board 80 is tested along diagonal path 82 using prisms 83 and 84 . diagonal path testing may be especially suitable in cases where it is suspected that anomalies may be in the form of diagonal ridges . a testing apparatus according to one embodiment of the present invention is shown in fig6 . in this embodiment , signal generator 85 produces a single frequency microwave signal 86 that is routed into transmitting horn 87 . the microwave energy passes from horn 87 through the dielectric sheet of microwave circuit board 88 along path 91 , into receiving horn 89 , and the resulting transmitted signal 92 is cabled to network analyzer 94 . network analyzer 94 also receives a reference signal 96 directly from signal generator 85 . by comparison of the reference signal 96 and transmitted signal 92 , the phase delay of the microwave energy through the board is determined . this phase delay may be displayed directly to an operator . alternatively , signal generator 85 may be swept in frequency , and a graph of phase delay as a function of frequency may be produced on x - y recorder 98 . recorder 98 receives its phase delay signal 97 from network analyzer 94 , and its frequency signal 99 from signal generator 85 . network analyzer 94 computes phase delay by determining the phase difference between signal 92 and reference signal 96 . to avoid error due to the transit time of signals 86 , 92 and 96 , the phase delay is determined with reference to the delay measured with board 88 removed and horns 87 and 89 brought together so that their apertures tightly abut . the additional delay measured with board 88 in place is thus due to the phase delay through the board . this delay is related to the dielectric constant of the substrate of board 88 as follows : ## equ2 ## where ฯ is the phase delay , ฮป is the wavelength of the radiation , l is the length of path 91 , and e av is the average dielectric constant along path 91 . thus the average dielectric constant can readily be calculated once the phase delay is known . in the embodiment shown in fig6 in which dielectric constant is determined from phase delay , it is desirable to minimize the amount of reflection taking place at the interface between the horns and the board . referring to fig7 a preferred construction of the transmitting and receiving horns for phase delay measurement is shown . horn 100 comprises a section of metal - clad microwave circuit board having a thickness and dielectric constant as close as possible to those of the board to be tested . the shape of the horn is defined by linear edges 102 , 103 and 104 and parabolic edge 105 . edges 103 , 104 and 105 , and a portion of edge 102 are covered with copper tape , as indicated by crosshatch in fig7 . the portion of edge 102 which is not covered with copper tape constitutes aperture 107 . microwave energy is cabled to or from the horn through tap point 110 . the shape of parabolic edge 105 is defined by a parabola having a focal length of f and a prime focus at the apex 108 formed by extending edges 102 and 104 . with this geometry , radiation introduced at tap point 110 will arrive at aperture 107 with a flat phase front . similarly , radiation entering aperture 107 will be focused at tap 110 without phase distortion . preferred dimensions for horn 100 are : a second preferred method of carrying out the present invention is illustrated in block diagram form in fig8 . in this embodiment , signal generator 120 produces a single frequency microwave signal 122 that is cabled into transmitting horn 124 . the microwave energy passes from horn 124 through the dielectric sheet of microwave circuit board 126 along path 120 , into receiving horn 128 , and the transmitted signal 132 is routed to amplitude detector 134 . the amplitude detector sends a signal 136 to x - y recorder 140 indicative of the amplitude of the microwave signal transmitted through board 126 . x - y recorder 140 also receives a frequency signal 142 from signal generator 120 . the frequency of the signal produced by signal generator 120 is varied continuously within a range of frequencies , and the resulting amplitude vs . frequency graph is recorded on the x - y recorder . the method shown in fig8 depends upon the creation of resonance or of standing waves of microwave energy within board 126 . to produce such resonance , it is preferable that there be wave reflection at the horn / board interfaces . as is well known , such reflection can easily be achieved by mismatching the dielectric constant of the horns and board , and / or by using horns whose thickness does not match that of the dielectric layer within the board being tested . for this reason , the method shown in fig8 is preferred for very thin boards , e . g ., less than 0 . 1 inches , because of the difficulty in matching horns to such boards . the output of x - y recorder 140 will consist of a series of amplitude peaks corresponding to different resonances . for thin boards in which the thickness t of the dielectric layer satisfies where l is the length of path 120 through the board , the resonance peaks are described by ## equ3 ## where f n is the resonance frequency , c is the velocity of light in a vacuum , l is the length of path 120 , e av is the average dielectric constant along path 120 , and n is a positive integer . since successive frequency peaks will correspond to successive values for n , the dielectric constant can be determined from ## equ4 ## where ฮดf is the peak spacing . more precise calculations can be made by repeating the amplitude versus frequency measurements for ranges of frequencies , which are whole multiples or divisions of the initial range , and thereby determining the exact resonance order of each frequency peak . for example , if a given peak had been tentatively identified as corresponding to resonance number 27 , and if the frequency of such peak was 12 . 63 ghz , then one would expect to find the ninth resonance at f / 3 or 4 . 21 ghz . failure to do so would suggest that 12 . 63 ghz corresponds to n = 26 or n = 28 , and further checking at f / 4 could select between these two values . fig9 a - h illustrate different methods of utilizing the data obtained through the present invention . referring first to fig9 a , a microwave circuit board having a nominal dielectric constant of 3 . 0 has been scanned along six paths consisting of three rows and three columns . the boundaries between adjacent paths are indicated by the dashed lines . the resulting values obtained for the average dielectric constants are indicated by the numbers written outside the board adjacent to the respective rows and columns . the numbers written within the board indicate the actual ( unknown ) variations of dielectric constant giving rise to the measured average values . as indicated , the center of the board in fig9 a contains an isolated peak of anomalously high dielectric constant . the size of the anomaly is 10 % of the nominal value for the board , a size that would make the board unsuitable for many applications . however , conventional testing techniques using a board - wide average would yield a value of 3 . 03 , a variation within the tolerances provided for many commercial boards . a simple inspection of the row and column averages produced by the present invention , however , reveals the presence of a serious problem with the board . fig9 b shows , in a format similar to that of fig9 a , a microwave circuit board in which the anomaly consists of a vertical ridge of high dielectric constant , the anomaly again being 10 % of the nominal value for the board . as in the case of fig9 a , the techniques of the present invention provide considerably more information about the suitability of the board for a given application . three rows and three columns have been used in the above examples for purposes of simplicity of illustration . in most instances , measurements of mean dielectric constant will be made over a greater number of paths , and more systematic methods for numerical processing are therefore desirable . in one preferred method , the dielectric constant for a particular subsection of the board is calculated by taking the arithmetic average of the row and column measurements corresponding to the subsection . symbolically , if e ij is the estimated dielectric constant for the subsection consisting of the intersection of row i and column j , then ## equ5 ## where r i is the measured average dielectric constant for row i , and c j is the corresponding quantity for column j . application of this formula to the values shown in fig9 a and 9b yields , respectively , the dielectric constant estimates shown in fig9 c and 9d . in both cases , the shape of the anomaly has been accurately portrayed . if it is believed that an anomaly consists of a single peak , then an improved method of estimation is : ## equ6 ## where e 0 is a nominal or most common value , and where m and n are the number of rows and columns respectively . if e 0 is taken to be 3 . 0 in fig9 a and 9b , then the results of applying this method are shown in fig9 e and 9f , respectively . as may be observed , the magnitude of the anomaly in fig9 a has been fully preserved in fig9 e . a third method of data handling is based on a cross - product or geometric average technique , and is represented by the formula : ## equ7 ## where e a is the average measured dielectric constant for the entire board . the results of applying this method to the boards of fig9 a and 9b are shown respectively in fig9 g and 9h . this approach completely reproduces the ridge anomaly of fig9 b . referring now once again to the phase delay method of fig6 the length of path 91 through the board will usually be greater than the effective wavelength of the radiation traveling along the path . in this case , phase delay can be expressed as where ฯ a is the actual phase delay , ฯ m is the phase delay measured by network analyzer 94 , and n is a positive integer . in general n is unknown , and thus there is an ambiguity in the determination of ฯ a . this ambiguity may be removed by measuring phase delay at a number of different frequencies , or by measuring it over a continuous range of frequencies using x - y recorder 98 , and comparing the results . in many cases , this can be a time - consuming process , and a technique for simplifying the determination of phase delay is desirable . a preferred method and apparatus for making phase delay measurements in accordance with the present invention is illustrated in fig1 and 11 . in this method , two phase delay measurements are made simultaneously ; one through the board , and a second through a reference path chosen to produce a known phase delay close to that of the board path . by subtracting the two phase delay measurements , the ambiguity discussed above is eliminated or greatly reduced . referring now to fig1 , the apparatus comprises a base 150 upon which arm 156 is pivotally mounted by pin 157 . microwave horns 158 and 160 are mounted respectively within slots 164 and 168 by mounting pins 159 and 161 , such that the horns are free to move longitudinally along slots 164 and 168 , but are not free to rotate . mounting pins 159 and 161 also pass through slots 162 and 166 respectively in arm 156 . microwave horns 152 and 154 are rigidly mounted to base 150 such that their central axes are aligned with slots 164 and 168 , and their apertures are aligned one under the other along line 153 . as a result of the described construction , horns 158 and 160 are constrained to move along parallel paths , defined by slots 164 and 168 , and to lie on the line defined by arm 156 . as arm 156 is rotated about pivot 157 , the board path length 172 between horns 152 and 158 will always be in a fixed ratio to the air path length 174 between horns 154 and 160 . depending on construction details , it may be desirable to raise horns 154 and 160 , such that path 174 is never blocked by board 155 . in operation , a microwave circuit board 155 to be tested is inserted between horns 152 and 158 , arm 156 is swung leftward so that the horns bear tightly against board 155 . referring now to fig1 , a single frequency microwave signal 182 is generated by signal generator 180 and cabled to power splitter 184 . the power splitter divides signal 182 into two equal output signals 186 and 188 , which signals are cabled to transmitting horns 152 and 154 , respectively . the radiation from horn 152 passes through microwave circuit board 155 along path 172 into receiving horn 158 , and the radiation from transmitting horn 154 passes along air path 174 into receiving horn 160 . the resulting received signals 190 and 192 are then combined in mixer / network analyzer 194 . the output of mixer / network analyzer 194 is a signal 196 whose amplitude is proportional to the phase difference between signals 190 and 192 . phase difference signal 196 along with frequency signal 200 are passed to x - y recorder 198 , which records the phase difference as a function of frequency . apparatus 150 is constructed such that the fixed ratio of the length of air path 174 to the length of board path 172 is equal to the square root of the nominal or average dielectric constant of board 155 . referring to equation ( 3 ), the result will be that the phase delay along paths 172 and 174 will be nearly equal , and the phase difference ฮดฯ measured by signal 196 will be small . thus , the ambiguity indicated by equation ( a ) will be eliminated or greatly reduced . since the phase delay along path 174 is known , the average dielectric constant along path 172 can easily be determined from the measured phase difference ฮดฯ . in particular , if subscripts 1 and 2 refer to paths 172 and 174 respectively , and if l 1 and l 2 are the lengths of paths 172 and 174 measured between the respective horn apertures , then : ## equ8 ## since e 2 = 1 . for a nominal dielectric constant of 2 . 56 , one would set l 2 =โ 2 . 56 l 1 = 1 . 6l 1 , and obtain : ## equ9 ## it will be understood that the invention may be embodied in other specific forms without departing from the spirit or central characteristics thereof . the described embodiments , therefore , are to be considered in all respects as illustrative , and the invention is not to be limited to the details thereof , but may be modified within the scope of the following claims . | 6 |
various embodiments are provided and described in detail as follow . the embodiments are merely described for being an example , but do not limit the scope of the present invention . in addition , in order to clearly show the technical features of the present invention , parts of elements are omitted in the drawings of the embodiments . refer to fig1 . fig1 is a perspective view of a uav 100 according to an embodiment of the present invention . the uav 100 includes a fuselage 110 , a plurality of landing gears 121 , 122 , 123 and 124 , a plurality of whirl wing structures 130 , a 3d image recognition system 140 and a plurality of distance sensing units 150 . the 3d image recognition system 140 may be disposed on the bottom of the fuselage 110 for obtaining a depth image of a scene , and may be capable of capturing a 2d image of the scene . the landing gears 121 , 122 , 123 and 124 and the whirl wing structures 130 are assembled together and disposed on the fuselage 110 . each of the landing gears 121 , 122 , 123 and 124 may respectively correspond to one of the whirl wing structures 130 . the distance sensing units 150 , such as the infrared sensors , are used to obtain a height information of the landing position and respectively disposed on the landing gears 121 , 122 , 123 and 124 . the landing gears 121 , 122 , 123 and 124 with a telescopic function may be specifically designed as screw rods , sleeves and so on , which are controlled to lengthen or shorten by an element such as a stepping motor . the numbers of the landing gears , the whirl wing structures and the distance sensing units of the uav 100 as shown in fig1 are all four , but the present invention does not limit thereto . the numbers of the landing gears , the whirl wing structures and the distance sensing units may be three or more than four . refer to fig2 . fig2 is a block diagram of the uav 100 according to an embodiment of the present invention . the uav 100 further includes a processing unit 202 and a storage unit 206 . the storage unit 206 is used to store the height information of the landing position obtained from the distance sensing units 150 , such as a memory . the processing unit 202 is coupled to the 3d image recognition system 140 and the storage unit 206 for determining a landing position in accordance with the depth image obtained from the 3d image recognition system 140 . in addition , the processing unit 202 may further control and adjust the length of each of the landing gears 121 , 122 , 123 arid 124 respectively in accordance with the height information stored in the storage unit 206 . the processing unit 202 may be , for example , a microprocessor or a microcontroller . refer to fig3 . fig3 is a flow chart of a landing method of the uav according to an embodiment of the present invention . in the present embodiment , the uav 100 of fig1 - 2 is exemplarily used for describing these steps of flow process . in step s 1 , the 3d image recognition system 140 obtains a depth image of a scene . the 3d image recognition system 140 may capture 2d images of different scenes , and perform processing to the 2d images to obtain a depth information of the 2d image , so as to obtain the depth image of the scene . refer to fig4 and 5 . fig4 is a part of flow chart of the landing method of the uav according to another embodiment of the present invention . fig5 is a schematic diagram of a 2d image according to another embodiment of the present invention . for instance , in step s 11 , the image capturing unit in the 3d image recognition system 140 ( such as a camera or a video camera ) captures a 2d image i of the scene . the image capturing unit may capture the 2d image i of the scene in accordance with different shooting angles ( e . g ., swinging the lens of the image capturing unit ) and shooting ranges ( e . g ., controlling the lens of the image capturing unit to zoom in or zoom out ). next , in step 512 , the 3d image recognition system 140 divides the 2d image i into a plurality of regions , such as region a 1 , region a 2 , region a 3 and region a 4 . in one embodiment , the number of the regions being divided may correspond to the number of the landing gears of the uav . in step s 13 , the 3d image recognition system 140 obtains depth values of all pixels in each of the regions a 1 , a 2 , a 3 and a 4 . for example , in region a 1 , there are pixels a 11 , a 12 , . . . , a 1 n contained therein . the 3d image recognition system 140 may depend on the color depth in each of the pixels a 11 , a 12 , . . . , a 1 n to recognize and obtain corresponding depth values d 1 n of all the pixels a 11 , a 12 , . . . , a 1 n , wherein n is an integer equal to or larger than 1 . in step s 14 , the 3d image recognition system 140 calculates average depth values respectively corresponding to each of the regions a 1 , a 2 , a 3 and a 4 to obtain the depth image . in case of region a 1 the 3d image recognition system 140 calculates average values of all the depth values d 1 n to obtain an average depth value d 1 of region a 1 . on this basis , the 3d image recognition system 140 respectively calculates average depth values d 2 , d 3 and d 4 of the regions a 2 , a 3 and a 4 , so as to obtain the depth image of the captured scene . refer to fig3 . after the step s 1 of obtaining the depth image of the scene , the method proceeds to step s 2 . in step s 2 , the processing unit 202 determines a landing position in accordance with the depth image . refer to fig4 . in step s 21 , the processing unit 202 obtains a maximum average depth value d max and a minimum average depth value d min from the average depth values d 1 , d 2 , d 3 and d 4 of the regions a 1 , a 2 , a 3 and a 4 , respectively . for instance , among the four regions a 1 , a 2 , a 3 and a 4 , the average depth value d 3 of the region a 3 is the maximum , while the average depth value d 1 of the region a 1 is the minimum . as a result , d 3 is the maximum average depth value d max , and d 1 is the minimum average depth value d min . in step s 22 , the processing unit 202 subtracts the minimum average depth value d min from the maximum average depth value d max to obtain a difference value d diff = d 3 โ d 1 . in step s 23 , the processing unit 202 determines whether the difference value d diff is smaller than a threshold value . when the processing unit 202 determines that the difference value d diff is smaller than the threshold value , the method proceeds to step s 24 , that is , the processing unit 202 determines to land the uav on the landing position . when the processing unit 202 determines that the difference value d diff is larger than the threshold value , the processing unit 202 determines the 3d image recognition system 140 to re - obtain a depth image of a scene , that is , the method proceeds back to step s 1 to search for a suitable landing position . in one embodiment , the threshold value of step s 23 may be a maximum telescopic length of each of the landing gears 121 , 122 , 123 and 124 . that is , before landing , the uav will first search for a suitable landing position where the uav can land steadily . if the first found landing position has a level drop that is larger than a maximum telescopic length of each of the landing gears 121 , 122 , 123 and 124 so that the uav cannot keep a balance or may even topple over , the uav will continue to find another landing positions . refer to fig2 . after the step s 2 of determining the landing position in accordance with the depth image , the method proceeds to step s 3 . in step s 3 , the distance sensing units 150 obtain a height information of the landing position , and store the height information in the storage unit 206 . in one embodiment , when determining to land the uav on the landing position , the processing unit 202 orders the uav to fly to the landing position , and aims each of the landing gears 121 , 122 , 123 and 124 to correspond to each of the regions a 1 , a 2 , a 3 and a 4 . in this embodiment , the distance sensing units 150 are , for example , infrared sensors for sensing distance . the distance sensing units 150 are respectively disposed in the landing gears 121 , 122 , 123 and 124 for obtaining a height information of the landing position corresponding to each of the regions a 1 , a 2 , a 3 and a 4 . the infrared sensor includes an emitting end for emitting an infrared light to the ground and a receiving end for receiving the infrared light reflected from the ground . during the traveling of the infrared light , an energy attenuation will be generated . the infrared sensors may respectively obtain current heights relative to the ground of each of the landing gears 121 , 122 , 123 and 124 according to the energy attenuation , so as to obtain the height information of the landing position , and store the height information in the storage unit 206 . next , after the step s 3 of obtaining the height information of the landing position , the method proceeds to step s 4 . in step s 4 , the processing unit 202 adjusts a plurality of relative distances of the landing gears 121 , 122 , 123 and 124 relative to the landing position in accordance with the height information to make the relative distances substantially the same . in one embodiment , the processing unit 202 may lengthen or shorten the length of each of the landing gears 121 , 122 , 123 and 124 respectively in accordance with the height information stored in the storage unit 206 to make the relative distances of the landing gears 121 , 122 , 123 and 124 substantially the same . next , after the step s 4 of adjusting the relative distances of the landing gears 121 , 122 , 123 and 124 relative to the landing position , the method proceeds to step s 5 . in step s 5 , the processing unit 202 orders the uav 100 to land on the landing position . because the relative distances of the landing gears 121 , 122 , 123 and 124 relative to the landing position have been adjusted substantially the same in the step s 4 , the processing unit 202 may order the uav 100 to land in such a straightly downward way that the landing gears 121 , 122 , 123 and 124 can touch the ground simultaneously to keep the balance during landing . fig6 a - 6c are schematic diagrams showing the landing of the uav according to an embodiment of the present invention . fig6 a - 6c are exemplarily used for describing the landing process of the steps s 3 to s 5 . in the present embodiment , the uav 100 of fig1 - 2 is exemplarily used for describing these steps of landing process . refer to fig6 a . when the uav 100 confirms a landing position 10 , the distance sensing units 150 respectively disposed on the landing gears 121 , 122 ( not shown ), 123 and 124 obtain a height information of the landing gears 121 , 122 , 123 and 124 on the landing position 10 . for example , heights relative to the ground h 1 , h 3 and h 4 of each of the landing gears 121 , 123 and 124 measured by the distance sensing units 150 on the landing gears 121 , 123 and 124 are 140 cm , 200 cm and 160 cm , respectively . the heights relative to the ground h 1 , h 3 and h 4 are used as the height information of the landing position 10 . refer to fig6 b . after the distance sensing units 150 obtain the height information of the landing position 10 , the processing unit 202 depends on the height information to shorten the length l 1 of the landing gear 121 by 10 cm , and respectively lengthen the lengths l 3 and l 4 of the landing gears 123 and 124 by 50 cm and 10 cm . therefore , the relative distances of the landing gears 121 , 123 and 124 relative to the landing position 10 are adjusted to be equal to each other ( i . e ., 150 cm ). refer to fig6 . after adjusting the relative distances of the landing gears 121 , 123 and 124 relative to the landing position 10 , the processing unit 202 controls the uav 100 to fly downwards by 150 cm on the landing position 10 . finally , the landing gears 121 , 123 and 124 may touch the ground simultaneously without losing balance when the uav 100 lands . in the landing method of the uav disclosed in above embodiment of the present invention , the uav will first search for a suitable landing position before landing , so as to prevent itself from toppling over resulted from the larger level drop while being landing . after finding the suitable landing position , the uav of the present invention will obtain a height information of the landing position , and then adjust the landing gears in accordance with the height information , and finally land on the landing position . therefore , the uav can prevent from toppling over resulted from late calculation of gravity . moreover , in the step of correspondingly adjusting the landing gears in accordance with the height information , the relative distances of the landing gears relative to the landing position are made all the same . thus , when the uav is controlled to land in a straightly downward way , the landing gears can not only touch the ground simultaneously to keep the balance , but also prevent itself from toppling over in the case that any landing gears have not touched the ground while being landing . while the invention has been described by way of example and in terms of the preferred embodiment ( s ), it is to be understood that the invention is not limited thereto . on the contrary , it is intended to cover various modifications and similar arrangements and procedures , and the scope of the appended claims therefore should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements and procedures . | 7 |
referring now to the drawings and , in particular , fig1 through 3 the heart of the present invention is the ata 10 , which is a rigid device with a tall end 11 and a short end 20 . the tall end 11 houses several of the ports that are needed to enable the numerous functions of the invention . an led light 12 provides a visual display of the current power and operational state of the ata 10 . the reset button 17 , when depressed by a user , shuts down and then immediately restarts the ata 10 . two usb ports 13 , 14 perform the function of providing data input / output as well as power input to the device . an ethernet port 15 allows an ethernet cord to be directly connected to the ata 10 so that the invention can be used without a computer with internet access . the telephone jack 16 is where the ata 10 can receive a connection from an analog telephone handset . the short end 20 of the invention contains a wi - fi adapter port 23 . in order to enable the ata 10 to employ a wi - fi internet connection to utilize voip service , a wi - fi adapter 24 must be inserted into the wi - fi adapter port 23 . when the wi - fi adapter 24 is fully engaged with the wi - fi adapter port 23 , the ata will search for available wi - fi networks and connect to an available wi - fi network . referring now to fig4 , the control circuitry 25 in the ata 10 contain several key components , all of which is mounted on to a platform . the heart of the circuitry components is the central processor 25 . the ata 10 also requires a random access memory component , an nic component , and a storage medium component . in addition , the storage medium will contain the necessary software to perform the basic voip operations , including codec , slic , and sip . each of these components connect work through the processor and the various ports depending upon a particular input from the internet and output to the internet that will be achieved from the physical connection to an analog telephone handset . referring now to fig5 , the basic telephone voip system is shown that includes an analog telephone handset 30 as one would find in the conventional residence or even commercially . the analog telephone handset 30 is connected to the ata 31 through the ata &# 39 ; s 31 telephone port ( rj 11 or compatible ). the ata 31 is shown connected to a computer 32 through a usb cord that is connected to the computer 32 and to the usb port on the ata 31 . the computer 32 is shown wired to a modem 33 ( or router , modem / router combination device and / or a switch ), which the computer is using to obtain access to the internet . the ata 31 receives power and accesses the internet through the computer &# 39 ; s 32 existing power supply and internet access and is able to provide voip service through the computer &# 39 ; s 32 internet connection . when the voip system is configured in this way , a user is able to place and receive telephone calls nationwide without the analog telephone headset 30 being wired through a pstn . referring now to fig6 , the voip system that does not require a computer is shown that includes a basic analog telephone handset 40 . the analog telephone handset 40 is connected to the ata 41 through the ata &# 39 ; s 41 telephone port ( rj 11 or compatible ). the ata 41 is shown connected to a usb electric plug adapter 42 through a usb cord that is plugged into one of the ata &# 39 ; s 41 usb ports . the usb electric plug adapter 42 allows the ata 41 to receive electrical power without a computer connection . the ata 41 is also shown connected directly to a modem 43 ( or router , modem / router combination device and / or a switch ) with a ethernet cord ( rj 45 or compatible ) plugged into its ethernet port . this allows the ata 41 to access the internet through the modem 43 without a computer connection . the ata 41 is able to utilize a direct connection to the internet through the ata &# 39 ; s 41 nic component , which is similar to the nic component found in computers . when the voip system is configured in this way , a user is able to place and receive telephone calls nationwide without the analog telephone handset 40 being wired through a pstn and even without a wired connection to a computer . referring now to fig7 , the voip system that does not require a computer is shown that includes a basic analog telephone handset 50 . the analog telephone handset 50 is connected to the ata 51 through the ata &# 39 ; s 51 telephone port ( rj 11 or compatible ). the ata 51 is shown connected to a usb electric plug adapter 52 through a usb cord that is plugged into one of the ata &# 39 ; s 51 usb ports . the usb electric plug adapter 52 allows the ata 51 to receive electrical power without a computer connection . the ata 51 is also shown exchanging wireless signals with a wireless router 53 . this facilitates the ata 51 to access the internet wirelessly through the wireless router 53 without a computer connection or even a wired connection to a modem , router , modem / router combination device and / or a switch . the ata 51 is able to connect to the wireless signal through the ata &# 39 ; s 51 wi - fi adapter and the ata 51 utilizes the connection to the internet through the ata &# 39 ; s 51 nic component , which is similar to the nic component found in computers . when the voip system is configured in this way , a user is able to place and receive telephone calls nationwide without the analog telephone handset 50 being wired through a pstn and even without the a wired connection to a computer or a modem . referring now to fig8 , the voip system that does not require a computer is shown that includes a basic analog telephone handset 60 . the analog telephone handset 60 is connected to the ata 61 through the ata &# 39 ; s 61 telephone port ( rj 11 or compatible ). the ata 61 is shown connected to a usb electric plug adapter 62 through a usb cord that is plugged into one of the ata &# 39 ; s 61 usb ports . the usb electric plug adapter 62 allows the ata 61 to receive electrical power without a computer connection . the ata 61 is also shown connected to a cell phone 63 through a usb cord that is plugged into one of the ata &# 39 ; s 61 usb ports . when configured in this manner , the ata 61 can access the internet through the cell phone &# 39 ; s 63 internet connection . generally , it is through a cell phone &# 39 ; s 63 connection to the cell phone tower 64 , whether the connection is of a gsm , cdma , or evdo standard , that the cell phone is able to obtain access to the internet . however , the ata 61 can also access the internet through the cell phone 63 if the cell phone is connecting to the internet through an available wi - fi or wimax signal . either way , this configuration provides the most flexibility in terms of location and facilitates the ata 61 to access the internet wirelessly cell phone 63 without a computer connection , a wired connection to a modern , router , modem / router combination device and / or a switch , or even a nearby wi - fi signal . when the voip system is configured in this way , a user is able to place and receive telephone calls nationwide without the analog telephone handset 60 being wired through a pstn and even without the a wired connection to a computer or a modem , or even a wlan nearby . referring now to fig9 the system is shown set up to have the analog phone 70 connected to ata 71 to include the wi - fi device 72 and a series of power adapters 73 , 74 , and 75 which are power connector adapters . the instant invention has been shown and described herein in what is considered to be the most practical and preferred embodiment . it is recognized , however , that departures may be made therefrom within the scope of the invention and that obvious modifications will occur to a person skilled in the art . | 7 |
as already indicated in the general summary , and by fig2 and 3 of the drawings , the construction member 20 of the invention is basically a shallow , channel - shaped member which may be assembled vertically with others to form a wall , as in fig2 or assembled horizontally with others to form a ceiling , as in fig3 . the preferred fabrication of the construction member is indicated diagramtically by fig1 with modification and further detail shown in fig4 to 6 inclusive . fig7 to 12 show erection details which will orient those skilled in the art and serve also to illustrate to them the time and cost savings to be had from use of the invention . referring to fig1 in particular , the upper part of the drawing shows a flat board member 20 which could be a 4 - foot wide or a 2 - foot wide gypsum board sheet , having two v - shaped grooves 22 , the sides of which are perpendicular to each other and the vertex of which is parallel to the long edge of the sheet . the grooves are spaced inwardly from the edges of the board a distance approximately equal to the desired depth of the flanges 24 to be formed by bending up the narrow side portions of the sheet along the vertices of the v - grooves , and define between them the panel portion 26 of the board . the v - shaped grooves may either be milled in a panel of otherwise conventional fabrication , or otherwise formed by cutting tools if not milled , or , in the case of gypsum board , may be formed as part of the board in its initial fabrication . in either case , the v - grooves thus milled , cut or otherwise formed leave intact a sufficient thickness of the paper skin or other laminate on the side of the board 20 opposite the groove to serve as a hinge about which to form the construction member 28 by bending up the flanges 24 as indicated by the transition between the upper and lower portions of fig1 of the drawings . an adhesive applied to the v - groove at or before the time of the bending up of the flanges , secures the flanges to the panel portion 26 of the construction member 28 in the perpendicular arrangement indicated in the lower portion of fig1 and in subsequent drawings , the bond being sufficient to enable the flanges to materially stiffen , i . e ., to enhance the longitudinal bending strength of , the member . while the two - step fabrication of fig1 is preferred in order to permit shipment of the member as a flat &# 34 ; blank &# 34 ; to be subsequently formed up at the erection site or at some intermediate station close to the job , i have contemplated , and have so indicated by fig4 the possibility of casting integrally flanged gypsum board , instead of forming by the v - notch , fold - up procedure . i have not , however , actually fabricated any construction members by that procedure , and believe , as far as gypsum board is concerned , that shipment of the gypsum board sheet as a pre - grooved but unfolded or flat blank is preferable to facilitate the handling and to minimize the damage to be expected from shipment and trans - shipment in the channel - shaped form . in fig5 i show the gypsum board blank 20 grooved to the depth of the gypsum filler 30 between the customary paper lamina 32 and 34 on opposite sides thereof . in addition , and by way of example only , i have shown on the notched side of the sheet which becomes the interior in contemplated wall construction assembly an optional additional lamina 36 , which may , for example , be a metal foil where a vapor barrier is desired , as in the exterior wall construction shown in cross section in fig7 . the paper skin 34 on the lower side of the sheet , which becomes the outside , or the &# 34 ; dress &# 34 ; side , when the flanges 24 are folded up , is left intact by the grooving , and may also have an optional layer 38 of a prefinishing material such as vinyl . to fabricate the construction member 28 from the grooved blank of fig5 a viscous liquid adhesive , such as sta - stuck ss - 2000a , manufactured by specialty chemicals company of elk grove village , ill , is deposited in the v - grooves in sufficient quantity to provide a slight exuded fillet 40 when the flanges 24 are folded up , as indicated in the lower portion of fig . 5 , and a sufficient waiting period allowed , of the order of 15 minutes , for the adhesive to set up before further handling . if desired for greater strength when using sheet of lighter gauge , e . g ., one - half inch , the mitered joint may be reinforced at intervals with glue blocks on the inside of the corner . fig6 illustrates a form of treatment of a gypsum board blank 20 &# 39 ; to provide v - grooves during the process of manufacture of the board . in this instance , the upper paper layer 32 of the board is formed into a v - shaped groove 22 &# 39 ; penetrating the gypsum filler 30 &# 39 ; while the gypsum is still in a fluid state , with suitable provision for the retention of the penetration until the gypsum filler has set up . the fig6 arrangement contemplates the application of a contact adhesive 42 to both walls of the v - grooves 22 &# 39 ; and to the upper surface of the board 20 &# 39 ; along a narrow margin flanking the grooves , all covered by a releasable protective &# 34 ; peel &# 34 ; tape 44 . the arrangement of fig6 would greatly increase the handleability of the construction member and greatly facilitate the erection of the flanges 24 &# 39 ; into stable bracing arrangement with the panel portion 26 of the construction member on the job site . the illustrative sample of fig . 6 also shows an optional interior laminate 36 &# 39 ; of a vapor barrier such as foil , and the optional exterior laminate 38 &# 39 ; such as a decorative vinyl . comparing the two corner treatments of fig5 and 6 , it will be noted that the paper - lined groove of the fig6 modification produces a slightly larger outside radius at the corner of the construction member when the flange is bent into place . to compensate for the additional paper material packed into the joint particularly at or near the folding axis , the v - groove is preferably made slightly larger than 90 ยฐ so that when the flange 24 &# 39 ; is folded up , and the two walls of the groove brought into contact , the flange 24 &# 39 ; will be perpendicular to the panel portion 26 &# 39 ; of the construction member . the basic plan for the application of the construction member of the invention to wall construction , as already indicated , is shown in fig2 i . e ., with the construction members 28 standing vertically in butted , side - by - side relation on both sides of the wall , and with the studs formed by their flanges 24 interspersed so that the studs integral with one side of the wall are in touching bracing contact with the panel portions 26 of the construction members of the opposite side . the adaptation of this basic assembly plan to exterior wall construction is illustrated in fig7 . for exterior wall construction the sheet material of the outside members is preferably one of greater structural strength , such as wood . in fig7 the construction members 46 which constitute the outside of the wall are shown as formed from plywood sheet 48 , but for this application particle board is also suitable . in this instance , i show the exterior construction members as sheathed with an outer lamina 50 of metal which may be either steel or aluminum , and preferably prefinished . adjacent exterior members 46 are abutted in line preferably with an application of caulking material at the joints , and then fastened together , as indicated , by hardened wood screws driven through the abutting flanges 52 . the construction members 28 for the inside of the exterior wall are of gypsum board and placed in abutting aligned relation with the studs formed by their adjacent flanges 24 interspersed between those of the outer panels . they are screwed top and bottom to plate members , not shown , in the manner later to be described in connection with interior wall construction . gypsum board used in this manner , i . e ., as the inner face of an exterior wall , will preferably have an inner layer 36 of a vapor barrier material , and the void between the interior and exterior construction members filled with insulation 54 . for its utility as a bonding material as well as in providing highly efficient thermal insulation , i contemplate the ultimate use of a freon - blow low - density , foamed , rigid polyurethane , with suitable provision in the top plates of the wall for the pouring of the material from portable equipment in the field , and with fixtures as necessary to prevent the &# 34 ; oil canning &# 34 ; of the panels as the polyurethane expands and sets up . the detailing of the utilization of the construction members of the invention for interior wall construction , and as ceilings , is illustrated in fig8 to 12 inclusive . as in typical dry - wall construction in commercial buildings , an interior wall ( fig8 ) is positioned by locating a channel - shaped floor track 60 along the intended axis of the wall . such channels are usually roll - formed sheet steel in light gauge , easily penetrated by self - drilling , self - tapping screws , and are secured in place , openside up , by powder - driven nails 62 , such as ramset , or by tempered concrete nails , driven through the web of the channel or &# 34 ; floor track &# 34 ; into the floor 64 . a hemmed ceiling track 66 of similar but wider channel shape and having smooth , hemmed , rounded edges on its flanges , is plumbed with the floor track 60 and secured by screws to the ceiling 68 , with the track open downwardly . the flanges 24 of the gypsum - board construction members 28 are cut off at their lower ends 70 sufficiently to clear the floor track and to permit use of the track as raceway for electricl conduit . one side of the wall is then assembled by inserting the construction members 28 into the ceiling track , and abuttng them to the floor track , to which they are secured with screws 72 driven through the panel portion 26 of the construction member along its bottom edge , as indicated in fig8 . with one side of the wall , or a substantial portion thereof , assembled , the opposite side is then applied , and secured in place in the same manner . the flanges of the ceiling track 66 provide the upper trim of the wall , and the power - driven screws 72 by means of which the construction members are secured to the floor track are concealed by the application of a base molding 74 , usually molded vinyl , after the erection of the wall . the starting of a wall , where it adjoins another wall with an inside corner on both sides , is illustrated in fig9 . in such case , and in addition to the laying of floor and ceiling track as described in connection with fig8 a hemmed track 76 is secured vertically to the existing wall 78 on the desired axis of the new partition wall and lightly secured in place in any convenient manner , as for example by a pair of spaced self - tapping screws . a flanged gypsum board construction member 28 is then set into place within the hemmed wall track 76 and a sheet metal stud 80 is placed against the inside surface of the flange 24 of the gypsum board construction member 28 , and screwed to the existing wall 78 at several levels by pairs of power driven screws 82 as indicated in fig . 9 , leaving sufficient space , however , for the subsequent insertion of the cut edge 84 of the panel portion 26 of the construction member 28 on the opposite side of the wall . fig1 , as earlier indicated , is a fragmentary horizontal section which illustrates doorway framing occurring randomly with respect to the joints between adjacent construction members . the doorway is cut at the desired location which will have been predetermined by a gap in the floor track 60 of width to accommodate the door jamb 90 . a sheet metal stud 92 is then inserted between the panel portions 26 of the gypsum board on opposite sides of the wall , and the cut ends 94 thereof are secured to the stud by screws 96 . the sheet - metal door jamb 90 may be of wall - gripping press - on type , with integral doorstop 98 , outer trim 100 , and return anchor portions 102 . the detailing of an exposed corner of an interior partitioning is illustrated in fig1 , which is also a fragmentary horizontal section . in this instance , it is assumed that the section of wall 106 extending vertically in fig1 was completed first . the construction member 108 on the inside of the corner is secured to a sheet - metal stud 110 having a corner molding 112 riveted to one of its flanges , by means of screws driven 114 through the panel of the interior construction member 108 and into the stud . the end panel 116 of the outside of the existing wall has its cut edge seated in the channel of the corner molding 112 , which is secured to the stud . the cornering wall 118 is then started by abutting the flange 24 of the construction member 122 on the inside of the new wall against the construction member 108 on the inside of the existing wall , with their edges flush , and securing the beginning construction panel 122 of the new wall to the end stud of the existing wall by means of self - tapping screws 124 , driven through the double thickness of the gypsum board and into the flange of the stud 110 . the outside side of the cornering wall is then started by the insertion of the cut edge of the cornering outer construction member 126 into the space between the corner molding 112 and the end of the existing wall 106 . ceiling installation is indicated by fig1 , a particularly suitable application being relatively long and narrow ceilings such as in corridors and the like . in such applications , the long dimension of the construction member 28 is placed transversly of the passageway , with the construction member unsupported between its ends , which rest upon sheet metal angles 130 secured to the adjacent wall 132 by means of screws . hallway ceilings are quite typically lower than those of the adjacent spaces for the accommodation of duct work for utilities supplied to the privately occupied adjacent spaces , and the construction member 28 of the invention is especially suited to use in so - called &# 34 ; dropped &# 34 ; ceilings , of which corridors and passageways are a typical occurrence . in such cases , as indicated in fig1 , the ends 134 of the upstanding flanges 24 of the individual construction members are relieved at an angle to permit the insertion of the member diagonally into the space above its intended level , the resting of one of its ends upon the supporting angle or other support while still positioned diagonally , and then the rotation of the opposite end of the panel down onto its support . in ceiling application , the construction members are preferably connected together for mutual support , this being accomplished by the driving of screws 136 through abutted upstanding flanges of adjacent members , with the omission of such screws at intervals where desired for access to the overlying space . for spaces larger than corridors , the same arrangement is equally feasible but in such case the intermediate support consists of suspended track which is typically rail - shaped , i . e ., with horizontal flanges on opposite sides of the track and with aperatures at intervals in the web of the track for the suspension of the same by means of stiff wire from a preexisting ceiling , or other overhead structure . the saving of erection time , labor and cost which i have experienced utilizing the construction member of the invention as described in detail in the foregoing specification has been substantial resulting not only from the substantial elimination of studding and framing time , but also the elimination of the need to secure the gypsum board to studs . moreover the decorating of walls and ceilings made in the manner described is much simplified from existing conventional dry - wall practice , particularly by the elimination of the necessity for taping and spackling seams between adjacent wall board panels . these savings may further be enhanced by precladding the dress side of the construction member with an eye - pleasing finishing surface such as vinyl , but even in the simplest , paper - surface form , the walls after erection are ready for painting without requiring the time - consuming and costly patching which has been a necessary incident of existing dry - wall construction practice . the features of the invention believed new and patentable are set forth in the appended claims . | 4 |
for convenience , in the following description like numerals refer to like structures in the drawings . [ 0016 ] fig2 illustrates a circular buffer architecture , represented generally by the numeral 20 . the circular buffer 20 is partitioned into three distinct sections . the first section 22 is for pre - processed symbols , the second section 24 is for present symbol processing , and the third section 26 is for post - processed symbol extraction . a symbol manager 28 is used for managing the locations of these symbols . the buffer 20 may include an elastic region that is able to absorb data growth or depletion due to differences in rates of the three devices ( output device , input device , and processor ) that use the buffer 20 . this region may hold up to one symbol , and may be located within the first section 22 . [ 0018 ] fig3 illustrates a simd architecture , represented by the numeral 36 . the architecture 36 includes a pcu 12 , multiple data paths 13 , multiple data memories 14 and multiple processors 15 . the architecture also includes enable signals 32 , coupled to the processors 15 . referring to fig2 data is typically input serially into the pre - processed section 22 . once the data has been received , it is rotated to the present symbol processing section 24 , where it is parallel - processed . once the processing is complete , the symbol is rotated to the post - processed section 26 of the buffer 20 , where it is output serially . although the symbol is rotated through several sections of the buffer 20 , its physical location does not necessarily chance . changing the location of the symbol can be done ; however , it would require more time and more memory . maintaining the same location for a particular symbol is accomplished since the buffer 20 is circular . rather than have the address of the symbol physically rotate , the sections 22 , 24 , and 26 of the buffer 20 rotate about predetermined addresses . therefore , an address that points to an incoming symbol is in the pre - processed section 22 . once the symbol has completely arrived and is being processed , the address that points to that symbol is in the processing section 24 . once the symbol has been processed , that address is considered to be in the post - processed section 26 . the symbol manager 28 locates the base address for each of the symbols , allowing the circular nature of the buffer 20 to be transparent to each device accessing the data . the input data enters the buffer 20 at an arbitrary data rate . the data is loaded sequentially into the pre - processed section 22 until a complete symbol is collected . at that point , the symbol manager 28 advances to the next base pointer location . ( as an added feature , the address generation unit can access the buffer 20 directly with the address offset from the processor without the addition of the base address from the symbol manager 28 , by way of a switch . this allows the processor 15 to bypass the symbol manager 28 and access the buffer 28 absolutely .) the pcu 12 indicates the start of a processing cycle with a start of processing ( sop ) pulse . at each sop pulse , the base pointer for the processing section 24 is compared to the base pointer for the incoming symbol ( in the pre - processed section 22 ). the difference between these base pointers indicates whether or not a full symbol is ready for processing . if a full symbol is present , the enable signal 32 ( shown in fig3 ) for that symbol is activated . otherwise , the enable signal 32 remains inactive and the comparison is done again at the next sop . therefore , only the processors 15 that have received a complete symbol are enabled . as each of the devices completes processing its respective symbol , the symbol manager 28 advances the base pointer of the processing section 24 to the next symbol . once the base pointer of the processing section 24 advances , the processed symbol is in the post - processed section 26 . the extraction of the post - processed data is slaved to the processor 15 , and is only performed after the symbol has been processed . an advantage of this type of buffering scheme is that the processor is de - coupled from the incoming data rate of each channel . this is true with the restriction that the sop of the processor is greater than or equal to the maximum baud rate of the channels . if this were not true , it is possible that incoming data could overwrite previously received data before it is processed . therefore , the net processing rate of each channel is approximately equal to the baud rate for that channel since its processor 15 may be periodically disabled . the rate at which any given channel is disabled ( assuming zero jitter between each of the baud rates ) is given by : % ๎ข ๎ข proc off = fbaud sop - fbaud chan fbaud sop this equation also indicates the โ bursty โ nature of the data output rate . that is , the output is provided in bursts โ when the processor is enabled โ rather than a constant steady stream . also , the varying instantaneous latency due to the gapped processing can be determined . since the data is assumed to be arriving at a constant input rate , any gaps in the processing increase buffering requirements . however , since the worst case , or fastest , baud rate of the channel is equal to the baud rate of the processor , the buffering requirement is limited to the symbol size for each of the three sections 22 , 24 , and 26 . implementing an simd in this manner provides several advantages . the architecture ultimately results in a net decrease in gate count and expended power , since the processors are only used for completely received symbols . buffering requirements can be combined with those necessary for other considerations in the signal processing . therefore , little or no extra memory is required . the structure can be applied to any symbol size . this includes processing on a sample by sample basis . the structure can be expanded to accommodate any number of channels . lastly , this structure has direct applications to implementations of itu g . 992 . 2 ( and other standards ) for dsl systems , since the baud rate changes throughout operation . in an alternate embodiment , it is possible that the data is received in parallel and the output transmitted in parallel . in yet another embodiment , it is possible that the data is received serially and the output transmitted in parallel . in yet another embodiment , it is possible that the data is received in parallel and the output transmitted serially . it is possible to implement the system as described above using other simd implementations and will be apparent to a person skilled in the art . although the invention has been described with reference to certain specific embodiments , various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the invention as outlined in the claims appended hereto . | 7 |
fig1 and 2 show anti - skid assembly 20 mounted on a tire 22 with fig1 showing the assembly 20 in normal position when the tire is properly rotating with respect to a road surface and fig2 depicts the position of the assembly when it has been automatically shifted to an operative position at which it gives maximum traction to the road surface to stop slippage when the tire is in a skid relative to the road surface . the tire is of a conventional type having a treaded circumferential road engaging surface 24 and a pair of opposing side walls 26 and 28 . assembly 20 includes a plurality of spaced straps 30 mounted transversely on the road engaging tire surface 24 . the straps are substantially parallel to one another and are mounted at their ends to a pair of opposing anchor cables 32 and 34 . the anchor cables are of sufficient length so as to permit the cable to extend circumferentially around the side wall of tire 22 . at least one of the cables , preferably the cable exposed to the exterior side of the tire when it is mounted on a vehicle includes a detachable means 36 which permits quick release attachment and detachment of the ends of a cable 32 or 34 when it is desired to remove the assembly from the tire or to mount the assembly on the tire . the general configuration of the assembly 20 including the cables 32 and 34 and the straps 30 is substantially the same as the embodiment shown in fig1 - 18 of u . s . pat . no . 3 , 817 , 307 . there are differences in structural details which will be specifically discussed below . anchor cables 32 and 34 are constructed of a braided fabric which is formed into a rope - like structure . the braided fabric provides a similar strength to that of the webbing used in u . s . pat . no . 3 , 817 , 307 and has additional advantages in that it is possible to separte the braids at the location of points of connection . for example , in fig5 it is shown how the braids of anchor cable 32 are parted to permit passage of a rivet 38 used to make the connection to a strap end or any other connection . by being able to separate the braids there is no reduction in strength of anchor member 32 which could occur if holes were punched in the anchor member 32 . naturally hole punching could require reinforcement around the location of the hole . this is unnecessary where the fabric can be braided and separated to permit passage of the rivet . it has been found that a conventional braided fabric can be utilized of a material such as polyester and the materical can be one that does not vary in length so that the anchor member can be properly sized for the tire on which it is to be utilized . alternatively as shown in fig3 and 4 , a single strap 30 which is the same as the straps of the fig1 and fig2 embodiment can be connected to a single anchor member 40 of the same material as anchor member 32 . anchor member 40 is much shorter in length than anchor member 32 and is used to connect a single strap 30 to a tire 22 by having a similar detachable means such as detachable means 36 in the embodiment of fig1 and 2 and being of sufficient length to pass through an appropriate aperture 42 in the tire . the actual separation point for anchor strap 40 can be intermediate its ends or at the location of connection to one end of strap 30 such as by means of connection assembly 44 . in the embodiment of fig3 - 8 , the detachable means 44 is located at the point of interconnection with one end of strap 30 . the other end of anchor member 40 is permanently attached to the other end of strap 30 . details of these points of attachment are depicted in fig5 - 8 and the manner of attachment is the same as for the embodiment of fig1 and 2 . the single strap attachment of fig3 - 8 is alternative to the multi - strap assembly of fig1 and 2 or is supplemental to that arrangement . the interconnection at the non - detachable end as shown in fig6 and 7 is accomplished by aligning the end portion of strap 30 which is of slightly greater thickness than the intermediate portion of the strap with the end of the braided anchor cable 40 . an appropriate aperture 46 is present in end 30 and is aligned with aperture 48 of cap 50 and aperture 52 of cap 54 . the caps are positioned on opposing sides of strap 30 and capture strap 30 and cable 40 therebetween with the holes therethrough in alignment with the hole in strap 30 . the exposed surfaces of caps 50 and 54 include counter sunk entrance ways 56 and 58 respectively to provide the necessary recesses for passage and mounting of rivet 38 therein . the rivet has a tubular body portion 60 and an enlarged head 62 on one end . insertion of rivet 38 through the aligned apertures will seat head 62 within the recess 56 in one cap and the opposite end portion of the rivet 38 in recess 58 . rolling over of the ends of the rivet in conventional fashion locks the rivet to the surrounding cap surface and in turn locks the anchor cable 40 to strap 30 . the rivets may be of a conventional metal material and the caps can be formed of a conventional low cost metal or plastic material which is of sufficient strength and hardness to maintain the integrity of the riveted connection . braided anchor cable 40 is detachably interconnected to form a continuous loop and detachable connector means 64 is utilized for this purpose . connector assembly 64 is shown in detail in fig8 of the drawings . it includes a rigid nylon or plastic receptacle hook 66 which has rectangularly shaped mating surfaces for engaging with one side of the end portion and edge of strap 30 so as to form a longer leg portion 68 with an aperture 70 therein to receive a rivet therethrough and a shorter leg portion 72 having an upright side wall 74 integrally formed with an arcuately shaped hook portion 76 . the undersurface of the hook portion forms a circular recess 78 with the inner surface of side wall 74 and the hook 76 terminates in a vertical edge 80 which is parallel to and spaced from inside edge 82 of wall 74 . the space between parallel edges 80 and 82 is less than the diameter of the arcuately shaped receiving recess 78 . the free end of cable 40 has a metal or rigid plastic rectangularly shaped loop 84 mounted thereon by means of a locking bar 86 affixed to the loop 84 intermediate the ends thereof and substantially bisecting an aperture 88 through the center of loop 84 . the end of cable 40 is passed through one portion of aperture 80 and over bar 86 and back through the other portion of aperture 88 doubling the cable upon itself and adjustably fixing the length of cable 40 . the end of loop 84 which extends beyond attached cable end 40 is of greater width than diameter so that it forms a locking tongue 90 . by positioning tongue 90 with its narrower dimension in alignment with the aperture formed between walls 80 and 82 , the tongue 90 can be passed therebetween and into larger arcuate recess 78 . thereafter , the locking tongue 90 can be rotated 90 ยฐ permitting its larger dimension to be exposed to the opening between walls 80 and 82 and retaining the tongue in position and the ends of cable 40 in attached condition . the wider dimension of tongue 90 is slightly less but approximately equal to the diameter of arcuate recess 78 thereby facilitating the rotation and positioning of the tongue within the recess in the latched position . to uncouple the cable ends , it is only necessary to rotate the tongue 90 the same 90 ยฐ to bring the smaller dimension of the tongue 90 into alignment with the opening between walls 80 and 82 at which time the loop 84 can be removed from receptacle 68 . in this manner , the coupling and uncoupling of the strap ends can be quickly and efficiently carried out . to assemble the strap to a tire it is merely necessary to pass one free end of the strap and cable assembly through an appropriate opening 42 in the tire with strap 30 positioned on the tire surface as shown in fig3 and 4 for use and the tongue 90 appropriately positioned as described above in recess 78 . if tightening of the strap and cable assembly is necessary , it is merely required to draw back on the free end of the loop of cable 40 formed on bar 86 . bar 86 is mounted in position by deforming the ends thereof into arcuate loops around the sides of loop 84 until they substantially encircle the sides of loop 84 and are crimped in that position so as to affix bar 86 to loop 84 . the same type of detachable means can be employed as detachable means 36 in the embodiment of fig1 and 2 . the longer leg of receptacle 66 is provided with an aperture 70 through which rivet 92 is passed with enlarged head 94 of the rivet bearing against the surface of the receptacle surrounding aperture 70 . an appropriate cap 95 is positioned with an aligned aperture 96 on the opposite side of the end of strap 30 to receive rivet 92 therethrough . the rivet ends are then turned over in conventional fashion to engage with the surface of cap 95 holding the cap and receptacle to the strap 30 . the portion of cap 95 surrounding aperture 96 is counter sunk to form recess 98 so that the end portion of rivet 92 is below the exposed surface of cap 95 . there are many different types of stud structures that can be employed to make the stops of the depicted embodiment with road engaging stud 41 . the studded straps can be used with a braided cable as shown and described above in connection with the embodiment of fig1 - 10 . alternatively it can be used with cables of other material such as chain , other metal , woven fabric , plastic or a combination of materials . some of these structures are depicted in fig1 - 22 of the drawings . stud 100 of fig1 is designed for assembly to strap 30 as shown in fig1 . the stud 100 includes a tubular body 102 having a central aperture 104 in one end to receive a rivet locking tool and having an enlarged head 104 on the other end . in the center of the top surface of head 106 is a tapered aperture 108 which is adapted to receive a tapered insert therein in tight frictional engagement . the insert 110 is shown in position in fig1 and partially extends above the upper surface of head 106 . insert 110 is of an extremely hard material such as high carbide steel to increase the longevity and biting characteristics of the stud in use . stud 100 as is the case with all of the stud discussed is of a hard material such as steel but need not be necessarily as hard as the high carbide steel of insert 111 . in fact , for ease of assembly and rolling over the ends of the rivets to lock it in position it is desirable to have a rivet of less hardness than insert 110 to facilitate assembly . as shown in fig1 , the stud 100 in the form of a rivet is inserted through an appropriate aperture 112 in strap 30 and through an aligned aperture in washer 114 on the underside of strap 30 . the riveting tool then is inserted through central aperture 104 in the bottom end of stud 100 and the ends are turned over locking the stud in position in strap 30 . the head 106 of the stud is positioned in a recess 116 in the upper surface of strap 30 formed by counter sinking the portion of the strap surrounding aperture 112 . in this manner , substantially only the hardened insert 110 is exposed to direct road surface contact and the head 106 is protected within recess 116 . it has been found that a tungsten carbide material is extremely effective for use as insert 110 . washer 114 can be of a hard metal or plastic material . it should have sufficient hardness to accept the rivet roll - over . other designs for the stud which can be assembled to strap 30 in the same manner are depicted in fig1 and 14 . stud 118 of fig1 is also in the form of a rivet and has an annular shaped head 120 and a wider upper body portion 122 terminating in an integrally formed lower body portion 124 . an appropriate tapered aperture 126 is present in the head end for receipt of the insert in an appropriate central bore 128 in the opposite end is provided for receipt of the riveting tool . stud 130 of fig1 also is in the form of a rivet and includes a tubular body 132 and an enlarged head 134 . the difference in structure from stud 100 resides in the nature of the bore arrangement with a continuous axial bore 136 being provided through the length of the stud . in this manner , one end of the bore is adapted to receive the riveting tool and the other end of the bore is adapted to receive insert 110 . another type of stud 138 is shown in fig1 where the stud takes the form of a screw machine shell having a smaller diameter tubular body portion 140 adapted to pass through the aperture 112 in the central portion of strap 30 and through an aperture in washer 142 to be rolled over and riveted in position as shown in dotted lines in fig1 . an appropriate central aperture 144 is formed in the end which passes through the washer to receive the riveting tool . the opposed end has an enlarged head portion 146 with a central aperture 148 to receive insert 110 of the hardened material . stud 150 of fig1 has the identical configuration of the embodiment of fig1 and is also of a screw machine shell type design . however , the end 152 which extends through aperture 112 is threaded to receive an appropriate nut 142 in threaded interengagement to lock the stud 150 in position . the positioning of the insert 110 is accomplished in a similar manner as in the previous embodiment . fig1 shows a further form as stud 154 which is once again in the form of rivet , this time with the head portion 156 on the underside of strap 30 and the body portion 158 of lesser diameter passing through aperture 112 in the strap and through an appropriate aperture in washer 160 on the upper surface of strap 30 . a single opening is present in the end of body portion 158 distal from head portion 156 to operate as a dual function opening first to receive the riveting tool to provide roll - over for the end of the body portion 58 onto the surface of washer 160 and then to receive insert 110 therein thereby forming the stud . stud 162 of fig1 is in the form of a tubular body 164 having an enlarged head 166 engaging with the undersurface of strap 30 . tubular body 164 passes through aperture 112 and has an annular groove 166 adjacent the end distal from the head . the groove extends beyond the upper surface of strap 30 and is adapted to receive a snap ring 170 to lock the stud 162 in position . an appropriately tapered aperture in the upper end of the stud body 164 is adapted to receive insert 110 to form the exposed stud for road engagement . fig1 shows a stud 172 which has an enlarged head 174 engaging with the undersurface of strap 30 and a tubular body 176 of lesser diameter passing through aperture 112 with at least the end portion of the tubular body having a threaded outer surface 178 to receive an appropriate nut 180 to lock the stud in position . an appropriate central aperture is provided to receive tapered insert 182 . a final form of stud 184 is depicted in fig2 . instead of a through hole in strap 30 &# 39 ;, a recess 186 is provided in the upper surface in which is inserted a portion of a tubular stud 188 . the stud material is the same as the stud material for the previous embodiments and includes a central aperture in the upper surface thereof to receive the hardened carbide insert 110 . in this embodiment , the stud may be positioned by pressing or molding it into the strap 30 &# 39 ; and includes a plurality of ribs 190 spaced along the portion inserted in recess 186 to serve in securing the stud 184 in the elastomeric material . fig2 and 22 show the use of bolts or rivets to provide the interconnection between anchor cable 40 and strap 30 . in fig2 it is shown how the apertures in the strap 30 and cable 40 are aligned with the appropriate apertures in caps 54 and 50 as described in connection with fig6 and 7 and then the rivet is inserted through the aligned apertures with the end portions being housed in the counter sunked recesses in the caps . a riveting tool 192 is then moved downward into the receiving riveting recess to provide roll - over of the ends of the rivet and lock it in position locking the caps and strap and anchor member together . an alternative form of attachment of the same members may be accomplished as depicted in fig2 by means of a threaded bolt 194 and a threaded nut 196 with the head of the bolt being received in the counter sunk recess in cap 50 and the nut being received in the counter sunk recess in cap 54 . naturally other conventional fastening means well known in the art can be substituted for the riveting and bolting arrangements depicted in fig2 and 22 . strap 30 as shown in fig2 has a central portion 198 of narrow diameter . in the normal relaxed position when mounted on the tire it has a small dimensioned thickness with projecting ribs 200 extending laterally on the tire surface . the upper exposed surface of the central portion 198 includes a lattice of ribs 202 to provide additional traction for the tire under normal operating conditions and two studs 204 spaced on the surface of the central portion 198 and extending upwardly therefrom . the studs once again facilitate normal traction with the road . the undersurface of central portion has a plurality of pointed prongs 206 extending downwardly therefrom which bite into the tire surface and tend to hold each strap in relatively fixed position on the tire when it is in normal position and the tire is rotating and not skidding with respect to the road surface . when a skid is initiated , the lateral projections 200 facilitate gripping of the strap with the road surface and twisting of the strap into the right angle position as shown in fig2 to expose the undersurface of central portion 198 to the road surface and enhance the gripping characteristics . in that position , the pointed projections 206 also assist in addition to the enlarged surface area exposed to the road due to the width of strap 30 in stopping the skid . once past the road contacting area , the strap will return to its initial configuration as shown in fig1 and in fig2 . in this manner , operation of the device depicted and described herein is the same as the device of u . s . pat . no . 3 , 817 , 307 . fig2 also shows two alternative methods of fastening the ends of strap 30 to the anchors 40 . in one form the anchor is merely connected to the ends of the strap 30 in the manner depicted in fig6 and 21 . however , alternatively as shown in respect to strap 30a as shown in fig2 partially in phantom , the strap ends include a pair of wings 208 with apertures 210 therein to receive the cable anchor 40 therethrough . this type of arrangement strengthens the cable attachment . the cable is first threaded through one aperture 210 and then is mounted in a similar fashion as described above by riveting or bolting to the strap and then passes through the other aperture 210 thereby permitting the loops 208 to bear some of the stress when the strap is twisted with respect to the cable as the strap shifts automatically between the operative and inoperative positions . to facilitate the shifting action , the central portion of strap 198 extends outwardly into a narrower neck portion 212 which does not contain projections 200 . neck portion 212 then is integral with an outwardly tapering extension 214 which communicates with a wider strap end 216 . the connection to cable 40 is made by means of an aperture through the end of portion 216 in the manner described above . the narrower central portion tapering outwardly into a wider end portion facilitates the twisting of the strap between the flat position with respect to the tire and the perpendicular position with respect to the tire in both directions . in this manner the strap operates identical to the straps of u . s . pat . no . 3 , 817 , 307 . the present assembly 20 is designed for use with or without the studs in the central portion of the strap . the nature of the braided anchor member 40 and the quick release nature of the detachable means for interconnecting the ends of the anchor are individually improvements in design . when studs are used , the number of studs is a matter of choice with two being the preferred number and as stated above the stud inserts can be of tungsten carbide or other similar hardened material such as stainless steel . it should also be noted that in a number of the embodiments of studs which are depicted and described above , there is a portion of the stud which extends above the exposed surface of the strap in addition to the insert 110 . this exposed portion provides an additional stop surface when the hardened insert wears off . the rivets and studs can be formed of a conventional steel material and the tapered hole for the insert can be formed in any conventional fashion such as by drilling . the material for straps 30 and 30 &# 39 ; and 30a is of a similar nature as the material described in u . s . pat . no . 3 , 817 , 307 such as a flexible high strength material like polyurethane plastic or a high strength rubber . thus the several aforenoted objects and advantages are most effectively attained . although several somewhat preferred embodiments have been disclosed and described in detail herein , it should be understood that this invwention is in no sense limited and its scope is to be determined by that of the appended claims . | 1 |
referring now to the figures , where like numbers indicate like features , the illustration of fig1 depicts a block diagram illustrating an exemplary layout and interconnectivity of electronic devices comprising a guest check presentation device with rfid payment receiving capabilities 100 ( hereinafter , rfid device ). the rfid device 100 may include a wireless ( e . g . rfid ) antenna / receiver 101 , and a dedicated rfid processor 102 . in exemplary embodiments of the rfid device , the rfid antenna may be used to read information from an rfid payment token , such as , but not limited to , an rfid keychain fob , an rfid enabled credit card or rfid enabled hotel key . in particularly useful embodiments , the rfid antenna 101 may be integrated into the rfid processor . the rfid processor 102 is also connected to a processor 105 in a manner that allows communication with the rfid processor 102 . in one exemplary embodiment , the rfid processor may be connected to the processor 105 via a pin - to - pin multi - line data bus , a bi - directional bus , such as the inter - integrated bus ( 12 c ), or via a serial connection . in another particularly useful embodiment , the rfid processor 102 may be integrated into the processor 105 . the processor 105 may also be connected to a communication device 103 . in some exemplary embodiments , this communications device 103 may be a device capable of communicating with a base station wirelessly using rf transmissions . in one particularly useful embodiment , the communication device 103 may be an 802 . 11x receiver / transmitter , communicating using any supported rf transmission protocol . in another useful embodiment , the communication device 103 may be an infra - red transmitter / receiver capable of communicating with a base station in a wireless fashion using transmissions in the infrared ( ir ) range . another exemplary embodiment of the communication device 103 may be where the communication device 103 is a contact socket connector which may be physically plugged into a docking station , where communication with a server and transmission of data may occur via the communications device 103 . in one useful embodiment , the communications device 103 may be , but is not limited to , a serial socket such a usb plug , rs232 socket , or db9 socket . in yet another particularly useful embodiment , the communications device 103 may be a multi - line bus socket similar to , but not limited to , a pcmcia socket , 22 - pin sync socket , ide plug , or the like . according to one implementation , the communication device 103 may be used to load information regarding a guest check onto the rfid device 100 . in another exemplary embodiment , the communications device 103 may be used to transmit information regarding payment , such as verifying the account represented by an rfid payment device used to pay a guest check . the rfid payment device and be any known device , such as , for example , a credit card with rfid capability , a keychain or other compact rfid payment device , a cell phone having an rfid payment capability , a personal digital assistant ( pda ) having rfid payment capability , etc . for example , after a customer pays a guest check using the rfid payment device of their choice , the processor 105 may transmit the guest account information via a wireless communication device 103 to a base station or account server , where the account information is verified , and the account properly debited , after which the account server may transmit an acknowledgement back the communication device 103 residing within the rfid device 100 . alternatively , the guest account information may be stored within system memory 106 until the rfid device 100 is returned to a dock or base station , where , upon the rfid device 100 being plugged into the dock , the communication device 103 then transmits the guest account information to a server where the appropriate guest account is debited . in another useful implementation , the communication device 103 may take the form of a physical socket which including one or more physical electrical connections used to charge batteries powering the rfid device 100 . the processor 105 may also be connected in a bidirectional manner to some form of system memory 106 . the system memory 106 may be any known or unforeseen class of digital memory such as eeprom , eprom , ram , rom , flash memory , removable digital storage such as a memory card or any combination thereof . the processor 105 may store and retrieve from the system memory 106 data such as , but not limited to , information regarding the guest check . additionally , the system memory 106 may be used to store an operating system or computer code for execution by the processor 105 controlling the operation of the rfid device 100 and for controlling any specific applications that may be appropriate for the device and the establishment within which it is used ( e . g ., customer reward programs , customer reward redemption , etc .). in some exemplary embodiments , the system memory 106 may be removably disposed within a socket to facilitate upgrades of memory . in another exemplary embodiment , the system memory 106 may be integrated into the processor 105 , e . g . as with a microcontroller such as exhibited by the 80cx51 microcontroller architecture . one or more keypad inputs 104 may also be connected to the processor 105 to collect user input to be communicated to the processor 105 . the keypad inputs 104 may include a numeric keypad for manually entering numeric data , buttons allowing a user to respond to prompts given on the graphic display 107 , other buttons used to interact with the rfid device 100 , or a combination thereof . in one exemplary embodiment , the keypad inputs 104 may be comprised of buttons representing individual digits for entering data , e . g . manually entering a numerical value representing a gratuity when a bill or guest check is presented to a guest in a hospitality setting such as a restaurant , hotel , or tavern . in another useful embodiment , the keypad inputs 104 may include one or more buttons to automatically add a fixed percentage of the presented bill as a gratuity before payment is tendered via an rfid payment token or device . in yet another exemplary embodiment , the keypad inputs 104 may also be comprised of one or more buttons for interacting with the rfid device 100 . for example , a guest presented with a bill or check in a hospitality environment may be given the opportunity to press a keypad input 104 button indicating a standard gratuity percentage prior to payment via an rfid payment token . additionally , a guest presented with a bill may be prompted to approve the amount to be charged by pressing a keypad input 104 button indicating acceptance of the charge before using an rfid payment token to provide payment information . those of skill in the art will recognize that keypad 104 can be in the form of buttons ( as shown ), or could be integrated into the graphic display 107 as a touch sensitive display screen . the processor 105 may also be connected to a graphic display 107 , via which the processor 105 may display information regarding the current transaction to a guest or customer . the graphic display 107 may be any known or unforeseen device allowing the electronic display of text or pictorial information such as an lcd , active or passive matrix tft screen , led or oled screen , etc . in an exemplary implementation , after the rfid device 100 is loaded with information regarding the guest check and presented to the guest , the graphic display 107 may show the total of the guest check , and prompt the user to enter a gratuity using the keypad input 104 , or prompt the guest to make payment bringing the rfid payment device within range of the rfid antenna 101 disposed within the rfid device 100 . the rfid device 108 may also include one or more indicator lights 108 connected to the processor 105 , and which may be used to signal the status of the rfid device 100 . in one exemplary embodiment , the rfid device may include three indicator lights which may be of different color , wherein one indicator light 108 may be used to indicate that rfid device is ready for payment , one indicator light may indicated that the rfid device has received payment or that the rfid payment device was properly read and recognized by the rfid antenna 101 and rfid processor 102 , and one indicator light 108 used to indicate that the payment approved and that the transaction is complete . in another exemplary embodiment , one of the indicator lights 108 may be used to indicate the charge status of batteries powering the rfid device 100 . the illustration of fig2 depicts an isometric view of a guest check presentation device with rfid payment capabilities ( hereinafter , the rfid device ). the rfid device 200 includes an enclosure , or housing 201 , with a display screen 203 for displaying data to a user . the housing 201 may be made of any suitably rigid material ( e . g . plastic , metal , etc .). in one exemplary implementation , the housing 201 may be used to house electronic components , such as those shown if fig1 , which may be needed to handle display , reading the rfid payment tokens , and communication . in another implementation , the housing 201 of the rfid device may include a recessed area 206 for disposition of a paper receipt for presentation to a guest . the display screen 203 may be of any type suitable for displaying text , graphics , or a combination thereof , to a guest , as exemplified in fig1 . the display screen 203 may be used to show the total amount for a guest check , or provide instructions for use of the rfid device to the user . in another useful embodiment , the display screen 203 may be used to display responses to prompts on the display screen , which responses may be selected using keypad inputs of the keypad 204 . response buttons 202 may be disposed adjacent to the display screen . in one preferred implementation , one or more response buttons 202 may each be labeled with a percentage for adding a tip or gratuity to the total check amount . in another useful implementation , the display screen 203 may show responses to a question or prompt shown on the display screen 203 , with the response buttons 202 allowing a user to select a response button corresponding to one of the provided responses . for example , a guest may be presented with an rfid device 200 where the information regarding the guest &# 39 ; s bill has been loaded . in this example , the device 200 may display possible responses on the display screen 203 directly above each response button 202 , with a different possible response being associated with each response button 202 . the rfid device 200 may display the total of the check , and the prompt the user to input a gratuity using the response buttons 202 , if desired . in such a situation , prompts allowing a user to automatically add their choice of a predetermined or recommended gratuity amount may be provided , or alternatively , various options such as 10 %, 15 % or 20 % gratuity may be displayed over the response buttons 202 . after a gratuity , if any , is entered , the rfid may recalculate the guest check , including the gratuity , and prompt the guest to press a response button 202 to accept the totality of the charges . keypad input buttons 205 may also be disposed on the face of the rfid device 200 . the keypad input buttons 205 may be used to manually enter numbers when more customized entry is required than provided by the response buttons 202 . in an exemplary embodiment , the keypad input buttons 205 may be used to enter a gratuity or tip amount that does not correspond to the standard and automatically calculated amounts allowed entry by the response buttons 202 . for example , a guest that feels he received excellent service may wish to give an extraordinary gratuity of 30 %, and would be able to key that amount in via the keypad input buttons 205 . in another embodiment , the keypad input buttons 205 may be used to enter a total charge amount including gratuity for a guest that prefers to charge a rounded amount when gratuity is added to the check . for example , a guest presented with an rfid device with a bill of $ 42 . 37 may wish to add gratuity such that the total charge is $ 50 . 00 instead of automatically adding a percentage that result in a charge that does not total an easily accountable amount . as mentioned above , keypad input buttons 205 could alternatively be integrated into the display 203 as a touch sensitive display . indicator lights 204 may be disposed on the housing 201 of the rfid device 200 . one or more of the indicator lights 204 may be used to display the status of the rfid 200 device to the guest , the server handling the transaction , or others . in an exemplary implementation , one indicator light 204 may be used to show that the rfid device is functioning properly , and is ready to receive payment . in this embodiment , a server may load information regarding the guest check into the rfid device , after which the indicator light 204 may illuminated indicating the rfid device is ready to be presented to the guest . in another exemplary embodiment , one indicator light 204 may be used to show that payment has been made by the guest , and that the rfid device may be retrieved by the server . in yet another embodiment , one indicator light may be used to show that the rfid device 200 was unable to read the guest &# 39 ; s rfid payment device , or that the guest payment was not accepted due to the guest account being invalid or having insufficient funds . additionally , in one useful embodiment , the indicator lights 204 may be disposed on the face of the rfid device 200 as exemplified in fig2 , or the indicator lights 204 may located elsewhere , such as the upper end face of the rfid device 200 . referring now to fig3 , the upper face 300 of the rfid device as shown in fig2 is displayed in isometric detail . in this figure , the rfid device includes an opening 301 allowing access to a communications socket or device 103 disposed within the opening 301 . in the embodiment exemplified in fig3 , socket and opening 301 may be disposed within the upper end surface or face of the rfid device 200 . in other useful implementations , the socket and opening 301 may be disposed within the lower end or face , or any other portion of the rfid device 200 housing 201 . the disposition of the socket and opening 301 may allow multiple rfid devices 200 to be plugged into a single base station parallel to one another , allowing for a compact storage arrangement . the illustration of fig4 depicts an isometric view of an alternative exemplary embodiment 400 of the rfid device 200 as shown in fig2 . in this embodiment , a cover 401 is hingedly attached to the housing 201 of the rfid device via a spine 402 . the cover 401 may be opened and closed in order to insert a guest check , or to access the interactive features of the rfid device . the illustration of fig5 depicts an isometric view of another alternative implementation 500 of guest check presentation device with rfid payment capabilities . in this implementation , response buttons 202 , a display screen 203 , indicator lights 204 , and keypad input buttons 205 may be disposed within a housing or case 501 . according to one particularly useful implementation , the display screen 203 may be of a size suitable for displaying multiple lines of a guest check . additionally , navigation buttons 503 may be disposed within the case 501 . in some embodiments , the navigation buttons may be used to scroll the text shown on the display screen 501 . fig6 is a flow diagram illustrating the process of presenting and electronically handling payment of a guest check using rfid payment device in a hospitality environment . in this process 600 , after hospitality service 601 such as a meal is completed , the guest check is totaled or finalized 602 . the totaled guest check is then printed , if necessary , and loaded 603 into the rfid device system memory 106 . the rfid device 100 with the guest check loaded into system memory 106 is then presented to the customer 604 . the customer then has the opportunity to review the check 605 , ensuring that the check conforms to their expectations . the customer may then be prompted by the rfid device 100 to enter a tip or gratuity 606 if the customer desires . after the customer enters a tip or gratuity 606 , the customer then swipes an rfid payment device 607 by bringing the rfid payment device into such proximity to the rfid antenna 101 that the rfid antenna 101 and rfid processor 102 disposed within the rfid device 100 may read the rfid payment device . the rfid device 100 then determines whether the rfid payment device was read properly 608 . where the rfid payment device was properly read , the rfid device 100 indicates rfid payment device acceptance 610 , and stores payment information 611 in the rfid device 100 system memory 106 . the payment information may next be verified 612 , after which the customer account is debited 613 . where the rfid device determines that the payment device was not properly read , the rfid device then indicates the rfid device failed to read the payment device 609 . fig7 is a flow diagram illustrating an alternative embodiment of a process for presenting and electronically handling payment of a guest check using rfid payment device in a hospitality environment . in this exemplary embodiment 700 , after hospitality service 701 is completed , the guest check is totaled or finalized 702 . the guest check is then printed , if necessary , and loaded 703 into the rfid device 100 system memory 106 . the rfid device loaded with the guest check is then presented to the customer 704 . the customer then reviews the check 705 , and enters a tip , if desired 706 . the customer then swipes an rfid payment device 707 to make payment . the rfid payment device information is then wirelessly transmitted to a base station 708 via a communication device 103 , where a payment is verified 709 . the base station then determines whether payment was accepted 710 . the customer rfid device that is used for swiping may be any type of rfid payment device . examples of such devices include , but are not limited to , rfid enabled credit cards ; rfid enabled wireless telephones ; rfid enabled personal digital assistants ( pdas ), rfid keychain type devices ; rfid usb keys , and any other known , or not yet known device that contains and rfid type device or radio tag that contains and / or stores customer payment information that can be interrogated and obtained during an rfid payment transaction . when the payment via rfid payment device is accepted , acceptance of the payment is transmitted 713 wirelessly to the rfid device 100 . the rfid device 100 then indicates payment acceptance 714 , and the customer account is debited 715 accordingly . where the base station determines that the payment was not accepted , declination of the payment is transmitted 711 to the rfid device 100 , which then indicated that the payment was declined 712 . those of ordinary skill in the art will recognize that the examples given herein are for exemplary purposes and may be changed without departing from the spirit of the invention . although illustrative embodiments of the present principles have been described herein with reference to the accompanying drawings , it is to be understood that the present principles are not limited to those precise embodiments , and that various other alterations , modifications and improvements may be affected therein by one skilled in the art . such alterations , modifications and improvements are intended to be within the scope and spirit of the present principles . accordingly , the foregoing description is by way of example only and is not intended to be limiting . this present principles should be limited only by the claims and equivalents thereof . | 6 |
the isocyanate trimers of formula a , which are used for the production of the urethane acrylates according to the invention are known from ep - a 798 , 299 ( u . s . pat . no . 5 , 914 , 383 , herein incorporated by reference ) or german patent application de - a 19 734 048 . 2 ( copending application u . s . ser . no . 09 / 126 , 303 , herein incorporated by reference ). the isocyanate trimers which are preferably used are those produced by the partial oligomerization of hexamethylene diisocyanate ( hdi ), 1 , 3 - bis ( isocyanatomethyl )- cyclohexane ( h 6 xdi ) or isophorone diisocyanate ( ipdi ). it is immaterial whether or not the diisocyanate starting material to be oligomerized is completely separated from the reaction products after partial oligomerization . the isocyanate trimers of formula , which are preferably used for the production of the urethane acrylates according to the invention , are those having a viscosity at 23 ยฐ c . of 300 to 3000 mpa ยท s , preferably 500 to 2000 mpa ยท s , more preferably 500 to 1500 mpa ยท s and most preferably 1000 to 1500 mpa ยท s ; an nco content of preferably 15 to 30 % by weight , more preferably 20 to 25 % by weight ; and a content of unreacted starting diisocyanates , of less than 5 . 0 % by weight , preferably less than 1 . 0 % by weight and more preferably less than 0 . 5 % by weight . alcohol component b ) is selected from one or more monobasic hydroxy - functional esters of ( meth ) acrylic acid . the latter is to be understood to include both esters of acrylic acid and esters of methacrylic acid . examples include the hydroxy - group containing esters obtained by reacting acrylic acid or methacrylic acid with dihydric alcohols , such as 2 - hydroxyethyl , 2 - or 3 - hydroxy - propyl or 2 -, 3 - or 4 - hydroxybutyl ( meth ) acrylates . also suitable are monohydric alcohols containing ( meth ) acryloyl groups and reaction products substantially containing monohydric alcohols which are obtained by the esterification of n - hydric alcohols with ( meth ) acrylic acid , wherein โ n โ preferably represents a whole number , or a fractional number ranging from greater than 2 to 4 , preferably 3 , and wherein ( n โ 0 . 8 ) to ( n โ 1 . 2 ), preferably ( n โ 1 ) moles of ( meth ) acrylic acid are used per mole of alcohols . mixtures of different alcohols can also be used as the alcohols . examples of these compounds include the reaction products of i ) glycerol , trimethylolpropane and / or pentaerythritol , or low molecular weight alkoxylation products of these alcohols ( such as ethoxylated or propoxylated trimethylolpropane , e . g . the addition product of ethylene oxide and trimethylolpropane , oh number 550 ). also suitable are mixtures of at least trihydric alcohols of this type with dihydric alcohols such as ethylene glycol or propylene glycol for example , with ( ii ) ( meth ) acrylic acid in the preceding molar ratio . these compounds have a number average molecular weight of 116 to 1000 , preferably 116 to 750 and more preferably 116 to 158 . mono - or dihydric alcohols which have a molecular weight of 100 to 300 , preferably 130 to 200 , contain ether and / or ester groups and have a branched structure can optionally be used as a further constituent of the alcohol component . examples include 2 , 2 - diethyl - 1 , 3 - propanediol , 2 , 2 - dimethyl - 1 , 3 - propanediol , 2 - ethyl - 1 , 3 - hexanediol , 2 , 5 - dimethyl - 1 , 6 - hexanediol , 2 , 2 , 4 - trimethyl - 1 , 3 - pentanediol , ( 3 - hydroxy - 2 , 2 - dimethyl - propyl )- 3 - hydroxy - 2 , 2 - dimethyl propionate and trimethylolpropane formal . the reaction of starting components a ) and b ) can be carried out in the absence of solvents or in solvents which are inert to isocyanates and hydroxyacrylates . example include acetone , 2 - butanone , ethyl acetate , n - butyl acetate and low molecular weight esters of ( meth ) acrylic acid , which are known by the generic term โ reactive thinners โ for curing under the effect of high - energy radiation ( e . g ., those described in p . k . t . oldring ( ed . ), chemistry & amp ; technology of uv & amp ; eb formulations for coatings , inks & amp ; paints , vol . 2 , 1991 , sita technology , london , pages 237 - 285 ). the reaction is carried out at temperatures of preferably 20 to 100 ยฐ c ., more preferably 40 to 80 ยฐ c . starting components a ) and b ), and the individual constituents of components a ) and b ), can be reacted in any sequence when carrying out the method according to the invention . the nco / oh equivalent ratio of components a ) and b ) is 0 . 7 : 1 to 1 : 1 , preferably 0 . 9 : 1 to 0 . 95 : 1 . in one preferred embodiment of the method , component a ) is placed in a suitable reaction vessel and that portion of component b ) that contains hydroxy - functional esters of ( meth ) acrylic acid is first added then reacted at the preceding temperatures until an nco content is reached which corresponds to the complete conversion of the hydroxy - functional esters of ( meth ) acrylic acid . the remainder of component b ), which may optionally be present and does not contain esters of ( meth ) acrylic acid is subsequently added , and again reacted at the aforementioned temperatures until an nco content is reached which corresponds to as complete reaction of the hydroxy - functional component which is possible . if component b ) contains a constituent which is not an ester of ( meth ) acrylic acid , the preferred molar ratio , based on hydroxy groups , of the constituent which contains ( meth ) acrylic acid esters to the constituent which is free from ( meth ) acrylic acid is 99 : 1 to 7 : 1 , more preferably 50 : 1 to 10 : 1 . the reaction of components a ) and b ) can be conducted with or without catalysts . suitable catalysts are known from urethane chemistry and include tin ( ii ) octoate , dibutyltin dilaurate and tertiary amines such as diazabicyclooctane . the resulting products preferably have an nco content of less than 0 . 5 % by weight , more preferably less than 0 . 1 % by weight . in order to prevent unwanted , premature polymerization , both during the reaction and during subsequent storage , it is recommended that 0 . 01 to 0 . 3 % by weight , based on the total weight of the reactants , of known polymerization inhibitors or antioxidants may be added to the reaction mixture . examples of these additives are described in โ methoden der organischen chemie โ ( houben - weyl ), 4th edition , volume xiv / 1 , page 433 et seq ., georg thieme verlag , stuttgart 1961 , and include phenols , cresols and / or hydroquinones . in a preferred embodiment of the preparation method , an oxygen - containing gas , preferably air , is passed through the reaction mixture in order to prevent unwanted polymerization of the ( meth ) acrylates . the urethane acrylates according to the invention can be employed as the sole binder component or can be used in admixture with other binder components that may be cured by radiation . these binder components are described , for example , in p . k . t . oldring ( ed . ), chemistry & amp ; technology of uv & amp ; eb formulations for coatings , inks & amp ; paints , vol . 2 , 1991 , sita technology , london , pages 31 - 235 . examples include urethane acrylates , epoxy acrylates , polyester acrylates , polyether acrylates and unsaturated polyesters . in addition , the binder vehicles according to the invention can be used in a form in which they are thinned by solvents . examples of suitable solvents include acetone , 2 - butanone , ethyl acetate , n - butyl acetate , methoxypropyl acetate and low molecular weight esters of ( meth ) acrylic acid . the mono -, di - or oligo esters of ( meth ) acrylic acid are known as reactive thinners . their function is to reduce the viscosity of the uncured coating composition and to be incorporated into the polymer by polymerization during curing . these compounds are described in p . k . t . oldring ( ed . ), chemistry & amp ; technology of uv & amp ; eb formulations for coatings , inks & amp ; paints , vol . 2 , 1991 , sita technology , london , pages 237 - 285 . examples include esters formed from acrylic acid or methacrylic acid , preferably acrylic acid , with the following alcohols : monohydric alcohols , such as the isomeric butanols , pentanols , hexanols , heptanols , octanols , nonanols and decanols ; cycloaliphatic alcohols such as isoborneol , cyclohexanol , alkylated cyclohexanols and dicyclopentanol ; arylaliphatic alcohols such as phenoxyethanol and nonyl phenyl ethanol ; and tetrahydrofurfuryl alcohols . also suitable are alkoxylated derivatives of these alcohols . examples of dihydric alcohols include alcohols such as ethylene glycol , 1 , 2 - propanediol , 1 , 3 - propanediol , diethylene glycol , dipropylene glycol , the isomeric butanediols , neopentyl glycol , 1 , 6 - hexanediol , 2 - ethylhexanediol , tripropylene glycol and alkoxylated derivatives of these alcohols . the preferred dihydric alcohols are 1 , 6 - hexanediol , dipropylene glycol and tripropylene glycol . examples of trihydric alcohols include glycerol , trimethyolpropane and alkoxylated derivatives thereof . propoxylated glycerol is preferred . the polyhydric alcohols which can be used include pentaerythritol or ditrimethylol propane and alkoxylated derivatives thereof . a photoinitiator component can also be added for the curing process by high - energy radiation . these components comprise initiators which are known in the art and which are capable of initiating polymerization by a free radical mechanism after irradiation by high - energy radiation . suitable photoinitiators are described in p . k . t . oldring ( ed . ), chemistry & amp ; technology of uv & amp ; eb formulations for coatings , inks & amp ; paints , vol . 3 , 1991 , sita technology , london , pages 61 - 325 , for example . they are used in amounts of 0 . 1 to 10 parts by weight , preferably 2 to 7 parts by weight and more preferably 3 to 4 parts by weight , based on the weight of components a ) and b ). the urethane acrylates according to the invention can be mixed with the known additives for polyurethane coating compositions , such as extenders , pigments , colorants , thixotropic agents , glossing agents , matting agents and flow enhancers , which are employed in customary amounts . the invention is further illustrated but is not intended to be limited by the following examples in which all parts and percentages are by weight unless otherwise specified . 1000 g ( 5 . 95 mole ) of hdi were placed in a stirred apparatus fitted with an internal thermometer , a reflux condenser , a gas inlet tube and a metering device for catalyst solution and were initially freed from dissolved gases at 60 ยฐ c . and a pressure of about 0 . 1 mbar for one hour . dry nitrogen was then passed through the batch , and a solution of tetrabutylphosphonium hydrogen difluoride ( bu 4 p + f โ ยท xhf ) in methanol / isopropanol was added in portions over about 20 to 50 minutes . during the addition a gentle stream of nitrogen was passed through the batch at an internal temperature of 60 ยฐ c ., in such a way that the internal temperature did not exceed 70 ยฐ c . the catalyst solution contained 4 . 75 % f โ , which did not represent the total fluorine content , and was prepared as described in german patent application de - a 19 824 485 . 2 ( co - pending application u . s . ser . no . 09 / 320 , 366 , herein incorporated by reference ), example 1a โ stock solution 1 ). after the refractive index n d 20 had reached the value given below , further reaction was suppressed ( see below ) by adding an amount of di - n - butyl phosphate , which corresponded to the molar consumption of fluoride . the batch was stirred for a further hour at 60 ยฐ c . and unreacted hdi was subsequently separated by thin - layer distillation in a short - tube evaporator at 0 . 15 mbar , using a heating medium at a temperature of 180 ยฐ c . the properties of polyisocyanate component a ), which contained hdi iminooxadiazine dione groups , are set forth below : further reaction was suppressed at : n d 20 = 1 . 4620 , which corresponded to the consumption of 421 mg of the catalyst solution and to the use of 221 mg di - n - butyl phosphate as the terminating reagent . 45 mole % of the isocyanate groups of hdi , which were converted in the oligomerization reaction , were present as iminooxadiazine dione groups and 52 mole % were present as isocyanurate groups . the difference from 100 mole % was essentially due to uretdione groups ( determined by 13 c nmr spectroscopy , as described in copending application u . s . ser . no . 09 / 318 , 537 , herein incorporated by reference , and in โ die angewandte makromolekulare chemie 1986 , 141 , 173 - 183 โ). further reaction suppressed at : n d 20 = 1 . 4670 , which corresponded to the consumption of 410 mg of the catalyst solution and to the use of 215 mg of di - n - butyl phosphate as the terminating reagent . 305 . 3 g of the polyisocyanate from example 1a ) were dissolved in 122 . 7 g of butyl acetate , and 0 . 1 g of dibutyltin dilaurate and 0 . 49 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol were added to the resulting mixture . the solution was heated to 60 ยฐ c . while passing air through it and while stirring . the source of heat was removed , and initially 64 . 4 g of 2 - hydroxypropyl acrylate and secondly 134 . 0 g of hydroxyethyl acrylate were added drop - wise in such a way that the temperature did not exceed 60 ยฐ c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . 615 . 4 g of the polyisocyanate from example 1b ) were treated with 0 . 5 g of dibutyltin dilaurate and 1 . 0 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol . the solution was heated to 60 ยฐ c . while passing air through it and while stirring . the source of heat was removed , and 394 . 4 g of 2 - hydroxyethyl acrylate were added dropwise such that the temperature did not exceed 60 ยฐ c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . a further 0 . 5 g of di - tert .- butyl - 4 - methyl - phenol were subsequently stirred in over 10 minutes at 60 ยฐ c . as a stabilizer . example 3 was repeated with the exception that 202 . 0 g of butyl acetate were initially placed in the reaction vessel . 435 . 0 g of the polyisocyanate from example 1b ) were dissolved in 176 . 0 g of 1 , 6 - hexanediol diacrylate , and 0 . 35 g of dibutyltin dilaurate and 0 . 35 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol were added thereto . the solution was heated to 60 ยฐ c . while passing air through it and while stirring . the source of heat was removed , and initially 78 . 0 g of 2 - hydroxypropyl acrylate , secondly 162 g of hydroxyethyl acetate , and finally 29 . 0 g of 2 - ethyl - 1 , 3 - hexanediol were added dropwise such that the temperature did not exceed 60 ยฐ c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . a further 0 . 35 g of di - tert .- butyl - 4 - methyl - phenol were subsequently stirred in over 10 minutes at 60 ยฐ c . as a stabilizer . 239 . 2 g of desmodur n 3600 ( an product of bayer ag , leverkusen , essentially containing hdi isocyanurate , nco content : 23 . 4 % by weight , viscosity 1200 mpa ยท s at 23 ยฐ c .) were dissolved in 98 . 9 g of butyl acetate , and 0 . 2 g of dibutyltin dilaurate and 0 . 4 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol were added thereto . the solution was heated to 60 ยฐ c . while passing air through it and while stirring . the source of heat was removed , and initially 50 . 7 g of 2 - hydroxypropyl acrylate and secondly 105 . 6 g of hydroxyethyl acrylate were added dropwise such that the temperature did not exceed 60 ยฐ c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . 248 . 4 g of the polyisocyanate starting materials form example 6 were dissolved in 102 . 3 g of butyl acetate and were treated with 0 . 2 g of dibutyltin dilaurate and 0 . 4 g of 2 , 6 - di - tert .- butyl - 4 - methyl - phenol . the solution was heated to 60 ยฐ c . while passing air through it and while stirring . the source of heat was removed , and 156 . 6 g of hydroxyethyl acrylate were added dropwise such that the temperature did not exceed 60 ยฐ c . the reaction was complete when the nco content of the solution was less than 0 . 10 % by weight . a further 0 . 1 g of di - tert .- butyl - 4 - methyl - phenol were subsequently stirred in over 10 minutes at 60 ยฐ c . as a stabilizer . the viscosities of the products produced were determined by means of a rotating viscometer at 23 ยฐ c . to test the tendency of the products to crystallize , one part of each product was stored at 23 ยฐ c . and another part of each product at 8 ยฐ c . all samples were checked daily for possible thickening / cry - tallization . products that exhibited thinnckening / crystallization were subsequently heated for 60 minutes at 60 ยฐ c . and were the stirred briefly . the initial viscosity , which was measured shortly after the production thereof , was obtained again . a comparison of examples 2 and 6 and of examples 4 and 7 shows that the products according to the invention had a lower viscosity and exhibited significantly improved storage stability . the products according to the invention obtained in examples 2 to 5 and the comparison products obtained in examples 6 and 7 were each treated with 2 . 5 % by weight of darocur 1173 ( a photoinitiator available from ciba spezialtรคtenchemie gmbh ). after applying the coating compositions to cardboard ( thickness of application : 250 g / m 2 ), the coated samples were passed under a high - pressure mercury vapor lamp ( hanovia , 80 w / cm , at a distance of 10 cm ). at a belt speed of at least 10 m / minute , solvent - and scratch - resistant coatings were formed . the term โ solvent - resistant โ in this instance means that the coating still appeared perfect after least 30 double strokes with a cloth saturated with n - butyl acetate under a load of 1 kg . although the invention has been described in detail in the foregoing for the purpose of illustration , it is to be understood that such detail is solely for that purpose and that variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention except as it may be limited by the claims . | 2 |
fig1 , in part , comprises the flat panels from which opposed interior sidewalls 203 j and 203 k , and middle floor panel 203 c , are formed . fig2 comprises the flat die cut sheet of fig1 after said panels 203 j , 203 k and 203 c have been detached along cut line 801 ( fig1 ). fig2 shows the flat panels of corrugated sheet 204 a and 204 b that can be folded along crease lines 291 f and 291 e to form the aforementioned front door , said panels referred to herein as the โ inside panel โ and โ outside panel โ, respectively . outside panel 204 b extends outwardly from exterior floor panel 101 . inside panel 204 a extends from outside panel 204 b . fig3 shows inside panel 204 a after it has been turned upward about 90 degrees . fig4 shows inside panel 204 a after it has been turned upward a full 180 degrees , thereby overlapping outside panel 204 b and glued to it to form the center section of the front door of said box . opposed rounded wings 204 c and 204 d extend from the left and right sides of outside panel 204 b . said center section and opposed rounded wings comprise the โ front door โ of said box . crease line 262 c acts as a hinge between said front door and said exterior floor panel of said box . said front door rotates between open and closed positions upon said hinge 262 c . in alternative embodiments , said front door could extend from ( and be hingedly attached to ) to other locations including , without limitation , the top lid or the interior or exterior sidewalls of said box . hole 617 provides a finger notch to facilitate opening said front door . fig5 a shows panels 203 j and 203 k after they have been turned ninety degrees upward with respect to middle floor panel 203 c . fig5 b shows a preferred embodiment in which panels 203 j and 203 k are positioned to form the interior sidewalls of the box . the upper side of middle floor panel 203 c has been glued to the lower side of interior floor panel 101 . in alternative embodiments , said opposed interior sidewalls and middle floor panel could extend from locations other than those shown in the preferred embodiment . said interior sidewalls 203 j and 203 k comprise holes 203 e and 203 f , respectively . fig5 b shows opposed panels 103 j and 103 k and opposed panels 102 a and 102 b as flat sheet before being turned . fig5 c shows said panels 103 j , 103 k , 102 a and 102 b after having been turned ninety degrees inward along crease lines 905 and 906 ( fig1 ). panels 103 j and 103 k form the opposed exterior sidewalls of the box . said exterior sidewalls comprise holes 103 e and 103 f , respectively . holes 103 e and 103 f are aligned with the aforementioned holes 203 e and 203 f , respectively , thereby forming a set of gripping areas through which hands can be inserted for carrying the box . fig5 c further shows panel 105 a after it has be turned along crease line 907 to form the exterior back wall of the box of the present invention . in fig5 b and 5c , wings 204 c and 204 d have been partially turned inward along crease lines 924 . fig5 d shows the box of the present invention after the aforementioned panels 102 a and 102 b ( not visible in fig5 d ) have been turned ninety degrees upward and glued to the underside of middle floor panel 203 c , said panels 102 a and 102 b thereby comprising the exterior floor panels of said box . panel 102 a has been turned along crease lines 901 a and 903 a ; panel 102 b has been turned along crease lines 901 b and 903 b . with respect to each of said panels , a double set of crease lines is used to facilitate turning . in fig5 d , exterior floor panels 102 a and 102 b , interior floor panel 101 and middle floor panel 203 c overlap each other and are glued together to form the triple thickness floor of box of the present invention . alternative embodiments may comprise single , double or other floor thicknesses . fig6 shows : ( i ) panels 104 a and 104 b in the process of being folded towards each other along crease lines 911 and 912 and ( ii ) panel 105 b after it has been turned with respect to panel 104 b along crease line 908 . fig7 shows : ( i ) panel 104 b after it has been fully folded and glued to panel 104 a , thereby forming a double - thickness top lid of the box of the present invention . fig7 further shows panel 105 b after it has been turned with respect to panel 104 b along crease line 908 . alternative embodiments may comprise single , triple or other top lid thicknesses . fig8 shows panel 105 b after it has been turned downward along crease line 908 to form the interior back wall of the box of the present invention . fig9 a shows the box of fig8 after the front door has been swung into closed position . the aforementioned center section of said front door covers the front opening of the box . left wing 204 c ( fig1 ) is tucked between exterior sidewall 103 j ( fig1 ) and interior sidewall 203 j ( fig1 ); right wing 204 d ( fig1 ) is tucked between exterior sidewall 103 k ( fig1 ) and interior sidewall 203 k ( fig1 ). stretchable tab 205 ( fig9 a ) is wrapped around button 208 ( fig9 b ), thereby securing said front door to said exterior sidewall . in a preferred embodiment , said tab 205 is permanently riveted , or otherwise affixed , to said front door . fig9 b shows the top lid of said box after said top lid has been turned downward along crease line 937 and 938 ( fig6 ) into closed position . loop 206 and tab 205 are both wrapped around button 208 . tab 205 secures said front door to said exterior sidewall . loop 206 secures said top lid to said exterior sidewall . in a preferred embodiment , said loop 206 is permanently affixed to said box by passing it through pair of holes 621 in said top lid . in a preferred embodiment , said button 208 is permanently riveted , or otherwise affixed , to said exterior sidewalls . in a preferred embodiment , loop 206 is similar in shape to a common rubber band and tab 205 has an oblong shape , although other shapes and structures of said loop and tab are possible in alternative embodiments . fig1 shows the results of a first set of steps in the process of collapsing the box of the present invention . in fig1 , the top lid of said box has been opened , exposing panel 104 b as the underside of said top lid . also in fig1 , the front door of said box has been opened , exposing panel 204 a as the back side of said front door . in fig1 , interior back wall 105 b has been turned upward about 130 degrees . in fig1 , interior sidewalls 203 j and 203 k are in the process of being folded downward . in fig1 : ( i ) said interior sidewalls 203 j and 203 k have been folded fully downward and rest atop exterior floor panel 101 ( as shown in fig1 ) and ( ii ) exterior sidewalls 103 j and 103 k are in the process of being collapsed inward along crease lines 909 a and 909 b , respectively . fig1 a shows the box of the present invention with exterior sidewalls 103 j and 103 k fully collapsed . fig1 b shows wings 204 c and 204 d fully folded inward and resting atop inside panel 204 a of said front door . fig1 c is a side view showing said front door in the process of being turned underneath the floor of said box upon crease line , or hinge , 262 c . fig1 d is a front view showing the box of the present invention fully collapsed with said front door fully turned , and resting beneath , said floor . in the above described preferred embodiment of the box of the present invention , the interior sidewalls ( 203 j and 203 k ) extend from the floor of said box . in a first alternative embodiment , the comparable interior sidewalls ( 6203 j and 6203 k ) extend from the back wall of said box . fig1 a shows the flat , die cut main sheet of corrugated from which such first alternative embodiment is primarily formed . fig1 b shows said flat die cut sheet after certain panels have been detached from it . fig1 c through 16f are perspective views showing the successive steps in which the main body of the box of said first alternative embodiment is formed from flat sheet stock . fig1 f shows panel 6105 b after it has been turned downward along score line 6937 ( fig1 b ) to form the interior back wall of the box of said first alternative embodiment . panels 6203 j and 6203 k , have been rotated downward along with panel 6105 b , said panels 6203 j and 6203 k , thereby in position to comprise the opposed interior sidewalls of said box . in additional alternative embodiments , opposed interior sidewalls could be attached to the main body of said box in locations other than the interior back wall . for example , without limitation , said interior sidewalls could be attached along : ( i ) the bottom of the exterior sidewalls , ( ii ) the top of said exterior sidewalls or ( iii ) the front of said exterior sidewalls or ( iv ) the back of said exterior sidewalls or ( v ) along the left and right sides of the main floor of said box or ( vi ) along the left and right sides of the interior floor panel of said box . in the above described preferred embodiment of the box of the present invention , the front door extends from the floor of said box . in , yet , another feature of the above stated first alternative embodiment , said front door is stored inside a hollow storage compartment that lies underneath the main body of said box . fig1 a , in part , comprises flat panels 6621 a and 6621 b from which said hollow front door storage compartment ( shown in fig1 d thru 17 f ) is formed . fig1 b comprises the flat die cut sheet of fig1 a after panels 6621 a and 6621 b have been detached along cut lines 6801 a and 6801 b ( fig1 a ), respectively . fig1 a thru 17 c are perspective views showing the components of the structure that comprises said hollow storage compartment . fig1 d thru 17 f show said components after they have been formed into a hollow compartment . front door panel 6204 would typically be die cut from a separate sheet that is not embodied within the main sheet shown in fig1 a , although , in other embodiments , said flat panel could be cut from said main sheet . fig1 d shows a front view in which said front door is fully housed inside said storage compartment . fig1 e and 17f respectively show a side view and a front view of said front door storage compartment with said front door partially protruding from said compartment . fig1 a , 18 b and 18 c show front perspective views after said front door storage compartment has been glued to the bottom of said box . said figs ., respectively show : ( i ) the front door panel fully housed inside said storage compartment , ( ii ) the front door panel protruding from said front door storage compartment and ( iii ) the panel after it has been pulled out of said compartment and rotated upward to form the front door of said box . in other alternative embodiments , the front door storage compartment could be attached either above or below the top lid , in front of or behind the back lid , or in other locations on said box . fig1 d thru 18 i show the box of said first alternative embodiment in successive stages of being collapsed . in fig1 d , top lid 6104 b has been turned upward into open position . in fig1 e , interior sidewalls 6203 j and 6203 k and interior floor 6105 b have been turned upward . in fig1 f , interior sidewall 6203 j and 6203 k have been turned 90 degrees inward . in fig1 g , exterior sidewalls 6103 j and 6103 k are in the process of being folded inward . in fig1 h , exterior sidewalls 6103 j and 6103 k have been folded fully downward . in fig1 i , front door panel 6204 has been pushed fully into the front door storage compartment , thereby completing the collapsing of said first alternative embodiment the box of the present invention . wherever the word โ hinge โ is used herein , such hinge comprises a means by which one or more of the surfaces to which said hinge is attached can pivot about an axis . such hinge can be made of a variety of materials including , without limitation , metal , plastic or paper and can comprise a variety of different structures . in particular , such hinge may comprise a length of flat , flexible tape that is affixed to a surface by glue or other means . in the alternative , such hinge may created within a wall by simple scoring , creasing , or cutting partially through , said wall ; such embodiment sometimes referred to as a โ living hinge .โ the above applies to any variation of the word โ hinge โ, such as โ hinged โ or โ hingedly โ. wherever the word โ glue โ is used herein , other means of attachment may be used including , without limitation , staples , clips , rubber bands , string , cord , rope , pins , adhesive , adhesive backed tape and clamps . similarly , in some instances the box may be formed without using any external means of attachment by simply relying on the various folds or other structures of the box to hold its elements in place . while the above description contains many specificities , these should not be construed as limitations on the scope of the invention , but rather as exemplifications of one or more embodiments thereof . other variations and embodiments are possible . without limitation , such other embodiments may include variations in the flat sheet from which the box of the present invention may be formed . those who are skilled in the art will readily perceive how to modify the invention . therefore , the appended claims are to be construed to cover all equivalent structures which fall within the true scope and spirit of the invention and should not be limited to the embodiments illustrated . | 1 |
exemplary embodiments of the present invention are now described with reference to the figures . although the following detailed description contains many specifics for purposes of illustration , a person of ordinary skill in the art will appreciate that many variations and alterations to the following details are within the scope of the invention . accordingly , the following embodiments of the invention are set forth without any loss of generality to , and without imposing limitations upon , the claimed invention . potential applications for the flexible cladding system of the present invention cover a range of industrial sectors including oil , automotive , power generation , and consumer products . of particular importance is the application of corrosion resistant alloy ( cra ) materials to linepipes . the technology of the invention is also useful for larger scale structures ( vessels ) fabricated from clad flat plates . another application involves abrasion resistant coatings . these clads may be from material compositions ranging from tool steels to refractory metals , bonded in both tubular and flat configurations . examples include erosion critical linepipe applications , surfaces for cutting tools / implements , and automotive engine cylinder liners . another class of applications is that requiring oxidation resistance such as combustion systems and boilers ( heat exchangers ). products , i . e ., clad structures manufactured using the system of the present invention may be flats or rounds , with respect to their geometry . in most embodiments , a single cladding layer may be deposited on the inside or outside surface of the clad structure and / or the top and bottom surfaces using the device disclosed in u . s . patent application ser . no . 12 / 412 , 685 or a suitable commercially available device such as , for example , a 400 - kva alternating current ( ac ) resistance seam welder with a medweld 3005 controller . the clad structures manufactured with this system include a substrate component , a cladding layer , and a surface activation layer . the substrate component is typically metal , such as steel . a specific example of the substrate material is 1018 hot - rolled steel , nominally 12 . 5 - mm thick , which is representative of pipeline steel . the cladding layer is typically a refractory metal , stainless steel , tool steel , or iconel alloy . inconel alloys are oxidation and corrosion resistant materials well suited for service in extreme environments subjected to pressure and heat . specific examples of the cladding layer include 1 . 8 - mm - thick inconel 625 , 3 . 1 - mm - thick inconel 825 , and 2 - mm - thick 316 stainless steel . surface activation may be accomplished by using specific coatings ( e . g ., ni โ p or ni โ b ) or by using braze materials . a specific example of a braze material or alloy is 0 . 08 - mm - thick aws bni - 9 foil . the surface activation layer may be chemically deposited , cold sprayed , and / or plated onto either the substrate or the cladding layer . specific advantages of this invention include : ( i ) texturing of surfaces is not required ; ( ii ) the thickness of the cladding layer may be much greater than with prior art structures ; ( iii ) system power requirements are reduced ; ( iv ) the combinations of materials that may be used with one another is greatly expanded over prior art systems ; ( v ) processing speed is increased over prior art systems ; and ( vi ) the resultant surface profile is of high quality , i . e ., there is low distortion . the final product has the appearance of having a solid state weld . fig1 provides a generalized illustration of an exemplary embodiment of a tubular clad structure 10 , in accordance with this invention , that includes cladding layer 20 ( having a cut line 22 ), surface activation layer 25 , and substrate 30 . a specific example of a product made using the system of this invention includes a demonstrator pipe nominally 350 - mm in diameter , 300 - mm long , and clad with 2 - mm of in625 . the clad product was manufactured using overlapping seams nominally 6 - mm to 7 - mm wide . joining was conducted circumferentially , using overlapping seams to create a nominally full bonded product . the product was sectioned and the bond line integrity examined . the results show a highly localized bond with virtually no dilution between clad and substrate . these initial results also indicate the interdependence of weld forces , currents , and travel speeds . the present invention is based , at least in part , on the technology disclosed in u . s . patent application ser . no . 12 / 412 , 685 to workman et al . entitled method of creating a clad structure utilizing a moving resistance energy source ( filed mar . 27 , 2009 ), which is incorporated by reference herein , in its entirety , for all purposes . previous research largely addressed fusion - based attachment of stainless steel and nickel - based cladding to flat carbon steel plates . processing was based on previously applied approaches to dissimilar metal thickness resistance seam welding ( see , gould , j . e ., johnson , w ., and workman , d ., development of a new resistance seam cladding process , deep offshore technology monaco 2009 , pennwell publications , tulsa , okla ., paper 127 ( 2009 ); and gould , j . e ., a thermal analysis of resistance seam cladding corrosion - resistant alloys to steel substrates , materials science and technology 2009 - joining of advanced and specialty materials 2009 ( jasm xi ), asm , metals park , ohio ( 2009 ), both of which are incorporated by reference herein , in their entirety , for all purposes ). additional research attempted to exploit the claims made in wo 2009 / 126459 a2 ( the pct equivalent to u . s . patent application ser . no . 12 / 412 , 685 ), cladding a nominally 3 - mm corrosion resistant alloy ( cra ) to the interior of steel pipe . this research determined that the technology as described previously as applied to nickel - base alloy cladding of steel pipes was challenged by : ( i ) excessively slow welding speeds limiting commercial viability ; ( ii ) distortion issues that prevented adequate bonding between the clad and substrate ; and ( iii ) difficulty welding clad liners in the thickness range demanded by the application ( 3 - mm ). the present invention utilizes a technology referred to as resistance seam weld cladding that uses resistance heating to create a localized bond . this bond is then driven over an extended area to create a product . product forms include both tubular ( pipe ) and flat ( plate ) configurations . the approach offers significant cost advantages over other cladding methods in high volume production . resistance seam weld cladding ( rsewc ) is a variant of resistance seam welding ( rsew ), which is a well - established technology for the joining of sheet materials ( see , welding handbook , 9 th ed ., vol . 3 , welding processes , part 2 , american welding society , miami , fla ., pp . 1 - 48 ( 2007 ); recommended practices for resistance welding , aws c1 . 1m / c1 . 1 : 200 ( r2006 ); and american welding society , miami , fla . ( 2006 ); resistance welding manual , fourth ed ., resistance welder manufacturers association , miami , fla . ( 2003 ), all of which are incorporated by reference herein , in their entirety , for all purposes ). the process is typically conducted with at least one electrode wheel , which is used to allow current flow into the workpieces , as well as to apply a welding force . the resultant resistance heating of the workpieces , combined with the applied normal forces , results in the formation of a localized bond . this bond is then propagated as the wheel ( s ) traverse the workpieces to make continuous seams . bonding can be the result of either melting and re - solidification of individual weld nuggets or by local deformation ( see , buer , f . y . and begeman , m ., l ., evaluation of resistance seam welds by a shear peel test , welding journal research supplement , 41 ( 3 ): 120s - 122s ( 1962 ); and gould , j . e ., theoretical analysis of bonding characteristics during resistance mash seam welding sheet steels , welding journal research supplement , 82 ( 10 ): 263s - 267s ( 2003 ), both of which are incorporated by reference herein , in their entirety , for all purposes ). processes are available not only for joining steel sheet , but also a range of stainless steel and ni - based alloys . with regard to the rsewc approach , clad material is prepared as an insert ( similar to the approach used for mechanically clad material ), and locally bonded to the substrate using a rsew wheel . to a large degree , the process is analogous to resistance welding dissimilar materials with dissimilar thicknesses . a specific application of this process is for welding a relatively thin layer of clad material onto a much thicker substrate . additionally , the clad layer is typically of substantially higher resistivity . previous work has shown that proper heat balance can be accomplished by a combination of electrode design , electrode material selection , and appropriate selection of welding times or processing speeds ( see , fong , m ., tsang , a ., and ananthanarayanan , a ., development of the law of thermal similarity ( lots ) for low - indentation cosmetic resistance welds , sheet metal welding conference ix , detroit aws section , detroit , mich ., paper 5 - 6 ( 2000 ); and agashe , s . and zhang , h ., selection of schedules based on heat balance in resistance spot welding , sheet metal welding conference x , detroit aws section , detroit , mich ., paper 1 - 2 ( 2002 ), both of which are incorporated by reference herein , in their entirety , for all purposes ). these approaches have recently been used to develop resistance spot welding practices for stack - ups with 4 : 1 thickness variations ( see , gould , j . e ., peterson , w ., and cruz , j ., an examination of electric servo - guns for the resistance spot welding of complex stack - ups , welding in the world , doi 10 . 1007 / s40194 - 012 - 0019 - x . to address the technical challenges previously identified , further research focused on the manufacture of actual clad pipe demonstrators . the following aspects of this invention resulted from this research : ( 1 ) one side strip coating of the clad layer with micron scale active metal alloys ( i . e ., surface activation layer 25 ); ( 2 ) use of the strip as the clad material ; ( 3 ) improvements in tooling to allow accurate positioning of the welding wheels facilitating accurate overlap of progressive seams ; ( 4 ) proper design of welding wheels both accommodating inherent flexure in the welding machine itself , as well as providing bonded seam on the order of several millimeters ; ( 5 ) the ability to clad using specifically sized preforms ; ( 6 ) low cost cleaning procedures to facilitate adequate bonding between the clad and the substrate ; ( 7 ) resistance heating procedures to allow reflow of the active metal layer , including ( a ) deliverable forces of the welding machine and ( b ) the desired clad metal layer thickness ; and ( 8 ) flood cooling procedures to prevent surface damage to both the clad metal and the substrate . with regard to cladding cra liners into steel pipe , five of these aspects are of particular importance . with regard to one side strip coating with ni โ p eutectic alloy , an important aspect of this invention is the inclusion of a thin , low cost melting point active layer affecting both the cra and substrate . this is typically done by utilizing one side electroless nickel plating . electroless nickel has a composition of nominally ni - 11 % to 13 % p . the coating may be applied by a commercial vendor or by other means . this volume of phosphorus provides a nominal 500 ยฐ c . melting point suppression of the deposited nickel . the deposition process itself results in only about a 10 - ฮผm coating of the completed assembly . single side coating allows the addition of the melting point suppressant to only the area where bonding is to occur , thereby minimizing any potential damage to the welding electrodes . alternate coating approaches many include electroless or electrolytic methods . with regard to use of a strip insert as the cra layer , the cra layer may be manufactured from strip stock nickel base cra with the nominally 10 - ฮผm eutectic material on one side . while current methods for mechanical cladding employ pre - formed tube sections of cra ( which could also be done ) there is advantage to using the clad strip stock directly . in this approach , strip material is mechanically coiled parallel to the axis of the pipe and inserted . the strip is cut to a width matching that to the substrate pipe inner diameter ( id ). once the strip is inserted , it is allowed to expand . springback of the strip then creates fit - up between the cra and the substrate pipe . the clad then can be welded into place using the rsewc process . as assembled , the cra will typically show a gap at the locations where the coiled ends meet . once rsewc has been completed , the remaining gap may be closed with a range of secondary joining technologies such as , for example , gas metal arc welding ( gmaw ), thereby completing the process of cladding . with regard to improvements to tooling for facilitating reproducible overlapping seams during rsewc , rsewc is typically done with normal loads ranging from several kilo - newtons to several 10 &# 39 ; s of kilo - newtons . additionally , the process is known to cause small surface deformations ( on the order of 100 - ฮผm ), so complex forces act on the tool during processing . this combination of high normal forces and local surface deformations can cause tracking inaccuracies during processing . initial research on flat plates used rigid tooling , and demonstrated tracking appropriate for the process . this invention provides an improvement in this technology wherein the tooling used to both retain the pipe during welding , as well as to provide indexing as part of the welding process . one embodiment of this tooling uses a spring loaded baseplate to support the pipe , rollers to provide for pipe rotation under the welding wheels , and a threaded mechanism to index the pipe as rsewc progresses . the generalized system illustrated in fig3 includes baseplate 70 , support 72 , rollers 74 , and axle 76 . with regard to proper design of the welding wheels to accommodate flexure of the welding machine and providing adequate single pass bond width , the wheels are designed both to create a defined contact area for joining and to be sufficiently robust to any flexure of the welding machine . wheel diameter is largely defined by the inner diameter of the clad surface for bonding . typically , wheels are designed with a maximum diameter providing a contact length under force on the order of 4 - 6 times the contact width or , alternately , 6 - 8 times the contact width ( see fig2 ). this design also prevents or minimizes surface marking . wheels also include a width and face radius that enable both some flexure of the welding machine , and provides adequate bond width . one embodiment of this invention includes a wheel design has a width of roughly 20 - mm , with a face radius of 150 - mm . the use of this wheel design , combined with the processing discussed below , results in per - pass bond widths on the order of 8 - mm for a 2 - mm thick clad . with regard to low cost cleaning procedures that facilitate adequate bonding between the cra coated surface and the pipe wall itself , another important feature for creating high quality bonds between the electroless nickel plated cra and the steel pipe is proper surface preparation . bonding largely depends on reflow of the electroless nickel , and potential reaction with these substrates . shot blasting with either a sic or steel media is a suitable process and typically results in excellent bonding . with regard to resistance heating procedures that allow reflow of the electroless nickel without significant changes to the properties of the clad and pipe materials , certain processes permit continuous bonding of the clad and substrate with minimal metallurgical changes to either component . sample cross sections of a joint showed intimate bonding of the cladding layer and substrate with little or no evidence of retained electroless nickel . this is related to both the forces and temperatures used in the process ( creating intimate fit - up ), and the rapid diffusivity of the phosphorus into the parent materials . additionally , this consolidation is done without any shielding gasses . this is a result of the high contact forces implicit in resistance processing , preventing oxygen exposure of the joint area and effectively creating a vacuum type bonding environment . uniformity of the bond across the joint area is achieved with this process . with regard to flood cooling procedures that prevent or minimize surface damage to both the cra and the pipe itself , this aspect of the present invention is enabled by proper thermal management , thereby allowing appropriate temperatures at the joint interface without excessively heating either the substrate steel pipe or the electrode / clad contact surface . either will lead to degradation of product performance . while heating is done resistively , cooling is done by flooding with water . flooding is done at both the inner diameter and outer diameter surfaces of the product . flooding is typically done with an excessive amount of water . more specifically , flooding is not done to actively control temperature profiles in the workpiece and electrodes , but rather provide a maximum cooling capability associated with the fluid medium . without proper flood cooling , damage would likely occur to the welding wheels and clad exposed surface , as well as the metallurgy of the substrate steel pipe . cooling of the wheels to achieve the same purpose may also be employed ( see fig4 ). the generalized system illustrated in fig4 includes clad structure 10 , inner welding wheel 50 , outer welding wheel 60 , internal cooling fluid conduits 80 , and external cooling fluid conduits 90 . achieving proper heat balance ( as described above ) creates conditions for bonding to occur . in embodiments where the surface activation layer is a braze alloy , a specific interlayer may be used ( bni - 9 ) that melts at lower temperatures than either the clad or the substrate . bni - 9 is a ni โ cr โ fe โ b eutectic alloy with a distinct melting point of 1055 ยฐ c . this melting point can be compared to the solidus points of the 1018 substrate ( 1495 ยฐ c .) and the various cladding materials ( 1270 - 1370 ยฐ c .). brazing with bni - 9 is typically done in vacuum and is effective as the rsew process results in high contact pressures ( supplied by a properly designed welding wheel ) over a specified area . this pressure has the effect of excluding the environment from joint area , allowing the braze alloy to flow . this is termed a โ micro - environment โ, and combined with the temperatures provided by the resistance heating facilitates localized brazing . joining is also enabled by the active character of the braze alloy itself . effectively , on melting , the braze locally alloys with the substrate ( s ), dissociating any residual surface . this effect facilitates wetting of the braze alloy , and formation of a joint . the combination of proper thermal balance , wide temperature operating window , appropriate micro - environment , and active alloy characteristics results in effective resistance brazing . while the present invention has been illustrated by the description of exemplary embodiments thereof , and while the embodiments have been described in certain detail , it is not the intention of the applicant to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . therefore , the invention in its broader aspects is not limited to any of the specific details , representative devices and methods , and / or illustrative examples shown and described . accordingly , departures may be made from such details without departing from the spirit or scope of the applicant &# 39 ; s general inventive concept . | 1 |
in the following description of the preferred embodiment , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration a specific embodiment in which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural changes may be made without departing from the scope of the present invention . fig1 illustrates an exemplary computer hardware environment that could be used with the present invention . in the exemplary environment , a computer system 100 comprises a computer 106 coupled to i / o devices comprising a monitor 102 , a keyboard 108 , a mouse device 110 , and a printer 118 . the computer 106 could also be coupled to other i / o devices , including a local area network ( lan ) or wide area network ( wan ) via interface cable 120 . the monitor 102 presents a display 104 visually depicting information from the computer system 100 to the user . the computer 106 comprises a processor and a memory including random access memory ( ram ), read only memory ( rom ), and / or other components . the computer 106 operates under control of an operating system 122 stored in the memory to present data to the user on the display 104 and to accept and process commands from the user via keyboard 108 and mouse device 110 . the present invention is preferably implemented using one or more computer programs or applications through a graphical user interface . these computer programs are depicted as windows 124 presented on the display 104 , operating under control of the operating system 122 . generally , the operating system and the computer programs implementing the present invention are tangibly embodied in a computer - readable medium , e . g . one or more of removable data storage devices 112 , 114 , such as a zip or floppy disc drive , or fixed data storage devices 130 , including for example , a hard drive , cd - rom drive , or tape drive . also , the relational databases used with the present invention can be stored in data storage devices 130 , 112 , 114 , or may be stored off - line and accessed via interface cable 120 . those skilled in the art will recognize that the exemplary environment illustrated in fig1 is not intended to limit the present invention . indeed , those skilled in the art will recognize that other alternative hardware environments may be used without departing from the scope of the present invention . the operation of the present invention is described with reference to fig2 through fig1 , which illustrate exemplary embodiments of the user interface aspects of the present invention . the present invention provides a method for extending rolling ball fillets to the outside boundary curves of two base surfaces , as shown in fig2 , 4 and 5 . as described in fig2 , a rolling ball fillet 136 is typically created between a first base surface 132 and a second base surface 134 . the present invention provides for an extension of the rolling ball fillet 136 via an extended rolling ball fillet 138 . as shown in fig3 the present invention also provides for the extension of a variable fillet 140 with an extended variable fillet 142 . fig4 illustrates how a rolling ball fillet 148 between a cylindrical surface 144 and planar surface 146 may be extended by an extended fillet 150 according to the present invention . fig5 shows how the present invention may be used to extend a rolling ball fillet 156 by an extended fillet 158 between a first surface 152 and a second surface 154 . fig6 a and 6b are a flow diagram illustrating the logical operation of the present invention . the process begins with the computer 106 receiving into its memory a ( u , v ) and b ( s , t ) as the definition of the two base surfaces , where parameters u , v and s , t are for the surfaces a ( u , v ) and b ( s , t ) respectively varying over the finite intervals . it is assumed that a rolling ball fillet surface exists between the two surfaces having a radius r . the present invention then provides for the creation of an extended fillet surface f ( p , q ) of radius r between a ( u , v ) and b ( s , t ) such that the rolling fillet is extended to the boundary of both the surfaces , as shown in fig1 . after the two base surfaces have been received into the computer 106 , at block 160 in fig6 a an offset surface a o ( u , v ) is created at the distance r for the base surface a ( u , v ), as illustrated by fig7 . the offset surface a o ( u , v ) of surface a ( u , v ) along its normal by a distance r is given by the relation : where a n ( u , v ) is the unit normal to the surface a ( u , v ) at any point u , v . the unit normal is given by the relation : ## equ1 ## where a u and a v are partial derivatives of surface a ( u , v ). at block 162 in fig6 a , an envelope surface e ( x , y ) is created for a boundary curve c ( w ) of the base surface b ( s , t ), where w denotes the parameter of the curve as shown by fig7 . the envelope surface e ( x , y ) is preferably created by instances of a ball of radius r with its center moving along the curve c ( w ). for each value of w there corresponds an instance of the ball . each instance of the ball intersects the normal plane of the curve c ( w ) in a circle whose radius equals r , which is equal to the radius of the sphere . this circle is called the &# 34 ; normal section &# 34 ;. all instances of the ball lead to a set or sequence of normal sections . the envelope surface e ( x , y ) may be understood as a spherical duct surface obtained by dragging a circle of radius r along the curve c ( w ). at block 164 in fig6 a , a spine curve 188 of the intersection of surfaces e ( x , y ) and a o ( u , v ) is computed as in shown in fig7 . the spine curve 188 contains a trace of points that simultaneously lie on the a o ( u , v ) and e ( x , y ) surfaces . the vector equation of the spine curve is given by the relation : at block 166 in fig6 a , the spine curve 188 is divided into a discrete sequence of k points represented by a set s which satisfies a predetermined chordial deviation tolerance . at block 168 in fig6 a , corresponding to each point in s , a set of contact points c1 on the surface a ( u , v ) is determined according to the following relation : it will be recognized that the set of points c1 also lies on the contact curve c1 ( w1 ) as shown in fig8 . at block 170 in fig6 a , corresponding to each point in s , a set of contact points c2 on the surface b ( s , t ) is determined according to the following relation : it will be recognized that the set of contact points c2 lies on the contact curve c2 ( w2 ), and that the curve c2 ( w2 ) is also a subset of the curve c ( w ), as shown in fig8 . at block 172 in fig6 a , a set of k arcs is preferably created from each collection of points on contact curves c1 ( w1 ) and c2 ( w2 ) with their center at the corresponding point in s . each of the arcs is tangent to the surface a ( u , v ) at one endpoint . it is possible to represent each arc in the set of arcs in the form of a spline segment , as shown in fig1 . the set c k ( p ) of k spline segments , each of degree d , polynomial n i , d ( p ) and control points x i , k can be represented by the following relation : ## equ2 ## at block 174 in fig6 a , an extended fillet surface f ( p , q ) is constructed from the spline segments c k ( p ) in three steps . in the first step , a q parameter value for the spline segments in set c k ( p ) is computed such that f ( p , q k )= c k ( p ) . this step assumes that the spline segments are iso - parametric in the p - direction . a centripetal method , as shown in fig9 may be used according to the following relation : ## equ3 ## in the second step , as shown in fig1 , the control points x i , k are interpolated from k = 0 , . . . k for each i , i = 0 , . . . n to determine curves c i ( q ) according to the following relation : ## equ4 ## in the third step , points y i , j are defined as the control points of the extended fillet surface according to the following relation : ## equ5 ## defined over the knot vectors p and q and degree d in the p and q direction , as shown in fig1 . the proof that the surface f ( p , q ) interpolates the set of splines c k ( p ) can be shown as follows : ## equ6 ## if in fig6 b at decision point 176 it is determined that one of the boundary curves of the surface f ( p , q ) is identical to one of the boundary curves of the rolling ball fillet , then the surface f ( p , q ) is an extended fillet and it is stored in the geometric model at block 178 . if at decision point 180 in fig6 b there are further boundary curves of b ( s , t ), the system obtains the next boundary curve at block 184 and flow control then returns to block 162 . if at decision point 176 there are no further boundary curves of b ( s , t ), and if at decision point 182 it is determined that the role of a ( u , v ) and b ( s , t ) has not been reversed , the role of a ( u , v ) and b ( s , t ) is reversed at block 186 and flow control returns to block 160 . otherwise , the procedure terminates . it will be recognized that the present invention is not limited to the embodiments described above . variations and modifications may be made without departing from the scope of the present invention . for example , an extended fillet can also be created for variable fillets as shown in fig3 a and 3b . further , the three step process for creating an extended fillet surface from spline segments can be replaced by other methods depending upon the type of surface being created . it will also be recognized that the present invention works for untrimmed as well as trimmed surfaces . the continuity between the rolling ball fillet and extended fillet can further be improved by blending the two surfaces along the common natural boundary . the envelope surface can also be a portion of the spherical duct surface obtained by dragging an arc , instead of a circle as described above . in conclusion , the foregoing description of the preferred embodiment of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the above teaching . it is intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto . | 6 |
embodiments of the present invention will be described in detail below with reference to the accompanying drawings . first , descriptions will be made as to the structure and operations of a multimedia processing section in accordance with an embodiment of the present invention provided on a receiving side that receives bitstreams with time stamps dedicated to ipmp processing ( hereafter called โ its โ) appended thereto . fig6 shows a structure of a multimedia processing section at a receiving side in accordance with an embodiment of the present invention . referring to fig6 , a bitstream receiving section 601 receives bitstreams that are multiplexed from a server . a demultiplexer 602 demultiplexes the multiplexed bitstreams , and extracts each of the bitstreams . here , each of the extracted bitstreams is independently stored in a buffer for bifs decoding 603 , a buffer for media decoding 604 ( wherein video and audio are generally called โ media โ in the present embodiment ), and a buffer for ipmp decoding 605 , respectively . the stored bitstreams are decoded by a bifs decoder 608 , a media decoder 609 and an ipmp decoder 610 , respectively . in some cases , as described below , decoding processings for bifs and each of the media may be prohibited by the ipmp processing . also , the demultiplexer 602 outputs time stamps for media streams and ipmp streams , respectively . the multimedia processing section also includes a media dts detector 607 , a media cts detector 616 , an ipmp dts detector 611 and an ipmp cst detector 612 . in the present embodiment , an its detector 606 extracts time stamps dedicated to ipmp processing which are referred to as its , and control decoding timings of the ipmp decoder 610 . decode time stamps ( dtss ) and composition time stamps ( ctss ) for the media and the ipmp are compared by a dts comparator 613 and a cts comparator 617 , respectively , to check whether or not the dtss and the ctss of the media and the ipmp are in consistent with each other , respectively . an and gate 619 provides logical products ( ands ) under conditions when the dtss and ctss of the media and the ipmp are in consistent with each other , respectively . accordingly , the and gate 619 outputs a true value โ 1 โ only when the dtss and ctss for the media are in consistent with the dtss and ctss for the ipmp , respectively . in other words , with the structure described above , a determination can be made as to whether or not the dtss and ctss for the media are completely in consistent with the dtss and ctss for the ipmp , respectively . a sync - controller 620 governs decoding timing control for the decoders , synchronization control among the media and reproduction timing control . when the dtss and ctss for the media are completely in consistent with the dtss and ctss for the ipmp , respectively , and assumes that updates of the ipmp data correspond to the corresponding access units of the media . as a more specific example , let us consider a situation where the media data has been scrambled , and its descrambling key changes periodically . in this case , a normal reproduction becomes impossible unless each of the access units of the media and the update timing of the descrambling key are accurately defined . the sync - controller 620 monitors outputs of the dts comparator 613 and the cts comparator 617 and controls the timings . more specifically , sync - controller 620 controls timings for descrambling the media data that are supplied to the respective decoders and update timings of the descrambling key . a bifs composition buffer 614 composes scene information that have been decoded by the bifs decoder . a media composition buffer 615 temporarily stores a specified amount of decoded image frames and audio data . when the ipmp method uses only a data scrambling , each of the media is composed ( re - constructed ) by a compositor 618 without a further change , and displayed or reproduced by a renderer 621 . a monitor apparatus 623 provides a final rendering on the image ( or video ) media ( for display ), and a speaker apparatus 624 provides a rendering on the audio media ( for audio reproduction ). when the ipmp method uses not only a data scrambling but also a control for reproduction or non - reproduction of the media , display and reproduction of each of the media must be accurately started ( or stopped ) at intended timings . in this case also , like the above case in which only the data scrambling is used , display and reproduction of each of the media can be accurately started ( or stopped ) in units of access units through controlling the compositor 618 and the renderer 621 by the sync - controller 620 based on the comparison results of the dts comparator 613 and the cts comparator 617 . fig1 shows a flow chart for describing a descrambling processing . when decoding is started ( step s 101 ), the its detector 606 detects itss ( step s 102 ). then , the ipmp decoder 610 decodes the ipmp data with the timings of the itss detected ( step s 103 ). the decoding processing of the ipmp data may correspond , when a scramble key itself is multi - scrambled ( encrypted ), to a processing to extract the scramble key to decode the media data . then , dtss and ctss of the ipmp data are detected by the ipmp dts detector 611 and the ipmp cts detector 612 , respectively ( step s 104 ). dtss and ctss of each of the media data are also detected by the media dts detector 607 and the media cts detector 617 , respectively ( step s 105 ). then , the dtss and ctss of the ipmp data and the dtss and ctss of each of the media are compared by the dts comparator 613 and the cts comparator 617 , respectively . when they are not in consistent with each other , a determination is made that the scramble key has not been updated , and the media data is descrambled with the current scramble key , and decoded ( step s 107 ). on the other hand , when they match with each other , a determination is made that the scramble key has been updated , the scramble key is updated ( step s 108 ), and then the media data is descrambled and decoded ( step s 109 ). then , the compositor 618 performs a composition processing and the renderer 621 performs a rendering processing ( step s 110 ), and these processings are repeated until the end of the data ( step s 111 ). it is noted that , when the ipmp method uses not only a data scrambling but also a control for reproduction or non - reproduction of the media , additional display and reproduction controls are performed in step s 110 . next , descriptions will be made as to the structure and operations of a multimedia processing section in accordance with an embodiment of the present invention provided on a transmission side that transmits bitstreams with itss appended thereto . fig7 shows the structure of a multimedia processing section on a transmission side in accordance with the present embodiment . referring to fig7 , a media encoder 701 performs an encoding for each of the media data , which is suitable for each of the media . for example , when the media data is image data , the media encoder 701 performs an encoding on the media data according to mpeg - 4 visual ( iso / iec 14496 - 2 ), and performs a scrambling processing with a scramble key . a dts / cts generator 702 generates time stamps ( dtss and ctss ) according to reproduction conditions of each of the media . an ipmp encoder 703 performs an encoding processing on the ipmp information . the encoding processing on the ipmp data may corresponds to a processing to scramble ( encrypt ) the scramble key itself . a dts / cts buffer 704 temporarily stores time stamps ( dtss and ctss ) that are generated by the dts / cts generator 702 . a sync - controller 705 receives inputs of the dtss and ctss generated by the dts / cts generator 702 and the ipmp information that is encoded ( scrambled or encrypted ) by the ipmp encoder 703 , and performs a synchronizing control for reproducing each of the media , and also controls generation of its information to be described below . an its generator 706 generates its information for each of access units according to an instruction from the sync - controller 705 based on the dtss and ctss stored in the dts / cts buffer 704 . a packetizer 707 performs an appropriate packetizing processing using the encoded media information and ipmp information , the dtss , the ctss , and the its information . since the values of the dtss and ctss of the ipmp are the same as those of the media information , the dts / cts generator 702 generates dtss and ctss for the ipmp . at the time of the packetizing processing , a header generation section 709 adds headers , and a multiplexer 708 performs a final multiplexing . then a bitstream transmission section 710 transmits the data multiplexed by the multiplexer 709 . fig8 shows a timing chart of time stamps in accordance with an embodiment of the present invention . fig8 shows video streams as one example of media streams , but the media streams can be of any type . what is to be focused on is the relations between the dtss and ctss of the video and dtss and ctss of the ipmp . for example , when a video access unit 1 ( video au 1 ) has a decode start timing dts 1 and a composition start timing cts 1 , a dts and a cts of the ipmp stream for this access unit have the same values as the dts 1 and the cts 1 , respectively . in other words , by making the values of dtss and ctss for each video access unit and each ipmp access unit equal to one another , the video access unit and the ipmp access unit can be correlated to each other . accordingly , dtss and ctss for the ipmp streams do not indicate decoding and composition timings of themselves , but are used for correlating each of the media streams and each of the access units . in the meantime , decoding ( for example , descrambling a scrambled encryption master key that is used to descramble the video bitstreams ) timings of the ipmp streams can be controlled in units of access units of the ipmp streams themselves by itss that are additionally defined . another embodiment of the present invention in which an electronic watermark technique is applied will be described below with reference to the accompanying drawings . in the present embodiment example , an electronic watermark technique is used to embed scramble keys for media data in ipmp data , and itss indicate processing timings for extracting ( decoding ) the scramble keys embedded by the electronic watermark technique . fig9 shows a timing chart of time stamps in accordance with the other embodiment . dtss and ctss shown in fig9 are used for the purpose of indicating mutual relations among the access units of the media streams and the ipmp streams . in the embodiment described with reference to fig8 , the present invention is applied to a system that uses an encryption scheme , for example . however , when media bitstreams have been scrambled , the media bitstreams need a descrambling processing , and then a decoding processing and a composing processing to be performed . accordingly , a relation its โฆ dts โฆ cts is established ( see fig8 ). when the time stamps its , dts and cts are equal to one another , such relation indicates an ideal state where all of the processings can be executed in no ( zero ) time . accordingly , the ipmp processing controls operations of the decoder ( i . e ., the ipmp processing has the decoder perform a decoding processing or not perform a decoding processing ). on the other hand , in the system using an electronic watermark technique , electronically watermarked data are extracted from decoded bitstreams , and therefore the decoding processing must be performed first , and then the ipmp processing controls operations of the compositor ( i . e ., the ipmp processing has the compositor perform a composition processing or not perform a composition processing ). in view of the above , the time stamps have a relation dts โฆ its โฆ cts . fig9 shows a timing chart in this case . in this manner , in accordance with the present invention , time stamps exclusively used for ipmp processings ( i . e ., itss ) are additionally provided , such that timings of itss can be flexibly controlled based on dtss and ctss for the media streams . the embodiments described above ( e . g ., the circuits indicated by block diagrams in fig6 and 7 ) may be realized by hardware . however , the entire system in accordance with the embodiments of the present invention can be realized by software . also , in the embodiments described above , video and audio data are handled as examples of multimedia data . however , the present invention is also applicable to texts and graphics data . as described above , in accordance with the embodiments of the present invention , a variety of ipmp processings are reliably synchronized , and can be flexibly composed . the present invention may be applicable to a system that is composed of a plurality of apparatuses ( for example , a host computer , interface devices , readers , printers and the like ), or to a unit that is composed of a single apparatus ( for example , a copy machine , a facsimile machine or the like ). the present invention can be achieved by having a storage medium that stores program codes of software that realize the functions of the embodiments described above supplied to a system or an apparatus , and by having a computer ( or a cpu or an mpu ) of the system or the apparatus read and execute the program codes stored in the storage medium . in this case , the program codes themselves that are read from the storage medium realize the functions of the embodiment of the present invention , and the storage medium that stores the program codes constitute the present invention . the storage medium to supply the program codes may be , for example , a flexible disk , a hard disk , an optical disk , an optical magnetic disk , a dvd , a cd - rom , a cd - r , a magnetic tape , a nonvolatile memory card , or a rom . furthermore , the present invention is applicable not only when the program codes read by a computer are executed to realize the functions of the embodiments , but also when an operating system that operates on the computer performs a part or all of the actual processing based on the instructions contained in the program codes and thereby realizes the functions of the embodiments . moreover , the present invention is also applicable when the program codes that are read from the storage medium are written on a memory of an expansion board inserted into a computer or of an expansion unit connected to a computer , and a cpu provided on the expansion board or on the expansion unit performs a part or all of the actual processing based on the instructions contained in the program codes and thereby realizes the functions of the embodiments . as described above , in accordance with the embodiments of the present invention , synchronization control information appended to media data and synchronization control information appended to ipmp information are synchronized , and information that indicates timings to start processings that are defined by the ipmp information are generated in association with the respective synchronization control information . as a result , processings for intellectual property management can be flexibly performed . while the description above refers to particular embodiments of the present invention , it will be understood that many modifications may be made without departing from the spirit thereof . the accompanying claims are intended to cover such modifications as would fall within the true scope and spirit of the present invention . the presently disclosed embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims , rather than the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . | 7 |
in the various views , similar parts , or parts performing similar functions , are referred to by the same numbers followed by an identifying letter suffix . the general disposition of the chambers and pistons and the operation of the basic system are diagrammatically illustrated by fig1 . in a typical supercharger or compressor application , a drive shaft 2 is connected by a pulley wheel and belt to an internal combustion engine or other power source ( not shown ). the shaft 2 drives an eccentric drive member 4 which has an oblong opening 6 that surrounds the drive shaft 2 . the eccentric drive member 4 is secured to the drive shaft by a pin 8 that is notched to receive an acuator ramp 12 that controls the position of the drive shaft 2 within the oblong opening 6 and thereby determines the stroke of the pistons . by varying the adjustment of the actuator ramp 12 , the eccentricity of the drive member 4 can be controlled . this variable displacement feature does not form part of the present invention and is described more fully in the above referenced patent application and also in u . s . pat . no . 4 , 907 , 950 . the eccentric drive member 4 is mounted in a bearing 14 that is rotatably positioned within a rigid drive sleeve 15 of an orbital - motion piston drive structure , generally indicated at 16 . the piston drive structure 16 is rigidly connected by four piston support brackets 17u , 17b , 17l and 17r respectively to four radially positioned pistons 18u , 18b , 18l and 18r . each of the pistons follows a circular orbit whose diameter is a function of the adjustment of the actuator ramp 12 . the pistons 18u , 18b , 18l and 18r are positioned respectively in one of the sliding chambers 22u , 22b , 22l and 22r . the pistons and the chambers are rectangular in cross section . each piston carries conventional piston seals , respectively , 24u , 24b , 24l and 24r . the circular orbit of each piston lies in a plane perpendicular to the longitudinal axis of the drive shaft 2 . each of the chambers is mounted for sliding reciprocating movement laterally with respect to the axis of the drive shaft . the apparatus is enclosed in a suitable housing , generally indicated at 25 . the lateral movement of the chambers that accompanies the orbital motion of the pistons also operates appropriate intake and exhaust valves ( not shown ). the structure and function of these valves is described in the above - referenced co - pending application and in u . s . pat . no . 4 , 907 , 950 . in some previous structures , the chambers are driven by the force of the piston seals 24 against the inner surfaces of the chambers . in the present structure , the chambers are driven laterally by a positive drive means independent of the seals 24 . the positive drive mechanisms for the chambers are illustrated diagrammatically by the exploded view of fig2 . rotation of the drive shaft 2 causes rotation of , two spaced eccentric drive members 4l and 4r ( only member 4r is shown in this view ) inside the circular bearings 14l and 14r . the outer races of the bearings 14l and 14r are formed respectively by the drive sleeve 15 , partially cut away in this view , that encompasses both of the bearings and may contain suitable hardened bearing inserts 26l and 26r ( see also fig3 and 4 ). the drive sleeve 15 and the piston driver structures , generally indicated at 16l and 16r , because they are secured to the pistons 22 , are restrained from rotation and thus follow a non - rotational orbital translation motion that is transferred to the pistons . the orbit of each piston is identical to the others except for a fixed radial displacement . the arrangement in which the eccentric drive members 4 , in spaced positions along the drive shaft 2 , simultaneously actuate the orbital movement of the sleeve 15 adds significantly to the stability of the compressor device . the drive mechanism for the chambers 22 creates the orbital motion of the drive sleeve 15 that drives the pistons . in this case , however , the orbital motion of the drive sleeve 15 is converted to reciprocating horizontal motion to drive the upper and lower chambers 22u and 22b and to reciprocating vertical motion to drive the two side chambers 22r and 22l . the bearings 14l and 14r are positioned within and drive the sleeve 15 in a non - rotational orbit , meaning that the sleeve 15 ( and also the piston drive structures 16 and 16r ) follows an orbital path but does not rotate about its own axis . the piston drive structure 16r has four radially extending brackets 17u , 17b 17l and 17r . the other drive structure 16l carries identical brackets 17 , partially visible in fig2 . the upper brackets 17u are secured to the upper piston 18u ; the two pairs of side brackets 17l and 17r are secured respectively to the side pistons 18l and 18r , and the bottom brackets 17b are secured to the bottom piston 18b . by this means when the drive shaft 2 is rotated , each of the pistons is driven in a circular orbit in a plane perpendicular to the longitudinal axis of the shaft 2 . to avoid an excessive load on the piston seals , the chambers 22u , 22b , 22l and 22r are driven by separate drive means along linear reciprocating paths , parallel with and displaced from the longitudinal axis of the drive shaft 2 , that correspond to the displacements of the pistons in the respective directions . this driving force is applied to the chambers by separate mechanisms secured to the ends of the chambers . the drive mechanism for the left hand ends of the chambers will now be described , it being understood that a similar drive arrangement is connected to the opposite ends of the chambers . the drive sleeve 15 extends beyond the piston drive structure 16l and carries a pair of ears 32a and 32b that extend laterally into corresponding notches 34a and 34b on the inner surface of an orbital chamber drive structure , generally indicated at 36l . the orbital chamber drive structure 36l has a pair of oppositely disposed inner drive rails 38 extending vertically along the sides . only one drive rail 38 is visible in the view of fig2 but the other rail is positioned symmetrically along the opposite side surface of the structure . this orbital chamber drive structure 36l is positioned within a first linear chamber drive structure , generally indicated at 42l , in which the inner drive rails 38 respectively engage outer drive rails 44 , only one of which is visible in fig2 . these mating drive rails permit vertical movement of the orbital chamber drive structure 36l within the linear chamber drive structure 42l , but do not permit horizontal movement of the orbital drive structure within the linear chamber drive structure . vertical or rotational movement of the linear chamber drive structure 42l is prevented by a pair of guide rails 46a and 46b that are fixed to the linear chamber drive structure 42l and are supported by two sets of guide pads 48a and 48b mounted for horizontal sliding movement in a fixed support plate 52l that may form part of the compressor housing 25 of fig1 . one of the end plates 54ul of the chamber 22u and one of the end plates 54bl of the chamber 22b form an integral part of the linear chamber drive structure 42l . the plate 54ul forms the left end plate of the upper chamber 22u and the plate 54bl forms the left end plate of the bottom chamber 22b . when the drive shaft 2 rotates , the sleeve 15 follows a non - rotational orbital path . this movement causes the orbital drive structure 36l to ride up and down in the linear chamber drive structure 42l while moving that structure horizontally in a reciprocating motion . an equivalent mechanism ( not shown ) operated by the eccentric drive member 4r through the bearing 14r produces an identical motion of the end plates at the opposite ends of the chambers 22u and 22b . the chambers 22u and 22b are thus caused to move laterally in synchronism with the horizontal component of motion of the pistons 18u and 18b . to drive the chambers 22r and 22l , the orbital chamber drive structure 36l is provided with a second pair of drive rails 56 that extend respectively horizontally along the upper and lower surfaces of the orbital chamber drive structure 36l and are offset along the axis of the shaft 2 from the drive rails 38 . it is not necessary that the drive rails 38 and 56 be axially displaced along the drive shaft 2 but , if desired , may be positioned in a common plane . these drive rails 56 respectively engage upper and lower cooperating outer drive rails 58 in a second linear chamber drive structure , generally indicated at 62l , that permit horizontal movement within the second linear chamber drive structure . only the upper drive rail 56 on the orbital chamber drive structure 36l and the lower drive rail 58 on the second linear chamber drive structure 62l are shown in this view , but opposing symmetrical rail drives are provided . the meshing drive rails on both the vertical and horizontal surfaces are provided with ball or roller bearing elements or other means to minimize the friction and wear of the reciprocating surfaces . horizontal or rotational movement of the second linear chamber drive structure 62l is prevented by a pair of guide rails 63a and 63b attached to the drive structure and mounted for vertical sliding movement in the fixed support 52l by means of two sets of guide pads 64a and 64b . an end plate 66l that forms the left end of the left side chamber 22l and an end plate 66r that forms the left end of the right side chamber 22r form integral parts of the second linear chamber drive structure 62l . as with the chambers 22u and 22b , the side chambers are driven to correspond to the vertical component ( as shown ) of the orbital movement of the pistons 18l and 18r . when the orbital chamber drive structure 36l moves in a circular orbit , the second linear chamber drive structure 62l reciprocates vertically driving the chambers 22l and 22r in a vertical reciprocating path . as stated above , a duplicate chamber driving mechanism ( not shown ) is provided and is driven by the orbital motion of the drive sleeve 15 to impart the appropriate motion to the right hand end of each of the chambers . analysis of the forces acting upon this assembly shows that the forces generated by acceleration and deceleration of the chambers as they reciprocate far exceeds the forces generated by the gases being compressed . earlier versions , in which the chambers are moved by pressure exerted on the piston seals or through a separate set of low friction or rolling element drive components , generally have high frictional losses reducing the efficiency of the system . in both such arrangements the pistons are generally located some distance from the drive shaft and any differential pressure between them and the driving mechanism , caused partially by unavoidable tolerances in the construction , thermal expansion or wear , can result in the creation of significant twisting or rotational torque on the chamber system as a product of the acceleration force and the eccentricity . in theory , the acceleration forces imparted by each of the opposing pistons on its associated chamber is identical , but in actual practice , one piston or the other usually exerts a large proportion of the total chamber - driving force . this results in much higher loads than would be predicted on the sliding or bearing surfaces that allow the chambers to reciprocate , increasing the friction losses and decreasing the useful life . this invention embodies a sliding or rolling interface between the eccentric drive element and the end plates of the chambers that allows the chamber drive structure to move horizontally for one pair of chambers and vertically for the other pair of chambers . friction losses are preferably minimized by using one of several rolling element configurations , while the twisting moments are dramatically reduced by having the drive forces resolved as near the centerline of the mass of the end plate and chamber assembly as possible . the twisting or rotational moments with respect to the upper and lower chambers 22u and 22b are resisted by the two guide rails 46a and 46b that are located respectively on the mass centerlines of the chamber end plates 54u and 54b . these guide rails ride , respectively , on the guide pads 48a and 48b that are slidably attached for horizontal sliding movement to the fixed support plate that may form part of the housing of the displacement apparatus . the guide rails 46a and 46b are positioned as far as possible from the centerline of the drive shaft 2 . by increasing the effective lever arm in this way , any twisting or overturning moment is resolved with minimum force , thus permitting the guide pads 48a and 48b to utilize a self - lubricated bearing material . the same considerations apply to the design of the end - plate chamber assemblies for the right and left chambers 22r and 22l and for the symmetrical constructions associated with the end plates that form the opposite ends of the chambers . with this arrangement , rolling bearing elements react with the largest forces to minimize friction losses , while maintaining minimum eccentricity between the centerline of the drive shaft 2 and centerline of the force that counteracts the overturning or twisting moments . as stated above this allows the use of simple sliding pads to resolve the much smaller gas pressure forces . various arrangements for counteracting the overturning forces are shown diagrammatically in fig5 to 11 . in the embodiment shown in fig5 a recirculating ball bearing system is positioned between the orbital chamber drive structure 36l and the end plates of the chambers . a somewhat more detailed illustration of this construction is shown in fig6 and 7 . in this example , ( fig5 ) the upper and lower chambers 22u and 22b are mounted for horizontal movement . the pistons , represented symbolically at 18u and 18b in this view , follow an orbital path as the chambers reciprocate . as before , this orbital drive movement is provided by the orbital chamber drive structure 36l . this orbital drive structure is confined by the chamber drive structure , or any structure secured thereto , indicated in this view diagrammatically at 42l , and the pistons 18u and 18b . the outer drive rails 44 are part of the chamber drive structure 42l , or a structure secured thereto , and the inner drive rail 38 is part of the orbital chamber drive structure 36l . free floating ball bearings 67a are positioned between the inner drive rails 38 and the outer drive rails 44 . to permit recirculation of the ball bearings , a recirculation track is provided through the pistons 18u and 18l . this ball bearing track may be through the pistons proper or it may be through appropriate structures forming part of the piston assemblies . with this arrangement , the ball bearings do not reciprocate , but follow a 360 - degree recirculation path . as before , the reciprocating motion is guided by the guide rails 46a and 46b and the guide pads 48a and 48b . as shown by fig6 and 7 , a separate set of recirculation ball bearings 67b is provided in connection with the vertical reciprocation of the side chamber drive structure 62l . fig8 illustrates an arrangement in which the recirculating ball bearings are replaced with low - friction sliding surfaces 68a and 68b . this arrangement provides a low cost simple displacement apparatus for less demanding applications . fig9 illustrates diagrammatically an arrangement where the recirculating ball bearings have been replaced by four small rolling elements 72 that resolve the twisting moments of the chambers . these rolling elements are mounted on the orbital chamber drive structure 36e and ride on the guide rails that form part of the end plate drive structure represented diagrammatically at 42e and 54f . as in the previous examples , rotary or twisting moments are resisted by the guide rails 46e and 46f operating respectively with the guide pads 48e and 48f . fig1 shows an arrangement similar to the one represented by fig9 in which the rolling elements 72 are mounted on the end plate structure 42g and ride on suitable guide rails 74 that form part of the orbital chamber drive structure 36g . fig1 illustrates diagrammatically another embodiment in which an inner drive rail 76 is circular in form and is mounted on the outer race of a drive bearing 78 slightly less than the distance between the outer guide rails 44j and 44k so that it can only make contact with one rail at any given time . this arrangement provides high efficiency , a simple construction and eliminates any possibility of jamming between the orbital drive structure 36j and the end plate drive structures 42j . the operation is based on a single - point rolling contact that minimizes the negative effects of tolerance reinforcements caused by changes in temperature , manufacturing tolerances and wear . | 5 |
referring to the drawing , fig1 shows a perspective view of parts of a data printing machine . a printing head 200 is moved laterally along a platen 202 , for example by a threaded lead screw 204 which rotates and is rotationally coupled to a rotary encoder 206 by a drive belt 208 . printing head 200 may be of the impact type having printing needles ( indicated pictorially in fig5 by numeral 556 ), arranged , for example , in a single column , which can be axially impelled or &# 34 ; fired &# 34 ; to impinge an inked ribbon against a printing surface ( 557 ), thereby forming a printed &# 34 ; dot &# 34 ; of a desired size and shape on the printing surface 557 . as the printing head 200 moves along the printing surface 557 additional dots are printed at specific locations , with coherent groupings of a plurality of dots forming characters such as letters or numbers . fig2 is a perspective view of internal components of rotary encoder 206 , including an elongated drive shaft 10 affixed to the central axis of a wheel 20 and rotationally coupled to drive belt 208 . rotation of lead screw 204 results in lateral movement of printing head 200 and transmission of a proportional rotation to wheel 20 through belt 208 and shaft 10 . wheel 20 has peripheral coding means , for example , a plurality of windows 100 , which rotate and are used to generate a signal which indicates lateral displacement of printing head 200 . in a particular embodiment , printing head 200 may print at a rate of 120 characters per second , as one example , in which case encoder 206 may be geared at a five - to - one gear ratio from the main drive shaft , and encoder wheel 20 may include twenty equally spaced windows 100 , resulting in a dot density on the surface 557 to be printed of 100 dots per inch , if each window 100 is made to correspond to a single dot position of the printing head 200 along the platen 202 , which is a very desirable relationship . if it is desired to change the dot density , the drive ratio of encoder wheel 20 can be changed , and / or encoder wheel 20 can have a different number of windows 100 in it . accordingly , the dot density on the surface 557 to be printed can be changed easily by changing the encoder module , while leaving most other parts of the printer the same . as shown in fig3 a plurality of window openings 100 , 100a , 100b , 100c , et seq . are spaced circumferentially in a circle around the periphery of wheel 20 . a u - shaped transducer housing 30 , with legs extending over both side edges of wheel 20 , has a pair of spaced cylindrical openings 32 and 34 ( fig2 and 3 ) extending through the legs of housing 30 parallel to the axis of shaft 10 and displaced from shaft 10 the same radial distance as window openings 100 . as wheel 20 rotates , the various window openings 100 move into and out of alignment with openings 32 and 34 to form a periodically interrupted light path . additionally , housing 30 has rectangular mounting openings 36 and 38 intersecting opening 34 at a right angle and rectangular mounting openings 40 and 42 intersecting opening 32 at a right angle . openings 36 and 42 extend into housing 30 parallel to the surface on a first side of wheel 20 and are adapted to receive light - emitting diodes 37 and 43 , respectively , by which openings 32 and 34 may be illuminated . openings 40 and 38 extend into housing 30 parallel to the surface on the other side of wheel 20 from openings 36 and 42 , and are adapted to receive photo - transistors 41 and 39 , respectively , for detecting light from light - emitting diodes 43 and 37 through openings 32 and 34 only when a window 100 is aligned with either opening 32 or 34 . advantageously , wheel 20 , housing 30 and a supporting framework for encoder 206 ( partially shown in fig1 ) are fabricated of plastic by molding . fig3 is taken along section line 3 -- 3 of fig2 and shows a part of the surface of wheel 20 and a partial cross - sectional view of housing 30 . the lateral spacing of openings 32 , 34 and of windows 100 is such that when opening 32 is fully aligned with window 100a , opening 34 is half covered by the wheel portion between windows 100b and 100c , and half exposed through window 100c . accordingly , a light source within opening 42 and communicating with opening 32 can transmit through window 100a and into opening 40 , where photo - transistor 41 receives the light and produces an electrical output . since window 100c is only partially aligned with opening 34 , photo - transistor 39 , associated with opening 38 , has a reduced electrical signal output amplitude compared to the output amplitude of photo - transistor 41 associated with opening 32 . from the relative position of openings 32 and 34 and the windows 100 , it can be appreciated that as wheel 20 rotates the magnitude of the light transmitted through openings 32 and 34 will vary approximately sinusoidally and that the sinusoid of the light output associated with opening 32 is displaced 90 electrical degrees from the sinusoid of the light output associated with opening 34 . further , in the situation illustrated in fig3 ( i . e ., with opening 32 fully exposed by window 100a ) the change in the magnitude of the output of photo - transistor 39 associated with opening 34 can indicate the direction of rotation of wheel 20 , since if this output is increasing at such time , wheel 20 , as shown in fig3 is rotating counterclockwise and , if the output is decreasing at such time , wheel 20 is rotating clockwise . fig4 shows a series of waveforms , with time along the horizontal axis and amplitude along the vertical axis , generated by decoding circuitry , shown in block form in fig5 from the output of encoder 206 . the approximately sinusoidal output produced by photo - transistors 39 and 41 , denoted output a and b , monitoring the light variations within openings 32 and 34 is applied to a differential amplifier 501 ( shown in fig5 ) to increase the magnitude of the signal . the amplified sinusoidal outputs a and b are coupled from amplifier 501 to a schmidt trigger 502 which changes the sinusoidal form of outputs a and b into square waves , corresponding to phase a ( ฯa ) and phase b ( ฯb ) shown as lines 1 and 2 , respectively , in fig4 . transformation of the sine waves to square waves facilitates an analysis and comparison of the wave forms . to this end , phases a and b are applied to logic circuitry which performs comparison of the two phases to determine the amount and direction of rotation of wheel 20 and , in turn , the amount and direction of movement of printing head 200 . more specifically , the position of the printing head 200 along the platen 202 , i . e ., along the printing surface 557 , may be monitored by monitoring , and algebraically summing , the pulses produced by rotating wheel 20 . the time of firing of the printing needles or stylii 556 to produce dot matrix printed characters can be controlled as a function of the pulses produced by the rotating wheel 20 of the encoder 206 . if , as a general rule , each such pulse is synchronized to , or used to trigger , the printing of one dot by a given needle 556 in the printing head 200 and the repetition rate of the square wave of phases a and b is directly related to the circumferential spacing of windows 100 , the spacing of windows 100 , in a sense , determines the spacing of dots imprinted by the printing head 200 on the surface 557 to be printed . the direction of rotation of wheel 20 , and thus the direction of travel of printing head 200 , may be determined by noting the level of one phase at the time of transition from a zero level to a one level of the other phase . for example , if phase b has a level transition from zero to one and phase a is at a one level at that time , wheel 20 can be defined as rotating in a first direction ( as shown in fig3 toward the left ). analogously , if phase b has a transition from zero to one and phase a is zero , wheel 20 can be defined as rotating in the other direction , e . g ., towards the right . a reversal in direction of rotation is indicated by an arrow 300 shown in fig4 . to the right of arrow 300 , at the point designated by arrow 302 , phase b has a zero to one transition , phase a is at a zero level , indicating leftward rotation . to the left of arrow 300 , when phase b has a zero to one transition , phase a is at a one level , indicating a rightward rotation . since the information from these phases is used to control ( i . e ., command ) printing operation by the printing head 200 at a particular horizontal location along the platen 202 and over the printing surface 557 , it is desirable to know as soon as possible when a reversal in direction of printing head movement ( i . e ., encoder rotation ) has occurred . if a zero to one transition of phase b is used to initiate interrogation of the direction of rotation , the first electrical indication that a physical change in direction of rotation has occurred at arrow 300 takes place at a time denoted by arrow 302 . an earlier electrical indication of the physical transition in direction can be obtained by using a one to zero , instead of a zero to one , transition of phase b , indicated by an arrow 304 . of course , when phase b switches from level one to level zero , a one level , rather than a zero level , of phase a indicates a change in direction of rotation . it can be appreciated that the interval of time between a physical change in direction of wheel 20 and an electrical indication that a change in direction has occurred depends upon the relative levels of phase a and phase b when a physical change in direction takes place and when the level transition which initiates interrogation of direction of rotation . typically , the level transition initiating interrogation is fixed in advance and the time interval between physical change in direction and electrical indication of change in direction depends upon the relative amplitude of phase a to phase b when physical reversal takes place . that is , phases a and b can both be zero or one , or phases a and b can have different levels . lines three through seven of fig4 indicate a preferred processing of the square waves of phase a and phase b at corresponding points in time . line three shows production of a pulse when phase a has a transition from zero to one , and line four shows production of a pulse when phase a has a transition from level one to level zero . line five is used to show a change in direction of wheel 20 when the reference used to initiate interrogation of the direction of rotation is the transition from level one to level zero of phase a . more specifically , starting at the left ( lines one and two ), phase b is at a level of one each time phase a makes a transition from level one to level zero until the time indicated at an arrow 306 . the transition of phase a and the level of phase b at arrow 306 is used to indicate a change in direction , and it may be seen that at point 306 direction line five undergoes a transition from level one , indicating one direction of rotation , to level zero , indicating another direction of rotation . line six is used to keep track of the printing head 200 so each printing position , or dot , is not lost when a change in direction occurs . line six is obtained by comparing line five with both lines three and four , i . e ., if line five is at level one then line six is the complement of line four ; if line five is at level zero then line six is the complement of line three . if a pulse occurs on line three or four during a transition of line five , then there is only a spike on line six , as opposed to a full pulse . line seven is a mirror image of line six , but with the spikes removed . each pulse on line seven indicates that the printing head 200 is present at a new dot location on the printing surface 557 , taking into consideration printing head direction reversals at the points already mentioned . the generation of the waveforms described above is accomplished in the circuit section 500 shown enclosed within a dotted box labeled direction and strobe decoder in fig5 . as already noted , square waves a and b are generated by schmidt trigger 502 , which is coupled to a quad - d flip - flop circuit 503 . the inputs of flip - flop circuit 503 also include a clock input , a power supply input and two feedback inputs . the outputs of flip - flop circuit 503 are coupled to a logic network comprising and circuits 504 , 505 and 506 , nand circuits 507 through 514 , and inverter circuits 515 , 516 and 517 . the signal represented by line 5 of fig4 appears at the output of inverter circuit 517 and the signal represented by line 7 of fig4 appears at the input of inverter 515 . describing circuit section 500 more specifically , the phase a output of schmidt trigger 502 is coupled to the 1d input of flip - flop circuit 503 and the phase b output of schmidt trigger 502 is coupled to the 2d input of flip - flop circuit 503 . the two inputs of and circuit 504 are coupled to the 1q and 4q outputs of flip - flop circuit 503 . the two inputs of and circuit 505 are coupled to the 1q and 4q outputs of flip - flop circuit 503 . one input of nand circuit 507 is coupled to the output of and circuit 504 and the other input of nand circuit 507 is coupled to the 2q output of flip - flop circuit 503 . one input of nand circuit 508 is coupled to the output of and circuit 505 and the other input of nand circuit 508 is coupled to the 2q output of flip - flop circuit 503 . the inputs of nand circuit 509 are coupled to output 2q of flip - flop circuit 503 and the output of and circuit 504 ; the inputs of nand circuit 510 are coupled to ouput 2q of flip - flop circuit 503 and the output of and circuit 505 ; the inputs of nand circuit 511 are coupled to the output of and circuit 504 and the output of inverter circuit 516 ; the inputs of nand circuit 512 are coupled to the output of nand circuit 514 and the output of and circuit 505 ; the inputs of and circuit 506 are coupled to the outputs of nand circuits 511 and 512 ; the inputs of nand circuit 513 are coupled to the outputs of nand circuits 507 , 508 and 514 ; the inputs of nand circuit 514 are coupled to the outputs of nand circuits 513 , 509 and 510 ; the input of inverter circuit 517 is coupled to the output of nand circuit 513 ; the input of inverter circuit 516 is coupled to the output of nand circuit 514 ; and the input of inverter circuit 515 is coupled to output 3q of flip - flop circuit 503 . the 3d input of flip - flop circuit 503 is coupled to the output of and circuit 506 and the 4d input of flip - flop circuit of 503 is coupled to the 1q output of flip - flop circuit 503 . the outputs of inverters 515 and 517 are coupled to an up - down counter 518 which forms the first element of a controller group receiving the outputs of circuit section 500 . a description of the controller group is found in u . s . patent application ser . no . 766 , 242 , entitled method and apparatus for setting and varying margins and line spacing on data printers , invented by william wegryn and juan f . velazquez , filed concurrently herewith , the disclosure of which is hereby incorporated by reference . a comparator 519 is coupled to counter 518 and a control logic and memory circuit 520 which is , in turn , coupled to an input / output interface 521 and a control character decoder 522 . control logic and memory circuit 520 also has an input from an operator - controlled keypad 550 and an input from a needle controller 525 . typical voltage signals from key pad 550 represent the binary number addresses of the left and right - hand margins desired by the operators . if desired , limit switches located at the left and right extremes of print head movement can be electrically coupled to logic and memory circuit 520 to provide voltage signals indicating the presence of the printing head 200 at the maximum permissible extreme of travel to either the left or the right . alternatively , maximum lateral travel can be indicated by an absence of pulses from encoder 206 during a period of time such as , for example , 50 milliseconds . the absence of pulses indicates printing head 200 has reached left or right limit or has jammed with respect to lateral movement . interface 521 is coupled to a data input source 523 , to the control character decoder 522 , and to a character storage buffer 524 . a needle power amplifier 527 is coupled to buffer 524 , sequentially , through a character generator read - only memory 526 and a needle controller 525 . the needle power amplifier 527 is also coupled to receive an input from a variable one - shot multivibrator 528 . a paper feed controller 529 is coupled to control character decoder 522 . up - down counter 518 stores the current printing head address , i . e ., the particular lateral location of the printing head 200 along the platen 202 , expressed in binary notation representing the number of dot positions from a reference point . the output of inverter 517 ( line 5 , fig4 ) indicates direction thus causing counter 518 to increment or decrement the stored binary number address when the output from inverter 515 ( inverse of line 7 ) indicates the presence of a pulse . more specifically , the voltage level of the signal output of inverter 517 establishes the sign of the binary number represented by the voltage output of inverter 515 . voltage signals sent from counter 518 to comparator 519 represent binary numbers indicating the actual location of the printing head 200 along the platen 202 . comparator 519 also receives voltage signals from control logic circuit 520 representing the binary number address of the location where the printing head 200 is desired to be located by the operator . comparator 519 compares the voltage signals representing the actual location of the printing head 200 with the voltage signals representing the desired location of the printing head 200 and generates voltage signals representing the difference between the two locations . that is , the output of comparator 519 is a voltage signal representing the distance from the actual location to the desired location of the printing head 200 and is applied to control logic circuit 520 . a carriage servo , power amplifier and motor circuit 552 is coupled to receive an input from control logic circuit 520 and determines the right and left movement of the printing head 200 along the platen 202 . carriage servo , power amplifier and motor circuit 552 also is coupled to receive an output of voltage pulses from circuit section 500 indicating movement of printing head 200 . the servo of circuit 552 is set for a given pulse repetition rate and changes the motor speed to attain that repetition rate . that is , if the received pulse repetition rate is too slow the motor is speeded up , and if the received pulse repetition rate is too fast the motor is slowed down . the data which is eventually printed on the printing surface 557 by the printing head 200 is supplied at data source 523 . a typical source can be , for example , a magnetic memory having information describing a particular paragraph to be printed . interface 521 is adapted to adjust the level of the voltage signals from data source 523 to the level required by control logic circuit 520 . for example , if control logic circuit 520 uses transistor logic , voltage applied to circuit 520 should be in the range of about 0 to 5 volts . in addition to translating voltage levels , interface 521 can also match impedance levels and filter out noise from data source 523 . further , interface 521 is coupled to data source 523 to send voltage signals indicating whether interface 521 can receive additional data . paper feed controller 529 applies a voltage signal to power amplifier and step motor 553 causing the paper to move one vertical increment . in one embodiment of this invention , twelve incremental steps are required to move the paper one line . paper feed controller 529 includes logic and memory circuits for determining the last instructions sent to motor power amplifier 553 and for determining how many more increments are acquired to complete one line . control character decoder 522 decodes characters from data source 523 which are not to be printed but , instead , are used to indicate such actions as line feed , carriage return , horizontal tab and various other control functions . for example , a single character representing the spacing of a certain number of lines is converted into an order for a discrete number of line spacings equal to the desired vertical distance . the completion of a control function is transmitted by a connection from paper feed controller 529 to decoder 522 . needle controller 525 operates in a manner analogous to paper feed controller 529 . more specifically , a character can have for example , 10 vertical segments much the same as each line can have a plurality of horizontal segments . needle controller 525 has an output of voltage signals representing the next character to be printed and the vertical column in which the character is to start . information about where the printing head 200 should be located is introduced into control logic 520 and compared in comparator 519 to the current print head address . information for the actuation or firing of the printing needles 556 is sent from control logic 520 to needle controller 525 and information indicating completion of printing at a given lateral location is sent from needle controller 525 to control logic 520 . in accordance with an embodiment of this invention , print needle actuation current for displacing a printing needle 556 is supplied to an actuating solenoid 555 from an unregulated power supply 554 for a regulated period of time determined by a variable one - shot multivibrator 528 which is coupled to needle power amplifier 527 . needle 556 is mechanically coupled to actuating solenoid 555 which , in turn , is electrically coupled to power supply 554 through the serial combination of multivibrator 528 and needle power amplifier 527 . needle power amplifier 527 is also electrically coupled to character generator memory 526 and receives a voltage level from character generator memory 526 which determines whether a pulse from multivibrator 528 supplying power is accepted or rejected . although unregulated power supplies are desirable because there is no heat generated by regulation and cooling requirements are therefore reduced , they may adversely affect the consistency and quality of the printed dots , which depend on the amount of power supplied to the solenoids 555 of the printing needles 556 . multivibrator 528 has an input representative of the voltage level of power supply 554 , and serves to regulate the duration of the time power supply 554 supplies current to the actuating solenoids 555 which drive the printing needles 556 . thus , regulation is accomplished by changing the width , i . e ., duration , of an actuating pulse from power supply 554 to needle power amplifier 527 . the power supply actuating pulse can be initiated , for example , by the pulses shown in fig4 line 7 , indicating a printing position has been reached . the action of variable one - shot multivibrator 528 is much like that of a switch which is closed during the duration of the pulse thereby connecting power supply 554 to power amplifier 527 . since a relatively constant amount of power is desired to be applied to the solenoids 555 activating the needles 556 , a high voltage at the output of power supply 554 causes variable one - shot multivibrator 528 to remain closed a shorter period of time than when a lower voltage is present at the output of power supply 554 . as a result , although power supply 554 is not regulated the power applied to needle power amplifier 527 is substantially regulated . referring to fig6 there is shown a wheel 20a in accordance with another embodiment of this invention . wheel 20a has a higher effective density of light - passing windows and permits a higher density of characters on the printed surface 557 . wheel 20a includes an outer ring of equally - spaced windows 101a , 101b , et seq . as in the embodiment shown in fig2 ( which for purposes of illustration here may be considered as including twenty such windows ). additionally , an innermost ring has a single window 103 to provide synchronization pulses , and an intermediate ring has another series of equally spaced windows 105 , i . e ., 105a , 105b , et seq . which for illustration may include thirty - three windows , as opposed to twenty , to provide a higher dot density on the printing surface 557 . a housing 30a , similar to housing 30 of fig1 has five openings to pass light between five pairs of light - emitting diodes and photo - transistors . as in the embodiment in fig2 the outer row of windows has two openings in housing 30a associated with it , here designated 33 and 35 . similarly , the intermediate row of windows has two housing openings 137 and 139 associated with it . in each case , the two openings and their associated two pairs of light - emitting diodes and photo - transistors are used to determine the direction of rotation of wheel 20a . a selective switching means chooses the electrical outputs associated with either the outer or intermediate ring depending upon the dot density desired . for example , the switching means can be included in amplifier 501 . the innermost ring with single window 103 has a single light - emitting diode and photo - transistor pair associated with it in housing 30a , at an opening 141 aligned to intersect the innermost ring . the output pulse produced by window 103 in the third ring is used to indicate the passing of window 103 by housing 30a which occurs once during each rotation of wheel 20a . this output pulse is used as a synchronization check to make sure that the number of windows counted during each complete rotation of wheel 20a is equal to the actual known number in the outer row or in the intermediate ring , whichever is selected . it is possible , in actual practice , for the printing head 200 to go out of synchronization for any number of reasons , including an electrical noise spike giving an erroneous indication of movement , or slippage or variation in the mechanical coupling between the printing head 200 and the encoder 206 . synchronization is accomplished by counting the pulses from the selected ring of multiple equally - spaced windows after a pulse is received from the innermost synchronization ring containing only a single window . after the number of pulses corresponding to the known number of windows in the outer ring are received , another synchronization pulse should be received . a synchronization pulse occurring when fewer than or more than the normal number of pulses have been counted indicates that the physical location of the printing head 200 is not synchronized with the location of the printing head 200 as indicated by the electronic logic circuitry . when such an out - of - synchronization signal is received , printing can be stopped by appropriate means , or an alarm signal sounded . if printing were to continue , provision can be made in the controller for electronically modifying the address counter so that it reflects the correct head position . any misalignment of left and right margins of a printed line may also be taken as an indication of a loss of synchronization of the printing head 200 . if , for example , an outer ring having twenty windows 101 is used to activate a printing head 200 to form a dot matrix character on the printing surface , and each window 101 is correlated to a single dot position of the printing head 200 across the platen 202 , there may advantageously be ten character spaces per inch and each character space may have twelve vertical columns , with the last three vertical columns being used for spacing between adjacent printed characters . thus the characters themselves may each consist of nine vertical columns . if , for comparison , the intermediate ring having thirty - three windows 105 is used , with other factors remaining the same , the character density will increase to sixteen and one - half characters per inch . in effect , each character is made narrower when the intermediate ring is used than when the outer ring is used . the number of characters printed per second remains the same , and is not affected by the particular ring used , but the speed of movement of the printing head 200 is less when the intermediate row of windows 105 is used than when the outer row of windows 101 is used . of course , the encoding techniques described , including the particular examples given for illustration , may be used with many different specific printer speeds . various modifications and variations will no doubt occur to those skilled in the art to which this invention pertains . for example , the coupling of the encoder 206 to the printing head 200 may be varied from that disclosed herein . similarly , the shape and spacing of the windows 100 , 101 , 105 may be varied from that disclosed here . these and all other variations which basically rely on the teachings through which this disclosure has advanced the art are properly considered within the scope of this invention . | 6 |
fig1 shows a plate - link chain portion 1 in double configuration in simplified form . the plate - link portion 1 includes four rocker pressure member pairs 4 , 5 , 6 , and 7 . each rocker pressure member pair 4 through 7 includes two rocker pressure members 8 , 9 . two of the rocker pressure member pairs 4 through 7 serve to constitute a chain link 11 , 12 , 13 . in the double configuration shown in fig1 , the chain links 11 and 13 are designed as shorter or short chain links . chain link 12 is designed as a longer or long chain link . the longer chain link 12 includes four plate - links 21 through 24 , which are coupled with one another by the rocker pressure member pairs 5 and 6 . the plate - links 21 through 24 of the long chain link 12 are of identical design . the short chain link 11 includes four plate - links 31 through 34 , which are coupled with one another by the rocker pressure member pairs 4 and 5 . the short chain link 13 includes four plate - links 35 through 38 , which are coupled with one another by the rocker pressure member pairs 6 and 7 . the plate - links 31 through 38 of the short chain links 11 and 13 are of identical design . a chain running direction extends in the vertical direction in fig1 . in the plate - link chain portion 1 , the two plate - links 22 , 23 of the long chain link 12 are disposed medially . the plate - links 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 of the short chain links 11 and 13 are combined in pairs . the plate - link pairs 31 , 32 and 35 , 36 of the short chain links 11 and 13 contact one another at their longitudinal ends that face one another . the plate - link pairs 31 , 32 and 35 , 36 are disposed laterally relative to the chain running direction between the plate - links 21 and 22 of the long chain link 12 . the plate - link pairs 33 , 34 and 37 , 38 of the short chain links 11 and 13 are similarly disposed laterally relative to the chain running direction between the plate - links 23 and 24 of the long chain link 12 . the longitudinal ends of the plate - link pairs 33 , 34 and 37 , 38 that face one another contact one another . intermediate spaces 29 , 30 are produced between the outer plate - links 21 , 24 of the long chain link 12 and the plate - links 31 , 35 , 34 , 38 of the shorter chain links 11 and 13 in the arrangement shown in fig1 . furthermore , the double configuration in fig1 includes intermediate spaces 39 , 40 between the longer plate - links 22 , 23 of the long chain link 12 and the shorter plate - links 32 , 36 , 33 , 37 of the shorter chain links 11 and 13 . the intermediate spaces 29 , 30 and / or 39 , 40 are advantageously provided with spacing and / or biasing elements ( not shown in fig1 ). filling the intermediate spaces 29 , 30 , 39 , 40 fulfills at least one of the following functional options . 1 . weight balancing for a uniform distribution of weight in the plate - link chain ; 2 . joint damping by means of elastic elements which lie pre - stressed around the rocker joints ; 3 . damping through axial bracing of the plate - links against one another ; 4 . springing / damping of the plate - links against the respective neighbor rocker pressure piece in the chain running direction ; 5 . springing / damping of the plate - links against following plate - links in the chain running direction . fig2 a shows a side view of a portion of a plate - link chain 41 having a long chain link 42 . within a longer plate - link 43 of the long chain - link 42 there are visible two longitudinal ends or bows 44 , 45 of plate - links of a longer and a shorter chain link . to the left thereof the same is shown , but in the foreground . the mutually facing longitudinal ends or bows 44 , 45 of the plate - links of the two chain links contact one another . the ends 44 , 45 are shaped on top so that the plate - links to which they belong are in contact when the chain is in a straight strand , as shown in fig2 a . by straight contacting surfaces at the ends 44 , 45 or bows in a contact region 48 , unwanted swing - back of the plate - link chain 41 is prevented when it is in the straight strand orientation . in the intermediate spaces 29 , 30 shown in fig1 , and laterally relative to the chain running direction , between individual plate - links of the longer and shorter chain links spacing and / or biasing elements 51 through 54 are positioned as shown in fig2 b . the spacing and / or biasing elements 51 through 54 on the one hand prevent unwanted telescoping of the longer chain links . in addition , so - called guide tips , which are also referred to as overlap tips and will be explained below in reference to fig5 , can be eliminated . fig3 a through 3d show different forms of spacing and / or biasing elements 61 through 64 in side views . the spacing and / or biasing elements 61 , 62 , and 64 are essentially h - shaped . the spacing and / or biasing element 63 is essentially x - shaped . the spacing and / or biasing element 62 has a notch 65 on top . the spacing and / or biasing element 63 has notches 66 , 67 on top and bottom . the spacing and / or biasing element 64 has a central opening 68 . fig4 shows a spacing and / or biasing element 61 of fig3 a in a perspective view . in that view it can be seen that the spacing and / or biasing element 61 is made of a corrugated material having corrugations 69 that extend between opposed longitudinal outer edges of the biasing element 61 . the material from which biasing element 61 is made can be a spring material . fig5 shows a plate - link chain portion 71 in triple configuration , also referred to as a triple grouping . the illustrated plate - link chain portion 71 includes four rocker pressure member pairs 74 through 77 , which serve to connect three chain links 81 through 83 . the chain links 81 and 83 are designed as shorter chain links . chain link 82 is designed as a longer chain link . the shorter chain link 81 includes four plate - links 31 through 34 , which are designed and identified exactly like the plate - links of the shorter chain link 11 in fig1 . the longer chain link 82 includes four plate - links 21 through 24 , which are configured and arranged exactly like the plate - links of the longer chain link 12 in fig1 . the shorter chain link 83 includes four plate - links 85 , 86 , 87 , and 88 , which are distributed differently than the other plate - links in the plate - link chain portion 71 . at the longitudinal ends of the plate - links 85 through 88 as shown in fig5 , in an overlap region 90 , there result overlap ends , which are also referred to as guide ends . in a manner similar to the previously described spacing and / or biasing elements , the overlap ends prevent unwanted sliding between one another of laterally spaced plate - links of the chain links 81 through 83 . however , the overlap ends or guide ends do not perform a biasing function , as do the spacing and / or biasing elements 61 . | 5 |
plasmid pspr6 ( see fig1 ), ( in escherichia coli nm554 host ncimb 40786 deposited with the national collections of industrial and marine bacteria limited , 23 st machar drive , aberdeen ab2 1ry scotland uk on feb . 8 , 1996 under the budapest treaty ) contains unique noti and spei restriction sites which are positioned on either side of the plasmid origin of replication ( ori ) and on either side of a tetracycline resistance marker teta / r . this plasmid allows the insertion of two independent copies of an expression cassette to improve the genetic stability of the plasmid during fermentations . in this example the expression cassette was dna encoding the expression of a fungal xylanase comprising of a constitutive promoter ( gene a3 promoter from bacteriophage t7 ), a ribosome binding site ( from lac z of e . coli ), the coding sequence for the enzyme ( truncated xylanase gene from plasmid pnx10 described in wo 93 / 25693 ) and a transcriptional terminator from bacteriophage t4 . the expression cassette was flanked by either noti or spei restriction sites . the expression cassette can be obtained by complete digestion of the plasmid pspr8 in e . coli nm554 , ( ncimb 40787 deposited with the national collections of industrial and marine bacteria limited , 23 st machar drive , aberdeen ab2 1ry scotland uk on feb . 8 , 1996 under the budapest treaty ) using restriction endonucleases noti or spei in a high salt restriction buffer . strain e . coli nm554 ( pspr8 ) was constructed as follows : plasmid dna was prepared from e . coli strain nm554 ( pspr6 ) grown overnight at 37 ยฐ c . in l broth ( 1 % tryptone , 0 . 5 % yeast extract , 0 . 5 % nacl ) using &# 34 ; rapid pure miniprep &# 34 ; ( rpm ) ( stratech scientific ltd , luton , uk ) following the manufacturers protocol . plasmid dna may also be isolated using standard methods such as described by sambrook et al 1 . 50 ฮผl of plasmid pspr6 dna was digested with restriction endonuclease noti ( boehringer mannheim , lewes , uk ) with the addition of 6 ฮผl of the manufacturers h buffer ( high salt restriction buffer ) and 20 units of restriction enzyme . digestion was carried out at 37 ยฐ c . for 16 h . the xylanase expression cassette was digested with noti and ligated to plasmid pspr6 similarly digested with noti , as follows . the two species of dna were mixed and the restriction enzyme and other contaminants were removed using an rpm miniprep ( following the manufacturer &# 39 ; s protocol but with the following modifications : dna mixture used in place of cleared lysate and dna eluted into 40 ฮผl ). 0 . 5 ฮผl of 100 mm adenosine triphosphate ( atp ) was added with 4 ฮผl of m buffer ( medium salt restriction buffer ). 1 unit of t4 dna ligase ( boehringer mannheim ) was added and the reaction incubated at 18 ยฐ c . for 16 h . 5 ฮผl of the ligation reaction was mixed with 100 ฮผl of e . coli strain jm109 ( atcc 53323 ) competent cell suspension , produced by calcium chloride treatment essentially as described by hanahan 2 , and incubated on ice for 45 m . cells were then heat shocked at 42 ยฐ c . for 90 s and returned to ice for 2 m . 1 ml of l broth was added and cells incubated at 37 ยฐ c ., with shaking , for 1 h before plating out dilutions onto l agar plates ( l broth + 1 % bacteriological agar ) containing 10 ฮผg / ml tetracycline and 1 % remazol brilliant blue -- xylan ( rbb - xylan , sigma , poole , uk ). plates were incubated for 24 h at 37 ยฐ c . one colony which gave a zone of clearing and contained the expected plasmid when miniprep dna was digested with noti was designated jm109 ( pspr7 ). plasmid dna from pspr7 which is shown diagramatically in fig2 was prepared as above from an overnight culture of jm109 ( pspr7 ) in l broth supplemented with 10 ฮผg / ml tetracycline . 50 ฮผl of plasmid dna was linearised by digestion with restriction endonuclease spei ( boehringer mannheim ) by adding 5 ฮผl of manufacturers h buffer and 20 units of spei enzyme . reaction was incubated for 16 h at 37 ยฐ c . the position of the noti flanked xylanase expression cassette ( xyl ) relative to the plasmid origin of replication ( ori ) and the selectable marker ( teta / r ) is shown . a second xylanase expression cassette , identical to the first except flanked by spei restriction sites rather than noti , was digested with spei as described above . this expression cassette may be obtained by the complete digestion of plasmid pspr8 with the restriction enzyme spei . this dna was ligated to spei digested plasmid pspr7 exactly as described above but with selection of transformants on l agar containing 10 ฮผg / ml tetracycline . tetracycline resistant colonies were screened using a rapid lysis method ( twigg and sherrett 3 ) to estimate the size of the plasmid carried . 1 colony which contained a plasmid larger than plasmid pspr7 and which subsequent digests of isolated plasmid dna with noti and spei restriction endonucleases showed to contain 2 copies of the xylanase expression cassette was designated jm109 ( pspr8 ), see fig3 which shows plasmid pspr8 showing the positions of both inserted xylanase expression cassettes ( xyl ) relative to the plasmid origin of replication ( ori ) and selectable marker ( teta / r ). plasmid dna was prepared from jm109 ( pspr8 ) and jm109 ( pspr7 ) and 1 ฮผl used to transform e . coli strain nm554 ( stratagene , cambridge , uk ). preparation of dna and competent cells and transformation of dna were done as described above . transformants were selected on l agar containing 10 ฮผg / ml tetracycline . stocks of nm554 ( pspr7 ) and nm554 ( pspr8 ) were stored at - 70 ยฐ c . in l broth containing 10 ฮผg / ml tetracycline and 25 % ( v / v ) glycerol . to prepare a fermentation inoculum , 50 ml of l broth containing 10 ฮผg / ml tetracycline was inoculated with 500 ฮผl from freezer stock and grown for approximately 4 h at 37 ยฐ c . with rapid aeration before transfer to the fermenter . fermentations were done using braun ed / er5 fermenters ( b . braun biotech , reading , uk ) . vessels were in situ sterilised and bottom agitated using 2 ร 70 mm diameter rushton impellers . the fermenter working volume was approximately 2 l . the medium used throughout the experiments was jv1 ( see appendix ). temperature was maintained at 37 ยฐ c .ยฑ 0 . 2 ยฐ c . the ph was measured using an ingold ph probe and maintained at 6 . 7 ยฑ 0 . 1 by the controlled addition of filter sterilised 10m nh 4 oh and 2m h 3 po 4 . an agitation speed of 600 rpm was used with air or 35 % o 2 aeration to maintain a % po 2 ( dissolved oxygen tension ) between 20 % and 80 %, of saturation measured by an ingold oxygen probe . foaming was controlled by the addition of sterile diamond shamrock ppg foamaster eea 142 at a rate of 0 . 1 ml / h . 50 ml inoculum was transferred to the fermenter which contained 2 l of jv1 medium plus 30 g / l glycerol and 10 ppm fe 2 + ( as feso 4 . 7h 2 o ). cultures were allowed to grow in batch to a point at which the co 2 evolution rate was between 10 and 40 mm / l / h ( typically 20 mm co 2 / l / h ), when the fermenter was switched to continuous operation at a dilution rate of 0 . 1 h - 1 . jv1 medium was fed with separate feeds of sterile glycerol ( feed rate 30 g / 1 ) and feso 4 . 7h 2 o ( feed rate 10 mg fe 2 + / l ). 1 ml samples were regularly withdrawn and stored at - 20 ยฐ c . in 25 % glycerol for later analysis of plasmid content . enzyme activity and dry cell weight was also periodically measured in 10 ml samples . xylanase enzyme activity was determined by measuring the amount of reducing sugar released from soluble oat spelt xylan substrate ( 1 %), essentially as described by kellett et al 4 . the production of xylanase and molecular weight was confirmed by sodium dodecyl sulphate polyacrylamide gel electrophoresis ( sds - page ) on an 8 - 25 % gradient gel with commasie blue protein staining using phast electrophoresis system ( pharmacia biotech , st albans , uk ). dry cell weights were determined by pelleting the cells in the withdrawn sample by centrifugation at 5700 rpm in a beckman tj - 6 centrifuge for 20 m and resuspending cells in 2 - 3 mls tris buffer ( 100 mm , ph7 . 2 ). cells were then re - pelleted and dried in a pre - weighed tube in an oven at 105 ยฐ c . for 16 h and mass of dried cells determined . changes to plasmid size during the fermentations were detected by plating of stored fermentation samples onto l agar containing 10 ฮผg / ml tetracycline and 1 % rbb - xylan . colonies were then picked and lysed using the procedure described by twigg and sherrett 3 . changes in plasmid size were seen as a shift in mobility of the plasmid band on a 1 % agarose gel compared to the control plasmid ( agarose gel electrophoresis was done as described by sambrook et al 1 ). fig4 shows xylanase activities ( ku / ml ) for fermentations of e . coli strains nm554 ( pspr7 ) โ, and nm554 ( pspr8 ), โฆ, growing in jv1 medium . cultures switched from batch to continuous culture , with dilution rate of 0 . 1 h - 1 , at approx . 10 hrs . these results show that strain nm554 ( pspr7 ), with a single copy of the xylanase expression cassette , very rapidly lost enzyme activity during continuous culture . sds page analysis of samples confirmed that the loss of enzyme activity corresponded to the loss of production of a heterologous protein band . examination of plasmids using the rapid lysis technique showed no difference in plasmid size compared to pspr7 control in samples taken up to 19 hrs , but showed several differently sized plasmids at the 50 hr and 72 hr sample points , indicating rearrangements and deletions had occurred in this plasmid causing the loss of enzyme activity . strain nm554 ( pspr8 ), containing 2 copies of the xylanase expression cassette , produced a high level of xylanase activity for 480 hrs in continuous culture . sds page confirmed production of heterologous protein over this time period . analysis of plasmids from fermentation samples showed no detectable change in plasmid size during the course of this experiment , indicated that no rearrangements or deletions had occurred . it was noted that the peak xylanase activity for nm554 ( pspr7 ) was higher than for nm554 ( pspr8 ) when the continuous fermentation was operated at a dilution rate of 0 . 1 h - 1 . in order to investigate whether the observed increase in strain stability was due to this initial reduction in enzyme expression strain nm554 ( pspr7 ) was fermented as previously but with a dilution rate of 0 . 2 h - 1 . this had the effect of reducing the peak xylanase activity to a comparable level to that seen with strain nm554 ( psprs ) operated at a dilution rate of 0 . 1 h - 1 . results showed the same instability despite the reduced expression level . analysis of plasmid content showed changes in plasmid size similar to those seen previously . the invention was further exemplified through production of a second protein , a haloalkanoic acid dehalogenase . in this example the host strain , promoter , ribosomal binding site , structural gene and fermentation medium were all different from those used in the xylanase example indicating the wide applicability of the invention . plasmid pspr6 was modified to remove the unique noti restriction site and introduce a unique psti restriction site at the same position . plasmid pspr6 dna was isolated and digested with noti restriction enzyme , as above . approx 2 ฮผg of a synthetic oligonucleotide with the sequence ggccctgcag ( seq id no : 1 ) was self annealed by heating to 94 ยฐ c . in high salt restriction buffer and cooling slowly to room temperature . the annealed oligonucleotide and digest ed pspr6 dna were mixed , atp added to final concentration of 1 mm and 1 unit of t4 dna ligase added . reaction was incubated at 18 ยฐ c . overnight . ligation mix was transformed into jm109 competent cells as described above and plated onto l agar plates containing 10 ฮผg / ml tetracycline . randomly picked colonies were screened by isolating plasmid dna and digesting with not i and psti restriction enzymes in separate reactions . one clone which failed to digest with noti but digested with psti was isolated and designated jm109 ( pspr6pst ). plasmid pspr6pst dna was isolated and digested with psti restriction enzyme in high salt restriction buffer . after 3 h incubation at 37 ยฐ c . 1 unit of calf intestinal alkaline phosphatase ( boehringer mannheim ) was added to prevent relegation . the reaction was incubated at 37 ยฐ c . for a further 30 mins then stopped by adding edta to a final concentration of 5 mm and heating the reaction to 75 ยฐ c . for 10 mins . the dehalogenase expression cassette , comprising the e . coli trp promoter , a two cistron type ribosomal binding site ( gold and stormo 5 ), the hadd dehalogenase structural gene ( barth et al 6 .,) and t4 phage transcriptional terminator , may be obtained by digesting the plasmid pspr11 . 1 ( deposited in e . coli host strain xl1 blue mr at ncimb as deposit no 40859 on feb . 12 , 1997 ) with the restriction enzyme psti as described above . plasmid pspr10 , which contains a single copy of the dehalogenase expression cassette , may then be obtained by ligation of this dna with the pspr6pst dna prepared as above , selecting for transformants on lagar containing 10 ฮผg / ml of tetracycline . plasmid pspr11 . 1 ( available from ncimb in host strain xl1 blue mr , deposit no 40859 ), contains 2 copies of the same dehalogenase expression cassette . this plasmid was constructed by the addition of a second copy of the expression cassette into a unique swai restriction site on plasmid pspr10 . plasmid pspr10 dna was isolated as previously and digested with restriction enzyme swai in high salt restriction buffer before treatment with calf intestinal alkaline phosphatase as described above . the dehalogenase expression cassette may be obtained by digestion of pspr11 . 1 with restriction enzyme psti . to produce blunt ended dna compatible with the swai digested plasmid pspr10 , 1 unit of t4 dna polymerase ( boehringer mannheim ) and a final concentration of 200 ฮผm each deoxyadenosine 5 &# 39 ; triphosphate , deoxy - cytidine 5 &# 39 ; triphosphate deoxyguanosine 5 &# 39 ; triphosphate and thymidine 5 &# 39 ; triphosphate ( all from boehringer mannheim ) was added to the reaction after 3 h incubation and incubated a further 30 mins at 12 ยฐ c . the reaction was stopped by heating to 75 ยฐ c . for 10 mins . the blunt ended dehalogenase expression cassette and swai digested pspr10 were ligated and transformed into xl1 blue mr competent cells ( stratagene ) as described above and plated onto l agar plates containing 10 ฮผg / ml tetracycline . plasmid pspr11 . 1 was identified by restriction digests of isolated plasmid dna , as containing 2 copies of the expression cassette in opposite orientations to one another . fermentation experiments were conducted in a derivative of e . coli strain w3110 ( atcc 27325 )( american type culture collection ( atcc ), 10801 university blvd , manassas , va ., 20110 - 2209 , usa ) engineered to be recombinationally deficient due to a deletion of the recj gene . the construction of this strain is given , but other recombinationally deficient hosts may also be used . 2 pcr products were produced of regions of the e . coli chromosome flanking the recj gene , primers used were : ctggatcccggcgttttcaggctttgctc ( seq id no : 2 ) with acagatcttcaccgaccacaataatccgc ( seq id no : 3 ) to give product 1 and acagatcttgaccctgtgcgagaaactgg ( seq id no : 4 ) with tgggatccgctcggcgtttacttcttcca ( seq id no : 5 ) to give product 2 . pcr reactions were carried out using 35 cycles of denaturation at 94 ยฐ c . for 1 min ; prime annealing at 60 ยฐ c . per 1 min and product extension at 72 ยฐ c . per 1 min . reactions were performed in a volume of 100 ฮผl , containing 200 ฮผm of each nucleoside triphosphate . taq dna polymerase buffer ( promega , southampton ;) and 5 units of taq dna polymerase . e . coli w3110 cells were used as template dna . the 2 pcr products produced were purified using an rpm column , as above , and cloned using the pmos blue t vector kit ( amersham , amersham , uk ) following the manufacturers protocol . plasmid containing pcr product 1 was isolated and digested with restriction enzyme bglii ( boehringer mannheim ) in medium salt restriction buffer . a dna fragment encoding streptomycin and spectinomycin resistance was produced by bam hi restriction digestion of plasmid put :: minitn5sm / sp ( de lorenzo 7 ) in medium salt restriction buffer . this fragment was ligated to the digested plasmid and transformed into xl1 blue mr competent cells with selection for transformants on l agar containing 50 ฮผg / ml ampicillin and 25 ฮผg / ml streptomycin . the insert from this plasmid was released by restriction digestion with the enzyme bamhi in medium salt restriction buffer . this fragment was ligated to the plasmid containing pcr product 2 which was digested with the restriction enzyme bglii . ligation and transformation was as above . a clone was identified by restriction digestion of isolated plasmid dna in which the streptomycin / spectinomycin resistance gene was flanked by dna which normally flanks the recj gene on the e . coli chromosome . the deletion of the recj gene on the e . coli chromosome was achieved by transformation of e . coli strain jc7623 ( atcc 47002 ). the above plasmid was digested using the restriction enzyme bamhi and the dna concentrated by ethanol precipitation ( sambrook et al 1 ) to give a final concentration approx 500 ng / ul . fresh electrocompetent jc7623 cells were produced ( sambrook et al 1 ) and 2 ฮผl of digested plasmid dna was transformed by electroporation in gene pulser electroporation apparatus ( bio - rad , hemel hempstead , uk ) ( 15 kv / cm , 25 ฮผf capacitance , 2000 parallel resistance ). after a 2 hr recovery period shaking in l broth at 37 ยฐ c ., transformants were recovered on l agar containing 25 ฮผg / ml streptomycin and 25 ฮผg / ml spectinomycin . transformants were screened for sensitivity to ampicillin by plating onto l agar containing 100 ฮผg / ml ampicillin . a transformant was identified as resistant to streptomycin and spectinomycin but sensitive to ampicillin and with an increased sensitivity to uv light compared to strain jc7623 . this strain was designated jc7623 ฮดrecj . the ฮดrecj mutation was introduced to strain w3110 by p1 phage transduction . a phage lysate was raised on jc7623 and used to infect w3110 using the method described by miller 8 . transductants were selected on l agar containing streptomycin and spectinomycin as above . for fermentations the strain w3110 ฮดrecj was transformed with the plasmids pspr10 and pspr11 . 1 using electroporation as described above . fermentation inocula and fermentations of dehalogenase producing strains were carried out essentially as described for xylanase production except that no yeast autolysate was present in the medium and glucose was used rather than glycerol . dehalogenase enzyme activity was measured as the rate of dechlorination of 2 - chloropropionic acid , ( fluka chemical , gillingham , dorset , uk ) neutralised with naoh . results of continuous fermentations of w3110 ฮดrecj ( pspr10 ) and w3110 ฮดrecj ( pspr11 . 1 ) are shown in fig5 . they show dehalogenase activities ( units / ml ) for fermentations of e . coli strains w3110 ฮดrecj ( pspr10 ) โด and w3110 ฮดrecj ( pspr11 . 1 ) ๎ข growing in jv1 medium , modified as described . the cultures were switched from batch to continuous operation , with dilution rate of 0 . 1 h - 1 , at approx 40 hrs . it can clearly be seen that the strain with pspr11 . 1 , containing 2 copies of the dehalogenase expression cassette , has much greater stability than the strain with plasmid pspr10 , which has only a single copy of the expression cassette . it is clear that although the peak enzyme activity is reduced the overall productivity of the fermentation is greatly enhanced . appendix______________________________________fermentation medium ( jv1 ) ______________________________________k . sub . 2 so . sub . 4 2 g / l mgso . sub . 4 . 7h . sub . 2 o 1 . 5 g / l h . sub . 3 po . sub . 4 ( 85 %) 0 . 14 ml / l cacl . sub . 2 . 2h . sub . 2 o 0 . 11 g / l trace elements solution 1 ml / l yeast autolysate ( biospringer , low salt , 20 g / l grade d ,) thiamine hcl ( sigma chemicals , uk 0 . 5 ml / l 32 g / l sterile stock ) tetracycline hydrochloride ( sigma chemicals , uk 0 . 15 ml / l 67 mg / ml sterile stock ) ______________________________________ trace element solution contained 0 . 2 g / l alcl 3 . 6h 2 o , 0 . 08 g / l cocl 2 . 6h 2 o , 0 . 02 g / l cucl 2 . 2h 2 o , 0 . 01 g / l h 3 bo 4 , 0 . 2 g / l ki , 0 . 5 g / l mnso 4 . h 2 o , 0 . 01 g / l niso 4 . 6h 2 o , 0 . 5 g / l na 2 mo 4 . 2h 2 o , 0 . 5 g / l znso 4 . 7h 4 o . all chemicals were of &# 34 ; ar &# 34 ; grade and obtained from fisons ( loughbrough , uk ) unless otherwise stated . sterilisation was carried out at 121 ยฐ c . for 30 m . thiamine , trace elements and tetracycline solutions were filter sterilised through a 0 . 2 ฮผm filter and added aseptically . 1 . sambrook , j ., e . f . fritsch and t . maniatis . 1989 . molecular cloning , a laboratory manual . cold spring harbor laboratory press , new york . 2 . hanahan , d . 1985 . techniques for transformation of escherichia coli . in : dna cloning vol , a practical approach ( ed : d . m . g . glover ) pp 109 - 135 . irl press , oxford . 3 . twigg , a . t . and d . sherratt . 1980 . trans - complementable copy number mutants of plasmid cole1 . nature 283 pp 216 - 218 . 4 . kellet , l . e ., d . m . poole , l . m . a . ferreira , a . j . durrant , g . p . hazelwood and h . j . gilbert . 1990 . xylanase b and an arabinofuranosidase from pseudomonas fluorescens subsp . cellulosa contain identical cellulose - binding domains and are encoded by adjacent genes . biochem j 272 pp 369 - 376 . 5 . gold , l . and stormo , g . d ., 1990 . high level translation initiation . methods in enzymology 185 p 89 - 103 . 6 . barth , p . t ., bolton , l ., and thomson j . c ., 1992 . cloning and partial sequencing of an operon encoding two pseudomonas putida haloalkanoate dehalogenases of opposite stereospecificity . journal of bacteriology 174 , p 2612 - 2619 . 7 . de lorenzo , v ., herrero , m ., jakubzik , u . and timmis , k . n . 1990 . mini - t - 5 transposon derivatives for insertion mutagensis , promoter probing and chromosomal insertion of cloned dna in gram negative eubacteria . journal of bacteriology . 172 p 6568 - 6571 . 8 . miller , j . h . 1972 . in : experiments in molecular genetics , pp 201 - 205 . cold spring harbor laboratory , new york . __________________________________________________________________________ # sequence listing - - - - & lt ; 160 & gt ; number of seq id nos : 5 - - & lt ; 210 & gt ; seq id no 1 & lt ; 211 & gt ; length : 10 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : oligonucleotide - - & lt ; 400 & gt ; sequence : 1 - - ggccctgcag - # - #- # 10 - - - - & lt ; 210 & gt ; seq id no 2 & lt ; 211 & gt ; length : 29 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : primer - - & lt ; 400 & gt ; sequence : 2 - - ctggatcccg gcgttttcag gctttgctc - # - # 29 - - - - & lt ; 210 & gt ; seq id no 3 & lt ; 211 & gt ; length : 29 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : primer - - & lt ; 400 & gt ; sequence : 3 - - acagatcttc accgaccaca ataatccgc - # - # 29 - - - - & lt ; 210 & gt ; seq id no 4 & lt ; 211 & gt ; length : 28 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : primer - - & lt ; 400 & gt ; sequence : 4 - - acagatcttg accctgtgcg agaaactg - # - # 28 - - - - & lt ; 210 & gt ; seq id no 5 & lt ; 211 & gt ; length : 29 & lt ; 212 & gt ; type : dna & lt ; 213 & gt ; organism : artificial sequence & lt ; 220 & gt ; feature : & lt ; 223 & gt ; other information : description of artificial - # sequence : primer - - & lt ; 400 & gt ; sequence : 5 - - tgggatccgc tcggcgttta cttcttcca - # - # 29__________________________________________________________________________ | 2 |
referring to the drawings and , in particular , to fig1 there is shown a checkered game board 10 consisting of alternating squares which are bilaterally colored , as indicated . the board has fourteen rows of squares and fourteen columns of squares , as indicated . in the drawing , the rows are numbered by arabic numerals and the columns by roman numerals . these numbers are used in the drawing strictly as coordinates for describing the movement of the playing pieces and would not ordinarily be on the playing board itself . the peripheral area of the board has the squares 11 colored black as indicated and alternating squares 12 colored white . at the center of the board is a discrete playing area marked by border 13 of a suitable distinguishing color . within the border 13 , the playing squares are of a different color . the colored squares are blue as indicated at 14 while the alternating squares 15 are white . on one side of the board a target area is provided which is marked by a boundary line 16 of distinctive color which surrounds playing squares 17 and 18 , located at coordinates 1 - vii and 1 - viii respectively . likewise , on the other side of the board is a target area marked by boundary line 19 surrounding squares 20 and 21 , located at coordinates 14 - vii and 14 - viii , respectively . a complete set of the playing pieces and their initial position on the playing board is shown in fig1 . the playing pieces consist of 20 of the basic pieces 22 , which may be called checkers , soldiers , pawns , or the like . for convenience , this description we will use chess terminology and refer to the pieces 22 as pawns . there are provided two bishops 23 and two knights 24 . an identical set of pieces arranged as shown is positioned on the opposite side of the board and differs only in color from the other set . the playing pieces will ordinarily be black and white as in a conventional chess set , although any other suitable contrasting colors could be used for the playing pieces of the opposing sides . in the playing area surrounded by borderline 13 , which is called the sea , there are provided a plurality of hollow pieces 25 which are small boats , located in row 5 and a single large boat 26 , located in row 4 . these boats are for transport of one or more of the playing pieces initially located in rows 1 , 2 and 3 , across the sea . boats 25 will accepted only one of the playing pieces while boat 26 will accept up to three of the playing pieces of the same or different kind . a similar set of small boats of opposite color are initally positioned in row 10 and a single large boat of opposite color is initially positioned in row 11 . the boats are not capable of independent movement but may be moved only when occupied by a playing piece of the same color . the large boat 26 likewise is not capable of independent movement but may be moved in accordance with the movement characteristics of any or all of the pieces of the small color occupying said boat . initially , large boat 26 occupies the squares at coordinates 4 - vii and 4 - viii . on the first move of large boat 26 it may move from either of the squares on which it sits , but subsequent moves are from a single square . in fig2 to 6 of the drawing , there are shown detail views of the playing pieces of the boats . one of the pawns 22 is shown in fig2 . one of the bishops 23 is shown in fig3 . one of the knights 24 is shown in fig4 . a small boat 25 is shown in fig5 . one of the large boats 26 is shown in fig6 . in these drawings , it is seen that the playing pieces are of square cross - section and fit into a square recess in small boat 25 for movement across the water area . the interior of large boat 26 is a rectangular recess which will accommodate up to three of the playing pieces . movement of the various pieces , including the boats , is illustrated in fig7 to 10 . in fig7 movement of the pawns 22 is illustrated . the pawns 22 may move forwardly or laterally in a straight line or forwardly on a diagonal line one square at a time . thus , in fig7 the pawn shown at square 1 - viii may move to any of squares 1 - vii , 2 - vii , 2 - viii , 2 - ix and 1 - ix . the pawn located at square 4 - iv may cross the boundary line 13 and move into small boat 25 , if desired , provided that boat 25 is unoccupied . in addition , pawns 22 may move forwardly or laterally in a straight line or diagonally in a straight line jumping over one of an adjacent piece ( pawn , knight or bishop ) of the same color to an unoccupied square beyond said piece . this movement may be continued as long as there are pieces to jump an unoccupied squares beyond the piece being jumped . these jumping moves may be made in a straight line direction along a row or column of squares or on the diagonal along squares of the same color . these jumping moves are also illustrated in fig7 . the pawn located at square 2 - vi may jump over square 3 - vii to enter the large boat at square 4 - viii . it should be noted that pieces may enter large boat 26 by entry of either of the squares 4 - vii or 4 - viii . pawn 22 on square 1 - vi could jump to square 3 - vi as indicated and could continue by jumping laterally to square 3 - viii . pawn 22 at square 1 - vi could likewise jump to square 3 - iv and thence jump over square 4 - iv to enter boat 25 on square 5 - iv , provided that boat 25 is unoccupied . when one of the pawns 22 is occupying one of the boats 25 , the boat containing the pawn may then move according to the rules for movement of the pawn on land , i . e . the black and white squares of the board , with the additional proviso that a boat 25 occupied by a pawn 22 may also move backward in a straight line or diagonally . this backward movement is forbidden to the pawns when moving on land , i . e . the black and white squares . the movement of the knights 26 is in accordance with the movement of the knight of the game of chess . thus , the knight 26 which is initially located on square 1 - viii may be moved initially to squares 2 - vi , 3 - vii , 2 - x , or 3 - ix . the movement of the knight 26 initially positioned on sqaure 1 - vii could be to any of the squares 2 - v , 3 - vi , 3 - viii or 2 - ix . the circles shown on squares 3 - vi and 3 - vii illustrate a first round move of the knights 26 to those positions . a second move of those knights would allow them to enter one or more of the boats . thus , one of the knights 26 moved to square 3 - vii could , on its second move , enter boat 25 on square 5 - vi , as indicated . likewise , a knight 26 moved on the first round to square 3 - vi could , on the second move , enter the large boat 26 at square 4 - viii . the movement of the bishops 23 is in accordance with the move of the bishop at the game of chess , i . e ., on the diagonal to an unobstructed destination . the bishop may not jump over any intervening piece in its move , whether such piece be of its own color or of the opposing color . the move of the bishop is illustrated in fig9 . a bishop located at the square 1 - vi may move diagonally to square 3 - iv or to square 4 - ix . likewise , the bishop located at 1 - ix may move to square 4 - vi . at this point the move of the bishop differs slightly from the game of chess . the bishop may move diagonally but must stop on the square adjacent the boundary line 13 surrounding the sea area ( blue and white squares ) of the board before entering an empty boat 25 . in the move illustrated , the bishop 23 would move to square 4 - vi on the initial move and on a subsequent move could enter an empty boat 25 located on square 5 - v . in fig1 , the movement of the small boats 25 and the large boat 26 is illustrated . in the position shown , small boat 25 , containing pawn 22 , is located on square 5 - iv and may make a first round move to square 6 - iv or 6 - v , or may jump over the boat containing bishop 23 on square 5 - v to empty square 5 - vi . this latter move would not be permissible if boat 25 on square 5 - v were unoccupied . on square 9 - vi there is shown a boat 25 containing a pawn 26 , for purposes of illustrating movement toward the central portion of the sea ( blue and white ) area . the boat , containing a pawn , may move one square in any straight line or diagonal direction , forward or backward , as shown by the arrows . the boat and pawn could therefore move to any of squares 10 - v , 10 - vi , 10 - vii , 9 - v , 9 - vii , 8 - v , 8 - vi or 8 - vii , provided that those squares are unoccupied . the boat 25 containing pawn 22 may also move by jumping over a boat which is occupied by a playing piece to a square which is unoccupied on the other side of such boat . this move may be on a straight line or on a diagonal line and the piece and boat may continue to move by jumping movement as long as there are alternant squares which are occupied and unoccupied to allow for such movement . movement of a boat 25 containing a bishop 23 is on the diagonal as indicated by the dotted line and arrow . the boat 25 containing bishop 23 on square 5 - v could move to square 10 - x , provided that the intervening path is unoccupied . a boat 25 containing one of the knights 26 would move similarly in accordance with the moves permitted to the knight . the movement of large boat 26 is in accordance with the rules for movement of any or all of the pieces contained in that boat . the initial move of the boat may be made from either of the two squares which it occupies , i . e ., 4 - vii and 4 - viii . the move can be from either of these squares in accordance with the moves of the occupying pieces . the maximum utilization of large boat 26 in the game requires that is be occupied by one of each kind of playing piece , i . e ., pawn , bishop , and knight . when occupied by all three types of playing pieces , boat 26 may move forward , backward or laterally according to the simple unobstructed moves of the knight or bishop or may move by jumping over the adjacent pieces to unoccupied squares on the other side of such piece in accordance with the moves of the pawn . up to this point , the moves of the pieces have been described in situations where opposing pieces are not encountered . it is therefore necessary to consider the rules of the game as applied to the capture of opposing pieces . when moving in the land area ( black and white squares ) the bishop 23 and the knight 24 capture pieces of opposite color by movement onto the square occupied by such piece . moves which involve capture of an opposing piece are not compulsory as at checkers . capture of an opposing piece by one of the pawns 22 is by a jumping move , as at the game of checkers , although the pieces may make the jumping moves in either a straight line forward or laterally or diagonally . when a piece is captured by a pawn jumping over it or by movement of a knight or bishop onto the square where such piece is located , such opposing piece is removed from the board . in the sea area ( blue and white squares ) enlcosed by boundary 13 , offensive action occurs only between boats 25 and 26 of opposing color when moving according to the moves of the pieces located in such boat . a boat moving according to moves of a bishop or a knight may capture a boat of opposite color by occupying the square on which such boat is located . a boat containing a pawn and moving according to the moves of a pawn may capture a boat of opposing color ( containing a piece of the opposing color ) by jumping over that boat to an unoccupied square on the other side . pieces located in boats in the sea area ( blue and white squares ) may not be attacked by pieces moving from the land area ( black and white squares ) with one exception . if a pawn enters an empty boat 25 or 26 from the land area by jumping over a boat containing a piece of the opposite color , the piece so jumped and the boat containing it are considered captured and removed from the board . pieces in the various boats moving in the sea area ( blue and white area ) may move to land in accordance with the movement of those pieces . pieces being carried in the boats may therfore make attacking moves against opposing pieces on the adjacent land but may not be attacked from land with the exception noted above for a pawn entering an empty boat . the objective of the game is to enter the opposing side of the board and occupy the target area enclosed by boundary line 19 or boundary line 16 , respectively . attempts to reach the target area may be by way of the land areas ( black and white areas ) on either side of the sea area ( blue and white areas ) or may be across the sea carried on the boats 25 and 26 . it should be noted that in attacking the opponent &# 39 ; s target area , the attacking pieces may capture pieces located inside the target area by the normal moves made by the attacking pieces . once an attacking piece is positioned inside the target area , it is immune from capture by the opponent &# 39 ; s pieces . such a piece may take offensive action and capture opponent &# 39 ; s pieces outside the target area , but in such case , the piece moving out of the target area would lose its immunity from capture . the game ends when one side has two of its pieces of any category , occupying the target area on the other side of the b chinese checkers , and chess with additional strategic concepts introduced by the boats which carry pieces across the sea area ( blue and white squares ). the game , as described , uses black and white squares for the land areas around the periphery of the board and blue and white squares for the sea area in the central portion of the board . other colors could obviously be used for distinguishing these separate areas so long as the sea area is distinguished in color from the surrounding land area . the individual pieces may be black for one side and white for the other or any other suitable colors pairs , i . e ., black and red , red and white , etc . the boats generally are of a shape fitting closely the shape of the pieces which they carry . the pieces are shown as having square bases , but could have round bases or bases of other shapes if desired , provided if the boats were made to accomodate . the pieces may be manufactured of wood , metal , plastic , paper mache , plaster , or any other suitable material of construction . the board is shown as one having fourteen rows and fourteen columns of squares of alternating color . the sea area is six squares in one direction by eight squares in the other direction with projecting areas for the initial positioning of the large boats . these areas could obviously be changed and the board made larger or smaller without varying the basic concept of the game . it should be obvious therefore to those skilled in the art that this invention does not have to be constructed precisely as described above and it should be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described . | 0 |
referring to fig3 , which shows schematically an overview of an example of a method according to the present invention , an original input image 11 is filtered by a low pass filter 12 which effectively removes the sharp or high frequency component of the input image 11 to leave an unsharp or low frequency image . this unsharp image is subtracted from the original image 11 in a summer 13 , which therefore outputs the high frequency component . the high frequency component is multiplied with a gain factor obtained from a gain calculator 14 in an amplifier 15 . the amplified high frequency component of the image is then added back to the original input image 11 in a second summer 16 , which outputs the enhanced image 17 . the gain that is provided by the gain calculator 14 is varied in the preferred embodiment , as will be discussed further below . in adaptive contrast enhancement , mathematically the enhanced or output image y ( m , n ) is obtained from the input image x ( m , n ) as : where m is the row number and n is the column number of the pixels , ฮผ ( m , n ) is the local mean of brightness levels , and g ( m , n ) is the enhancement gain ( calculated by the gain calculator 14 ). the preferred embodiments use a locally adaptive non - linear filter to find the local mean ฮผ ( m , n ) at each pixel . the filter can be regarded as a geometric averager of the brightness levels of the pixels . the use of such a filter introduces a phase - shift in the filtered output . accordingly , in the preferred embodiment , two filters are used . the first filter runs horizontally along a single row of pixels in a first direction , from left to right , and is referred to herein as the forward filter which outputs ฮผf ( m , n ). the second filter runs in the opposite direction , from right to left horizontally along a single row of pixels , and is referred to herein as the backward filter which outputs ฮผb ( m , n ). the local mean ฮผ ( m , n ) that is used in the enhancement algorithm is given by the average of the outputs of the two filters , i . e . the forward and backward filters that are used are each recursive infinite impulse response ( iir ) filters . a โ recursive โ filter is one that uses recursion , i . e . the present value of the output signal is dependent on at least one previously calculated value of the output signal . an iir filter has an impulse response that is non - zero over an infinite length of time , which is in contrast to finite impulse response ( fir ) filters which have impulse responses of finite duration . in the preferred embodiment , the input - output relationship for the forward filtered ฮผf ( m , n ) is : and the input - output relationship for the backward filtered ฮผ b ( m , n ) is : as can be seen , for each filter the local mean ฮผf ( m , n ) or ฮผb ( m , n ) at a pixel is dependent on the local mean at a previous pixel ( i . e . ฮผf ( m , n โ 1 ) and ฮผb ( m , n + 1 ) respectively ) as well as the brightness level x ( m , n ) at the current pixel . ( clearly , if attempting to filter the first pixels at the leftmost and rightmost ends of the row of pixels , there is no local mean at a previous pixel to be used in the recursive filters . this can be handled in a number of ways . in one example , the filtering begins at the second pixel from the left of a row for the forward filter and second pixel from the right of the row for the backward filter . in each case , the value that is used for the local mean at the previous pixel in the recursion equations ( 3 ) and ( 4 ) for these second pixels at the left and right of the row is the original brightness level of the first pixels respectively at the left and right of the row .) in these filter relationships , ฮป ( m , n ) is the delay coefficient . as can be seen , each filter has a single pole , namely the delay coefficient ฮป ( m , n ). as will be discussed further below , this makes the filtering process computationally efficient . in order to achieve adaptive contrast enhancement , the delay coefficient ฮป ( m , n ) is adapted at each pixel to edge information , or information about other areas of high contrast , in the input image 11 . given that ฮป ( m , n ) is effectively the weight of the previous output , a higher value of ฮป ( m , n ) increases the low - pass characteristic of the filter . accordingly , when an edge is encountered , ฮป ( m , n ) should be decreased so that the edge will be preserved in the output . for the backward filter . as will be appreciated , these edge signals are the differences between the original pixel value and the previous filter output . using these edge signals , ฮป ( m , n ) for the forward filter is obtained in one example using : ฮป โก ( m , n ) = [ 1 - ๏ ฮผ f โก ( m , n - 1 ) - x โก ( m , n ) ๏ l ] ฮฑ ( 7 ) here , l can be any constant integer up to the maximum possible pixel value less 1 , i . e . up to the number of brightness levels available in the input image less 1 . in an example , the number of brightness levels available in the input image is 256 , so in principle l may be set as any integer up to 255 , with a high value ( such as 255 ) being preferred . preferred values for ฮฑ are in the range of 5 to 9 , with 7 being found to provide particularly good results . as will be seen from an inspection of equations ( 7 ) and ( 8 ), strong edges reduce ฮป ( m , n ) such that the low - pass characteristic of the filter at that location is reduced . the operation of the two filters is shown schematically in fig4 . in particular , there is shown a row of pixels 20 . the forward filter 21 passes along the row 20 in a first direction , from left to right . the backward filter 22 passes in the opposite direction along the row 20 from right to left . a ฮป look - up table 23 provides the required values of ฮป at each pixel location . an averager 24 outputs the mean of the outputs of the forward and backward filters 21 , 22 . thus , the output image can be seen as the sum of the input image ( the first term in equation ( 9 )) and the amplified high - pass filtered original image ( the second term in equation ( 9 )). the fact that the second term in equation ( 9 ) is the high - pass filtered original image can be seen from the fact that it is the difference between the original image and the low - pass filtered image . the frequency response of the high - pass filter generating the second term in equation ( 9 ) is : a plot of equation ( 10 ) is shown in fig5 . as can be seen , the gain of the high - pass filter is approximately constant after some frequency threshold . accordingly , not only are high frequencies being enhanced , but mid - range frequencies are also enhanced and with substantially the same magnitude . this increases the visual quality of the enhanced image because details that have their energy in the mid - range of the frequency spectrum are enhanced as well as the high frequency details . it can also be seen that the magnitude of the frequency response decreases with decreasing ฮป . since ฮป is a function of the edge signal , this demonstrates that the high - pass filter adapts itself to edges by reducing its magnitude . from equation ( 9 ), it can be seen that enhancement in the locality of edges decreases because the magnitude of the enhancement signal decreases accordingly . this adaptive behaviour allows the preferred contrast enhancement method to successfully avoid so - called over / under shooting artefacts . by way of comparison , fig5 also shows the corresponding plot in dashed lines for a laplacian filter , which has three taps {โ 1 , 2 , โ 1 }. as can be seen in fig5 , the laplacian filter emphasises the high frequency components . broadly speaking , the gain at high frequencies is about twice that at the mid - range frequencies . this causes two problems , namely noise sensitivity in the mid - range and over / under shooting around edges . a laplacian filter also requires complex computation , as mentioned above . in the above discussion , reference has been made principally to filtering in a forward and a backward direction along rows of pixels in the input image 11 . the filtering may however be carried out by filtering in a forward and backward direction ( i . e . up and down ) columns of pixels in the input image 11 . in the most preferred embodiment , filtering is carried out by two filters operating in opposite directions along the rows of pixels and by two filters operating in opposite directions along the columns of pixels . in the preferred embodiment , the gain that is used to amplify the high frequency component is calculated by the gain calculator 14 in dependence on the original brightness level at the pixel and the magnitude of the difference between the local mean and the original pixel brightness level . the original pixel brightness level determines the maximum gain that can be applied to the current pixel . the end user or system designer can select a gain within this range of possible gains . the maximum gain that can be used in enhancing is chosen by comparing the pixel value to two thresholds . the larger threshold , maxsatlev , is chosen such that enhanced version of the pixel brightness level is less likely to saturate to the maximum available brightness level . the smaller threshold , minsatlev , is chosen such that the enhanced version of the pixel brightness level is less likely to saturate to zero . given the maximum gain that can be used to enhance the high - frequency component , a user - selected maximum gain from the range of possible gains is used . this user - selected maximum gain is used to modulate a gain function . this gain function is a function of the magnitude of the difference between the local mean and the original pixel brightness level . if ( mdiff & lt ; a ) gain = 0 ; elseif ( mdiff & lt ; b ) gain = k ( cos ( ฯ + ฯ / 2 . ( mdiff โ a )/( b โ a ))+ 1 ); elseif ( mdiff & lt ; c ) gain = kcos ( ฯ / 2 . ( mdiff โ b )/( c โ b )); else gain = 0 ; end , where k is the user - selected maximum gain , a , b , c are constants to be chosen by the designer , and mdiff is the magnitude of the difference . in one particular example , a = 1 , b = 7 , c = 21 and k = 1 . this particular example is shown schematically in fig6 . when mdiff is in the range [ a , b ], the gain function in the preferred embodiment is derived from a cosine that is evaluated in the 3rd quadrant . this produces a convex function , which better avoids noise enhancement by first slowly increasing and then rapidly increasing to the maximum user selected gain ( i . e . k ). when mdiff is in the range [ b , c ], the function is derived from a cosine that is evaluated in the 1st quadrant . this produces a concave function , which better enhances the medium level frequency components in the image by first slowly decreasing and then rapidly decreasing to zero to avoid saturation . it should be noted that the gain function can be any function with similar characteristics , namely : zero when the magnitude of the difference is less than some threshold , and again zero when the magnitude of the difference is greater than some threshold . the first condition ensures the preservation of smooth regions in the image . the second condition avoids saturation . the computational complexity of the preferred method is extremely low because at each given pixel , two single pole iir filters are used . the delay coefficient ฮป of the filter does not have to be computed as such since ฮป is determined by equations ( 7 ) and ( 8 ) and the edge signal that is input to this function is always an integer ( in this example between zero and 255 ). accordingly , for both ฮป and the enhancement gain , respective look - up tables can be used . in a particular example , the total number of computations required per pixel , including the computation of the indices of the look - up tables , is two multiplications , six additions and one bit shift . this provides low computational complexity , which means that the method can be carried out quickly and / or in relatively low cost equipment . this makes the method particularly attractive for use in consumer equipment , such as television sets , computer displays , etc . the memory requirements are also low , being 256 bytes for the ฮป look - up table , c bytes ( 21 in the example mentioned above ) for the enhancement gain look - up table , one line store for the output of the forward filter and an additional single register for the output of the backward filter . the present contrast enhancement method may be used prior to resizing of an image , particularly prior to zooming in on the image , so that edges will look sharper than otherwise . this is because the edges are enhanced prior to the resizing of the image . the method may be used to blur an image , for example so as to give depth perception to the image or before shrinking the image . embodiments of the present invention have been described with particular reference to the examples illustrated . however , it will be appreciated that variations and modifications may be made to the examples described within the scope of the present invention . | 7 |
according to the present invention , certain styryl sulfone derivatives affect the mapk signal transduction pathway , thereby affecting tumor cell growth and viability . the compounds inhibit the growth and proliferation of breast and prostate tumor cells in a dose - dependent manner , without affecting normal cell growth . this cell growth inhibition is associated with regulation of the erk and jnk types of mapk . the ability of the styryl sulfones to regulate these mapks and induce cell growth arrest is dictated by the nature and position of the functional groups present in the compound . treatment of breast and prostate tumor cells with the styryl sulfone compounds of the invention leads to inhibition of cell proliferation and induction of apoptotic cell death . the effect is observed for estrogen receptor ( er ) positive as well as estrogen receptor negative cells , although once breast cancer cell line tested , cell line 361 , showed considerable resistance to styryl sulfones . inhibition of cell proliferation and induction of apoptotic cell death is also observed for androgen - dependent as well as androgen - independent prostate tumor cells , although the former are considerably more sensitive to the styryl sulfones . tumor cells treated with the compounds of the invention accumulate in the g2 / m phase of the cell cycle . as the cells exit the g2 / m phase , they appear to undergo apoptosis . treatment of normal cells with the styryl sulfones fails to produce a similar effect on cell cycle progression . normal cells exhibit normal cell cycle progression in the presence and absence of styryl sulfone drug . both cells treated with the styryl sulfone compounds of the invention and untreated cells exhibit similar levels of intracellular erk - 2 , but the biochemical activity of erk - 2 as judged by its ability to phosphorylate the substrate myelin basic protein ( mbp ), is considerably diminished in drug - treated cell compared to untreated cells , in prostate tumor cells . fr - 20 , a preferred compound of the invention , reduced the phosphorylation status of mbp by more than 80 % compared to mock - treated cells . western blot analysis of the drug and mock - treated cell lysates with erk - 2 antibody shows the same amount of protein in both lysates , indicating that higher levels of phosphorylated mbp in mock treated cells was not due to an unequal quantity of erk - 2 protein in the lysates . these results suggest that the styryl sulfones of the present invention block the phosphorylating capacity of erk - 2 . the styryl sulfones of the present invention enhance the ability of jnk to phosphorylate c - jun protein compared to mock - treated cells . without wishing to be bound by any theory , this result suggests that the styryl sulfones may be acting like pro - inflammatory cytokines or uv light , activating the jnk pathway , which in turn may switch on genes responsible for cell growth inhibition and apoptosis . the compounds of the invention are characterized by cis - trans isomerism resulting from the presence of one or more double bonds . the compounds are named according to the cahn - ingold - prelog system , the iupac 1974 recommendations , section e : stereochemistry , in nomenclature of organic chemistry , pergamon , elmsford . n . y . 1979 ( the โ blue book โ). see also , march , advanced organic chemistry , john wiley & amp ; sons . inc ., new york , n . y ., 4th ed ., 1992 . p . 127 - 138 . stearic relations around a double bond are designated as โ z โ or โ e โ. ( e )- styryl and benzyl sulfones are prepared by knoevenagel condensation of aromatic aldehyde with active methylene molecules such as aryl , benzyl , styryl sulfonyl acetic acids , phenacyl aryl sulfones and sulfonyl diacetic acid . the procedure is described by reddy et al ., acta . chim . hung . 115 : 269 ( 1984 ); reddy et al ., sulfur letters 13 : 83 ( 1999 ); reddy et al ., synthesis 322 ( 1984 ); and reddy et al ., sulfur letters 7 : 43 ( 1987 ), the entire disclosures of which are incorporated herein by reference . ( z )- benzyl and ( z )- styryl sulfones are synthesized by the nucleophilic addition of aromatic and aliphatic thiols to phenyl acetylene , and subsequent oxidation of the product with 30 % hydrogen peroxide . aryl and benzylsulfonyl acetic acids are the starting compounds for the synthesis of ( e )- styryl aryl and ( e )- styryl benzyl sulfones . arylsulfonyl acetic acids may be prepared by the condensation of sodium aryl sulfinate with chloroacetic acid at alkaline ph . an alternate method for the synthesis of same compounds involves oxidizing the products obtained by the condensation of sodium arylthiolate with chloroacetic acid . benzylsulfonyl acetic acids may be synthesized by 30 % hydrogen peroxide oxidation of the condensation products of the condensation of benzyl chlorides with sodium thioglycollate . alternatively , benzylsulfonyl acetic acids may be synthesized by 30 % hydrogen peroxide oxidation of the products of the condensation of sodium salts of benzyl thiols with chloroacetic acids . to prepare the ( e )- styryl benzyl and ( e )- styryl benzyl sulfones , a mixture of the appropriate sulfonylacetic acid ( e . g ., 10 mmol ), an aromatic aldehyde ( e . g ., 10 mmol ) and a catalytic amount of benzylamine in acetic acid ( e . g ., 15 ml ) is refluxed for 2 - 3 hours . after cooling , dry ether is added and the reaction mixture is refrigerated overnight . the ethereal solution is washed successively with a saturated solution of sodium hydrogen carbonate , sodium bisulfite , dilute hydrochloric acid and finally with water . evaporation of the sodium sulfate dried ethereal solution gives solid products of ( e )- styryl aryl or benzyl sulfones which may be recrystallized with 2 - propanol or 95 % ethanol . ( z )- styryl aryl and ( z )- styryl benzyl sulfones may be prepared by the addition of sodium arylthiolate or benzylthiolate prepared from appropriate thiol ( e . g ., 10 mmol ) and sodium hydroxide ( e . g ., 20 mmol ) to freshly distilled phenylacetylene in methanol . the mixture is refluxed for 24 hours and poured onto crushed ice . the ( z )- styryl aryl and ( z )- styryl benzyl sulfides are oxidized with 30 % hydrogen peroxide to provide ( z )- styryl aryl and ( z )- styryl benzyl sulfones , respectively . ( e ),( e )- bis ( styryl ) sulfones may be prepared by the condensation of sulfonyl diacetic acid with aromatic aldehydes in the presence of benzylamine as catalyst . the reaction mixture is refluxed for 2 hours in glacial acetic acid . after cooling , absolute ether is added to the reaction mixture , which is washed successively with saturated solution of sodium bicarbonate sodium bisulfite , dilute hydrochloric acid and water . evaporation of the dried etherial layer yields ( e ),( e )- bis ( styryl ) sulfones . ( z ),( e )- bis ( styryl ) sulfones may be prepared by mixing a solution of ( z )- styrylsulfonyl acetic acid in glacial acetic acid with araldehyde and benzylamine . the solution is boiled for 3 hours . the reaction mixture is cooled and dry ether is added . any product separated is filtered . the filtrate is diluted with more ether and washed with saturated solution of sodium hydrogen carbonate , sodium bisulfite , dilute hydrochloric acid and water . the ether layer is separated , dried and evaporated to give ( z ),( e )- bis ( styryl ) sulfones . the styryl sulfones of the invention may be administered in the form of a pharmaceutical composition , in combination with a pharmaceutically acceptable carrier . the active ingredient in such formulations may comprise from 0 . 1 to 99 . 99 weight percent . by โ pharmaceutically acceptable carrier โ is meant any carrier , diluent or excipient which is compatible with the other ingredients of the formulation and to deleterious to the recipient . the compounds of the invention may be administered to individuals ( mammals , including animals and humans ) afflicted with breast or prostate cancer . the compounds may be administered by any route , including oral and parenteral administration . parenteral administration includes , for example , intravenous , intramuscular , intraarterial , intraperitoneal , intranasal , rectal , or subcutaneous administration . the active agent is preferably administered with a pharmaceutically acceptable carrier selected on the basis of the selected route of administration and standard pharmaceutical practice . the active agent may be formulated into dosage forms according to standard practices in the field of pharmaceutical preparations . see gennaro alphonso , ed ., remington &# 39 ; s pharmaceutical sciences , 18th ed ., ( 1990 ) mack publishing co ., easton , pa . suitable dosage forms may comprise , for example , tablets , capsules , solutions , parenteral solutions , troches , suppositories , or suspensions . for parenteral administration , the active agent may be mixed with a suitable carrier or diluent such as water , an oil , saline solution , aqueous dextrose ( glucose ) and related sugar solutions , or a glycol such as propylene glycol or polyethylene glycol . solutions for parenteral administration preferably contain a water soluble salt of the active agent . stabilizing agents , antioxidizing agents and preservatives may also be added . suitable antioxidizing agents include sulfite , ascorbic acid , citric acid and its salts , and sodium edta . suitable preservatives include benzalkonium chloride , methyl - or propyl - paraben , and chlorbutanol . for oral administration , the active agent may be combined with one or more solid inactive ingredients for the preparation of tablets , capsules , or other suitable oral dosage forms . for example , the active agent may be combined with carboxymethylcellulose calcium , magnesium stearate , mannitol and starch , and then formed into tablets by conventional tableting methods . the specific dose of compound according to the invention to obtain therapeutic benefit will , of course , be determined by the particular circumstances of the individual patient including , the size , weight , age and sex of the patient , the nature and stage of the disease , the aggressiveness of the disease , and the route of administration . for example , a daily dosage of from about 0 . 05 to about 50 mg / kg / day may be utilized . higher or lower doses are also contemplated . the practice of the invention is illustrated by the following non - limiting examples . to a solution of ( 8 g , 0 . 2 mol ) sodium hydroxide in methanol ( 200 ml ), appropriate thiophenol or benzyl mercaptan ( 0 . 1 mol ) is added slowly . then chloroacetic acid ( 0 . 1 mol ) is added in portions and the reaction mixture is refluxed for 2 - 3 hours . the cooled contents are poured onto crushed ice and neutralized with dilute hydrochloric acid ( 200 ml ). the resulting aryl and benzylthioacetic acids ( 0 . 1 mol ) are subjected to oxidation with 30 % hydrogen peroxide ( 0 . 12 mol ) in glacial acetic acid ( 25 ml ) by refluxing for 1 - 2 hours . the contents are cooled and poured onto crushed ice . the separated solid is recrystallized from hot water to give pure aryl and benzylsulfonyl acetic acids . a mixture of the appropriate aryl or benzylsulfonyl acetic acid ( 0 . 001 mol ), an aromatic aldehyde ( 0 . 001 mol ) and benzylamine ( 1 ml ) in glacial acetic acid ( 15 ml ) is reflexed for 2 - 3 hours . the contents are cooled and treated with dry ether ( 50 ml ). any product separated is collected by filtration . the filtrate is diluted with more ether and washed successively with a saturated solution of sodium bicarbonate ( 20 ml ), sodium bisulfite ( 20 ml ), dilute hydrochloric acid ( 20 ml ) and finally with water ( 35 ml ). evaporation of the dried ethereal layer yields a solid in many cases . however , in some cases a syrupy material separates and is solidified on treatment with 2 - propanol . the purity of the compounds is checked by tlc ( silica gel bdh , hexane / ethyl acetate 3 : 1 ). to freshly distilled phenyl acetylene ( 51 . 07 g , 0 . 5 mol ) is added sodium thioglycollate prepared from thioglycolic acid ( 46 g , 0 . 5 mol ) and sodium hydroxide ( 40 g , 1 mol ) in methanol ( 250 ml ). the mixture is refluxed for 24 hours and poured onto crushed ice ( 500 ml ) after cooling . the styrylthioacetic acid , formed after neutralization with dilute hydrochloric acid ( 250 ml ), is filtered and dried ; yield 88 g ( 90 %); m . p . 84 - 86 ยฐ c . the styrylthioacetic acid is then oxidized to styrylsulfonylacetic acid as follows . a mixture of styrylthioacetic acid ( 5 g , 25 mmol ) in glacial acetic acid ( 35 ml ) and 30 % hydrogen peroxide ( 15 ml ) is heated under reflux for 60 minutes and the mixture is poured onto crushed ice ( 200 ml ) after cooling . the compound separated is filtered and recrystallized from hot water to give white crystalline flakes of ( z )- styrylsulfonylacetic acid ; yield 2 . 4 g ( 41 %); m . p . 150 - 51 ยฐ c . a solution of ( z )- styrylsulfonylacetic acid ( 2 . 263 g , 10 mmol ) in glacial acetic acid ( 6 ml ) is mixed with an aromatic aldehyde ( 10 mmol ) and benzylamine ( 0 . 2 ml ) and refluxed for 3 hours . the reaction mixture is cooled , treated with dry ether ( 50 ml ), and any product separated is collected by filtration . the filtrate is diluted with more ether and washed successively with a saturated solution of sodium hydrogen carbonate ( 15 ml ), sodium bisulfite ( 15 ml ), dilute hydrochloric acid ( 20 ml ) and finally with water ( 30 ml ). evaporation of the dried ethereal layer yields ( e )( z )- bis ( styryl ) sulfones . ( e ),( e )- bis ( styryl ) sulfones are prepared following the same procedure as described above with exception that sulfonyldiacetic acid is used in place of ( z )- styrylsulfonylacetic acid , and twice the amount of aromatic aldehyde ( 20 mmol ) is used . these compounds are synthesized by two methods which employ different reaction conditions , solvents and catalysts . method 1 : phenacyl aryl sulfones are made by refluxing ฮฑ - bromoacetophenones ( 0 . 05 mol ) and sodium arylsulfinates ( 0 . 05 mol ) in absolute ethanol ( 200 ml ) for 6 - 8 hours . the product which separates on cooling is filtered and washed several times with water to remove sodium bromide . the product is then recrystallized from ethanol : phenacyl - phenyl sulfone , m . p . 90 - 91 ยฐ c . ; phenacyl - p - fluorophenyl sulfone . m . p . 148 - 149 ยฐ c . ; phenacyl - p - bromophenyl sulfone , m . p . 121 - 122 ยฐ c . ; phenacyl - p - methoxyphenyl sulfone . m . p . 104 - 105 ยฐ c . ; p - nitrophenacyl - phenyl sulfone . m . p . 136 - 137 ยฐ c . a solution of phenacyl aryl sulfone ( 0 . 01 mol ) in acetic acid ( 10 ml ) is mixed with an araldehyde ( 0 . 01 mol ) and benzylamine ( 0 . 02 ml ) and refluxed for 3 hours . the solution is cooled and dry ether ( 50 ml ) is added . the ethereal solution is washed successively with dilute hydrochloric acid , aqueous 10 % naoh , saturated nahso 3 solution and water . evaporation of the dried ethereal layer gives a solid product which is purified by recrystallization . method 2 : dry tetrahydrofuran ( 200 ml ) is taken in a 500 ml conical flask flushed with nitrogen . to this , a solution of titanium ( iv ) chloride ( 11 ml , 0 . 01 mol ) in absolute carbon tetrachloride is added dropwise with continuous stirring . the contents of the flask are maintained at โ 20 ยฐ c . throughout the course of the addition . a mixture of phenacyl aryl sulfone ( 0 . 01 mol ) and aromatic aldehyde ( 0 . 01 mol ) is added to the reaction mixture and pyridine ( 4 ml , 0 . 04 mol ) in tetrahydrofuran ( 8 ml ) is added slowly over a period of 1 hour . the contents are stirred for 10 - 12 hours , treated with water ( 50 ml ) and then ether ( 50 ml ) is added . the ethereal layer is separated and washed with 15 ml of saturated solutions of 10 % sodium hydroxide , sodium bisulfite and brine . the evaporation of the dried ethereal layer yields 2 -( arylsuifonyl )- 1 - phenyl - 3 - aryl - 2 propen - 1 - ones . a solution of phenyl sulfonylacetic acid ( 0 . 01 mol ) and benzaidehyde ( 0 . 01 mol ) was subjected to the procedure 1 . the title compound was obtained in 68 - 72 % yield . a solution of phenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 78 - 80 % yield . a solution of phenyl sulfonylacetic acid ( 0 . 01 mol ) and 2 , 4 - dichlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 60 - 65 % yield . a solution of phenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 78 - 80 % yield . a solution of 4 - chlorophenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 70 - 72 % yield . a solution of 4 - chlorophenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - methylbenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 60 - 64 % yield . a solution of 4 - chlorophenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - methoxybenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 68 - 70 % yield . a solution of 4 - chlorophenyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 80 % yield . a solution of benzyl sulfonylacetic acid ( 0 . 01 mol ) and 2 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 72 % yield . a solution of benzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 78 % yield . a solution of 4 - chlorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - fluorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 72 % yield . a solution of 4 - chlorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 80 % yield . a solution of 4 - fluorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - fluorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 73 % yield . a solution of 4 - fluorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 2 . 4 - difluorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 68 % yield . a solution of 4 - bromobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - fluorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 82 % yield . a solution of 4 - bromobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 88 % yield . a solution of 4 - fluorobenzyl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 82 % yield . a solution of 4 - bromobenzylsulfonyl acetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 88 % yield . a solution of 4 - chlorobenzylsulfonyl acetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 1 . the title compound was obtained in 92 % yield . a solution of ( z )- styryl sulfonylacetic acid ( 0 . 01 mol ) and 4 - 4 - fluorobenzaldehyde ( 0 . 01 mol was subjected to procedure 2 . the title compound was obtained in 68 % yield . a solution of ( z )- styryl sulfonylacetic acid ( 0 . 01 mol ) and 4 - bromobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 2 . the title compound was obtained in 70 % yield . a solution of ( z )- styryl sulfonylacetic acid ( 0 . 01 mol ) and 4 - chlorobenzaldehyde ( 0 . 01 mol ) was subjected to procedure 2 . the title compound was obtained in 64 % yield . a solution of phenacyl - 4 - fluorophenyl sulfone ( 0 . 01 mol ) and 4 - fluorobenzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 63 % yield . a solution of phenacyl - 2 - chlorophenyl sulfone ( 0 . 01 mol ) and 2 - fluoro benzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 58 % yield . a solution of phenacyl - 2 - chlorophenyl sulfone ( 0 . 01 mol ) and 4 - bromo benzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 66 % yield . a solution of phenacyl - 4 - chlorophenyl sulfone ( 0 . 01 mol ) and 4 - bromo benzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 60 % yield . a solution of phenacyl - 2 - nitrophenyl sulfone ( 0 . 01 mol ) and 4 - bromo benzaldehyde ( 0 . 01 mol ) was subjected to method 1 of procedure 3 . the title compound was obtained in 56 % yield . the effect of the styryl sulfones on the growth of normal and tumor cells of breast and prostate was examine utilizing four cell lines , nih3t3 , mcf - 7 . bt - 20 and lncap . nih / 3t3 cells represent normal fibroblasts while lncap is an androgen - dependent prostate tumor cell line . mcf - 7 , is an estrogen - responsive breast tumor cell line , while bt - 20 is an estrogen - unresponsive breast tumor cell line . mcf - 7 and bt - 20 were grown in dulbecco &# 39 ; s modified eagle &# 39 ; s medium ( dmem ) containing 10 % fetal bovine serum supplemented with penicillin and streptomycin . lncap were cultured in rpmi with 10 % fetal bovine serum containing penicillin and streptomycin . nih3t3 cells were grown in dmem containing 10 % calf serum supplemented with penicillin and streptomycin . all cell cultures were maintained at 37 ยฐ c . in a humidified atmosphere of 5 % co 2 . cells were treated with test compound at 2 . 5 ฮผm or 5 . 0 ฮผm concentration and cell viability was determined after 48 hours by the trypan blue exclusion method . the compounds identified in table 1 , 2 and 3 inhibited cell growth and induced cell death , to varying degrees . the tables list the percent viable lncap and mcf - 7 cells treated with 5 . 0 ฮผm compound . five of the more active compounds which exhibited the highest activity were designated as fri - 2 ( e - 2 , 4 - difluorostyryl - 4 - fluorobenzyl sulfone ). fri - 6 ( e - 4 - fluorostyryl 4 - bromobenzyl sulfone ), fri - 7 ( e - 4 - bromostyryl 4 - fluorobenzyl sulfone ). fri - 20 ( e - 4 - fluorostyryl 4 - chlorobenzyl sulfone ) and fri - 22 ( e - 4 - chlorostyryl 4 - chlorobenzyl sulfone ). these compounds were found to substantially inhibit the growth and induce the death of lncap , bt - 20 and mcf - 7 cells at 2 . 5 mm ( fig1 a ) and 5 . 0 mm ( fig1 b ) after 48 hours of treatment with the compounds . under identical conditions , more than 80 % of nih3t3 cells were viable after 48 hours incubation ( fig1 a and 1 b ), e - 4 - chlorostyryl 4 - bromobenzyl sulfone and e - 4 - bromostyryl 4 - chlorobenzyl sulfone were also highly active . the dose dependency of the styryl sulfone was established by treating the cells with fri - 20 , one of the five most active compounds . nih3t3 , mcf - 7 , bt - 20 and lncap cells were treated with fri - 20 dissolved in dmso to concentrations of 250 nm , 500 nm , 1 ฮผm , 2 . 5 ฮผm and 5 ฮผm and examined for their proliferation and viability after 48 hours ( fig2 a ). the percentage of living cells was determined by trypan blue exclusion . the control cells were treated with dmso to determine the effect of solvent on cells . at a concentration of 250 nm , there was about 10 % cell death in mcf - 7 , bt - 20 and lncap cells and about 15 - 20 % inhibition in cell division compared to untreated cells after 48 hours . there was about 30 - 50 % inhibition in cell proliferation and 25 - 30 % cell death in lncap . bt - 20 and mcf - 7 at 500 nm concentration . under these conditions , only 2 - 3 % of nih3t3 cells were non - viable at both the concentrations . the lncap , bt - 20 and mcf - 7 cell growth was greatly inhibited by 1 ฮผm concentration of fri - 20 with concomitant loss of cell viability . after 48 hours incubation , 60 - 75 % of the lncap bt - 20 and mcf - 7 cells were dead at 2 . 5 mm fri - 20 concentration , whereas more than 90 % of nih3t3 cells were viable ( fig2 a ). the lncap , bt - 20 and mcf - 7 cells treated with 5 ฮผm fri - 20 ( fig2 a ) showed nearly 90 % cell death . nih3t3 showed little or no alteration in their ability to grow and maintain & gt ; 80 % viability in the presence of fri - 2 , - 6 , - 7 , - 20 or - 22 , at 5 ฮผm concentration . the time course of the activity of fri - 20 was demonstrated as follows . nih / 3t3 , mcf - 7 , bt - 20 and lncap were treated with fri - 20 at 2 . 5 ฮผm and the number of viable cells was determined at 12 , 24 , 48 and 72 hours by trypan blue exclusion . the mean of three independent experiments is shown in fig2 b . the time course study revealed that more than 95 % of mcf - 7 , lncap and bt - 20 cells were dead after 72 hours of treatment with fri - 20 at 2 . 5 ฮผm ( fig2 b ). the effect of fr - 20 on the growth of normal and tumor cells of breast and prostate was examine utilizing nine cell lines : nihl3t3 and hfl ( normal fibroblast cell lines ); mcf - 7 and 361 ( estrogen - receptor negative breast tumor cell lines ); btf - 20 , 435 and skbr - 3 ( estrogen - receptor positive breast tumor cell lines ); lncap ( androgen sensitive prostate tumor cell line ); pc - 3 and du - 145 ( androgen insensitive prostate tumor cell line ). the cells were grown as in example 22 , a . fr - 20 was dissolved in dmso and added to the cells at 2 . 5 ฮผm and 5 . 0 ฮผm concentration . to control cells , dmso was added equivalent to the volume of solvent ( dmso ) present at the highest concentration of the compound . the activity of the compound as evaluated after 48 hours by trypan blue exclusion . nih3t3 and hfl cells were found to maintain a percent viability of 85 - 90 % at 2 . 5 and 5 . 0 ฮผm concentration . of the seven breast tumor cell lines treated with fri - 20 compound , mcf - 7 , htb126 , t470 and 435 cells showed very high mortality with less than 25 % and 10 % viability at 2 . 5 and 5 . 0 ฮผm concentrations of the drug ( fig3 a ). nearly 50 % of skbr - 3 and bt - 20 cells were dead at 2 . 5 ฮผm and 75 % at 5 . 0 ฮผm concentration of the compound . the 361 breast tumor cell line , on the other hand showed considerable resistance to fri - 20 with 50 - 75 % of cells being viable at 2 . 5 and 5 . 0 ฮผm concentration . fri - 20 had profound effect on the viability of androgen - dependent lncap prostate tumor cell line when compared to androgen - independent du - 145 and pc - 3 prostate cell lines . at 2 . 5 mm fri - 20 , 80 % of lncap , 40 % of pc - 3 and 20 % of du - 145 cells were killed . at 5 . 0 mm fri - 20 , 72 % of lncap , 47 % of pc - 3 and 40 % of du - 145 were killed ( fig3 b ). the androgen - dependent prostate tumor cell line lncap was grown as in ex . 22 . a , and treated with 2 . 0 ฮผm fri - 20 dissolved in dmso or with equivalent amounts ( 10 ml ) of dmso alone . cells were harvested 6 , 12 , 24 , and 48 hours following treatment and stained with propidium iodide and subjected to flow cytometry ( facs ) for analysis of dna content . as shown in fig4 the addition of fr - 20 to the culture medium results in the accumulation of cells in the g2 / m phase of the cell cycle and as the cells exit this phase of the cell cycle they appeared to undero apoptosis . cells treated with dmso alone failed to exhibit such an arrest in the g2 / m phase of the cell cycle suggesting that the effects seen are associated with fri - 20 addition . treatment of the normal cell lines nih3 or hfl with fri - 20 failed to produce a similar effect on cell cycle progression . nih3t3 and hfl exhibited normal cell cycle progression in the presence and absence of drug . to examine the effects of fri - 20 on the mapk pathway , nih3t3 , lncap and mcf - 7 cells were incubated with fri - 20 at a concentration 2 . 5 mm for48 hours . following incubation of cells in the presence and absence of fri - 20 , the cells were lysed using erk lysis buffer containing 20 mm hepes ( ph 7 . 4 ), 50 mm ฮฒ - glycerophosphate , 0 . 5 % triton x - 100 , 2 mm mgcl 2 , 1 mm egta . 1 mm dithiothreitol , 2 ฮผg / ml leupeptin , 2 ฮผg / ml aprotinin , 100 ฮผm phenylmethylsulfonyl fluoride , and 1 mm benzamidine . erk - 2 in 100 mg of cell lysate was immunoprecipitated by incubating lysate protein with 1 mg of erk - 2 polyclonal antibody ( antibody sc - 154 to erk2 is from santa cruz biotechnology , inc .) for one hour followed by an additional incubation of 20 ฮผl of protein a - sepharose ( pharmacia ) for one hour . the immune complex - bound protein a - sepharose beads were washed twice with lysis buffer and twice with erk / mapk buffer containing 20 mm hepes ( ph 7 . 4 ), 50 mm ฮฒ - glycerophosphate , 10 mm mgcl 2 , 1 mm egta , 1 mm dithiothreitol , and 100 mm na 3 vo 4 . the immunoprecipitated were then tested for map kinase activity by an in vitro assay which utilizes myelin basic proteins ( mbp ) as a substrate for erk - 2 in the presence of [ ฮณ - 32 p ] atp . accordingly , the beads were resuspended in 40 ฮผl of mapk buffer containing 100 ฮผm [ ฮณ - 32 p ] atp ( 5000 cpm / pmol ), and the kinase assay was carried out for 20 minutes at 30 ยฐ c . using 5 ฮผg of mbp as substrate . the reaction was stopped by the addition of laemmli &# 39 ; s buffer followed by the boiling of the samples for 3 minutes . the proteins were resolved on 12 % sds - page ; the gel was dried , and an autoradiogram was developed . the results show that both drug - treated and untreated cells exhibit similar levels of intracellular erk - 2 , but the biochemical activity of erk - 2 , as judged by its ability to phosphorylate mbp , was considerably diminished in drug - treated cells compared to cells treated with dmso alone . in prostate tumor cells , fri - 20 reduced the phosphorylation status of mbp by more than 80 % compared to mock - treated cells ( fig5 ). cell lysates of fri - 20 - treated cells were prepared for western blot analysis as follows . nih3t3 , lncap or mcf - 7 cells were seeded at a density of 2 ร 10 5 cells / per well in a six - well plate and allowed to grow for 24 hours . fresh medium was added to each well 2 hours before treatment with fri - 20 . the compound was dissolved in dmso to make a 2 mm stock solution and added to the medium ( 2 ml ) to obtain a final concentration of 2 . 5 and 5 . 0 ฮผm . after 48 hours at 37 ยฐ c . the cells were washed twice with 10 ml of ice cold phosphate - buffered saline and harvested in 400 ฮผl of lysis buffer containing 25mm hepes ( ph 7 . 6 ), 0 . 1 % triton x - 100 . 300 mm nacl , 1 . 5 mm mgcl 2 , 20 mm ฮฒ - glycerophosphate , 100 ฮผm na 3 vo 4 , 0 . 2 mm edta , 0 . 5 mm dithiothreitol , 2 ฮผg / ml aprotinin , 2 ฮผg / ml leupeptin . 100 ฮผm phenylmethylsulfonyl chloride and 1 mm benzamidine . the cell lysates were kept on ice for 30 minutes and centrifuged for 10 minutes in a microcentrifuge ( 16000 ร g ). the cell lysates were separated from the debris and normalized for protein content . western blot analysis was carried out on the drug - and mock - treated cell lysates with erk - 2 antibody . equal amounts of total protein ( 100 ฮผg ) were loaded in each lane of a sds - page gel ( 10 - 12 %) and transferred to immobilon - p ( millipore , usa ). following transfer , membranes were blocked in 3 % milk , then probed with erk - 2 and jnk - 1 rabbit polyclonal antibodies ( santa cruz biotechnoloy inc . santa cruz , calif .) and then probed with horseradish peroxidase linked donkey anti - rabbit 1 g secondary antibody ( amersham ) ( 1 : 10000 dilution ). the antibody was detected using the ecl western blotting analysis kit ( amersham ) following the manufacturer &# 39 ; s instructions . the western blot analysis of the drug - and mock - treated cell lysates with erk - 2 antibody showed the same amount of protein in both lysates ( fig6 ), indicating that higher levels of mbp phosphorylation in mock - treated cells was not due to an unequal quantity of erk - 2 protein in lysates . these results suggest that fri - 20 blocks the phosphorylating capability of erk - 2 . to further establish if the activity of stress activated protein kinases ( sapks ), of which jnk is a member , is compromised in the presence of fri - 20 , cells ( nih3t3 , mcf - 7 or lncap ) were treated with fri - 20 dissolved in dmso or with dmso alone . forty - eight hours later , the cells were lysed with kinase buffer and the lysates used for estimation of the amount of jnk present in each lysate by western blot analysis using jnk polyclonal antibody . the biochemical activity of the jnk present in the fri - 20 - treated and mock - treated cell lysates was also determined by immunoprecipitation of jnk followed by incubation with gst - c - jun protein as a substrate for jnk in the presence of [ ฮณ - 32 p ] atp . accordingly , jnk - 1 in 100 mg of cell extracts was immunoprecipitated by incubating the lysate with 1 mg of jnk - 1 polyclonal antibody ( sc from santa cruz biotechnology ) for one hour followed by an additional incubation with 20 ฮผl of protein a - sepharose ( pharmacia ) for one hour . the beads were washed twice with jnk lysis buffer ( as described above ) followed by two washes with jnk reaction buffer . the beads were resuspended in 40 ฮผl of jnk buffer containing 20 mm [ ฮณ - 32 p ] atp ( 5000 cpm / pmol ), and the kinase reaction was carried out for 20 minutes at 30 ยฐ c . using 3 ฮผg of purified gst - c - jun ( 1 - 79 ) as substrate . the reaction was stopped , and the radioactivity in the phosphorylated gst - c - jun protein was quantitated . the results show that the fri - 20 treatment enhanced the ability of jnk to phosphorylate recombinant gst - c - jun protein by 60 - 80 % compared to mock - treated cells ( fig7 ). jnk has been shown to be activated by treatment of cells with uv radiation , pro - inflammatory cytokines and environmental stress ( derijard et al ., cell 1025 ( 1994 )). the activated jnk binds to the amino terminus of c - jun and increases its transcriptional activity by phosphorylating at ser63 and ser73 ( adler et al ., proc . natl . acad sci . usa 89 : 5341 ( 1992 ); kwok et al ., nature 370 : 223 ( 1994 )). without wishing to be bound by any theory , the results demonstrated herein suggest that fri - 20 may act like a pro - inflammatory ctokine or uv light in activating the jnk pathway , which in turn may switch on genes responsible for cell growth inhibition and apoptosis . the killing effect of fr - 20 or androgen - sensitive ( lncap ) and androgen insensitive ( du145 ) prostate tumor cells was compared to the effect of cisplatin ( cis - diamminedichloroplatinum ii ), a widely used anti - prostate cancer agent . the cells were grown as in example 26 . fri - 10 or cisplatin was dissolved in dmso and added to the cells at various concentrations . viability was determined after 72 hours by the trypan blue exclusion method . the concentration of fri - 20 required to completely kill lncap and du145 cells was 2 . 5 ฮผm and 5 . 0 ฮผm , respectively . under identical conditions , complete killing of lncap and du145 cells by cisplatin required 25 ฮผm and 15 ฮผm concentrations , respectively . thus , fri - 20 is at least tenfold more active than cisplatin in killing both hormone - dependent and hormone - independent prostate tumor cells . all references cited with respect to synthetic , preparative and analytical procedures are incorporated herein by reference . the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and , accordingly , reference should be made to the appended claims , rather than to the foregoing specification , as indication the scope of the invention . | 2 |
referring now to the drawings , and particularly fig1 thereof , there is shown a seat cover 10 of the invention . the seat cover 10 comprises a cover section 12 which has a peripheral edge 14 which may be elasticized so that it can easily fasten or engage in a releasable manner to the infant / child seat . the cover section 12 has generally two areas , namely a seat area 16 and a back area 18 which , respectively , cover the seat and the back of the infant / child seat . two approximately parallel lateral slots 20 and 22 are formed within the back area 18 and a single slot 24 is formed in the seat area 16 . each lateral slot 20 and 22 has a pair of edges 26 and 28 and each edge 26 and 28 has an upper section 30 , a middle section 32 , and a lower section 34 . along the middle section 32 of each edge 26 and 28 , there is formed a fastening mechanism 36 . the fastening mechanism 36 comprises a first velcro โข strip 38 on the edge 26 and a corresponding second velcro โข strip 40 along the edge 28 . the first and second velcro โข strips 38 and 40 can easily be releasably fastened to and unfastened from each other . fastening has the effect of closing off at least a portion of the lateral slots 20 and 22 , while conversely , unfastening the first and second velcro โข strips 38 and 40 opens these lateral slots 20 and 22 . reference is made to fig3 of the drawings which illustrates the seat cover 10 as shown in fig1 , but with the first and second velcro โข strips 38 and 40 of both of the lateral slots 20 and 22 closed off . in this configuration , only smaller apertures 42 and 44 will allow the slots 20 and 22 to part at their edges 26 and 28 to accommodate the seat belts as will be described in more detail below . note that the central slot 24 does not typically require any fastening since it need only be small to allow a central seat strap to be pulled therethrough . in fig2 , the rear of a car seat 50 is shown . the car seat 50 has a frame 52 molded to provide a seat 54 , a back 56 and side walls 58 on each side of the seat 54 . the car seat 50 can be secured in a vehicle in conventional fashion . the back 56 has a left upper orifice 60 , a left lower orifice 62 , a right upper orifice 64 and a right lower orifice 66 . each of the upper sections 30 of the slots 20 and 22 are formed to be at the approximate location of the upper orifices 60 and 64 . each of the lower sections 34 of the slots 20 ands 22 are formed to be at the approximate location of the lower orifices 62 and 66 . the orifices 60 and 62 are adapted to fit one shoulder seat belt 70 while the orifices 64 and 66 are adapted to fit the other shoulder seat belt 72 . the seat belt 70 passes through the upper section 30 of slot 20 to the front of the seat back 56 and then back behind the seat back 56 by passing through the lower section 34 of the slot 20 . similarly , the seat belt 72 passes through the upper section 30 of slot 22 to the front of the seat back 56 and then back behind he seat back 56 by passing through the lower section 34 of the slot 22 . the elongate shape of the slots 20 and 22 allow the entire front section of seat belts 70 and 72 to be pulled therethrough as can be seen in fig4 of the drawings . once pulled through , as seen in fig4 , the fastening means 36 is sealed to leave only small apertures 42 and 44 at the upper section 30 and the lower section 34 respectively , as illustrated in fig5 of the drawings . note that the dimensions of the small apertures 42 and 44 can be varied so as to be larger or smaller , by regulating the size of the fastening means 36 . therefore , the size of the small apertures 42 and 44 need not be on the scale shown in the drawings but can be made longer or shorter so that different requirements and preferences can be accommodated . with the seat belts 70 and 72 pulled through the slots 20 and 22 , and the slots 20 and 22 sealed and closed as shown in fig5 of the drawings , a safe , easy and effective method is provided to instal a seat cover of the invention . no complex time consuming procedures are required to remove and reinstall the seat belts and , further , the unsightly gaping spaces which are present without the fastening mechanism are eliminated or significantly reduced . thus , seat covers can be changed often and simply with worrying about safety and cleanliness issues . in other embodiments of the invention , a fastening mechanism other than velcro โข may be used . thus , a hook and eye arrangement , zippers , buttons or tying cords are just examples of the various types of fastening mechanisms that can be used within the scope of the invention . the invention also provides for a hood structure which can be easily removed and replaced . in accordance with another aspect of the invention , there is thus provided a hood for use with an infant / child seat , the hood typically comprising a support bar having ends connectable to the infant / child seat , and a fabric hood piece attached to the support bar , the fabric piece having a hem formed by a releasable fastening means , such as velcro โข, so that the hood piece can be easily removed and installed on the support bar for mounting on the infant / child seat . one such hood arrangement can be seen in fig6 of the drawings . a hood structure 80 comprises a hood 82 designed to shield or protect the infant &# 39 ; s face from the sun , rain , or other condition . the hood 82 has an edge 84 which is seamed to form a channel 86 . the channel 86 receives an elongate and flexible rod whose ends ( not shown ) extend outwardly through openings 88 and 90 and fasten to the seat or frame . the rod can be easily installed and removed making the hood structure 80 a convenient , safe and simple accessory to use . the invention is not limited to the precise details described herein and variations and modifications can be made within the scope of the invention . different types of fabric can be used to construct the seat cover , the slots may vary in length according to the specific infant / child seat for which it is designed and the location of the seat belts , and the size and length of the fastening mechanism on the slot can be varied according to preselected criteria . | 0 |
in accordance with embodiments of the present invention , an apparatus and method are provided to enable effective control and monitoring of a motorized locomotion assisting exoskeleton device by means of ground force measurement . by โ ground force measurement โ is meant a local measurement of the force that is exerted by an area of a supporting surface that counters the force exerted on that area of the surface by the user . the supporting surface may be a floor , or ground , below the user , or any other horizontal or non - horizontal surface that supports the weight of , or otherwise supports or stabilizes the user , or counters a force exerted by the user or the locomotion assisting exoskeleton device . the ground force may be a force applied directly by the supporting surface on a component of the locomotion assisting exoskeleton device , or may be transmitted via a body or object that is between the supporting surface and the component . the locomotion assisting exoskeleton device includes braces and supports that may be strapped on , or otherwise attached or affixed to , the trunk and sections of limbs and body parts in the lower portion of the body of a user . the various braces and supports are connected to one another by means of joints that enable relative movement between the braces and supports . the locomotion assisting exoskeleton device may include motorized actuation assemblies or joints for moving parts of the user &# 39 ; s body , such as for bending joints in order to propel various limbs of the user &# 39 ; s body . the locomotion assisting exoskeleton device may also include sensors for measuring relative situation of various components of the device , and thus of the body parts to which they are attached . such sensors may measure , for example , the angle between the brace sections on either side of a joint . in addition , the locomotion assisting exoskeleton device may include one or more sensors that sense or measure tilt . for example , such a sensor affixed to the upper portion of the user &# 39 ; s body may measure the tilt of that portion of the body . the user of the locomotion assisting exoskeleton device is provided with a set of controls that communicate with the locomotion assisting exoskeleton device . by means of the controls , the user may select a locomotion mode for the device . available modes may include walking , climbing a stair , descending a stair , sitting , and standing from a sitting position . in accordance with embodiments of the present invention , the locomotion assisting exoskeleton device includes a foot brace that is positioned under a foot of the user . the foot brace supports the foot of the user , and applies force to the user &# 39 ; s foot that counters the force of the weight of the user on the foot brace . the foot brace is provided with one or more ground force sensors . ground force sensors are known in the art . for example , a ground force sensor may be based on a force sensitive resistor , such as a piezoresistive force sensor . a ground force sensor generates a signal that indicates the force that is applied to it . the amount of force applied to the ground force sensor depends on the posture or stance of the user , or on the activity of the user . when a locomotion mode is selected , the locomotion assisting exoskeleton device awaits an instruction before initiating the appropriate motion sequence . in accordance with embodiments of the present invention , instructions are provided in accordance with signals generated by the ground force sensors of a foot brace . by shifting the weight of the user &# 39 ; s body , perhaps with the aid of crutches , the user may increase or decrease the force applied to one or more of the ground force sensors . for example , if a walking gait mode was selected and the user wishes to begin walking with the right foot , the user slightly leans on the left foot ( perhaps with concurrent use of crutches ). a ground force sensor on the right foot brace may then generate a signal indicating decreased force and a force sensor of the left foot brace may indicate increased force . the locomotion assisting exoskeleton device then initiates the walking gait by lifting and extending the right foot brace . the locomotion assisting exoskeleton device continues to monitor the signals generated by the ground force sensors . thus , the user retains control over the gait . by leaning or otherwise controlling the force on the ground force sensors in an expected manner , the user continues to enable the gait . if , however , the weight of the user shifts in a manner inconsistent with the current phase of the gait , the locomotion assisting exoskeleton device may alert the user or halt the gait or converge to a stance until further instructions are received . fig1 a shows a motorized locomotion assisting exoskeleton device that is controlled in accordance with embodiments of the present invention . locomotion assisting exoskeleton device 20 is powered and controlled by controller pack 22 . controller pack 22 incorporates a controller in the form of a programmable processor , and a battery or other power supply ( shown schematically in fig1 c ). controller pack 22 is generally worn on the back of a person using locomotion assisting exoskeleton device 20 . alternatively , the various components of controller pack 22 may be attached to or incorporated in various components of exoskeleton device 20 . for example , components of controller pack 22 may be incorporated into braces 24 . controller pack 22 may communicate with a tilt sensor 23 that is fixed to a location on the upper portion of the user &# 39 ; s body . for example , tilt sensor 23 may be worn on a shoulder strap that holds controller pack 22 to the user &# 39 ; s torso , and thus senses the degree of tilt of the torso . the tilt sensors may include accelerometers , gyroscopes , or any other sensors capable of being incorporated in a locomotion assisting exoskeleton device and designed to sense tilt . the tilt sensor generates a signal that indicates whether the user &# 39 ; s upper portion of the body is leaning or is upright with respect to the vertical braces 23 a are affixed by means of straps 25 to segments of the user &# 39 ; s lower limbs and to the pelvis , torso , or other parts of the user &# 39 ; s body . braces 23 a incorporate motorized actuation assemblies 24 . each actuation assembly 24 includes a motorized actuator ( not shown ) that , in response to commands transmitted by controller pack 22 , causes a joint that connects between individual braces 23 a to bend or extend . bending or extending a joint may propel or move a limb to which an adjoining brace is attached . when the lower limbs of the user are affixed to braces 23 a , each of the user &# 39 ; s feet is placed on a foot brace 26 . foot brace 26 may be movable by means of a separate motorized actuation assembly ( not shown ) to lift , guide , and lower a foot of the user . alternatively , foot brace 26 may include a coil , spring , or other elastic anti - drop mechanism associated with ankle joint 27 . the anti - drop mechanism associated with ankle joint 27 holds foot brace 26 substantially horizontal when foot brace 26 is raised above , and is not supported by , a supporting surface . fig1 b shows a control panel unit associated with the motorized locomotion assisting exoskeleton device shown in fig1 a . control panel unit 30 communicates with controller pack 22 via a wireless or other communications channel . typically , control panel unit 30 is strapped to the user &# 39 ; s wrist by means of straps 34 . control panel unit 30 includes one or more touch - sensitive buttons or keys 32 . the touch - sensitive buttons 32 may serve as a mode selector to select a mode of locomotion , to verify a command , or to communicate other instructions to controller pack 22 . one or more ground force sensors 28 are mounted on each foot brace 26 . each of ground force sensors 28 is capable of generating a signal that indicates the force applied to that sensor . signals generated by ground force sensors 28 are transmitted to controller pack 22 . controller pack 22 receives signals transmitted by control panel unit 30 and by ground force sensors 28 . on the basis of the received signals and in accordance with programmed instructions , controller pack 22 transmits instructions to actuation assemblies 24 . the instructions transmitted to actuation assemblies 24 may cause one or more of braces 23 a to move , propelling any limbs attached to the units . by activating buttons 32 and by adjusting the force on ground force sensors 28 , a person may control locomotion assisting exoskeleton device 20 to assist in performing a desired task . examples of controlling a locomotion assisting exoskeleton device in accordance with embodiments of the present invention are described below . fig1 c is a block diagram of the locomotion assisting exoskeleton device shown in fig1 a and fig1 b . power supply 15 is located in controller pack 22 . main supply 16 provides power to main processor 12 , actuation assemblies 24 , and motors 38 . main supply 16 may include a rechargeable battery that may be charged by means of charger unit 18 that may be connected to main supply 16 through protection circuit 19 . when necessary , an appropriate alternative external power source , such as an auxiliary battery , may be connected to auxiliary connection 17 . main processor 12 may receive signals from tilt sensor 23 and ground force sensors 28 . main processor 12 may communicate with control unit 30 over a wireless connection through wireless communications board 14 . main processor 12 communicates with actuation assemblies 24 via communications channels , such as controller - area network ( can ) bus 37 . each actuation assembly 24 includes a control board 36 . each control board 36 controls a motor 38 that determines the motion of actuation assembly 24 , and thus of a brace or joint to which actuation assembly 24 may be attached . in general , a user of locomotion assisting exoskeleton device 20 selects a mode of operation . modes of operation may include selection of a task to be carried out . examples of such tasks may include walking with a particular gait , sitting , standing from a sitting position , climbing stairs , and descending stairs . the locomotion assisting exoskeleton device may include one or more alerting devices for alerting the user of situations demanding the user &# 39 ; s attention . such alerting devices may generate audible , visible , or tactile alert signals . the alerting devices may be incorporated into one or more components of the locomotion assisting exoskeleton device . situations requiring user attention may include contradictory or unexpected movements or foot loading , falling , and points during the execution of a procedure where user verification is required for safety purposes . depending on the details of the control algorithm for the motorized locomotion assisting exoskeleton device , the ground force sensor values used in controlling the locomotion assisting exoskeleton device may represent a signal generated by a single sensor , or may be a representative value of the signals based on processing the outputs generated by part or all of an array of sensors associated with a single foot brace . alternatively , the value used may represent a pattern or map of forces applied to the sensors of one or both foot braces . for the sake of simplicity in the discussion below , the values of forces measured by the ground force sensors , or foot loadings , may be classified into one of four loading categories . the ranges of sensor signals to be included within each loading category may vary from user to user , or from one mode of operation to another . the loading categories may also be defined relative to one another . the category representing the range of the smallest forces may be labeled โ foot off โ ( fo ), and is associated with a foot brace that is not touching the ground . the category representing the next larger range of forces may be labeled โ foot touching โ ( ft ), associated with a foot brace that is touching the ground , but with minimal loading . the category representing the next larger range of forces labeled โ foot lightly loaded โ ( fll ), may represent light loading on a foot brace , associated with a situation where the user is standing on both feet , and load of the weight of the body is shared with the other foot brace . finally , a category representing the range of greatest forces may be labeled โ foot heavily loaded โ ( fhl ). fhl is associated with a user leaning on one foot brace , with that foot brace supporting most of the weight of the user &# 39 ; s body . in addition to the signal output of ground force sensors , control of the locomotion assisting exoskeleton device may utilize a measurement of the tilt of the upper part of the user &# 39 ; s body . the tilt measurement may be used to check whether the tilt of the user &# 39 ; s body is consistent with the current phase of an activity . in addition , depending on the control algorithm of the locomotion assisting exoskeleton device , the user may use body tilt , in addition to applying force to the ground force sensors , to control the locomotion assisting exoskeleton device . loading on a particular foot , the right or the left foot is indicated in the discussion below by preceding the abbreviation for a loading category with the letter r or l , respectively . for example , the right foot lightly loaded may be designated rfll . the left foot touching may be designated lft . various combinations of loading on the right and left legs may indicate various stances . a stance is to be understood as including any posture of the body , such as , for example , standing , sitting , or a phase of a walking gait , including an unstable or falling posture , and not only a stable standing posture . for example , a loading combination rfll and lfll may indicate that the user is standing straight or otherwise placing approximately equal loading on both legs . a combination of rfhl with lighter loading on the left leg , lfll , lft , or lfo , may be indicate that the user is leaning on the right leg . conversely , a combination of lfhl with rfll , rft , or rfo may indicate leaning on the left leg . leaning on a leg is understood to include standing on one leg with the other leg being held above the ground . any combination of fll , ft , or fo loading on one leg , combined with ft or fo loading on the other leg , may indicate falling . falling may also be indicated by a tilt sensor . during falling , the tilt sensor may indicate that the upper body is tilted at an angle indicative of falling , or may indicate acceleration indicative of falling . in the diagrams discussed below , the left leg is designated lg , the right leg is designated rg , and ground force sensors are designated gf . in the examples of the control methods described below , the user may coordinate the action of the locomotion assisting exoskeleton device with the use of crutches . however , the role of the crutches is not indicated in the figures . fig2 a is a diagram of the control process for initiating a step from a standing position , in accordance with embodiments of the present invention . fig2 b is a flow chart of a control method for the process illustrated in fig2 a . by means of the controls on the control panel unit of the exoskeleton skeleton device , the user indicates the intention to initiate a walking gait ( step 140 ). the control system of the locomotion assisting exoskeleton device then checks whether tilt sensors indicate that the user is leaning forward ( step 142 ). if not ( step 57 ), the system checks whether a predetermined time has elapsed since step 140 ( step 144 ). if the time has elapsed , the process of initiating a walking gait times out and is halted ( step 58 ). if not , the system continues to wait for an appropriate signal from the tilt sensors ( return to step 142 ). the user initiates the walking gait by leaning forward ( step 41 ). the user may be initially standing with weight distributed approximately equally between both legs ( as in step 40 , rfll and lfll , loading ). if no change in loading is detected by the ground force sensors within a predetermined period of time ( step 150 ), the process of initiating a walking gait times out and is halted ( step 58 ). the user may lean on the right leg ( rfhl loading , step 42 ) to instruct the locomotion assisting exoskeleton device to begin a walking gait , stepping with the left leg first . leaning on the right leg is a relatively intuitive way of indicating that the user wishes to start walking by stepping with the left leg . when the control system detects leaning on the right leg , the system executes an algorithm ( step 44 ) causing the locomotion assisting exoskeleton device to extend the left leg . the user is then standing with left leg extended ( step 46 ). the system records that a walking step was made with the left leg ( step 146 ) and the gait maintenance process ( described below ) begins ( step 48 ). if the user prefers to start the gait with the right leg , the user leans on the left leg ( lfhl loading , step 50 ). this initiates a walking step with the right leg ( step 52 and step 54 ) that is recorded by the system ( step 148 ). during the process of initiating a gait , the locomotion assisting exoskeleton device continues to monitor the ground force sensors . should the ground force sensors indicate falling ( step 56 , fll , ft , or fo loading on one leg combined with a ft or fo loading on the other ), or a tilt sensor indicate falling , the walking gait initiation procedure is halted ( step 58 ). alternatively , initiating a gait by the locomotion assisting exoskeleton device may be controlled by means of activating the ground force sensors alone , without waiting for a signal from a tilt sensor . fig3 is a diagram of control for initiating a step from a standing position using only ground force sensors , in accordance with embodiments of the present invention . leaning on either leg initiates the gait initiation process . if the ground force sensors do not indicate that the user has leaned on either leg within a predetermined period of time , the gait initiation process times out and is halted . fig4 a is a diagram of the control process for maintaining a gait , in accordance with embodiments of the present invention . fig4 b is a flow chart of a control method for the process illustrated in fig4 a . before initiating another walking step of the gait , the system checks if the tilt sensors indicate that the user is leaning forward . if not ( step 57 ), and a predetermined time period has elapsed ( step 144 ), the gait maintenance process times out . when the process times out , an algorithm is executed ( step 70 ) to bring both legs to a standing position ( step 40 ) and the process is halted ( step 58 ). the user indicates the intention to continue the walking gate by continuing to lean forward ( step 47 ). if the previous step of the gait was executed with the left leg , the user may be standing in the position of step 46 , with left leg extended forward . the user leans on the extended left leg ( step 60 ) to instruct the locomotion assisting exoskeleton device to continue the walking gait by extending the right leg ( step 62 ). the system records that the last step of the gait was executed with the right leg . the user is now in the position of step 54 , with right leg extended . on the other hand , while standing in the position of step 46 , the user may lean on the trailing right leg ( step 68 ) or on both legs with about equal force . continuing to lean on the trailing right leg or on both legs for a predetermined time interval ( step 150 ) instructs the locomotion assisting exoskeleton device to halt the walking gait . the system executes an algorithm ( step 70 ) to bring the user &# 39 ; s legs together to a standing stance , to the position of step 40 . the walking process is then halted ( step 58 ). if the previous step of the gait was executed with the right leg so that the user stands with right leg extended ( step 54 ), the user may lean on the extended right leg to instruct the locomotion assisting exoskeleton device to continue a forward gait by extending the left leg ( step 64 ). the locomotion assisting exoskeleton device then executes a step of the gait with the left leg forward ( step 66 ) so that the user is standing with the left leg extended ( step 46 ). the system records that a step was executed with the left leg ( step 146 ). on the other hand , while still standing in the position of step 54 , leaning on the trailing left leg ( step 74 ) or about equally on both legs ( step 40 ) for a predetermined time interval ( step 150 ) instructs the locomotion assisting exoskeleton device to bring the user to a standing position ( step 70 and step 40 ) and to stop the gait maintenance process ( step 58 ). after taking a step of the gait , with the having one leg extended ( step 46 or step 54 ), the system again checks for tilt ( step 142 ) and repeats the step process . if during execution of a step of the gait , the ground force sensors or a tilt sensor indicate that the user is falling ( step 56 ), the gait maintenance process is halted ( step 58 ). alternatively , the process of maintaining a walking gait of the locomotion assisting exoskeleton device may be controlled by means of activating ground force sensors alone , without waiting for a signal from a tilt sensor . fig5 is a diagram of the control process for maintaining a gait using only ground force sensors , in accordance with embodiments of the present invention . leaning on the extended leg signals continuation of the gait maintenance process . if the ground force sensors do not indicate that the user has leaned on the extended leg within a predetermined period of time , the gait maintenance process times out , the legs are brought together to a standing - straight position , and the process is halted . fig6 is a diagram of the control process for standing from a sitting position , in accordance with embodiments of the present invention . the user , in a sitting position , uses the control panel unit of the locomotion assisting exoskeleton device to signal the locomotion assisting exoskeleton device that the user wishes to stand . in order to instruct the locomotion assisting exoskeleton device to initiate the standing procedure , the user places both feet on the ground ( step 80 , ft loading on both legs ). the locomotion assisting exoskeleton device initiates a standing procedure algorithm ( step 82 ). the locomotion assisting exoskeleton device begins straightening the user &# 39 ; s legs ( step 84 and step 86 ), bringing the user to a standing position ( step 88 ). while executing the standing procedure , the locomotion assisting exoskeleton device monitors the output signals of the ground force sensors . if the standing procedure proceeds as expected , the ground force sensors measure increasing force during steps 84 and 86 until the full standing position of step 88 is attained ( rfll and lfll loading ). alternatively or additionally , progress of the standing procedure may be monitored by means of sensors that sense the angles of the various joints , and that are incorporated in the actuation assemblies of the locomotion assisting exoskeleton device . deviation from the expected increase in force , or change in joint angle , for a predetermined interval of time may be interpreted as indicating a problem with the standing procedure . in such a case , the locomotion assisting exoskeleton device may alert the user , and may halt or suspend the standing procedure until further instructions are received or may return the user to a sitting position 80 . another safety means may involve a tilt sensor that senses the tilt angle of a part of the upper body of the user . if the tilt sensor indicates that the user is falling , the locomotion assisting exoskeleton device may act to attempt to prevent or mitigate the effects of the fall . for example , the locomotion assisting exoskeleton device may cause the user to sit back . fig7 is a diagram of the control process for sitting from a standing position , in accordance with embodiments of the present invention . while standing in front of a surface on which the user wishes to sit , the user uses the control panel unit to instruct the locomotion assisting exoskeleton device to execute a sitting procedure . the user stands straight , with approximately equal force ( fll loading ) on both legs ( step 90 ). this signals the locomotion assisting exoskeleton device to initiate a sitting procedure algorithm ( step 92 ). the locomotion assisting exoskeleton device bends the user &# 39 ; s legs ( step 94 and step 96 ), bringing the user to a sitting position ( step 98 ). while executing the sitting procedure , the locomotion assisting exoskeleton device continues to monitor the ground force sensors . it is expected that the ground force sensors will indicate decreasing ground force until a full sitting position is attained ( rft and lft loading ). alternatively or additionally , progress of the sitting procedure may be monitored by means of sensors that sense the angles of the various joints , and that are incorporated in the actuation assemblies of the locomotion assisting exoskeleton device . a deviation from the expected decrease in force , or change in joint angle , for a predetermined interval of time may be interpreted as indicating a problem with the sitting procedure . the procedure may then be stopped or paused until further instructions are received . if a tilt sensor indicates that the user may be falling during the sitting procedure , the sitting procedure may be stopped , and action may be taken to prevent , or mitigate the effects of , the fall . fig8 a is a diagram of the control process for ascending a stair , in accordance with embodiments of the present invention . fig8 b is a flow chart of a control method for the process illustrated in fig8 a . to ascend a stairway of several stairs , the control process is repeated for each consecutive stair . to initiate the process of ascending a stair , a user standing below a stair to be ascended uses the control panel unit to instruct the locomotion assisting exoskeleton device to execute a stair ascending procedure ( step 160 ). the system then checks if the ground force sensors indicate that the user is leaning on a single leg ( step 162 ). the user leans on one leg to instruct the locomotion assisting exoskeleton device to initiate the procedure by placing the opposite leg on top of the stair . if the user does not lean on a single leg but continues to stand on both legs , the locomotion assisting exoskeleton device alerts the user ( step 163 ). in this example , the user leans on the left leg ( step 100 ). for simplicity , we limit the discussion here to an example in which the user leans on the left leg in order to begin the ascent with the right leg . however , the description of the procedure remains valid if right and left legs are interchanged throughout . in response to leaning on the left leg , the locomotion assisting exoskeleton device executes an algorithm for lifting the right leg and extending it forward above the stair ( step 102 ). with the right leg positioned above the stair , the ground force sensors are expected to indicate that the user is standing on the left leg ( step 104 ). the locomotion assisting exoskeleton device then executes an algorithm to lower the right leg ( step 106 ), checking the ground force sensors on the right foot brace ( step 170 ) until the sensors indicate that the right foot has touched the top of the stair ( rft loading ) while leaning on the left leg ( step 108 ). at this point the output signals from the ground force sensors are monitored to check whether the right foot is fully resting on the stair ( step 172 ). for example , input signals from sensors in both the toe and heel of the right foot brace may be checked to verify that all sensors indicate at least minimal contact ( ft loading ). if the sensor signals indicate that all or part of the right foot is not resting on top of the stair within a predetermined time interval , the algorithm assumes that the procedure has failed . in the event of such failure , the locomotion assisting exoskeleton device may return the right foot to its original position as at the beginning of the procedure ( step 173 ), i . e . the position of step 100 . the procedure is then halted until further instructions are received ( step 58 ). if the sensors indicate that the procedure has continued as expected , and that the right foot is fully resting on top of the stair , the locomotion assisting exoskeleton device may alert the user to this by generating an audible or other signal . for safety reasons , the locomotion assisting exoskeleton device may then await acknowledgment or verification from the user before proceeding to the next step in ascending the stair ( step 174 ). the user may indicate verification by means of a control button , or by any other appropriate control or signaling means known in the art . once verification is received from the user , system checks whether the user is leaning on the right leg ( step 176 ). in addition , the system may verify that a tilt sensor indicates that the user &# 39 ; s torso is leaning forward . if the user leans on the right leg ( step 110 ), the system executes an algorithm to lift the left leg and the user &# 39 ; s body to the top of the stair ( step 112 ). failure to lean on the right leg , or to lean forward , within a predetermined time interval may indicate the user &# 39 ; s stance is inconsistent with safely proceeding with the ascend stair procedure . therefore , failure to lean on the right leg , or to lean forward , may cause the locomotion assisting exoskeleton device to alert the user and to stop the procedure until further instructions are received ( step 178 ). when step 112 is complete , the left leg is brought into line with the right leg on top of the stair . the user is then standing on top of the ascended stair ( step 114 ). at this point , the user may use the control panel unit to instruct the locomotion assisting exoskeleton device to execute a procedure to begin a walking gait , to ascend another stair , or any other appropriate action . throughout the stair ascending procedure , the stability and safety of the user may be achieved by concurrent use of crutches or a hand railing . during execution of the stair ascending procedure , the ground force sensors or a tilt sensor may indicate that the user is falling . the locomotion assisting exoskeleton device may then take action to prevent , or mitigate the effects of , a fall . for example , the locomotion assisting exoskeleton device may attempt to restore balance to prevent a fall , may cause the user to collapse in such a manner as to reduce the impact of a fall . fig9 a is a diagram of the control process for descending a stair , in accordance with embodiments of the present invention . fig9 b is a flow chart of a control method for the process illustrated in fig9 a . to descend a stairway of several stairs , the control process is repeated for each consecutive stair . to initiate the process of descending a stair , a user standing on an upper level above a stair to be descended uses the control panel unit to instruct the control system of the locomotion assisting exoskeleton device to execute a stair descending procedure ( step 182 ). the user leans on one leg to instruct the locomotion assisting exoskeleton device to initiate stair descent procedure with the opposite leg . if the user does not lean on a single leg ( step 184 ) but continues to stand on both legs , the locomotion assisting exoskeleton device alerts the user ( step 186 ). in this example , the user leans on the left leg ( step 120 ). for simplicity , we limit the discussion here to an example in which the user leans on the left leg in order to begin the descent with the right leg . however , the description remains valid if right and left legs are interchanged throughout . in response to leaning on the left leg , the system executes an algorithm for extending the right leg forward above the stair ( step 122 ). while extending the right leg , the system continues to check if the right foot is no longer touching the upper level ( rfo loading , step 190 ). when the right leg is extended above the stair , the ground force sensors are expected to indicate rfo loading on the right foot , and that the user is standing on the left leg ( step 124 ). at this point , for reasons of safety , the system may wait for an acknowledgement signal indicating verification by the user ( step 192 ). verification from the user may be understood to indicate that crutches are properly positioned , or other precautions have been taken , to assure proper support of the user &# 39 ; s body during the next steps of the procedure . if verification is received , the locomotion assisting exoskeleton device then executes an algorithm for bending the left knee ( step 127 ), lowering the right leg . during execution of the algorithm of step 127 , the ground force sensors may indicate a state equivalent to falling , with a combination of rfo and lfll or lft loading ( step 126 ). however , in reality , the weight of the user is being supported by crutches or other means . during this phase of descending a stair , a true state of falling may be indicated only by a tilt sensor or similar sensor , and not by the ground sensors . while bending the left knee , the system checks the ground force sensors for rft loading ( step 194 ) that may indicate that the right foot has made contact with the top of the stair . when rft loading is indicated , the right foot is expected to rest on the top of the stair the algorithm of step 127 ceases to execute . the ground force sensors are checked to verify that the user is leaning on the right leg ( step 196 ). if not the user is alerted ( step 198 ). when the user leans on the right leg ( step 128 ), the system begins execution of an algorithm to remove the left leg from the upper level ( step 130 ). the locomotion assisting exoskeleton device lifts the left leg at the hip and bends the left knee to remove the left foot from the upper level . this action continues as long as the ground force sensors indicate lft loading ( step 131 ). when the ground force sensors indicate lfo , the left foot is expected to be positioned above the stair , with the user leaning on the right leg ( step 132 ). the system then executes an algorithm that causes the locomotion assisting exoskeleton device to lower the left foot until the left foot touches the top of the stair ( step 134 ). when step 134 is complete , the user is standing with both legs on top of the stair ( step 136 ). at this point , the user may use the control panel unit to instruct the locomotion assisting exoskeleton device to execute a procedure to begin a walking gait , to descend another stair , or any other appropriate action . throughout the stair descending procedure , the stability and safety of the user may be achieved by concurrent use of crutches or a hand railing . it should be understood that in the above descriptions of examples of control processes , steps of the processes may have been omitted for the sake of clarity and simplicity . also , variations of the processes and procedures described above may be apparent to one skilled in the art , and are to be considered as falling within the scope of the present invention . examples of such variations are : additional or different points during a procedure where user verification may be required , different means of indicating user verification or monitoring a procedure , additional timeout intervals that were not indicated in the above discussion , use of tilt sensor output in procedures where such use was not described in the above discussion , use of angle sensor output , changing the order of individual steps of the procedure , and other variations . thus , as described above , a system for the convenient , safe , and intuitive control of a locomotion assisting exoskeleton device is provided . it should be clear that the description of the embodiments and attached figures set forth in this specification serves only for a better understanding of the invention , without limiting its scope . it should also be clear that a person skilled in the art , after reading the present specification could make adjustments or amendments to the attached figures and above described embodiments that would still be covered by the present invention . | 1 |
fig1 shows a photovoltaic assembly 100 according to an exemplary embodiment of the present disclosure . the exemplary photovoltaic assembly 100 includes an optical assembly 106 that is affixed to a front surface of a photovoltaic cell 102 for concentrating solar rays . in an exemplary embodiment , the optical assembly 106 provides a concentration of about 1600 times or greater than the incident solar concentration . in an exemplary embodiment , this level of solar concentration produces a large amount of heating at the photovoltaic cell 102 . the photovoltaic cell 102 is coupled to a cell package 104 for dissipating heat from the photovoltaic cell 102 . in an exemplary embodiment , a back surface of the photovoltaic cell 102 is directly soldered to the cell package 104 using a solder . the solder may include an 80 / 20 lead / tin solder or a low melt solder . alternate solders usable for soldering the photovoltaic cell 102 and cell package 104 may include alloys containing at least one of lead , tin , copper , gallium , silver , manganese , magnesium , bismuth , indium , zinc and antimony , such as for example sn โ ag โ cu , sn โ ag โ cu โ zn and sn โ ag โ cu โ mn . alternately , the photovoltaic cell 102 may be coupled to the cell assembly 104 using a conductive particle infused polymer adhesive , such as silver paste . wires 108 are bonded between the photovoltaic cell 102 and the cell package 104 to provide an electrical path for current produced at the photovoltaic cell 102 . in an exemplary embodiment , the wires 108 may be bonded using a solder such as the exemplary solders listed above . in an alternate embodiment the cell is connected to the top surface conductors on the cell package using on of wire bonding and ribbon bonding methods where the wire and ribbon may comprise one of gold , silver , platinum , palladium , aluminum , silicon and copper . fig2 shows an exploded view of an exemplary cell package 104 of fig1 in one embodiment of the present disclosure . the exemplary cell package 104 includes a coating 202 , a solder mask 204 , a copper layer 206 , a dielectric layer 208 and a substrate layer 210 . in an exemplary embodiment , copper layer 206 and substrate layer 210 form electrodes coupled to the photovoltaic cell 102 . in an exemplary embodiment , copper layer 206 forms an electrical circuit with the photovoltaic cell 102 . coating 202 provides a top surface of the cell package and is in contact with the photovoltaic cell 102 . coating 202 provides a substantially corrosion resistant surface for wire bonding and may include at least one of gold , silver , nickel , zinc and tin . solder mask 204 provides a second layer of the cell package 104 and includes an insulating material . the solder mask may include standard solder mask material such as , for example , an epoxy paint . the solder mask 204 may be applied via screen printing in an exemplary embodiment . the solder mask may have windows for wire bonding , strap bonding or strap welding of connections between the photovoltaic cell 102 and package electrodes ( not shown ) of the cell package 104 . the solder mask 204 further includes windows allowing interconnecting wires ( see fig5 ) to be soldered to the package electrodes , thereby interconnecting a plurality of photovoltaic assemblies 100 to each other and / or to an external device . in exemplary embodiments , the interconnecting wires may be bonded between the photovoltaic cell 102 and the electrodes of the cell package 104 using gold wire bonding , ribbon bonding or strap welding , for example . connective bonding material may include at least one of gold , silver , invar , iron , copper and tin . copper layer 206 provides a third layer of the cell package 104 and is an electrically conductive layer that forms a second electrode of the photovoltaic cell 104 . in alternate embodiments , the copper layer 206 may be made of any material that is electrically conductive . copper layer 206 may be patterned using exemplary lithographic methods such as photolithography , screen printing , and ink jet printing , for example . after patterning , an etch process may be used to remove unwanted copper from the copper layer 206 to form a selected shape . in addition , the copper layer is selected to provide an electrically conductive channel for conducting current generated from the photovoltaic cell , for example , to the interconnecting wires . in various embodiments , the current densities are in a range from about 6 . 3 amps per square centimeter ( amps / cm 2 ) to about 25 . 2 amp / cm 2 . the copper layer 206 may be electrically coupled to an electrode of the photovoltaic cell 102 using a ribbon bond , a wire bond , etc . dielectric layer 208 provides a fourth layer of the cell package 104 that provides electrical isolation of the copper layer 206 from the underlying substrate layer 210 . the dielectric layer 208 further allows heat transfer from the copper layer 206 to the substrate layer 210 . in an exemplary embodiment , the dielectric layer 208 may include an fr4 matrix of glass fiber and epoxy that may be cured by thermal , chemical or ultraviolet methods . substrate layer 210 provides a fifth and bottom layer of the cell package 104 and may be a thick layer in comparison to layers 202 - 208 . the substrate layer 210 may serve as both an electrode and a thermal conductor . increasing the thickness d of the substrate layer 210 relative to the thicknesses of layers 202 - 208 increases an ability of the substrate layer 210 to spread the heat conducted to the substrate layer from the photovoltaic cell 104 via the layers 202 - 208 . the substrate layer may have lateral dimensions of length and width . increasing the size of the lateral dimensions may improve a thermal coupling of the substrate layer 210 to a backplane ( see fig4 ). the lateral dimension and thickness of the substrate layer may be selected to achieve a selected thermal performance ( i . e ., solar heat dissipation ) of the cell package 104 and a selected operating temperature of the related photovoltaic assembly 100 . in an exemplary embodiment , the substrate layer 210 is made of copper or other material selected to achieve high thermal conductivity . in alternate embodiments , layer 210 may include aluminum or at least one of copper , aluminum , iron , chrome , nickel , molybdenum , zinc and tin . in an embodiment in which a photovoltaic cell has a length and width of about 3 . 75 millimeters ( mm ), a length and width of the substrate layer 210 may be about 15 mm and the thickness may be about 1 . 5 mm . layers 206 , 208 and 210 may be coupled to each other by pressure and heat to cure layer 208 to form a bond . in an exemplary embodiment , layers 206 , 208 and 210 may be bonded to form a sheet that is then separated into individual substrates suitable for use in a selected cell package 104 . the separated substrates may be patterned into individual substrate layers using printed circuit methods . fig3 shows a cell package 104 in an alternate embodiment . the alternate cell package 104 includes a coating 302 , a solder mask 304 , a copper layer 306 , a dielectric layer 308 and a substrate layer 310 . in the alternate embodiment , layer 306 includes both cell electrodes 306 a and 306 b coupled to the photovoltaic cell 102 and is made of thick copper that has a thickness that is substantially between about 20 microns and about 400 microns . the dimensions of the layer 306 are selected so as to be conducive to spreading heat laterally . layer 308 is made thin in comparison to layer 208 of fig2 to increase heat transfer between layer 306 and the substrate 310 . fig4 shows a cross - sectional view 400 of an exemplary photovoltaic assembly coupled to a backplane 410 . the photovoltaic assembly includes photovoltaic cell 402 mounted on an exemplary cell package 404 . the cell package 404 is coupled to an insulation layer or layers 408 via a thermal adhesive 406 that allows heat transfer between the cell package 404 and the insulation layer or layers 408 . the insulation layer or layers 408 may be a printable layer . in one embodiment , the insulation layer or layers 408 may be multi - layer insulators . the insulation layer or layer 408 may also include aluminum oxide , polymers , or other electrically resistive particles , etc . in an exemplary embodiment , the thermal adhesive 406 may include a material having at least one of a high thermal conductivity , a high mechanical flexibility , an ability to cure at low temperatures , an ability to withstand operating temperatures in a range from about โ 40 ยฐ c . to about 120 ยฐ c ., and an ability to adhere to the contacting faces of the cell package 404 and of the insulation layer or layers 408 providing electrical insulation . the thermal adhesive 406 may include , but is not limited to , silcool ยฎ tia - 0220 of momentive performance materials , inc . in an exemplary embodiment , the thermal adhesive 406 includes an insulating silicone adhesive . in alternate embodiments , the thermal adhesive 406 may include epoxy and acrylic adhesives . in another embodiment , the thermal adhesive 406 includes a polymer with thermally conductive particles embedded therein . exemplary polymers may include at least one of silicone , acrylic and epoxy . exemplary particles may include at least one of aluminum oxide , aluminum nitride and silicon dioxide . in an exemplary embodiment , the thermal adhesive 406 is compressed to a thin bond line of approximately 50 microns or less and is allowed to slightly extrude beyond the edges of the cell package 404 . the insulation layer 408 or layers reduces electrical conduction between the cell package 404 and the backplane 410 , while allowing heat transfer therebetween . the insulation layer or layers 408 may be bonded to an aluminum backplane 410 prior to bonding the insulation layer or layers 408 to the cell package 404 . the insulation layer or layers 408 may include an epoxy - based screen - printable material . in various embodiments , the insulation layer or layers 408 may include any electrically - insulating material with high dielectric strength , strong adhesion to the anodized aluminum of the backplane 410 and an ability to resist heat damage at temperatures in an operating range from about 85 ยฐ c . to about 120 ยฐ c . in an exemplary embodiment , the insulation layer or layers 408 may include techniflex by technic corp . and may be applied using screen printing methods on the backplane 410 to a thickness of about 15 microns . in alternative embodiments , the insulation layer or layers 408 may include , but is not limited to , paints , lacquers , powder coats , etc . such materials in the alternative embodiment of the insulation layer or layers 408 may include at least one of polyester , polyurethane , polyester - epoxy , epoxy , acrylic and silicone . the aluminum backplane 410 may include a sheet of anodized aluminum . in an exemplary embodiment , the backplane 410 includes a sheet of about 1 . 5 mm in thickness and an anodized layer thickness of about 10 microns . in various embodiments , the anodized layer may have a thickness that provides a protective layer to the aluminum surface as well as an electrical breakdown resistance . electrical breakdown resistance is provided by the thermal adhesive 406 , the insulation layer or layers 408 and the anodization of the backplane 410 . in an exemplary operation of the photovoltaic assembly , heat concentrated at the photovoltaic cell is transferred to the cell package 404 . at the cell package 404 , the heat is distributed in along lateral dimensions of the cell package at the copper substrate , such as substrate 210 in fig2 or alternately substrate 310 in fig3 in order to reduce an areal density of the heat by spreading the heat , in general along a lateral dimension of the substrate . heat from the substrate 210 is transferred to the aluminum backplane 410 through the insulation layer 408 . in various embodiments , the insulation layer 408 prevents current transfer between substrate 310 and the aluminum backplane 410 by providing a breakdown resistance to about 1700 volts or more . fig5 shows an exemplary assembly 500 for mounting a plurality of photovoltaic assemblies . cell package 502 a is shown having an associated photovoltaic cell 504 a and an associated secondary optic 506 a . cell package 502 b is shown having an associated photovoltaic cell 504 b and an associated secondary optic 506 b . cell packages 502 a and 502 b are coupled to the aluminum backplane 510 via exemplary screen - printed dielectric 520 . cell packages 502 a and 502 b are disposed on the backplane 510 at a location that corresponds to a focal point of their respective secondary optics 506 a and 506 b when the backplane 501 is perpendicular to solar radiation . in one embodiment , a protection diode 512 is packaged to the backplane in a manner similar to the packaging of cell packages 502 a and 502 b . the protection diode 512 includes a heat shield 514 that protects the protection diode 512 from heat or dissipates heat from the protection diode 512 . in an exemplary embodiment , the heat shield 514 includes a copper strip that covers the protection diode 512 and is soldered to contact pads of the diode package . interconnecting wiring 516 provides an electrical connection between cell packages 502 a and 502 b . in one embodiment , the interconnecting wiring 516 connects printed circuit layers of the cell packages 502 a and 502 b . the interconnecting wiring 516 includes copper wire that is soldered to electrodes of the cell packages 502 a and 502 b . the diameter of the wire is selected to handle a current provided by the exemplary cell packages and to reduce internal resistance losses kinks 518 are introduced into the interconnecting wiring 516 to avoid mechanical stress due to thermal expansion of the interconnecting wiring 516 . the interconnecting wiring 516 may be sufficiently rigid to be self - supporting . the interconnecting wiring 516 may be affixed to the backplane 510 separated by a separation distance in a range of about 1 millimeter to about 2 millimeters above the surface of the backplane 510 . such a configuration avoids physical contact with the insulating dielectric or with the aluminum anodized surface . fig6 shows a top view of a solar panel assembly 600 in an exemplary embodiment . the exemplary solar panel assembly 600 includes five tiers 602 a - 602 e of cell packages . in each tier , four cell packages , such as exemplary cell packages 604 a - 604 d , and a protection diode 606 are connected in parallel using the interconnecting wiring 608 . the cell packages are coupled to an aluminum backplane 610 via dielectric layer 612 . the tiers 602 a - 602 e are connected in series to form a solar panel assembly 600 having 20 cell packages . in various embodiments , the number of cells in parallel vs . the number of cells in series may be selected to achieve a selected current - voltage ratio of the solar panel assembly 600 . having cells wired in parallel ( in the tiers ) allows one or more cells to fail while maintaining the function of the panel at a reduced power , thereby improving an overall reliability of the solar panel assembly 600 . terminal connections 614 provide electrical coupling from the interconnecting wiring 608 to external circuitry . the interconnect wiring 608 may be soldered to an insulated multi - strand copper external connection wire ( not shown ) that penetrates the aluminum backplane 610 to an exterior of the solar panel assembly 600 via a strain relief cord grip . fig7 shows an exemplary solar panel package 700 of the present disclosure . the exemplary solar panel package 700 includes an enclosure 702 that encloses a solar panel assembly ( not shown ) having one or more cell packages according to the present disclosure . a lens 704 such as a fresnel lens is coupled to a top of the enclosure 702 using an adhesive , to enclose the solar panel assembly . in various embodiments , the adhesive includes a silicone adhesive . filtered vents are provided in the enclosure 702 to equalize pressures between an interior and an exterior of the enclosure 702 and to allow moisture within the enclosure to escape to an exterior of the enclosure 702 . fig8 shows an exploded view 800 of the solar panel package 700 of fig7 . the exploded view 800 shows the enclosure 702 and the fresnel lens 804 . additionally , the exploded view 800 shows the solar panel assembly 802 that includes a number of cell packages and resides in a chamber formed by the enclosure 702 and the fresnel lens 704 . the enclosure 702 may further include one or more cooling fins 804 to aid in the dispersion of heat from the enclosure 802 and thus from the solar panel 802 . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure . as used herein , the singular forms โ a โ, โ an โ and โ the โ are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms โ comprises โ and / or โ comprising ,โ when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one more other features , integers , steps , operations , element components , and / or groups thereof . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the description of the present disclosure has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the disclosure in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the disclosure . the embodiment was chosen and described in order to best explain the principles of the disclosure and the practical application , and to enable others of ordinary skill in the art to understand the disclosure for various embodiments with various modifications as are suited to the particular use contemplated the flow diagrams depicted herein are just one example . there may be many variations to this diagram or the steps ( or operations ) described therein without departing from the spirit of the disclosure . for instance , the steps may be performed in a differing order or steps may be added , deleted or modified . all of these variations are considered a part of the claimed disclosure . while the exemplary embodiment to the disclosure had been described , it will be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the disclosure first described . | 8 |
embodiments of the invention are described in detail hereinafter with reference to the accompanying drawings to further clarify the objectives , technical solutions and advantages of the embodiments of the invention . a wideband code division multiple access ( wcdma ) network system is one of the mainstream networks of the 3g mobile communication systems , adopting the general packet radio service ( gprs ) techniques . the schematic diagram illustrating the wcdma system architecture is shown in fig1 , which includes a terminal 101 , an access network 102 and a cn 103 , wherein the cn 103 connects with the internet to implement the interaction between the mobile communication network and the internet . the access network 102 further includes a base station ( node b ) 104 and a rnc 105 , the cn 103 further includes an sgsn and a ggsn . to play a stream media , there is also a content server 106 in the network , which is called a stream media server , and the stream media or the stream media link is directly placed on the webpage of the content server . the user visits the webpage of the content server 106 in the internet by the terminal 101 via the access network 103 and the cn 103 , to select , click and play the stream media which the user wants to watch . as the visit to the webpage of the content server by the user is an interactive traffic without requirements on rate and time delay , it uses the be traffic as the bearer . when the user clicks the stream media on the webpage , it is necessary to switch the be traffic to the streaming traffic to bear the stream media . in embodiments of the invention , the stream media refers to stream , namely real time stream , and the stream media transmission refers to the stream transmission . according to different initiators of traffic switching , the solution can be implemented in two embodiments , which are the traffic switching performed by the content server and the traffic switching performed by the network element such as the sgsn or the ggsn in the cn . the content server initiates the be traffic / streaming traffic switching . the flow chart of the embodiment is shown in fig2 , which includes the following steps . step 201 : a terminal sends a request for activating data traffic to a cn via an access network . step 202 : upon receiving the request , the cn sends a request to the access network for setting up a be traffic bearer channel . step 203 : upon receiving the request from the cn , the access network interacts with the terminal to set up the be traffic bearer channel . step 204 : the access network sends to the cn a message indicating the be traffic bearer channel has been set up successfully . steps 205 to 206 : the terminal visits the content server in the manner of be traffic bearer to obtain the stream media network link address through the access network and the cn . step 207 : the terminal visits the stream media network link , and requests the stream media transmission . step 208 : the content server analyzes the sdp file corresponding to the stream media to be transmitted , and obtains the qos requirement of the stream media transmission . the sdp file includes : basic information of the session , such as the title and author as well as the type of the stream media , the bandwidth requirement , and etc . step 209 : the content server sends a request for setting up a streaming traffic bearer to the sgsn of the cn , wherein the request includes the qos requirement of setting up the streaming traffic . the sgsn activates the pdp context by interacting with the ggsn , and authenticates the terminal user . step 210 : if the authentication is successful , the cn sends to the rnc of the access network a request for switching the bearer channel from the be traffic to the streaming traffic . step 211 : upon receiving the request , the access network interacts with the terminal to switch the bearer channel from the be traffic to the streaming traffic . step 212 : the access network notifies the sgsn in the cn that the bearer channel has been switched to the streaming traffic successfully . step 213 : the terminal sends a play signaling of the real - time streaming protocol ( rtsp ) to the content server , upon receiving the play signaling , the content server transmits the stream media to the terminal via the streaming traffic bearer channel . step 214 : when the stream media transmission is finished , the terminal sends to the content server a teardown signaling of rtsp for terminating the stream media transmission ; upon receiving the teardown signaling , the content server sends a request for setting up a be traffic bearer to the sgsn in the cn . step 215 : the sgsn in the cn sends to the rnc of the access network a request for switching the bearer channel from the streaming traffic to the be traffic . step 216 : upon receiving the request , the access network interacts with the terminal to switch the bearer channel to the be traffic . step 217 : the access network notifies the sgsn in the cn that the bearer channel has been switched to the be traffic successfully , and terminates the current traffic flow . in this embodiment , network element of the cn , for example , an sgsn or a ggsn analyzes network packet sent to a content server by a terminal . when determining that stream media transmission is about to start according to the contents of the network packet , the network element of the cn switches the bearer channel from the be traffic to the streaming traffic . when determining the stream media transmission is about to end from the contents of the network packet , the network element of the cn switches the bearer channel from the streaming traffic to the be traffic . therefore the embodiment requires the sgsn or the ggsn to analyze and identify the network packet , and the analyzing step can be divided into two steps : step 1 , analyzing a destination address of a forwarded network packet , and determining whether the destination address is the address of the content server . if the destination address is the address of the content server , proceed to step 2 ; otherwise , forward the network packet ; step 2 , further analyzing the content of the network packet , determining whether the content is a play signaling or a teardown signaling which both belongs to the rtsp ; if the content is a play signaling , the sgsn or the ggsn initiates the switching from the be traffic to the streaming traffic ; if the content is a teardown signaling , the sgsn or the ggsn initiates the switching from the streaming traffic to the be traffic . if the content of the network packet is neither of the two kinds of signaling , forward the network packet . the start or end of the stream media transmission is determined by identifying a play signaling or a teardown signaling in the step 2 mentioned above , which can also be determined by identifying other kinds of signaling indicating the start or end of the stream media or other characteristic information . the flow chart of this embodiment is shown in fig3 , which includes the following steps . step 301 : a terminal sends a request for activating data traffic to a cn via an access network . step 302 : upon receiving the request , the cn sends a request to the access network for setting up a be traffic bearer channel . step 303 : upon receiving the request from the cn , the access network interacts with the terminal to set up the be traffic bearer channel . step 304 : the access network sends to the cn a message indicating the be traffic bearer channel has been set up successfully . steps 305 to 306 : the terminal visits the content server in the manner of the be traffic bearer to obtain a stream media network link address via the access network and the cn . step 307 : the terminal visits the stream media network link , and sends a rtsp play signaling to the content server . step 308 : the sgsn or the ggsn determines that the signaling sent to the content server from the terminal is the play signaling by analyzing and identifying the network packet , obtains and analyzes the sdp file corresponding to the stream media from the content server , and obtains the qos requirement of the stream media transmission . the content of the sdp file includes basic information of the session such as the title and author , the type of the stream media , the bandwidth requirement , and etc . the sgsn activates the pdp context through interacting with the ggsn , and authenticates the terminal user . step 309 : if the authentication is successful , the sgsn of the cn sends to the rnc of the access network a request for switching the bearer channel from the be traffic to the streaming traffic . step 310 : upon receiving the request , the access network interacts with the terminal to switch the bearer channel from the be traffic to the streaming traffic . step 311 : the access network notifies the sgsn of the cn that the bearer channel has been switched to the streaming traffic successfully . step 312 : the content server transmits the stream media to the terminal via the established streaming traffic bearer channel . step 313 : when the stream media transmission is finished , the terminal sends a rtsp teardown signaling to terminate the stream media transmission to the content server , the sgsn of the cn or the ggsn of the cn determines the signaling sent to the content server by the terminal is a teardown signaling by analyzing and identifying the network packet . step 314 : the sgsn of the cn sends to the rnc of the access network a request for switching the bearer channel from the streaming traffic to the be traffic . step 315 : upon receiving the request , the access network interacts with the terminal to switch the bearer channel to the be traffic . step 316 : the access network notifies the sgsn of the cn that the bearer channel has been switched to the be traffic successfully . the foregoing describes only preferred embodiments of the invention and is not to limit the invention . any modification , equivalent substitution , and improvement without departing from the spirit and principle of the invention should be covered in the protection scope of the invention . | 7 |
the present invention is shown in an elevational view , partially in cross - section , in fig1 . there is shown rescue tool 1 having a frame 3 which is constructed so as to be integrally formed with handles 5 . a pair of arms 7 and 9 are attached to each other by bolt 11 mounted through yoke 13 . the arms are constructed of a graphite laminate composite material with a directional fiber orientation to maximize strength and stiffness . the frame may be constructed of metal , or of a hybrid of metal and graphite . thus , the arms are essentially graphite - reinforced plastic , while the frame is metal or graphite - reinforced . the arms made of the graphite laminate composite are extremely strong , but are of lighter weight than the metal arms known in the prior art . the arms in the present invention may weigh about two pounds , while the steel arms used previously might be 91 / 2 pounds . unlike those of the prior art , the arms of the present invention are flat plates , and need not be made of i - beam or box cross - section . despite being flat plates , the arms maintain their rigidity . the overall weight of the complete tool is approximately 50 pounds , a substantial reduction compared to the prior art tools which have weighed as much as 70 pounds , or more . arms 7 and 9 are also connected to frame 3 by pivot links 15 and 17 . the pivot links are connected to the arms 7 and 9 by arm pins 19 and 21 , and are connected to the frame 3 by pivot pins 23 and 25 . disposed within hollow cylindrical region 27 is piston 29 . piston 29 is adapted to push on yoke 13 , through hollow cylinder 31 which is connected directly to the base 33 of yoke 13 . region 27 is adapted to receive high - pressure fluid , as will be described below . region 27 is further defined by end cap 35 which is attached to frame 3 by bolt 37 . valve block 39 is mounted on frame 3 , and holds the valves that are used for directing fluid into the regions around the piston , as will be described more fully below . attached to arms 7 and 9 are a pair of cutting blades 41 and 42 ( blade 42 being shown in phantom , as the blades overlap each other when the arms 7 and 9 are together ). due to the composition of the arms , the arms maintain their rigidity such that when the arms come together , the blades cut like a scissors . that is , the blades will not separate while cutting but will make a clean , sharp cut . attached to the tips of arms 7 and 9 are work jaws 43 and 45 . the work jaws , which can be made of steel , have holes 46 which are suitable for insertion of chains or nylon belts to perform lifting operations . work jaws 43 and 45 are used as the working tool surfaces for pushing , prying and lifting . the work jaws will become worn with use , and may be replaced . they are attached to arms 7 and 9 by a pin with an internal ball detent ( not shown ) to prevent accidental withdrawal , but which is removable by hand , thus making it possible to replace the work jaws in the field , without tools . the holes 46 can be used to attach chains or nylon belts , or other material of high tensile strength , in order to use the tool for lifting . the cutting blades 41 and 42 are attached to their respective arms by a plurality of bolts 47 . as is apparent from fig1 when piston 29 is forced upward , as indicated by the direction of arrow a , the arms 7 and 9 separate . as the arms separate , they are free to pivot on links 15 and 17 , as well as around yoke 13 . conversely , when the piston is moved downward , the arms 7 and 9 are forced together . when the hydraulic pressure on the piston 29 is sufficiently great , the arms 7 and 9 can be forced together or apart with extraordinary power , and can be used to push or pull with tremendous strength . also , when the arms 7 and 9 are forced together , blades 41 and 42 can be utilized as a high - powered scissors for cutting through metal . it is to be appreciated that the fixed point of rotation of the arms is at the center of the apparatus , i . e . at the yoke 13 , and not at the outer edges of the apparatus . as the piston 29 is moved , the arms are allowed to rotate around arm pins 19 and 21 , and the arm pins also move , by virtue of rotation of the links 15 and 17 around pivot pins 23 and 25 . because the force is applied at one point in the center ( and not at two points , on the ends , as was done in the prior art ), it is possible to make the distance from the yoke 13 to the arm pins 19 and 21 greater , thus increasing the lever arm length , and improving performance . in fact , the ability to use a longer lever arm results in the ability to achieve the same force with a smaller piston , thus reducing the weight of the tool . the detailed structure of the links and the yoke are further illustrated in fig2 and 3 . fig2 which is a cross - sectional view taken along the lines 2 -- 2 of fig1 shows frame 3 and arms 7 and 9 . arms 7 and 9 are shown attached to links 15 and 17 by arm pins 19 and 21 . also shown are pivot pins 23 and 25 , which attach the links 15 and 17 to frame 3 . also visible in fig2 are cutting blades 41 and 42 . the arms 7 and 9 are sandwiched between members 49 and 51 of yoke 13 ( see fig1 ). clamped around members 49 and 51 are bolt 52 and nut 50 . fig3 which is a cross - sectional view taken along the line 3 -- 3 of fig1 provides more detailed illustration of link 15 . arm pin 19 is shown holding arm 7 to link 15 . the frame pivot bolt 23 and pivot pin nut 55 are shown . also visible , mounted on handle 5 is valve block 39 to which are attached valve triggers 61 . the valve triggers 61 are used to control the tool manually . when the appropriate trigger is squeezed , the arms are made to open or close , according to the direction of high - pressure fluid flow in the hydraulic system , which will be explained below . fig6 is a schematic diagram of the hydraulic system , together with an abbreviated cross - sectional elevation of the rescue tool . although the rescue tool , as shown in fig6 is not identical to that shown in fig1 it is understood that fig6 represents the same rescue tool as that in fig1 and thus some of the same reference numerals are used in the schematic drawing of fig6 for purposes of clarity . fig6 shows hydraulic pump 71 which draws fluid along line 73 from reservoir 75 . fig6 also depicts schematically valve 77 which has four ports and three positions . valve 77 is centered by spring means 79 , and is manually operated by pressing triggers 80 . the triggers 80 are either identical to , or are operatively connected to , the valve triggers 61 of fig3 . the ports of valve 77 are indicated by the letters a , b , c , and d . in the quiescent position , which is the position shown in fig6 ports a and b are connected within valve 77 , so that fluid from reservoir 75 is pumped along line 73 and back to reservoir 75 through line 81 . when valve 77 is moved to the right in fig6 fluid pumped by pump 71 through line 73 enters the valve 77 at port b and exits valve 77 at port d along line 83 . the fluid then enters lower region 85 of the cylinder 91 . at the same time , any fluid that is in upper region 87 of cylinder 91 is drawn out through line 89 , entering valve 77 at port c , exiting valve 77 at port a , and returning to reservoir 75 through line 81 . the net effect is to cause an increase in pressure in region 85 and a decrease in pressure in region 87 , thereby causing piston 29 to move up , and to force arms 7 and 9 apart . conversely , when valve 77 is moved to the left in fig6 fluid pumped by pump 71 through line 73 enters valve 77 at port b and exits valve 77 at port c , and travels through line 89 into upper region 87 of cylinder 91 . at the same time , fluid in lower region 85 of cylinder 91 exits the cylinder through line 83 , and enters valve 77 at port d , leaves valve 77 at port a , and returns to reservoir 75 through line 81 . the net effect is an increase in pressure in upper region 87 , and a decrease in pressure in lower region 85 , causing piston 29 to move downward , thereby causing the arms 7 and 9 to come together . the hydraulic system is portable , and the pressure lines shown schematically in fig6 are preferably flexible hoses with quick - connect couplings having appropriate check valves . the operating pressure of the system should be at least 5 , 000 p . s . i . for a pulling distance of 32 inches , a minimum opening force of 12 , 000 pounds is required . a cutting force of 40 , 000 pounds is also needed . fig4 and 5 together illustrate the attachment of the arms to the yoke in the embodiment described above , and in an alternative embodiment . both figures are taken in a direction indicated by line 4 -- 4 of fig1 . fig4 shows the embodiment used in the tool described so far . arms 7 and 9 are shown held within yoke 13 by bolt 101 , the bolt being mounted within bushing 103 . it is seen that head 105 of bolt 101 , and nut 107 press upon the external surfaces 109 and 111 of yoke 13 . although this embodiment has been found to produce a workable tool , it has the disadvantage that , because of the tightness of the nut and bolt , the yoke may be deformed when this embodiment is used . the embodiment shown in fig4 produces a mechanical couple on the yoke , which tends to twist the yoke . the alternative embodiment , illustrated in fig5 avoids the problem of deformation of the yoke . in this embodiment , there is effectively only one member , namely nut 113 , pressing upon an external surface 111 of yoke 13 . bolt 115 is disposed within yoke 13 , and rests upon a portion of washer 117 . glide washer 119 separates yoke 13 from arms 7 . it is found that this arrangement avoids the deformation problem described above . it is apparent that the objects of the present invention are fulfilled by the above disclosure . many modifications to the basic design are possible . all such modifications which would be apparent to those skilled in the art are deemed within the spirit and scope of the following claims . | 8 |
the following description of an embodiment of the present invention is made with reference to the above - described drawings wherein like numerals refer to like parts or components through the several figures . the present invention is directed to a method and system for locating and retrieving stored computer files that are related to an incoming telephone call directed to a computer user . fig1 is a block diagram illustrating an exemplary operating environment for an embodiment of the present invention and includes a general description of a modern public switched telephone network through which the present invention preferably operates . the modern public switched telephone network ( pstn ) has separate signaling paths for voice signals ( or other customer - utilized communication circuits ) and for control signals , which include information transmitted throughout the network to control the connection and disconnection of the voice circuits . the public switched telephone network that evolved in the 1980s also incorporated the advanced intelligent network ( ain ). some of the components of the advanced intelligent network are illustrated in fig1 . the advanced intelligent network ( ain ) uses the signaling system 7 ( ss7 ) network for signal or system control message transport . the components thereof are well known to those skilled in the art . the operation of many of the components of the advanced intelligent network is also described in u . s . pat . no . 5 , 245 , 719 to weisser entitled โ mediation of open advanced intelligent network interface by shared execution environment โ which is incorporated herein by reference . the ss7 communications protocol is provided in the document entitled โ bell communications research specification of signaling system 7 ,โ document tr - nwt - 000246 , issue 2 ( june 1991 ), plus revision 1 ( december 1991 ), which is also incorporated herein by reference . referring still to fig1 , a plurality of central offices is provided in a typical public switched telephone network . each central office may include an electronic switch known to those skilled in the art as a service switching point ( ssp ). these are indicated in fig1 as ssp switches 12 , 14 , and 16 . the number of ssp switches depends on the number of subscribers to be served by the public switched telephone network . an ssp is the ain component of a typical electronic central office switch used by a local exchange carrier . the terms โ ssp โ and โ switch โ are used interchangeably hereinafter and are understood to refer to a telecommunications switch having ain capability and which may be utilized for connecting voice channel circuits , including voice channel lines , such as trunk circuits 30 and 32 . central offices switches ( ssp ) 12 , 14 , and 16 have a plurality of subscriber lines 18 , 20 , and 22 connected thereto . each of the subscriber lines 18 , 20 , and 22 is connected to a terminating piece or pieces of customer premises equipment that are represented by telephone sets 21 , 24 and 28 . ssp switches 12 , 14 , and 16 are connected by a plurality of trunk circuits indicated as 30 and 32 in fig1 . these are the voice path trunks that interconnect the central offices 12 , 14 , and 16 and over which calls are connected when completed . each piece of terminating equipment in the pstn is preferably assigned a directory number . the term โ directory number โ is used herein in a manner consistent with its generally understood meaning of a number that is dialed or input by an originating party at an originating station to reach a terminating station associated with the directory number . a directory number , typically a ten digit number , is commonly referred to as a โ telephone number โ and may be assigned to a specific telephone line , such as the telephone line 18 shown in fig1 . much of the intelligence , and the basis for many of the enhanced features of the network , resides in the local service control point ( scp ) 42 that is connected to signal transfer point 34 via ss7 data link 44 . as is known to those skilled in the art , service control points , such as scp 42 , are physically implemented by relatively powerful fault tolerant computers . among the functions performed by the service control points is maintenance of network databases used in providing enhanced services . the scp 42 is also connected to a caller id with name ( cnam ) database 48 . the cnam database comprises a plurality of directory numbers along with associated names for the directory numbers . the cnam database may be used to provide a look - up database to provide caller identification ( id ) service . in operation , the intelligent network elements of the telecommunications network 100 , as described above , communicate with each other via digital data messages transmitted over the network of digital data links . an ssp may be configured to interface with these network elements through the use of a trigger . a trigger in the network is an event associated with a particular subscriber line or call that causes the ssp to generate a data packet message to be sent to a service control point . in order to keep the processing of data and calls as simple and generic as possible at central office switches , such as ssp central office switches 12 , 14 , and 16 , a relatively small set of triggers are defined at the ssp central office switches for each call . the message created by an ssp 12 in response to a trigger is known as a โ query โ message . a query message opens a โ transaction โ and the ssp generally holds the communication until it receives a reply from an appropriate network element via the network of digital data links instructing the ssp 12 to take a certain action . if the ssp 12 receives no instructions within a certain amount of time , the ssp โ times - out โ and executes a default task for the communication . the reply to the query message may be a โ conversation โ message or a โ response โ message . conversation messages allow for bi - directional exchanges between network elements while the transaction remains open . a โ response โ message closes the transaction opened by the query message , and usually instructs the ssp 12 to route the held communication for connection with a terminating station . query messages , conversation messages , and response messages are standard types of messages defined by the ain protocol . the details of the ain protocol are known to those skilled in the art and will not be further described herein . for more information regarding the ain protocol , see bellcore specification gr - 1298 - core switching systems generic requirements for ain 0 . 1 , which is incorporated herein by reference . the modern advanced intelligent network also includes service nodes ( sn ) such as service node 55 shown in fig1 . those skilled in the art are familiar with service nodes , which are physically implemented by the same types of computers that embody the scp 42 . in addition to the computing capability and data base maintenance features , service nodes 55 use isdn lines and may include dtmf signal recognition devices , tone generation devices , text to speech ( tts ) voice synthesis devices and other voice or data resources . as shown in fig1 , the connection is through the ssp . for example sn 55 is connected to scp 42 via isdn links 54 to ssp 12 , isdn / ss7 protocol conversion in ssp 12 , and ss7 links 36 and 44 . it is understood that the service node 55 may also be connected to a service management system 46 , but such connection is not shown in fig1 . service nodes 55 are used principally when some custom feature or service is needed that requires an audio connection to the call or transfer of a significant amount of data to a subscriber over a switched connection during or following a call . the computer 23 illustrated in fig1 represents any well known computing device capable of processing information that may be stored and subsequently retrieved by the computer user . the computer 23 may be operated on the same subscriber line 18 as the telephone 21 of the computer user such as often the case in a home computing or small business computing environment . the subscriber line 18 connected to the computer 23 may be a standard analog subscriber line or may include other lines for transmitting data to and from the computer 23 such as a digital subscriber line or t1 line . alternatively , the computer 23 may be part of a distributed computing environment in a large business or educational institution where data is transmitted to and from the computer 23 in accordance with the present invention from a telecommunications network 100 that is connected to the distributed computing environment or network in which the computer 23 resides . likewise , data and files saved on the computer 23 may be saved on and retrieved from a remote memory server connected to the computer 23 via a distributed computing environment . referring now to fig2 , in accordance with the present invention , incoming calls directed to the operator of a telephone 21 and computer 23 are received at the telephone 21 along with caller identification information obtained on the calling party . as should be understood by those skilled in the art , when the calling party initiates a telephone call to the called party from the calling party &# 39 ; s telephone 24 , an intelligent network component such as the service control point 42 obtains caller identification information such as the caller &# 39 ; s name , telephone , and address from the cnam database 48 for presentation to the called party at the called party &# 39 ; s telephone 21 . operation of caller identification systems is well known to those skilled in the art . a computer telephony interface 210 serves as an interface between the called party &# 39 ; s telephone 21 and the called party &# 39 ; s computer 23 . computer telephone integration , as facilitated by the computer telephony interface ( cti ) 210 , is a process for integration of a telephone system with a computing system . for example , the cti 210 may be used for allowing computer applications to answer incoming calls , provide database information on a computer screen at the same time the call comes in , automatically route and reroute calls , automatically dial and speed dial outgoing calls from a computer resident database and identify incoming customer calls and transfer them to predetermined destinations based on caller identification received on the incoming telephone call . according to the present invention , the cti 210 serves as an interface between the called party &# 39 ; s telephone 21 and the called party &# 39 ; s computer 23 for linking computer files saved on the called party &# 39 ; s computer 23 to the incoming telephone call based on caller identification information received on the incoming telephone call . the computer telephony interface 210 may be a software application program resident on the called party telephone 21 for passing information such as the caller identification information on a calling party to the called party computer 23 . alternatively , the computer telephony interface 210 may also include a software application program resident on the called party computer 23 for receiving and acting upon information received from the called party telephone 21 such as the caller identification information on a calling party . the software synchronization program 220 is a computer software application according to the present invention resident on the called party computer 23 for linking stored computer files to caller identification information received through the cti 210 on an incoming telephone call . the software synchronization program 220 may include an application programming interface ( api ) which as is known to those skilled in the art is a set of routines used by an application program to direct the performance of procedures by the computer &# 39 ; s operating system . in accordance with the present invention , the procedures performed by the program 220 include searching for the file paths to stored computer files that are associated with an incoming telephone call based on caller identification information for the incoming telephone call . additionally , the software synchronization program 220 launches a dialog box , discussed with reference to fig3 , for providing the called party access to all stored computer files related to the incoming call . accordingly , the software synchronization program 220 serves as an intermediary application between the cti 210 and stored computer files related to an incoming telephone call . the application program 230 is illustrative of any software application program for creating and storing files in accordance with the present invention . for example , the application program 230 may be a word processing program , a spreadsheet program , a database program , a desktop publishing program , and the like . the application program 230 is limited only by the numbers and types of software application programs loaded and operated on the called party &# 39 ; s computer 23 for creating , storing , and operating on computer files . the memory 240 is illustrative of memory containing stored computer documents that may be accessed , retrieved , and displayed in accordance with the present invention . for example , the documents 340 , 350 , 370 may include word processing documents , spreadsheet documents , database documents , and the like . the memory 240 may be resident on the computer 23 or may be resident on a remote storage device such as a remote memory server that may be accessed by the computer 23 via a distributed computing environment . in order for the software synchronization program 220 to locate stored computer files 340 , 350 , 375 for presentation to the called party in accordance with the present invention , the stored files must include information that allows the software synchronization program 220 to locate those files in relation to caller identification information received on an incoming telephone call . the document management system 245 is illustrative of a software program or application programming interface for collecting information related to a given computer file and linking that information to the computer file for subsequent searching and retrieval of the file based on that collected information . for example , in accordance with a variety of well known document management systems , when a user of the computer 23 saves any computer file 340 , 350 , 375 , the computer user is presented with a dialog box that requires the input of certain identification information for the file before the file is saved . for example , upon selection of the save functionality of the application program 230 , such as a word processing program , the user of the computer 23 may be presented with a dialog box that requests such information as a name for the file to be saved , a name or title associated with the file , or other information that may be used to locate the file during a subsequent search . in accordance with the present invention , the document management system 245 in conjunction with the application program 230 allows the user to save information including the name of a party related to the stored file , the telephone number of a party associated with the stored file , the address of a party associated with the stored file , or any other pertinent personal or related information . for example , if the user has prepared a spreadsheet of accounting data for a project on which she is working with a fellow employee , when the user saves the spreadsheet file with the software application program 230 , the document management 245 allows the computer user to store the name of the fellow employee , the fellow employee &# 39 ; s telephone number , the fellow employee &# 39 ; s address , and any other information , such as the employee &# 39 ; s job title , wireless telephone number , and the like . according to the present invention , when an incoming telephone call is received by the called party on the called party &# 39 ; s telephone 21 , caller identification information received on the calling party , as described above , is used by the software synchronization program to search for computer files based on the caller identification information so received . that is , the software synchronization program searches on caller identification information such as the caller &# 39 ; s name , telephone number , and address . based on the search of the memory 240 by the software synchronization program 220 , all computer files 340 , 350 , and 375 , with stored identification information matching caller identification information received on the calling party allows the software synchronization program to flag those files for presentation to the called party in response to the incoming telephone call . referring now to fig3 , a graphical user interface 310 for presentation of caller identification information on an incoming call and for providing the called party access to computer files related to the incoming call is illustrated . when an incoming telephone call is received and information on that call such as caller identification information is passed to the called party &# 39 ; s computer 23 via the cti 210 , the software synchronization program 220 launches the graphical user interface 310 on the display screen 300 of the computer 23 . the caller identification information 325 including any information included in the caller identification data such as the telephone number , address , e - mail address , work address , etc . for the incoming telephone call is displayed . prior to launching the user interface dialog box 310 , the software synchronization program searches for all files 340 , 350 , 360 , 370 , 375 , associated with the incoming call , as described above with reference to fig2 . once the software synchronization program establishes a file path to each of the stored files related to the incoming call , the dialog box 310 is displayed to the called party so that the called party may access the related files . an icon 330 is illustrated in fig3 for presentation of all files related to the incoming telephone call located by the software synchronization program , as described above . selection of the icon 330 launches a display box 335 that displays each of the related files . as shown in fig3 , a letter document 340 , a spreadsheet document 350 , a presentation document 360 , and a database document 370 are illustrated as documents located and presented to the called party as related to the incoming telephone call . alternatively , the display box 335 may be presented to the called party automatically without selection of the icon 330 . as should be understood by those skilled in the art , the presentation of the files 340 - 375 may be done according to a number of display protocols such as alphabetical ordering or ordering based on the date of document modification . referring now to fig4 , the following is a description of an exemplary operation of an embodiment of the present invention with reference to fig1 - 4 . fig4 illustrates a logical call flow of steps performed by a method and system of the present invention for linking and retrieving stored computer files related to an incoming telephone call . the method 400 begins at start step 405 and proceeds to step 410 where a calling party places a telephone call from the calling party &# 39 ; s telephone 24 to the called party at the called party &# 39 ; s telephone 21 . at step 415 , a query is generated from the central office ssp 14 of the calling party to the service control point 42 for obtaining caller identification information on the calling party from the cnam database 48 . at step 420 , the telephone call from the calling party along with the caller identification information retrieved from the cnam database 48 is routed to the called party at the called party &# 39 ; s telephone 21 through the called party &# 39 ; s central office ssp 12 in accordance with standard call routing procedures . according to the present invention , the computer telephony interface 210 recognizes the caller identification information and routes the caller identification information to the software synchronization program resident on the called party &# 39 ; s computer 23 . at step 425 , in response to receipt of the caller identification information on the incoming call , the cti 210 launches the software synchronization program 220 for searching and retrieving stored computer files related to the incoming telephone call . at step 430 , the software synchronization program searches the memory 240 of the computer 23 for computer files related to the incoming telephone call based on the caller identification information associated with the incoming telephone call . as described above with reference to fig2 , the software synchronization program locates related computer files based on previously input information related to the incoming telephone call such as the caller &# 39 ; s name , telephone number or address . once the software synchronization program 220 locates all computer files related to the incoming telephone call , the dialog box 310 is launched on the display screen 300 of the computer 23 at step 435 . as shown in fig3 , according to a preferred embodiment , caller identification information for the incoming telephone call is presented in the dialog box to the user of the computer 23 . at step 440 , based on the files located by the software synchronization program 220 , the icon 330 is enabled and is displayed to the user of the computer 23 in the dialog box 310 . as described above , selection of the icon 330 causes the display box 335 to be presented to the user of the computer 23 for presentation of a list of all files located by the software synchronization program 220 that are related to the incoming telephone call based on the caller identification information for the incoming telephone call . alternatively , as described above , the display box 335 may be presented to the user of the computer 23 automatically without selection of the icon 330 . at step 450 , the called party may view the list of documents found by the software synchronization program and select a document that the called party determines is most likely the document the calling party is calling to discuss . or , the calling party may wait until the calling party tells the called party the precise document the calling party would like to discuss . for example , if the calling party recognizes from the caller identification information 325 that the calling party is a co - worker with whom the called party has very recently constructed the spreadsheet document 350 displayed in the display box 335 , the called party may select the spreadsheet document 350 at step 450 . at step 455 , selection of the stored computer file , such as the spreadsheet document 350 , launches an instance of the application program 230 responsible for creation and storage of the selected file , and the selected file , such as the spreadsheet document 350 is displayed to the called party on the computer screen 300 of the called party &# 39 ; s computer 23 . advantageously , the called party quickly and efficiently locates and launches the selected computer file related to the incoming call without having to place the caller on hold or cause the caller to wait while the called party searches for a selected file through a large list of stored files on the called party &# 39 ; s computer 23 . it will be apparent to those skilled in the art that various modifications or variations may be made in the present invention without departing from the scope or spirit of the invention . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . | 7 |
as used herein , โ a โ or โ an โ means one or more . unless otherwise indicated , the singular contains the plural and the plural contains the singular . as used herein , โ surface โ refers to locations at or above the surface . attention is first directed to fig1 wherein the preferred embodiment is shown . in the preferred embodiment of this invention , there is a well construction method where a first conduit 4 commonly known to those familiar with the art of well construction as casing is deployed into the earth 18 through the well bore 3 . casing 4 is grouted into a well bore 3 in the earth 18 generally referred to as a well bore 3 . a second conduit , shown in fig1 as conduit 5 , may be deployed into the well bore 3 through the casing 4 . conduit 5 may be a continuous length of tubing , referred to as coiled tubing , and is lowered and extracted from the well through an elastomeric sealing device 6 separating the well pressure environment from the surface environment . it should be understood that although coiled tubing and injector heads is preferred and discussed in this example , any other conduit material , deployment method , and extraction method , familiar to those of ordinary skill in the art , may be used . for example , powered spooling drums , drilling rigs and work over rigs with jointed pipe may be used instead of , or in addition to coiled tubing . the coiled tubing 5 is lowered and extracted from the well with a coiled tubing injector device 7 that mechanically engages the coiled tubing 5 to push or pull it into the well . it is clearly understood to those familiar with the art of well construction that the coiled tubing can be replaced with other types of tubing , such as with jointed tubing that is threaded and lowered into the well with a rig and that the coiled tubing or jointed tubing can be lowered into well tubing or casing but without changing the herein disclosed inventive method . the embodiment shown in fig1 includes a fracture head or well head manifold 8 connected to the casing 4 for the injection of fluids from the surface into the casing 4 . manifold 8 , together with the region that is within casing 4 yet outside of conduit 5 to which manifold 8 is fluidly coupled , comprises the first conduit ( as distinguished from the second conduit 5 ). the stimulation fluid 51 to be injected is pumped from at least one tank or blender 10 through at least one pump 9 into the casing 4 through manifold 8 . the fluid 51 for the purpose of this embodiment is a water based fluid with a polyacrylamide , a friction reducer fluid , mixed into it and is transmitted through the casing 4 and injected through the perforation tunnels 2 into at least one subterranean reservoir 1 . during the injection process of the preferred embodiment , another fluid 17 is injected down the coiled tubing 5 to mixing point 11 . for the purpose of this embodiment fluid 17 is a fluid like hydrogen peroxide that breaks the long chain polymer bonds of polyacrylamide fluid 51 as they are mixed at injection point 11 and continue into the subterranean reservoirs . the position of the mixing point 11 in the well may be modified during the injection process by lowering or raising the coiled tubing 5 with the tubing injector device 7 . in preferred embodiments , mixing point 11 comprises an injection valve on coiled tubing conduit 5 , although mixing point 11 can take any form whereby the fluid paths defined by coiled tubing conduit 5 and that of manifold 8 and the interior of casing 4 come into fluid communication with one another . injection valve 11 preferably contains a back pressure valve or be in combination with a back pressure valve on the coiled tubing 5 in order to keep fluids 51 from the casing 4 from entering the coiled tubing 5 . the second fluid 17 being injected into the well through coiled tubing 5 is pumped from at least one tank 12 at surface through a surface pump 13 into the coiled tubing 5 , which may be partially wound on a coiled tubing reel 21 . although the described preferred embodiment deals with wells and formation having perforated intervals , it should be noted that the method is also applicable to wells and formations which do not have perforated intervals . such perforated intervals can be those that are naturally - occurring and those that are formed by use of explosive charges when drilling the well . in the preferred embodiment there is also a data communication line 14 inside the coiled tubing 5 connected at surface to a data collection device 15 . this data communication line can be connected to a pressure and temperature measurement and / or recorder 16 connected and disposed in the casing 4 on the coiled tubing 5 . the data communication line 14 can be an optical fiber transferring data from the subterranean environment to the surface . the data is collected using analytical and / or recording device 15 . although device 15 is shown at the surface in the fig1 , it should be understood that the analytical data may be collected and recorded in a subterranean environment also . one non - limiting example of device 15 is an optical time domain reflectometer ( otdr ) that launches light down the optical fiber 14 disposed in the coiled tubing 5 and measures the backscattered light up the optical fiber 14 to surface where it is interpreted in the otdr device at surface to yield a distributed temperature profile versus depth along the length of the fiber . other optical , electrical , hydraulic , nuclear , acoustic , and spectroscopic measurements may be used to remotely gather information regarding well conditions , with the resulting data then transmitted via the communication line 14 . preferably this communication transmits real - time data , which can be used to optimize the injection profile of fluids into intervals 1 and 2 in real - time . various fluids and injection methods including , colloidal suspensions , solids and gases can be injected down coiled tubing 5 to affect the injection fluid process where said fluids may include additives that affect , among other things , viscosity , composition , ph , temperature , pressure , and flow rate . other recording and / or analytical devices , known to those of skill in the art , which measure and / or record temperature , pressure , radio - activity , composition , and / or any other relevant parameters may be used , either alternatively or additionally . the communication line 14 may also be an electronic communication line that sends and receives electronic data communications relating to well conditions . as for the case for an electronic communication line , wherein an electronic communication line is used , it is preferable that any data transmitted is transmitted in real - time to permit real - time optimization of fluid injection . additionally , the point or points of data gathering with the data temperature measurement and / or recorder 16 and the distributive sensor optical fiber 14 can be affected similarly by raising or lowering the coiled tubing 5 with the tubing injector device 7 . fig2 illustrates another embodiment in which a fluid 17 is injected into second conduit 5 while fluids comprising injected fluid and reservoir fluids 53 are produced up the first conduit which comprises the volume of casing 4 outside of second conduit 5 and manifolds 8 . in a preferred embodiment , fluids from reservoir 1 and 2 are produced back through the perforations 2 into the casing 4 and back to the surface through manifold 8 or a wellhead while simultaneously injecting a fluid 17 like hydrogen peroxide from the surface tank 12 through the coiled tubing 5 into the casing 4 . this simultaneous injection of hydrogen peroxide into the well casing 4 while the well is flowing back fluid 53 further treats the fluids 53 in the well thereby reducing and killing bacteria and polymers in the flowed back fluids 53 . it is understood that , in addition to , or in lieu of the fluid hydrogen peroxide , many combinations of other compositions can be added to the coiled tubing of 5 , including but not limited to , bactericides , oxidizers , surfactants , acids , salts , ph modifiers , scale inhibitors and their various concentrations and combinations can be used in this process without deviating from the scope of the invention . this embodiment also teaches that the injection point 11 can be changed to be above or below the perforated interval 1 and or 2 before during and after the fluid is being injected down coiled tubing 5 while fluids 53 are flowing or when the fluids of 53 are not flowing . for example , the coiled tubing 5 with the optical fiber 14 can be lowered with injector head 7 to below both perforated intervals 1 and 2 and an optical survey of the distributive temperatures of the well bore maybe taken by launching light from the otdr device 15 while the well fluids 53 are flowing . conversely , the otdr well temperature profile survey can be obtained when fluids 53 are not flowing . attention is directed to fig3 , which is a specific sub - embodiment of the embodiment of fig1 wherein the coiled tubing 5 with data communication line 14 disposed in the coiled tubing 5 is lowered to point below at least one perforated interval 22 at some time during the injection process . as a result , mixing point 11 is below at least one perforated interval 22 . this lowering or raising of the coiled tubing 5 in the well can take place at any time during the injection process or after the injection process and the depth of mixing point 11 can be selected by monitoring the distributive temperature profiles of the well on the otdr ( and / or other analytical device ). the injection of crosslinker material can be increased down the coiled tubing 5 such that it causes the fluid 51 being injected from surface through the casing 4 to have a higher viscosity below the perforated interval 22 thus diverting more of the stimulation fluid being injected down the casing 4 into the upper perforated intervals at 22 . many perforated intervals can be treated in a well in this manner by diverting the fluids from the bottom - most perforations sequentially up the well by injecting a viscosity modifier through the coiled tubing , and then adjusting ( raising or lowering ) the coiled tubing injection depth in the well . by thus varying the location of the down - hole mixing , the viscosity profile and hence the fluid injection profile into multiple well intervals can be manipulated . referring now to fig1 in the preferred embodiment , a fluid composition 51 is injected , from a surface tank 10 through a pump 9 wherein the composition comprises a friction reducer chemical such as polyacrylamide . the composition may comprise solids added at the surface . the friction reducer can be blended into the composition ( which may be water ) in the tank 10 or added at the pump 9 at surface ; in either case the friction reducer is added to the composition being injected into the well casing 4 . the composition comprising the friction reducer is then pumped through the manifold 8 into the casing 4 and into the perforations . simultaneously , while the composition is being pumped down the casing 4 , an oxidizer fluid ( such as a fluid comprising hydrogen peroxide ) is injected down the coiled tubing 5 from a surface tank 12 through a pump 13 and into the coiled tubing 5 the well casing through the mixing point 11 where the hydrogen peroxide mixes with the composition in the casing 4 at a depth in the well denoted by 11 . in the preferred embodiment the distal end of the coiled tubing and the mixing point 11 ( preferably an injection valve ) are located at a well depth which is approximately 100 feet above the depth of perforated intervals 1 and 2 . in the preferred embodiment the perforated depth and the casing are located several thousands of feet below the surface of the earth 18 . this allows the friction reducer to form a friction reducing film on the internal diameter of the casing 4 and the outer diameter of the coiled tubing 5 from the surface depth 18 to the depth 11 thereby maximizing the effect of the friction reducer to reduce fluid friction between the injection fluid and the well conduits during the injection . just above the perforated interval at depth 11 , the mixing of the hydrogen peroxide 17 begins a process of breaking down the long polymer chains of the polyacrylamide thereby reducing its molecular length and reducing its adhesion and plugging to reservoir porosity and permeability upon prior to fluid 51 entering the reservoirs 56 . in the preferred embodiment of fig1 , the down - hole pressure is recorded at the recorder 16 and is read at the surface from the data recording device 15 , preferably in real time with the simultaneous injection of the hydrogen peroxide down the coiled tubing 5 and the composition comprising friction reducer 51 down the casing 4 . attention is directed to fig2 which further teaches that once the injection process is completed , the fluid injected into subterranean reservoirs 1 and 2 is produced back into the casing 4 and back to the surface of the earth 18 through manifold 8 or a wellhead while simultaneously injecting a fluid 17 hydrogen peroxide from the surface tank 12 through the coiled tubing 5 into the casing 4 . this simultaneous injection of hydrogen peroxide into the well casing 4 while the well is flowing back the stimulation fluid 53 further treats the injection fluids in the well thereby reducing and killing bacteria and polymers in the flowed back fluids . it is understood that many combinations of chemicals can be added to the coiled tubing of 5 including bactericides , oxidizers , surfactants , acid , and their various concentrations and combinations can be used in this process without deviating from the scope of the invention . in another embodiment , the injection process shown in fig3 comprises the injection of a water based fluid 51 with a gelling agent ( for example , hydroxypropyl guar ( hpg )) blended into water and pumped at the surface down into the well having perforated intervals 22 , 1 , 2 . the fluid is injected through manifold 8 through the casing 4 while a crosslinker fluid ( or other viscosity enhancer for fluid 51 ) is injected down the coiled tubing 5 and mixed into the gelled fluid at mixing point 11 , whereby the blended fluids 51 continue down the casing 4 being transported into the perforated interval 22 and into a subterranean reservoir 56 . by injecting the crosslinker fluid down coiled tubing 5 and mixing with fluid 51 at mixing point 11 the viscosity of fluid 51 in the casing 4 below the perforated interval 22 is higher thereby affecting the injection profile such that fluid 51 is diverted to the upper interval 22 and less to the lower intervals 1 and 2 . in a still further embodiment , a fluid 51 with a catalyst is injected down the casing 4 of fig1 while hydrogen peroxide is injected down the coiled tubing 5 and injected through the injection valve 11 into the casing 4 where the catalyst and the hydrogen peroxide mix in the well and are injected into the reservoir 1 through the perforations 2 and 1 . in some embodiments , the fluid 51 injected down the casing 4 contains a fuel and a magnesium oxide that decomposes or otherwise neutralizes the hydrogen peroxide in the subterranean environment . it should be understood that an almost unlimited combination of gelled fluids , catalyst , fuels , surfactants , and oxidizers can be added to the fluid 51 being pumped down the well casing 4 to be mixed with almost unlimited combination of fluids 17 , catalyst , fuels , surfactants , acids , and oxidizers being injected simultaneously down the coiled tubing 5 . in a preferred embodiment , the use of an analytical instrument to collect , transmit , and possibly record down - hole well information , preferably in real - time at surface , allows for the optimization of the injection of fluids rate and positioning of the injection point . for instance , if data collected indicates an increase in pressure in one or more conduits supplying fluids to the subterranean environment , one may increase the concentration of friction reducer or otherwise change the composition of friction reducer ( for example , going from one friction reducer to another friction reducer ) to optimize performance . likewise , the optical fiber that is a distributive sensor may indicate that a particular injection profile is developed during the fluid injection profile and the location of the injection point of the coiled tubing , or changes in the fluids being injected can be made at surface to modify the injection profile . other examples of optimization should be immediately clear to those of skill in the art . it should also be understood that in any of the embodiments discussed , the compositions injected may be those that increase or decrease viscosity of a resulting fluid when the injected fluid mixes with another fluid . alternatively , other characteristics of the resulting fluid can be modified by injecting various compositions , including , but not limited to , ph modifiers , scale inhibitors , corrosion inhibitors , bacterial contamination inhibitors ( such as bactericides ), surfactants ( to modify surface tension ), etc . variables such as injection and production pressure and flow can be manipulated as well to fine - tune the injection to optimize specific properties . these variables can be changed in real time in response to data collected and monitored using the analytical instrumentation and recording devices described herein . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . the examples given are merely illustrative and not exhaustive . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the invention is intended to encompass within its scope such processes , machines , manufacture , compositions of matter , means , methods , or steps . | 2 |
the term โ bio - applications โ as used herein refers to all applications for which the most important property is biocompatibility . the term โ biocompatibility โ as used herein refers to biochemical characteristics which a material possess that make it acceptable to living organisms ( human , animals and plants ), as an integral part of them , without have spontaneous or in time the manifestation of some repulsive or toxic phenomena under the form of inflammation , infections and others ( black j ., โ biological performance of materials : fundamentals of biocompatibility โ, 2 d ed . m . dekker , n . y ., 1992 ). this interpretation is given both to pure materials ( 100 % purity , other substances not detected ) and those that have a purity less than 100 % ( because they contain contaminants ). the standards that have guided biocompatibility testing are the 1 ) tripartite guidance ; 2 ) the international organization for standardization ( iso ) 10993 standards ( which are known as the biological evaluation of medical devices and remain under development internationally ); and 3 ) the fda blue book memoranda . in one embodiment , the present invention relates to a process of obtaining styrene - maleic - anhydride copolymers using bulk - polymerization methods and free - radical initiators , with monomer feeds of styrene ( sty ): maleic anhydride ( manh ) of 1 : 6 , 1 : 14 , 1 : 8 , or 1 : 12 and a quantity of initiator not less than 0 . 01 % and not more than 0 . 05 % versus the reaction mass . in another embodiment , the quantity of initiator is not less than 0 . 025 % and not more than 0 . 035 %. examples of suitable initiators for initiating polymerization are the customary agents which form free radicals by thermal decomposition . non - limiting examples include : diacyl peroxides , such as dibenzoyl peroxide , di - tertbutyl peroxide , tert - butyl perbenzoate or tert - butyl perethylhexanoate peresters , such as tert - butyl perpivalate , aliphatic azo compounds , such as azoisobutyronitrile , azo - 4 - cyanopentanoic acid or other water - soluble aliphatic azo compounds , salts of peroxodisulphuric acid or hydrogen peroxide . in one embodiment , the initiator is dibenzoyl peroxide and azoisobutyronitrile . polymeric reactions are carried out in a kneader - extruder connected to a vacuum that includes a trap for condensed water cooled at temperature of 5 - 7 ยฐ c ., a heating - cooling mantle , thermometer , and dosing funnel for liquids , in which is loaded at ambient temperature a predetermined quantity of technical grade maleic anhydride . the maleic anhydride is mixed at temperatures of about 75 ยฐ c . for about 30 minutes to yield a transparent fluid mass of melted maleic anhydride . a persistent semi - opaque melt indicates the presence of maleic acid . transforming maleic acid to maleic anhydride can be achieved by connecting the kneader to a vacuum distillation apparatus and adjusting the pressure to 400 mbar at the above temperature for about 30 minutes . the maleic anhydride melt at atmospheric pressure is brought to a temperature not less than 55 ยฐ c . and not greater than 100 ยฐ c . in another embodiment , the temperature is between 65 ยฐ c . and 90 ยฐ c . technical grade styrene and dissolved initiator are added to the maleic anhydride melt over a period of time not less than 10 minutes and not greater than 60 minutes . in another embodiment , period of time is between 20 and 40 minutes . mixing is continued at atmospheric pressure and a temperature not less than 60 ยฐ c . and not greater than 150 ยฐ c . for a period of time not less than 45 minutes and not greater than 300 minutes . in another embodiment the mixing temperature is maintained between 85 ยฐ c . and 115 ยฐ c . in another embodiment , the mixing time is between 60 and 180 minutes . the yellow - brown , viscous and transparent reaction mass is processed to transform unreacted excess maleic anhydride to maleic acid by hydrolysis . the content of the kneader is cooled to not less than 55 ยฐ c . and not greater than 85 ยฐ c . by adding deionized water ( with a conductivity less than 10 ฮผs ). in another embodiment , the content of the kneader is cooled to temperatures between 60 ยฐ c . and 80 ยฐ c . the amount of deionized water added is not less than 5 % and not greater than 40 % by weight versus the reaction mass . in another embodiment , the amount of deionized water added is between 10 % and 35 % by weight during a period of time not less than 30 minutes and not greater than 180 minutes . in another embodiment , the deionized water is added between 60 minutes and 120 minutes . after finishing dosing with the deionized water , the reaction mass is mixed for a period of time not less than 20 minutes and not greater than 90 minutes . in another embodiment , the reaction mass is mixed for a period of time between 30 minutes and 60 minutes . alternatively , the reaction mass is cooled to ambient temperatures by circulating through the mantle liquid with temperatures of 5 - 7 ยฐ c . the maleic acid is then extracted from the content of the kneader according to the following process . a stainless steel mixing vessel equipped with a nuce filter and having a useful volume three times larger than that of the kneader is used . the mixing vessel is further equipped with an impeller stirrer with two blades , a mantle for heating or cooling , a thermometer , a dosing nipple for liquids , an inlet - pipe connection for compressed air , an outlet nipple , and , in the interior , a filter based on two pierced stainless steel plates with a polyamide cloth ( 100 micron mesh ) between them . the vessel is filled with deionized water ( with a conductivity less than 10 ฮผs ) in an amount that is approximately six times the volume of the reaction mass at a temperature not less than 5 ยฐ c . and not greater than 40 ยฐ c . in another embodiment , the temperature is between 15 ยฐ c . and 35 ยฐ c . while stirring the deionized water moderately ( stirrer speed = 40 - 60 rpm ) the reaction mass is added via the helical conveyer . the coarse , aqueous suspension formed is mixed for not less than 1 hour and not greater than 6 hours . in another embodiment , the suspension is mixed between 2 and 4 hours . the stirring is then stopped and the aqueous phase is eliminated by filtration under pressure . the process is repeated for as many times as it takes to obtained a maleic acid content in the supernatant of less than 0 . 001 % by weight as determined by volumetric titration with a solution of naoh 0 . 01 n . the wet solid , substantially free of the maleic acid , and with a humidity content of 70 %, is transferred to a circular dryer equipped with a heating and cooling mantle , thermometer , helicoidally stirrer , breaking device with rotary knife , and is connected to a vacuum distillation apparatus comprising a filter with sackcloth , condenser , and collecting vessel for the condensation water . the granular mass is dried at a temperature of not less than 50 ยฐ c . and not greater than 90 ยฐ c . in another embodiment , the drying temperature is between 60 ยฐ c . and 80 ยฐ c ., and the vacuum is at 50 mbar for a period of time not less than 4 hours and not more than 10 hours . in another embodiment , the drying period of time is between 6 and 8 hours . lastly , the material is cooled to ambient temperature , removed from dryer , and packed in welded polyethylene bags . the aqueous solution of maleic acid resulting from the extraction is processed by thermal dehydration to obtain maleic anhydride using one of the proceeding known methods in art and adapted to the present invention ( see for example u . s . pat . no . 3 , 993 , 671 ; u . s . pat . no . 4 , 118 , 403 ; u . s . pat . no . 4 , 414 , 898 or u . s . pat . no . 4 , 659 , 433 ). sma copolymers prepared in conformity with the methods described above have the following characteristics : a ) the amount of residual styrene was measured by extraction with benzene ( spectroscopic grade ) of 1 g of polymer for 12 hours by sohxlet extraction . the benzene extractions were then analyzed by gas spectroscopy ( perkin - elmer equipment ). b ) the amount of residual maleic acid was measured by dialysis with distilled water of a 2 g sample of polymer at 40 ยฐ c . using a spectr / por ce dialyze membrane in 14 cycles of 24 hours each ( 500 ml water per cycle ), the water was changed after each cycle . the accumulated water was analyzed for maleic acid by hplc method ( waters equipment ). c ) monomeric concentration expressed as sty : mal ( styrene : maleic comonomer [ maleic anhydride + maleic acid ]) was estimated by conductometric titration of a solution prepared by dissolving 0 . 1 g of dry polymer in a solution of naoh 0 . 5 n and hcl 0 . 5n . d ) functionality ratio , expressed as manh : mal ( maleic anhydride [ maleic anhydride + maleic acid ]), [( mol / g ): ( mol / g )], was estimated using ftir quantitative analysis ( shimazu equipment ): maleic anhydride p . a . ( across ) and maleic acid p . a . ( across ) versus the characteristic absorption bands : 1770 - 1790 cm 1 for anhydride and 1700 - 1720 cm 1 for cooh . e ) viscosimetric average molecular weight , m v , was estimated using the evaluation of intrinsic viscosity [ ฮท rel ] based on relative viscosity [ ฮท ] of one solution of polymer with concentration c = 0 . 5 g / 100 ml in tetrahydrofuran at 25 ยฐ c ., using the calculus formulae ( raju k . v . s . n ., yaseen m . j . appl . polym . sci ., 45 , 677 - 681 , 1992 ; chee k . k . j . appl polym . sci ., 34 , 891 - 899 , 1987 and spiridon d . et al . polymer international , 43 , 175 - 181 , 1997 ). [ ฮท ] = 2 โข ( ฮท rel - ln โก ( ฮท rel ) - 1 ) c โข [ ฮท ] = 0 . 77 โ 10 - 4 โ m v 0 . 725 in a kneader - extruder apparatus ( 60 liters ) connected to a vacuum that includes : a trap for condensed water cooled at temperatures of 5 - 7 ยฐ c ., a heating - cooling mantle , thermometer , and dosing funnel for liquids , 25 kg of technical grade maleic anhydride was added at ambient temperatures . the maleic anhydride was mixed and heated at 75 ยฐ c . for about 30 minutes to obtain a transparent fluid mass of melted maleic anhydride . technical grade styrene with 8 g of dissolved dibenzoyl peroxide was added under ambient pressure over 20 minutes bringing the temperature of the mixture to 65 ยฐ c . after adding the styrene , the temperature of the reaction increased rapidly during a period of 15 minute from 78 ยฐ c . to 116 ยฐ c . due to polymerization . when the exothermic phase of polymerization is completed , mixing continued at atmospheric pressure at 100 ยฐ c . for another 60 minutes . the reaction mass was a viscous , transparent , yellow brown solution which was cooled to 65 ยฐ c . by adding 8 liters of deionized water ( with a conductivity less than 10 ฮผs ) while mixing over 60 minutes . after finishing water dosing , the reaction mass was mixed for another 45 minutes at 65 ยฐ c . alternatively , the reaction mass can be cooled to ambient temperatures by circulating cooled water ( 5 - 7 ยฐ c .) through the mantle of the kneader . the reaction mass is transferred through the helical conveyer located in the interior central zone of the apparatus to a stainless steel vessel ( nutsche filter ) containing 160 liters of deionized water at 18 ยฐ c . under moderate stirring ( stirrer speed adjusted to 40 - 60 ppm ). the nutsche filter has a useful volume three times larger than that of the kneader . the nutsche filter has a mantle for heating and cooling , a stirrer , a thermometer , a dosing nipple for liquids , an inlet - pipe connection for compressed air , an outlet nipple , and , in the interior , a filter media based on two pierced plates of stainless steel with a polyamide cloth between them ( 100 microns mesh ). the coarse aqueous suspension was mixed for 2 hours . the aqueous phase was then removed by filtration under pressure . the process was repeated 3 times . the last supernatant had a maleic acid concentration of only 0 . 00073 % by weight . the wet solid had a humidity content of 68 . 3 % and was transferred to a circular dryer equipped with a heating and cooling mantle , thermometer , helicoidally stirrer , breaking device with a rotary knife and was connected to a vacuum . the wet mass was dried at 65 ยฐ c . at 50 mbar for 5 hours . lastly , the material was cooled to ambient temperature , removed from the dryer , and packaged in welded polyethylene bags . the aqueous solution of maleic acid resulting from the extraction was collected for maleic anhydride recovery . from this process , 5 . 17 kg sma copolymer was obtained as a white powder : 94 . 598 % sma copolymer ; 5 . 31 % water ; 0 . 029 % styrene and 0 . 063 % ( maleic anhydride + maleic acid ), all as weight percent . the purified sma copolymer had the following structural characteristics : m y = 1 , 251 , 000 ; sty : mal = 46 : 54 same equipment and procedure as described in example 1 except 3 . 4 liters of styrene having 6 . 8 grams of dibenzoyl peroxide dissolved therein was added at 80 ยฐ c . maximum temperature during the exothermic phase was 121 ยฐ c . the last supernatant from the extraction had a maleic acid content of 0 . 00095 % by weight and drying was at 80 ยฐ c . for 6 hours . the process yielded 6 . 28 kg of sma copolymer as a white powder : 95 . 267 % sma ; 4 . 63 % water ; 0 . 031 styrene and 0 . 072 % ( maleic anhydride + maleic acid ), all as weight percent . the purified sma copolymer had the following structural characteristics : m v = 546 , 000 ; sty : mal = 48 : 52 and manh : mal = 0 . 68 . same equipment and procedure as in example 1 except that 2 . 5 liters of styrene having 8 . 5 grams of initiator dissolved therein was added over 40 minutes . maximum temperature during the exothermic phase was 128 ยฐ c . polymerization was complete after 180 minutes with a final temperature of 85 ยฐ c . hydrolysis utilized 6 liters of water added over 120 minutes and the extractions were made at 35 ยฐ c . the process yielded 4 . 72 kg of sma copolymer as a white powder : 93 . 08 % sma ; 6 . 82 % water ; 0 . 018 % styrene and 0 . 082 % ( maleic anhydride + maleic acid ), all as weight percent . the purified sma copolymer had the following structural characteristics : m v = 726 , 000 ; sty : mal = 51 : 49 and manh : mal = 0 . 27 . in the same type of kneader - extruder apparatus that used in example 1 , 25 kg of technical grade maleic anhydride was loaded at ambient temperatures . the maleic anhydride was heated and mixed at 75 ยฐ c . for 30 minutes to yield a fluid transparent mass of melted maleic anhydride . 3 liters of technical grade styrene having 9 . 8 grams of dibenzoyl peroxide dissolved therein was added at atmospheric pressure over a period of 40 minutes . after adding the styrene , the temperature of reaction increased rapidly from 83 ยฐ c . to 132 ยฐ c . over 12 minutes . after the exothermic phase of reaction was completed , mixing at atmospheric pressure at 115 ยฐ c . continued for 120 minutes . at this time 9 . 8 liters of deionized water ( with conductivity less than 10 ฮผs ) was added over 120 minutes cooling the reaction mass to 60 ยฐ c . the reaction mass was mixed at 60 ยฐ c . for 60 minutes at 60 ยฐ c . alternatively , the reaction mass can be cooled to ambient temperatures by circulating cooled water ( 5 - 7 ยฐ c .) through the mantle . the granular mass from the kneader was transferred through the helical conveyer to a vessel containing 160 liters of water at 15 ยฐ c . under moderate stirring . the coarse aqueous suspension was mixed for 4 hours before removing the aqueous phase by filtration under pressure . this process was repeated 3 times . the last supernatant removed had a maleic acid content of 0 . 00091 % by weight . the purified wet solid had a humidity content of 72 . 8 % and was transferred to a circular dryer connected to a vacuum and dried at 80 ยฐ c . at 50 mbar for 4 hours . lastly , the material was cooled to ambient temperature , removed from dryer , and packed in welded polyethylene bags . the aqueous solutions of maleic acid from the extractions were collected for maleic anhydride recovery . the process yielded 6 . 93 kg of sma copolymer as a white powder : 92 . 114 % sma ; 7 . 82 % water ; 0 . 021 % styrene and 0 . 045 % ( maleic anhydride + maleic acid ), all as weight percents . the purified sma copolymer had the following structural characteristics : m v = 251 , 000 ; sty : mal = 42 : 58 and manh : mal = 0 . 17 . the same type of equipment and procedure as in example 4 was used except 2 . 4 liters of styrene having 6 . 8 grams of dibenzoyl peroxide dissolved therein was added , the reaction mass was added to 2 . 1 liters of deionized water , and drying was carried out at 80 ยฐ c . for 8 hours . the process yielded 4 . 72 kg of sma copolymer as a white powder : 96 . 121 % sma ; 3 . 78 % water ; 0 . 041 % styrene and 0 . 058 % ( maleic anhydride + maleic acid ), all as weight percents . the purified sma copolymer had the following structural characteristics : m v = 1 , 780 , 000 ; sty : mal = 49 : 51 and manh : mal = 0 . 79 . | 0 |
before explaining an optical transmitting device in the preferred embodiments , the aforementioned conventional optical transmitting device will be explained in fig1 . as shown , a coded data signal to be repeated is input to an electrical - optical converter 1 and is converted into an optical signal . then , the optical signal is amplified by an optical amplifier 2 and is again transmitted to an optical transmission line ( not shown ). the optical amplifier 2 is composed of an optical fiber for amplification , a semiconductor laser for excitation , an optical coupler which couples light emitted from the semiconductor laser for excitation with optical signal light , an optical isolator etc . the optical signal entering the optical fiber for amplification is optically amplified by the semiconductor laser for excitation and is then output . next , an optical transmitting device in the first preferred embodiment will be explained in fig2 wherein like parts are indicated by like reference numerals as used in fig1 . referring to fig2 a coded data signal to be repeated is converted into an optical signal by an electrical - optical converter 1 . the optical signal is optically direct - amplified by a first optical direct amplifier 2 and is then supplied to an optical switch 3 . applicable to the optical switch 3 are , for example , an optical device such as a semiconductor switch , a temperature sensitive type optical switch ( also called a therm - optic switch ( tosw )) and an optical material with electro - optic effect such as lithium niobate ( linbo3 ) and lithium tantalate ( litao3 ), which are composed of an optical waveguide with one input port and n ( n is an integer of two or more ) output ports . each of the output ports of the optical switch 3 can be selected by an optical path switching controller 7 . to the n output ports , n kinds of dispersion compensating fibers 4 - 1 to 4 - n which have dispersion compensating quantities different from each other are connected , thereby being adaptable for various transmission lines . next , outputs from the n kinds of dispersion compensating fibers are combined into one signal light by an optical coupler 5 , then input to a second optical direct amplifier 6 . signal light output from the optical coupler 5 has a reduced optical level since it has passed through various optical parts . because of the reduced optical level , the optical direct amplifier 6 is needed to amplify the signal light up to a normal level . meanwhile , it is obvious that the first and second optical direct amplifiers 2 , 6 may have the same composition as the optical direct amplifier 2 in fig1 . if , in an optical transmission system that employs a 1 . 55 ฮผm band optical amplifier , an existing 1 . 3 ฮผm band zero - dispersion single mode fiber is used as the transmission line , deterioration in transmission characteristics may be caused by wavelength dispersion . the 1 . 3 ฮผm band zero - dispersion single mode fiber has a positive wavelength dispersion . therefore , an optical fiber which has a negative wavelength dispersion to cancel the positive wavelength dispersion can be used as a dispersion compensating fiber ( dcf ). this dcf is 1 . 55 ฮผm band optical fiber , which is made by , for example , increasing the refractive index distribution of a core and decreasing the diameter of the core to provide the dcf with a negative wavelength dispersion . then , by providing the obtained dcf with various lengths , it can be used as the dispersion compensating fibers 4 - 1 to 4 - n in fig2 . examples of such kind of dcf are detailed in technical report of the institute of electronics information and communication engineers , emd93 - 42 , cpm93 - 55 ooe93 - 76 ( 1993 - 08 ), pp . 51 - 56 . an optical transmitting device in the second preferred embodiment will be explained in fig3 wherein like parts are indicated by like reference numerals as used in fig2 . as shown in fig3 in the second embodiment , n pairs of dispersion compensating means which are composed of optical circulators 8 - 1 to 8 - n and fiber gratings 9 - 1 to 9 - n are used instead of the dispersion compensating fibers 4 - 1 to 4 - n in the first embodiment . namely , each of the signal lights output from the output ports of the optical switch 3 is input to one port of any one of the optical circulators 8 - 1 to 8 - n , to the other ports of which the fiber gratings 9 - 1 to 9 - n are connected . then , signal lights output from further ports of the respective optical circulators 8 - 1 to 8 - n are introduced to the optical coupler 5 to combine them into one signal light . this signal light is , similarly to the first embodiment , optically direct - amplified by the second optical direct amplifier 6 , then sent out to an optical transmission line ( not shown ). the fiber gratings 9 - 1 to 9 - n are of optical fibers with gratings written on by interference exposure using , e . g ., ultraviolet laser light . by providing the gratings with n kinds of pitches ( by writing a wavelength difference less than 1 nm on an optical fiber of several tens nm ), which are different from each other , dispersion compensating means with various negative dispersion compensating quantities can be obtained . the signal light supplied to the input port of any one of the optical circulators 8 - 1 to 8 - n enters and passes through corresponding one of the fiber gratings 9 - 1 to 9 - n connected to the other port of the optical circulator , then returning to the same port by reflection . when going and returning through the fiber grating , a phase difference is introduced depending on the grating , thereby enabling the dispersion compensating of signal light . in the second embodiment , there is an advantage that the dispersion compensating means can be miniaturized as compared to that in the first embodiment using dcf since the lengths of the fiber gratings 9 - 1 to 9 - n can be within several tens nm . although the invention has been described with respect to specific embodiment for complete and clear disclosure , the appended claims are not to be thus limited but are to be construed as embodying all modification and alternative constructions that may be occurred to one skilled in the art which fairly fall within the basic teaching here is set forth . | 7 |
the ensuing description provides preferred exemplary embodiment ( s ) only , and is not intended to limit the scope , applicability or configuration of the disclosure . rather , the ensuing description of the preferred exemplary embodiment ( s ) will provide those skilled in the art with an enabling description for implementing a preferred exemplary embodiment . it being understood that various changes may be made in the function and arrangement of elements without departing from the spirit and scope as set forth in the appended claims . a detection material using a polymer sensor technology provides detection of a chemical , biological and / or explosive ( cbe ) substance , also referred to hereinafter as an โ item of interest .โ this detection material can include different technologies , such as but not limited to , molecularly imprinted polymer ( mip ) technology that can register detection of an item of interest that has come in contact with the media using organic and / or inorganic polymers created to detect certain molecules and / or molecule groups . upon detection , the physical characteristics of the detection material , such as color ( including non - visible spectra , such as infrared ), transparency , magnetic and / or electrical conductivity , can change . thus , one or more images and / or electrical readings of the material can be taken and used to determine a change in a physical characteristic of the detection material , thereby indicating detection of an item of interest . because detection material can be configured to detect a specific item of interest substance , multiple detection materials can be applied to the media to detect multiple items of interest . in addition to being able to detect the item ( s ) of interest , some embodiments also provide an indication of the volume or strength of trace materials detected . detection materials include polymers that are currently available to detect a particular item of interest . they could include vapor or particulate sensing polymers , florescent quenching polymers , and / or molecularly imprinted polymers ( mip ). current classifications of sensing would include cbe substances . the molecular formula and the electrical properties for each classification of substances vary , as well as the formulations for each subclass . for example , the molecular formula for a mip polymer that detects tnt will vary from the molecular formula for the mip polymer that detects rdx . these differing formulas cause physical properties of a mip polymer to react differently upon exposure . the value of the exposure information can be a value indicative of the amount of exposure experienced . the characteristics of the mip can be such that a physical characteristic or electrical characteristic changes as a function of exposure . the use of detection materials , applied to and / or embedded in a media as described herein , can be utilized in any of a variety of security applications . for example , and not by way of limitation , fig1 a is a simplified block diagram of a detection system 100 - 1 that can be used in a public transit system . in this embodiment , a transit passenger 105 who has been issued a ticket / media 130 can insert the ticket / media 130 into the validator unit 145 . along with validating the ticket / media 130 , the validator unit 145 can utilize techniques described herein to apply a detection material to the ticket / media 130 and determine whether the ticket / media 130 has been exposed to any items of interest while in the custody of the transit passenger 145 . the validator unit 145 can then reissue the ticket / media 130 to the transit passenger 105 , or capture the media . the determination of whether to reissue or capture the ticket / media 130 can be based on whether the ticket / media 130 was exposed to an item of interest , a level of exposure , a type of exposure , which may be considered with additional information ( e . g ., a current security threat level , information regarding the transit passenger 145 , a time of day , a condition of the media ( e . g ., if damaged or purposefully altered to reduce readability ), etc .). furthermore , information may be written to the media / ticket 130 before reissuance or capture , which can include a flag or other information regarding detection / non - detection of an item of interest along with other information ( e . g ., validation information ) that can provide additional functionality in the transit system . in this embodiment , the validator unit 145 can be connected with various other components of the detection system 100 - 1 either directly or via a network 210 . for example , the validator unit 145 can communicate with a camera 155 to capture a picture and / or video of the transit passenger 105 . the captured picture and / or video can be associated with the ticket / media 130 provided by the transit passenger 105 to allow the detection system 100 - 1 to have a form of passenger identification associated with the picture and / or video . other components of the detection system 100 - 1 can provide added functionality in a transit system context . for example , information regarding detection / non - detection of an item of interest , along with images from the camera 155 and other information associated with the media / ticket 130 , may be sent to a security computer 185 for further analysis , processing , security measures , and / or archival . the validator unit 145 and / or security computer 185 can further communicate information to one or more transit gate / fareboxes 175 . this can , for example , enable the transit gate / fareboxes 175 to deny access to a media / ticket 130 that has been flagged by the detection system 100 - 1 . additionally or alternatively , a transit gate / farebox 175 can deny access if the transit gate / farebox 175 reads information from the ticket / media 130 that the ticket / media 130 has been flagged . the detection system 100 - 1 can also include an image / data distribution system 165 . the image / data distribution system 165 can be used to distribute information to help ensure the security of the transit system . for example , if a media / ticket 130 is flagged , the image / data distribution system 165 can send captured images or video of the transit passenger 105 , and / or other data associated with the flagged ticket / media 130 , to police , security , transit personnel , etc . such alerts can be sent from a computer or other processing device using short message service ( sms ), email , telephone , or the internet to computers , terminals , cellphones , mobile devices , etc . fig1 b is a simplified illustration of another embodiment of a detection system 100 - 2 . in particular , but not by way of limitation , fig1 b provides an overview of how detection materials can be used to help enhance security in an airport security line . in this embodiment , a passenger 110 is issued a ticket / media 130 by a ticket / media dispenser 140 when moving from an unsecured area 102 to a semi - secure area 104 . the ticket / media dispensing can be overseen and / or operated by a first security worker 120 - 1 . the ticket / media dispenser 140 can be , for example , integrated into a first security checkpoint , in which the first security worker 120 - 1 checks identification of the passenger 110 . the identification of the passenger 110 can be automatically or manually associated with the ticket / media 130 issued to the passenger 110 , and the ticket / media 130 can include a unique identifier for later identification of the ticket / media 130 . moreover , the ticket / media 130 can include a detection material to detect exposure to an item of interest . the passenger 110 then moves though the semi - secure area 104 , exposing the ticket / media 130 to trace amounts of substances ( in a process called โ sample harvesting โ) on the passenger &# 39 ; s hands , clothes , luggage , etc . when attempting to enter a secure area 106 from the semi - secure area 104 , the passenger 110 can enter the ticket / media 130 into a ticket / media analyzer 150 and optionally pass through other security measures , such as a metal detector 170 or similar device . the media / ticket analyzer 150 can analyze the detection material of the ticket / media 130 to determine whether the ticket / media 130 was exposed to any items of interest . the ticket analyzer 150 can also validate and / or mutually authenticate the ticket / media 130 and compare to the initial issuance record of the ticket / media dispenser 140 . the ticket / media 130 analyzer 150 can then indicate to a second security worker 120 - 2 a result of the analysis ( e . g ., whether an item of interest was detected , a level of exposure of the ticket / media 130 to an item of interest , etc .). additionally or alternatively embodiments can integrate cbe detection with a luggage screener 160 to determine whether luggage , trays , or other items travelling through the luggage screener 160 have been exposed to an item of interest . depending on the type of detection material used , such analysis may have to occur before the ticket / media 130 is exposed to x - rays or other security measures that could alter the detection material , thereby adversely impacting the accuracy of the analysis . the result of the analysis could be provided to a security worker 120 - 3 operating the luggage screener 160 . detection materials and analysis can be part of detection systems used in various types of applications . fig2 a illustrates a block diagram of the basic components of a detection system 200 - 1 , according to a first embodiment . media issuer ( s ) 240 can issue media to users at a first location , such as a checkpoint of a security line , a ticket booth or vending machine in a transit station , an outer entrance to a stadium , etc . an element of this embodiment is to provide some period of time from the issuance of media in which the media can be exposed to an item of interest . this exposure can occur when a user touches the media , or the media comes in contact with other items that may have come in contact with an item of interest . such items can include clothes , luggage , purses , wallets , etc . multiple media issuers 240 and / or analyzers 250 can be used in the detection system 200 to reduce congestion of users in the system . the media issuer ( s ) 240 can include ticket feeders and / or other media - issuing devices that help ensure the media is not exposed to an item of interest beforehand . the media itself can provide a sampling particle harvesting enhanced surface , which can enhance the likelihood that items of interest remain on the surface of the media until analysis . the media issuer ( s ) 240 additionally can collect identification information from a user to whom the media is issued . this can include reading identification information from a government - issued identification card ( e . g ., drivers license ) and / or gathering biometric information of the user . collecting biometric information of the user can include taking a picture , scanning certain identifying features ( e . g ., fingerprint , retina , etc . ), recording a voice , gathering a signature , etc . the information collected can be sent via a network 210 to a central processing system 220 , which can store the information in a data store 230 . the detection system 200 also includes analyzer ( s ) 250 that determine whether the issued media has been exposed to an item of interest . the analyzer ( s ) 250 can be located at a second location to help allow time for a media to become exposed to any items of interest in the media &# 39 ; s proximity . for example , in a transit station where media issuer ( s ) 240 are located in or at vending machines and / or ticket booths , the analyzer ( s ) can be located in or at a validator , on a platform , or in a transit vehicle . in another example , media issuer ( s ) 240 may be located at a checkpoint at the beginning of a security line ( e . g ., in an airport or a courthouse ) and analyzer ( s ) 250 could be located at a later point in the security line ( e . g ., at a metal detector , after luggage x - ray , etc .). alternatively , if a user and / or an item to which the media is attached is expected to return to a location at which media issuer ( s ) 240 are located , the analyzer ( s ) 250 can be located at the location of the media issuer ( s ) 240 and / or integrated with the media issuer ( s ) 240 . rental equipment , for example , such as luggage carts , may be returned by a user to a location at which the equipment was originally rented . as discussed in greater detail hereafter , the analyzer ( s ) 250 can determine whether the media has been exposed to an item of interest by apply detection material to media and determining whether the undergoes any changes in physical and / or electrical characteristics . the analyzer ( s ) 150 can automatically apply the detection material to the media using application methods involving adhesive frame , sticker , magazine , or roll feed application . to help facilitate application , the detection material can be disposed on a sticker , roll of tape , clear laminate , or other material enabling the detection material to adhere to the media and react with any items of interest that may be on the media . in addition , or as an alternative , to chemical adhesion , adhesion can be created with an electrical charge , such as through negative or positive electron current flow or static electrical charge ( e . g ., ion charge via chemical - based reaction ), and analyzer ( s ) 250 can be configured to create , activate , and / or expose an adhesion area on the media prior to applying the detection material . after the detection material is applied to the media , the analyzer ( s ) 250 can determine whether the detection material has reacted . for example , the analyzer ( s ) 250 can take an image of the media to determine whether physical characteristics of a detection material ( e . g ., color , transparency , etc .) have changed to indicate detection of an item of interest . this analysis may also reference an image of the media that was taken before detection material was applied to the media or even before the media was issued to the user . optionally , the media contains a background color that is encoded to be used as a quality and reference check during analysis . in one embodiment for example , after receiving the media and before applying detection material to the media , the analyzer ( s ) 250 can take a first image of the media for initial reference of color and graphics . afterwards , the analyzer ( s ) 250 can apply the detection material and take a second image of the media to determine a change in color with respect to the first image . in an alternative embodiment ( not shown ) the media issuer ( s ) 240 can communicate with the analyzer ( s ) 250 to validate serialization , original background color for matching and card anti - cloning verification as well as transaction counting and transaction timing . optionally , the media issuer ( s ) 240 and analyzer ( s ) 250 have check - and - balance networked communication protocol and work as a paired device ( s ). the media discussed herein can include any of a variety of media types , including media provided in current transit , transportation , security , and other systems . for example , the media may comprise a fob , ticket , boarding pass , security card , or other item used for admission , access , etc . additionally or alternatively , the media can be applied to or otherwise integrated with other items , such as a luggage cart in a hotel or airport , a tray or bin for personal items in an airport security line , a keycard for a hotel room , personal items ( e . g ., mobile devices , identification cards , etc ), and more . the media itself can be made of one or more of a variety of materials , including but not limited to paper , plastic , glass , paper / plastic composite , and metal foil . to help ensure the correct media is identified by the analyzer ( s ) 250 , media can include a unique identifier . the unique identifier can include any of a variety of unique features , including numbers and / or letters . the unique identifier may be issued and / or read by the media issuer ( s ) 240 when issuing the media . depending on the desired functionality of the media and / or the detection system 200 , the unique identifier can be embedded on the media such that it can be read by the analyzer ( s ) 250 utilizing radio frequency identification ( rfid ), bar code scanning , optical imaging ( e . g . optical pattern recognition ), and / or magnetic stripe reading . optionally , the unique identifier may contain identification information of a user , such as birth date , social security number or other government - issued identifier , name , address , phone number , email address , and / or information provided by a government - issued identification card . moreover , the unique identifier may be encrypted , and the unique identifier also can be embedded within other information provided by the media issuer ( s ) 240 to the central processing system 220 . fig2 b is a block diagram of the basic components of a detection system 200 - 2 , according to a second embodiment . here , media issuer ( s ) 240 and analyzer ( s ) 250 are connected directly with a communication link 245 . moreover , the media issuer ( s ) 240 and analyzer ( s ) 250 are only optionally connected via a network 210 to a central processing system 220 and data store 230 . configurations with out a network 210 and / or centralized systems 220 , 230 , analyzer ( s ) 250 and or media issuer ( s ), for example , can be configured to interact directly and / or provide the functionality of the central systems 220 , 230 . fig3 a shows a block diagram of an embodiment of a media issuer 240 - 1 . a processing unit 310 , which can include one or more processor and / or microcontroller , runs software 325 embedded in memory 320 . the memory 320 can include persistent storage such as flash , rom , or some other non - volatile machine readable medium . the memory 320 also can be used to store unique identifiers , user information , and / or other information relating to issued media . this embodiment of the media issuer 240 - 1 includes identification ( id ) reader ( s ) 330 , which can collect id information from a user . id reader ( s ) 330 can include magnetic stripe , rfid , bar code , and / or optical image readers configured to gather information from a user identifying media , such as a drivers license and / or credit card . additionally or alternatively , the media issuer 240 - 1 can be connected and / or integrated with other equipment ( not shown ) via a biometric data interface 370 to collect biometric information from the user to which the media is issued . the equipment can include devices such as scanners and / or cameras can be to gather biometric data such as a fingerprint , signature , facial image , retinal scan , etc . this information can be utilized by the media issuer 240 - 1 and / or detection system 200 to determine an identity of a user , and associate the identity with a unique identifier of the media issued to the user . this association can be used later to help determine if the user has the correct media at the time of analysis of the media . this embodiment of the media issuer 240 - 1 additionally includes a media dispenser 350 and a media reader / writer 340 . these two components can be integrated and / or synchronized to ensure that media writer writes to the media dispensed by the media dispenser 350 . the media writer 240 can write a unique identifier , which can include information specific to the media and / or to the person to whom the media is issued . depending on the functionality of the media , the media writer 240 can write this information to the media in various ways , such as utilizing contactless / proximity technology ( such as radio frequency identification rfid , iso / iec 14443 , near - field communication ( nfc ), and / or other wireless techniques ), electrical communication ( e . g ., contact smartcard technology ), magnetic stripe writing , stamping , and / or printing of optical bar codes and / or other optical images or patterns . finally , this embodiment of the media issuer 240 - 1 includes a network interface 360 . the network interface 360 can enable the media issuer 240 - 1 to communicate with other components in the detection system 200 , via the network 210 . the network interface 360 can utilize any of a variety of hardware and software layers to interface with the network 210 . the hardware involved , for example , can utilize wireless radio frequency ( rf ), optical , wired , satellite , and / or other communications technologies . as shown herein , alternative embodiments can provide an interface that communicates directly with analyzer ( s ) 250 . fig3 b shows a block diagram of another embodiment of a media issuer 240 - 2 . this embodiment illustrates how an embodiment of a media issuer 240 - 2 can include a media imager 380 , which can comprise a camera , scanner , and / or other sensor utilizing a charge coupled device ( ccd ), digital light processor ( dlp ), infrared ( ir ) sensor , and / or other optical technologies . as discussed herein , some embodiments of a detection system 200 include capturing an image of media before and after application of the detection material . this can include capturing an image of the media before issuance , which can be used as a reference in later analysis of the media . as shown in fig3 a and 3b , media issuer ( s ) 240 can include a number of components and can be configured various ways . the embodiments of the media issuers 240 - 1 , 240 - 2 illustrated are provided as examples and are not limiting . other embodiments can include more or less components , integrate multiple components into one combined component , and / or divide functionality differently among components , depending on desired functionality . for example , where biometric data is sufficient to identify users , a media issuer 240 may not include id reader ( s ) 330 . fig4 a shows a block diagram of an analyzer 250 - 1 , according to one embodiment . similar to the media issuers 240 described herein , the analyzer 250 - 1 in this embodiment includes a processing unit 310 , analyzer memory 323 with analyzer software 327 . also , the analyzer 250 - 1 includes a media imager 380 and a detection material applicator 345 . according to some embodiments , the media imager 380 can be used to take two images , a first image before and a second one after the detection material is applied to the media . because the media may have been exposed to an item of interest prior to analysis by the analyzer 250 - 1 , the detection material can indicate exposure shortly after contact with the media . thus , the first image can be taken prior to application of the detection material to serve as a reference . this reference image can facilitate the processing of the second image to determine whether detection material has reacted to an item of interest . for example , the images can be analyzed to determine a change or change rate in reflective light in the event a color change occurs after exposure to an item of interest . analysis can be conducted by the processing unit 310 , a remote system , and or the media imager 380 . therefore , in some embodiments , the media imager 380 can provide the additional functionality of a processing image comparator , differentiator and / or image integrator . the determination of whether an item of interest is detected can be made by the processing unit , which can run the analyzer software 327 to process image ( s ) taken by the media imager 380 to determine changes in coloration , opacity , etc . alternatively , the analyzer 250 - 1 can use the network interface 360 to provide information to the central processing system 220 or other processing system , via the network 210 , to make the analysis . once a result is determined , it is provided using an analysis indicator 430 and / or provided via the network interface 360 to the central processing system 220 or other remote system . the functionality of the analysis indicator can vary , depending on cost considerations and desired functionality of the detection system 200 . the indicator can be simple binary indicator such as a light - emitting diode ( led ), for example , indicating detection or not . additionally or alternatively , the indicator can indicate a more detailed result , such level ( s ) of detection and / or material ( s ) detected . this can be provided a variety of ways , including a text and / or graphical display , series of light indicators , etc . the analysis indicator 430 can be read by a human operator , who can execute appropriate security procedures based on the indicated result . the analyzer 250 - 1 in the embodiment of fig4 a additionally can validate a media . depending on the application of the detection system 200 , a validator 420 can be integrated into the analyzer 250 - 1 . this can provide validating functions in transit and other applications . for example , where a transit passenger is issued a ticket by a media issuer 240 at a ticket booth or vending machine , the transit passenger later can insert the ticket into the analyzer 250 - 1 for ticket validation . the analyzer 250 - 1 can then validate the ticket an addition to analyzing the ticket to determine whether it has been exposed to an item of interest . additionally , the analyzer can include one or more media reader ( s )/ writer ( s ) 410 and / or a biometric data interface 370 to verify an identifier of the media and identify of the user . the media reader ( s )/ writer ( s ) 410 can determine a unique identifier of the media using technologies such as bar code or other optical scanner , rfid and / or magnetic stripe reader , etc . once the unique identifier is determined , the analyzer can communicate with the central processing system 220 via the network interface 360 to determine an identity of a user associated with the unique identifier ( the association being previously created upon issuance of the media ). the analyzer 350 - 1 can also receive biometric data of the user from the biometric data interface 370 to verify that the user providing the media at the analyzer 350 - 1 is the same user to which the media was issued . alternatively , the analyzer can provide the biometric data to the central processing system 220 and / or other remote system to verify the user . if the user is different or cannot be verified , the analyzer 250 - 1 can indicate accordingly to another system via the network interface 360 and / or using the analysis indicator 430 . finally , the media reader ( s )/ writer ( s ) 410 can write additional information to the media , such as an indication of the result of the detection analysis , a timestamp , and / or other information that can provide additional functionality to the media . fig4 b shows a block diagram of an analyzer 350 - 2 , according to another embodiment . this embodiment includes less components and therefore provides different functionality . for example , rather than include a biometric data interface 370 , this embodiment simply includes a camera 440 , which can be utilized to determine and / or verify an identity of a user . in some embodiments , the camera may simply record a picture of a user associated with the media having a certain unique identifier . these latter embodiments , for example , may be included in embodiments of detection systems 300 in which an identity of a user is not determined at issuance , or verification of a user identity is not needed during analysis . although , as indicated herein , media of various forms can be utilized in the systems and methods described herein , fig5 a and 5b illustrate a wireless smartcard that can be used as media , according to one embodiment . fig5 b illustrates a inlay core 508 of the smartcard , which includes an induction antenna 530 and an integrated circuit 550 , which provide the wireless smartcard functionality . the overall configuration of the smart card can be changed dependent upon the requirements of the media and the ergonomics of the device , which can enhance detection from the expected handling of the smartcard . fig5 a , illustrates an external layer ( s ) 504 of the smartcard , which can include a front and / or back layer ( s ). in addition to graphics and / or other features that can provide additional functionality to the smartcard , the external layer ( s ) 504 can include detection areas 524 to which detection material is applied to determine exposure of the media to items of interest . detection areas 524 can include special materials and / or specially - treated surfaces that can facilitate sample harvesting of particles , including items of interest . for example , media can be manufactured in a unique manner that makes the surface of the media and / or detection areas 524 highly receptive to capturing particles as follows . the media surface structure can be manipulated to gather , capture and enhance the particle detection . in addition the media surface and / or detection areas 524 may also be smooth or glossy , dependent on the type of threat detection material . furthermore , changes in color of detection area ( s ) can be compared to a color matrix to be used for a quality and reference check . the external layer ( s ) 504 can be made of a plastic , plasticized , polyvinyl or paper material and the locations of the detection areas 524 can vary with ergonomic requirements . other card types can be utilized in certain embodiments of the systems and methods described herein . for example , fig5 c illustrates a non - wireless card 512 having a magnetic stripe 534 and detection areas . detection areas are preferably located in areas of the card where the card will be handled by a card user , which may vary by card type . moreover , although cards conforming to the id - 1 size of the iso / iec 7810 standard can be used , cards of virtually any type can be integrated into detection systems and methods described herein . embodiments of media shown in fig5 a - 5c are shown for illustration purposes and are not limiting , and various forms of media other than cards can be used . fig6 a is a flowchart of an embodiment of a process 600 - 1 for determining exposure of media to an item of interest . the depicted portion of the process 600 - 1 can begin at block 605 , where the media having a unique identifier is issued at a first location . as indicated herein , the unique identifier could be written to the media at issuance and may contain information indicative of a user . the media is then subject to exposure to items of interest during a period in which the media is in the custody of a user , while traveling from the first location to a second location . at block 610 , the unique identifier of the media is read at the second location , and at block 615 , a first image of the media is created . reading the identifier of the media can identify the previously - issued media , and creating a first image of the media can provide a reference image that can be used in later analysis . at block 620 , the detection material is applied to the media . as discussed earlier , a detection material can be sensitive to certain substances , such as certain molecules or families of molecules . thus different detection materials can be applied to different areas of the media to determine exposure to different items of interest . a predetermined amount of time may be provided after the detection material is applied and before an image of the media is taken , to provide any necessary time for detection material to react . at block 625 , a second image of the media is created , and at block 630 , the first and second images are analyzed to determine whether the detection material has reacted ( i . e . whether the detection material has been exposed to an item of interest ). this analysis can occur at the second location , or may occur remotely , depending on desired functionality . the result of the analysis is indicated at block 635 . this result can include a range of values . fig6 b is a flowchart of another embodiment of a process 600 - 2 for determining exposure of media to an item of interest , illustrating yet further contemplated features . for example , at block 603 , information regarding the identity of a user can be collected . this can include biometric and / or biographic information retrieved in a database , provided by a user , read from an identification card or other identifying media , and / or captured during the issuance process . with identification information , the unique identifier can be associated with an identity of the user . this association can be made , for example , by a media issuer 240 or another component of a detection system 200 . once the media is presented at a second location , a picture of a user is captured at block 613 , and at block 617 the identify of the user is verified . additionally or alternatively , other biometric and / or biographic information can be collected and used to verify the identity of a user . in any event , verification of a user &# 39 ; s identity can involve retrieving information regarding the association between the user and the unique identifier of the media . at block 617 , an image of the media is created , and at block 633 the image is analyzed to determine whether the detection material has reacted . unlike the process 600 - 1 of fig6 a , this process 600 - 2 analyzes a single image . such single - image analyses are contemplated where the detection material and media imaging are sufficiently accurate to provide a reliable analysis . at block 640 , the media is validated . as described herein , embodiments can incorporate other features , such as ticket validation , to provide additional functionality to the user . in so doing , not only is overall security increased , but individual users are provided an additional convenience . finally , at block 645 , the media is returned to the user or captured . as discussed hereinabove , whether the media is returned to the user or captured can depend on whether an item of interest was detected , a type of item of interest detected , and / or a value or level of detection . moreover , other factors ( e . g . information regarding the user , a security threat level , a time of day , etc .) can be considered in the determination of whether to return the media . captured media can be preserved for further analysis and / or processing . fig6 c is a flowchart of yet another embodiment of a process 600 - 3 for determining exposure of media to an item of interest , illustrating how processes contemplated herein can be further altered and adapted . the process 600 - 3 , for example , can be carried out by validator units 145 such as those discussed in the detection system 100 - 1 utilized in a public transit system , as shown in fig1 a . the process begins at block 607 , where the media is issued . however , this step may not be needed ( as indicated by the dotted line ) in certain cases , such as where media is provided by a third party , or is reusable ( e . g . identification or security cards ). at block 609 the media is read and validated before undergoing a process ( blocks 613 - 633 ) similar to those shown in fig6 a and 6b . here , however , no unique identifier is read from the card . nonetheless , the picture of the user , taken at block 613 , can be used to associate the user with a particular media . another feature shown in this process 600 - 3 is , at block 637 , data can be written to the media . the information can include detection / non - detection information , such as a timestamp , location , what item ( s ) of interest was detected , and / or levels of detection . other information ( e . g ., transit data ) can also be written to provide additional functionality to the media . depending on the type of media , data can be written using contactless / proximity or other radio frequency ( rf ) technology , electrical signals , magnetic stripe writing , stamping , and / or printing of optical bar codes and / or other optical images or patterns . a number of variations and modifications of the disclosed embodiments can also be used . for example , the processes depicted in fig6 a - 6c are not limiting and can include more or less blocks , may combine or separate features of a particular blocks , or rearrange order of blocks while keeping within the spirit of this disclosure . embodiments could be embedded into any human - transported item . furthermore , embodiments described herein regarding contactless smartcards can apply similarly to smartcards with contacts . also , as indicated earlier , media can be issued and analyzed at the same location . depending on the result of a detection analysis , an analyzer 250 can route the media to a capture bin or issue to an external feeder for human exchange . fig7 a and 7b illustrate additional embodiments of media that can be utilized in the systems and methods described herein . for example , fig7 a shows a media 710 having non - symmetric , geometrically - spaced holes in one or more layers of the media 710 that are used to capture particles , including items of interest . the holes can also enhance particle detection , and they may be rough or non - symmetrical , and / or smooth or symmetrical , as shown by media 720 in fig7 b . the holes can be under or over the polymer detection area ( s ) 524 . the disclosure has focused on detecting items of interest by using images of media to determine changes in physical characteristics of a detection material . other methods can be used , however , additionally or alternatively , to determine whether the detection material has been exposed to an item of interest . for example , where a detection system 100 utilizes detection materials that have electrical properties that change upon exposure to an item of interest , one or more electrical readings ( e . g ., conductivity , capacitance , inductance , etc .) can be taken by an analyzer 250 before and / or after application of the detection material to the media . electrical measurement reader ( s ) can thereby be used in addition or as an alternative to a media imager ( s ) 380 . additionally , components shown in various diagrams detailed herein can include additional functionality . for example , components described as โ readers โ or โ writers โ can include proximity coupling devices ( pcds ) that include both reading and writing capabilities . other components can be similarly combined to form multi - functional units . conversely , components having multiple functions may be separated into functionally distinct units . also , it is noted that individual embodiments may be described as a process which is depicted as a flowchart , a flow diagram , a data flow diagram , a structure diagram , or a block diagram . although a flowchart may describe the operations as a sequential process , many of the operations can be performed in parallel or concurrently . in addition , the order of the operations may be re - arranged . a process is terminated when its operations are completed , but could have additional steps not included in a figure . a process may correspond to a method , a function , a procedure , a subroutine , a subprogram , etc . when a process corresponds to a function , its termination can correspond to a return of the function to the calling function or the main function . furthermore , embodiments may be implemented by hardware , software , firmware , middleware , microcode , hardware description languages , or any combination thereof . when implemented in software , firmware , middleware or microcode , the program code or code segments to perform the necessary tasks may be stored in a machine readable medium . a processor ( s ) may perform the necessary tasks . the term โ machine - readable medium โ includes , but is not limited to portable or fixed storage devices , optical storage devices , wireless channels and various other mediums capable of storing , containing or carrying instruction ( s ) and / or data . a code segment or machine - executable instructions may represent a procedure , a function , a subprogram , a program , a routine , a subroutine , a module , a software package , a class , or any combination of instructions , data structures , or program statements . a code segment may be coupled to another code segment or a hardware circuit by passing and / or receiving information , data , arguments , parameters , or memory contents . information , arguments , parameters , data , etc . may be passed , forwarded , or transmitted via any suitable means including memory sharing , message passing , token passing , network transmission , etc . while the principles of the disclosure have been described above in connection with specific apparatuses and methods , it is to be clearly understood that this description is made only by way of example and not as limitation on the scope of the disclosure . | 6 |
the present invention is directed to improvements pertaining to the telephone and caller identification services . the present invention makes for a more efficient use of time , whether for personal use or for business use . it will lend convenience and will greatly help the blind . those that cannot move around easily will also be helped . the imagination can come into play , selecting a tune or sound to represent an individual is limitless . business will benefit by having well thought out responses to inquiries to their clients . these calls can be recorded and stored as a record . objects of the invention are to make for a more efficient use of time and lend convenience . personal caller identification is an improvement on conventional answering machines and answering services . in accordance with aspects of the invention , when someone calls , the number associated with the caller identification will activate a tape that will play a tune or sound identifying the caller . a person can be anywhere in hearing range and know who is calling . each expected caller will have a section of the tape with his or her tune or sound as identification . the tape may be numbered , as in a cassette tape . as seen in fig1 , there is preferably a menu on the telephone machine or device 10 identifying each caller and the block of numbers or range in memory set aside for that caller . for example , robert brown may be the second person listed on the menu , along with his telephone number and range in memory ( meter range 100 - 200 ). the telephone includes components to record and store the messages or delete them , as seen at the bottom of the telephone 10 . the user can use the handset 12 to record messages and play them back . the telephone 10 also includes the functionality to record the tune or sounds for each prospective caller &# 39 ; s numbered section on the tape . a button will be available to turn the tape to the desired number on the tape or point to the appropriate location in memory . by way of example , when the telephone 10 rings , it will ring twice . the number associated with the caller identification preferably starts a tape . this tape plays a tune or sound that identifies the caller to the called party . the caller will not hear these sounds . the called party can be anywhere within hearing range , and the person will know who is calling by the tune or sound . the called party does not have to stop what he or she is doing to find out who is calling . each expected caller would preferably be identified by a different tune or sound . the tune could be associated , e . g ., with the caller &# 39 ; s personality or his or her relationship to the person he or she is calling . a user can , instead of a tune or sound , just record the person &# 39 ; s name , saying it over and over with appropriate comments . this information can be put on a storage medium , preferably on tape , with each caller identification number having a section of the tape that is numbered . by way of example only , the numbers could be 1 to 1000 . the numbers will be visible on the machine as the tape plays , as seen by meter no . 1 on the bottom left of the telephone 10 . the telephone 10 desirably includes a in - built recording system to record the tune , sound or name on the numbered tape . adequate space on the tape will be given for the identifying sound and a possible message , and a section on the tape for a reply . each number on the caller identification will activate the tape to the section of the tape set aside for that number . at the end of the section set aside for a specific number or calling party , the tape will stop . preferably , there will be another tape that records a special message for a specific number or calling party . again , each specific message for a specific number will have a block of numbers reserved or set aside on the tape . there will be a menu of all the names and telephone numbers of prospective callers and the numbers on the tape set aside for each caller . bob has to leave and is expecting a call from alice . bob can record , on the numbers of the tape set aside for alice &# 39 ; s telephone number , a message for alice instead of waiting for her to call . when alice calls , her number on the caller identification will activate the tape that is assigned to that number and will give her bob &# 39 ; s message . a lawyer , businessman ( the โ professional โ), etc . can record a message on the section of the tape set aside for each number representing a client . he or she can state a question the client wants answered , give a reply and leave a section of the tape for a response . the client can call anytime for this information . the client can call late at night or all weekend . thus , the client may hear the professional restate the client &# 39 ; s question , along with the professional &# 39 ; s answer . then the client can leave a reply to the answer on the reserved section of the tape . it can be seen that this type of messaging creates a pleasant environment in which the client and the professional can communicate effectively . the lawyer , businessman , etc ., after hearing these calls , can store these calls as a record on a separate tape or memory set aside to record calls , as seen by the โ recording messages for storage โ portion of the telephone 10 in fig1 , or he or she can delete the call . the professional can use a record button and a button on his or her telephone 10 to bring the tape to the desired location on the tape , as seen by meter no . 2 in the recording messages for storage section . this allows the professional to record any client &# 39 ; s reply as a record . the telephone 10 may also include a small light associated with each expected caller to identify if they called while the person was out . thus , the light next to caller number 2 , robert brown , may light up after he calls . all other calls may be processed as they would by a conventional answering machine . in order to more fully understand the invention , a client - professional dialogue will now be described in relation to the flow diagram of fig4 . the professional and client had a prima face meeting or a first telephone call . the client asks the professional to look up some information or provide an answer to a question . the professional tells the client that a personal caller identification system will be used to get the information to the client . the client is given or sent a notebook with a pen and a small meter that can be put flat on a desk . ( see fig3 ). when the client calls , the regular caller identification in the telephone 10 registers the number and it is decoded , as seen by the โ detect incoming call โ and โ obtain caller identification number from incoming call โ steps in fig4 . by decoding , it is meant that the telephone 10 is programmed to play a section of tape or a memory location allotted for that caller &# 39 ; s telephone number . if the caller is on the menu , the client will hear the question he or she wants answered . it will last one minute . continuing , the client will hear the answer or response to the question . it will last one minute . as the tape continues , the third section will be set aside for a response or reply by the client , after the client hears , โ please record your response after the beep .โ the three sections will each last one minute . if the caller is not listed on the menu , his or her call is directed to an answering machine . the meter is run by a small battery and has three digits and two buttons , e . g ., start and reverse ( see fig3 ). the client is told to work out the response in the notebook so it will be concise and easily understood . this material in the notebook will become a record of what the professional and the client are working towards . the client will press start on the meter that is flat on the desk in front of the client , at the beginning of the recording . the first section , the question , will use up 0 to 33 on the meter . section two , the answer , will use up 33 to 66 on the meter . section three , the response , will take up 66 to 100 on the meter . it is to be understood that these numbers are merely exemplary , and may differ depending on the storage medium , duration of messaging , etc . as mentioned above , the client was asked to work out his or her response in the notebook to have as a record . this will be a time saver for both parties . the efficient messaging will be one minute of a concise and compact response . if the client wants to hear the call again , he or she can call again . the client can press reverse on the meter to get to 0 again . the client may call anytime during the week and all weekend . the professional prepares the tape in the following manner . each client will be listed on the menu ( fig1 ). each client will , for example , have 100 numbers on meter no . 1 ( fig1 ). if the professional wants to record a message for client no . 3 , client no . 3 is assigned 200 to 300 on meter no . 1 , which can represent three minutes of playing time on the tape . the whole tape , if it has sixty minutes , can service 20 clients . after each hundred on meter no . 1 , 100 for each client , the tape automatically stops with the aid of a timer . the time limit can be adjusted depending on the needs of the professional . meter no . 1 may be adjusted , and the 100 numbers for each client will remain the same . meter no . 2 is preferably also adjusted to have 100 numbers for each call recorded and stored on the recording messages for storage tape . the switch , in function , is set at dubbing for recording a message and tape for rehearing a message when the professional has his or her work completed , he or she may start to record . the professional sets meter no . 1 for client no . 3 ( fig1 ). meter no . 1 is set at 200 . now , the professional is ready to record . of course , when the tape is recording , it is reflected on meter no . 1 . the professional presses the record button ( fig1 ) for recording messages and talks near the โ record voice or sound here โ button . the professional will record the question and use 200 to 233 on meter no . 1 . it will last one minute . continuing , the professional will answer the question using up 233 to 266 on meter no . 1 . it will last one minute . then , the professional will say , โ please record your response after the beep ,โ and the professional will press the beeper button . this section will last one minute . the tape will stop at the end of the response with the aid of a timer . meter no . 1 will , of course , have the number 300 . the recording is then ready for the client . after the client calls and hears the recording and records his or her response , the button on the left side of the client &# 39 ; s name , using a timer , lights up . when the professional wants to hear the call , the professional presses the lighted button and , with the aid of a timer , reverses to 200 on meter no . 1 and plays to 300 on the meter . if the professional wants to save the call , he or she presses the reverse button on meter no . 1 to go from 300 to 200 . the professional then presses the play button on โ recording messages for storage โ section and simultaneously presses the โ high speed dubbing โ button as well . the call will be recorded and stored either in the same or a different memory . after the professional records the call , he or she will record in his or her notebook ( fig2 ), on the page set aside for that client , the date the client called , a note on the call and the numbers used on meter no . 2 . when the professional wants to hear the call again , he or she will adjust meter no . 2 connected to the tape used for recording messages for storage and hears the call again ( fig1 ). for example , if the professional wants to hear john doe &# 39 ; s call of jun . 10 , 1999 again ( fig2 ), meter no . 2 is set at 1500 and the professional presses play of the tape , recording messages for storage . with the aid of a timer , meter no . 2 stops at 1600 . the call has been heard . the switch , in function , is set at dubbing for recording a message and tape for rehearing a message ( fig1 ). if the professional does not want to save the call , he or she presses delete using the same method as on an answering machine . the call is automatically deleted . the system of the present invention will now be described in more detail . fig1 has a view of an illustrative personal caller identification device , the telephone 10 , in accordance with the present invention . no . 12 is the handset or receiver and a numeric keyboard 14 is also provided . device 10 is connected to a standard telephone line 16 via input jack 18 . an output jack 20 is provided to the standard telephone line 16 via input jack 18 for attachment of other telephone line equipment . display 22 displays the caller identification number transmitted with the telephone call through the telephone network that identifies the telephone number from which the calling party is calling . this can be done by means of fiber optics associated with the telephone line that can transmit or receive information . fiber optics may also be used with this invention to decode an incoming telephone number , activate a series of timers and play a section of the recording messages tape assigned to that number . the menu may have 20 or more names of clients . on the menu , each client is preferably assigned 100 numbers ( e . g ., a counter range from 201 to 300 ) on meter no . 1 . the telephone numbers of each client may be manually added or taken off the list . this can also be done digitally with information going through a telephone line 16 and then turned into numbers . this is an over - simplification of a telecommunication art that has manifested itself in remarkable works . meter no . 1 has four digits with a button for reverse and fast forward . the tape or memory for recording messages has pause , fast forward , reverse , play , record , stop / eject , delete and beeper . the short lines (-----) indicate where the tape for the โ recording messages โ is located . the โ recording messages โ section is used by the professional to record his or her messages . the professional records or speaks near the โ record voice or sound here โ section . meter no . 2 has a button for recording messages for storage . buttons for the โ recording messages for storage โ section are pause , fast forward , reverse , play , high speed dubbing and stop / eject . the recording messages for storage tape has a switch for controlling dubbing and tape playing . it is used as in a regular tape recorder . when copying a message , the switch will be on dubbing . when rehearing a message , the switch will be on tape . fig2 shows the page in the professional &# 39 ; s notebook for john doe . each client will have a page in the notebook to provide a record or log of discussions with that client . it will include the client &# 39 ; s name , telephone number and calls recorded . the date the client called and a notation about the call will also be recorded . when the tape is complete , another tape will be placed in its place and will be labeled as recording messages for storage tape no . 2 . fig3 shows the meter the professional gives or sends to the client . it shows the meter before the call and the dotted lines indicating where the battery is located . fig3 also shows how the meter increments as the user listens to and records messages . fig4 is a flow chart of the steps involved in the use of the present invention . the telephone rings and the caller identification number is displayed on the display 22 ( see fig1 ). the caller identification number is compared to the list on the menu of the telephone / device 10 . if it is not on the menu , the call is directed to an answering machine , e . g ., with the use of the output jack 20 to the standard telephone line 16 via the input jack 18 . if the caller identification number is on the menu , it is decoded ( and plays , e . g ., the 100 numbers on meter no . 1 assigned to that number . for example , if john doe calls , his number is displayed on the display 22 . it is decoded and the messaging is played from the portion of the memory or tape , e . g ., 200 to 300 , on meter no . 1 . it stops with the use of a timer , and the light on the left of his name goes on to signal that john doe called . the professional may add or delete telephone numbers manually from the menu with a mechanical switch . today , it is possible to program the different operations with a computer . it is known in the art that all of this information can be stored in a chip in the telephone to perform all of the operations necessary in the present invention . wherever the technical improvements in the art may lead , the nucleus of the present invention will remain constant . this nucleus is that the present invention can state a client &# 39 ; s question or request for information , answer the question or give the requested information , and a response to the question or information can be given all in one telephone call . all of this can be recorded and stored together , e . g ., on one tape . the power source for the system to perform the present invention may be a battery , a telephone line or an electrical outlet . a computer chip in the telephone and the power source constitute a complete circuitry . when the client calls , the regular caller identification registers the number , and it is decoded , i . e ., it is programmed to play a section of tape allotted for that number . this tape is associated with the โ recording messages โ portion of the device 10 ( fig1 ). the names are listed on the menu of the device , with the numbers allotted for each caller placed after the caller &# 39 ; s name . the client will hear the question he or she wants answered . it will last one minute . continuing , the client will hear the question answered or the information he or she requested . as the tape continues , the third section will be set aside for a response by the client after the client hears , โ please record your response after the beep .โ the three sections will each last one minute . thus , it can be seen that the present invention solves the problems associated with past messaging systems and provides a cohesive personalized messaging system . although the invention herein has been described with reference to particular embodiments , it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims . | 7 |
fig1 a and 1b illustrate the connection between a conventional lvds driver 100 and receiver 102 . the driver has an input 114 , a non - inverting output 116 and an inverting output 118 . the driver is comprised of transistors , indicated as switches 104 - 110 , that are controlled by the input 114 . the receiver has a non - inverting input 120 , an inverting input 122 , and an output 124 . a first signal path connection 126 is formed between driver output 116 and receiver input 120 . a second signal path connection 128 is formed between driver output 118 and receiver input 122 . a termination resistor 112 is placed across the receiver inputs 120 and 122 . in fig1 a , a logic high is input to the driver . in response , transistors 104 and 106 are turned on and transistors 108 and 110 are turned off . in this arrangement current flows from the driver current source through transistor 104 , termination resistor 112 , and transistor 106 . the direction of the current flow develops a voltage across termination resistor 112 such that the voltage at the receiver input 120 is more positive than the voltage at receiver input 122 . in response to this input voltage , the receiver outputs a logic high on output 124 . in fig1 b , a logic low is input to the driver . in response , transistors 108 and 110 are turned on and transistors 104 and 106 are turned off . in this arrangement current flows from the driver current source through transistor 108 , termination resistor 112 , and transistor 110 . the direction of the current flow develops a voltage across termination resistor 112 such that the voltage at the receiver input 122 is more positive than the voltage at receiver input 120 . in response to this input voltage , the receiver outputs a logic low on output 124 . fig1 a and 1b are provided to illustrate the conventional operation of current mode lvds drivers and receivers . voltage mode lvds drivers and receivers may also be used , but current mode lvds drivers and receivers are the most common variety . the present disclosure may be used with either current or voltage mode lvds drivers and receivers . fig2 a and 2b illustrate an lvds connection formed between a first device 200 and a second device 204 . devices 200 and 204 may be sub - systems in a system , boards in a backplane , ics on a board or other substrate , or embedded core circuits in an ic . in fig2 a and 2b and all following figures , the devices could represent ; ( 1 ) a master device coupled to a slave device , ( 2 ) a master device coupled to another master device , or ( 3 ) a slave device coupled to another slave device . example master devices include but are not limited too ; a microprocessor , a digital signal processor , a serdes serializer , a computer , a production or field tester , an emulation controller , and a trace / debug controller . example slave devices include but are not limited too ; a circuit controlled by a microprocessor , a circuit controlled by a digital signal processor , a serdes deserializer , a circuit controlled by a computer , a circuit controlled by a tester , a circuit controlled by an emulation controller , and a circuit controlled by a trace / debug controller . device 200 comprises a signal source 202 and an ldvs driver 100 . device 204 comprises a signal destination 206 and an ldvs receiver 102 . the signal source 202 in device 200 may be any type of circuit that operates to output signals to the lvds driver 100 . the signal destination 204 may be any type of circuit in device 204 that operates to input signals from lvds receiver 102 . the source and destination circuits could be used to perform a myriad of operations including but not limited to ; ( 1 ) a functional operation of the device , ( 2 ) a test operation of the device , ( 3 ) a debug operation of the device , ( 4 ) a trace operation of the device , and ( 5 ) an emulation operation of the device . one example signal source circuit could be a serdes serializer that operates to input parallel data from another circuit within device 200 and to output the data serially to driver 100 . one example signal destination circuit could be a serdes deserializer that operates to input serial data from receiver 102 and to output the data in parallel to another circuit within device 204 . fig2 a illustrates a logic high being output from source 202 and received by destination 206 . as seen , the driver 100 outputs current from output terminal 116 to output terminal 118 , which develops a voltage across resistor 112 with the polarity being more positive on the receiver input 120 than receiver input 122 . the receiver 102 outputs a logic high to destination 206 in response to the polarity of the voltage across the resister 112 . fig2 b illustrates a logic low being output from source 202 and received by destination 206 . as seen , the driver 100 outputs current from output terminal 118 to output terminal 116 , which develops a voltage across resistor 112 with the polarity being more positive on the receiver input 122 than receiver input 120 . the receiver 102 outputs a logic low to destination 206 in response to the polarity of the voltage across the resister 112 . in either fig2 a or 2 b the termination resistor 112 may exist within device 204 or it may exist external of device 204 . this is true for all following figures . fig3 illustrates two devices 300 and 302 each having signal source 202 and destination 206 circuits and lvds driver 100 and receiver 102 circuits . in this example , source 1 202 of device 300 can communicate with destination 1 206 of device 302 and source 2 202 of device 302 can communicate with destination 2 206 of device 300 . the communications can occur simultaneously since separate lvds signal paths 304 and 306 exist between the devices . having to use separate lvds signal paths for simultaneous communication increases the interconnect between devices 300 and 302 . fig4 illustrates two devices 400 and 402 each having signal source 202 and destination 206 circuits and lvds driver 402 and receiver 102 circuits . lvds drivers 402 are similar to lvds drivers 100 with the exception that the lvds drivers 402 have an enable input 404 and 406 . the enable input is used to enable or disable the output drive of driver 402 . if enable input 404 is set to enable driver 402 of device 400 and enable input 406 is set to disable driver 402 of device 402 , source 1 202 of device 400 can communicate with destination 1 206 of device 402 . likewise , if enable input 404 is set to disable driver 402 of device 400 and enable input 406 is set to enable driver 402 of device 402 , source 2 202 of device 402 can communicate with destination 2 206 of device 400 . the communications cannot occur simultaneously but rather must occur at separate times since only one lvds signal path 410 exists between the devices . having to communicate at separate times decreases the communication bandwidth between the source and destination circuits of devices 400 and 402 . as seen in fig4 , the termination resistors 112 of each receiver 102 lie in parallel on the lvds signal path 410 . this results in a parallel resistance termination ( prt ) 412 on the signal path ( indicated in dotted line ). the value of prt 412 is equal to the parallel resistance of resistors 112 . for example , if resistors 112 are 100 ohms , a typical value for lvds termination resistors , prt will be 50 ohms . since current mode lvds drivers 402 output a constant current , a reduction in the signal path termination resistance ( i . e . the 50 ohm prt ) will lower differential signaling voltages on the signal path 410 to the receivers 102 . lowering differential signaling voltages can cause communication problems ( i . e . lowers the differential noise margin ) between an enabled driver and receiver in the lvds signaling arrangement of fig4 . therefore the differential signaling arrangement of fig4 should only be used in applications where noise is low and the signaling path 410 is short . the present disclosure provides a way to allow simultaneous source to destination communication between devices , like in fig3 , while requiring only a single lvds signal path interconnect between devices , like in fig4 . the present disclosure provides a way to maintain appropriate lvds signaling voltages ( and noise margins ) on an lvds signal path where the termination resistance of the signal path is decreased due to the parallel arrangement of lvds termination resistors , like in fig4 . fig5 illustrates the lvds signaling arrangement between devices 500 and 502 according to the present disclosure . device 500 comprises a signal source 1 202 , a signal destination 2 206 , an lvds driver 100 , an input circuit 504 , termination resistor 112 , and resistors 506 and 508 . the input circuit 504 receives inputs from lvds signal path 514 , lvds signal path 516 , and the output from source 1 202 . the input circuit 514 provides input to destination 2 206 . resistor r1 506 is placed in series between the driver output terminal 116 and signal path 514 . resistor r2 508 is placed in series between the driver output terminal 118 and signal path 516 . device 502 comprises a signal source 2 202 , a signal destination 1 206 , an lvds driver 100 , an input circuit 504 , termination resistor 112 , and resistors 510 and 512 . the input circuit 504 receives inputs from lvds signal path 514 , lvds signal path 516 , and the output from source 2 202 . the input circuit 514 provides input to destination 1 206 . resistor r3 510 is placed in series between the driver output terminal 116 and signal path 514 . resistor r4 512 is placed in series between the driver output terminal 118 and signal path 516 . if devices 500 and 502 are boards or other substrates in a system , resistors 506 - 512 could be discrete resistors placed , as shown , in series between the driver outputs 116 and 118 and board / substrate contacts connected to signal paths 514 and 516 . if devices 500 and 502 are ics on a board or other substrate , resistors 506 - 512 could be poly or transistor channel resistances placed , as shown , in series between the driver outputs 116 and 118 and ic pads connected to signal paths 514 and 516 . if devices 500 and 502 are embedded core circuits in an ic , resistors 506 - 512 could be poly or transistor channel resistances placed , as shown , in series between the driver outputs 116 and 118 and core circuit terminals connected to signal paths 514 and 516 . the lvds driver and series resistor arrangement could be as shown in fig5 , i . e . the driver and resistors are separate circuits connected together inside the device , or the driver and series resistors could be integrated to form a new driver circuit 518 applicable for use by the present disclosure . the circuitry and detail operation of the input circuits 504 will be described later in regard to fig1 , 12 , and 13 . during operation of the devices in fig5 , source 1 202 of device 500 outputs data to driver 100 which transmits differential signals over the signal paths 514 - 516 to input circuit 504 of device 502 to be input to destination 1 206 of device 502 . simultaneously , source 2 202 of device 502 outputs data to driver 100 which transmits differential signals over the signal paths 514 - 516 to input circuit 504 of device 500 to be input to destination 2 206 of device 500 . resistors 506 - 512 should be equal in value or as near equal in value as possible to each other . the value of each resistor 506 - 512 is preferably less than the value of the termination resistor 112 . in the following description of the examples shown in fig6 a - 6b , 7 a - 7 b , 8 a - 8 b , 9 a - 9 b , and 10 it will be assumed for simplification that the termination resistors 112 are 100 ohms , resistors 506 - 512 are each 25 ohms , and the drivers 100 are 5 milliamp lvds drivers . with 100 ohm termination resistors 112 , the parallel termination resistance ( prt ) 412 across the signal paths 514 - 516 , due to the termination resistors 112 , is equal to 50 ohms . while these resistor and current values are used in the description , the present disclosure is not limited to use of only these values . indeed , other resistance and current values can be used without departing from the spirit and scope of the present disclosure . in fig6 a , it is seen that if source 1 of device 500 and source 2 of device 502 both output a logic high to drivers 100 , input circuit 504 of device 500 will input a logic high to destination 2 of device 500 and input circuit 504 of device 502 will input a logic high to destination 1 of device 502 . in fig6 b , the electrical model of the fig6 a signal transfer operation is shown . as seen , driver 100 of device 500 sources current ( i 1 ) into signal path 514 from terminal 116 and returns current ( i 2 ) from signal path 516 at terminal 118 . also as seen , driver 100 of device 502 sources current ( i 3 ) into signal path 514 from terminal 116 and returns current ( i 4 ) from signal path 516 at terminal 118 . the sum of the source currents ( i 1 and i 3 ) pass through prt 412 ( the parallel resistance of terminal resistors 112 ) and develop a voltage across prt with the polarity shown . the voltage developed across prt is input to the voltage input ( vin ) of the input circuits 504 of fig6 a . in response to vin the input circuits 504 output logic highs to destinations 1 and 2 206 . in fig6 b , if the drivers 100 each provide a source current of 5 milliamps , the voltage across each resistor 506 - 512 will be 125 millivolts ( i . e . 25 ohms ร 5 ma ) and the voltage across prt 412 will be 500 millivolts ( i . e . 50 ohms ร 10 ma ). a vin of 500 millivolts with the polarity shown provides a differential lvds input signal to the input circuits 504 that the input circuits 504 can easily recognize as a logic high . the 500 millivolts differential input signal also provides excellent noise immunity in applications with high noise and long signal paths 514 - 516 . while a 500 millivolts differential signal was produced in this example using the assumed currents and resistances , other differential signal voltages could be produced using different assumptions on currents and resistances . in fig7 a , it is seen that if source 1 of device 500 and source 2 of device 502 both output a logic low to drivers 100 , input circuit 504 of device 500 will input a logic low to destination 2 of device 500 and input circuit 504 of device 502 will input a logic low to destination 1 of device 502 . in fig7 b , the electrical model of the fig7 a signal transfer operation is shown . as seen , driver 100 of device 500 sources current ( i 2 ) into signal path 516 from terminal 118 and returns current ( i 1 ) from signal path 514 at terminal 116 . also as seen , driver 100 of device 502 sources current ( i 4 ) into signal path 516 from terminal 118 and returns current ( i 3 ) from signal path 514 at terminal 116 . the sum of the source currents ( i 2 and i 4 ) pass through prt 412 and develop a voltage across prt with the polarity shown . the voltage developed across prt is input to the voltage input ( vin ) of the input circuits 504 of fig7 a . in response to vin the input circuits 504 output logic lows to destinations 1 and 2 206 . in fig7 b , if the drivers 100 each provide a source current of 5 milliamps , the voltage across each resistor 506 - 512 will be 125 millivolts ( i . e . 25 ohms ร 5 ma ) and the voltage across prt 412 will be 500 millivolts ( i . e . 50 ohms ร 10 ma ). a vin of 500 millivolts with the polarity shown provides a differential lvds input signal to the input circuits 504 that the input circuits 504 can easily recognize as a logic low . again , the 500 millivolts differential input signal provides excellent noise immunity in applications with high noise and long signal paths 514 - 516 . as in fig6 a - 6b , while a 500 millivolts differential signal was produced in the fig7 a - 7b example using the assumed currents and resistances , other differential signal voltages could be produced using different assumptions on currents and resistances . in fig8 a , it is seen that if source 1 of device 500 outputs a logic high to the driver 100 of device 500 and source 2 of device 502 outputs a logic low to driver 100 of device 502 , input circuit 504 of device 500 will input a logic low to destination 2 of device 500 and input circuit 504 of device 502 will input a logic high to destination 1 of device 502 . in fig8 b , the electrical model of the fig8 a signal transfer operation is shown . as seen , driver 100 of device 500 sources current ( i 1 ) into signal path 514 from terminal 116 and returns current ( i 2 ) from signal path 516 at terminal 118 . also as seen , driver 100 of device 502 sources current ( i 4 ) into signal path 516 from terminal 118 and returns current ( i 3 ) from signal path 514 at terminal 116 . in this electrical situation , the current ( i 1 ) sourced from driver 100 of device 500 is the current ( i 3 ) returned to driver 100 of device 502 , and the current ( i 4 ) sourced from driver 100 of device 502 is the current ( i 2 ) returned to driver 100 of device 500 . since resistors 506 - 512 are assumed to be 25 ohms each and the source currents i 1 and i 4 are assumed to be 5 milliamps each , the voltages present on signal path 514 and signal path 516 are the same or very close to being the same . with the same voltage present on the terminals of prt 412 , no current , or only a small leakage current , flows through prt 412 . thus the voltage drop across prt ( i . e . vin ) that is input to input circuits 504 is extremely small . in response to the small vin voltage , the input circuits 504 of devices 500 and 502 are designed to input the opposite logic level that each device 500 and 502 was outputting . for example , since source 1 202 of device 500 in fig8 a is outputting a logic high , the input circuit 504 of device 500 will respond to the small vin voltage by inputting a logic low to destination 2 206 of device 500 . likewise , since source 2 202 of device 502 in fig8 a is outputting a logic low , the input circuit 504 of device 502 will respond to the small vin voltage by inputting a logic high to destination 1 206 of device 502 . in fig9 a , it is seen that if source 1 of device 500 outputs a logic low to the driver 100 of device 500 and source 2 of device 502 outputs a logic high to driver 100 of device 502 , input circuit 504 of device 500 will input a logic high to destination 2 of device 500 and input circuit 504 of device 502 will input a logic low to destination 1 of device 502 . in fig9 b , the electrical model of the fig9 a signal transfer operation is shown . as seen , driver 100 of device 500 sources current ( i 2 ) into signal path 516 from terminal 118 and returns current ( i 1 ) from signal path 514 at terminal 116 . also as seen , driver 100 of device 502 sources current ( i 3 ) into signal path 514 from terminal 116 and returns current ( i 4 ) from signal path 516 at terminal 118 . in this electrical situation , the current ( i 2 ) sourced from driver 100 of device 500 is the current ( i 4 ) returned to driver 100 of device 502 , and the current ( i 3 ) sourced from driver 100 of device 502 is the current ( i 1 ) returned to driver 100 of device 500 . since resistors 506 - 512 are assumed to be 25 ohms each and the source currents i 2 and i 3 are assumed to be 5 milliamps each , the voltages present on signal path 514 and signal path 516 are the same or very close to being the same . with the same voltage present on the terminals of prt 412 , no current , or only a small leakage current , flows through prt 412 . thus the voltage drop across prt ( i . e . vin ) that is input to input circuits 504 is extremely small . in response to the small vin voltage , the input circuits 504 of devices 500 and 502 are designed to input the opposite logic level that each device 500 and 502 was outputting . for example , since source 1 202 of device 500 in fig9 a is outputting a logic low , the input circuit 504 of device 500 will respond to the small vin voltage by inputting a logic high to destination 2 206 of device 500 . likewise , since source 2 202 of device 502 in fig9 a is outputting a logic high , the input circuit 504 of device 502 will respond to the small vin voltage by inputting a logic low to destination 1 206 of device 502 . fig1 is provided to indicate that in applications where noise is low and the signal paths are short , a single termination resistor ( rt ) 1002 may be used between the signal paths instead of the two separate termination resistors 112 previously shown on the input of the input circuits 504 . it is clear that use of a single termination resistor 1002 , of say 100 ohms , will advantageously increase the vin voltage to the input circuits 504 using the assumed 5 milliamp lvds drivers 100 . the operation of the present disclosure in the single termination resistor arrangement of fig1 is identical to that previously described in fig6 a - 6b through 9 a - 9 b . as seen from the above descriptions of fig6 a - 6b , 7 a - 7 b , 8 a - 8 b , 9 a - 9 b , and 10 , the present disclosure uses a network of resistances ( r1 , r2 , r3 , r4 , and prt / rt ) in an lvds signal path 514 - 516 in combination with special input circuits 504 to advantageously enable simultaneous differential signal communication between two devices . fig1 a illustrates a first example circuit 1100 that could be used to perform the function of input circuit 504 . circuit 1100 comprises an inverter 1102 with its input coupled to the output 1120 from source circuit 202 , a differential receiver 102 with its non - inverting input 1108 coupled to signal path 514 and its inverting input 1110 coupled to signal path 516 , a window comparator 1104 with its a input 1112 coupled to signal path 514 and its b input 1114 coupled to signal path 516 , and a multiplexer 1106 with a first input coupled to the output of inverter 1102 , a second input coupled to the output of differential receiver 102 , a control input coupled to the output window comparator 1104 , and an output 1118 coupled to the input to destination circuit 206 . the function of the window comparator 1104 is to output a logic high on the c output 1116 whenever the voltage on its a input 1112 is greater than the voltage on its b input 1114 plus an offset voltage ( osv ) โ or โ whenever the voltage on its b input 1114 is greater than the voltage on its a input 1112 plus an offset voltage ( osv ). otherwise the window comparator outputs a logic low on the c output 1116 . the offset voltages ( osv ) are set such that if a small differential voltage , as described in fig8 a - 8b and 9 a - 9 b , is present between signal paths 514 and 516 , the voltage differential at the a and b inputs of the window comparator 1104 will not be sufficiently large enough to cause the c output of the window comparator to be set to a logic high . thus in response to small differential voltages , the window comparator 1104 will output a logic low to the control input of multiplexer 1106 , which causes the inverted out ( out *) signal from the source 202 of a device to be input to the destination 206 of the same device , via multiplexer output 1118 . on the other hand , if an adequately large differential voltage is present between the signal paths 514 and 516 , the differential voltage at the a and b inputs of the window comparator 1104 will be sufficiently large enough to exceed the offset voltages ( osv ) and cause the c output of the window comparator to be set to a logic high . for example , the 500 mv signal of polarity shown in fig6 a - 6b will cause output c of the window comparator to be set high . likewise , the 500 mv signal of polarity shown in fig7 a - 7b will cause output c of the window comparator to be set high . if output c of the window comparator is high , multiplexer 1106 will output the output of receiver 102 to the destination 206 via multiplexer output 1118 . for example , receiver 102 will output a logic high to destination 206 , via multiplexer 1106 , in response to receiving the 500 mv signal of polarity shown in fig6 a - 6b . further , receiver 102 will output a logic low to destination 206 , via multiplexer 1106 , in response to receiving the 500 mv signal of polarity shown in fig7 a - 7b . in summary , the input circuit 1100 of fig1 a outputs the inverted output of the source 202 of a device to the destination 206 of the same device if the differential voltage on signal paths 514 and 516 is small and within a voltage window established by offset voltage ( osv ) settings . the input circuit 1100 of fig1 a outputs the output of the receiver 102 to the destination 206 of the device if the differential voltage on signal paths 514 and 516 is large and outside the voltage window established by the offset voltage ( osv ) settings . fig1 b illustrates one example circuit 1124 that could be used as window comparator 1104 of fig1 b . the circuit 1124 comprises a first comparator 1126 with its non - inverting input 1132 coupled to input a 1112 and its inverting input 1134 coupled to input b 1114 , a second comparator 1128 with its non - inverting input 1136 coupled to input b 1114 and its inverting input 1138 coupled to input a 1112 , an or gate 1130 with a first input coupled to the output of comparator 1126 , a second input coupled to the output of comparator 1128 , and an output coupled to output c 1116 . comparator 1126 is designed such that the voltage on its non - inverting input 1132 must be greater than the voltage on its inverting input 1134 by an offset voltage ( osv ) value ( assumed to be 80 millivolts in this example ) before the comparator output will go high . comparator 1128 is designed such that the voltage on its non - inverting input 1136 must be greater than the voltage on its inverting input 1138 by an offset voltage ( osv ) value ( assumed to be 80 millivolts in this example ) before the comparator output will go high . if the voltage difference on the a and b inputs is less than 80 millivolts , output c goes low . if the voltage difference on the a and b inputs is greater than 80 millivolts , output c goes high . while 80 millivolts was used as an example osv , any desired value of osv may be used as well . fig1 a illustrates a second example circuit 1200 that could be used to perform the function of input circuit 504 . circuit 1200 comprises an inverter 1202 with its input coupled to the output 1216 from source circuit 202 , a window comparator 1204 with its a input 1208 coupled to signal path 514 and its b input 1210 coupled to signal path 516 , and a multiplexer 1206 with a first input coupled to a fixed logic high , a second input coupled to a fixed logic low , a third input coupled to the output of inverter 1202 , a first control input coupled to output c 1212 of window comparator 1204 , a second control input coupled to output d 1214 of window comparator 1204 , and an output 1218 coupled to the input to destination circuit 206 . ( 1 ) to output a logic high on output c and a logic low on output d whenever the voltage on its a input 1208 is greater than the voltage on its b input 1210 plus an offset voltage ( osv ) โ and โ the voltage on its b input 1210 is less than the voltage on its a input plus an offset voltage ( osv ), ( 2 ) to output a logic low on output c and a logic high on output d whenever the voltage on its a input 1208 is less than the voltage on its b input 1210 plus an offset voltage ( osv ) โ and โ the voltage on its b input 1210 is greater than the voltage on its a input plus an offset voltage ( osv ), ( 3 ) to output a logic low on output c and output d whenever the voltage on its a input 1208 is less than the voltage on its b input 1210 plus an offset voltage ( osv ) โ and โ the voltage on its b input 1210 is less than the voltage on its a input plus an offset voltage ( osv ). the offset voltages ( osv ) are set such that if a small differential voltage , as described in fig8 a - 8b and 9 a - 9 b , is present between signal paths 514 and 516 , the voltage differential at the a and b inputs of the window comparator 1204 will not be sufficiently large enough to cause both the c and d outputs of the window comparator to be set high . thus in response to small differential voltages , the window comparator 1204 will output logic lows to the control inputs of multiplexer 1206 , which causes the inverted out ( out *) signal from the source 202 of a device to be input to the destination 206 of the same device , via multiplexer output 1206 . on the other hand , if an adequately large differential voltage is present between the signal paths 514 and 516 , the differential voltage at the a and b inputs of the window comparator 1104 will be sufficiently large enough to exceed the offset voltages ( osv ) and cause either the c or d output of the window comparator to be set high . for example , the 500 mv signal of polarity shown in fig6 a - 6b will cause output c to be set high and output d to be set low . likewise , the 500 mv signal of polarity shown in fig7 a - 7b will cause output d to be set high and output c to be set low . if output c is high and output d is low , multiplexer 1206 will output the fixed logic high input to destination 206 via multiplexer output 1218 . if output c is low and output d is high , multiplexer 1206 will output the fixed logic low input to destination 206 . and as mentioned , if both output c and d are low , multiplexer 1206 will output the inverted output ( out *) of the source 202 of a device to the destination 206 of the same device . in summary , the input circuit 1200 of fig1 a outputs the inverted output of the source 202 of a device to the destination 206 of the same device if the differential voltage on signal paths 514 and 516 is small and within a voltage window established by offset voltage ( osv ) settings . the input circuit 1200 of fig1 a outputs the fixed logic high to the destination 206 of the device if the differential voltage on signal paths 514 and 516 is such that the voltage on input a is sufficiently larger that the voltage on input b plus the offset voltage ( osv ). the input circuit 1200 of fig1 a outputs the fixed logic low to the destination 206 of the device if the differential voltage on signal paths 514 and 516 is such that the voltage on input b is sufficiently larger that the voltage on input a plus the offset voltage ( osv ). fig1 b illustrates one example circuit 1220 that could be used as window comparator 1204 of fig1 b . the circuit 1220 comprises a first comparator 1222 with its non - inverting input 1226 coupled to input a 1208 , its inverting input 1228 coupled to input b 1210 , and its output coupled to output c 1212 , and a second comparator 1224 with its non - inverting input 1230 coupled to input b 1210 , its inverting input 1232 coupled to input a 1208 , and its output coupled to output d 1214 . comparator 1222 is designed such that the voltage on its non - inverting input 1226 must be greater than the voltage on its inverting input 1228 by an offset voltage ( osv ) value ( 80 millivolts in this example ) before the comparator output c will go high . comparator 1224 is designed such that the voltage on its non - inverting input 1230 must be greater than the voltage on its inverting input 1232 by an offset voltage ( osv ) value ( 80 millivolts in this example ) before the comparator output d will go high . if the voltage difference on the a and b inputs is less than 80 millivolts , comparator outputs c and d go low . while 80 millivolts was used as an example osv , any desired value of osv may be used as well . fig1 a - 13d show another circuit 1300 that could be used to realize window comparator 1104 of fig1 a . circuit 1300 comprises a first comparator 1302 with its non - inverting input coupled to the a input and its inverting input coupled to a reference voltage ( assumed to be 250 mv in the fig1 a - 13d examples ), a second comparator 1304 with its non - inverting input coupled to the b input and its inverting input coupled to the reference voltage , an or gate 1306 with a first input coupled to the output of comparator 1302 , a second input coupled to the output of comparator 1304 , and an output coupled to the c output . to simply the description , circuit 1300 will be shown used in the signaling arrangements previously described in fig6 b , 7 b , 8 b , and 9 b , and with the previously assumed resistance and current values stated for said figures . fig1 a illustrates that in the previously described signaling arrangement of fig6 b , the voltage ( 625 mv ) on the a input of circuit 1300 , coupled to signal path 514 , will be greater than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) on the b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1302 will output a logic high to or gate 1306 and comparator 1304 will output a logic low to or gate 1306 . in response , the or gate will output a logic high on the output c , causing multiplexer 1106 of fig1 a to output the output of receiver 102 to destination 206 as previously described . fig1 b illustrates that in the previously described signaling arrangement of fig7 b , the voltage ( 125 mv ) on the a input of circuit 1300 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 625 mv ) on the b input , coupled to signal path 516 , will be greater than the reference voltage ( 250 mv ). thus comparator 1302 will output a logic low to or gate 1306 and comparator 1304 will output a logic high to or gate 1306 . in response , the or gate will output a logic high on the output c , causing multiplexer 1106 of fig1 a to output the output of receiver 102 to destination 206 as previously described . fig1 c illustrates that in the previously described signaling arrangement of fig8 b , the voltage ( 125 mv ) on the a input of circuit 1300 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) on the b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1302 will output a logic low to or gate 1306 and comparator 1304 will output a logic low to or gate 1306 . in response , the or gate will output a logic low on the output c , causing multiplexer 1106 of fig1 a to output the output ( out *) of inverter 1102 to destination 206 as previously described . fig1 d illustrates that in the previously described signaling arrangement of fig9 b , the voltage ( 125 mv ) on the a input of circuit 1300 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and voltage ( 125 mv ) on the b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1302 will output a logic low to or gate 1306 and comparator 1304 will output a logic low to or gate 1306 . in response , the or gate will output a logic low on the output c , causing multiplexer 1106 of fig1 a to output the output ( out *) of inverter 1102 to destination 206 as previously described . fig1 e - 13h depicts another circuit 1308 that could be used to realize window comparator 1204 of fig1 a . circuit 1308 comprises a first comparator 1310 with its non - inverting input coupled to the a input , its inverting input coupled to a reference voltage ( assumed to be 250 mv in the fig1 e - 13h examples ), and an output coupled to the c output , a second comparator 1312 with its non - inverting input coupled to the b input , its inverting input coupled to the reference voltage , and an output coupled to the d output . to simply the description , circuit 1308 will be shown used in the signaling arrangements previously described in fig6 b , 7 b , 8 b , and 9 b , and with the previously assumed resistance and current values stated for said figures . fig1 e illustrates that in the previously described signaling arrangement of fig6 b , the voltage ( 625 mv ) on the a input of circuit 1308 , coupled to signal path 514 , will be greater than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) the on b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1310 will output a logic high on the c output and comparator 1312 will output a logic low on the d output . in response to c being high and d being low , multiplexer 1206 of fig1 a will output the fixed logic high input to destination 206 as previously described . fig1 f illustrates that in the previously described signaling arrangement of fig7 b , the voltage ( 125 mv ) on the a input of circuit 1308 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 625 mv ) the on b input , coupled to signal path 516 , will be greater than the reference voltage ( 250 mv ). thus comparator 1310 will output a logic low on the c output and comparator 1312 will output a logic high on the d output . in response to c being low and d being high , multiplexer 1206 of fig1 a will output the fixed logic low input to destination 206 as previously described . fig1 g illustrates that in the previously described signaling arrangement of fig8 b , the voltage ( 125 mv ) on the a input of circuit 1308 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) the on b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1310 will output a logic low on the c output and comparator 1312 will output a logic low on the d output . in response to c being low and d being low , multiplexer 1206 of fig1 a will output the output ( out *) of inverter 1202 to destination 206 as previously described . fig1 h illustrates that in the previously described signaling arrangement of fig9 b , the voltage ( 125 mv ) on the a input of circuit 1308 , coupled to signal path 514 , will be less than the reference voltage ( 250 mv ) and the voltage ( 125 mv ) the on b input , coupled to signal path 516 , will be less than the reference voltage ( 250 mv ). thus comparator 1310 will output a logic low on the c output and comparator 1312 will output a logic low on the d output . in response to c being low and d being low , multiplexer 1206 of fig1 a will output the output ( out *) of inverter 1202 to destination 206 as previously described . while fig1 a - 11b , 12 a - 12 b , and 13 a - g have shown various examples of how to design input circuits 504 for use by the present disclosure , it is anticipated that other ways of designing input circuits 504 will be conceived by those skilled in the art . thus the present disclosure is not limited to only using the example input circuit designs shown and described herein . fig1 illustrates two devices 1400 and 1402 coupled together using an lvds signal path 514 - 516 for transferring data signals and an lvds signal path 1424 - 1426 for transferring clock signals . the devices communicate data simultaneously between each other using input circuit 504 , driver 100 , and signaling path resistor network as previously described . the data being communicated could be of any data type , including but not limited to ; functional data , test data , debug data , trace data , and emulation data device 1400 comprises a deserializer 1404 for inputting serial data from input circuit 504 , data receiving circuitry 1406 for inputting parallel data from the deserializer 1404 , a serializer 1408 for inputting serial data to driver 100 , and data providing circuitry 1410 for inputting parallel data to serializer 1408 . the combination of the data receiving circuitry 1406 and deserializer 1404 represent one example design for a destination circuit 206 . the combination of the data providing circuitry 1410 and serializer 1408 represent one example design for a source circuit 202 . device 1400 also comprises clock output circuitry 1412 and an lvds clock driver 1428 . the clock output circuitry 1412 provides a clock output to driver 1428 and outputs control ( ctl ) signals to operate the providing circuitry 1410 , serializer 1408 , deserializer 1404 , and receiving circuitry 1406 . the control ( ctl ) signals output to the serializer and deserializer from the clock output circuit will operate faster than the control signals to the receiving and providing circuits since they will be controlling the higher speed serial input and output operations occurring over signal paths 514 and 516 . the clock output circuit 1412 may employ use of clock and control signal modification circuits such as but not limited to ; a phase lock loop , a phase shifter , a frequency divider , or a frequency multiplier . driver 1428 is similar to driver 100 and drives lvds clock outputs from device 1400 on signal paths 1424 and 1426 . lvds clocking is shown being used to provide high speed clock signals from device 1400 to device 1402 . if desired , single ended clocking could be used instead of the differential clocking shown , but the clocking frequency would be reduced between device 1400 and 1402 . device 1400 is assumed to be a master device since it outputs the lvds clock on signal paths 1424 - 1426 . device 1402 comprises a deserializer 1418 for inputting serial data from input circuit 504 , data receiving circuitry 1420 for inputting parallel data from the deserializer 1418 , a serializer 1414 for inputting serial data to driver 100 , and data providing circuitry 1416 for inputting parallel data to serializer 1414 . as in device 1400 , the combination of the data receiving circuitry 1420 and deserializer 1418 represent one example design for a destination circuit 206 , and the combination of the data providing circuitry 1416 and serializer 1414 represent one example design for a source circuit 202 . device 1402 also comprises clock input circuitry 1422 and an lvds clock receiver 1430 . the clock input circuitry 1422 receives the clock output from receiver 1430 and outputs control ( ctl ) to operate the providing circuitry 1416 , serializer 1414 , deserializer 1418 , and receiving circuitry 1420 . the control ( ctl ) signals output to the serializer and deserializer from the clock input circuit will operate faster than the control signals to the receiving and providing circuits since they will be controlling the higher speed serial input and output operations occurring over signal paths 514 and 516 . the clock input circuit 1422 may employ use of clock and control signal modification circuits such as but not limited to ; a phase lock loop , a phase shifter , a frequency divider , or a frequency multiplier . receiver 1430 is similar to receiver 102 and inputs the lvds clock outputs from device 1400 on signal paths 1424 and 1426 . device 1402 is assumed to be a slave device since it inputs the lvds clock on signal paths 1424 - 1426 . during operation data is transmitted from the providing circuitry 1410 and serializer 1408 of device 1400 to the deserializer 1418 and receiving circuitry 1420 of device 1402 . simultaneous with data transmitted from device 1400 to device 1402 , data is transmitted from the providing circuitry 1416 and serializer 1414 of device 1402 to the deserializer 1404 and receiving circuitry 1406 of device 1400 . the simultaneous data transfers between devices 1400 and 1402 are controlled by clock output circuitry 1412 of device 1400 and the clock input circuitry 1422 of device 1402 . as mentioned , internal to device 1400 , clock output circuitry 1412 provides the control ( ctl ) inputs to operate the providing 1410 , serializer 1408 , deserializer 1404 , and receiving 1406 circuits . external to the device , clock output circuitry 1412 provides the lvds clock input to device 1402 . internal to device 1402 , and in response to the lvds clock input from device 1400 , the clock input circuitry 1422 provides the control ( ctl ) inputs to operate the providing 1416 , serializer 1414 , deserializer 1418 , and receiving 1420 circuits . fig1 is provided to indicate that a plurality of the providing ( 1410 , 1416 ), serializer ( 1408 , 1414 ), deserializer ( 1404 , 1418 ), and receiver ( 1406 , 1420 ) circuit arrangements 1504 - 1510 of fig1 could exist in devices 1500 and 1502 . each arrangement 1504 - 1506 in device 1500 operable , in response to the clock output circuitry 1412 to communicate data simultaneously with an associated arrangement 1508 - 1510 in device 1502 via an input circuit 504 , driver 100 , resistors , and lvds signal path 1512 / 1514 . fig1 illustrates a device 1600 coupled to a debug , trace , or emulation controller 1610 via an lvds signal path 1606 and lvds clock path 1608 according to the present disclosure . the debug , trace , or emulation controller 1610 is similar in design to the master device 1400 of fig1 with the exception that its specific function is to control a debug , trace , or emulation operation in device 1600 via the data and clock signal paths 1606 and 1608 . device 1600 is similar to the slave device 1402 of fig1 with the exception that the providing circuit 1416 of fig1 is indicated to be a memory or other circuit 1602 that needs to be controlled by device 1610 to output data during a debug , trace , or emulation operation , and the receiving circuit 1420 of fig1 is indicated as being a memory or other circuit 1604 that needs to be controlled by device 1610 to input data during a debug , trace , or emulation operation . using the lvds signaling approach of the present disclosure , much higher debug , trace , and / or emulation communication can occur between master device 1610 and slave device 1600 , as opposed to other approaches used in the industry today . for example , it is well known to use the ieee 1149 . 1 standard interface ( i . e . jtag ) for debug , trace , and / or emulation operations . however , standard jtag communication rates between a master and slave device is limited to around 50 - 100 mhz . since the present disclosure uses lvds signaling , the communication rates between a master 1610 and slave 1600 during debug , trace , and / or emulation operations can be greater than 400 mhz . indeed , using the lvds signaling approach of the present disclosure , communication for debug , trace , and / or emulation operations may well extend into the gigahertz range . device 1600 can be extended , as shown in device 1502 of fig1 , to include a plurality of lvds signal paths and associated driver 100 , input circuits 504 , serializer 1414 and deserializer 1418 such that high speed communication to greater number of debug , trace , and / or emulation circuits 1602 and 1604 is possible . fig1 is provided to indicate that a slave device 1700 may use a shift register 1702 during debug , trace , and / or emulation operations instead of a separate serializer 1414 ( i . e . a serial in / parallel out circuit ) and a separate deserializer 1418 ( i . e . a parallel in / serial out circuit ) if desired . in operation the shift register 1702 loads parallel debug , trace , and / or emulation data from circuit 1602 and shifts the data out to driver 100 as debug , trace , and / or emulation data is shifted in from input circuit 504 to be loaded in parallel to debug , trace , and / or emulation circuit 1604 . fig1 illustrates a device 1800 coupled to an ic or die tester 1810 via an lvds signal path 1806 and lvds clock path 1808 according to the present disclosure . the tester 1810 is similar in design to the master device 1400 of fig1 with the exception that its specific function is to control a test operation in device 1800 via the data and clock signal paths 1806 and 1808 . device 1800 is similar to the slave device 1402 of fig1 with the exception that a scan path 1802 is coupled between the output of the input circuit 504 and the input of driver 100 , and a circuit under test 1804 is shown coupled to the scan path 1802 to be the receiving 1420 and providing 1416 circuits during test operations . device 1800 can be a packaged ic , an unpackaged ic die , or a die on wafer . the circuit under test 1804 is typically , but not limited to being , combinational logic . the serial data input to scan path 1802 from input circuit 504 is stimulus test data to be applied in parallel 1812 to the inputs of circuit under test 1804 . the serial data output from scan path 1802 to driver 100 is response test data loaded in parallel 1814 to the scan register from the circuit under test outputs . scan testing is well known . what is new is performing scan testing using the lvds signaling approach of the present disclosure . using the lvds signaling approach of the present disclosure , much higher test input and output communication can occur between master device 1810 and slave device 1800 , as opposed to other approaches used in the industry today . for example , known scan interface used in the industry today ( ieee standards 1149 . 1 and 1500 ) are limited to scan test communication rates / frequencies of around 50 - 100 mhz . since the present disclosure uses lvds signaling , the communication rates between a master 1810 and slave 1800 during scan testing can be greater than 400 mhz . indeed , using the lvds signaling approach of the present disclosure , communication for scan test operations may well extend into the gigahertz range . fig1 illustrates a device 1900 coupled to an ic or die tester 1912 via a plurality of lvds signal paths 1906 - 1908 and an lvds clock path 1910 according to the present disclosure . each lvds signal path 1906 - 1908 is coupled to an arrangement 1902 - 1904 of drivers 100 , input circuits 504 , scan paths 1802 , and circuits under test 1804 . the tester 11912 is similar to tester 1810 with the exception that it can communicate to the device 1900 over the plurality of lvds signal paths 1906 - 1908 , instead of the single lvds signal path of fig1 . by increasing the number of lvds signal paths and arrangements 1902 - 1904 a larger number of circuits 1804 can be tested in parallel , which decreases test time of device 1900 . fig2 illustrates either a plurality or ics 2018 - 2030 in a fixture 2000 or a plurality of die 2018 - 2030 on a wafer 2000 interfaced to a plural ic or die tester 2002 via lvds data and clock signal paths 2004 - 2016 . if the ic or die 2018 - 2030 are the type shown in fig1 , there will be one lvds data signal path pair and one lvds clock signal path pair between the tester 2002 and each ic or die 2018 - 2030 . if the ic or die 2018 - 2030 are the type shown in fig1 , there will be one lvds clock signal path pair and a plurality of lvds data signal path pairs ( indicated by increased line width ) between the tester 2002 and each ic or die 2018 . fig2 illustrates how a plurality of ics 2018 - 2030 in a fixture 2000 or a plurality of die 2018 - 2030 on a wafer 2000 may be scan tested in parallel ( i . e . at the same time ) using the lvds signaling approach of the present disclosure . while fig1 - 20 have illustrated the lvds signaling approach of the present disclosure for testing ics or die using a scan test approach , other test approaches may be interfaced to the lvds signaling approach of the present disclosure as well . other test approaches that may be interfaced to the lvds signaling interface of the present disclosure may include but are not limited to , ( 1 ) a test approach based on ieee standard 1149 . 1 , ( 2 ) a test approach based on ieee standard 1149 . 4 , ( 3 ) a test approach based on ieee standard 1149 . 6 , ( 4 ) a test approach based on ieee standard 1500 , ( 5 ) a test approach based on built in self test , and ( 6 ) a test approach based on functional testing . although the present disclosure has been described in detail , it should be understood that various changes , substitutions and alterations may be made without departing from the spirit and scope of the disclosure as defined by the appended claims . | 7 |
referring to fig1 and 2 of the drawings that follow , there is shown a hollow circular cylindrical body 2 having an intended axis of rotation 3 . from the axis 3 outwards , the body 2 comprises an inner substrate layer 4 , two magnetic segments 6a , 6b , fibre reinforcing layers 8 , 10 and an outer protective coating 12 . in this context magnetic segments 6a , 6b may be regarded also as substrates . the body 2 has a length of 500 mm ( of which 350 mm is the active length ), an internal diameter of 100 mm and a radial thickness of about 6 mm . the substrate 4 defines a cylindrical tube and comprises a layer of resin impregnated fibres forming a rigid substrate base layer . the substrate 4 is a single hoop layer . that is one in which the winding angle relative to the axis 3 is approximately 90 ยฐ. it will be appreciated that the winding angle must not be exactly 90 ยฐ otherwise the layer would be built up radially not longitudinally . it is preferred that the winding angle be chosen to lay fibre adjacent one another . the fibres may comprise carbon fibres or alternatively may be glass fibres , kevlar ( polyaramid ) plastics , boron , nylon , polyolefin or mixtures of those or any other suitable fibres . the resin can be an epoxy , in this case ly556 with hy917 hardener . in the embodiment of fig1 and 2 two substantially similar segments 6a , 6b are shown . each segment 6a , 6b extends for the substantial length of the cylinder defined by substrate 4 . each segment 6a , 6b is half of a cylindrical tube the internal diameter of which matches the external diameter of the substrate 4 . the segments 6a , 6b each comprise a mixture of an epoxy and a magnetic material . the magnetic material is isotropically and homogeneously distributed in a powder form , typically with a mean particle size of about 10 - 30 ฮผm and may comprise iron , nickel , cobalt or an alloy containing one or more of these . it may comprise a ferrite , eg barium ferrite . alternatively and preferably the material comprises a known hard magnetic material ( ie hard to demagnetise ) comprising a rare - earth element , eg cobalt - samarium or neodymium - iron - boron . the amount of magnetic material to epoxy in the segments 6a , 6b is 40 - 50 % by volume , although up to 80 % loading by volume has been achieved . the reinforcing layer 8 comprises a fibre and epoxy hoop layer substantially similar to substrate 4 . the reinforcing layer 10 comprises a fibre and epoxy helix layer , similar to reinforcing layer 8 in materials , but wound with a winding angle relative to the rotor axis 3 of significantly less than 90 ยฐ. the hoop layer 8 provides thermal stability and radial strength . the helix layer 10 provides lateral structural stiffness . the combination of the hoop and helix layers 8 , 10 provides some thermal stability and lateral stiffness , as well as a rougher surface to which protective coating 12 can key . since , on cooling the helical layer 10 shrinks significantly more than the hoop layer 8 , the latter protects the magnetic body to some extent during the cooling process . a method of manufacturing the cylindrical body 2 of fig1 and 2 will now be described . the unmagnetised neodymium - iron - boron ( ndfeb ) magnetic material and uncured epoxy resin are mixed together in the ratio of up to 80 % of magnetic material by volume . referring to fig3 of the drawings that follow there is shown a two part mould 14a , 14b having male 14a and female 14b components . the male mould 14a is a hemicylindrical body of diameter r 1 . the female mould 14b is a cylindrical concave trough of diameter r 2 where r 2 is greater than r 1 by 3 mm . the ndfeb epoxy resin mixture ( identified at 16 ) is conveyed into the female mould 14b and the male mould 14a placed centrally thereover as shown . the epoxy resin is at least partially cured . the segment 6a is then self - supporting . the segments 6a , 6b produced are of constant 3 mm thickness . this has been found to be the best compromise between inertia , magnetisation and torque for most applications . the magnetic layers or segments 6a , 6b thereby produced are in the form of semi - cylindrical slabs comprising a generally homogeneous distribution of magnetic material and binder , without embedded fibre tows . the magnetic material is evenly distributed throughout the bulk of the segments 6a , 6b . next , the substrate layer 4 is formed by hoop winding carbon fibre tows impregnated with uncured epoxy resin onto a circular cylindrical mandrel ( not shown ) using a known fibre winding machine . only one layer is required to form the substrate 4 . glass , kevlar or other fibre tows could also be used . the preformed segments 6a , 6b are then disposed about the substrate 4 and secured temporarily thereto by an epoxy glue or other fixative . next the hoop layer 8 of controlled thickness is wound around the segments 6a , 6b . when the fibre tows cure , a hoop layer shrinks less than a helix layer . therefore , the hoop layer 8 protects the segments 6a , 6b which is a reason why it is desirable to have hoop layers on either side of the magnetic material . if a helically wound layer was adjacent the magnetic material , the pressure it would exert on curing could deform the segments 6a , 6b and even result in it not being possible to remove the cylindrical body from the mandrel . the combination of hoop layer 8 and helix layer 10 each formed from fibre tows impregnated with uncured epoxy resin is wound over the magnetic material to achieve the required mechanical properties for the cylindrical body . the resin in the substrate 4 , segments 6a , 6b , layers 8 and 10 is then cured by heating the body to a curing temperature appropriate to the resin ( s ). the body can then be removed from the mandrel ( not shown ) as it will be self - supporting when cured . a protective outer layer 12 is then disposed about the layer 10 . the nature of the final layer 12 is determined by the intended application of the body 2 . for instance , if the body 2 is to be used as a roller , the outer layer 10 could comprise a rubber , ceramic or stainless steel covering . either before or after the application of layer 12 , the ndfeb is magnetised to align the particles . in fact this can be carried out at any stage . magnetisation is achieved by passing the segments through a high strength magnetic field , typically 3 tesla . energies of only about 15 kj are required because the smaller segments can be magnetised separately or the magnetisation can be achieved in stages along the length of the segment . a preferred field pattern for the magnetised body 2 is shown in fig4 of the drawings that follow magnetised by a circumferentially continuously varying field . this pattern is based on an extension of that referred to in a paper &# 34 ; permanent magnets for production and use of high energy beams &# 34 ;, proc . 8th int . workshop on rare earth permanent magnets , pp 123 - 136 , 1985 ( k halbach ) the content of which is incorporated herein by reference . the fields of fig4 describe generally sinusoidal patterns . the magnetisation field distribution h to magnetise a halbach cylinder must satisfy the following criteria with the units being amps per metre : ## equ3 ## for an internal field , and according to the following for an external field : where p is the required number of pole - pairs h is the magnetising field strength , and ฮธ h is the angle between the magnetizing field direction and the reference axis . the external field ( relative to the current carrier ) produced by a sinusoidally distributed current , of density jz = j sin ( pฮธ ), the units being amps per square metre for an internal field relative to the cylindrical body , is given by : ## equ4 ## in which r 1 is the internal radius to the current carrier and r 2 is the external radius to the current carrier . thus , the distribution of the external field satisfies the conditions for the magnetisation of a multi - pole halbach cylinder . externally of the cylinder , the magnetic field is kept at a minimum and normally about zero . thus , the halbach cylinder is substantially self - shielding . in the halbach paper there is reference only to the production of the field using discrete magnetic blocks orientated approximately to generate the field described above . cylindrical bodies according to the present invention can be magnetised to produce a continuous field that better satisfies the halbach equations ( 1 )-( 3 ). in fig4 the field pattern is produced from magnetising the segments 6a , 6b with a continuously varying field to produce 8 equally spaced poles ( or pseudo - poles ) labelled a through h for convenience . this field pattern produces a relatively high field inside the body 2 , with a minimal field outside , thereby reducing electromagnetic interference caused by operation of the body 2 . the magnetisation in the body is described by the following equation ( 4 ): ## equ5 ## where m is the magnetisation vector , p is the required number of pole pairs and ฮธ m is the angle between the magnetic field direction and the radial axis of reference of the body . referring to fig5 of the drawings that follow , there is shown an arrangement for the internal magnetisation of the cylindrical body 2 . in fig5 the cylindrical body 2 has an inner radius r i and an outer radius r o , and disposed internally about the body 2 are a first group of six longitudinal conductors 20a - 20f and a second group of six longitudinal conductors 22a - 22f . each conductor subtends an angle of 2ฮฑ . current is passed one way through conductors 20a - 20f and the other way through conductors 22a - 22f in order to magnetise the cylindrical body 2 . in order that the magnetisation can so far as possible approximate the sinusoidal halbach field desired , the angular spacing and radial distance of the conductors 20 , 22 is determined as follows . a multipole magnetised cylindrical body 2 with an internal field is characterised by a magnetisation distribution which satisfies : where ฮธ m is the angle the magnetisation vector m makes with an arbitrary reference axis , as is shown in fig6 of the drawings that follow , and p is the number of pole - pairs . to achieve the magnetisation distribution , the magnetising field must satisfy the same condition . for an even number of conductors per pole , as in fig4 in which there are 8 , the n th harmonic of the current density for a distribution having k conductors per half pole is given by : ## equ6 ## the number of harmonics which can be eliminated equals k . this is achieved by solving the following set of equations : ## equ7 ## for example , for the case in which k = 3 , the determination of the angles ฮธ 1 , ฮธ 2 and ฮธ 3 for with the 3rd , 5th and 7th harmonics are eliminated is achieved by solving the following set of equations : for example , another type of modulation which can be used independently or in conjunction with the previous , is one having two conductors per half pole , ie k = 2 . in this case , only the 3rd and 5th harmonics can be eliminated , and the angles ฮธ 1 and ฮธ 2 are determined similarly to the previous case . in this case equation ( 6 ) is reduced to : alternatively , an odd number of conductors per pole can be used , ie k conductors per half pole plus one conductor situated at the centre of a pole . for these category of distributions the nth harmonic of the current density j n is given by : ## equ8 ## again the number of harmonics which can be eliminated equals k and this is achieved by determining the angular positions of the conductors solving the following set of equations : in the above equations ( 6 ) to ( 11 ) j n is the current density contributing to the magnetisation for the nth harmonic . regarding the distance &# 34 ; d &# 34 ; between the conductors and the magnet , this is chosen to filter the effect of the lowest harmonic not eliminated by the angular distribution of the conductors . for example in the case of the distribution the 3rd , 5th and 7th harmonics have been eliminated hence , they do not have any contribution to the magnetising field . however , the harmonics 9th , which represents the lowest harmonic not eliminated by the distribution of the conductors , and above , ie 11th etc , are still existent , and to minimise their contribution to the magnetising field in the magnet region the distance &# 34 ; d &# 34 ; is required to minimise their effect on the magnetisation . in general , the distance d is given by : ## equ9 ## where r i is the inner radius of the magnet cylinder , p the number of pole pairs and n s the order of the lowest harmonic not eliminated by the current density distribution . in the first example given above n s = 9 . in the second example given above where only 3rd and 5th harmonics are eliminated n s = 7 . although up to now the invention has been described largely in relation to internally magnetised cylindrical bodies it can equally well be applied to externally magnetised cylindrical bodies . internal field cylindrical bodies can be used in external rotor permanent magnet motors , and external field cylindrical bodies can be used in internal rotor permanent magnet motors , as well as other applications . in the case of an externally magnetised body , the conductors 20a - 20f and 22a - 22f are disposed about the body 2 externally as shown in fig7 of the drawings that follow . for such a multiple external field cylinder the magnetisation distribution satisfies : and the distance &# 34 ; d &# 34 ; of a conductor from the surface of the body in order to reduce higher harmonic effects is given by : ## equ10 ## where r o is the external radius of the cylinder . of course , the distance d can be exceeded , but this requires further energy to be imparted to the conductors to achieve the desired magnetisation . thus , if the cylindrical body is magnetised only internally , only an internal field is produced , and if magnetised only externally only an external field is produced . the arrangement is self - shielding . in order to decrease the energy required to magnetise a given body , a slotless iron core 26 can be used as shown in fig8 of the drawings that follow for both an internal and an external field . the body facing surface of the iron core should be close as close as possible to the conductors for maximum effect . it is important for the core to be slotless to make the previous equations applicable . magnetising fixtures are designed to imprint a specific number of poles on a cylindrical magnet . the magnetising field required for full magnetisation depends on the magnetic material to be magnetised . three parameters are chosen to fully magnetise a multipole magnet cylinder , with a given size and using a given capacitor discharge magnetiser : the designer can still proceed in the same way , for example choosing a specific distribution or combining different distributions in different layers to change the number of conductors per pole . however , the angular positions of the magnetising conductors and minimum distance &# 34 ; d &# 34 ; for each layer must be satisfied in any case for the preferred magnetisation . before use , the body 2 is tested and corrected for any imbalance using high speed rotational trials . typically an imbalance will be corrected by removal or adding of material from or to a part of the body 2 . magnetised cylindrical bodies of this type have many applications , such as as rotors in motors , generators or rollers . these rotors are sometimes referred to as current sheet equivalent materials . the reader &# 39 ; s attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification , and the contents of all such papers and documents are incorporated herein by reference . all of the features disclosed in this specification ( including any accompanying claims , abstract and drawings ), and / or all of the steps of any method or process so disclosed , may be combined in any combination , except combinations where at least some of such features and / or steps are mutually exclusive . each feature disclosed in this specification ( including any accompanying claims , abstract and drawings ), may be replaced by alternative features serving the same , equivalent or similar purpose , unless expressly stated otherwise . thus , unless expressly stated otherwise , each feature disclosed is one example only of a generic series of equivalent or similar features . the invention is not restricted to the details of the foregoing embodiment ( s ). the invention extends to any novel one , or any novel combination , of the features disclosed in this specification ( including any accompanying claims , abstract and drawings ), or to any novel one , or any novel combination , of the steps of any method or process so disclosed . | 7 |
referring now to the drawings , fig1 shows a motor - generator 14 arranged about a central axis 18 and located within a space bounded by a front housing cover 20 secured by bolts 22 and to a housing 24 , whose position is fixed . the motor - generator 14 includes a stator 26 , secured by a series of bolts 28 to an extension of the housing 24 or another fixed member ; electrically conductive wire wound in a coil 30 about axis 18 ; a rotor 32 surrounded by the stator ; and a rotor shaft 34 supported for rotation about axis 18 on bearings 36 , 38 . each axial end of the rotor 32 is covered by an end cap 40 , 42 . a ring 48 contacts the end cap 40 . a nut 50 , engaged by a screw thread with rotor shaft 34 , contacts ring 48 . fig2 and 3 show a dog clutch 52 comprising nut 50 and a dog clutch member 58 . the coil of an electric conductor , preferably copper wire , is encased in a electromagnet assembly 54 secured by a first snap ring 56 on cover 20 and located adjacent the dog clutch member 58 . a belleville spring 60 , contacting dog clutch member 58 and a second snap ring 62 , continually urges the dog clutch member 58 leftward away from nut 50 . fig3 and 5 show that dog clutch member 58 is formed with projection 64 , spaced mutually and angularly about axis 18 and extending rightward axially away from the body of member 58 and toward the nut 50 . fig3 and 4 show that nut 40 is formed with projections 66 , spaced mutually and angularly about axis 18 and extending leftward axially away from the body of nut 50 and toward the teeth 64 of member 58 . fig4 shows that the axial inner face of nut 50 is formed with nine of the angularly spaced projections 66 , each projection 66 being formed with an inclined ramp 72 , an angular length portion 74 that may have a flat surface , and dog clutch tooth 76 , located at the opposite end of the length portion 74 from the location of the ramp 72 . similarly , fig5 shows that the axial inner face of dog clutch member 58 is formed with three of the angularly spaced projections 64 , each projection being formed with an inclined ramp 78 , an angular length portion 80 that may have a flat surface , and a dog clutch tooth 82 , located at the opposite of the length portion 80 from the location of the ramp 78 . the dog clutch member 58 is also formed with lugs 86 , spaced angularly about axis 18 and extending radially outward from the axis . the clutch member 58 is installed such that each of its projections 64 is located between first and second projections 66 of the nut 50 , with the clutch tooth 82 of the clutch member projection 64 aligned with and facing the clutch tooth 76 of the first one of the clutch member projections 64 , and with the ramp 86 of the clutch member projection 64 aligned with and facing the ramp 72 of the second one of the clutch member projections 64 . when installed in this manner and position ramps 72 and 78 are substantially parallel surfaces , as shown in fig6 and 7 . fig6 and 7 show a ramp 78 of dog clutch member 58 contacting a ramp 72 of nut 50 , and clutch teeth 82 of clutch member 58 spaced from clutch teeth 76 of the nut 50 . fig8 is an end view of the axial inner face of the dog clutch member 58 showing the clutch member installed in the end cover 20 . each lug 86 of member 58 is fitted in a recess 88 formed in the end cover 20 , thereby preventing rotational displacement of member 58 relative to the cover 20 and nut 50 , but permitting axial translation of member 58 relative to the cover and nut . in operation , when the coil of electromagnet 54 is energized , dog clutch member 58 translates rightward , when viewed as in fig2 and 3 , toward nut 50 due to the effect of the magnet field produced by the electromagnet . when rotor shaft 34 and nut 50 rotate counterclockwise about axis 18 when viewed as in fig8 , the clutch tooth 76 of at least one of the projections 66 of the nut contacts a corresponding clutch tooth of one of the projections 64 of the clutch member 58 , thereby preventing rotation of the rotor shaft and nut . when the coil of electromagnet 54 is deenergized , spring 60 urges dog clutch member 58 leftward , when viewed as in fig2 and 3 , away toward nut 50 . when rotor shaft 34 and nut 50 rotate clockwise about axis 18 when viewed as in fig8 , the ramp 72 of at least one of the projections 66 of the nut ascends the ramp 78 of one of the projections 64 of the clutch member 58 , thereby forcing the clutch member leftward , disengaging the nut from the clutch member , and allowing rotation of the rotor shaft and nut . leftward axial translation of the dog clutch member 58 is limited by its contact with the end cover 20 , as fig2 shows . rightward axial translation of the dog clutch member 58 is limited by its contact with nut 50 , whose axial position is fixed . in accordance with the provisions of the patent statutes , the preferred embodiment has been described . however , it should be noted that the alternate embodiments can be practiced otherwise than as specifically illustrated and described . | 5 |
in the fixed contact structure according to the present invention , an accommodation section is formed in the housing thereof to receive a slider therein , the housing being loaded with a printed circuit board such that fixed contact plates attached to the printed circuit board are brought into electrical conduction with the traveling contacts . hereinafter , embodiments of the fixed contact structure of the present invention being applied to the automotive room lamp will be explained with reference to the drawings . referring to fig1 which is a perspective view of the automotive room lamp system in general , the numeral 1 denotes a box - shaped base body formed by injection molding or the like , the body being divided into three chambers aligned generally in a longitudinal direction . in the respective left hand and right hand chambers , lamps and push switches are accommodated while lens plates 1 a are pivotally supported thereto on the central chamber sides thereof in cantilever fashion . when each lens plate 1 a is pressed at an end portion thereof opposite to the pivotal end thereof , the above mentioned push switches are turned on to light the lamp and when the lens plate 1 a is pressed again in a similar way , the push switch is operated to switch off the lamp . the thus structured automotive room lamp system is known as disclosed in u . s . pat . no . 6 , 273 , 593 ( the entire content of which is expressly incorporated hereinto by reference ). furthermore , bus bars ( not shown ) to connect the lamp and the push switch are mounted to the back side of the base body 1 . the numeral 2 denotes a switch box to be accommodated in the central chamber of the base body 1 , the structure of the box being shown in greater detail in fig2 and 3 . as is shown , the switch box 2 is composed of a front plate 21 , a printed circuit board 22 mounted to the interior of the front plate 21 by means of screws or the like . a back plate 23 is engaged with a hole 21 a in the front plate 21 by way of claw 23 a from the back thereof so as to be made integral with the front plate 21 . a slider or traveling contact member 24 has a knob 24 a protruding through a slot 21 c in the front plate 21 . the slot 21 c thus provides access to the slider 24 to allow lateral sliding manipulation of the same . the front plate 21 has a partition wall 21 d which defines an accommodation section 21 b . the partition wall 21 d has upright portions 21 d 1 which define six cutouts 21 i , each upright portion 21 d 1 being formed with steps at its upper portion . the front plate 21 is formed with a transparent window 21 e for letting out the light from a light emitting diode 22 d which will be explained later . on the back side of the front plate 21 , there is further formed a light shielding wall 21 f to surround the transparent window 21 e . ( see fig1 ) it is to be noted in this connection that the numeral 21 g denotes a sound collecting hole for picking up sound for a microphone to allow a hand free use of a cellular phone , for example . the slider 24 slidably accommodated in the accommodation section 21 b is oriented such that the knob 24 a thereof protrudes through the slot 21 c in the front plate 21 . as shown in fig6 , the slider 24 is provided with two traveling contacts 24 b and having contact faces and urged by springs 24 c toward the partition walls 21 d such that the contact faces are exposed outside thereof , each traveling contact 24 b being arranged for the contact faces to short any two of the fixed contact plates 22 c to be described later on . the printed circuit board 22 is soldered with a microphone 22 a , a connector terminals 22 b to be led out into the connector box 22 b for connecting the bus bars and the power source to the connectors , fixed contact plates 22 c to be engaged with the upright portions 21 d 1 of the partition wall 21 d in the front plate 21 and the light emitting diode 22 d to do spot illuminating . ( see fig9 and 10 ) as shown in fig4 and 5 , the respective fixed contact plates 22 c have fixation bases 22 c 1 to be connected to the conduction patterns of the printed circuit board 22 , contact portions 22 c 2 rising from the fixation bases 22 c 1 and engagement portions 22 c 4 having cutouts 22 c 3 therein such that the entire structure are channel shaped as viewed from the side . the procedure of bringing the fixed contact plates 22 c into engagement with the partition walls 21 d of the accommodation section 21 b will be explained hereinafter . in this regard , it is to be noted that the fixed contact plates 22 c are soldered to the printed circuit board 22 . therefore , when the printed circuit board 22 is assembled with the front plate 21 , the engagement portions 22 c 4 of the contact plates 22 c will be inserted into the generally u - shaped openings defined by the upright portions 21 d 1 . the relatively narrow width cutouts 22 c 3 in the fixed contact plates 22 c are thereby received within and slidably guided downwardly by the upright portions 21 d 1 . during assembly , the fixed contact plates 22 c will ultimately reach a lowermost extent of being guided downwardly along the upright portions 21 d 1 , at which time the upper engagement portions 22 c 4 of the contact plates 22 c are brought into abutment with the steps 21 d 2 formed in the upright portions 21 d 1 . as such , the contact plates 22 c will be seated in their final fixed position so as to be exposed through the openings of the upright portions 21 d 1 . in such a state , the printed circuit board 22 may then be further fastened to the front plate 21 by means of screws or the like to ensure that the fixed contact plates 22 c are secured immovably to the partition wall 21 d without play . the contact portions 22 c 2 of the contact plates 22 c are thus positioned so as to be substantially flush with the surfaces of the upright walls 21 d . such a flush mounting of the contact portions 22 c 2 thereby ensures that the traveling contacts 24 b of the slider 24 move relatively smoothly when the slider 24 within the accommodation section 21 b is manipulated so as to slide relative to the fixed contact plates 22 c . it is to be noted that the accommodation portion 21 b is also defined by an outer wall standing opposite to the partition wall 21 d . the outer wall preferably has a patterned indented surface 21 h formed in the inner side thereof so as to provide a clicking feel upon the sliding movement of the slider 24 . the switch box 2 is assembled into an integral body by securing the printed circuit board 22 to the front plate 21 , inserting the slider 24 into the accommodation portion 21 b , engaging the back plate 23 to the front plate 21 and then bringing a claw 23 b formed in the back plate 23 into engagement with a hole 1 b formed in the base body 1 . ( see fig1 ) in the preferred embodiment , the printed circuit board 22 is provided with two sets of fixed contact plates 22 c , the two sets being formed in separated positions , each set having three fixed contact plates 22 c . on the other hand , the slider 24 is provided with a pair of traveling contacts 24 c in separated positions , thus enabling the slider 24 to cause the fixed contacts 22 b to perform a two - step switching action while being slid . if the thus constructed slide switch is to be installed in a vehicle such as a minivan or the like having three rows of seats , the circuit as shown in fig1 will be required . more specifically , the push switches s 1 and s 2 incorporated with the slide switches to be used for a front seat illumination in a vehicle , the push switches s 3 and s 4 loaded with two lamps to be used for a middle seat illumination light and the switch s 5 loaded with two lamps for rear seat illumination are connected as shown in fig1 such that the operation of the middle seat and rear seat illumination lamps is controlled by sliding the front seat slide switch . it is to be noted in this connection that the numerals l 1 to l 5 denote lamps whereas the numeral s 6 denote a door switch to be turned on in response to the opening of a car door . hereinafter , the control operation thereof will be explained . in case the traveling contacts of the respective switches s 1 to s 5 have been switched to the fixed contact side as shown while the traveling contact 24 b is connected to the door contact of the fixed contact plate 22 c , the respective switches s 1 to s 5 are grounded by way of the door switch s 6 which is turned on when the door is opened . in this state , all the lamps l 1 to l 5 connected to the respective switches s 1 to s 5 are lit . on the other hand , all the lamps l 1 to l 5 are turned off if the door is closed to open the door stitch s 6 . when the traveling contacts 24 b of the slide switch are turned to the on side of the fixed contact plates 22 c while the switches s 1 to s 5 are as depicted , the traveling switch 24 b is grounded regardless of the on - off position of the door switch s 6 , thus enabling all the illumination lamps l 1 to l 5 arranged at the driver &# 39 ; s seat are brought into a lit state . furthermore , if the respective switches s 1 to s 5 are switched to the opposite direction from the connection state , the respective fixed contacts are grounded such that the lamps at the respective seats are freely operated for lightening . the light emitting diodes 22 d to be soldered to the printed circuit board 22 are inserted into a holder 25 secured to the printed circuit board 22 before the soldering is done . thereafter , the lead wire 22 d 1 of the light emitting diode 22 d is inserted into a through hole in the printed circuit board 22 for soldering . the holder 25 is formed of a resin in the shape of a rectangular sleeve having legs 25 a diagonally designed to fit into holes formed in the printed circuit board 22 . the inside of the holder 25 is provided with a platform 25 b to support the underside of the light emitting diode 22 d , the platform 25 b having a hole to allow the insertion of the lead wires 22 d 1 . further , the holder 25 has a wall above the platform 25 b , the wall having protruding members 25 c to restrain the play of the light emitting diode 22 d . the upper portions of the protruding members 25 c are formed with slants 25 c 1 to allow smoother insertion of the light emitting diodes 22 d into the holder 25 . the holder 25 is an open top type having an upper portion which flanks the light shielding wall 21 f formed in the inner wall surface of the front face plate 21 . therefore , when the light emitting diode 22 d is energized to be lit , the light ray radiating from the light emitting diode 22 d is emanated toward the transparent window 21 e formed in the front plate 21 to do the spot illumination for the cup holders or the like installed inside the vehicle by the light ray therefrom . in general , visible light rays from the light emitting diode tend to be diffused . however , the light emitting diode used in the present invention is accommodated within the holder 25 to prevent light rays from emanating outside the opening in the holder 25 . since the opening in the holder is positioned to extend in the light shielding wall 21 f , light rays spreading out from the opening in the holder 25 are shielded by the light shielding wall 21 f and are thereby prevented from being emitted from the room lamp per se . in the preferred embodiment of the present invention , although the explanation has been given only with respect to the automotive room lamp , it is needless to say that the invention can be applied to devices in which the operation of the circuit of the printed circuit board are controlled by electrically connecting the slide switches and the printed circuit board . | 7 |
referring now to the drawings , and to fig1 in particular , the fuel assembly illustrated therein and generally designated with reference numeral 10 is of the kind commonly employed in pressurized water reactors . basically , it comprises a lower end structure or bottom nozzle 12 adapted to support the fuel assembly on the lower core plate ( not shown ) of a nuclear reactor , guide tubes or thimbles 14 connected to the bottom nozzle 12 and extending longitudinally upwards therefrom , transverse support or spacer grids 16 spaced from each other along the guide thimbles 14 and fastened thereto , an instrumentation tube 20 extending longitudinally through the center of the fuel assembly , and an upper end structure or top nozzle 22 attached to upper end portions of the guide thimbles 14 . these parts all together form an integral unit known as the skeleton of the fuel assembly . the complete fuel assembly includes an array of fuel rods 18 loaded into the skeleton , in a manner to be described later herein , and supported by the grids 16 in parallel spaced relationship with respect to one another . each fuel rod 18 comprises a cladding tube 23 which is hermetically sealed at its opposite ends by means of end plugs 26 , 28 , and nuclear - fuel pellets 24 contained in the cladding tube and held firmly stacked therein by means of a pressure spring 30 interposed between the upper end plug 26 and the stack of fuel pellets 24 . during reactor operation , the fuel pellets , composed of fissile material , are the source of energy generated in the form of heat which is extracted from the reactor core by means of a liquid moderator / coolant , such as water or water containing boron , circulated therethrough . fissioning is controlled by means of control rods ( not shown ) which are connected to a control mechanism 34 mounted in the top nozzle 22 and operable to effect axial movement of the control rods into and out of preselected ones of the guide thimbles 14 , all as well known in the art . only some of the support grids 16 of the fuel assembly 10 are shown in fig1 . typically , there would be eight or ten , each comprising , as illustrated in fig2 and 4 , and cellular structure composed of a plurality of inner straps 40 interlaced and joined together in an egg - crate - like manner so as to form open cells , as indicated at 42 , and of outer or peripheral straps 44 interconnected at their ends and connected to the outer ends of the inner straps 40 so as to add strength to the whole grid structure . the inner and outer grid straps are made of a material having a low neutron - capture cross - section , such as for example a zirconium alloy known as zircaloy , and they are provided with detents , such as detents 46 and 48 ( see fig3 and 4 ), which project from the various cell - defining strap portions , or cell walls , into the respective cells 42 so as to resiliently engage and laterally support the fuel rods , such as fuel rod 18 , inserted therein . the spacing between the detents on each pair of strap portions forming oppositely disposed walls of a cell 42 is somewhat less than the outer diameter of the fuel rod to be received in the cell , the difference being accommodated , upon insertion of the fuel rod , due to resilience of the detent or detents on one of the respective pair of oppositely disposed cell walls or , if only relatively stiff detents are employed , by the resilience of the strap portions themselves . as noted earlier herein , the detents in the fuel - rod receiving cells of a support grid may take various forms . in the embodiment illustrated , they consist of elongate springs 46 and relatively rigid dimples 48 formed out of the grid straps , each cell - defining strap portion having thereon one elongate spring 46 which projects into the cell 42 located on one side of the strap portion , and a pair of dimples 48 which are located adjacent the opposite ends of the elongate spring 46 and project into the cell 42 located on the other side of the same strap portion . thus , each grid cell 42 has associated therewith two resilient springs 46 projecting from two cell walls located adjacent each other , and four relatively stiff dimples 48 arranged in two pairs projecting from the two remaining cell walls opposite the spring - bearing walls , so that there are altogether six detents 46 , 48 per grid cell 42 to engage and bear against the fuel rod 18 extending through the cell . the springs 46 and the dimples 48 are elongate and generally trapezoidal , with the springs 46 oriented to extend substantially parallel to the longitudinal axes of ( i . e . to the coolant - flow direction through ) the cells 42 , as seen best from fig4 and with the dimples 48 oriented to extend transversely of said longitudinal axes and said coolant - flow direction , as seen best from fig3 . there are other known grid designs ( not shown ) which have the dimples as well as the springs oriented in parallel to the longitudinal axes of the grid cells . as seen from fig3 and 4 , the support grid 16 partially illustrated therein includes mixing vanes 50 which extend from upper ( i . e . downstream , with regard to the coolant flow direction ) edge portions of the grid straps 40 , 44 , and have the function of promoting the mixing of coolant flow along the fuel rods in order to avoid local hot - spot conditions and to average the enthalpy rise in order to maximize power output , as well known in the art and as described , for example , in u . s . pat . no . 3 , 395 , 077 to long sun ton et al . usually , fuel rods are loaded into a fuel assembly from its top end , either by pulling them from the bottom end of the fuel assembly or by pushing them from its top end , depending primarily upon whether the fuel assembly is readily accessible from either end , as during manufacture of a new fuel assembly , or is readily accessible only from the top , as during reconstitution or reassembly of a fuel assembly standing upright in a submerged work station . it should be noted in this context that terms such as &# 34 ; top &# 34 ;, &# 34 ; bottom &# 34 ;, &# 34 ; upper &# 34 ;, &# 34 ; lower &# 34 ; and the like are generally used herein with reference to the operational or upright position of the fuel assembly rather than necessarily the disposition in which the fuel assembly might be held during a fuel - rod loading operation . referring now to fig5 it schematically illustrates equipment typically employed for pulling fuel rods into a fuel assembly skeleton while the latter is supported in a prone position and with its top and bottom nozzles not yet in place . basically , the equipment comprises a fuel rod magazine 52 for holding a complement of fuel rods ( only one being indicated at 18 ), and a fuel rod loader 54 including at least one axially extendable and retractable gripper 56 . as seen from fig6 the gripper 56 comprises a sleeve 57 and an expander rod 60 . the sleeve 57 is partially split longitudinally from the distal end thereof and , at the latter , has a gripping portion or gripper head 58 . the expander rod 60 extends into the sleeve 57 and is axially movable therein in one direction to expand the gripper head 58 , and in the opposite direction to permit elastic return of the gripper head 58 to its normal , i . e . non - expanded , condition . when in its non - expanded condition , the gripper head 58 is insertable into and withdrawable from a suitably shaped socket 62 formed in the lower end plug 28 of each fuel rod 18 , as described , for example , in copending u . s . patent application , ser . no . 797 , 331 of d . a . boatwright , filed nov . 12 , 1985 , and assigned to the present assignee . operation of the expander rod 60 effecting expansion or contraction of the gripper head 58 while the latter is inserted in the socket 62 causes the gripper head to be locked to or to be released for separation from , respectively , the end plug 28 of the fuel rod 18 . the initial step of a fuel - rod loading operation resides in placing the fuel assembly 10 , or rather the fuel assembly skeleton without its end structures ( top and bottom nozzles ), in position between the magazine 52 and the loader 54 such that its top and bottom are facing toward and are properly aligned with the magazine and the loader , respectively , as seen from fig5 . with the skeleton thus positioned , the gripper 56 of the loader is extended through the grid cells and into the end - plug socket 62 of the fuel rod 18 held aligned therewith in the magazine 52 . then , the expander rod 60 is operated to lock the gripper head 58 to the end plug 28 , whereupon the gripper 56 is retracted so as to pull the fuel rod out of the magazine 52 and into the aligned cells of all of the support grids 16 of the fuel assembly 10 . once the fuel rod is in its fully inserted position , the expander rod 60 is operated in release the gripper for disengagement thereof from the inserted fuel rod 18 . this operation is repeated until all of the fuel rods to be loaded into the fuel assembly 10 are in place . it is during this loading operation that a fuel rod , if unprotected , is at risk of having its cladding surface scratched by the detents 46 , 48 in the various grid cells , as explained hereinbefore . in accordance with the present invention , each fuel rod , during insertion thereof , is protected by means of a thin - walled metallic tubular member which has a uniform wall thickness of not more than about 0 . 008 inch and is positionable so as to have its wall interposed between the detents within the grid cells and the fuel rod being inserted therein . referring to fig7 and 8 , basically , the protective tubular member comprises a thin - walled tube 70 which has an as - formed inner diameter substantially equal to the outer diameter of the fuel rod to be received , and a longitudinal slit 72 formed in its wall 71 so as to render it resiliently deflectable in a diameter - reducing sense . the slit 72 , as shown in fig7 extends throughout the length of the tube 70 ; furthermore , it has a width sufficient to permit inward deflection of the tube wall to an extent enabling the tube alone to be inserted into the grid cells essentially without causing outward deflection of the detents therein , but insufficient to permit any of the detents within the grid cells 42 to enter the slit 72 . the tube 70 is of sufficient length to extend at least through a majority and preferably through all but one of the support grids of the fuel assembly to be loaded . the thin - walled tube may be formed from any suitable metallic stock lending itself to being shaped into a longitudinally split tube having the above - mentioned characteristics , the currently preferred material being stainless steel having a thickness substantially in a range of from 0 . 006 to 0 . 008 inch ( ca . 0 . 15 to 0 . 20 mm ). it is noted in this context that the wall thickness of the tubular member as shown in some of the various drawings is exaggerated for the purpose of greater clarity in illustration . if desired , the inner wall surface of the tube may be coated with a suitable anti - friction material chemically compatible with the environment in which the tube is to be utilized , such as polytetrafluoroethylene , for example . in order to facilitate insertion of the thin - walled tube 70 into the cells 42 of the various grids 16 , the tube 70 as shown in fig7 is provided with a tapered , frusto - conical end portion 74 formed integral therewith at the end thereof which during insertion is its leading end . the tubular member also includes tube withdrawal means comprising two openings 76 formed in diametrically opposed wall portions of the tube 70 proximate to its leading end and adapted to receive a suitable withdrawal tool or implement , such as , for example , a pin 78 ( see fig7 c ) adapted to be inserted into the openings 76 and used in pulling the tubular member from the inserted fuel rod . as mentioned hereinbefore , the longitudinal slit 72 , splitting the wall 71 of the tube 70 preferably from end to end and thereby rendering it radially deflectable through application of a moderate force , enables the tube 70 to be readily inserted into grid cells 42 alone , that is to say , prior to insertion of the fuel rod . hence , during insertion of the fuel rod , the tube 70 will serve the dual purpose of protecting mixing vanes , such as indicated at 50 in fig3 and 4 , from being bumped and damaged by the fuel rod , and of protecting the fuel rod from being scratched by the detents 46 , 48 within the grid cells 42 . referring now to fig7 a - c in which reference characters 16a and 16z designate the uppermost grid and the lowermost grid , respectively , of the fuel assembly 10 ( fig1 ), the protective tubular member or tube 70 is shown in fig7 a as inserted in the grids 16 and ready to receive a fuel rod 18 from the magazine 52 ( fig5 ). to load the fuel rod 18 into the grids 16 , the gripper 56 is extended axially through the protective tube 70 , as indicated in fig7 a by an arrow , is engaged with and locked to the lower end plug 28 of the fuel rod 18 , and then is retracted so as to pull the latter into the tube 70 , during which movement the wall 71 of the tube 70 will protect the fuel rod from being scratched by the detents 46 , 48 within the grid cells 42 . when the fuel rod 18 has reached its fully inserted position , as shown in fig7 b , it is suitably restrained from further movement while the protective tube 70 is advanced , such as by being pushed from the top , far enough to render the openings 76 near its leading end accessible , as seen from fig7 c , for engagement thereof with the above - mentioned tube withdrawal implement or pin 78 which then is used to pull the protective tube 70 off the fuel rod 18 . disengagement and full retraction of the gripper 56 may be effected either after utilizing the gripper for holding the fuel rod 18 in its inserted position during withdrawal of the protective tube 70 , or immediately after arrival of the fuel rod 18 in its inserted position in which event the fuel rod 18 is restrained in another suitable manner , such as , for example , by means of a holding implement ( not shown ) engaged with the upper end plug 26 or one held axially against the lower end plug of the inserted fuel rod 18 . referring now to fig9 which shows a modification of the protective tubular member , the latter as illustrated therein comprises a split tube 70 &# 39 ; similar in every respect to the one just described , except that the tube 70 &# 39 ; has no openings for receiving a tube withdrawal tool and instead has its tapered end portion 74 terminating in an in - turned lip 80 which , in cooperation with a shoulder 59 ( see fig6 ) formed on the gripper 56 at the juncture between the gripper head 58 and the sleeve 57 , serves as the means for withdrawing the protective tube 70 &# 39 ; from an inserted fuel rod . more specifically , the in - turned lip 80 is dimensioned such as , during initial extension of the gripper 56 into the protective tube 70 &# 39 ;, to be engaged and resiliently cammed aside by the entering gripper head 58 , and then to resiliently snap back to its natural position in which it is subsequently engaged by the shoulder 59 ( fig6 ) on the gripper head 58 when the gripper 56 is retracted and has pulled the fuel rod 18 to its fully inserted position , as shown in fig9 a . once the fuel rod 18 has reached this fully inserted position , the gripper 56 is operated to release its head 58 for withdrawal from the socket 62 in the lower end plug 28 of the inserted fuel rod 18 , whereupon retraction of the gripper 56 is continued , as shown in fig9 b , thereby causing the shoulder 59 on the gripper head , in cooperation with the in - turned lip 80 of the protective tube 70 &# 39 ;, to pull the latter from the inserted fuel rod 18 whilst the fuel rod is suitably retained in its inserted position , for instance by means of the previously mentioned implement ( not shown ) engaged with the upper end plug of the fuel rod 18 . a further modification of the protective tubular member embodying the invention is illustrated in fig1 wherein the tubular member again comprises a thin - walled tube 70 &# 34 ; which is similar in every respect to the thin - walled tube 70 of fig7 - 8 , except that the tube 70 &# 34 ; has no tapered end portion and has a substantially uniform diameter throughout its length . consequently , the protective tube 70 &# 34 ; is particularly suitable for use with fuel assemblies which are not readily accessible from the bottom and , therefore , require the protective tube to be withdrawn from the top . in order to minimize the chance of the tube &# 39 ; s getting caught on any of the detents within the grid cells during insertion therein , the tube 70 &# 34 ; preferably is provided with a chamfer 85 formed at the edge thereof which is its leading edge during insertion . the means for withdrawing the protective tube 70 &# 34 ; from an inserted fuel rod is shown in fig1 to comprise a generally l - shaped slot 84 which is formed in a wall portion of the tube 70 &# 34 ; adjacent the end thereof which is the leading end of the tube during its withdrawal , one leg of the l - shaped slot 84 extending into the tube wall in a direction generally parallel to the longitudinal slit 72 , and the other leg of the l - shaped slot 84 extending partly circumferentially of the tube 70 &# 34 ; and preferably terminating in an up - turned toe portion , as seen best from fig1 . the l - shaped slot 84 is adapted to receive a radial pin 88 on a lower end portion 86 of a long - handled tool 85 which is partially insertable into the slit tube 70 &# 34 ;. in order to facilitate entry of the radial pin 88 into the l - shaped slot 84 , the latter preferably is flared outward at the entrance thereof , as seen from fig1 . referring to fig1 a - c , the protective tubular member 70 &# 34 ; is shown in fig1 a as inserted into the grids of the fuel assembly and ready to receive a fuel rod 18 . if the fuel assembly were readily accessible from the bottom the fuel rod 18 could be pulled into the slit tube 70 &# 34 ; in the same manner as described hereinbefore . however , it is assumed that the fuel assembly is not readily accessible from the bottom and that , therefore , the fuel rod 18 must be pushed into the protective tube 70 &# 34 ; from the top . this can be done in any suitable manner known to the art , and may be done by utilizing the long - handled tool 85 as a push - rod . once the fuel rod 18 has been inserted into the protective tube 70 &# 34 ;, the lower end portion 86 of the long - handled tool 85 is engaged in the upper end portion of the protective tube 70 &# 34 ; while , at the same time , the radial pin 88 thereon is inserted into the vertical leg of the l - shaped slot 84 until it bottoms therein , whereupon the tool 85 is partially rotated to move the pin 88 into the horizontal leg of the l - shaped slot 84 and to the end thereof where it is aligned with the up - turned toe portion of the slot , as seen from fig1 b . with the tool 85 thus connected to the protective tube 70 &# 34 ;, it is retracted so as to pull the tube 70 &# 34 ; from the inserted fuel rod 18 , as depicted in fig1 c , while the fuel rod is being restrained in a suitable manner , for instance by means of an elongate restraining element ( not shown ) incorporated in the long - handled tool 85 and slideably supported therein such that it can be held restrainingly engaged with the upper end plug 26 of the inserted fuel rod 18 while the tool 85 is used simultaneously to pull the protective tube 70 &# 34 ; off the inserted fuel rod . it should be noted that each of the protective tubular members 70 , 70 &# 39 ; and 70 &# 34 ; described above lends itself to being inserted into the suppport grids 16 either alone , i . e . separate from and before the fuel rod , as shown herein , or simultaneously with a fuel rod while disposed thereon . if a fuel rod is to be loaded into grid cells which have mixing vanes associated therewith , it will likely be preferred to insert the protective tube before the fuel rod in order to protect the mixing vanes from being damaged through contact with the fuel rod , as explained hereinbefore . insertion of each protective tubular member 70 , 70 &# 39 ; or 70 &# 34 ; along may be effected by suitably guiding and pushing , or pulling , the tubular member into the selected cells 42 of the grids 16 ; if to be pulled , a similar technique may be employed as used in pulling the tubular member off an inserted fuel rod , as set forth above with particular reference to fig7 c , 9b or fig1 c , respectively . turning now to fig1 and 12a - c , they illustrate an embodiment wherein the protective tubular member is adapted for insertion thereof together and simultaneously with a fuel rod . as seen best from fig1 , the protective tubular member comprises a thin - walled tube 90 for receiving a fuel rod , and means 94 both for pulling the tubular member , together with the fuel rod disposed within the tube 90 , into the grids 16 ( fig1 ) of the fuel assembly 10 , and for withdrawing the protective tubular member from the fuel rod after insertion thereof . the thin - walled tube 90 corresponds essentially to the tube 70 &# 34 ; shown in fig1 in that it has a longitudinal slit 92 formed in its wall and is of uniform diameter throughout its length . the means 94 for inserting the protective tubular member together with the fuel rod , and for subsequently withdrawing the tubular member from the inserted fuel rod , comprises an end plug 94 secured to the tube 90 at the end thereof which is its leading end during insertion into the grids . the end plug 94 is similar to the fuel - rod end plug 28 shown in fig6 in that it is tapered and has formed therein a socket 96 adapted to be engaged with the gripper head 58 , and it may be secured to the thin - walled tube 92 in the same conventional manner as employed in securing the end plug 28 to the cladding tube of the fuel rod . the initial step in utilizing the protective tubular member of fig1 is to mount the latter telescopically upon the fuel rod 18 to be inserted , followed by a fuel - rod loading operation the same as initially described herein with respect to fig5 except that now the gripper head 58 of the extended gripper 56 is engaged with the end plug 94 of the protective tubular member 90 ( see fig1 a ) instead of with the lower end plug 28 of the fuel rod 18 . upon retraction of the gripper 56 , the protective tubular member , together with the fuel rod 18 disposed within the thin - walled tube 90 , is pulled into the cells 42 of the successive grids 16 until it reaches the fuel rod fully inserted position shown in fig1 b , whereupon the fuel rod 18 is restrained from further movement while the gripper 56 and the protective tubular member 90 still locked thereto continue to be retracted , thereby to pull the protective tubular member from the inserted fuel rod 18 , as depicted in fig1 c . in this case as in the preceding ones , restraint for the inserted fuel rod against further movement thereof while the protective tubular member is being withdrawn may be provided by any suitable means , such as the previously mentioned tool or implement ( not shown ) adapted to be restrainingly engaged with the upper end plug of the inserted fuel rod . such tool or implement may be of a kind to be manipulated manually or it may be one which , for instance , is supported from the fuel - rod magazine 52 ( fig5 ) and adapted to restrainingly engage the upper end plug of the fuel rod automatically as the latter leaves the magazine and reaches its fully inserted position within the fuel assembly 10 . additionally or alternatively , such restraint may also be provided by arranging for the protective tubular member 70 , 70 &# 39 ;, 70 &# 34 ; or 90 to extend , when in the fuel - rod inserted position , through all of the support grids 16 of the fuel assembly except the end grid 16a or 16z which is nearest the end of the protective tubular member representing its trailing end during withdrawal of the tubular member from the inserted fuel rod . with each of the arrangements as depicted in fig7 a - c , 9a - b and 12a - c , wherein the respective tubular members 70 , 70 &# 39 ; and 90 are withdrawn downwardly , the end grid nearest said trailing end of the tubular member is the uppermost grid 16a , whereas with the arrangement as depicted in fig1 a - c , wherein withdrawal of the tubular member 70 &# 34 ; occurs in the upward direction , the end grid nearest said trailing end of the tubular member 70 &# 34 ; is the lowermost grid 16z . this step of leaving an end portion of the fully inserted fuel rod exposed may be employed with any of the schemes disclosed herein but is illustrated , by way of example , only in connection with the embodiment shown in fig1 a to 12c . as seen best from fig1 b , the protective tube 90 has a length such as to leave the upper end portion of the fuel rod 18 exposed . thus , as the protective tube 90 together with the fuel rod therein approaches the fully inserted position during insertion , its upper end will ride off the detents 46 , 48 within the cell 42 of the uppermost grid 16a . this enables the detents 46 , 48 to frictionally engage the bare end portion of the fuel rod 18 and to apply thereto a restraining force which will cause the movement of the fuel rod to be arrested even as the gripper 56 and the protective tubular member 90 still connected thereto continue to be retracted . in this manner , the insertion of the fuel rod and the withdrawal of the protective tubular member from the inserted fuel rod can be effected in one continuous operation . it is believed that leaving an end portion of the fuel rod 18 thus exposed during insertion is not likely to result in any objectionable scratching of its cladding surface since the bare end portion will come into direct moving contact with the detents of only one grid cell , and movement of the fuel rod relative to the detents will cease almost immediately after such direct contact has been established . although each of the foregoing embodiments has been described with respect to only one protective tubular member 70 , 70 &# 39 ;, 70 &# 34 ; or 90 , and even though it is possible of course to use a single protective tubular member repeatedly for loading several fuel rods in succession , it will be appreciated that in practice it may well be found more expedient to employ a separate protective tubular member individually for each of a plurality of fuel rods . thus , protective tubes such as the one shown in fig7 - 8 , fig9 fig1 or fig1 may be placed one on each of a whole complement of fuel rods stored in the magazine 52 ( fig5 ) and to be loaded into the fuel assembly 10 . alternatively , a whole complement of protective tubular members such as the one shown in fig7 - 8 , fig9 or fig1 may be inserted into the grids 16 of the fuel assembly 10 for having fuel rods subsequently loaded therein . this latter approach offers a particular advantage if practiced with the kind of protective tube illustrated in fig1 , and in conjunction with a new fuel assembly skeleton being prepared for shipment to , and subsequent loading with fuel rods at , a nuclear power plant . where protective tubes can or must be inserted and withdrawn from the same end of a fuel assembly , such as the top , it may be desirable to cluster several of the tubes , for instance by supporting them from a common plate ( not shown ) having the ends of the protective tubes connected thereto and having apertures for enabling fuel rods to be inserted therethrough and into the respective tubes . preferably , such plate would include means engageable with suitable retraction apparatus ( not shown ) for withdrawing the plate , together with the protective tubes connected thereto , upon completed insertion of the fuel rods . finally , it will be appreciated that even though the invention has been described herein in conjunction with a fuel assembly designed for use in a pressurized water reactor , it is applicable just as well with respect to fuel bundles for boiling water reactors . | 8 |
referring first to fig1 a heart beat coincidence detection system 10 is shown . system 10 is implemented , for example , on a corometrics 120 series maternal / fetal monitor manufactured by ge marquette medical systems of milwaukee , wis . however , system 10 may be implemented on other fetal monitoring systems , or other medical devices . system 10 includes an input / output device 12 coupleable via wires or wirelessly to one or more transducers 14 . transducers 14 include a fetal heartbeat transducer 16 and a maternal heartbeat transducer 18 , and may further include additional transducers 20 . transducers 14 may each include an electrocardiogram electrode , ultrasound transducer , blood pressure transducer , pulse oximetry transducer , or other transducer configured to monitor cardiac activity from a heart beat source and to generate a cardiac signal based on that activity . input / output device 12 includes a port , circuit board , or other circuit configured to receive the cardiac signals from transducers 14 and provide one or more of the cardiac signals to a digital signal processor 22 . digital signal processor 22 is an integrated circuit or other circuit configured to receive analog signals from transducers 14 , digitize them , and detect heart beats on the cardiac signals . digital signal processor 22 includes a processor and program - storage memory to perform these tasks , but may include any necessary circuit elements , such as discrete components , analog components , programmable logic , etc . digital signal processor 22 provides a priority interrupt to a central processing unit 24 ( e . g ., an intel or motorola microprocessor , or other processing circuit ) each time a heart beat is detected . central processing unit 24 runs a heart beat coincidence detection algorithm stored in program memory 26 each time the priority interrupt is received from digital signal processor 22 . the algorithm will be described below with reference to fig2 a and 2b . according to an alternative structure , digital signal processor 22 and central processing unit 24 can be fabricated on one integrated circuit . alternative methods and systems of heart beat detection for both fetal heart beats and maternal heart beats may be utilized in system 10 . system 10 further includes an operator input device 28 including keypads , switches , dials , a touch - screen interface , and / or other devices configured to receive input data from a caregiver or other operator . system 10 further includes one or more output devices 30 , such as , a display 32 , a strip chart device 34 , and / or a communications link 36 coupled to the central processing unit 24 and including any necessary interface circuitry . central processing unit 24 generates output signals , such as display signals , based on the heart beat coincidence detection algorithm stored in program memory 26 and provides these output signals to one or more of output devices 30 . the heart beat coincidence algorithm of fig2 a and 2b is configured to compare the heart beats on two or more cardiac signals and determine whether the heart beats exhibit coincidence . the above matrix illustrates the transducers which may be compared by the exemplary system and method . for example , a fetal electrocardiograph signal ( f 1ecg ) is compared to a maternal electrocardiograph signal ( m ecg ) as indicated by the word โ yes โ in the chart . however , a fetal electrocardiograph signal ( f 1ecg ) is not compared to a maternal blood pressure signal ( m bp ) as indicated by the word โ no โ in the chart . the symbols f 1ecg , f 1us ( fetal ultrasound signal 1 ), f 2us ( fetal ultrasound signal 2 ), m ecg , m spo2 ( maternal pulse oximetry transducer ), and m bp correspond to ports of input / output device 12 configured to receive cardiac signals from corresponding transducers . thus , f 1ecg is not compared to f 1ecg as indicated by the โ x โ since only one port on system 10 is available for this transducer . further , it is noted that the maternal blood pressure sensor is not utilized in this exemplary embodiment for comparison to any other signal . other alternative configurations of this matrix are contemplated , depending on the capabilities of the system . referring now to fig2 a and 2b , an exemplary heart beat coincidence detection method 50 is shown . method 50 is operable in system 10 as software , but may alternatively be operable via discrete circuit elements or other programming elements . at step 52 , cardiac signals on two channels , channel 1 and channel 2 , are monitored . when a heart beat occurrence is detected on one of channels 1 or 2 , the heart beat occurrence is registered and timestamped . hbt 1 and hbt 2 in fig2 a indicate the heart beat timestamps for a heart beat occurrence detected on channel 1 and a heart beat occurrence detected on channel 2 , respectively . when a heart beat occurrence is detected on the other of the two channels , the method proceeds to step 54 . a heart beat occurrence on one of channels 1 and 2 followed by a heart beat occurrence on the other of channels 1 and 2 is referred to hereinafter as a cycle . at step 54 , the method identifies whether the heart beat occurrences on channels 1 and 2 bear a 1 : 1 correspondence . in other words , at step 54 , the method calculates whether the number of heart beat occurrences from one of channels 1 and 2 occurs twice between successive heart beat occurrences in the other channel . if a correspondence of greater or less than 1 : 1 is found , the method proceeds to step 55 . at step 55 , if channel 1 ( representing the fetal heart beat in this exemplary embodiment ) has greater than one heart beat for one heart beat of channel 2 ( representing the maternal heart beat in this exemplary embodiment ), the method proceeds to step 68 . if channel 1 has less than one heart beat for one heart beat of channel 2 , the method proceeds to step 72 ( fig2 b ). alternatively , when the heart beat occurrences indicate greater or less than 1 : 1 correspondence , the method may directly generate a divergence signal , as described below with respect to step 82 . once a cycle of heart beat occurrences is detected and time stamped , times associated with each heart beat occurrence are compared to detect coincidence . the following is one exemplary method for comparing heart beat occurrences to detect coincidence , though alternative methods are contemplated utilizing heart beat occurrences . at step 56 , a time offset ( e . g ., a phase shift ) between hbt 1 and hbt 2 is calculated . next , the running jitter between multiple cycles of occurrences is determined to indicate coincidence or divergence . in this exemplary embodiment , determining jitter between cycles includes keeping a record of the minimum and maximum phase shifts occurring among a plurality of cycles . therefore , the jitter determination assumes multiple cycles over a period of time ( e . g ., a time โ window โ). the time window is a fixed time ( e . g ., three seconds ) in this exemplary embodiment after which the minimum and maximum phase shift variables are reset but may alternatively depend on a cycle count or all cycles during a period of 1 : 1 correspondence . at step 58 , a minimum phase shift variable is updated with the new phase shift provided the new phase shift is smaller than the prior minimum phase shift . at step 60 , a maximum phase shift variable is updated with the new phase shift provided the new phase shift is greater than the prior maximum phase shift . at step 62 , a jitter is calculated by subtracting the minimum phase shift from the maximum phase shift . once the phase relationship has been characterized by phase shift and jitter , this data is used to determine if the heart beat occurrences are representative of coincidence or divergence . maximum jitter and maximum phase shift criteria are applied . thus , at step 64 , the jitter is compared to a maximum jitter threshold ( j ) and the maximum phase shift is compared to a maximum phase shift threshold ( s ). maximum jitter threshold ( j ) and maximum phase shift threshold ( s ) are variable and may be adjusted to tune the algorithm . for example , maximum jitter threshold ( j ) may be set at approximately 100 ms , or as low as approximately 1 ms . in one exemplary embodiment , maximum jitter threshold ( j ) is less than one - half the minimum expected beat - to - beat interval . for example , if the minimum expected beat - to - beat interval is 200 ms ( i . e ., corresponding to 300 beats per minute ), maximum jitter threshold ( j ) is set to one - half of 200 ms , or 100 ms . phase shift threshold ( s ) may be set at approximately 200 ms , or between 1 and 2 , 000 ms . alternatively , ( j ) and ( s ) may be tuned to any value , depending upon the application and such factors as transducer type / cardiac source . maximum phase shift and maximum phase jitter thresholds may be dynamically variable by the algorithm or static . the potential range of the phase shift between channels with signal peaks demonstrating a 1 : 1 correspondence is defined as 0 - 359 degrees , but would generally be expected to be within 180 degrees . in the time domain this could be from 0 to 1999 milliseconds depending upon the period between beats from channel 1 and channel 2 . coinciding heart beats at the low end could occur offset 1999 milliseconds from one another and be 359 degrees out of phase . maximum phase jitter may be defined as a constant or as a variable to the algorithm . one method is to make j a function of the maximum phase shift . for example , j = max shift / 3 . in this example , the maximum allowable jitter for beats to be characterized as coinciding would be 33 %. an embodiment that followed these principles would , first , characterize beats from two channels to be within 359 degrees phase of each other if the beat registry is 1 : 1 . then , within a window of comparison , the jitter , which is evaluated as the difference between the maximum and minimum phase shift , may be qualified characteristic of coincidence if less than 33 % of the maximum . maximum shift may be further qualified in the time domain if so desired , and would be a function which takes into account system latencies , this embodiment is more forgiving of the degree of phase shift , but enforces consistency in the phase relationship by allowing only a minimum in the phase jitter . with this approach the max jitter threshold should not be implemented to exceed 49 %. if the jitter is less than the maximum jitter threshold and the maximum phase shift is less than the maximum phase shift threshold , a coincidence counter is incremented and a divergence counter is decremented at step 66 . alternatively , the coincidence counter is decremented and the divergence counter is incremented at step 68 . as indicated by steps 64 , 66 , and 68 , both an increasing jitter and an exceedingly high phase shift indicate divergence . a steady jitter and a smaller phase shift indicate coincidence . at step 70 the heart beat registry is reset and prepared for registration of a new cycle of heart beat occurrences . at step 72 , a coincidence index is calculated . the coincidence index represents the degree of coincidence or divergence between heart beat occurrences on channels 1 and 2 over a time window which is either fixed or variable , as described hereinabove . in this example , the time window includes all heart beat occurrences in a three second window . the time window may include between 2 and 100 heart beat cycles . at step 72 , the coincidence index may be calculated , for example , as a ratio ( as in this exemplary embodiment ) or as a percentage of cycles which coincide . at step 74 , the coincidence index is compared to coincidence / divergence criteria ( e . g ., a coincidence trigger threshold ( c )) which indicates when a sufficient amount of coincidence or divergence is detected to alert the operator . the coincidence / divergence criteria are variable and may be adjusted to tune the algorithm . for example , coincidence trigger threshold ( c ) may be set at approximately 70 % of cycles being coincident , or approximately 3 coincident cycles to every 1 divergent cycle . alternatively , ( c ) may range between 50 % and 90 %, or may be any other value , depending upon the application and such factors as transducer type / cardiac source . if the coincidence index meets the coincidence / divergence criteria , a timer is started for the respective criterion . if the coincidence index continues to meet the coincidence / divergence criteria over multiple heart beat cycles for a predetermined time period , a signal will be generated to the user to notify the user of coincidence or divergence . in this exemplary embodiment , a coincidence trigger flag is used to implement the timer . at step 74 , if the coincidence index exceeds the coincidence trigger threshold ( c ), the coincidence trigger flag is checked at step 76 to see if it is false . if the coincidence trigger flag is false , at step 78 the coincidence trigger flag is set to true , a coincidence timer is started , and the algorithm returns to step 52 . the coincidence timer may be set to 60 seconds , between 40 and 80 seconds , or any other time , depending upon the application . if the coincidence trigger flag is not false at step 76 , at step 80 the coincidence timer is checked to see if it expired . if not , the algorithm returns to step 52 . if so , a coincidence signal is generated at step 82 and provided to one of output devices 30 . returning to step 74 , if the coincidence index does not exceed the coincidence index trigger threshold ( c ), the coincidence trigger flag is checked at step 84 . if the coincidence trigger flag is true , at step 86 , the coincidence trigger flag is set to false , a divergence timer is started , and the algorithm returns to step 52 . the divergence timer may be set to 5 seconds , between 1 and 10 seconds , or any other time , depending upon the application . if the coincidence trigger flag is not true , at step 88 the divergence timer is checked to see if it expired . if not , the algorithm returns to step 52 . if so , a divergence signal is generated at step 82 and provided to one of output devices 30 . in operation , when the coincidence index exceeds coincidence index trigger threshold ( c ) for a predetermined time ( i . e ., the duration of the coincidence timer ), a coincidence indicia is generated on one or more of output devices 30 . when the coincidence index is below coincidence index trigger threshold ( c ) for a predetermined time ( i . e ., the duration of the divergence timer ), a divergence indicia is generated on one or more of output devices 30 . according to one alternative , a divergence indicia is only provided to output devices 30 if a coincidence indicia was previously provided to output devices 30 . this alternative is particularly advantageous when the strip chart is utilized , since no indicia need be provided to the user when the heart beat occurrences are divergent unless a previous indicia indicated the heart beat occurrences were coincident . referring now to fig3 a chart 89 illustrates the operation of a portion of the heart beat coincidence detection algorithm of fig2 a . a heart beat occurrence on channel 1 is shown at occurrence 90 . a heart beat occurrence on channel 2 is shown at occurrence 92 . the phase shift or time offset between occurrences 90 and 92 is indicated by time period 94 . the x - axis of the chart represents real time in milliseconds ( ms ). in this example , the phase shift between occurrence 90 and 92 is 150 ms , as shown . in operation , the algorithm first updates the maximum and minimum phase shift values with the new phase shift value of 150 ms . a subsequent heart beat occurrence 96 is received on channel 1 , and a further subsequent heart beat occurrence 98 is received on channel 2 . note that 1 : 1 correspondence is maintained between heart beat occurrences on channels 1 and 2 from the first cycle to the second cycle . the phase shift between occurrences 96 and 98 is calculated as 155 ms , indicating a slight difference from the previous cycle . the maximum phase shift is updated to equal 155 ms and a jitter is calculated as 5 ms . further heart beat occurrences on chart 89 indicate phase shifts of 153 ms , 220 ms , 250 ms , and 190 ms and corresponding jitters of 5 milliseconds , 70 milliseconds , 100 milliseconds , and 100 milliseconds . the maximum phase shift and jitter are compared to maximum phase shift threshold ( s ) and maximum jitter threshold ( j ) to determine whether coincidence and divergence counters should be incremented or decremented . the coincidence index is then calculated and compared to the coincidence index trigger threshold ( c ). this occurs over a three second time window . processing continues in accordance with the relevant steps of fig2 b . the output of the algorithm is dependent on the values of thresholds ( j ), ( s ), and ( c ), which may be programmed when manufactured , may be updateable , and may also be adjusted by the operator via operator input device 28 to give the operator control over the sensitivity . referring now to fig4 a screen display 100 is shown . screen display 100 is generated by display 32 ( fig1 ) in response to display signals provided by central processing unit 24 . additional graphics cards or alternative circuitry may be implemented . screen display 100 includes an indicia 102 ( e . g ., the text โ hbc โ) indicating that the heart beat coincidence feature is currently operational . at step 82 of the heart beat coincidence algorithm ( fig2 b ), the algorithm generates a display signal which is one of a coincidence signal , a divergence signal , or no signal . display 100 indicates that a coincidence signal is received by displaying heart rates for channels 1 and 2 in inverse video at indicia 104 and 106 . other indicia may be used to indicate coincidence , such as , two side - by - side hearts , the text โ coincidence detected โ, an audible tone , other indicia , or some combination thereof . divergence is indicated in this example by ordinary ( i . e ., non - inverse ) video , but may be indicated by a different indicia or by no indicia . referring now to fig5 a portion 110 of a strip chart is shown . portion 110 is generated by strip chart device 34 ( fig1 ) in response to signals provided by central processing unit 24 . additional graphics cards or alternative circuitry may be implemented . portion 110 includes an indicia 112 ( e . g ., the text โ hbc โ) indicating that the heart beat coincidence feature is currently operational . indicia 112 is printed periodically ( e . g ., every 30 minutes ), but may alternatively be printed only once . at step 82 of the heart beat coincidence algorithm ( fig2 b ), the algorithm generates a display signal which is one of a coincidence signal and a divergence signal . strip chart device 34 indicates that a coincidence signal is received by printing a coincidence indicia 114 ( e . g ., two overlapping heart icons ). other indicia may be used , such as , the text โ coincidence detected โ, an audible tone , or some combination thereof . divergence may be indicated by a different indicia , such as indicia 116 ( e . g ., two non - overlapping heart icons ) or by no indicia . indicia 116 indicates that the coincidence was resolved . coincidence indicia 114 and divergence indicia 116 may be printed periodically to approve the current status , or may be printed only when the status changes . according to a further advantageous feature , the coincidence or divergence status may also be output via communications link 36 . while the embodiments and application of the invention illustrated in the figures and described above are presently preferred , it should be understood that these embodiments are offered by way of example only . for example , alternative algorithms may be employed to compare the heart beat occurrences . further , the method steps presented may be employed in a different order . accordingly , the present invention is not limited to a particular embodiment , but extends to various modifications that nevertheless fall within the scope of the appended claims . | 0 |
fig1 illustrates an athlete 2 moving toward an invisible barrier 1 : the athlete wears a belt with a sensor 16 the barrier , shown with dashed lines , is set up as a spatially fixed device and is formed by two markers . each of the two markers is constructed as a magnetic compound dipole ( mcd ) 3 and mounted on so - called cones 4 , i . e ., on pylons , such as are used , for example , in traffic control . in this manner , a type of gate is created , through which the athlete 2 is to run and which the athlete can easily recognized , because the cones 4 have contrasting color stripes 5 . with this set up , multiple barriers 1 may be set up at a venue that is not at a sports arenas , for example , for sporting events in which a number of athletes 2 are to be guided through the center of a city or through other courses . the barrier 1 is an imagined , invisible line between two posts of the virtual gate through which the athlete 2 is to run , whereby the construction of the post is clearly shown in fig2 : the cone 4 and the mcd 3 that is integrated into the cone 4 form the virtual gate . fig7 illustrates the mcd 3 as having two magnets 6 arranged at the ends of a metallic extension yoke 7 . fig8 illustrates that two or more magnets 6 are provided on each end of the mcd 3 . the mcd 3 is removably mounted in the cone 4 , whereby the cone 4 , for example , may have a sleeve that is open at the top , so that the mcd 3 is insertable through this opening , or the mcd 3 may have a circumferential flange on the extension yoke 7 , which limits the insertion depth into the cone 4 . in any case , multiple cones 4 are stackable , one on top of the other , after the mcds have been removed . the mcds 3 may also be bundled together to save space , so that overall , the organizational effort that is involved in setting up and later taking down a number of barriers 1 for a sporting event is reduced . the time detection barriers take up a relatively small space when being transported and may be set up in a very easy manner . this is because there is no need for cables , electronics for data evaluation , etc . to set up and operate the barriers 1 , such as is necessary when the barriers have to be permanently installed along a race course . fig3 shows a fitness device 8 , that has a bar 9 that is operated by the athlete 2 . the athlete 2 wears a belt with a sensor 16 . the bar 9 is connected with a plurality of weights 11 via a cable 10 guided over several pulleys . the cable 10 carries not only the weights 11 , but also a magnet 12 , that is movable along with the cable 10 and , particularly , is movable relative a spatially fixed mounted mcd 3 . the presence of the athlete 2 , as well as also the number of motions that the athlete carries out with the bar , are recorded by sensor based on the modulation of the magnetic field on the mcd 3 . this is done without requiring the use of a barrier 1 with the system that is shown here in fig3 . a second mcd 3 may be used to modulate the magnetic field of the first mcd 3 . fig4 to 6 illustrate a system for recording the position of an object in which a barrier 1 is not needed . the fitness device 8 shown here is a so - called ellipsis trainer , shown in side view in fig4 and 6 . fig5 illustrates components of the trainer 8 seen from the rear . similarly to the set up shown in fig3 , the athlete 2 wears a belt here , too , with the sensor 16 , and a movable magnet 12 is mounted on the fitness device 8 , where the spatially fixed mcd 3 is also mounted . the system according to the invention records the number of motion cycles that the athlete 2 executes with the fitness device 8 , based on the relative motion between the mcd 3 and the magnet 12 . fig4 and 5 show , in two different variants of the ellipsis trainer , that the movably mounted magnet 12 may be provided on one of the two step platforms 14 on which the athlete stands , or that a movable magnet 12 may be mounted on each of the step platforms 14 . or , it is also possible , as shown in fig6 , to affix the movable magnet 12 to a flywheel or cam wheel 15 that is set into rotation by means of the step platform 14 that serves as a crank to rotate the cam wheel . instead of a magnet 12 , a second , movable mcd 3 may be used . also , instead of the sensor 16 that is worn by the athlete 2 , the sensor may also be set up a distance from the fitness device 8 . fig9 illustrates an mcd 3 , that is encased in a sheath 17 . the sheath 17 does not have to be constructed as a magnetic shield , but merely serves to maintain a minimum distance of the mcd 3 to the surrounding objects , so as to reliably avoid magnetic disturbances that can be generated in close range to the mcd 3 because of the relatively strong magnetic field . furthermore , the sheath 17 may be constructed as protection against the elements of the weather , for example , so that the material used for the extension yoke 7 is protected against corrosion . finally , the sheath 17 may also be padded , to serve as a mechanical protection for the mcd 3 as well as for the athletes 2 , when they run through a magnetic barrier 1 . fig1 to 15 illustrate six different embodiments of magnetic barriers 1 , whereby these illustrations all show the magnetic barrier in a plan view . the arrow indicates the direction in which the athlete 2 passes through the barrier 1 . different set ups enable the recognition of the individual barriers , because the change in the magnetic field when passing the sensor differs in the set ups . additional combinations of set ups are possible with the use of diagonally oriented mcds . fig1 is a plan view of a magnetic barrier 1 , by which the two cones 3 are provided with contrasting stripes 5 and each has a vertically oriented mcd 3 . both mcds 3 are oriented in the same direction , i . e ., with either both north poles or both south poles of the magnets 6 pointing up . fig1 illustrates a magnetic barrier 1 , that has the same basic construction , whereby the two mcds 3 are oriented differently in the cones 4 . in other words , in one mcd , the north pole of the magnets 6 is pointing up and in the other mcd in the cone 4 the north pole of the magnet 6 used there is pointing down . fig1 and 13 illustrate two magnetic barriers 1 , in which the mcds 3 are oriented horizontally , also , lying down , and parallel to the direction the athlete is running through the gate . the โ n โ and โ s โ indicators make clear , that , in fig1 , the mcds 3 are oriented the same , whereas the two mcds 3 in the magnetic barrier in fig1 are oriented opposite each other . fig1 and 15 show two constructions of magnetic barriers 1 , in which the mcds 3 are also horizontally oriented , but not in the direction the athlete is running , but rather , transverse to the runner &# 39 ; s direction . fig1 relates to an embodiment , in which the two mcds 3 are oriented in the same direction , and fig1 to an embodiment of the magnetic barrier 1 in which the mcds are oriented opposite each other . in these two embodiments , the two north poles of the mcds 3 point inward , i . e ., toward the athlete 2 or toward the open passage through the magnetic barrier 1 . fig1 shows an athlete 2 riding a horse through the open passage way of a magnetic barrier 1 . the two mcds 3 are arranged in vertical orientation and , in this embodiment , the athlete 2 is not wearing a belt , but rather , the belt is part of the saddle belt that the horse is wearing . the sensor 16 is arranged in the lower area of the saddle belt . the dashed lines show how the lines of the sensor 16 run to the mcds 3 of the magnetic barrier 1 and indicate schematically the action between the sensor 16 and the mcds 3 . fig1 shows that the magnetic barrier 1 is not used to detect an athlete &# 39 ; s travel , but rather , travel a ball 18 . the two mcds 3 are mounted on the goal posts of a soccer goal . depending on the material that the goal posts are made of , the mcds 3 may be embedded into the posts . the ball 18 just crossing the goal line in the upper portion of fig1 and , thus , the magnetic barrier between the two mcds 3 . the effective lines between the sensor 16 that is incorporated into the ball 18 and the mcds 3 are shown in dashed lines . the ball 18 , which is shown in a larger scale in fig1 , below the soccer goal , carries the sensor 16 inside it . the sensor 16 is elastically suspended in the center of the ball 18 to protect it . the sensor 16 may be read wirelessly via a data cable after the end of the game . it is a particular advantage , however , if the sensor 16 is equipped with a radio module , so that during the game , practically in real time , the sensor signal may be evaluated . this provides irrefutable evidence , for example , of whether the ball 18 crossed the goal line between the soccer goal posts . fig1 shows the magnetic field lines of two mcds 3 , which are oriented opposite each other , as can be seen on the โ n โ and โ s โ designations on the magnetic north and south poles . fig1 shows , with the same distance of the two mcds 3 , that is , with a magnetic barrier 1 having the same width , the magnetic field lines of an arrangement in which the magnets 6 of the mcds 3 are oriented in the same direction . | 0 |
hereinafter , embodiments of the present invention will be described on the basis of the drawings . fig1 is a conceptual diagram of a die bonder 10 viewed from the upper side according to an embodiment of the present invention . the die bonder roughly includes a wafer supplying unit 1 , a work supplying / feeding unit 2 , a die bonding unit 3 , and a control device 4 that controls the respective units and a bonding flow in each embodiment to be described later . the work supplying / feeding unit 2 includes a stack loader 21 , a frame feeder 22 , and an unloader 23 . a work ( a substrate such as a lead frame or a die already laminated on a substrate ) supplied to the frame feeder 22 by the stack loader 21 is fed to the unloader 23 via two processing positions on the frame feeder 22 . the wafer supplying unit 1 includes a wafer cassette lifter 11 and a pickup device 12 . the wafer cassette lifter 11 includes wafer cassettes ( not shown ) filled with wafer rings , and sequentially supplies the wafer rings to the pickup device 12 . each wafer ring holds a wafer w having a die d , and the pickup device 12 holds the wafer rings . the die bonding unit 3 includes a preform unit 31 and a bonding head unit 32 . the preform unit 31 applies a die adhesive agent on the work fed by the frame feeder 22 . the bonding head unit 32 includes a bonding head 35 , an xzฮธ driving unit 36 that drives the bonding head in the x or z direction or rotates the same by ฮธ , a y driving unit 37 that drives the xze driving unit in the y direction , a collet replacing unit 50 , and a collet descent distance correcting unit 60 . the bonding head 35 is lifted by the xzฮธ driving unit 36 while picking up the die d from the pickup device 12 , and translates the die d in the x direction to a bonding point on the frame feeder 22 . then , the bonding head 35 allows the die d to descend to be bonded onto the work with the die adhesive agent applied . hereinafter , as a feature of the embodiments , the collet attachment confirmation means 70 that confirms whether or not a collet is attached , the collet replacing unit 50 , and the collet descent distance correcting unit 60 that corrects a collet descent distance after collet replacement will be described . in the first place , structures of the bonding head 35 , a collet 40 and a collet holder 41 and a configuration of the collet attachment confirmation means 70 will be described using fig2 . the bonding head 35 has , in the middle , an absorption hole 35 v to which absorption air flows , and includes , on the tip end side , a collet shank 35 s connected to the collet holder 41 and a collet fixing unit 35 k that fixes the collet holder 41 to the collet shank 35 s . the collet holder 41 has , in the middle , an absorption hole 41 v in communication with the absorption hole 35 v , a magnet 41 j fixing the collet 40 , and the collet attachment confirmation means 70 provided in the absorption hole 41 v . as shown in fig4 , the four sides of the collet 40 are held by the collet holder 41 , and the collet 40 includes plural absorption holes 40 v in communication with the absorption hole 41 v to absorb the die d . the collet attachment confirmation means 70 includes an orifice 70 o , a confirmation bar 70 b with one end fixed to the orifice , and a compression spring 70 c that presses the orifice towards the collet holder 41 . in the case where the collet 40 is attached to the collet holder 41 as shown in fig2 , the confirmation bar 70 b is pushed up by the collet 40 against the compression spring 70 c in the collet attachment confirmation means 70 , and the orifice 70 o is lifted to secure the volume of air flow . on the other hand , in the case where no collet 40 is attached , the compression spring 70 c allows the orifice 70 o to descend to decrease the volume of air flow . the attachment of the collet 40 is confirmed by the volume of air flow or differential pressure . according to the above - described collet attachment confirmation means 70 , the attachment of the collet can be reliably confirmed without providing optical means . next , a first example of the collet replacing unit 50 as a second embodiment will be described using the drawings . in the first place , a configuration of the collet replacing unit 50 will be described using fig3 to fig6 . each of fig3 and fig4 is a birds - eye view of the collet replacing unit 50 shown in fig1 . fig3 shows a state in which an unused collet 40 is housed in a supplying unit 51 . fig4 shows a state in which the collet holder 41 is grasped to attach the collet 40 . fig5 is a plan view of the collet replacing unit 50 viewed from the upper side in the state of fig3 . fig6 is a diagram of the inside of the supplying unit 51 viewed from the direction of the arrow a in fig4 . as shown in each of fig3 and fig5 , the collet replacing unit 50 includes the supplying unit 51 that supplies an unused collet 40 , and a discarding unit 56 that discards a used collet 40 . the supplying unit 51 and the discarding unit 56 include opening portions 51 k and 56 k on the upper side , respectively . the opening portions 51 k and 56 k have the same structure , and include fixing claws 51 t and 56 t , respectively , of engagement portions at diagonal positions denoted by the circles . it should be noted that in consideration of a case in which the direction of mounting the die d is shifted by 90 ยฐ as shown by the dotted line in the embodiment , two engagement portions are each provided at the positions where the fixing claws 51 t and 56 t are rotated by 90 ยฐ. as shown in fig6 , the supplying unit 51 includes a collet housing unit 51 s in which plural unused collets 40 are stacked , a compression spring 51 b as pressing and moving means that presses and moves the unused collets 40 in the collet housing unit towards the opening portion 51 k , and a spring housing unit 51 r in which the compression spring is housed . on the other hand , the discarding unit 56 includes a waste housing unit under the opening portion in which used collets 40 are housed . a cylinder or the like may be provided as the pressing and moving means . in the supplying unit 51 , the fixing claws 51 t serve as protrusion prevention means to prevent the collet from protruding by being engaged with the collet 40 . in addition , the fixing claws 51 t and 56 t are highly important when the collet 40 is attached to the collet holder 41 , or when the collet 40 is detached from the collet holder 41 . as shown in fig4 , the areas of the collet holder 41 corresponding to the fixing claws 51 t and 56 k are cut in a triangle shape so as not to interfere with the fixing claws 51 t and 56 k . a method of attaching the collet 40 to the collet holder in the collet replacing unit 50 with such a configuration will be described using fig3 to fig7 . each of fig3 and fig5 shows a state in which the collet 40 is simply housed in the supplying unit 51 . in this case , the fixing claws 51 t serve to prevent the collet 40 from protruding . next , as shown in fig4 , the bonding head 35 is controlled to move the collet holder 41 to the upper side of the unused collet 40 . after discarding , the bonding head 35 is only moved from the discarding unit 56 to the supplying unit 51 in the lateral direction . thereafter , the collet holder 41 is allowed to descend to grasp the unused collet 40 while covering the whole , and the unused collet 40 is held by the magnet 41 j . since the four corners of the collet holder 41 are cut in a triangle shape , the collet can be held without interfering with the fixing claws 51 t . next , as shown in fig7 , the collet 40 is rotated by the bonding head 35 in the counterclockwise direction by ฮธ from the state of fig5 to be separated from the fixing claws 51 t . then , the bonding head 35 is lifted , and the attachment of the collet 40 is confirmed by the method shown in the first embodiment . thereafter , the process is moved to the following operation . next , a method of discarding a used collet 40 to the discarding unit 56 will be described using fig8 and fig9 . in the case of discarding , procedures opposite to the case of supplying an unused collet are performed . specifically , the bonding head 35 is first controlled to move the collet 40 to the upper side of the opening portion 56 k of the discarding unit 56 . thereafter , the collet 40 is rotated in the counterclockwise direction by ฮธ so that the diagonal positions of the collet 40 do not interfere with the fixing claws 56 t , and the state shown in fig8 is realized . next , the collet 40 is allowed to descend using the bonding head 35 to be inserted into the opening portion 56 k , and the collet 40 is rotated in the counterclockwise direction by ฮธ . then , the diagonal positions of the collet 40 are moved to the lower side of the fixing claws 56 k , and the state shown in fig9 is realized . thereafter , by pressing the diagonal positions of the collet 40 with the fixing claws 56 t , the bonding head 35 is lifts the collet to overcome the holding force of the magnet 41 j in order to detach the collet 40 from the collet holder 41 . the collet 40 falls into the waste housing unit under the opening portion . then , the bonding head 35 is moved to the side of the supplying unit 51 to hold an unused collet 40 , and the above - described procedures are performed . in the above - described embodiment , the fixing claws are provided at the diagonal positions . avoiding portions 41 c cut in a triangle shape are provided at the diagonal positions of the collet holder 41 corresponding to the fixing claws in order to avoid the fixing claws . the positions of the fixing claws are not limited to the diagonal positions , but may be other positions . for example , the fixing claws are provided at the middle positions of the opposite two sides , and the shape of the avoiding portions 41 c may be set in the middle portions of the collet holder 41 corresponding to the fixing claws so as not to interfere with the fixing claws by the rotation of the collet holder . to put it in an extreme way , a trapezoidal portion on the shorter side of the collet holder shown in fig4 may be cut . in this case , it is necessary to position in the longitudinal direction . for example , convex portions are provided in the longitudinal direction of the collet holder for positioning , and concave portions may be provided at the corresponding positions of the collet . even in the above - described embodiment , the avoiding portions 41 c may not be in a triangle shape . for example , the avoiding portions 41 c may be in a rectangular shape or ยผ circular shape . in the above - described embodiment , the collet replacing unit 50 is provided at one position . however , the collet replacing unit 50 may be installed at any position in a movable range of the bonding head as long as a mounting process is not affected , and plural collet replacing units 50 may be installed . in this case , the collet replacing units 50 may be provided for different die sizes . further , even if the die sizes are different , the outer shape of the collet may be standardized so as to be held by the common collet holder . according to the above - described second embodiment , plural unused collets 40 are orderly stacked and housed , so that a stock area can be narrowed . further , according to the above - described second embodiment , the collet replacing unit 50 can be downsized by accessing the supplying unit 51 and the discarding unit 56 from the upper side , and a replacement area including the stock area can be narrowed . further , according to the above - described second embodiment , the collet 40 can be attached or detached to / from the collet holder 41 ( bonding head 35 ) with a simple structure in which the fixing claws 51 t and 56 t are provided at the opening portions 51 k and 56 k of the supplying unit 51 and the discarding unit 56 , respectively , and the magnet 41 j is provided at the collet holder 41 . next , a second example of the collet replacing unit 50 as a third embodiment of the collet replacing unit 50 will be described using fig1 . the third embodiment is different from the second embodiment in the following two points , and the other points are the same . first , the collet 40 is detached from the collet holder 41 by the rotation of the fixing claws 51 t and 56 t and the collet 40 in the second embodiment . in the third embodiment , movable claws 52 t and 57 t are provided at the positions where the fixing claws 51 t and 56 t exist . by moving the movable claws 52 t and 57 t with shape - memory alloy springs 52 b and 57 b , respectively , the collet 40 is attached or detached to / from the collet holder 41 . the shape - memory alloy springs 52 b and 57 b release the holding of the collets 40 by shrinking the springs when current flows . thus , it is not necessary to rotate the collet when the collet 40 is attached or discarded in the third embodiment . second , as similar to the first embodiment , when the collet 40 is pushed up by the compression spring 51 b in the supplying unit 51 in the third embodiment , the movement of the movable claw 52 t causes a collet for replacement to protrude . in order to prevent this , when the collet 40 is replaced in the third embodiment , the stretch of the compression spring 51 b is fixed by a pulse motor ( not shown ), and the fixing by the pulse motor is released when the movable claw 52 t holds the collet . specifically , the pulse motor that fixes the stretch of the compression spring 51 b configures protrusion prevention means . in this case , using a pulse motor or a servo motor as moving means of the stacked unused collets , the collet is moved by the pulse motor or the servo motor by the height of the collet to serve as protrusion means , so that the movable claws 52 t can be eliminated . this point can be applied to the second embodiment , and the fixing claws 51 t can be eliminated . it should be noted that there are various driving methods of the movable claws 52 t and 57 t . for example , the movable claws 52 t and 57 t may be driven by a cylinder or a motor . next , an embodiment of the collet descent distance correcting unit 60 and a collet descent distance correcting method will be described using fig1 . the collet descent distance correcting unit 60 includes a collet height measuring unit 61 that measures changes of the height of the collet , and a control device 4 that corrects the descent distance of the collet , namely , the bonding head 35 on the basis of the measurement result by the collet height measuring unit . the collet height measuring unit 61 is a commercial sensor configured using a light emitting unit 61 h and a light receiving sensor 61 j . the collet height measuring unit 61 is fixed to the die bonder structure unit while being adjacent to the collet replacing unit 50 or the collet replacing unit 50 . the light emitting unit 61 h emits light 61 b with a certain bandwidth to the light receiving sensor 61 j , and the light receiving sensor 61 j can measure the length h of a light receiving unit or the length of a light - blocking unit in a unit of nm . a collet descent distance correcting method by such a collet descent distance correcting unit 60 will be described . the collet 40 is allowed to descend to a certain position of the collet descent distance correcting unit 60 . when the length of the light receiving unit of the collet 40 before collet replacement is hb and the length of the light receiving unit of the collet 40 after collet replacement is ha , the height change ฮดh of the collet 40 is represented as the following formula ( 1 ). the descent distance bh of the bonding head 35 when the die d is picked up or is attached to the substrate is corrected only by the height change ฮดh of the collet 40 . the correction may be done by using previous descent distance bhb or a standard descent distance bh . according to the above - described fourth embodiment , variations in the height of the collet at the time of manufacturing can be corrected in a unit of nm , and the die can be picked up and mounted to the substrate or the like without an adverse effect on the die such as destruction in the worst case . next , a bonding flow in the embodiment will be described using fig1 . in the first place , a collet 40 is attached to the bonding head on the basis of the collet attachment method shown in the second or third embodiment ( s 1 ). the attachment of the collet 40 is confirmed on the basis of the first embodiment ( s 2 ). if the attachment of the collet cannot be confirmed , s 1 is performed again . next , the descent distance of the collet is corrected on the basis of the fourth embodiment ( s 3 ). thereafter , the die d is mounted ( s 4 ). during the mounting , time of replacing the collet 40 is determined ( s 5 ). if replacement is necessary , the flow is moved to s 1 to replace the collet 40 , and the processes after s 2 are continued . finally , it is determined whether or not a predetermined mounting process is completed , and the process is completed ( s 6 ). as a method of confirming the attachment in the flow , optical means provided at the die bonder to confirm the posture of the die may be used without using the method of the first embodiment . according to the above - described fifth embodiment , a bonding method with a high operation ratio can be realized . according to the above - described first to fourth embodiments , a die bonder and a bonding method with a high operation ratio can be provided . the embodiments of the present invention have been described above , and various alternative , modified , or converted examples are available for those skilled in the art on the basis of the above description . the present invention includes various alternative , modified , or converted examples without departing from the gist of the present invention . | 8 |
a typical prior art cordless telephone system is shown in fig1 to include a portable unit 10 and a base unit 12 . when the hand set 13 of the portable unit 10 is removed from its cradle ( not shown ), switch 14 closes to apply power to the transmitter 16 and tone generator 18 . the transmitter 16 transmits a carrier , which may , for example , be 17 mhz and this signal is modulated by the tone from generator 18 applied through the interrupter contacts of a dial 20 . as an example , the tone signal may be 5000 hz . the frequency modulated signal from transmitter 16 is received by the receiver rc of base unit 12 . the dialing tone is detected by the tone decoder s 1 coupled to receiver rc and which in turn actuates a line relay rl through a controller or gate g whereby line relay contacts 30 are closed to connect the base station 12 to the telephone line 32 through line interfacing circuit t which may be , for example , a hybrid transformer . when the portable unit dial 20 is dialed , the dialing tone is interrupted in accordance with the dial contacts repeated opening and closing whereby the energizing circuit to the line relay rl is similarly interrupted . in this manner , the contacts 30 open and close to provide dialing pulses to the line l . voice transmission from the portable unit 10 is transmitted through handset transmitter 36 , amplifier modulator 38 , transmitter 16 , and to the receiver rc of base unit 12 for amplification by audio amplifier a which is connected to line 32 through circuit 34 . when ringing voltage appears in telephone line l , any suitable circuit device responsive to ringing voltage , such as an opto - isolator circuit 41 couples a ring detector circuit 42 to line l for detecting peak voltage levels . the ring detector circuit 42 enables a tone generator 44 which in turn modulates the signal from the base unit transmitter 46 . the base unit carrier wave will be transmitted at a different frequency than the portable unit , such as 27 mhz , for example , while the modulating signal may be 1700 hz , for example . this modulated signal is transmitted to the portable unit receiver 47 for being sensed by the tone detector 48 which energizes a bell 50 through electronic switch 52 . when the call is answered by lifting the portable unit handset 13 from its cradle , the line relay rl is energized as discussed above to close contact 30 thereby signaling the telephone line to remove the ringing voltage as in any normal telephone system . simultaneously , the portable cradle switch 14 removes the supply voltage from the tone detector 48 and energizes the portable unit receiver 48 to accommodate normal voice communication . voice communication received from telephone lines l is applied by line interfacing circuit 34 through audio amplifier 54 for modulating the signal from transmitter 46 and this transmitted signal is received by portable unit receiver 48 which is coupled to the handset receiver 56 through audio amplifier 58 . voice transmission from the handset transmitter 36 is summed with the tone from generator 18 in amplifier modulator 38 and this composite signal modulates the signal from transmitter 16 to produce wave propagation to the base unit receiver rc which is coupled to line l through audio amplifier a . fig2 shows a portion of the base station 12 which incorporates the present invention . in addition to the components of this portion of the circuit illustrated in fig1 the embodiment of fig2 includes a second tone detector circuit s 2 , a delay circuit d and a reset circuit rs . the tone detector s 2 is similar to tone detector s 1 although it is preferably adjusted to detect a different tone signal than the tone detector s 1 . it will be recalled that in the embodiment of fig1 the tone generator 18 is coupled through dial 20 to the amplifier modulator 38 so that the tone signal from generator 18 is employed to modulate the carrier wave transmitted by transmitter 16 . the portable unit employed with the embodiment of fig2 would be substantially the same as that illustrated in fig1 except a second tone generator ( not shown ) is connected directly to the amplifier modulator 38 while the first tone generator 18 is connected through the dial 20 . preferably , the two tone generators used in the portable unit to be employed in connection with the embodiment of fig2 would be of a type capable of generating tone signals within a very narrow band , such as , for example , tuning fork reeds . these signals provided by the two tone generators would preferably be different frequency signals which would each modulate the carrier frequency . the detector s 1 is tuned so that it detects the first tone signal , that is the one not subject to dialing pulsing interruptions while the detector s 2 detects the tone signal associated with the dial 20 . accordingly , each of these tone signals is employed to modulate the carrier wave and is transmitted automatically when the portable unit handset is taken off its cradle to open the hook switch . the gate g is preferably an and gate such that when tone signals are detected by s 1 and s 2 the and gate is operative to actuate relay rl which in turn closes contacts 30 so that the system is connected to the telephone line l . a feedback circuit f is provided for maintaining the gate g in an enabled condition so that the line relay rl will remain energized should the signal to s 1 be lost . for this purpose , the delay circuit d and the reset circuit rs are provided for resetting the and gate should the tone signal detected by both circuits s 1 and s 2 be interrupted . the interruptions of the signal detected by s 2 which is occasioned by dialing will cause opening and closing of the contacts 30 in the manner discussed with respect to fig1 . fig3 shows the circuitry of fig2 in greater detail . the gate g may comprise an and gate consisting of transistors tr 1 and tr 2 . when the first signal is detected by tone detector s 1 , an output is provided through converters ic 1 and ic 2 to the base of transistor tr 1 . if a second tone signal is detected by tone detector s 2 , a positive signal is applied to the base of transistor tr 2 . as a result , both transistors tr 1 and tr 2 become conductive to provide a signal to relay rl for closing contacts 30 . if at this time , the s 2 signal is interrupted , such as occurs during dialing on the portable unit , the relay contacts 30 are interrupted so that the dialing pulses will be transmitted to line l in the manner discussed with respect to fig1 . because of the cascade connection of the ic 1 and ic 2 converter circuits and the feedback circuit consisting of resistor r 2 and diode d 4 , once the output of ic 2 becomes positive , this output signal will remain even if the output of tone detector s 1 is interrupted . as a result , so long as an output signal exists from tone detector s 2 , the relay rl will remain energized and communication to the telephone line l may continue . the signal s 2 may be , for example , about 5 khz so as not to interfere with the lower voice frequency of telephone communication . the audio amplifier a , which is shown in fig1 and 2 but not in fig3 is provided with a narrow band pass filter or phase synchronous circuit to eliminate the tone signal generated by the portable unit into which the tone detector s 2 is responsive . as indicated above , the function of the reset circuit rs is to de - energize the relay rl when the tone signal to detector s 2 terminates . specifically , when the output signal from tone detector s 2 ceases , the base voltage of transistor tr 3 disappears after a predetermined time delay dictated by the resistor r 1 and the capacitor c 1 of delay circuit d . on this event , the voltage of the junction of transistor tr 4 emitter and resistor r 3 disappears so that the input voltage of ic 1 becomes zero and the output voltage of ic 2 similarly goes to zero . in this manner , the converter circuit ic 1 and ic 2 is reset and will remain in this condition so long as a positive signal does not return to its input . the delay circuit d consisting of capacitor c 1 and resistor r 1 are provided so that the converter circuit is not reset when the s 2 input is pulsed or interrupted in the case of dialing . in this manner , during dialing the converter circuit is not reset so that the delay circuit restores the converter circuit only when the s 2 output had disappeared for a fixed time which is greater than the time between dialing pulses . in the system illustrated in fig3 the s 2 signal of about 5 khz is applied constantly during a period of the telephonic communication , and therefore this signal sound may be disadvantageously leaked and heard in the telephonic communication in the event of poor performance of the eliminating filter of the receiving unit , component change or the other reasons . it will be appreciated that the s 2 tone signal and the carrier wave signal always exist simultaneously . since the modulated 5 khz wave signal never exists when the carrier wave does not exist , and because the 5 khz signal always corresponds to the carrier wave signal , the carrier wave may be used instead of the 5 khz signal without interference in the audio system . in addition , when the carrier wave is used instead of the 5 khz signal , there will be no interference as the result of jamming and disturbance waves . first , when there is no telephonic communication between the portable telephone and the receiver when an interfering wave is received having approximately the same frequency to which the receiver rc is tuned , an output is produced in the tone decoder s 2 . however , because the s 1 tone signal does not exist , so that the gate g is not operated , the interference is of no consequence . in the case where the interference signal is received during established telephonic communication , an output has been already produced in the tone detector s 2 in the manner indicated above so that the transistor tr 1 in fig3 is in a conductive condition . hereupon , even if the disturbing or interfering wave is further added , the operation of the tr 1 remains as it is , and again , no change is caused by the interference . the same results occur regardless of whether the disturbance wave is steady or intermitted . it will be appreciated , therefore , that it is possible to use the carrier wave for the s 2 detected signal , and further this proposed system produces excellent results as will be described hereafter , in comparison with a system using the specific signal , for example , the 5 khz wave modulating signal . specifically , in considering the case where an interfering or disturbance wave exists , when the disturbance wave signal is especially large in the system using the 5 khz wave modulation signal , the signal is suppressed , and the 5 khz multiple restored signal is decreased so the transistor tr 1 in fig3 may become nonconductive . in this case , undesirably the telephonic communication is not only interfered with but also the circuit may be cut off . however , as is apparent from the foregoing discussion , such an interference will have no effect in the system using the carrier wave . furthermore , in this system , the additional tone generator in the portable unit 10 for the s 2 signal as well as the s 2 signal filter of the receiving unit audio amplifier a are not required , thereby reducing costs . a disadvantage in using the carrier wave as the s 2 signal in the embodiment of fig3 results from the fact that if a disturbance wave of about the same frequency as the carrier signal is received during dialing , misdialing will result . specifically , when an output is produced in the selector s 1 by the first signal , the relay rl is operated to connect the system to the line . if , while the carrier wave , i . e . the s 2 output is intermitted during dialing , a disturbance wave is also received , an output is produced in the selector s 2 so that the s 2 output is not disconnected in response to the dialing , whereby a wrong number may be called or the dialing disabled . these defects are alleviated in the embodiment of the invention shown in fig4 . here a pair of tone detection circuits s 1 &# 39 ; and s 1 &# 34 ; are provided in addition to the tone detector s 2 . detector s 1 &# 34 ; is connected to the radio receiver rc through a gate ga while the second tone detector s 1 &# 39 ; is connected to the radio receiver rc and to gate ga which is operative for a fixed time after receiving an enabling signal from detector s 1 &# 39 ;. the signal received from the portable unit and which is initiated when the handset is elevated , consists of the carrier frequency modulated by a combined frequency signal with the detector s 2 tuned to the carrier frequency while the detectors s 1 &# 39 ; and s 1 &# 34 ; are each tuned to one of the frequencies of the combined modulating frequency signal . in addition , the frequency signal to which the detector s 1 is tuned is interrupted during dialing . gate ga is of a type that remains conductive so long as an input exists once turned on by a triggering signal so that the signal to detector s 1 &# 34 ; will continue even though the signal from s 1 &# 39 ; is interrupted by the dialing operation . when the portable unit handset is lifted from its cradle to provide the carrier frequency and the combined modulating frequency , the carrier wave is detected by s 2 which energizes transistor tr 2 while the first portion of the combined frequency is detected by s 1 &# 39 ; which enables gate ga so that tone detector s 1 &# 34 ; can detect the other portion of the modulating frequency to set transistor tr 1 whereby line coupling occurs in the manner discussed above . transistor tr 4 is biased such that when a signal appears on the output of detector s 1 &# 39 ;, transistor tr 4 becomes nonconductive . however , during dialing , the s 1 &# 39 ; portion of the modulating frequency is interrupted so that transistor tr 4 becomes conductive , thereby connecting diode d 1 to ground so that transistor tr 2 is turned off and the line contacts 30 are opened . accordingly , whenever the interruption of the tone detected by detector s 1 &# 39 ; is interrupted , transistor tr 2 is turned off regardless of whether s 2 detects an interference signal . when the combined frequency portion of the signal is detected by s 1 &# 39 ; between dialing pulses or when dialing is completed , transistor tr 4 will be turned off so that transistor tr 2 may be turned on to complete line coupling . accordingly , if the tone detector s 2 receives an interference signal during dialing , it will have no effect upon the dialing operation . further , because gate ga will continue to provide the tone signal to s 1 &# 34 ; after initially being enabled by the signal from s 1 &# 39 ;, the interruption of the s 1 &# 39 ; signal will have no effect on the operation of transistor tr 1 . those skilled in the art will appreciate that the portable unit illustrated in fig1 requires modification in a well - known manner when employed with the embodiment of fig4 to provide the output signal consisting of a carrier wave and a modulating wave consisting of two frequencies in combination , one of which is interrupted during dialing . while only a few embodiments in the invention have been illustrated and described , it is not intended to be limited thereby but only by the scope of the appended claims . | 7 |
in the fig1 two elevators of a elevator group are designated by c and d . wherein each elevator includes a car 2 guided in an elevator shaft 1 and driven by a hoist motor 3 by way of a hoisting cable 4 . in this example , fifteen floors e0 and e14 are served by the cars . the hoist motor 3 is controlled by a drive control , such as the control shown in the european patent no . ep - b 0 026 406 , wherein the target value generation the regulation functions and the stop initiation are realized by means of a microcomputer system 5 . the system 5 is connected to measuring and adjusting elements 6 of the drive control . the microcomputer system 5 computes a sum which is also called operating costs corresponding to the waiting time of all passengers and this sum is made the basis of the call allocation procedure , as is for example shown in the application ep - a 0 356 731 mentioned above . the car 2 includes a load measuring device 7 which is connected with the microcomputer system 5 . call registering and indicating devices 8 , which are for example shown in the previously identified application ep - a 0 320 583 and which have decade keyboards , are provided on the floors by which calls for travels to desired target floors can be entered . the call registering and indicating devices 8 are connected by way of an address bus ab and a data input conductor dl with the microcomputer system 5 . the call registering and indicating devices 8 of a floor are connected together and can be associated with more than one elevator of the group wherein , for example , those connected to the elevator c are connected by way of coupling members in the form of multiplexers 9 to the microcomputer system 5 of the elevator d . the microcomputer systems 5 of the individual elevators of the group are connected together by way of a comparison device 10 , which is shown in the european patent no . ep - b 0 50 304 , and a party line transmission system 11 , which is shown in the european patent no ep - b 0 050 305 , and together with the call registering and indicating devices 8 form a group control similar to the control shown in the aforementioned application ep - a 0 356 731 . the call registering and indicating devices 8 are furthermore connected by way of conductors l to the microcomputer systems 5 as described below . a signal by which the microcomputer systems 5 can identify an actuated call registering and indicating device 8 can be transmitted by way of the conductors l . the portion of the microcomputer system 5 , illustrated schematically in the fig2 and which is associated for example with the elevator a . includes a floor call memory ram1 and a first and a second call allocation memory ram2 and ram3 respectively . for each direction of travel , the memories possess storage places corresponding to the number of the floors ; however only the memories associated with the upwards calls are illustrated . the floor call memory ram1 consists of a first and a second memory portion , ram1 . 1 and ram1 . 2 respectively , wherein the calls identifying the entry floors are stored in the first memory portion ram1 . 1 and the calls identifying the target floors are stored in the second memory portion ram1 . 2 . the first allocation memory ram2 is associated with the first memory portion ram1 . 1 and the second allocation memory ram3 is associated with the second memory portion ram1 . 2 . an operating costs register for the storage of the operating costs is denoted by r1 and a car position register is denoted by r2 . a selector r3 in the form of a another register generates addresses which correspond to the floor numbers and by means of which the storage places of the memories ram1 . 1 , ram1 . 2 , ram2 and ram3 can be addressed . while the selector r3 indicates that floor at which the travelling car 2 could still stop , the car position register r2 indicates that floor in the region of which the car 2 is actually situated . the floor call memory ram1 , as well as the first and second call allocation memories ram2 and ram3 , are read - write memories which are connected with a bus sb of the microcomputer system 5 . memories 12 13 and 14 which are shown in the patent application ep - a 0 356 731 identified above are read - write memories in which data for the operating costs computation are stored load values in the form of a number of persons are stored for each floor in the load memory 12 . such persons are situated in the respective car during a future stop or the travel past a floor , and the number can be calculated on the basis of the entered calls . in this case , load values formed from faulty call entries can be corrected through comparison with the values ascertained by the load measuring device 7 . the door opening and closing times of the elevator concerned are stored for each floor in the door time memory 13 , while the traveling times of the elevator car between each floor and each other floor are stored in the traveling time memory 14 . denoted by 15 is an additional memory which is connected with the bus sb and in which are stored the times needed by a passenger at a floor for traversing the paths between the respectively actuated call registering and indicating device 8 and the shaft doors of the elevators . a comparator 16 , which is for example formed by the processor of the microcomputer system 5 , has inputs connected with the travelling time memory 14 and the additional memory 15 . the operating costs register r1 is connected through a switching device 17 in the form of a tri - state buffer with the comparison device 10 , wherein an activating lead of the tri - state buffer is connected to an output of the comparator 16 . the elevator shaft doors of the elevators a b , c and d of an elevator group shown by way of example in the fig3 are denoted by 18 for a particular floor . the shaft doors 18 can have the same spacings between adjacent pairs and the call registering and indicating devices can be located in the center between each two adjacent shaft doors . the empirically derived time which a passenger needs for the travel along a path between the call registering and indicating device 8 actuated by him and the adjacent one of the shaft doors 18 is denoted by &# 34 ; t &# 34 ;. in the arrangement shown in the example of fig3 a passenger would need a time of &# 34 ; 5t &# 34 ; to move to the indicated shaft door 18 upon allocation of the elevator d in response to the actuation of the call registering and indicating device 8 positioned between the elevators a and b . the additional memories 15 , associated with the elevators a , b . c and d as shown in the fig4 include a number of storage places corresponding to the number of call registering and indicating devices 8 provided on a floor . corresponding to the arrangement shown in the fig3 the additional memories 15 each have three storage places which are denoted in the sequence of the elevators by ab , bc and cd . the stored times entered in the fig4 result from the definition of the time &# 34 ; t &# 34 ; given in the description relating to fig3 wherein the time &# 34 ; 5t &# 34 ; mentioned by way of example is to be found in the storage place ab of the additional memory 15 associated with the elevator d . denoted by 20 in the fig5 are multiplexers which are associated with the elevators and the call registering and indicating devices 8 of a floor and which have a number of inputs corresponding to the number of call registering and indicating devices 8 located on a floor . the inputs of all of the multiplexers 20 associated with the same call registering and indicating device 8 are connected together . one input of each of the multiplexers 20 is connected with an output of an associated and gate 21 . inputs of the and gate 21 are connected to inverting outputs q of storage cells 22 of the associated call registering and indicating devices 8 . the multiplexers 20 are connected to the address buses ab of the associated microcomputer systems 5 and at an output are connected ( fig2 ) by way of the conductor l with the additional memory 15 of the associated microcomputer system 5 . the noninverting outputs q of the storage cells 22 are , as is known from the application ep - a 0 320 583 previously mentioned or european patent no . ep - b 0 246 395 , connected with inputs of multiplexers 23 associated with the respective call registering and indicating devices 8 for the interrogation of calls entered on a floor . the above described elevator group control operates as follows : after entry of a call , for example according to the data shown in the fig2 a call on the floor e10 for the floor e13 , a call identifying the entry floor is transferred into the first memory portion ram1 . 1 and a call identifying the target floor is transferred into the second memory portion ram1 . 2 of the floor call memories ram1 of all of the elevator cars . thereafter , the multiplexers 20 are interrogated for which it is assumed that the call from the floor e10 was entered by means of the call registering and indicating device 8 located between the elevators a and b . in this case , the output of the associated and gate 21 and thereby also the inputs of all of the multiplexers 20 associated with the actuated call registering and indicating device 8 become logic &# 34 ; 0 &# 34 ; ( fig5 ). upon the generation of the address associated with the respective input , the microprocessors of the microcomputer systems 5 interpret the signal &# 34 ; 0 &# 34 ; which is then carried on the conductors l as requiring that the content of the storage place ab of the additional memory 15 must be applied to the one input of the comparator 16 ( fig2 and 4 ). thereafter the associated travelling time is read from the travelling time memory 14 , in dependence on the car position contained in the car position register r2 and the address of the call entry floor e10 , and is applied to the other input of the comparator 16 . let it now be assumed that the travelling time of the car of the elevator d is less than the time &# 34 ; 5t &# 34 ; stored in the storage place ab of the additional memory 15 . in this case , the logic state at the output of the comparator 16 changes in such a manner that the switching device 17 is switched into a high resistance state and the operating costs register r1 is disconnected from the comparison device 10 . after the load values of the load memory 12 have been corrected in accordance with the newly entered call on the floor e10 , the operating costs for the entry and target floors of the new call are computed for all elevators , for which a formula is used for example which is disclosed in the previously identified application ep - a 0 356 731 . in this case , it is presumed that due to the possible new stops taking place at the entry and target floors not only the waiting times of the new passengers would be created , but also the waiting times of all traffic participants of already allocated calls of the elevator concerned would be increased . as already mentioned in the preceding , the computer takes door opening and closing times from the door time memory 13 , the number of the persons already situated in the car from the load memory 12 and the travelling times of the car from the instantaneous position to the entry or target floor from the travelling time memory 14 for the operating costs computation . immediately after the computation , the operating costs are transferred into the operating costs register r1 and are compared with the operating costs of the other elevators by means of the comparison device 10 , according to the method shown in the previously identified patent ep - b 0 050 304 , wherein the elevator d is excluded from the comparison as described in the preceding . let it now be assumed that the elevator a displays the lowest operating costs so that an allocation instruction is entered ( dashed arrows , fig2 ) for floor e10 in the first call allocation memory ram2 and for the floor e13 in the second call allocation memory ram3 . immediately after the allocation , the selected elevator a and its position are indicated in an indicating field of the call registering and indicating device 8 actuated by the passenger whereupon the passenger moves to the correspondingly identified shaft door 18 and arrives there before the car arrives . if the selector r3 , in continuation of an assumed upward travel of the car situated for example in the region of the floor e4 , switches over to the newly allocated floor e10 , then the stopping of the car is initiated on reaching the brake onset point according to the drive control described in the previously identified patent ep b 0 026 406 for example . in accordance with the provisions of the patent statutes the present invention has been described in what is considered to represent its preferred embodiment . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope . | 1 |
as shown in fig1 a , a system and method 100 according to our invention decomposes time series network traffic data arrival rate information 101 into multiple frequency bands . the frequency bands are used to identify low and high frequency components in the data arrival rate . an energy distribution in each frequency band is determined in order to analyze 1050 short and long term fluctuations in the network traffic . we use the output of the analysis to dynamically allocate 800 bandwidth for data streams transmitted by the network 102 . our unique energy distribution analysis enables better predictions of the bandwidth requirements than prior art techniques . our method is applicable to both aggregate and individual applications traffic . our method can be used to distribute an available bandwidth among multiple traffic data streams based on their frequency characteristics . more specifically , our invention can be deployed in weighted fair queuing ( wfq ) processes to adaptively update weight coefficients of each traffic class entering into the vfq process . our invention can be used in quality - of - service ( qos ) management blocks of network routers , switches , digital subscriber line access multiplexer ( dslam ), and the like . as shown in fig1 b , the system 100 according to our invention includes a clock 110 connected to a data counter 120 . the data counter receives the incoming network traffic ( data ) 101 . the network traffic is also presented to an output queue or buffer 105 . the output of the data counter 120 is connected to a shift register 130 of size m , for example eight . the shift register 130 is connected to a discrete wavelet transform unit ( dwt ) 200 , e . g ., a haar wavelet filter bank . specifically , we use a haar - 2 basis . an analyzer 140 processes the output of the dwt 200 . the output of the analyzer is connected to resource allocation mechanism ( ram ) 800 . the ram 800 can also receive optional feedback parameters , e . g ., buffer statistics 801 , from the buffer 105 and a minimum non - zero value x dc 132 from 130 . the output 809 from the ram 800 drives a dynamic bandwidth controller ( dbc ) 900 , which in turn , decides whether to start a renegotiation cycle with the network 102 based on the new prediction information and the comparison of previous and current variance and mean of the energy distribution in the sub - bands and sets a renegotiation flag . the dbc starts a renegotiation cycle with a network according to values of the renegotiation flag , e . g . renegotiate if the flag is one . if no renegotiation is decided , the dbc waits for the next prediction from the ram 800 . the dbc is also responsible for forwarding the buffered traffic onto the network 102 at the current negotiated data rates . โ n ๎ข ฮด ๎ข ( t - nt ) , during each time interval , the amount of data ( x n ) 121 that is received at qos management block is measured by in the data counter 120 . the measured data 121 can be bits , bytes , packets , cells , etc . as shown in fig7 for a thirty second mpeg - 4 video trace 401 where the x - axis 402 is the index of frames transmitted and the y - axis 400 is the frame sizes in bits . the amount of data received in a given fixed length time interval essentially gives the instantaneous data rate during the interval . the most recent m values of the measured data rate are buffered in the shift register 130 as an integer vector x k =[ x ( n โ m + 1 )ร( n โ m + 2 ) . . . x ( n )] 131 and also the minimum non - zero sample 132 of the integer vector 131 is determined . [ 0041 ] fig3 graphs data arrival rates 301 for consecutive time intervals where each vector x has n elements . in the vector 131 , n is a time instance , k is a time scale , and m is an integer , e . g ., eight samples . each element x ( i ) indicates the amount of data , e . g ., bytes , received in a time slot i . for two consecutive time instances , the arrival rate information can be expressed by their sum and their difference . the difference reveals sharp changes in the arrival rate . an average arrival rate vector including m consecutive time slots is x k + 1 = ยฝ ./[ x ( n โ m + 1 )+ x ( n โ m + 2 ) x ( n โ m + 3 )+ x ( n โ m + 4 ), . . . x ( n โ 1 )+ x ( n )] ( 1 ) difference of the arrivals of data between two consecutive time slots is denoted by a vector y k + 1 such that y k + 1 = ยฝ ./[ x ( n โ m + 1 )โ x ( n โ m + 2 ) x ( n โ m + 3 )โ x ( n โ m + 4 ), . . . x ( n โ 1 )โ x ( n )] ( 2 ) equations 1 and 2 can be rewritten in the general form x k + 1 ( i )= 0 . 5 ( x k ( 2 i โ 1 )+ x k ( 2 i )), and ( 3 ) y k + 1 ( n )= 0 . 5 ( y k ( 2 i โ 1 )โ y k ( 2 i )). ( 4 ) we are interested in the dynamic behavior of the traffic as manifested by differences between consecutive samples . the data measuring steps can produce zero and positive integer values . wavelet domain modeling of positive processes requires that a positive output is ensured . to guarantee that a process is positive , a sufficient and necessary condition is | y k , n ( i )|โฆ y k , n ( i ). the haar wavelet satisfies this constraint . therefore , we use the haar - 2 wavelet . however , any wavelet satisfying the above condition can be used in the dwt block 200 . therefore , as shown in fig2 we pass the buffered arrival rate vector x k , n 131 through a dyadic tree of scaling filters 210 and wavelet filters 220 , where each branch produces a low frequency component x k + 1 211 , and 212 , 213 respectively and a high frequency component x k + 1 221 of x k , n and further 222 and 223 . the output of each scaling filter 210 is down - sampled 230 by a factor of two . in other words , the output of each scaling vector 210 generates pair - wise average arrival rate vectors 211 , 212 and 213 , and the output of the each wavelet filter 220 generates pair - wise rate arrival differences 221 , 222 and 223 . the scaling and wavelet coefficient vectors of the haar wavelet are ฯ =[ 1 /{ square root }{ square root over ( 2 )} 1 /{ square root }{ square root over ( 2 )}] and ฯ =[ 1 /{ square root }{ square root over ( 2 )}โ 1 /{ square root }{ square root over ( 2 )}], respectively . we know that for โ n , k , all x k ( n )โง 0 . as stated above , wavelet domain modeling of positive processes requires the constraint that a positive output is ensured . to guarantee the constraint that the process is positive , the sufficient and necessary condition is | y k ( n )|โฆ x k ( n ). the provision of this constraint for the haar wavelet is seen by modifying equations 3 and 4 such that x k ( 2 i โ 1 )= 2 โ ยฝ ( x k + 1 ( i )+ y k + 1 ( i )), and ( 5 ) x k ( 2 i )= 2 โ ยฝ ( x k + 1 ( i )โ y k + 1 ( i )). ( 6 ) the haar wavelet coefficients of a stationary signal are identically distributed with e [ y k ( n )]= 0 for โ k . therefore , applying the discrete haar wavelet transform 200 on the measured arrival rate data 131 reveals irregularities and sharp changes in traffic behavior . having r as a m ร m wavelet transform matrix composed of parameters of vectors ฯ and ฯ , and x as the vector data with length m , the wavelet transform operation can be expressed as w = x . r , where w is the wavelet transform vector with size m . dwt block outputs vector w 600 energy of a stochastic process x at scale k can be determined from w 600 by e k = โ n = 2 k - 1 + 1 2 k ๎ข ๏ w _ ๎ข ( n ) ๏ 2 , k : scale index . ( 7 ) energy distribution in multi - resolution analysis provides information about the level of traffic burstiness and self - similarity . therefore , consideration of energy contents of a signal at different time scales in the dynamic bandwidth allocation method according to the invention has strong advantage over prior methods to prevent the impacts of traffic self - similarity . we define two moving windows : a โ data unit โ and a โ wavelet unit .โ a moving data unit 650 illustrated in fig6 b , covers eight most recent measured data arrival rate samples 131 to be analyzed . each window of samples x 650 overlaps a previous window as shown in fig6 b between two consecutive measurements . in fig6 a , our wavelet transformed data vector w 600 uses a window of eight samples , the same size as of โ the data unit โ so that our multi - resolution process can respond to sudden changes in data rates . the area covered by this window is denoted as a โ wavelet unit ,โ wu . we use the wavelet unit w = rx =[ w 1 w 2 w 3 w 4 w 5 w 6 w 7 w 8 ] the analyzer 140 takes the vector w 600 produced by the dwt 200 as input , and then computes and forwards the energy information 141 in each sub - band to the ram 800 . energy of the stochastic process x at scale k in the dyadic tree is determined by equation 7 , and yields energy vector e n [ e 1 , n , [ e 2 , n , . . . , [ e k , n ] 141 . as shown in fig5 energy 501 in each scale 510 - 513 is found by applying equation 7 to the wavelet transform unit vector w 600 . the x - axis 502 is in units of radians . scale 513 reveals the highest frequency detail within the original traffic data . the detail is expressed by four coefficients . the detail in scale index 512 is assigned to two coefficients . the first two element 511 and 510 in vector w 600 stands are assigned one element of coarser scales . the sum of the energies in each frequency band is bounded by the total energy of original data x . strong empirical evidence contends that the wavelet coefficients from 1 / f processes are weakly correlated both along and across the scales . abry et al ., in โ wavelet analysis of long range dependent traffic ,โ ieee trans . inform . theory , v : 44 , pp . 2 - 15 , jan . 1998 , and sahinoglu et al ., in โ self - similarity and its effects on network performance ,โ ieee comm . magazine , january 1999 , describe that for the haar wavelet , the variance progression of the wavelet transform of fractional gaussian noise satisfies var ( w k ( n ))โ 2 โ k ( 2h โ 1 ) . the ratio of the energies in two subsequent scales can then be related to the hurst parameter h as ฮณ = var ๎ข ( w k ๎ข ( n ) ) var ๎ข ( w k + 1 ๎ข ( n ) ) = 2 2 ๎ข h - 1 , see r . riedi , m . s . crouse , v . j . ribeiro , r . g . baraniuk , โ a multifractal wavelet model with application to network traffic ,โ ieee trans . on information theory , v : 45 , n : 3 , april 1999 . the stability of the arrival rate is proportionally related to the increase in this ratio . we define and use the following properties of frequency and energy distribution in the ram 800 . if for โ i , j , x ( i )= x ( j ) where 0 & lt ; i , j & lt ; n , i โ j and ijฮตz + , the energy content in each high frequency band becomes zero , and traffic is considered to be constant bit rate ( cbr ). in this case the entire energy of the input data is present within the lowest frequency band . the bandwidth to allocate to this type of traffic must be equal to x ( i ). if the elements of x show an increasing characteristic over time such that x ( n )& gt ; x ( n โ 1 ) n = 2 , 3 . . . , n , then the energy distribution in each frequency band increases from finest to a coarser scale , being the lowest in the highest frequency region , e [ e j + 1 ]& gt ; e [ e j ]. the ram unit increases the bandwidth demand for the next time slot and sends this request to the dbc 900 . a decrease in the coarse scale energy while the fine scale energies are stable is an indicator of a linear decrease in traffic volume . less bandwidth than that in the previous time slot is needed . a request to lower the bandwidth allocation is sent to dbc from ram . assume that v i stands for the variance of the energies among k scales in time slot i , m i stands for the mean value of energy contents , and u i stands for the utilization . v i + 1 & gt ; v i and m i + l & lt ; m i u i + 1 & lt ; u i this is representative of possibly approaching โ off โ interval , or departing flows in case of aggregate traffic . the request to decrease the bandwidth allocation is sent to the dbc . this is representative of added flows to the aggregate traffic or an approaching โ on โ interval . the request to increase the bandwidth allocation is sent to the dbc . this is representative of traffic is getting smoother . in this case no bandwidth renegotiation is required . this is representative of traffic getting smoother with increased utilization therefore , the request for increase in bandwidth is sent to the dbc after receiving a request for bandwidth renegotiation and the amount of bandwidth to allocate in the next time slot , the dbc 900 uses a threshold table that comprises the previous energy statistics and decides whether to grant the request , or not . [ 0082 ] fig8 shows the ram 800 that receives the energy vector 141 from the analyzer . the ram also receives external feedback parameters ( buffer statistics ) 801 , e . g ., momentary buffer size , packet / cell loss rate , and the minimum non - zero value x dc 132 of the integer vector 131 produced by the shift register 130 . [ 0083 ] fig9 shows the dynamic bandwidth controller unit 900 which takes the variance and mean of the energy distribution in previous measure 902 and the current measure 903 , and the new bandwidth prediction 809 from ram 800 and decides if to start a resource renegotiation cycle with the network . the system first filters out the minimum non - zero dc component x dc 132 in traffic measurements x 131 . effectively , the x dc 132 is a lower bound for the bandwidth allocation in a next time slot and is one of the contributing components in each bandwidth prediction . the signal 131 at the output of the m shift register 130 includes low and high frequency components . the signal 131 is fed into a filter bank in which high pass filters 220 are composed of haar wavelet coefficients , and low pass filters 210 are composed of haar wavelet scaling coefficients . the signal 131 is decomposed into three high frequency sub - bands 511 - 513 , a coarse sub - band 510 , as described above . energies in each of the high frequency sub - band 511 - 513 are used as a representative of the traffic volume within that frequency band . the traffic volume that generates the maximum energy e max 804 is computed . because underestimation may cause the buffer congestion , while overestimation can only result in underutilization of the available bandwidth , we take the contribution of maximum energy content in each adaptation interval for the bandwidth allocation . the square root 802 of e max 804 returns a signal that would have the energy amount e max 804 . this equivalent signal , the square root of e max is added to 132 by 803 as the second component to the new bandwidth prediction . the new prediction is also compensated with the present queue size 801 to flush the queue contents to prevent building up delays . finally , the new prediction 809 takes the form in eq . 8 bw ( n + 1 )= x dc ( n )+ max ( e n ( i ))+ queue_size ( n ) ( 8 ) we can also modify the ram 600 so that the buffer size information 801 is not needed for bandwidth renegotiation . this can be done without degrading the queuing performance and without increasing the capacity underutilization . in a first modification , the ram 600 method compensates the new bandwidth allocation by including a component with energy equivalent to the superposition of all the energies bw ๎ข ( n + 1 ) = x d ๎ข ๎ข c ๎ข ( n ) + โ i - 1 k ๎ข e _ n ๎ข ( i ) . here , the value k is the number of high frequency sub - bands into which the data are decomposed . in a second modification , the bandwidth compensation is provided as the sum of k components , each of which is representing a bandwidth contribution such that the energy of each component is the same as the energy in one of the sub - bands . bw ๎ข ( n + 1 ) = x d ๎ข ๎ข c ๎ข ( n ) + โ i = 1 k ๎ข e _ n ๎ข ( i ) . bw ๎ข ( n + 1 ) = w _ n ๎ข ( 1 ) + โ i = 1 k ๎ข e _ n ๎ข ( i ) , w _ n ๎ข ( 1 ) = 1 m ๎ข โ i = 1 m ๎ข x _ k , n ๎ข ( i ) , that is the average of a data unit x k , n 131 , or in other words the first element in w 600 . bw ๎ข ( n + 1 ) = w _ n ๎ข ( 1 ) + โ i = 1 k ๎ข e _ n ๎ข ( i ) . the condition w n ( 1 )& gt ; x dc , n in time slot n is always true . therefore , it is clear that the third and fourth modifications allocate more bandwidth in each renegotiation than the first and second modifications . [ 0098 ] fig1 compares the queuing performances , of the wavelet - energy method according to the invention with four traditonal approaches . [ 0099 ] fig1 compares the queuing performances 1101 - 1104 , in a top to bottom order , of the four modified wavelet - energy methods described above where the x - axis 1105 is the index of a time slot , and the y - axis 1100 is the average queue size . [ 0100 ] fig1 compares the trade between average utilization 1201 and average queue size 1202 for the four modified wavelet - energy ram methods where the x - axis 1103 is the index of a time slot , and the y - axis to the left 1200 is average utilization and y - axis to the right is average queue size . predicting bandwidth requirements using the wavelet - energy method as described above yields better performs than prior art techniques . the invention also enables smaller queue sizes at a minimal expense of increased bandwidth utilization . this invention is described using specific terms and examples . it is to be understood that various other adaptations and modifications may be made within the spirit and scope of the invention . therefore , it is the object of the appended claims to cover all such variations and modifications as come within the true spirit and scope of the invention . | 7 |
referring to fig1 , a communications system 1 for delivering content to a mobile terminal 2 is shown . the communications system 1 includes sources 3 1 , 3 2 , 3 3 , 3 4 of content , for example in the form of video , audio and data files , and content servers 4 1 , 4 2 for retrieving content and , optionally , re - formatting , storing , aggregating and / or scheduling the content . the content servers 4 1 , 4 2 may be controlled by respective entities 5 1 , 5 2 referred to as โ content providers โ. however , the content servers 4 1 , 4 2 may be controlled by the same entity . the communications system 1 further includes a datacast service system 6 . the datacast service system 6 receives content from the content servers 4 1 , 4 2 via a network 7 , such as the internet , and performs a number of functions including receiving content , providing service sets and service bundles , arranging service sets data in carousels , generating service information ( si ) data , encapsulating and multiplexing data . in one embodiment of the invention a service set can be used for combining same kind of services of one service or content provider together . one service may belong to a number of service sets . in another embodiment of the invention a number of services are bundled into a service bundle , which may be a sellable entity . the datacast service system 6 may also re - format , store , aggregate and / or schedule content the communications system 1 also includes a broadcast network 8 , for example in the form of a terrestrial digital video broadcasting ( dvb - t ) network , for providing a transmission channel from the datacast service system 6 to the mobile terminal 2 . other broadcast networks may be used including other types of dvb networks , such as a cable dvb network or satellite dvb network , a digital audio broadcasting ( dab ) network or an advance television system committee atsc ) network or a terrestrial integrated services digital broadcasting - terrestrial ( isdb - t ) network . the datacast service system 6 and broadcast network 8 are controlled by an entity 9 referred to as a โ datacast operator โ. however , the broadcast network 8 may also be used for other purposes , such as transmission of digital television , and may be controlled by another , different operator ( not shown ). under those circumstances , the datacast operator 9 controls the datacast service system 6 but not the broadcast network 8 . a public land mobile network ( plmn ) 10 , for example in the form of a gsm system , may provide a return channel from the mobile terminal 2 to the internet 7 . other plmn networks may be used , such as other types of second - generation ( 2g ) network such as digital advanced mobile phone system ( d - amps ) network or personal digital communication system ( pdc ) network , a โ two - and - a - half โ generation network , such as general packet radio service ( gprs ) network and enhanced data rates for gsm evolution ( edge ), or a third - generation network ( 3g ), such as universal mobile telephone system ( umts ) network based on wideband code division multiple access ( w - cdma ), or a time division synchronous code division multiple access ( td - scdma ) network . a local area network ( lan ) 11 , for example using ieee 802 . 11x , may also be provided for obtaining data from local sources ( not shown ) or from the internet 7 . other lans or personal area networks ( pans ) may be used such as bluetooth โข. referring to fig2 , first and second geographical regions 12 , 13 are shown . one or both of the regions 12 , 13 may be a country , a part of a country , city or town or a district of a city or town . for example , the first region 12 may be a city , while the second region 13 may be a countryside surrounding the city . the first region 12 is served by the first datacast service system 6 via the broadcast network 8 . the broadcast network 8 comprises a core network 14 and one or more transmitters 15 1 , 15 2 , 15 3 which transmit in respective cells 16 1 , 16 2 , 16 3 . gap filler transmitters ( not shown ) may also be provided . it will be appreciated that alternative configurations of the broadcast network 8 may be used . for example , the core network need not be provided . the broadcast network 8 is in this example arranged to transmit as a single frequency network ( sfn ) using 16 quadrature amplitude modulation ( qam ) at frequency lying in the range 470 to 862 mhz . the first region 12 is also served by plmn 10 ( fig1 ) in a conventional manner . the second region 13 is served by second datacast service system 17 via another broadcast network 18 comprising a core network 19 and one or more transmitters 20 1 . alternative configurations may be used as with the first datacast service system . a user is initially located in the second region 13 and moves to the first region 12 , taking their mobile terminal 2 with them . in the first region 12 , the mobile terminal 2 receives a signal 21 transmitted from a transmitter 15 3 carrying a number of services . as explained earlier , it is desirable that the datacast service system 6 is easily identifiable and that information about services is readily available . therefore , the datacast service system 6 provides its own information service which supplements an electronic service guide ( esg ). the information service is specific to the area served by the datacast service system 6 . thus , when the mobile terminal 2 moves to the first region 12 , local information can be provided quickly . referring to fig3 , a schematic diagram of an embodiment of a datacast service system 6 according to the present invention is shown . in this embodiment of the invention , the datacast service system 6 comprises an interface 22 for receiving service data 23 and , optionally , relevant electronic service guide ( esg ) data 24 , both in the form of ip data , from content servers 4 1 , 4 2 ( fig1 ) and storage 25 for optionally storing at least part of the service data 23 and esg data 24 . the system 6 also comprises a controller 26 , memory 27 storing a computer program 28 for controlling the datacast system 6 shown in fig3 , a service information ( si ) table generator 29 , a carousel generator 30 , a multiprotocol encapsulation ( mpe ) encapsulator 31 and a multiplexer 32 . the controller 26 includes an esg data generator 33 for generating esg data 34 , which together with esg data 24 , is used for describing the scheduling and timing of content . the controller 26 also includes a main page generator 35 for producing a main page 36 for the datacast operator , herein referred to as the โ dco main page โ. the controller 26 also includes a hierarchy page generator 37 for generating a hierarchy page 38 which will be described in more detail later . the controller 26 may provide main pages 39 1 , 39 2 , 39 3 for a number of services . the service main pages 39 1 , 39 2 , 39 3 may be provided by the content servers 4 1 , 4 2 ( fig1 ). however , the controller 26 may modify the service main pages 39 1 , 39 2 , 39 3 or generate the service main pages 39 1 , 39 2 , 39 3 from the service data 22 . the dco main page 36 is selectively provided by the datacast operator 9 ( fig3 ) and may include data for identifying the datacast operator , data for advertising and / or data for informing the user , for example announcing new , upcoming or updated services , informing the user of popular services or providing recommendations . the carousel generator 30 receives data relating to the services such as service data . 22 and esg data 24 , 34 . it may generate a number of carousels 40 , 41 , 42 , 43 , 44 including an alert carousel 40 for notifying the mobile terminal 2 ( fig1 ) e . g . of changes in service , a security association carousel 41 for encryption keys for encrypted content , a session announcement carousel 42 for announcing sessions , a main page carousel 43 for providing main pages for the datacast operator and the services and a hierarchy carousel 44 for providing data relating to the hierarchy of available services . carousels 40 , 41 , 42 , 43 , 44 repeatedly transmit data usually in a cyclically manner . referring to fig4 , the main page carousel 43 may comprise the dco main page 36 in the form of one or more files 47 1 , 47 2 , 47 3 and service main pages 39 1 , 39 2 , 39 3 each in the form of one or more files 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 . the number of files 47 1 , 47 2 , 47 3 comprised in the dco main page 36 need not be the same as the number of files 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 comprised in any other service main page 39 1 , 39 2 , 39 3 . furthermore , the number of files 48 11 , 48 12 , 48 13 comprised in any service main page , for example the first service main page 39 1 , need not be the same as the number of files 48 21 , 48 22 , 48 23 comprised in another service main page , for instance the second service main page 39 2 . the files 47 1 , 47 2 , 47 3 , 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 are in one embodiment of the invention in the form of hypertext mark - up language ( html ) protocol files . however , other file formats may be used , such as extensible mark - up language ( xml ) or session description protocol ( sdp ). reference is made to โ session description protocol โ by m . handley & amp ; v . jacobson , rfc 2327 , ietf , april 1998 . referring to fig5 , a hierarchy file carousel 44 comprises a hierarchy file 38 in the form of one or more sub - files 49 1 , 49 2 , 49 3 . in one embodiment of the invention the hierarchy file 38 need not be configured or transmitted in the form of a carousel 38 . referring to fig6 , the esg data 24 , 34 includes service description data 50 in one embodiment of the invention . referring to fig7 , the hierarchy file 38 comprises sets 51 1 , 51 2 , 51 3 , 51 4 , 51 5 of carousel information . each carousel 40 , 41 , 42 , 43 , 44 ( fig3 ) has a respective set 51 1 , 51 2 , 51 3 , 51 4 , 51 5 of carousel information comprising an identifier 52 1 , 52 2 , 52 3 , 52 4 , 52 5 for identifying the carousel type , a list 53 1 , 53 2 , 53 3 , 53 4 , 53 5 of ip addresses and port numbers for sets of pages within a carousel , an optional list 54 1 , 54 2 , 54 3 , 54 4 , 54 5 of times for indicating when carousel information will expire and optional list 55 1 , 55 2 , 55 3 , 55 4 , 55 5 of times for indicating frequency of updates . the session , main page and hierarchy carousels 42 , 43 , 44 include respective lists 54 2 , 54 4 , 54 5 of expiry times . the main page and hierarchy carousels 43 , 44 may include respective lists 55 4 , 55 5 of update times . thus , the main page carousel 43 ( fig3 ) has a set 51 4 of carousel information including an identifier 52 4 for indicating that the carousel is the main page carousel , a list 53 4 of ip addresses and port numbers for the dco main page 36 ( fig4 ) and the service main pages 39 1 , 39 2 , 39 3 ( fig4 ), a list 54 4 of expiry times and a list 55 4 of update intervals . the ip addresses in lists 53 1 , 53 2 , 53 3 , 53 4 , 53 5 conform in one embodiment of the invention to ipv6 protocols and reference is made to โ internet protocol , version 6 ( ipv6 ) specification โ, by s . deering and r . hindern , rfc 2460 , ietf , december 1998 and other related ipv6 rfcs . however , other ip protocols may be used . the expiry times in lists 54 1 , 54 2 , 54 3 , 54 4 , 54 3 conform in one embodiment of the invention to network time protocol ( ntp ) and reference is made to โ network time protocol ( version 3 ) specification , implementation โ by d . mills , rfc 1305 , ietf , march 1992 . however , other times may be used . the expiry times in lists 54 1 , 54 2 , 54 3 , 54 4 , 54 5 may differ from one another . the update intervals 55 1 , 55 2 , 55 3 , 55 4 , 55 5 may be expressed in seconds . however , other units of time such as milliseconds may be used in various embodiments of the invention . referring to fig8 , an exemplary directory structure 56 of the main pages 36 , 39 1 , 39 2 , 39 3 is shown . in this example the dco main page 36 includes the service main pages 39 1 , 39 2 , 39 3 . as will be explained in more detail later , in one embodiment of the invention the ip address of the hierarchy file 38 is signalled through si , in particular through the nit 45 ( fig3 ) and the int 46 ( fig3 ). referring to fig9 , in one embodiment of the invention the datacast service system 6 transmits data in accordance with a number of transport protocols and a protocol stack 57 is shown . in one embodiment of the invention in the network layer ( layer 3 ), ipv6 protocols 58 are used and reference is made to โ internet protocol , version 6 ( ipv6 ) specification โ ibid . ip security ( ipsec ) is not necessarily used when transmitting main page files 47 1 , 47 2 , 47 3 , 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 . further in one embodiment of the invention in the transport layer ( layer 4 ), usergram data protocol ( udp ) 59 is used and reference is made to โ user datagram protocol โ, by j . postel , rfc 768 , ietf , august 1980 . in one embodiment of the invention real - time transport protocol ( rtp ) 60 1 may be used to transport files . however , asynchronous layered coding ( alc ) protocol 60 2 may be used in other embodiments of the invention . reference is made to โ a transport protocol for real - time applications โ by h . schulzrinne et al ., rfc 1889 , ietf , january 1996 and โ asynchronous layered coding protocol โ by m . luby et al ., rfc 3450 , ietf , december 2002 . on the rtp / alc layer 60 , a filecast payload format may be used which specifies , in detail , the use of rtp / alc protocols . a number of different file formats may be used . for example , xml 62 1 may be used for hierarchy files 49 1 , 49 2 , 49 3 ( fig5 ), security association files ( not shown ) and session announcement files ( not shown ). sdp 62 2 may be used for technical session information that is not directly shown to the user . in various embodiments of the invention html 62 3 may be used for main page files 47 1 , 47 2 , 47 3 , 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 . if more than one language is supported , then the main pages can be sent in files for different languages . the language used is indicated e . g . using language codes . reference is made to โ tags for the identification of languages โ by h . alvestrand , rfc 1766 , ietf , march 1995 . referring again to fig3 , an mpe encapsulator 31 encapsulates data , such as data from carousels 40 , 41 , 42 , 43 , 44 , into sections ( not shown ) compliant with dsm - cc section format for private data as specified section 7 โ multiprotocol encapsulation โ in โ digital video broadcasting ( dvb ); dvb specification for data broadcasting โ, etsi en 301 192 , v1 . 3 . 1 ( 2003 ). however , some data may not be so encapsulated . for example , the nit 45 may be segmented into network information sections , for example as specified in section 5 โ service information ( si ) tables โ in โ digital video broadcasting ( dvb ); specification for service information ( si ) in dvb systems โ, etsi en 300 468 , v1 . 5 . 1 ( 2003 ). referring also to fig1 , the multiplexer 32 places the sections ( not shown ) into mpeg - 2 transport stream ( ts ) packets 63 , according to international organisation for standards / international electrotechnical commission ( iso / iec ) standard 13818 - 1 โ information technology โ generic coding of moving pictures and associated audio information : systems โ and outputs a transport stream 64 . the transport stream 64 is provided to the broadcast network 8 ( fig1 ) in which it may be multiplexed with other streams ( not shown ), then modulated and broadcast . as mentioned earlier , the ip address of the hierarchy file 38 may be signalled through si , in particular through the nit 45 ( fig3 ) and the int 46 ( fig3 ). referring to an example illustrated in fig1 , the nit 45 includes first and second descriptor loops 65 , 66 in which a plurality of descriptors ( not shown ) for , inter alia , specifying data values and identifying other parts of the transport stream , may be inserted . a linkage descriptor 67 can be used to point to other parts of the transport stream and thus obtain further data or access a service . to identify itself as such , the linkage descriptor 67 includes a descriptor tag 68 containing a predetermined value , e . g . 0 ร 0b . the linkage descriptor 67 also includes a transport stream id 69 and an original network id 70 to identify uniquely a transport stream , in this case carrying the int 46 . the transport stream 54 ( fig1 ) may carry a plurality of sets of ip streams , a set of ip streams being known as an โ ip platform โ. each ip platform can be identified by a platform id 71 and a platform name 72 which describes the platform and can be used by the mobile terminal 2 to select a platform . reference is made to section 7 . 4 โ network ( si ) signalling โ in โ digital video broadcasting ( dvb ); dvb specification for data broadcasting โ, etsi en 301 192 ibid . and in section 6 . 2 . 17 โ linkage descriptor โ in โ digital video broadcasting ( dvb ); specification for service information ( si ) in dvb systems โ etsi en 300 468 ibid . to identify itself as such , the int 46 includes a table id 73 containing a predetermined value , such as 0 ร 4c . the int 46 includes a platform id 74 and may include one or more target ip address descriptors 75 , each including a target ip address 76 . the ip address on which the hierarchy file 38 ( fig6 ) is transmitted is specified in target ip address 70 . referring to fig1 , a process performed by the datacast service system 6 in one embodiment of the invention is shown in the form of a flow diagram . referring also to fig3 , in one exemplary embodiment of the invention the dco main page generator 35 generates a dco main page 36 and the hierarchy page generator 37 generates a hierarchy page 38 ( step s 1 ). this may be done periodically , for example every 10 or 100 seconds . additionally or alternatively , the dco main page generator 35 may generate a dco main page 36 when any one of a number of predefined events occurs , such as a change in service , or any one of a number of predefined conditions , such as when a number of consumers exceeds a given number , are satisfied . additionally or alternatively , the dco main page generator 35 may generate a dco main page 36 as - and - when directed to do so by the dco operator 9 . the controller 26 also may provide service main pages 39 1 , 39 2 , 39 3 ( step s 2 ). the carousel generator 30 receives the dco main page 32 ( fig4 ), the service main pages 33 1 , 33 2 , 33 3 and the hierarchy page 38 and generates the main page carousel 43 and the hierarchy file carousel 44 ( step s 3 ). generation of the main page carousel 43 and the hierarchy file carousel 44 includes assigning respective ip addresses and port numbers to the dco main page 36 ( fig4 ) and the service main pages 39 1 , 39 2 , 39 3 ( fig4 ), and to the hierarchy file 38 ( fig6 ). the ip address and port numbers assigned to the dco main page 36 ( fig4 ) and the service main pages 39 1 , 39 2 , 39 3 ( fig4 ), as well as ip address and port numbers assigned to other carousels , are included in the hierarchy file 38 ( fig6 ). the ip address and port number assigned to the hierarchy file 38 ( fig6 ) are supplied to the table generator 29 for inclusion in the int 46 . the carousels 40 , 41 , 42 , 43 , 44 are local , i . e . specific to the network area . in other words , each network area has its own hierarchy , main page , security association , session announcement and alert carousels . thus , the hierarchy file 38 ( fig6 ) has a different ip address in each network area . the ip addresses may be assigned on an ad - hoc basis . alternatively , the ip addresses may be pre - assigned . the nit 45 and int 46 are prepared and cyclically transmitted ( step s 4 ). the main page and hierarchy file carousels 43 , 44 are transmitted ( step s 5 ). referring to fig1 , the mobile terminal 2 in one embodiment of the invention is in the form of a mobile telephone handset with a multimedia capability . the mobile terminal 2 includes first and second antennae 77 1 , 77 2 , a receiver 78 , and a transceiver 78 2 . in this example , the first antenna 77 , and receiver 78 , are used to receive signals from the broadcast network 8 ( fig1 ). the second antenna 77 2 and transceiver 78 2 are used to transmit and receive signals to and from the plmn 10 ( fig1 ). the receiver and transceiver 78 1 , 78 2 each include respective r . f . signal processing circuits ( not shown ) for amplifying and demodulating received signals and respective processors ( not shown ) for channel decoding and demultiplexing . the mobile terminal 2 also includes a controller 79 , a user interface 80 , memory 81 , storage 82 a smart card reader 83 , smart card 84 received in the smart card reader 83 , a coder / decoder ( codec ) 85 , a speaker 86 with corresponding amplifier 87 and a microphone 88 with a corresponding pre - amplifier 89 . the user interface 80 comprises a display 90 and a keypad 91 . the display 90 is adapted for displaying images and video by , for instance , being larger and / or having greater resolution than a display of conventional mobile telephone and being capable of colour images . the mobile terminal 2 also includes a battery 92 . a transceiver 93 may optionally be provided for transmitting and receiving signals to and from the lan 11 ( fig1 ). the transceiver 93 may be a wireless card compliant to ieee 802 . 11x or bluetooth โข specifications . the controller 79 manages operation of the mobile terminal 2 under the direction of computer software 94 stored in memory 81 . for example , the controller 79 provides an output for the display 90 and receives inputs from the keypad 91 . the mobile terminal 2 may be modified by providing a single receiver adapted to receive signals from the broadcast network 8 ( fig1 ) and the plmn 10 ( fig1 ) and a transmitter adapted to transmit signals to the plmn 10 ( fig1 ). alternatively , a single transceiver for both communications networks 8 , 10 may be provided . when the mobile terminal 2 is switched on and / or if the mobile terminal 2 moves from one region 13 ( fig1 ) to another region 12 ( fig2 ) served by different datacast operators 6 , 17 ( fig2 ) or served by the same datacast operator and having at least partly different services available , then the mobile terminal 2 may not have up - to - date โ or even any โ electronic service guide ( esg ) information . the mobile terminal 2 acquires esg data 24 , 25 ( fig3 ), which includes nit 45 , int 46 , main pages 47 1 , 47 2 , 47 3 , 48 11 , 48 12 , 48 13 , 48 21 , 48 22 , 48 23 , 48 31 , 48 32 , 48 33 ( fig4 ) and service description data 50 ( fig6 ) using information included in the hierarchy file 38 ( fig5 ) and the dco main page 36 ( fig3 ). more detailed information may also be acquired , on request , using information included in the esg data 24 , 25 ( fig3 ). referring to fig1 and 14 illustrating one embodiment of the invention , a process performed by the mobile terminal 2 , for example when it is switched or moves from one region 13 ( fig1 ) to another region 12 ( fig2 ), is shown in the form of a flow diagram . the controller 79 instructs the receiver 78 1 to locate a network , in this case the broadcast network 8 ( fig1 ) ( step s 6 ). this may be achieved by scanning a part of the radio frequency spectrum until signal 21 ( fig2 ) is found . alternatively , the controller 79 may select one or one or more pre - defined or user inputted network frequencies . then again , the user may instruct the controller 79 to find a given network . in this exemplary embodiment of the invention the controller 79 locates , downloads , parses and stores the nit 45 , then locates , downloads , parses and stores the int 46 ( step s 7 ). the controller 79 obtains the ip address and port number of the hierarchy file 38 ( step s 8 ). this may comprise determining whether any ip address within the hierarchy file 38 falls within a predefined esg ip address range and returning any address which falls within that range . the controller 79 joins the address , downloads , parses and stores the hierarchy file 38 in storage 82 ( step s 9 ). from the hierarchy file 38 , the controller 79 can obtain respective ip addresses and port numbers for the carousels 40 , 41 , 42 , 43 , 44 . in particular , the controller 79 may obtain the ip address and port number for the main pages 36 , 39 1 , 39 2 , 39 3 ( step s 10 ), may join the addresses and download one or more of the main pages 36 , 39 1 , 39 2 , 39 3 ( step s 11 ). furthermore , the controller 79 can obtain the ip address and port number for session announcement carousel 42 ( step s 12 ), join the address and download the session description data 50 ( step s 13 ). the session description data 50 may include universal resource locators ( urls ) for obtaining further , more detailed information ( not shown ). at the request of the user , the controller 79 may retrieve more detailed information ( not shown ) via the plmn 10 ( fig1 ) or lan 11 ( fig1 ). referring to fig1 , 15 and 16 , a process performed by the mobile terminal 2 in one embodiment of the invention , for example once it obtained esg information , is shown in the form of a flow diagram . the controller 79 may only listen to announcements , such as hierarchy file 38 , when it is time for an update . based upon the expiry time 54 5 ( fig7 ), the controller 79 determines whether it is time to update the hierarchy file 38 ( step s 15 ). if it is time for an update , the controller 79 downloads a new hierarchy file 38 โฒ ( step s 16 ). the currently stored hierarchy file 38 and the new hierarchy file 38 โฒ each have values 95 , 95 โฒ indicating when they were last modified . the controller 79 compares the modification time 95 โฒ of the new hierarchy file 38 โฒ with the modification time 95 of the currently - stored hierarchy file 38 ( step s 17 ). if the modification time 95 โฒ of the new hierarchy file 38 โฒ is later than the modification time 95 of the currently - stored hierarchy file 38 , in other words the new hierarchy file 38 โฒ is indeed newer than the currently - stored hierarchy file 38 , then the new hierarchy file 38 โฒ is stored in storage 82 ( step s 18 ). if not , the expiry time 54 5 ( fig7 ) is simply updated ( step s 19 ). the controller 79 may also check expiry times 54 4 for the main page carousel 43 . however , the update interval 55 4 ( fig7 ) for the main page carousel 43 may be shorter than the update interval 55 5 ( fig7 ) for the hierarchy file carousel 44 . therefore , the controller 79 may calculate expected expiry times for the main page carousel 43 using the update interval 55 4 , thereby avoiding the need to check the hierarchy file 38 . referring to fig1 , a first view of a dco main page display 96 as displayed by the mobile terminal 2 in display 90 is shown in one embodiment of the invention . the dco main page display 96 is the first page which is presented to the user when the datacast service system 6 ( fig1 ) is accessed and can be used to view the esg . the dco main page display 96 can be quickly presented because the dco main page 36 ( fig3 ) is used as a default starting point and presents the most relevant information to the user . the dco main page display 96 may include a number of fields including an operator identity field 97 , terminal status area 98 , an active area 99 , selection buttons 100 , time / date field 101 and further soft key selection buttons 102 . the operator identify field 97 may include the name of the datacast operator 9 ( fig1 ) and a logo . the terminal status area 98 may include information such as network connection status , battery level and incoming call alert . the information may be presented in the form of icons , animated icons or text . some of the fields may display data and information which has been received from the datacast service system 6 ( fig1 ). some of the fields may display data and information which has been stored in the storage 82 ( fig1 ) and which originates from the datacast service system 6 ( fig1 ), the user , the terminal 2 , another source , for example via plmn 10 ( fig1 ) or a combination of these . the selection buttons 100 may include a button 100 1 for presenting a viewing history , a button 100 2 for displaying programs which are currently running , a button 100 3 for displaying available channels and a button 100 4 for switching to a viewer 105 ( fig1 ) which fills substantially all or most of the display 90 . the dco main page display 96 is updated to reflect changes in esg , service popularity etc . it can also be used for informing users of upcoming events , changes in services or service availability . the dco main page display 96 may also be used for advertising purposes , such as displaying trailers . in fig1 , the active area 99 shows a list 103 of available channels . referring to fig1 , a second view of the dco main page display 96 is shown in which the active area 99 shows a list 104 of programs currently running . the selection buttons 100 may include a button 100 5 for entering an options menu , a button 100 6 for reverting back to the first view shown in fig1 and a button 100 7 for obtaining further details . referring to fig1 , a viewer 105 is shown . the viewer 105 includes an active area 106 and a button 107 for reverting to the dco main page display 96 . as mentioned earlier , the mobile terminal 2 can be used not only to obtain and render content obtained from the broadcast network 8 ( fig1 ), but also content and / or data obtained from the plmn 10 ( fig1 ). referring to fig2 , a process performed by the mobile terminal 2 in one embodiment of the invention is shown in the form of a flow diagram . referring also to fig1 and 13 , the controller 79 retrieves at least a part of the service data 23 from the datacast service system 6 via the broadcast network 8 ( step s 20 ). additionally , the controller 79 retrieves data ( not shown ) from a source ( not shown ) via the plmn 10 ( step s 21 ). the processor 79 displays service data 23 in the display 90 , for example in the dco main page display 96 ( step s 22 ) and also displays data obtained from the plmn 10 in the display 90 . it will be appreciated that many modifications may be made to the embodiments hereinbefore described . for example , the mobile terminal 2 may take the form of a personal digital assistant ( pda ). furthermore , a fixed or semi - fixed terminal may be used , for example in the form of a set - top box or personal computer . | 7 |
it will be appreciated that the invention may be implemented in a variety of ways for a range of different radios and batteries . the embodiments described here are given by way of example only . fig1 shows a battery charger for the first embodiment of a hand portable radio , having a cradle formed by a lower portion 10 and an upper portion 11 . these portions are typically made from moulded plastic and fastened together by screws , although a range of options might be considered . the upper portion includes a recess 12 with a rim 13 , which receives the base of the radio , or the battery alone , and a rear support 14 which contains all or part of a lock and release mechanism for a rear part of the radio or battery . the lower portion forms a shell around part of the upper portion . fig2 gives an exploded view of the cradle , showing a locking actuator 20 , a locking release actuator 21 , and locking latch 22 . in this example , the locking actuator and latch are in sliding contact with the release actuator which is in turn mounted in the upper portion of the cradle . a pair of spring loaded locking pins 23 are mounted in the rim 13 . these components form a lock and release mechanism which holds the radio or battery securely in the cradle . the components are typically made from plastic and may take a variety of shapes in other embodiments . fig3 a , b , c and corresponding fig4 a , b , c indicate how the lock and release mechanism operates in relation to a complete radio 50 including battery 51 . fig5 a , b indicate how the lock and release mechanism operates in relation to the battery alone . the locking actuator 20 has an approximate l shape with a single leg 30 , and sits in a vertical orientation within the cradle , biased upwards by a spring 31 . a foot 32 on the lower end of the leg lies in the bottom of the upper portion 11 and extends into the recess 12 . an aperture 33 towards the upper end of the leg is guided by an internal part on the upper portion 11 . a shoulder 34 on the upper end of the leg is shaped to engage the locking latch 22 . the release actuator 21 has an approximately square o shape with a central aperture 35 , and sits in a vertical orientation in the upper portion of the cradle , biased upwards by a spring 36 . a contact portion 37 protrudes above the cradle . a pair of slots 39 guide the locking latch through the central aperture , and include respective cam surfaces 40 . a foot 41 is guided by an aperture in the upper portion 11 and rests on spring 36 . the locking latch 22 is approximately u shaped with a pair of arms 42 and lies in a horizontal orientation through the release actuator 21 , biased transversely by a spring 43 . the arms are able to slide in slots 39 on the release actuator while a pair of cam surfaces 44 are aligned with corresponding surfaces 40 . the ends of arms 42 are shaped to engage corresponding recesses in a battery . fig3 a and 4 a show the empty cradle . locking actuator 20 is held upwards by spring 31 . shoulder 34 on the locking actuator restrains the locking latch 22 in an open position , against spring 43 . the locking release actuator 21 is held upwards in an open position by spring 36 . all of the springs are seated on internal surfaces of the cradle as shown . fig3 b and 4 b show a radio 50 including battery 51 locked into the cradle by a user . locking actuator 20 is displaced downwards in recess 12 against spring 31 , by contact of the battery on foot 32 . locking latch 22 has been released by shoulder 34 and is displaced transversely into engagement with the battery by spring 43 . the radio generally abuts internal walls of the recess 12 and is biased firmly against arms 42 of the latch by spring 31 . pins 23 have also engaged the battery but are not shown in this view . fig3 c and 4 c show how the radio 50 is released from the cradle . the user applies downwards pressure to contact portion 37 of the locking release 21 , against spring 36 . cam surfaces 40 on the release actuator engage cam surfaces 44 on the locking latch 22 which restores the latch to the open position out of engagement with the battery 51 . the locking actuator and the radio are returned upwards by spring 31 and shoulder 34 again restrains the latch against spring 43 . the user then removes pressure from the release actuator which returns to the open position , and the radio can be removed from the cradle . fig5 a and 5 b correspond to fig3 b and 4 b , and show how the battery 51 is held in the cradle without necessarily being attached to the radio . the locking actuator , locking latch and release actuator behave as before . pins 23 hold the battery in engagement arms 42 of the latch . charging of a battery separately from the radio might be considered an optional feature . fig6 is a sectional view indicating the location of electrical contacts 60 inside the cradle . these contacts meet corresponding contacts on the battery 51 . the associated electrical circuit and connection to an external power supply , typically a vehicle battery , will be known to a skilled reader and have not been shown . the cradle may be fixed within a vehicle in a variety of ways , depending on surfaces and fittings which are available inside vehicle . a range of brackets may be attached to the rear of the cradle for example . the cradle may also be held in an aperture having edges which are sandwiched between the upper and lower portions 10 and 11 . fig7 shows a second embodiment of the battery charger , having a cradle formed by a lower portion 15 and an upper portion 16 . the upper portion includes a recess 17 with a rim 18 , which receives the base of the radio , or the battery alone , and a rear support 19 which contains all or part of a lock and release mechanism for a rear part of the radio or battery . the charger in fig7 includes a locking actuator 70 , a locking release actuator 71 , and a locking latch formed by a pair of pins 72 mounted separately in the upper portion 16 . the locking actuator and latch are in sliding contact with the release actuator which is in turn mounted in the upper portion of the cradle . these components form a lock and release mechanism which holds the radio or battery securely in the cradle . fig8 a , b , c and corresponding fig9 a , b , c indicate how the lock and release mechanism operates in relation to a complete radio 50 including battery 53 . the lock and release mechanism may also operate in relation to the battery alone . the locking actuator 70 has an approximate l - shape with a single leg 80 , and sits in a vertical orientation within the cradle , biased upwards by a spring 81 . a foot 82 on the lower end of the leg lies in the bottom of the upper portion 16 and extends into the recess 17 . an aperture 83 towards the upper end of the leg is guided by an internal part on the upper portion 16 . a pair of arms 84 on the upper end of the leg are shaped to interact with the pins 72 of the locking latch . the release actuator 72 is an approximately square o - shape with a central aperture 85 , and sits in a vertical orientation in the upper portion of the cradle , biased upwards by a spring 86 . a contact portion 87 protrudes above the cradle . the arms of the locking latch are guided by internal sides of the central aperture 85 . cam surfaces 90 on external sides of the central aperture interact with the pins 72 . a foot 81 is guided by an aperture in the upper portion 16 and rests on spring 86 . the locking latch is formed by a pair of separate latches or pins 72 in this example . each pin has an approximate l - shape which includes a central block 91 , a cam surface 92 and a protrusion 93 . each pin lies in a horizontal orientation biased transversely inwards to the cradle by a respective spring 94 . the cam surfaces 92 are aligned with corresponding cam surfaces 90 on the release actuator 71 . the protrusions 93 engage corresponding recesses in the battery 53 . fig8 a and 9 a show the empty cradle . locking actuator 70 is held upwards by spring 81 . arms 84 restrain the pins of locking latch 72 in an open position , against springs 94 . the locking release actuator 71 is held upwards in an open position by spring 86 . all of the springs are seated on internal surfaces of the cradle as shown . fig8 b and 9 b show a radio 50 including battery 53 locked into the cradle by a user . locking actuator 70 is displaced downwards in recess 17 against spring 81 , by contact of the battery on foot 82 . locking latch 72 has been released by arms 84 and the pins are displaced transversely into engagement with the battery by springs 94 . the radio generally abuts internal walls of the recess 17 and is biased firmly against the latch by spring 81 . other pins provided in the cradle may also engage the battery but are not shown in this view . fig8 c and 9 c show how the radio 50 is released from the cradle . the user applies downwards pressure to contact portion 87 of the locking release 71 , against spring 86 . cam surfaces 90 on the release actuator engage cam surfaces 92 on the locking latch 72 which restores the respective pins to the open position out of engagement with the battery 53 . the locking actuator and the radio are returned upwards by spring 81 and arms 84 again restrain the pins of latch 72 against springs 94 . the user then removes pressure from the release actuator 71 which returns to the open position , and the radio can be removed from the cradle . | 7 |
as previously mentioned , this invention is designed for an existing ink duct of any arbitrary printing press . these elements are therefore represented in a purely schematic fashion . the actual design can be much more complex , however , this is irrelevant to this invention , since only one element need be matched to these existing conditions . every conventional printing press has an ink duct 2 which includes a housing 20 with a plurality of bores , mainly threaded bores 21 , through which duct - adjusting screws extend . the duct - adjusting screws act directly on an ink blade 22 , which rests against a ductor 23 . the ink present at the ductor 23 is intermittingly lifted off by a vibrator and transferred to an ink roller of an ink unit . a plurality of bores 21 are provided with regular spacing in the housing 20 of the ink duct 2 . the shape , diameter , length and extension of the bores 21 is extremely different between presses , depending on the particular press . instead of adapting the ink duct to a new duct - adjusting screw unit , or even to install a completely new ink duct , the duct - adjusting screw unit is divided basically into two areas , an area which remains the same and an adapted , type - specific area , such as an adapter element 10 . the adapter element 10 , as shown in fig1 comprises a two - piece cylindrical sleeve . the sleeve has a threaded element 11 and a plug element 12 . the nomenclature threaded element and plug element are merely used to differentiate the elements and corresponds to the exemplary embodiment shown in the drawings . the threaded element 11 is adapted in its design and dimensions to the conditions present in the existing housing 20 of the ink duct 2 to be equipped . the threaded element 11 of the adapter 10 is therefore customized . in contrast , the plug element 12 of the adapter 10 is standardized and fits the unchanged remaining part of the duct - adjusting screw unit 1 . the first element of the adapter element 10 , here designed as the threaded element 11 , has a lesser diameter than the plug element 12 , in most occurring cases . the plug element 12 is a cylindrically turned element , which can be pushed with pass fit into an adjusting block 13 . the adjusting block 13 preferably has a cuboid shape and has a cylindrical through - bore 14 . a contact pressure bolt 4 is seated in the through - bore 14 . the contact pressure bolt 4 extends almost completely through the adjusting block 13 and extends centered through the entire adapter element 10 , until it rests against the ink blade 22 . the adapter element 10 accordingly also has a bore 15 with a diameter of the same dimension , which extends completely through the adapter element 10 . the threaded element 11 of the adapter element 10 has an exterior thread 16 , which is matched to the existing interior thread in the bore 21 of the housing 20 of the ink duct 2 . thus the entire duct - adjusting screw unit 1 is releasably connected with the ink duct 2 and is also adjustable with respect to the ink duct 2 . as represented here , the connection between the adjusting block 13 and the adapter element 10 can be provided by means of a fixation screw 17 , which engages a circumferential recess 18 on the plug element 12 of the adapter element 10 . the fixation screw 17 laterally extends through the adjusting block 13 as far as a widened bore 19 . the length and diameter of the widened bore 19 are precisely matched to the plug element 12 of the adapter element 10 . as long as the fixation screw 17 is not tightened , the adapter element 10 is secured in the axial direction , but is still rotatable , which is useful for mounting and rough adjustment . the plug element 12 can also be fixed in place in the adjusting block 13 with appropriate recesses cut into both elements for an only limitedly releasable connection using a seger ring 17 &# 39 ;, by means of which an axial fixation is also achieved , while the rotatability of the two elements with respect to each other remains assured . this alternative is shown in a simplified form in fig1 . a seating bore 40 , which extends at least as far as into the through - bore 14 , is cut into the adjusting block 13 vertically with respect to a direction of extension of the cylindrical through - bore 14 . a pivot body 41 is rotatably seated and axially secured in the seating bore 40 , designed as a blind bore . axial securing can occur by conventional means , for example by means of a seger ring . on a front face located toward the cylindrical through - bore 14 , the pivot body 41 has an eccentric link track 42 , which is at least partially formed as a section of a circle . a catch 43 fastened on the contact pressure bolt 4 engages the link track 42 . thus , a rotating movement of the pivot body 41 leads to an axial displacement of the contact pressure bolt 4 . in order to improve guidance of the contact pressure bolt 4 and the pivot body 41 in the contact area , and also to prevent tilting of the catch 43 in the link track 42 , the contact area of the contact pressure bolt 4 is ground to form a flat sliding face 44 . the length of the flat sliding face 44 corresponds to at least a diameter of the pivot body 40 plus the maximum displacement of the contact pressure bolt 4 . the pivot body 40 also projects laterally out of the adjusting block 13 which accommodates an actuating lever 51 , which is arranged radially on the pivot body 40 . basically , the actuating lever 51 indicates by means of its angular position a position of the contact pressure bolt 4 with respect to the ink blade 22 . however , the indication can also be provided by a graduation 52 on the pivot body 41 , for reading off its angular position with respect to the adjusting block 13 . the setting is considerably more visible , however , if an element 53 having a graduation is screwed to the adjusting block 13 . in the embodiment in accordance with fig1 the element 53 is a cylinder calotte with an appropriate read - off graduation . the element 53 can also approximate a shape of a plate . the element 53 with the graduated scale for indication is fixed interchangeably by means of a screw 54 . the screw 54 directly engages the cylindrical through - bore 14 , which has an interior thread at the end . the element 53 with the graduation can also be designed in a press - specific manner . for example , the element 53 with the graduation can have exactly the width corresponding to the spacing between two neighboring duct - adjusting screw units . in this case , the element 53 is wider than the adjusting block 13 , or respectively wider than the entire width of the remaining duct - adjusting screw unit 1 without the element 53 . in the completely retrofitted state , the elements supporting the graduation lie closely next to each other . mounting the duct - adjusting screw units 1 in accordance with this invention is performed such that the adapter element 10 , which is produced in a press - specific manner , is screwed into an approximately correct position by means of its threaded section and the remainder of the unit is placed on the plug element 12 of the adapter element 10 . a tightening area 45 , provided in an advantageous manner , remains accessible on the adapter element 10 and is used to tighten the adapter element 10 by means of a tool , for example an open - end wrench . accordingly , the tightening area 45 can be hexagonal or octagonal . for a first adjustment , the pivot body 41 is set to a minimal position by means of the actuating lever 51 , and thereafter the adapter element 10 is screwed in with the aid of an open - end wrench until a pressure of the contact pressure bolt 4 against the ink blade 22 is so great that practically no ink can be passed . by pivoting the actuating lever 51 it is therefore possible to adjust ink delivery to the ductor 23 from a minimum to a maximum . this setting is easily recognizable , and can be easily set and read off , so that the same setting can be immediately repeated for a new printing process . an experienced printing press operator can determine by means of the material to be printed alone which setting is at least approximately appropriate for correct ink delivery . | 1 |
( the invention adding sb to hydrocarbon fcc feed so that it deposits on to the catalyst over time ) a commercial catalyst , foc90 , available from akzo chemicals , inc ., a division of akzo nobel , is employed in a conventional fluid catalytic cracking unit ( fcc ) of a design by uop , m . w . kellogg , or other designer . the catalyst circulates successively through a riser into a recovery section and then into a regenerator where carbon is burned off by treatment with air and / or co 2 . the decoked catalyst is then recycled back to the riser for contact with additional quantities of a heavy oil feedstock which contains approximately 10 ppm nickel plus 5 ppm iron . from this stream of catalyst , there is continuously or intermittently withdrawn a portion which is sent to a magnetic separator of the type described in u . s . pat . no . 5 , 147 , 527 . the magnetic separator operates conventionally and removes a high metal - contaminated portion of the catalyst before recycling the remaining lower metal catalyst back to the cracking cycle . when a 1 : 1 ppm ( weight ) ratio of feed iron to antimony ( as antimony acetate , 97 % wt .) is added to the feed to the fcc , the antimony gradually deposits on the circulating catalyst so that the catalyst which was earliest added becomes the most magnetic , and newly added make - up catalyst is the least magnetic . operating the same magnetic separator conventionally , causes a sharper recovery of new catalyst because the magnetic susceptibility of the nickel - iron - contaminated catalyst is sharply increased by the antimony depositing on the catalyst . the magnetic susceptibility of the newly added catalyst is virtually zero , whereas the magnetic susceptibility of the catalyst which has been in the unit for several months is approximately 1 to 200 ร 10 โ 6 emu \ g , giving a sharp difference on which the magnetic separator can operate to provide a separation between older and newer catalyst . ( the invention incorporating sb into a high value specialty catalyst additive particle during manufacture ) zsm - 5 and similar catalysts are covered by a number of patents , e . g . u . s . pat . nos . 3 , 702 , 886 ; 4 , 229 , 424 ; 4 , 080 , 397 ; ep 94693b1 ; and 4 , 562 , 055 , and is highly favored by the petroleum refining industry because it cracks hydrocarbon feedstocks in such a way as to produce higher octane gasoline . however , zsm - 5 costs approximately 2 - 4 times the cost of normal cracking catalyst conventionally used for fcc units . therefore , it is common practice to add some zsm - 5 particles along with a conventional product , e . g . foc - 90 or other conventional commercial catalyst . when withdrawing metal - contaminated catalyst , some of the zsm - 5 is removed and is conventionally landfilled or otherwise disposed of to waste . by incorporating 0 . 01 to 15 , more preferably 0 . 02 to 5 , and most preferably 0 . 03 to 2 % by wt . of antimony into the catalyst as it is made , a zsm - 5 catalyst can be โ tagged โ so that it separates preferentially from the conventional catalyst which does not contain substantial quantities of antimony . as the zsm - 5 / antimony tagged catalyst circulates , it is successively contacted with hydrocarbon fuel , separated from the hydrocarbon products , sent through a conventional regenerator to remove carbon , and is separated out ( a portion at a time ) to a magnetic separator . the magnetic separator preferentially separates the high magnetic susceptibility zsm - 5 catalyst which has had its magnetic susceptibility enhanced by the presence of antimony together with contaminating nickel and iron from the metal - containing hydrocarbon feed . alternatively , or supplementally , the highest magnetic fraction from the separator can be further processed through the same or an additional magnetic separator to still further concentrate ( beneficiate ) the zsm - 5 - containing catalyst . note that the common practice of adding antimony to fcc feedstocks can be conventionally combined with the invention , though it somewhat decreases the difference in magnetic susceptibility between the catalyst which was tagged with antimony during manufacture and that which was not because both will have some sb deposited on their surface from the feedstock being cracked . ( comparative ; the effect on magnetic susceptibility of the presence of iron versus the presence of nickel ) table 1 sets forth the magnetic susceptibility together with the parts per million of iron , nickel , and antimony for a series of different catalysts , all based on a commercially available petroleum cracking catalyst , foc - 90 manufactured by the filtrol division of akzo chemicals , inc ., a division of akzo nobel . as can be readily seen , the fe + foc - 90 ( 4 ) has a sharply increased magnetic susceptibility over sb + foc - 90 ( 2 ). this increase is enhanced as the nickel increases ( 3 and 4 ). when even a lower amount of nickel is added with 600 ppm of antimony ( 7 ), the magnetic susceptibility is dramatically increased by a factor of over four . this is only slightly affected by tripling the amount of nickel on the catalyst ( 6 ). thus , a major discovery of the invention is that antimony together with nickel plus iron is enormously higher in magnetic susceptibility than iron or nickel alone . thus , adding antimony , e . g . to a feed so that it deposits on a cracking catalyst gradually over time , can effectively sharpen the separation achieved by a magnetic separator operating on the catalyst . further evidence of such interaction between iron and antimony is evident in table ii . as can be seen , without antimony the magnetic susceptibility is at 2 . 89 ร 10 โ 6 emu / g . whereas with the addition of antimony , the magnetic susceptibility was increased by approximately 69 %, thus demonstrating the applicability of this invention . all magnetic susceptibilities supported in this application were measured by mathew - johnson magnetic susceptibility balance according to techniques recited in u . s . pat . no . 5 , 190 , 635 to hettinger , col . 6 , lines 8 - 16 . specific compositions , methods , or embodiments discussed are intended to be only illustrative of the invention disclosed by this specification . variation on these compositions , methods , or embodiments are readily apparent to a person of skill in the art based upon the teachings of this specification and are therefore intended to be included as part of the inventions disclosed herein . while foc - 90 is used in the examples , many other commercial catalysts can be used , e . g . davison / grace and / or engelhard . reference to documents made in the specification is intended to result in such patents or literature being expressly incorporated herein by reference . | 8 |
further aspects , features and advantages of this invention will become apparent from the detailed description which follows . polymers or polymer precursors of the present invention can be composed or synthesized according to a number of alternatives . for example , polymers can be formed by co - polymerizing one of the monomers from table 1 and one of the monomers from table 2 . also , polymers can be formed by co - polymerizing one of the monomers from table 1 , one of the monomers from table 2 , and one of the monomers from table 4 . polymer precursors can also be synthesized by co - polymerizing one of the monomers from table 3 , and one of the monomers from table 2 and / or one of the monomers from table 4 . alternatively , polymer precursors can be synthesized by self - polymerizing a monomer from table 1 , table 2 , table 3 or table 4 . the polymer precursors described above can be functionalized by attaching any suitable functional units such as bio - molecules to its reactive sites . the polymer is ether soluble in water in its precursor state or after functionalization . examples of suitable bio - molecules for functionalization may include , without limitation , carbohydrates , proteins , peptides , dna , rna , antibodies , antigens , enzymes , bacterias , redox molecules , host molecules , guest molecules , haptens , lipids , microbes , aptamers , sugars or the like . some specific examples of polymer precursors and functionalized polymers with suitable bio - molecules are shown in table 5 . the wavelength of energy absorbed by the polymers is about 700 - 1100 nm or above about 1100 nm , and the absorption can be adjusted by adjusting the degree of polymerization . the band gaps of the polymers are generally between about 0 . 8 ev and about 1 . 7 ev . in a number of cases , the band gaps are between about 1 . 1 ev and about 1 . 4 ev . the concepts of the present invention will now be further described by reference to the following non - limiting examples of specific polymers and exemplary techniques for their formation . it should be understood that additional polymers and additional techniques of formation are also comprehended by the present invention . scheme 1 below illustrates the synthesis of 4 , 7 - dibromo - 5 , 6 - diamine - benzo [ 1 , 2 , 5 ] thiadiazole 4 starting from benzo [ 1 , 2 , 5 ] thiadiazole . benzothiadiazole ( 10 . 0 g , 73 . 4 mmol ) and hbr ( 150 ml , 48 %) were added to a 500 ml three - necked round - bottomed flask . a solution containing br 2 ( 35 . 2 g , 220 . 3 mmol ) in hbr ( 100 ml ) was added dropwise very slowly . after the total addition of br 2 , the solution was heated at reflux for overnight . precipitation of a dark orange solid was noted . the mixture was cooled to room temperature , and a sufficient amount of a saturated solution of nahso 3 was added to completely consume any excess br 2 . the mixture was filtered under vacuum and washed exhaustively with water and dried under vacuum to yield the dibrominated product 2 , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl3 ): ฮด 7 . 75 ( s , 2h ) ppm 4 , 7 - dibromobenzo [ 1 , 2 , 5 ] thiadiazole 2 ( 409 , 137 mmol ) was added to a mixture of fuming sulphuric acid ( 200 ml ) and fuming nitric acid ( 200 ml ) in small portions at 0 ยฐ c . and then the reaction mixture was stirred at room temperature for 72 hrs . after 72 hrs , the mixture was poured into ice - water , the solid was filtered and washed with water several times , then recrystallized in ethanol to give compound 3 as a pale yellow solid . a mixture of 4 , 7 - dibromo - 5 , 6 - dinitro - benzo [ 1 , 2 , 5 ] thiadiazole 3 ( 10 g , 26 mmol ) and fine iron powder ( 10 g , 178 mmol ) in acetic acid was stirred at 80 ยฐ c . until compound 3 completely disappeared monitored by thin layer chromatography ( tlc ). the reaction mixture was cooled down to room temperature and then precipitated in 5 % solution of naoh . the solid was filtered and washed with water several times . obtained filter cake was dissolved in hot ethyl acetate ( etoac ) and then filtered to remove unreacted iron , the filtrate was evaporated to remove solvent on a rotary evaporator to give 4 , 7 - dibromo - 5 , 6 - diamine - benzo [ 1 , 2 , 5 ] thiadiazole 4 as a yellow solid , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , dmso ): ฮด 3 . 31 ( s , 4h ) ppm . scheme 2 below shows the synthesis of 1 , 2 - bis ( 4 -( 3 - bromopropoxy )- phenyl ) ethane - 1 , 2 - dione 6 starting from 1 , 2 - bis ( 4 - methoxyphenyl ) ethane - 1 , 2 - dione . 1 , 2 - bis ( 4 - methoxyphenyl ) ethane - 1 , 2 - dione ( 5 g , 18 . 52 mmol ) was dissolved in ch 2 cl 2 and cooled to โ 78 ยฐ c . ( solid occurred again ). bbr 3 ( 8 . 3 m , 87 . 82 mmol ) was added and mixture was allowed to warm to room temperature and stirred for 15 hrs . tlc check showed 1 , 2 - bis ( 4 - methoxyphenyl ) ethane - 1 , 2 - dione completely disappeared . the reaction mixture was poured into ice , extracted by etoac , washed with nacl solution , dried over mgso 4 . the solvent was removed by vacuum , and the residue was purified by column chromatography to give compound 5 , 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , dmso ): ฮด 10 . 8 ( s , 2h ), 7 . 71 ( d , j = 8 . 8 mhz , 4h ), 6 . 90 ( d , j = 8 . 8 mhz , 4h ) ppm . 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione ( 2 . 6 g , 10 . 74 mmol ) was dissolved in dmf and k 2 co 3 ( 5 . 9 g , 42 . 7 mmol ) was added , 100 mmol of 1 , 3 - dibromopropane and a catalytic amount of ki were then added . the mixture was heated to 80 ยฐ c . and stirred for 3 days . tlc check showed 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione disappeared . dimethylformamide ( dmf ) was removed , and water was added , extracted by etoac , washed with brine , dried over mgso 4 . the solvent was removed and the residue was purified by column chromatography to give 1 , 2 - bis ( 4 -( 3 - bromopropoxy ) phenyl ) ethane - 1 , 2 - dione 6 as a pale yellow solid , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): ฮด 7 . 94 ( d , j = 8 . 8 mhz , 4h ), 6 . 99 ( d , j = 8 . 8 mhz , 4h ), 4 . 20 ( t , j = 6 . 2 mhz , 4h ), 3 . 61 ( t , j = 6 . 2 mhz , 4h ), 2 . 34 ( m , 4h ) ppm . 4 , 7 - dibromo - 5 , 6 - diamine - benzo [ 1 , 2 , 5 ] thiadiazole 4 ( 0 . 6 g , 1 . 23 mmol ) and 1 , 2 - bis ( 4 -( 3 - bromopropoxy ) phenyl ) ethane - 1 , 2 - dione 6 ( 0 . 4 g , 1 . 23 mmol ) were placed in a reaction flask , and acoh was added . the reaction mixture was heated to 125 ยฐ c . and stirred for 3 . 5 hrs . tlc check showed both compound 4 and 6 disappeared . the mixture was cooled down to room temperature and poured into water , and then extracted by etoac , washed with brine , dried over mgso 4 . the residue was purified by column chromatography to give monomer 1 , 4 , 9 - dibromo - 6 , 7 - bis ( 4 -( 3 - bromopropoxy ) phenyl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 - g ] quinoxaline as a orange solid , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): ฮด 7 . 77 ( d , j = 8 . 8 mhz , 4h ), 6 . 95 ( d , j = 8 . 8 mhz , 4h ), 4 . 19 ( t , j = 6 . 2 mhz , 4h ), 3 . 64 ( t , j = 6 . 3 mhz , 4h ), 2 . 37 ( m , 4h ) ppm . scheme 4 below shows the co - polymerization of monomer 1 and thiophene - 2 , 5 - diboronic acid to produce polymer 1 . 0 . 2 mmol of monomer 1 and 0 . 2 mmol of 2 , 5 - thiophene - diboronic acid , pd ( pph 3 ) 4 ( 8 mg ), k 2 co 3 ( 0 . 25 g ) were placed in three - neck flask and degassed , and then refilled with n 2 . 20 ml of tetrahydrofuran ( thf ) and 8 ml of water were added , and reaction mixture was heated to 85 ยฐ c ., stirred for 24 hrs . the reaction was cooled down to room temperature and poured into ch 3 oh . collected polymer 1 was washed with ch 3 oh several times and dried by vacuum to give a dark solid . absorption of polymer 1 was measured and the spectrum is shown in fig1 . maximum wavelength absorption of energy by the polymer 1 can reach 1008 nm . 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione ( 2 . 6 g , 10 . 74 mmol ) was dissolved in acetone and k 2 co 3 ( 5 . 9 g , 42 . 7 mmol ) was added , then 80 mmol of 1 - bromo - 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethane was added . the mixture was heated to 80 ยฐ c . and stirred for 24 hrs . a tlc check showed 1 , 2 - bis ( 4 - hydroxyphenyl ) ethane - 1 , 2 - dione disappeared . acetone was removed , and water was added , extracted by etoac , washed with brine , dried over mgso 4 . the solvent was removed and residue was purified by column chromatography to give 1 , 2 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl ) ethane - 1 , 2 - dione 7 as a pale yellow oil , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): ฮด 7 . 94 ( d , j = 8 . 8 mhz , 4h ), 6 . 99 ( d , j = 8 . 8 mhz , 4h ), 4 . 21 ( t , j = 4 . 8 mhz , 4h ), 3 . 88 ( t , j = 4 . 8 mhz , 4h ), 3 . 80 ( t , j = 6 . 3 mhz , 4h ), 3 . 78 - 3 . 66 ( m , 16h ), 3 . 46 ( t , j = 6 . 3 mhz , 4h ) ppm . 4 , 7 - dibromo - 5 , 6 - diamine - benzo [ 1 , 2 , 5 ] thiadiazole 4 ( 0 . 6 g , 1 . 23 mmol ) and 1 , 2 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl ) ethane - 1 , 2 - dione 7 ( 0 . 89 g , 1 . 23 mmol ) were placed in a reaction flask , and acoh was added . the reaction mixture was heated to 125 ยฐ c . and stirred for 3 . 5 hrs . a tlc check showed both compound 4 and 7 disappeared . the mixture was cooled down to room temperature and poured into water , and then extracted by etoac , washed with brine , dried over mgso 4 . the residue was purified by column chromatography to give monomer 2 , 4 , 9 - dibromo - 6 , 7 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy )- phenyl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 - g ] quinoxaline as an orange sticky oil , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): ฮด 7 . 75 ( d , j = 8 . 8 mhz , 4h ), 6 . 94 ( d , j = 8 . 8 mhz , 4h ), 4 . 20 ( t , j = 4 . 8 mhz , 4h ), 3 . 90 ( t , j = 4 . 8 mhz , 4h ), 3 . 82 ( t , j = 6 . 3 mhz , 4h ), 3 . 76 - 3 . 69 ( m , 16h ), 3 . 47 ( t , j = 6 . 3 mhz , 4h ) ppm . scheme 7 below shows the co - polymerization of monomer 2 and thiophene - 2 , 5 - diboronic acid to produce polymer 2 . 0 . 2 mmol of monomer 2 and 0 . 2 mmol of 2 , 5 - bis ( tributylstannyl ) thiophene , pd ( pph 3 ) 2 cl 2 ( or pd ( pph 3 ) 4 ) ( 8 mg ) were placed in a two - neck flask and degassed , and then refilled with n 2 . 20 ml of thf ( or toluene ) was added , and reaction mixture was heated to 85 ยฐ c ., stirred for 24 hrs . the reaction mixture was cooled down to room temperature and then poured into ch 3 oh . collected precipitate was washed with ch 3 oh several times and recrystallized from ch 2 cl 2 / ch 3 oh and washed with ch 3 oh again and then dried by vacuum to give polymer 2 as a black solid . scheme 8 below shows an example of the conversion of polymer 2 to a bio - molecule derivatized water soluble polymer by attaching glucose to polymer 2 . 0 . 2 g of polymer 2 was dissolved in 8 ml of dmf in 25 ml single - neck round bottom flask . 0 . 2 g of 1 - thio - ฮฒ - d - glucose was added , following by 0 . 5 g of anhydrous k 2 co 3 . the reaction mixture was stirred at room temperature for 30 hrs , and then transferred into a dialysis tube for dialysis against water for 2 days ( 8 water changes ). the solution obtained in dialysis tube was then transferred into a single - neck round bottom flask . after removal of water , glucose - functionalized polymer 2 was obtained as a black solid . glucose - functionalized polymer 2 has very good water solubility as shown in fig2 . shown on the left is monomer 2 in ch 2 cl 2 solution . shown in the middle is an upper layer of water and a lower layer of polymer 2 in ch 2 cl 2 solution . shown on the right is an upper layer of glucose - functionalized polymer 2 in water solution and a lower layer of ch 2 cl 2 . scheme 9 below shows the co - polymerization of monomer 3 and thiophene - 2 , 5 - diboronic acid to produce polymer 3 . 0 . 15 mmol of monomer 3 and 0 . 15 mmol of 2 , 5 - thiophene - diboronic acid , pd ( pph 3 ) 4 ( 8 mg ). k 2 co 3 ( 0 . 25 g ) were placed in two - neck flask and degassed , and then refilled with n 2 . 10 ml of thf and 5 ml of water were added , and reaction mixture was heated to 85 ยฐ c ., stirred for 24 hrs . the reaction mixture was cooled down to room temperature and the water phase was extracted and transferred into a dialysis tube for dialysis against water for 2 days . then , the water solution in the dialysis tube was transferred into a single - neck round bottom flask , and the water was removed to give polymer 3 as a dark solid . polymer 3 has very good water solubility . scheme 10 below illustrates the synthesis of monomer 4 , 6 , 7 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl )- 4 , 9 - bis ( 5 - bromothiophen - 2 - yl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 - g ] quinoxaline , starting from monomer 2 . 2 . 0 g ( 1 . 98 mmol ) of monomer 2 and 40 mg of dichlorobis -( triphenylphosphine ) palladium were placed in a 50 ml two - neck round bottom flask , degassed and refilled with n 2 . anhydrous thf was added following by 2 -( tribytylstannyl ) thiophene ( 2 . 3 g , 4 . 96 mmol ). the mixture was heated to reflux . after stirring 4 hrs , the reaction mixture was cooled down to room temperature and poured into water , extracted with etoac . combined etoac layer was washed with water and dried over anhydrous mgso 4 . the solvent was removed and the residue was purified by chromatography to give monomer a , 6 , 7 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl )- 4 , 9 - di ( thiophen - 2 - yl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 - g ] quinoxaline as a dark blue sticky oil , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): ฮด 9 . 01 ( d , j = 4 . 0 mhz , 2h ), 7 . 81 ( d , j = 8 . 8 mhz , 4h ), 7 . 71 ( d , j = 5 . 0 mhz , 2h ), 7 . 34 ( m , 2h ), 6 . 98 ( d , j = 8 . 8 mhz , 4h ), 4 . 23 ( t , j = 4 . 8 mhz , 4h ), 3 . 94 ( t , j = 4 . 8 mhz , 4h ), 3 . 85 ( t , j = 6 . 3 mhz , 4h ), 3 . 80 - 3 . 72 ( m , 16h ), 3 . 49 ( t , j = 6 . 3 mhz , 4h ) ppm . monomer a ( 1 . 2 g , 1 . 19 mmol ) was dissolved in a 1 : 1 mixture of chloroform and acetic acid and n - bromosuccinimide ( 0 . 43 g , 2 . 42 mmol ) was added . the reaction mixture was stirred in darkness at room temperature for 3 hrs . a tlc check indicated complete reaction , and the mixture was poured into water and extracted with etoac . the combined organic layer was washed with brine solution and dried over anhydrous mgso 4 . after removal of solvent , the residue was purified by chromatography to afford monomer 4 , 6 , 7 - bis ( 4 -( 2 -( 2 -( 2 -( 2 - bromoethoxy ) ethoxy ) ethoxy ) ethoxy ) phenyl )- 4 , 9 - bis ( 5 - bromothiophen - 2 - yl )-[ 1 , 2 , 5 ] thiadiazolo [ 3 , 4 ] quinoxaline , as a dark sticky oil , as confirmed by the following nuclear magnetic resonance ( nmr ) data obtained therefrom : 1 h nmr ( 500 mhz , cdcl 3 ): ฮด 8 . 98 ( d , j = 4 . 0 mhz , 2h ), 7 . 74 ( d , j = 8 . 8 mhz , 4h ), 7 . 25 ( m , 2h ), 6 . 99 ( d , j = 8 . 8 mhz , 4h ), 4 . 24 ( t , j = 4 . 8 mhz , 4h ), 3 . 94 ( t , j = 4 . 8 mhz , 4h ), 3 . 82 ( t , j = 6 . 3 mhz , 4h ), 3 . 78 - 3 . 71 ( m , 16h ), 3 . 47 ( t , j = 6 . 3 mhz , 4h ) ppm . scheme 11 below shows the co - polymerization of monomer 4 and 1 , 4 - phenylenediboronic acid to produce polymer 4 . 0 . 2 mmol of monomer 4 and 0 . 2 mmol of 1 , 4 - phenylenediboronic acid , pd ( pph 3 ) 4 ( 8 mg ), kco 3 ( 0 . 25 g ) were placed in two - neck flask and degassed , and then refilled with n 2 . 20 ml of thf and 8 ml of water were added , and reaction mixture was heated to 85 ยฐ c ., stirred for 24 hrs . the reaction mixture was cooled down to room temperature and then poured into ch 3 oh . collected precipitate was washed with ch 3 oh several times and recrystallized from ch 2 cl 2 / ch 3 oh and washed with ch 3 oh again and then dried by vacuum to give polymer 4 as a black solid . scheme 12 below shows an example of the conversion of polymer 4 to a bio - molecule derivatized water soluble polymer by attaching glucose to polymer 4 . 0 . 2 g of polymer 4 was dissolved in 8 ml of dmf in 25 ml single - neck round bottom flask . 0 . 2 g of 1 - thio - ฮฒ - d - glucose was added , following by 0 . 5 g of anhydrous k 2 co 3 . the reaction mixture was stirred at room temperature for 30 hrs , and then transferred into a dialysis tube for dialysis against water for 2 days ( 10 water changes ). the solution obtained in dialysis tube was then transferred into a single - neck round bottom flask . after removal of water , glucose - functionalized polymer 4 was obtained as a black solid . glucose - functionalized polymer 4 has good water solubility as shown in fig3 . on the left is an upper layer of aqueous phase ( water ) and a lower layer of polymer 4 in ch 2 cl 2 solution . on the right is an upper layer of glucose - functionalized polymer 4 in water solution and a lower layer of ch 2 cl 2 . scheme 13 below shows an example of the conversion of polymer 2 to polymer 5 , with subsequent functionalization of polymer 5 with carboxylic acid groups , making cooh - functionalized polymer 5 water soluble . 0 . 3 g of polymer 2 was dissolved in 8 ml of thf in 25 ml single - neck round bottom flask . 0 . 4 g of k 2 co 3 was added , following by 0 . 5 ml of ethyl thioglycolate . after stirring at room temperature for 30 hrs , the whole mixture was poured into water and then filtered . the obtained solid was washed with water 2 times , then washed with ch 3 oh several times to yield polymer 5 . the obtained polymer 5 was directly used to do next step hydrolysis as described below without further purification . polymer 5 was dissolved in 10 ml of thf , and a solution of naoh ( 2 . 7 g ) in water ( 1 ml ) was added . a few seconds later after adding the naoh solution , a large amount of dark precipitates occurred in the reaction mixture . the mixture was stirred for about 5 minutes and then transferred into a dialysis tube for dialysis against water . the dark precipitates soon completely dissolved in water in the dialysis tube and the mixture was dialyzed against water for 2 days ( 8 water changes ). the solution in dialysis tube was then transferred into a single - neck round bottom flask and dried by lyophilization to give cooh - functionalized polymer 5 as a dark solid . cooh - functionalized polymer 5 has very good water solubility and its absorption in water was measured and the spectrum is shown in fig4 . maximum wavelength absorption of energy by the cooh - functionalized polymer 5 can reach about 950 nm . the cooh - functionalized polymer 5 shows a broad range of absorption beginning at about 700 nm in the visible region . the absorption continues past 1100 nm , which is well into the nir region . scheme 14 below shows an example of the conversion of cooh - functionalized polymer 5 to biotin - immobilized polymer 5 . 2 . 0 mg cooh - functionalized polymer 5 was dissolved in 0 . 2 ml of 0 . 1m mes buffer . 1 . 0 mg edc was dissolved in 0 . 1 ml di water . 1 . 0 mg sulf - nhs was dissolved in 0 . 1 ml di water . then , 27 ฮผl of this edc solution and 50 ฮผl of this sulf - nhs solution were added to the solution of step 1 ) and the whole mixture was incubated for 30 minutes . 1 . 0 mg biotin was dissolved in 0 . 1 ml dmso . 25 ฮผl of this solution was added to the mixture of step 2 ). the whole mixture was incubated for overnight under gentle stirring then , the mixture was transferred into a dialysis tube for dialysis against water for 12 hrs ( 2 water changes ). after dialysis , the solution was transferred into a vial to dry by lyophilization to give biotin - immobilized polymer 5 . binding experiments of biotin - immobilized polymer 5 with streptavidin coated magnetic beads the above biotin - immobilized polymer 5 was used to incubate with streptavidin - coated magnetic beads following a reported procedure . the results , as observed by the naked eye , are shown in fig5 . on the left ( fig5 a ) is shown the binding experimental results for the streptavidin coated magnetic beads plus biotin - immobilized polymer 5 . in the middle ( fig5 b ) is shown the control experimental results for the streptavidin coated magnetic beads plus cooh - functionalized polymer 5 . on the right ( fig5 c ) is shown only the streptavidin coated magnetic beads . the binding and control experiments of the streptavidin coated magnetic beads and biotin - immobilized polymer 5 described above were carried out under the same conditions . after incubation , all the beads were washed with a coupling buffer 4 times . fig5 results are shown for the beads re - suspended in tris - buffer solution after the 4 washings . a color change can be visualized after the binding even without using fluorescence as signals to see the binding . for comparative purposes , a commercial available nir dye labeled biotin , atto 680 - biotin , was used to do the same binding experiment . the atto 680 - biotin used in the binding experiment is the same concentration and volume as biotin - immobilized polymer 5 used in the binding . fig6 shows the results of beads binding with atto 680 - biotin . on the left ( fig6 a ) is shown the atto 680 - biotin only . in the middle ( fig5 b ) is shown the binding of the streptavidin coated magnetic beads and atto 680 - biotin . on the right ( fig6 c ) is shown the streptavidin coated magnetic beads . fig7 shows comparative binding experimental results for magnetic beads binding with biotin - immobilized polymer 5 and atto 680 - biotin . on the left ( fig7 a ) is shown the binding for the streptavidin coated magnetic beads plus biotin - immobilized polymer 5 . in the middle ( fig7 b ) is shown the binding for the streptavidin coated magnetic beads plus the atto 680 - biotin . on the right ( fig7 c ) is shown the streptavidin coated magnetic beads . because of the water solubility of the polymers and their optical properties in the nir range , these polymers can be used as fluorescence signaling reagents in many bio - related applications in the life sciences , diagnostic testing markets , pharmaceutical market , and environmental testing and biological warfare agent detection markets . the water - soluble polymers above can also be used to form thin films by applying much lower potential in aqueous solution . these polymers can often be related to electro - conductive polymers with low band gaps . with both water soluble and electrically conductive properties , the polymers can be used in a biological related system for a number of applications , including as a conductor for electrical signals of biological origin and otherwise . any numbers expressing quantities of ingredients , constituents , reaction conditions , and so forth used in the specification are to be understood as being modified in all instances by the term โ about โ. notwithstanding that the numeric al ranges and parameters setting forth , the broad scope of the subject matter presented herein are approximations , the numerical values set forth are indicated as precisely as possible . any numerical value , however , may inherently contain certain errors or inaccuracies as evident from the standard deviation found in their respective measurement techniques . none of the features recited herein should be interpreted as invoking 35 u . s . c . ยง 112 , ยถ 6 , unless the term โ means โ is explicitly used . although the present invention has been described in connection with preferred embodiments thereof , it will be appreciated by those skilled in the art that additions , deletions , modifications , and substitutions not specifically described may be made without departing from the spirit and scope of the invention . | 7 |
the air cleansing module described herein may be used as part of a complete aircraft system to be used in an air filtration and sanitation capacity for cabins and / or fuel cells . the air cleansing module modifies existing aircraft air cleaning technology by containing oxidative species within a reaction chamber and / or dispersing the oxidative species into the atmosphere in question such as the aircraft cabin or pemfc air source . furthermore , prior art air purification generally uses uv lamps , but the present system uses a uv led array , which has the capacity to yield a finely tunable spectrum of uv wavelengths to target a wider range of contaminant species . it also provides a beneficial reacting coating on the surface of the module . the air cleansing module also cleanses air without the use of harmful chemicals and toxins making it a safe alternative to many air sanitation products . certain embodiments described herein are adaptations made to current monogram systems technology that is used to treat water . details of the water treatment system are provided in u . s . publication no . 2012 / 0051977 , the entire contents of which are incorporated herein by reference . the adaptations and modification provided herein allow the system to be used for air sanitation , cleansing , and treatment as well . fig1 shows one embodiment of an air treatment system 10 for aircraft cabins and / or proton exchange membrane fuel cells . in the embodiment shown , air enters through inlet 18 and exits from outlet 20 . this embodiment incorporates an ultraviolet ( uv ) source with a photo - catalytic oxidative ( pco ) coating on the inner reaction chamber surface . this pco coating interacts with the uv light to create radical oxidative species that are able to destroy pathogens adsorbed to the inner surface of the reaction chamber , pathogens resident in the volume of the reaction chamber , and pathogens moving in the air flow of the device . the uv light interacts with the photo - catalyst , so the uv source and the photo - catalyst are placed in close proximity to one another . the pco coating can be made from multiple different photo - catalytic surfaces . the most commonly used and effective pco material is titanium - dioxide ( tio 2 ). tio 2 has been shown to be non - toxic and a powerful source of hydroxyl and superoxide radicals . when these radicals are created , they react directly with pollutants in the air to destroy them . in the view of fig2 , the pco coating 13 is applied to the inner surface of the reaction chamber 12 . this coating can be applied either directly to this inner surface , or to protrusions 42 from the inner surface , as shown in fig3 . such protrusions 42 are used to induce turbulent flow of air and increase surface area , and may be referred to as fins 42 . turbulence inducing fins 42 , which are positioned in the interior of air flow space 22 , are intended to induce turbulence and agitate air in the system . the quartz tube or other sheath of the uv lamp may rest on these fins or teeth for support as well . in an alternate embodiment , the pco coating is not used directly . instead , a photo - catalyst coating of tio2 or equivalent with additional doping with silver , copper , and rhodium is used . in this embodiment , the system will eject radical species of hydroxyl , super - oxide , hydrogen peroxide , and ozone into the area of interest , which can render the system potentially more active when compared to the direct pco system , as the radical species attack pollutants at the point of interest , such as the aircraft cabin or pemfc air source , rather than in a reaction chamber . in one embodiment , the coating reacts with the airstream to release reactive species into the target atmosphere to perform the reactions therein . in another embodiment , the device may be located at the central circulation point or at an air distribution point . the structural features shown and described are all shown and described in co - pending application ser . no . 12 / 872 , 420 , publication no . 2012 / 0051977 , the entire contents of which are incorporated herein . the present inventors have modified the point - of - use water treatment system for use in disinfecting cabin air by including a reactive coating to interior of flow path , adapted interface points for aircraft environmental control system , optimized internal geometry to maximize contact time for airstream . the system 10 shown and described is generally constructed as a self - contained unit to be used as an air treatment system . referring now to the individual features of the system shown in fig1 , the reaction chamber 12 contains one or more germicidal uv light sources 14 , which are typically housed inside a sleeve 16 ( typically a quartz sleeve , but alternate sleeve options are within the scope of this invention and are described in more detail below ). air enters the treatment system 10 from a bottom inlet 18 , flows through the chamber 12 as described below , and exits through top outlet 20 , instantly ready for use . inlet 18 and outlet 20 are generally tubular or circumferential in nature . in one embodiment , inlet 18 is generally in fluid communication with an air source , such as an air tank or cabin duct air , and is configured to deliver air to the chamber 12 . outlet 20 extends out of the chamber 12 , and its free end is in fluid communication with an air - dispensing apparatus , such as a vent to deliver air to the end user or an inlet valve to deliver air to a proton exchange membrane fuel cell . for example , the system 10 may be placed in the air ducts of the cabin and the air can be purified either actively or passively . similarly , the device can be placed into the inlet tube for the cabin air into the pemfc with either the active or passive method as well . in the embodiment shown in fig2 , air entering the chamber 12 is directed through an air flow space 22 positioned generally in the center of the chamber 12 . air flow space 22 is typically an annular tube , although it should be understood that any appropriate channel or configuration may be provided . in this example , a uv light source 14 is generally positioned within the air flow space 22 in order to treat the air . the uv light source 14 positioned inside the air flow space 22 is generally protected by a sleeve 16 ( alternate options for which are described below ). the air to be treated enters the air flow space 22 , around the outside of the uv source 14 and sleeve 16 . the interior of the chamber wall 12 is covered with the pco coating 13 or the phfreme equivalent in order to produce radical oxidative species when contacted with the uv light . alternatively , in the embodiment shown in fig3 , air entering the chamber 12 is directed through an air flow space 22 positioned generally in the center of the chamber 12 , and one or two ( or more ) uv light sources 14 may be positioned alongside each side of the air flow space 22 within the chamber 12 , in order to treat the air . although two uv light sources 14 are shown and described , it should be understood that only a single uv source or more than two sources may be used . the interior of the chamber wall 42 should be covered ( at least partially , and in some instances , substantially fully coated ) with the pco coating or the phi / reme equivalent in order to produce radical oxidative species when contacted with the uv light . in either of these reaction chamber embodiments , one or more reflectors 24 may be positioned near or against the chamber wall 26 to help light reflection and enhance treatment . the reflector 24 may be a removable sleeve or liner inside the chamber 12 , and may be made of any appropriate reflective material , whether metal or non - metal . for example , exemplary reflectors may be made of ceramics or polymers , or may have coatings of ceramics or polymers , or specifically , may have polymeric coatings with a high gloss finish . alternate reflectors may be anodized aluminum - based , with or without the described coatings . in one embodiment , there may be provided an anodized coating that may have at least a portion stripped away in order to obtain conductivity and ground the unit for safety . in other words , the reflector can be etched to establish a conductivity point . even in the instance where a high gloss finish is used , there may be an etched portion to establish a contact point . the general intent for the reflectors is to provide as much reflection of the uv light back into the system as possible . uv light sources 14 are typically referred to as uv lamps . the uv lamps are typically enclosed by sleeves 16 to protect the lamps and help reflect light . the uv light source 14 may be any appropriate uv light source , such as low or high pressure uv lamps , standard uv bulbs , or light - emitting diode ( led ) sources , as described herein . the light is mounted so that as air passes through a flow chamber , uv rays are admitted and absorbed into the air stream . when uv energy is absorbed by the reproductive mechanisms of bacteria and viruses , the genetic material ( dna / rna ) is rearranged so that they can no longer reproduce , killing the bacteria and eliminating the risk of disease . uv treatment thus disinfects air without adding disinfection chemicals . in a preferred embodiment , the uv light source is provided as one or more light emitting diodes ( leds ) 30 that are positioned anywhere in the reaction chamber , as long as they are able to emit light having a disinfection wavelength to the air being treated . this may also be an array of leds with clusters emitting at different wavelengths so as to create a spectrum effect . the leds may either be positioned inside the air flow ( in a configuration similar to that shown in fig2 ) or positioned outside the air flow ( as shown in fig3 , 5 a , and 5 b ). the general goal is to expose the air in the flow passage to the uv led wavelength . any geometry that allows the leds to be arranged around or in the air is considered within the scope of this invention . for example , as shown in fig5 a , the uv light source may be provided as a set of one or more light emitting diode ( led ) units 28 . one example of an led unit 28 is shown in fig4 . the leds 30 themselves are manufactured to emit light in the ultraviolet range . they may be provided as individual leds 30 arranged in various positions directly on the chamber wall 26 , on or against air flow space 22 , or they may be arranged on units 28 as shown . if arranged on units 28 , one or more sides of the unit 28 may be provided with a reflective surface 32 in order to help reflect to the uv light emitted more effectively . the uv leds may be positioned in any desired configuration . one example is the box - shaped configuration shown in fig5 a , which is formed by two l - shaped units of fig4 . in the l - shaped embodiment shown , one or both panels 34 may be provided with a reflective surface 32 . in one specific use , the units 28 may be positioned around the air flow space 22 at angles to one another so that a box - shaped unit is formed . alternate configurations are possible and within the scope of this invention . for example , although an l - shaped led unit 28 and a box - shaped configuration are shown , it should be understood that any appropriately shaped unit may be used and is considered within the scope of this invention . for example , the unit 28 may be provided as a cylindrical or partially cylindrical unit ( e . g ., a tubular unit , a circular , round or oval unit , or a half circle unit , two partially separated halves ), a square or rectangular unit , single panels , a 3 - sided triangular unit , a straight or curved configuration , or any other appropriately shaped unit . moreover , although the leds 30 are shown as being provided in two rows in fig4 , it should be understood that fewer or more rows may be provided or that the leds may alternatively be scattered in random patterns along one or more panels 34 , along the inside wall of chamber , along the air flow space 22 , or in any other appropriate position in chamber 12 , as long as the leds are able to treat the air in the system . in the specific embodiment shown , the design of the unit has an l - shape array of uv leds and a corresponding l - shaped reflector that emits uv light and reflects on to the air to be treated . the uv led and reflector units may be used as structural components . this arrangement allows for the use of a larger quartz sleeve to maximize air flow rate . in other words , when a uv array is positioned on the outside of the air flow space , there is provided a larger passage for the air , which allows the air path to be larger , and as such , allows more air to be treated per pass . an alternative uv led arrangement with the array inset in the air flow / reaction chamber is diagrammed in fig5 b . in this embodiment , the leds are arranged on two flat panels , spaced to evenly illuminate a focal center . an alternative is to arrange leds on the concave side of a curved panel , and spaced to evenly illuminate a focal center , as shown in fig5 b . curvature can be of such a design that it facilitates the focus of light from illuminating leds into the target media , although other led configurations are possible and within the scope of this invention . the array of leds can be coated with a tio 2 layer , or an alternative photocatalyst to produce a pco reaction directly adjacent to the air flow . this provides a dual benefit of irradiating pathogens from a closer distance and providing a larger surface area for pco to occur . in one embodiment , inlet 18 is configured with at least one bend 36 , curve , or portion having a non - linear dimension along its length in order to prevent line of sight to the uv light source contained within the reaction chamber 12 . outlet 20 is also configured with at least one bend 38 , curve , or portion having a non - linear dimension along its length in order to prevent line of sight to the light source contained within the reaction chamber 12 . the bends 36 , 38 ( or curves or non - linear portions ) of this design are primarily intended to protect maintenance personnel or anyone else who may come into direct contact or otherwise have their eyes positioned at or near inlet 18 or the outlet 20 from being directly subjected to the uv light . the bends 36 , 38 prevent the uv light source from being immediately viewable , causing the light to refract and take differing paths along the inlet and outlet portions . the system 10 is typically provided with a minimal number of components and in certain embodiments , has a modular construction , as shown in fig6 . a modular construction provides increased ease of maintenance and replacement . in one embodiment , the modular construction is provided by three main components : a removable lower cap 44 comprising an inlet 18 , reaction chamber 12 , and removable upper cap 46 comprising an outlet 20 and a lamp housing 48 . however , it should be understood that the modular components may be provided alternatively as desired . the modularity provided by removable lower cap 44 and removable upper cap 46 allows easier cleaning , maintenance ( e . g ., disassembly and reassembly ), and access to the uv lamp . the caps may be secured to the chamber 12 by any appropriate mechanism , such as threaded , bolted , clamped , or any other securing means . as shown in fig7 , air inlet 18 may have one or more turbulence inducing fins 42 . in the specific embodiment shown , fins 42 are provided on the inside of lower cap portion 44 , and are intended to introduce turbulence into the air entering the air flow space 22 . causing agitation of the air and creating a vortex helps ensure circulation of the molecules in the air and distribution of the uv light through all air in the system . the turbulence also keeps the air in the air flow space 22 for a longer time , allowing for a lengthened contact time . the fins 42 may serve the additional ( or alternate ) function of supporting a uv lamp . in one embodiment , fins 42 are secured to the sides of cap portion 44 , as shown in fig8 and 9 . in this feature , the fins 42 create turbulence while also supporting a uv light source , providing dual functions . in one embodiment , one or more springs may be associated with the tripod , typically at the tripod base , which absorb shock and support the free end of the sleeve and uv light source . in effect , the tripod / spring combination helps vibrationally isolate the uv light source by absorbing potential shock rather than transferring shock to the uv lamp . the uv air disinfection system will be in communication with the environmental control system ( ecs ) to coordinate operation and conserve power . when the ecs is powered and operating at full capacity , such as during high - activity periods during flight or while on ground , the uv light source will be activated and air will be disinfected upon contact with the pco coating in the unit before distribution to consumers or passengers . if the ecs is operating below full capacity , the uv air disinfection system will incorporate signals from the ecs and fine - tune uv light intensity to give the appropriate dose for disinfection . the system will be deactivated when the ecs is no longer operating , for example during aircraft shutdown overnight . there may be features of certain hvac systems that may require different control mechanisms for a treatment module . for example , if the module is running all the time , it may be possible to provide โ once time โ air passes as desired . fig1 shows an embodiment of this invention positioned in an air duct . here , the device will emit radical oxidizers into the air stream which will then be carried by the inherent air flow in the duct to the target . changes and modifications , additions and deletions may be made to the structures and methods recited above and shown in the drawings without departing from the scope or spirit of the invention and the following claims . while the foregoing written description enables one of ordinary skill to make and use what is to be considered to be the best model thereof , those of ordinary skill will understand and appreciate the existence of variations , combinations , and equivalents of the specific embodiment , method , and examples herein . | 0 |
the present disclosure provides a method of producing stable genipin - rich extracts from the genipa americana plant . the process involves aqueous or polar solvent extraction and organic non - polar solvent extraction . the resulting powder form of genipin - rich extract is off - white in color and has genipin content up to about 97 %. the present disclosure further provides applications of the genipin - rich extracts in the production of natural heat - stable colorants and as a new cross - linking agent for use in a broad range of areas , such as foodstuffs , drugs , nutritional supplements , personal care products , cosmetics , animal feed , textiles , biodegradable polymers , and biomaterial production . the starting materials used in this process are fruits or leaves from a plant of genipa americana l . which is also known by numerous informal names : genipap , huito , jaguar , bilito , cafecillo denta , caruto , caruto rebalsero , confiture de singe , danipa , genipa , gรฉnipa , genipayer bitu , guaitil , guaricha , guayatil colorado , huitol , huitoc , huitu , irayol , jagua blanca , jagua amarilla , jagua colorado , jeipapeiro , juniper , maluco , mandipa , marmelade - box , nandipa , รฑandipa genipapo , tapaculo , tapoeripa , taproepa totumillo , yagua , yanupa - i , yenipa - i , yenipapa bi , genipapo , huitoc , vito , chipara , guanapay , or other varieties such as jenipaporana , or jenipapo - bravo , etc . the fruit is optimal for harvest when mature in size , firm , and green to greenish brown in color . materials may be whole fruit , fruit pulp , fruit juice , fruit puree , fruit juice concentrate , dried powder from fruits or juice , water - insoluble part of fruit , and leaves from genipa americana l . in order to produce the genipin - rich extracts of the present invention , the mature fruits of genipa americana are processed with water or polar solvent in about 1 : 0 . 5 - 5 . 0 ( by weight ) ratios depending on extraction efficiency , preferably from about 1 : 1 - 1 . 5 ratios . after washing and / or blanching , the fruit is peeled and cut into pieces ; then milled or blended with water or polar solvents ; extracted with or without heating , the pulp , seeds and skin are separated by filtration ; and liquid is collected . extraction may take place for up to about 1 hour , preferably about 15 - 30 min , at a temperature of about 15 - 40 ยฐ c . the water or polar solvent extraction from fruit pulp of genipa americana may be repeated 1 - 3 times . then , the ph of polar solvent extracts is measured and adjusted to about 3 . 8 - 4 . 0 using acids . concentration can be performed on a rotary evaporator with vacuum and temperature set at about 40 - 46 c . the solid content in the concentrate may be greater than 15 % w / w , preferably about 40 - 70 % w / w . next , the aqueous extract or the concentrated genipin - rich aqueous extract may be further extracted with non - polar organic solvents involving suitable mixing ( by shaking or agitation ) in a ratio of about 1 : 1 . those non - polar organic solvents have a polarity index from about 0 to 5 . 0 and water solubility less than about 30 %. the organic solvent phase is then separated from aqueous phase by settling and siphoning the top organic layer or by using a high speed centrifuge . non - polar solvent extraction may be repeated 2 - 3 times depending on the extraction efficiency . the genipin - rich extracts may subsequently be dried by evaporation and organic solvent can be recycled and reused for genipin extraction . the remaining yellow or off - white solid is a genipin - rich extract in which genipin content is at least about 70 % w / w of the solids . alternatively , the mature fruits of genipa americana are processed with organic solvents directly in a ratio of about 1 : 1 - 2 . after washing and / or blanching , the fruit is peeled and cut into pieces , then milled or blended , extracted with non - polar organic solvent directly , with or without heating , the pulp , seeds and skin are separated and the solvent extract is collected . extraction may take place for up to about 1 hour , preferably about 15 - 30 min at temperature of about 18 - 25 ยฐ c . the organic solvent extraction may be repeated 2 - 3 times depending on the extraction efficiency . the genipin - rich extracts may subsequently be dried using an evaporator and condenser , and organic solvent can be recycled and reused . the resulting off - white or yellow solids is genipin - rich extract that contains genipin at greater than about 40 % w / w of solid . genipin - rich extracts may be aqueous or polar solvent extracts obtained from the starting material sources described . polar solvents include those with water solubility up to 100 % and polarity index greater than about 5 . 0 , such as water , acetic acid , methanol , ethanol , n - propanol , iso - propanol , dimethyl sulfoxide , dimethyl formamide , acetonitrile , acetone , dioxane tetrahydrofuran , etc ., or acetic , citric , phosphate acid buffer solutions , or mixtures thereof in different ratios . this list is not intended to limit the solvent used , however considering food safety , water , ethanol , n - propanol , iso - propanol , methanol and acetic , citric and phosphate acid buffer solutions , are preferred for food uses of the extract . genipin - rich extracts may alternatively be organic solvent extracts obtained from aqueous or polar solvent extracts described above . non - polar organic solvents include those with less than about 30 % of water solubility and a polarity index from 0 to about 5 . 0 , such as ethyl acetate , butyl acetate , n - butanol , diethyl ether , hexane , 2 - butanone , chloroform , 1 , 2 - dichloroethane , benzene , xylene , methyl - t - butyl ether , toluene , carbon tetrachloride , trichloroethylene , cyclohexane , pentane , and heptane , or mixtures thereof in different ratios . this list is not intended to limit solvent used , however considering food safety , ethyl acetate , butyl acetate , and n - butanol are preferred . genipin - rich extracts may alternatively be organic solvent extracts obtained from the starting material sources described . organic solvents include those with polarity index less than about 6 . 0 , and mixtures thereof in different ratios . the solvent or solvent mixture with low solubility in water is preferred in order to obtained colorless genipin - rich extracts . methods used for solid - liquid separation can be , for example , regular filtration , centrifugation , press filtration , and membrane cartridge filtration . the liquid - liquid separation can be done , for example , by using high speed centrifuge , or by settling and siphoning the required liquid layer . acids used for ph adjustment can be any organic or inorganic acids , selected to be suitable for the intended end use . concentration can be performed by any method known in the art , for example , by evaporation using a rotary vacuum evaporator , a flash evaporator , an osmosis filtration device , or an ultra - filtration device with a suitable membrane . genipin - rich extract is an off - white powder or crystals . some batches may have a slightly yellowish or greenish tint if purity is relatively low . the genipin content can be up to about 97 % ( w / w ) depending on the extraction method . no geniposide , geniposidic acid , or other iridoid compounds were found in genipin - rich extract when analyzed by hplc . the remainder of the composition of the genipin - rich extract is mainly moisture , fat , and also small amounts of acids and nitrogen - containing compounds , with the balance being carbohydrates , as noted in the following table . hplc methods can be used to determine genipin content and perform other iridoid analysis . genipin content of the off - white genipin - rich powder is stable when stored at refrigerated temperatures . genipin level decreased by less than about 5 % after 3 months of storage . however , when mixing genipin - rich extract with compounds having a primary amine group , genipin will quickly react and generate colorants and / or polymers . high genipin content extract readily dissolves in alcohol , alcohol - water mixtures , or hot water . its solubility in cold water is limited . the present invention also provides a method of manufacturing a blue colorant by using the genipin - rich extract reaction and mixing with water and amino acids , for example ( but not limited to ), lysine , histidine , arginine , glutamine , asparagine , methionine , glycine , glutamic acids , tyrosine , valine , alanine , serine , leucine , taurine , carnitine , ornithine and citrulline , in the presence of oxygen . heating can be used to accelerate the reaction speed . the molar ratios of genipin - rich extract to amino acids are from about 1 : 0 . 5 to about 1 : 10 . the blue shades generated are variable among deep blue , violet - blue , bright - blue , and greenish - blue depending on the amino acid used . the blue colorant generated from genipin - rich extract is a heat - and acid - stable pigment . similar blue colorants also can be generated by reaction of the genipin - rich extract with other extracts , fruit and vegetable juices , plant and animal materials , including dairy and egg products , which contain amino acids , polypeptides , proteins , and compounds with one or more primary amine groups . the blue color also can be generated by reaction of the genipin - rich extract with collagen , gelatin , chitosan , enzymes , and microbes . the colorant produced can be further concentrated or deposited on clay or other carriers and used in foods , cosmetic ( toothpaste , makeup , hair dye , etc ), and textile ( clothes ) applications . the present invention provides a method of manufacturing a red colorant by using the genipin - rich extract . the genipin - rich extract is hydrolyzed to remove a methyl group and convert the genipin to genipinic acid which further reacts with amine - containing compounds , with extra organic acid present and under anaerobic conditions , to generate red pigment . heating can be used to accelerate red pigment formation . the red solution can be further purified on an ion exchange column and the eluted material can be concentrated on a rotary vacuum evaporator . the genipa red is a heat - stable pigment , and is also stable at a high ph . genipin - rich extract can be dispersed or dissolved in about 5 - 50 % ethanol , preferably about 5 - 15 % ethanol , and about 0 . 5 - 1 . 5 n sodium hydroxide or potassium hydroxide solution , to a concentration of extract of about 5 - 10 % w / w . hydrolysis can be performed with or without heating for from about 30 min to 24 hours , preferably about 2 - 10 hours under room temperature (ห 20 ยฐ c .). hydrolyzed genipin - rich extract can be neutralized in ph by using acids , preferably organic acids , such as acetic acid , formic acid , lactic acid , citric acid , tartaric acid , adipic acid , oxalic acid , succinic acid , fumaric acid , and malic acid , preferably acetic acid and / or tartaric acid . the ph of hydrolyzed solution can be adjusted to the about 3 . 5 - 5 . 0 range . the acidified solution is then heated to about 65 - 85 ยฐ c ., and preferably about 70 - 75 ยฐ c ., for about 5 - 120 minutes , preferably about 10 - 20 minutes . the insoluble brown by - products are removed since they will not contribute to red color formation . precipitate separation can be accomplished by any of the filtration or centrifugation methods known in the art , for example , using regular filtration , centrifuge , press filtration , or tangential flow filtration or membrane cartridge filtration methods . formation of the insoluble brown by - products can be further enhanced by the addition of calcium carbonate to adjust the ph to about 5 - 7 . 5 and mixing for about 5 - 30 minutes . precipitation separation can be accomplished by the methods described above . the clear solution described above can be adjusted to ph about 4 . 0 - 4 . 6 with organic acid or salt , preferably acetic acid and / or sodium acetate . red color is generated after mixing with compounds having primary amine groups and heating to about 70 - 95 ยฐ c ., preferably about 80 - 85 ยฐ c ., for about 2 hours , or about 90 - 95 ยฐ c ., for about 1 hour . the compounds with primary amine groups can be selected from amino acids , such as alanine , arginine , lysine , aspartic acid , glutamic acid , glycine , histidine , valine , leucine , and serine . this listing is not intended to limit useful compounds with primary amine groups . the present invention , in addition , provides a method of manufacturing green colorant by using the genipin - rich extract . genipin - rich extract can react with certain amino acids , such as isoleucine , threonine , cysteine , and tryptophan , to generate green color . it also can react with primary amine - containing compounds and mix with carotenoids , annatto , and turmeric pigments to generate green color . since genipa green can provide a heat resistant green shade , it is very useful in the food industry because of heat instability of the natural green pigment , chlorophyll . similar green colorants also can be generated by reaction of the genipin - rich extract with other extracts , fruit and vegetable juice , plant and animal materials , including dairy and egg products , which are rich in amino acids , for example , isoleucine , threonine , cysteine , and tryptophan . the green color also can be generated by reaction of the genipin - rich extract with collagen , gelatin , chitosan , enzymes and microbes and mixing with carotenoids , annatto , and turmeric pigments to generate green color . the colorant produced can be further concentrated or deposited on clay or other carriers and used in foods , cosmetic ( toothpaste , makeup , hair dye , etc ), and textile ( clothes ) applications . the present invention , in addition , provides a means to generate other colorants , like purple , red , yellow , orange , brown , and black by using the genipin - rich extract . purples and reds can be created by mixing genipin - rich extract with carmine , beet juice , and anthcyanin colorants and solution with amine - containing compounds . oranges and yellows can be created by reacting genipin - rich extract with pentoses , such as xylose , ribose , or vitamin c . black color shade can be generated when alkaline earth metals ( e . g . magnesium or calcium ), or metals with multi - valences are involved during genipin reaction with compounds containing a primary amine group . the present invention provides new materials which contain up to about 97 % of genipin content . genipin - rich extract can react with any compound that contains a primary amine group , such as collagen , gelatin , chitosan , glucosamine , and various enzymes and proteins , to form new texture materials used in , for example , the food , cosmetic , biomaterial , and polymer industries . the present invention also provides a cross - linking agent obtained from the natural plant , genipa americana , which can replace synthesized chemicals , such as glutaraldehyde , formaldehyde , glyoxal , malonaldehyde , succinaldehyde , epoxy compounds , etc . genipin - rich extract used as a cross - linking agent has a much lower toxicity than those commonly used synthetic cross - linking reagents . genipin - rich extract can work as a natural cross - linking agent for encapsulation production in the food and pharmaceutical industries . encapsulated materials can be nutritional ingredients , such as omega - 3 oil , vitamin a , conjugated linolenic oil , or medicines . gelatin , collagen , whey proteins , casein , chitosan , soy proteins , and other plant or animal proteins , are good starting materials in conjunction with the genipin - rich extract to use to make an encapsulation shell , film or micro - membrane . the products have good thermal and mechanical stability , as well as their biocompatible property . following examples are provided for purpose of further illustrating the present disclosure , but should in no sense be taken as limiting . a ) huito fruits were peeled to yield 866 . 0 g of peeled fruit . the peeled fruit was cut into pieces and blended with 1300 g of deionized ( di ) water and pureed with a blender to produce a puree ; b ) the puree was allowed to stand for 15 min at room temperature ; and the insoluble solid was separated from the aqueous extract by filtration . then , 1212 . 4 g of di water was added to the filtrate and mixed for 15 minutes followed by a second filtration step ; c ) the filtrate was adjusted to ph & lt ; 4 . 0 using citric acid , and concentrated to 25 - 55 % ( w / w ) of solid content on a rotovapor ; d ) then , the concentrated aqueous extract was extracted using ethyl acetate in a 1 : 1 ratio . the colorless or slightly yellow clear ethyl acetate layer was collected . this liquid - liquid extraction was repeated 2 times ; e ) next , the combined ethyl acetate extract layers were evaporated on a rotovapor at a temperature of 40 ยฐ c . and vacuum of 35 mm hg to remove the solvent . condensed ethyl acetate can be reused for genipin extraction . after evaporating the ethyl acetate , an off - white or slightly yellow powder was obtained . the powder contained 74 . 4 % w / w of genipin . a ) huito fruits , 462 g , were peeled and blended with di water 537 g to produce puree ; b ) the puree was allowed to stand for 15 min at room temperature , and the insoluble solid was separated from aqueous extract by filtration . then , the same quantity of di water was added to the solid part , and the extraction step was repeated 2 times ; c ) the combined aqueous extract was adjusted to ph & lt ; 4 . 0 using citric acid and concentrated to 24 . 92 % ( w / w ) of solid content via a rotovapor ; d ) then , the concentrated aqueous extract was extracted using butyl acetate in 1 : 1 ratio . the colorless or slightly yellow clear butyl acetate layer was collected . this liquid - liquid extraction was repeated 2 times ; e ) next , the combined butyl acetate extract was evaporated on a rotovapor at a temperature of 55 ยฐ c . and vacuum of 35 mm hg to remove the solvent . condensed butyl acetate can be reused for genipin extraction . after evaporating butyl acetate , an off - white or slightly yellow powder was obtained . the powder contains 90 . 9 % w / w of genipin . the genipin - rich extract made by the method in example 2 was tested for stability . genipin - rich powder , 0 . 20 g each , was sealed in vials and stored at 4 ยฐ c . samples were pulled at 0 , 4 wks , 6 wks , and 12 wks , and genipin content was tested by using the hplc method . results are shown in table 1 . fifteen grams of genipin - rich extract made by the method in example 1 was dissolved in 118 . 10 g of 10 % ethanol solution . 16 . 89 g of 0 . 9 n solution of koh was added to the above mixture and the genipin was hydrolyzed with stirring at room temperature ( 22 ยฐ c .) for 7 . 5 hours . the ph of the hydrolyzed solution was adjusted to less than 4 . 0 with tartaric acid . the solution was heated to 74 ยฐ c . for 15 min and cooled . the precipitate was filtered out through # 2 filter paper . next , the ph of the filtrate was adjusted to ห 6 . 5 using calcium carbonate and the slurry was mixed for 10 minutes . the resulting precipitate was filtered off and the filtrate ph was adjusted to 4 . 0 - 4 . 5 by the addition of acetic acid . after alanine ( 4 . 50 g ) was added , genipin red color was developed by heating to 82 ยฐ c . for 2 hrs . the color was analyzed by taking 0 . 30 g of genipin red color and diluting to 30 . 0 g with di water . l -, a -, and b - values were measured on a hunter lab spectrometer , and the absorption curve measured on a uv / vis spectrometer . results are shown in the following table . three grams of genipin - rich extract made by the method in example 2 was dissolved in 23 . 5 g of 10 % ethanol solution . 3 . 78 g of 1 . 0n solution of koh was added to the above mixture and the genipin was hydrolyzed with stirring at room temperature ( 22 ยฐ c .) for 8 . 0 hours . the ph of the hydrolyzed solution was adjusted to less than 4 . 0 with tartaric acid . the solution was heated to 74 ยฐ c . for 15 minutes and cooled . the precipate was removed by filtration on # 2 filter paper . next , the ph of the filtrate was adjusted to ห 7 . 0 using calcium carbonate and the slurry was mixed for 15 minutes . the resulting precipate was filtered off and the filtrate ph was adjusted to 4 . 0 - 4 . 5 by the addition of acetic acid . after alanine ( 1 . 20 g ) was added , genipin red color was developed by heating to 84 ยฐ c . for 2 hours . the color was analyzed by taking 0 . 50 g of genipin red color and diluting to 30 . 0 g with di water . l -, a -, and b - values were measured on a hunter lab spectrometer , and the absorption curve measured on a uv / vis spectrometer . results are shown in the following table . one and a half grams of genipin - rich extract made by the method in example 2 was dissolved in 11 . 8 g of 10 % ethanol solution . 1 . 97 g of 1 . 0n solution of koh was added to the above mixture and the genipin was hydrolyzed with stirring at room temperature ( 22 ยฐ c .) for 8 . 0 hours . the ph of the hydrolyzed solution was adjusted to less than 4 . 0 with tartaric acid . the solution was heated to 74 ยฐ c . for 15 minutes and cooled . the precipitate was removed by filtration through # 2 filter paper . next , the ph of the filtrate was adjusted to ห 7 . 0 using calcium carbonate and the slurry was mixed for 15 minutes . the resulting precipitate was filtered off and the filtrate ph was adjusted to 4 . 0 - 4 . 5 by the addition of acetic acid . after alanine ( 0 . 60 g ), taurine ( 0 . 60 g ), and magnesium chloride ( 0 . 4486 g ) was added , a dark brown - black color was developed by heating to 84 ยฐ c . for 2 hours . the color was analyzed by taking 1 . 0 g of genipin color and diluting to 30 . 0 g with di water . l -, a -, and b - values were measured on a hunter lab spectrometer , and the absorption curve measured on a uv / vis spectrometer . results are shown in the following table . 0 . 108 g of genipin - rich extract , made by the method in example 2 , was dispersed in 8 . 6 g of 8 % ethanol aqueous solution in a test tube . solids were completely dissolved after heating in a ห 50 ยฐ c . water bath . then , 1 . 0 ml aliquots of the above genipin solution was put into test tubes separately and l - threonine 0 . 012 g , l - isoleucine 0 . 014 g , or l - histidine 0 . 016 g , respectively , were added . all test tubes were heated in an 80 ยฐ c . water bath for 2 hours . the color was analyzed by taking 0 . 30 g of genipin color produced and diluting to 30 . 0 g with di water . l -, a -, and b - values were measured on a hunter lab spectrometer , and the absorption curve measured on a uv / vis spectrometer . results are shown in the following table . 0 . 37 g of genipin - rich extract , made by the method in example 2 , was dispersed in 34 . 63 g of 10 % ethanol aqueous solution in a beaker . alanine 0 . 7 g , and xylose , 1 . 4 g , were added and dissolved . sample heated at 92 ยฐ c . for 1 hour . after cooling , the color was analyzed by taking 1 . 50 g of the color solution and diluting to 30 . 0 g with di water . the color was observed to be orange - red in contrast to the red color observed when alanine was mixed alone with the genipin - rich extract . l -, a -, and b - values were measured on a hunter lab spectrometer , and the results are shown in the following table . | 0 |
in an embodiment of the present invention , a backplane device using a 3 - tft approach is used ( 1 dual gate selection tft + 1 transfer tft ). compared to a 3 - tft lc backplane setup for a spatial light modulator as described in ep10156572 . 9 or in pct / ep / 2011 / 053912 , an oled is inserted instead of the pixel capacity . accordingly , the basic principle of the backplane device disclosed in ep10156572 . 9 or in pct / ep / 2011 / 053912 can be applied to the backplane device for the light source array or light source matrix according to the present invention . therefore , the entire content of the documents ep10156572 . 9 or pct / ep / 2011 / 053912 is incorporated herein by reference . for the backplane according to the present invention the voltage source connected to the analog line is replaced by a current source . the tfts are switching only digital , such there is no analog feedback into the pixel or into the circuitry of the pixel . the current flow is not regulated in the pixel circuit but thru outside drivers . this is especially applied for a cluster of the backplane device , wherein the backplane device comprises at least two , preferably many clusters . fig1 shows a 4 ร 4 pixel cluster of an embodiment of a backplane design . fig2 a and 2 b show in an enlarged representation two examples of the circuitry being used as a pixel circuitry 20 to drive one oled , which might be used as one pixel of the 4 ร 4 pixel cluster as shown in fig1 in the dotted circle . the schematic representation of the address decoder 24 for the x 0 to x 3 lines is shown by the rectangle above the 4 ร 4 pixel cluster in fig1 . the schematic representation of the address decoder 24 for the y 0 to y 3 lines is shown by the rectangle on the left hand side of the 4 ร 4 pixel cluster in fig1 . even though not shown in fig1 , it is also possible that the transistors of the x address decoder and / or the y address decoder is integrated into the 4 ร 4 pixel cluster . in other words , the transistors of the x address decoder and / or the y address decoder can be placed in between the pixels , such that a seamless sequence or arrangement of the pixel clusters can be achieved without gaps , even if every single pixel cluster comprises its own x address decoder and / or the y address decoder . the placement of the transistors of the x address decoder and / or the y address decoder can be done in a manner such that the transistors of the x address decoder and / or the y address decoder are not accumulated at one location , but rather are spread over the area of the cluster . the backplane device 16 according to the present invention therefore might comprise pixel circuitries for providing the on / off control of single pixels 14 . furthermore , address decoder circuits might be provided for addressing single pixels 14 . at least one address decoder circuit for a pixel cluster 18 might be assigned and / or located on the backplane device 16 at or near the location of the pixel cluster 18 either at the margin or the periphery of the pixel cluster 18 , as shown schematically in fig8 . alternatively , at least one address decoder circuit for a pixel cluster 18 might be integrated into and therefore might be located in the pixel cluster 18 . the address decoder circuit for a pixel cluster 18 might be distributed within the pixel cluster 18 . oled driving : a driving scheme is assumed that supports individual activation and deactivation of the pixels 14 / oleds di , 500 . a 3 - tft solution described for oled driving is shown in fig2 a and 2 b and fig9 and 10 and is adapted in a way to use the transfer - tft ( t_ti , 300 ) like a switch to close or open the connection between the analog line 22 and a ground line via the oled di , 500 . the selection tfts t_yi , 100 and t_xi , 200 in fig2 a , 2 b , 9 and 10 are used to address only one single pixel per cluster . the logic level of the โ enable โ- line 30 as shown in fig2 a , 2 b , 9 , 10 selects the type of the operation , e . g . โ 1 โ= enable and โ 0 โ= disable . after the address operation the current voltage value at the gate g of the transfer tft t_ti , 300 is maintained by the additional gate storage capacity c_si , see fig2 a , 2 b . nearly the same principle is used to store values in dram memory cells . the backplane device can be adapted such that a pixel being enabled by an enable address operation remains enabled the hole frame until it is disabled by a disable address operation . at frame start all pixels 14 are disabled . first a number of pixels 14 are enabled . if a predetermined ( e . g . a medium ) number n of pixels are enabled , the analog line is used to apply a current i t = n * i p were i p is the predetermined or desired current thru each oled pixel of the n enabled pixels . the total current i t is regulated by an external programmable current source connected to the oled display . if the number n of enabled pixels is changed , the current provided by the current source must be also adjusted to the new values . because only one pixel is enabled or disabled per address cycle in one embodiment the approximate value of the total current is changing only slowly compared to the address operations , if the total number n is quite high . for oled displays with very low gray scale resolution and a broad uniformity of the brightness , it can be supposed that the threshold voltages of all oleds are approximately equal and the r on of all transfer tfts ( t_ti , 300 ) are also approximately equal . now the brightness of an oled pixel can be adjusted by the duration an oled pixel is enabled . so the brightest pixels are switched on early in the frame and are disabled at the end of the frame . in other words , the light source of the pixel is to be operated for a pre - determinable time period . black pixels are not activated and dark pixels are only activated for a short time . because of the non linear characteristic curve of an oled , very small variations of the threshold voltage will result in large variations of the oled current ( i = f ( u )). if oleds with different threshold voltages are connected in parallel , the currents are not equally divided up between all enabled pixels . to compensate for this , the time an oled pixel is enabled must be adjusted by a correction factor computed from the current - voltage response curve of this pixel and from the curves of all other enabled pixels . if a large number of pixels are enabled , it is possible to use an average voltage response curve instead of the superposition of all other enabled pixels . this will reduce computing effort , because only a correction value stored for each pixel must be multiplied with the desired pixel brightness to compute the on - time of a pixel . however , this shows that a classification of the pixels and in particular of the oleds of the pixels according to a pixel characteristic is helpful for determining the order of switching the single light sources on and / or off depending on the pixel characteristic . if the threshold voltages are too different , nearly all current flows thru the oleds with the lowest threshold voltages . to prevent this , only oled pixels with similar threshold voltages are enabled at one time . for instance , pixels with high threshold voltages at frame start and pixels with low at the end . in this case , the average voltage response curve used to compute the correction values must be adapted equally to the average values of the enabled pixels . a calibration for all pixels might be performed , in order to determine the pixels with similar threshold voltages . this can be done by applying the measurement schemes mentioned above . these characteristics might be stored . in an embodiment of the present invention , a switch on is only performed for pixels with the similar threshold voltage . therefore , the pixels are sorted by the oled threshold voltage vt as a pixel characteristic . a number n of pixels with similar vt are connected to the analog line 22 . a programmable current source ( i_analog ) is connected to the analog line 22 . the total current ( i_analog ) is divided by the number of the parallel connected oled pixels . the current thru one oled di is about i_pixel = i_analog / n . the measurement of pixel characteristics can be performed as follows : if only one oled pixel per cluster is selected ( t_t conductive ) the electrical characteristics of each single oled can be measured one by one thru the analog line 22 . this can be done once after power - up or in the background . if for instance 1 % of the frame time is used to measure 1 % of the pixels , the measurement - cycle of 100 frames is short enough to compensate for aging effects . aging effects of oleds and a - si tfts are normally in time periods greater than 120 s . it is possible to measure the threshold voltage but also the voltage to current response curve according to the measurement schemes mentioned above . in a preferred embodiment , there is provided an external current regulation and a maximum current driving . an oled pixel ( i . e . the oled light source of a pixel ) is connected to the analog line 22 being adapted to act as a current source and is enabled by the enable operation ( enable line 30 on , x and y address line 26 , 28 on ). if a new pixel is connected to the analog line 22 , the total current i_analog has to be increased by the external programmable current source in order to maintain the maximum current flowing thru each enabled pixel and therefore through each oled light source of the enabled pixels . depending on the pixel brightness , after a time period the pixel is disconnected from the analog line by a disable operation ( x and y address line 26 , 28 on , enable line 30 off ). the start of the time period of a pixel being enabled is defined by its threshold voltage . the duration of the time period is defined mainly by the brightness of the pixel . because a large number of pixels are enabled at the same time the threshold voltages of these pixels are similar but not equal . this might result in small variations from the ideal current i_pixel = i_analog / n . a compensation with small offset values for start and duration ( position and length ) of the time period is computed depending on the division of the currents between the enabled pixels . because a pixel with maximum brightness is enabled only for a portion of the frame time , the oleds are pulsed with adapted higher maximum pixel current . additionally or alternatively , driving the oleds with different currents is provided . an oled display offers a very large on / off contrast ratio . depending on the desired brightness - resolution the time period of a very dark pixel is too short to address , if the pixel is driven with the maximum current for this pixel . to solve this problem , all dark pixels with similar threshold voltage vt are enabled only on special dark periods , where the driving current is reduced to a small portion of the maximum current ( for instance 10 %). the bright pixels with similar threshold voltage vt can be enabled at the dark period too , to shorten their duty cycle . but if these pixels are disabled , the current division is improved because of the lower number of pixels enabled at the same time . therefore , depending on the pixel characteristics , at least two groups g 1 , g 2 of pixels can be determined . the pixels of each pixel group g 1 or g 2 can be controlled collectively . two groups g 1 , g 2 of pixels are indicated by the different dotted lines of the two groups of pixels g 1 and g 2 as shown in fig1 . this might be applied on the complete light source matrix or in a cluster . in an implementation for an oled backplane structure or a backplane device 16 clusters 18 of pixels are used and the oled backplane structure comprises preferably only digital switching tfts ( thin film transistors ). a cluster of pixels in the sense of the present application is especially a plurality of pixels forming a connected or a contiguous region of the light source matrix or of the display . such a region might have a rectangular shape , a square shape , a honeycomb shape or any other suitable shape . preferably , a cluster does not extend over a full width or a full length of the display . several clusters can be arranged next to each other in a seamless manner . a cluster can be regarded as a sub - display . if negated and non negated address lines are used , address decoders can be integrated using only nmos a - si tfts . this requires a doubled amount of global address lines compared to a cmos implementation . a display with 60 fps ( frames per second ) and 64 ร 64 pixels per clusters need an a - si tft switching frequency of about 350 khz . a total of 0 . 22 tfts / pixel are needed to implement the address decoders . so this embodiment enables a driving of the oleds using a - si address decoders . fig3 shows an example cluster design comprising 4 ร 4 pixels . fig3 shows furthermore the pixel circuit and the address decoder circuits not being embedded into the pixel matrix . the address decoder circuits as shown above and to the left hand side of the 4 ร 4 pixel circuitry in fig3 correspond to the x and y address decoders 24 indicated by the rectangles as shown in fig1 . the static and dynamic pixel characteristics can be predicted with suitable models in order to compute the values for the external current source and the address operations . because the backplane circuit is only driven by digital values to compensate for the large tft variations , the analog pixel characteristics have to be measured / determined by external circuits . it might be necessary that a frame memory and a computing unit are needed to determine the driving parameters for each pixel . the characteristics of the backplane device according to a preferred embodiment can be outlined by the following features : a light source matrix with oled light sources used as a display with only 3 . 25 tfts / pixel are provided . a - si , p - si and amorphous oxide tfts are possible . digital switching tfts marginalize the ltps threshold voltages variations . power savings can be achieved because the oleds are directly driven through the very low r on of the transfer - tft . only one dac ( digital to analog converter ) per cluster is needed , not one per column line . the present invention supports very high on / off current ratios . new pixel circuits are achieved by multiplexing of an analog - line and one address - line , a combination of the enable - line and one address - line or both . more than 10 variations are possible , depending on the specific characteristic of the behaviour of the oleds . four examples are illustrated in fig2 a , 2 b , 9 and 10 . as address decoders normal existing variants like โ nand address decoder โ or โ nor address decoder โ can be applied . the address decoders can be embedded into the pixel matrix or can be arranged not being embedded into the pixel matrix . a global data distribution can be achieved by applying shift registers and / or global lines with amplification and / or global lines with a threshold circuit . examples for that are described e . g . in wo 2009 / 024523 a1 or wo 2009 / 092717 a1 . fig4 shows an example of a driving scheme for an example 4 ร 4 pixel cluster which is shown in fig1 or 3 . the tables being shown in fig4 b are to be completed on the right hand side of the tables shown in fig4 a . in fig4 a the x and y addressing and the enable e operation is shown . in the left table of fig4 a , the y - addressing operations of two the global y - addressing lines g_y 0 and g_y 1 as well as the four y - addressing lines y 0 , y 1 , y 2 and y 3 are shown . in the middle table of fig4 a , the x - addressing operations of two the global x - addressing lines g_x 0 and g_x 1 as well as of the four x - addressing lines x 0 , x 1 , x 2 and x 3 are shown . in the very left table entry of fig4 a , the enable or disable operation on the enable line of the pixel cluster is indicated . this is also shown in the very right table of fig4 a . the order of addressing and enabling is done from the top row to the bottom row in a sequential order . in the upper left table of fig4 b , the logic levels on the gates g 00 to g 33 of the transfer transistors of the pixels p 00 to p 33 are shown as a consequence of the addressing and enabling operations as shown in fig4 a . the reference g 00 relates to the gate of the transfer transistor of the pixel p 00 , the reference g 01 relates to the gate of the transfer transistor of the pixel p 01 and so on . a transfer transistor can either be in a conductive state โ then the logic level is 1 โ or in a non - conductive state โ then the logic level is 0 โ. it is indicated with a grey background when the logic level on one of the gates g 00 to g 33 changes from 0 to 1 or from 1 to 0 . for example , pixel p 11 is not enabled at all during the frame cycle as shown in the tables of fig4 a and 4 b ; pixel p 21 is enabled first , pixel p 12 is enabled thereafter . pixels p 21 and p 12 are enabled for the same amount of time and therefore appear with the same brightness and , because they are enabled for the longest duration , they appear as the brightest pixels with a value of 30 , as indicated in the lowest row of fig4 b being labelled with โ sum of brightness โ. in the table on the right side , the current values being applied on the analog line i_analog are indicated . in this example , every light source is operated with the same current value , e . g . with 1 arbitrary unit ( 1 a . u .). if e . g . two pixels are enabled , two times of the current value (= 2 a . u .) is supplied on the analog line . therefore , when 12 pixels are enabled , the twelvefold of the current value (= 12 a . u .) is supplied on the analog line . fig5 shows in a schematic diagram an example of the current characteristic of an analog line of a backplane device according to the prior art . the current i is shown in arbitrary units ( a . u .) as the function of the pixel number n for the duration of two frames . because of the addressing scheme of the prior art , wherein the pixels of a spatial light modulator and for a light source array or matrix are addressed line by line and within a single line are addressed one after another , different uniformly distributed currents between the range of 0 a . u . and 6 a . u . are applied on the analog line of the prior art backplane , whenever the next pixel according to the fixed addressing scheme is addressed . this results in driving analog values from the outside of the display area in a very fast manner , leading to the physical limits of the electronics of a backplane device , for example the large line capacities prevent increasing switching frequencies on the continues analog lines . this approach also makes a high precision of the tfts being applied necessary , in order to ensure analog signal quality . however , the frame rate or refresh rate of the spatial light modulator or the light source array or matrix can be increased according to the particulars of the present invention . according to the present invention , a pixel value assigning scheme being different to the one known from the prior art is used . this can be seen by the schematic diagram shown in fig6 a . the diagram in fig6 a shows a current characteristic 10 being a current function which is applied to the analog line of the backplane device , to which the pixels are connected . this current characteristic 10 shown in the diagram comprises the current values which are applied to the analog line during two frames . the current characteristic 10 comprises the shape of essentially a ramp up function for the first frame and comprises essentially a ramp down function for the second frame . a high precision of the pixel value or the current to flow through the light source of the pixel can be achieved , because the alteration of the current characteristic 10 comprises a relative low frequency . according to this embodiment of the invention , the current characteristic 10 has been generated depending on the pixel values which have to be assigned to single pixels of the light source matrix by the backplane device . because the current characteristic 10 is almost a function comprising a linear increase for the first frame and almost a linear decrease for the second frame , the pixel values to be assigned to the pixels are rather highly distributed . in other words , no regions comprising the same pixel value appear in the two frames which will be assigned by the current characteristic 10 of fig6 a , because if , for example โ
of all pixels would have the same pixel value , this would result in a region of the current characteristic 10 being horizontal or parallel to the abscissa as shown in the diagram of fig6 a . the schematic diagram according to fig6 b shows the pixel address signals which are applied to the addressing lines of the backplane device for the first frame . as can be seen , in this embodiment , high frequency signals are applied to the addressing lines . however , because these addressing signals are digital signals having the logical value of either 0 or 1 , this can be realized electronically at a higher frequency than realizing the high frequency analog values as they are shown for example in fig5 . fig7 a shows a schematic representation of a part of a light source matrix 12 comprising pixels 14 and comprising a backplane device ( not shown ) according to the prior art . the pixels 14 of the light source matrix 12 as shown in fig7 a comprise four different pixel values 15 being indicated with different hatching . in the example of fig7 a four pixels have been assigned with the maximum pixel value 15 of 100 %. three pixels 14 comprise the pixel value 15 of 66 %. six pixels 14 comprise the pixel value 15 of 33 % and the remaining three pixels comprise the pixel value 15 of 0 %. indicated by the numbers in each pixel 14 of the light source matrix 12 of fig7 a the address numbering of the single pixels 14 is indicated starting at 1 and ending at 16 . below the light source matrix 12 from fig7 a is indicated in the diagram the current characteristic 10 being a current function which is applied to the analog line of the backplane device , to which the pixels 14 are connected . on the abscissa , the fixed clock cycles of the pixels 14 being addressed are shown . the pixels 14 are addressed in a fixed order as shown on the abscissa , i . e . starting with pixel 1 and ending with pixel 16 . as a result , high frequency โ arbitrary โ values have to be applied on the analogue line , comparable to the ones shown in fig5 . the current characteristic 10 ( being 0 % to 100 %) is shown in dependence from the pixel address ( being 1 to 16 ). as can be seen , depending from the pixel values to be displayed with the light source matrix 12 , the current characteristic 10 is very fluctuating or comprises alternating current values , thus limiting the maximum speed with which the light source matrix 12 can be addressed or encoded . fig7 b shows a schematic representation of a part of a light source matrix 12 comprising pixels 14 comprising a backplane device ( not shown ) according to the present invention . the pixels 14 of the light source matrix 12 as shown in fig7 b display the same pixel values 15 as the light source matrix 12 as shown in fig7 a . because the addressing of the pixels 14 of the light source matrix 12 as shown in fig7 b is carried out in a different manner compared to the prior art , the address numbering of the pixels 14 ( being indicated by the numbers written in each pixel 14 ) of the light source matrix 12 depends on the pixel value 15 to be assigned to each pixel 14 . fig7 b below shows in a schematic representation the current characteristic 10 to be applied on the analog line ( not shown in fig7 a , 7 b ) for the pixel value 15 distribution as indicated in fig7 b above . on the abscissa of fig7 b the addressed pixels 1 to 16 are shown and the numbers are indicated in the pixels 14 of the light source matrix 12 . however , the order in which those 16 pixels are addressed is an order being indicated in the row below the addressed pixels . it appears that the order of addressing the pixels 14 is arbitrary . however , the order of addressing the pixels 14 depends on the pixel value 15 to be displayed with the light source matrix 12 . accordingly , the analog values being assigned to the different pixels 14 might have a characteristic of a ramp - up function having a low frequency of changing currents . as it can be seen , the current corresponding to the pixel value 15 of 0 % is applied to the analog line for a total of 3 pixel addressing cycles , i . e . the pixels 1 , 2 and 3 having the addresses 1 , 4 and 11 ( which correspond to the address numbering indicated in the pixels 14 of fig7 a ). the current corresponding to the pixel value 15 of 33 % is applied to the analog line for six pixel writing cycles , i . e . for the pixels 4 - 9 . the current corresponding to a pixel value 15 of 66 % is applied for three addressing cycles , i . e . for the pixels 10 - 12 . the current corresponding to the pixel value 15 of 100 % is assigned for four pixel addressing cycles to complete the assigning of all 16 pixels 14 of the light source matrix 12 for one frame as shown in fig7 b . each pixel 14 is enabled for the duration of a pixel cycle only , wherein the duration of the pixel cycles is essentially identical . as can be seen from fig6 a and 7 b , the current characteristic 10 is variable in time and in these examples has predominantly the characteristic a mathematically monotonic function . starting with the pixel value distribution of the pixels 14 of the light source matrix 12 as shown in fig7 a or 7 b , the current characteristic 10 as shown in fig7 b below is generated . in this example , a ramp up function is applied . therefore , the current characteristic 10 starts with the lowest current and increases to the highest current . therefore , the current characteristic 10 depends on the pixel values 15 to be assigned to the pixels 14 . this is to be understood in particular under the term โ pixel value assigning scheme โ. the current characteristic 10 is generated by a generating means not shown in fig7 b . once the current characteristic 10 has been generated depending on the pixel values 15 to be assigned to the pixels 14 , the pixel addresses of the pixels 14 to be addressed when the current characteristic 10 is applied to the analog line are determined . as can be seen , the pixels 14 comprising a pixel value 15 having 0 % will be addressed first . it is not necessary that the addresses of the pixels 14 having the 0 % pixel value 15 are exactly in the order as indicated above . a different order of assigning these pixel values 15 to the pixels 14 could be used as well . therefore , it is possible that the generated current characteristic 10 being applied to the at least one analog line determines the order of addressing of the pixels 14 . in this example , the addressing of all pixels 14 to which the same pixel value 15 is assigned is performed in temporal proximity to each other . advantageously , the analogue current can be ramped - up slowly from a minimum value to a maximum value with very few external drivers . the addresses or positions of the pixels to which a certain analog value is to be assigned is digitally transferred to the address decoders . if the backplane device comprises plurality of single clusters , then the addresses of all pixels of a cluster are digitally transferred to the address decoders of the cluster . fig8 shows an example of a backplane device 16 comprising a plurality of clusters 18 . fig8 does not show the complete backplane device 16 , but only a single section of it . therefore , only four clusters 18 are shown in fig8 . every cluster 18 comprises pixel circuits 20 being indicated schematically with single squares . every pixel circuit 20 is assigned to a pixel of the light source matrix ( not shown in fig8 ). according to the embodiment as shown in fig8 , the clusters 18 are controlled independently from each other . the pixels and therefore the pixel circuits 20 form a connected and contiguous region of the backplane device 16 as well as of the light source matrix to form the cluster 18 . the connected regions of this embodiment have a rectangular shape and the clusters 18 do not extent over the full with or over the full length of the backplane device 16 or the light source matrix . every cluster 18 comprises an analog line 22 as well as pixel addressing means 24 for addressing the pixels or the pixel circuits 20 of the cluster 18 . it is schematically indicated in fig8 , that pixel data coming for example for a computer are transferred to the display electronics of the display device in which the light source matrix and the backplane device 16 is included . the display electronics transfers the pixel values and the addressing values to the panel electronics of the backplane device 16 . depending on the particular configuration of the display device , the current characteristic 10 and the pixel address can be generated either in the computer or in the display electronics of the display device or in the panel electronics of the backplane device 16 . in fig8 it is indicated , that each cluster 18 comprises a connecting line between the panel electronics and the pixel addressing means 24 for transferring address information to the pixel addressing means 24 . it is schematically shown in fig8 that the pixel addressing means 24 is connected and / or comprises x - addressing lines 26 . the addressing means 24 for addressing the y - address of a pixel comprises y - addressing lines 28 . for achieving redundancy , a build - in โ software โ approach and / or additional redundancy circuits can be applied . the concept of the present invention can especially be applied in an advantageous way for display designs comprising backplanes using clusters , for example as disclosed in wo 2009 / 024523 a1 , wo 2009 / 092717 a1 , wo 2008 / 138983 , wo 2008 / 138984 , wo 2008 / 138985 , wo 2008 / 138986 or ep10156572 . 9 or pct / ep2011 / 053912 , all of which are copied with their whole content herein by reference . furthermore , the concept of the present invention can be applied for displays displaying 2d and 3d content . 3d displays might especially be stereoscopic displays , stereoscopic displays generating multi - views , auto - stereoscopic displays with tracking of the user &# 39 ; s eyes and holographic displays . such a 2d or 3d display could be operated in transmissive , in reflective or in transflective mode . such a 2d or 3d display could be working on the principle of oled , lcd ( liquid crystal display ) or pdp ( plasma display panel ). with the backplane device according to the present invention it is possible to scale up to larger sizes and resolutions for a light source array / light source matrix , especially because of the cluster approach . the display size is nearly unlimited , because the digital lines can be extended with registers and the analog line has very low frequency . it is furthermore possible to achieve power savings while operating the light source array / light source matrix with the backplane device according to the present invention , due to driving the light sources โ oleds โ directly over the low r on of the transfer tfts of the pixel circuits . a very high grey scale resolution and contrast can be obtained , because the oled current and / or the oled on - time can be controlled very precisely . with the backplane device according to the present invention it is possible to control the pixel value of each pixel ( e . g . the brightness at which each light source of the light source array or light source matrix is operated ) either by the duty cycle ( or duration per time interval ) each pixel is activated or by the current value being applied to each pixel ( or each light source ) or by the combination of both alternatives . the digital switching of the tfts of the pixel circuitry tolerate the threshold voltage changes caused by gate bias stress . especially if the light source array / light source matrix comprises oleds as single light sources , the lifetime of the oleds can be expanded advantageously , because a single oled is loaded with a rather constant current distribution during its duty cycle when being switched on when being driven by a backplane device according to the present invention compared to the rather peaked current distribution while being switched on when being driven by a backplane device according to the prior art . the low duty cycle of the pixel tfts allows to maintain digital function over the life time without compensation . higher duty cycle of pixel tfts are advantageous in respect to lengthen the life - time for each of them , but individual compensation might be necessary . because a smaller number of tfts for each pixel circuitry is needed , a higher yield in production of the backplane device can be achieved . the well known problem of tft gate bias stress is caused by impurity traps and other reasons of the tfts of an a - si backplane leading to charge trapping in tft as a reason for threshold - voltage shift . impurity traps are statistically distributed . the gate bias stress also statistically differs between tfts . according to the addressing scheme of the present invention , it is possible to individually address each pixel e . g . by a direct electrical connection from outside to each pixel allowing direct measurement of the characteristics of the pixel , e . g . the pixel circuitry and / or the light source . by these means , measurement can be easily controlled from outside the panel . such a measurement process can be performed in real - time as a background measurement process , e . g . within 1 % of the frame time . there is no need to implement additional tfts in matrix / on the pixels to carry out such measurements . the selection tfts ( t_yi , 100 ; t_xi , 200 ) according to the present invention comprise a low duty cycle . this allows to maintain the digital function of the selection tfts over the lifetime of the backplane device without substantive further compensation . it is also possible to reverse potential effects with a negative gate voltage pulse . tfts with medium duty cycles ( such as address decoder tfts ) can be sufficiently compensated with a collective pulse . this collective compensation is also possible for the pixel tfts (โ transfer tft โ, 300 ) for low duty cycle oled pixels . the concept of the backplane device according to the present invention also allows to individually compensate each pixel tft for oled duty cycles up to 100 %. as a result , brightness and colour of the pixel values will not change until the end of the lifetime . for example , the average duty cycles of the address decoder tfts are within the range between 10 % and 20 %. a compensation for the address decoder tfts can be done collectively . the average duty cycles of the selection tfts ( t_xi , t_yi according to fig2 ) are within the range between 0 . 2 % and 1 %. the selection tfts ( t_xi , t_yi ) do not need a compensation . the average duty cycles of the pixel driving tfts ( transfer tfts , according to fig2 ) are up to 80 %. a compensation for the pixel driving tfts ( transfer tfts , tip can be done individually or collectively depending on length of duty cycle . measurements of single tfts of all three types of tfts can be carried out on an individual basis . fig9 shows an example of two pixel circuitries 20 , 32 for two neighbouring pixels , each pixel circuitry 20 or 32 comprising three tfts 100 , 200 , 300 according to the second embodiment mentioned above . the two pixels are addressed by the same y - addressing line 28 . the first tft 100 of the first pixel circuitry 20 is connected to the x - addressing line 26 ( x 1 ) of the second pixel circuitry 32 โ as an enabling function and therefore indicated with reference numeral 30 โ, to the y - addressing line 28 and to the second tft 200 of the first pixel circuitry 20 . the second tft 200 of the first pixel circuitry 20 is connected to the first tft 100 of the first pixel circuitry 20 , to an x - addressing line 26 ( x 0 ) of the first pixel circuitry 20 and to the third tft 300 of the first pixel circuitry 20 . the third tft 300 of the first pixel circuitry 20 is connected to the second tft 200 of the first pixel circuitry 20 . the third tft 300 of the first pixel circuitry 20 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the first pixel circuitry 20 to the ground gnd . the first tft 100 of the second pixel circuitry 32 is connected to the x - addressing line 26 ( x 0 ) of the first pixel circuitry 20 โ as an enabling function and therefore indicated with reference numeral 30 โ, to the y - addressing line 28 and to the second tft 200 of the second pixel circuitry 32 . the second tft 200 of the second pixel circuitry 32 is connected to the first tft 100 of the second pixel circuitry 32 , to an x - addressing line 26 ( x 1 ) of the second pixel circuitry 32 and to the third tft 300 of the second pixel circuitry 32 . the third tft 300 of the second pixel circuitry 32 is connected to the second tft 200 of the second pixel circuitry 32 . the third tft 300 of the second pixel circuitry 20 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the second pixel circuitry 32 to the ground gnd . this embodiment does not have to have a separate enable line on the backplane device for the enablement functionality of a pixel . this is achieved by using the x - addressing line 26 of the one pixel as the enable line 30 for the other pixel of the two neighbouring pixels 20 , 32 . this can be done , if the logic level of the enable line 30 corresponds to the logic level of the x - addressing lines 26 . depending on whether a n - channel or p - channel transfer tft 300 or n - channel or p - channel selection tfts 100 , 200 are used , the following control schemes need to be applied ( x 0 , x 1 = signal being applied to the respective x - addressing line 26 , y = signal being applied to the y - addressing line 28 ): fig1 shows an example of four pixel circuitries 20 , 32 , 34 , 36 for four neighbouring pixels , each pixel circuitry 20 , 32 , 34 or 36 comprise three tfts 100 , 200 , 300 according to the third embodiment mentioned above . the four pixels are located adjacent to each other and are addressed by the same y - addressing line 28 . the first tft 100 of the first pixel circuitry 20 is connected to the x - addressing line 26 ( x 2 ) of the third pixel circuitry 34 โ as an enabling function and therefore indicated with reference numeral 30 โ, to the y - addressing line 28 and to the second tft 200 of the first pixel circuitry 20 . the second tft 200 of the first pixel circuitry 20 is connected to the first tft 100 of the first pixel circuitry 20 , to an x - addressing line 26 ( x 0 ) of the first pixel circuitry 20 and to the third tft 300 of the first pixel circuitry 20 . the third tft 300 of the first pixel circuitry 20 is connected to the second tft 200 of the first pixel circuitry 20 . the third tft 300 of the first pixel circuitry 20 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the first pixel circuitry 32 to the ground gnd . the first tft 100 of the second pixel circuitry 32 is connected to the x - addressing line 26 ( x 0 ) of the first pixel circuitry 20 โ as an enabling function and therefore indicated with reference numeral 30 โ, to the y - addressing line 28 and to the second tft 200 of the second pixel circuitry 32 . the second tft 200 of the second pixel circuitry 32 is connected to the first tft 100 of the second pixel circuitry 32 , to an x - addressing line 26 ( x 1 ) of the second pixel circuitry 32 and to the third tft 300 of the second pixel circuitry 32 . the third tft 300 of the second pixel circuitry 32 is connected to the second tft 200 of the second pixel circuitry 32 . the third tft 300 of the second pixel circuitry 32 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the second pixel circuitry 32 to the ground gnd . the first tft 100 of the third pixel circuitry 34 is connected to the x - addressing line 26 ( x 3 ) of the fourth pixel circuitry 36 as an enabling function and therefore indicated with reference numeral 30 , to the y - addressing line 28 and to the second tft 200 of the third pixel circuitry 34 . the second tft 200 of the third pixel circuitry 34 is connected to the first tft 100 of the third pixel circuitry 34 , to an x - addressing line 26 ( x 2 ) of the third pixel circuitry 34 and to the third tft 300 of the third pixel circuitry 34 . the third tft 300 of the third pixel circuitry 34 is connected to the second tft 200 of the third pixel circuitry 34 . the third tft 300 of the third pixel circuitry 34 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the third pixel circuitry 34 to the ground gnd . the first tft 100 of the fourth pixel circuitry 36 is connected to the x - addressing line 26 ( x 1 ) of the second pixel circuitry 32 โ as an enabling function and therefore indicated with reference numeral 30 โ, to the y - addressing line 28 and to the second tft 200 of the fourth pixel circuitry 36 . the second tft 200 of the fourth pixel circuitry 36 is connected to the first tft 100 of the fourth pixel circuitry 36 , to an x - addressing line 26 ( x 3 ) of the fourth pixel circuitry 36 and to the third tft 300 of the fourth pixel circuitry 36 . the third tft 300 of the fourth pixel circuitry 36 is connected to the second tft 200 of the fourth pixel circuitry 36 . the third tft 300 of the fourth pixel circuitry 36 is adapted to switch an electrical connection between the analog line 22 through the light source 500 of the fourth pixel 36 to the ground gnd . likewise to the second embodiment , this embodiment does not have to have a separate enable line on the backplane device for the enablement functionality of a pixel . this can be achieved , if for one pixel , the x - addressing line 26 of one of the other pixels of the four neighbouring pixels is used as the enable line 30 for this pixel . this can be done , if the logic level of the enable line 30 corresponds to the logic level of the x - addressing lines 26 . depending on whether a n - channel or p - channel transfer tft 300 or n - channel or p - channel selection tfts 100 , 200 are used , the following control schemes need to be applied ( x 0 , x 1 , x 2 , x 3 = signal being applied to the respective x - addressing line 26 , y = signal being applied to the y - addressing line 28 ): while the present invention has been described in conjunction with a specific embodiment , it is understood that many alternatives , modifications and variations will be apparent to those skilled in the art in light of the foregoing description . in particular , a person skilled in the art derives from the backplane device disclosed in the drawings and the description of this application a method to operate the backplane device according to the present invention and / or to use the backplane device according to the present invention for a specific purpose , e . g . to use it for a display device . accordingly , this invention is intended to embrace all such alternatives , modifications and variations which fall within the scope of the appended claims . | 6 |
the same reference numbers are used in the individual figures for the same or equivalent components . fig1 shows in a schematic view a block diagram of a sensor arrangement 1 according to the invention to record the position h and / or position change of a measured object 2 relative to an electromagnetic sensor 3 . a magnet 4 in the form of a permanent magnet is assigned to the measured object 2 , which is enclosed on almost all sides in the depicted variant by the measured object 2 . sensor 3 has a coil system 5 , which consists of a sensor coil 6 and a compensation coil 7 . in the area of influence of the coil system 5 a foil 8 of soft magnetic material is arranged . the sensor coil 6 has two terminals k 1 and k 2 . terminal k 1 is connected to the synchronizable oscillator 10 , terminal k 2 is connected to the input of an evaluation circuit 11 and the electrical contact 9 of the foil . the oscillator 10 supplies the sensor coil 6 with an alternating voltage of fixed frequency and amplitude . in this way an electromagnetic alternating field is generated by the sensor coil 6 , which induces eddy currents in foil 8 . the electromagnetic properties , like electrical conductivity ฯ and magnetic permeability ฮผ of the material of foil 8 , then influence the character and feedback of the eddy currents on the alternating field . through a distance change between measured object 2 with sensor 3 the magnetic permeability ฮผ of foil 8 changes , which leads to a change in alternating field in the coil system 5 . as a result of this , the complex impedance z of the sensor coil 6 changes , which is measured by means of evaluation circuit 11 . the voltage drop between terminals k 1 and k 2 is amplified with a difference amplifier 12 , in which the voltage u 2 at the output of the amplifier 12 is proportional to the impedance z of the sensor coil 6 . two orthogonal components u 3 and u 4 are determined for voltage u 2 by an electronic arrangement 13 . the voltage u 3 is used to control a controllable voltage source 14 , which supplies the compensation coil 7 of the coil system 5 with a direct current i_ . because of this a constant magnetic field is produced by the compensation coil 7 , which together with the magnetic field of permanent magnet 4 and the alternative field of sensor coil 6 forms a resulting magnetic field . the size of the direct current i_ is measured via the voltage drop on a stable resistor 15 by means of an integrator 16 . the signal at the output โ out 1 โ of integrator 16 is used to determine the distance changes between the measured object 2 and sensor 3 . the controllable voltage source 14 can be formed in different ways . a d / a converter or digital potentiometer can be used , which are driven via the signal u 3 . one possible embodiment is shown in fig8 and described in detail further below . the second voltage component u 4 , which is generated by the electronic arrangement from voltage u 2 , is used to synchronize oscillator 10 . because of this the voltage u 1 and voltage u 4 produced by the oscillator are synchronous . the sensor arrangement 1 could be used in a closed control loop , in which the signal u 3 is a control quantity determined as the difference between a target value in the memory of electronic arrangement 13 and the voltage u 2 . in another variant of the control loop the signal u 3 is interrupted and the voltage source 14 controlled manually , for example , via the keyboard , in order to reach a certain value of direct current i_ . the output signal is generated from โ out 2 โ of the electronic arrangement 13 . the relation between magnetic field distribution along the foil 8 and position h of magnet 4 will be explained with reference to fig2 ( a ) , ( b ), ( c ). the foil 8 consists of a nanocrystalline material that is applied to a support 17 , which consists of ceramic , for example . in this fig2 the significance of the redundancy factor is apparent : during a change in position of the measured object from distance h 1 to h 4 the distribution of permeability in the foil only varies by the path from a - b to g - h . this path is shortened by the redundancy factor relative to the path h covered by the measured object , in which the redundancy factor has a value of 3 , for example . fig2 ( a ) shows an arrangement consisting of a foil 8 applied to a support 17 and with which the distribution of the magnetic field generated by a permanent magnet 4 can be determined indirectly along foil 8 . a measurement coil 18 with a width ฮด = 3 mm is arranged in one layer around the support 17 and foil 8 . the measurement coil 18 is then configured so that it is movable in the longitudinal direction of foil 8 . the diagram depicted in fig2 ( b ) shows the amount of complex impedance of measurement coil 18 during a shift in measurement coil 18 in the x direction along foil 8 ( length of the foil l = 25 mm , width 5 mm and thickness 0 . 02 mm ). several impedance trends are shown in the diagram , which are obtained at different positions h of the measured object 2 relative to foil 8 . for clarification the positions h 1 = 60 mm , h 2 = 50 mm , h 3 = 40 mm and h 4 = 30 mm are given as numerical values this also shows how large the measurement range of such an arrangement can be set . the diagram of fig2 ( c ) schematically shows the area of the foil in which a maximum steepness of the impedance characteristic and therefore maximum sensitivity of the sensor using the soft magnetic foil is set . the areas are then shown for positions h 1 = 60 mm , h 2 = 50 mm , h 3 = 40 mm and h 4 = 30 mm . it is readily apparent that the areas ( a - b ), ( c - d ), ( e - f ) and ( g - h ) move in proportion to position h of the permanent magnet 4 . the relative sensitivity s is plotted more precisely in fig3 as a function of position h of the measured object 2 . the following applies for sensitivity s of sensor 3 : in which ฮดz / z is the relative impedance change of the sensor coil ( 7 ) and ฮดh the step width between the individual positions h . it is readily apparent that the relative sensitivity s assumes maximum values at position h 0 . in an area ยฑ ฮดh around position h 0 the relative sensitivity s still remains at significant values and is then significantly reduced . fig4 shows a diagram of the direct current trends dependent on the position change ยฑ ฮดh of a measured object relative to base position h 0 . the diagram shows that a linear function can be set up between the direct current i_ and the position changes of the permanent magnet ยฑ ฮดh . fig5 shows a first practical example of sensor arrangement according to the invention which consists of a measured object 2 and a sensor 3 . a permanent magnet 4 is incorporated in a housing of the measured object 2 so that the magnetic field direction agrees with the movement axis of the measured object 2 . the sensor 3 is designed flat and contains a support 17 on which two planar coils 6 and 7 are arranged on both sides . a circuit board or ceramic substrate could be used to support 17 and the coils 6 and 7 could be favorably produced by known methods , for example , screen printing on support 17 or gluing onto it . the support 17 with coils 6 and 7 is covered with two circuit boards 19 , 20 made of electrically conducting material , preferably aluminum or copper . the width โ ฮด โ of coils 6 and 7 is only about 25 % of the length โ l โ of foil 8 , which is glued onto one side of circuit board 20 . the coil 6 is supplied at high frequency alternating voltage and serves as measurement coil . the compensation coil 7 consists of several layers and is supplied with direct current . fig6 shows a second practical example of a sensor according to the invention . the sensor 3 consists of a round support 17 which is produced from a plastic . a first multilayer coil which serves as compensation coil 7 and is supplied with direct current is wound in a groove around support 17 . the measurement coil 6 , which is supplied by an oscillator with alternating current of higher frequency , is wound in one layer along support 17 and encloses the compensation coil 7 . a foil 8 of nanocrystalline or amorphous material is glued in the interior of a tube 21 . the tube 21 consists of a material with high electrical conductivity and simultaneously serves as sensor housing . the tube 21 is covered on a side of the measured object 2 with a cover 23 of electrically conducting material , which , however , is permeable for the permanent magnetic field ( h =) of the measured object 2 . the evaluation electronics 24 is incorporated in a housing 25 which should be connected to tube 21 and foil 8 for emc reasons . it is advantageous in this variant that the sensor 3 is completely encapsulated and shielded and can be incorporated directly without an additional pressure tube in a pressure space , for example , a hydraulic or pneumatic cylinder . fig7 shows a third variant of a sensor 3 in which a permanent magnet 4 is arranged at a specific fixed distance d to the coil system 5 of sensor 3 and does not move with the measured object 2 . the measured object 2 consists of ferromagnetic steel and is arranged at a base distance h to the surface of sensor 3 and is movable . in a first variant ( a ) the permanent magnet 4 is arranged on the side of the coil system 5 facing away from measured object 2 . this arrangement is particularly advantageous if relatively large measurement ranges , for example , 15 mm are measured with good linearity with a sensor 3 of limited size , for example , a diameter of 10 mm . in a second variant ( b ) the permanent magnet 4 is arranged between the measured object 2 and the coil system 5 . this variant can be used advantageously when small position changes ฮดh are to be measured at relatively large base distance h of , say , 25 - 30 mm and the diameter of the sensor is only 10 mm . in a third variant the coil system 5 of sensor 3 , which consists of two coils 6 and 7 , is wound concentrically on a support 17 . a foil 8 of soft magnetic material is arranged between coil 6 and 7 , which encloses coil 7 . coil 6 serves as a measurement coil whose impedance or the imaginary part im z of the impedance depends on distance h and is measured . the coil 7 is supplied with direct current and serves as compensation coil . a tube 26 made of an electrically conducting material , for example , aluminum or copper , is situated above it . the housing 25 could then be produced cost - effectively from a non - conducting material , for example , plastic . a direct current could be adjusted ( or set ) so that during position changes ฮดh between sensor 3 and measured object 2 the impedance or im z remains constant . in this case the level of the direct current is proportional to the position changes ฮดh . the measured object could also have a profiled surface , for example , a gear or a rotor so that rotational speed and / or angles can also be measured with the sensor . fig8 shows a circuit diagram of the controllable dc source for driving the compensation coil with the device according to fig1 . the dc source has an electronically adjustable digital potentiometer 27 which is driven via a control line 28 by a tracking control or keyboard . the digital potentiometer 27 is supplied symmetrically with a direct voltage by two operational amplifiers 29 , 30 , in which a reference voltage u ref lies between the non - inverting inputs of the operational amplifiers 29 , 30 . the potentiometer arm 31 of the digital potentiometer 27 is connected to the non - inverting input of an additional operational amplifier 32 . a coil 33 is arranged between the output of the operational amplifier 32 and its inverting input , over which a direct current i_ flows . the coil 33 is formed here by the compensation coil 7 of the circuit according to fig1 . the level of the direct current i_ is determined by a resistor 34 as a function of the voltage of the output of the operational amplifier 32 , which again depends on the position of the potentiometer arm 31 of the digital potentiometer . the circuit is then dimensioned so that in the middle position of potentiometer arm 31 the current i_ equals zero . depending on the position of the potentiometer arm , a positive or negative current can be produced . depending on the position of the working point of the sensor the polarity and level of the direct current i_ is set so that the constant sensitivity of the sensor is reached in the area ยฑ ฮดh . the voltage dropping over resistor 34 is measured via an integrator , which consists of an operational amplifier 35 , resistor 36 and capacitor 37 . finally , it is mentioned that the practical examples described above merely explain the claimed teachings , but do not restrict them to the practical examples . | 6 |
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those having skill in the art . referring to fig6 a , a sheet iron 50 of a 4 pole rotor 100 has at the center thereof a hole 41 into which a rotating shaft ( not shown ) is to be fixed , permanent magnets with a predetermined length and which are disposed oppositely and in parallel with the radius direction from the center of rotor 100 , and first permanent magnet receiving slots 51 to 54 and second permanent receiving slots 61 to 68 which are formed in such a manner that four pairs of permanent magnets are disposed in ladder - shape toward the outer surface of sheet iron 50 . planar - type permanent magnets are fixed into magnet receiving slots 51 to 54 and 61 to 68 . preferably , the angle between two opposing permanent magnets disposed in ladder - shape is 120 ยฐ to 170 ยฐ, and more preferably , 150 ยฐ, considering the smooth flow of the magnetic flux through the rotor . preferably , thickness of the permanent magnet is 2 % to 8 % of the circumference of the rotor , and the permanent magnets are disposed in such a manner that the magnetic poles of same polarity are opposed to each other by 180 ยฐ centering from the rotating shaft . for example , second permanent magnet receiving slots 67 and 68 are disposed to be more adjacent as they go away from the center toward the outer surface of the rotor . a magnetic flux leakage preventive groove 110 shaped as a recess is formed at the outer surface of the rotor . magnetic flux leakage preventive groove 110 is formed in such a manner that the center thereof is positioned at a point where the centerline between permanent magnetic receiving slots 67 and 68 crosses the circumference of the rotor . referring to fig6 b , magnetic flux leakage preventive groove 110 includes portion ( a ) between the end of permanent magnet receiving slot 68 and the outer surface of the rotor , portion ( b ) between the sidewall of permanent magnet receiving slot 63 and the sidewall of magnetic flux leakage preventive groove 110 , and portion ( c ) which is the bottom surface of magnetic flux leakage preventive groove 110 . here , preferably , length l1 of portion ( a ), length l2 of portion ( b ), and length l3 which is the depth of magnetic flux leakage preventive groove 110 excluding length l1 are 0 . 5 mm or shorter , respectively . if they are longer than 0 . 5 mm , the magnetic flux leakage prevention effect will be decreased . length l3 is longer than the air gap between the stator and the rotor , which prevents the useless magnetic flux caused by the circular outer surface of the rotor , i . e ., the magnetic flux leakage . in some cases , length l3 is within a range that does not exceed the thickness of the permanent magnets , and the width of magnetic flux leakage preventive groove does not exceed 1 . 2 times of the thickness of the permanent magnets . in such a manner , the magnetic flux generated at the end of the magnet may not pass magnetic flux leakage preventive groove 110 , and pass teeth 46 of stator 45 . referring to fig7 a and 7b , the magnetic flux passes through the air gap between the rotor and the stator , teeth 46 , and the main body of rotor 100 , and enters the adjacent permanent magnet of opposite polarity . the magnetic flux intends to flow via the medium having excellent magnetic permeability , and has less magnetic reluctance as the magnetic flux path is shorter . therefore , it is preferable to make the magnetic circuit as short as possible . in addition , if the magnetic flux is distributed densely at a certain position , the magnetic reluctance increases . therefore , it is preferable to uniformly distribute the magnetic flux . as shown in fig7 a and 7b , the magnetic flux is distributed uniformly , and specifically , in the rotor , the magnetic flux line in the magnet proceeds in one direction . the magnetic flux leakage where the magnetic flux generated from the end of the permanent magnet directly passes the permanent magnets can be reduced by magnetic flux leakage preventive groove 110 which is designed to have a magnetic reluctance smaller than those between the permanent magnet and teeth 46 and those between the end of the permanent magnet and the end of the adjacent permanent magnet . thereby , the magnetic flux leakage is reduced , and the magnetic flux generated from the end of the permanent magnet passes through teeth 46 , which substantially enhances a motor efficiency . according to the present invention , the amount of torque generated from the magnetomotive force of the stator is further increased than the conventional art assuming that the number of turns of coils and the current consumption are the same . in addition , the torque ripple is enhanced , too . in the present invention , arrangement of magnets of the rotor is enhanced , and the magnetic flux leakage preventive groove having an appropriate size is formed at the outer surface of the rotor , to thereby reduce the magnetic flux leakage and the core loss in the rotor . thus , an overheating during the operation of the motor is prevented , and the useful magnetic flux is increased . ultimately , further large amount of torque can be achieved , and the motor can be operated in a high efficiency . the same amount of torque can be obtained with the reduced size of the motor . in addition , the magnetic reluctance can be reduced by making the path along which the magnetic flux flows to be short as possible . as a result , maximum amount of torque can be obtained with the same current of the stator . in summary , grooves shaped as a recess are formed at the outer surface of the rotor to which the permanent magnets of different polarities are adjacently positioned , which minimize the magnetic flux leakage . a high torque can be obtained with the same power consumption , the torque ripple can be reduced , and the noise and the vibration can be minimized . this invention has been described above with reference to the aforementioned embodiments . it is evident , however , that many alternative modifications and variations will be apparent to those having skill in the art in light of the foregoing description . accordingly , the present invention embraces all such alternative modifications and variations as fall within the spirit and scope of the appended claims . | 7 |
we describe a novel nasogastric tube introducer device ( fig1 , 3 , 4 , 8a , 8b , 9a , 9b , 9c , 10a , 10b , 10c , 10d , 11a , 11b and 11c ) comprising guide means in order to guide the nasogastric tube into a subject , the guide means comprising a longitudinal hollow conduit having a peripheral wall defining a passageway therethrough extending from a first / proximal end to a second / distal end . when used , the second / distal end of the device is inserted into the nasal cavity of a patient and the first / proximal end remains outside the nose . the device is manoeuvred as it is inserted in order for the distal end to locate in the gastrointestinal tract . a nasogastric tube can then be relatively easily passed through the conduit to the stomach . preferably the conduit is curvilinear comprising a unique โ s โ shaped curvature ( see for example , fig1 , 3 , 4 # 6 ; 9 a ) that conforms to the anatomy of the nasopharynx area , the design being based on nasal passage profiles from patient ct scans . the curvature improves steering of the nasogastric tube towards the gastrointestinal tract . the shape of the device generates gentle torque that guides the insertion to land in the hypopharynx in optimal position for esophageal cannulation , giving the device a predictable landing zone in the esophagus . preferably the conduit has a posteriorly directed second / distal end ( fig1 # 7 , 9 a ). such a curvature further assists to guide the nasogastric tube away from the trachea towards the esophagus which is posterior to the larynx and reduces the chance of tracheal cannulation . a combination of the anatomically conforming curvilinear form and semi - rigid but flexible material reduces the likelihood of multiple nasogastric tube insertion attempts and results in a procedure that is less time - consuming than when x - rays are used for monitoring positioning . in a preferred embodiment , the nasogastric tube introducer device further comprises an alarm member mounted at the first / proximal end . the alarm member may be detachably mounted . in view of hygiene concerns , a disposable alarm would be favoured . in order to be more certain that the device is not misaligned in the trachea , the alarm member is attached to the first / proximal end of the device and works on the basis of air passing through the trachea to provide an indication whether the nasogastric tube is correctly positioned in the gastrointestinal tract or is misplaced in the lung of said subject . the auditory feedback mechanism produces a characteristic warning sound should cannulation of the trachea occur . this sound is not produced if the esophagus is successfully cannulated . an example of a suitable alarm is the disposable baam ยฎ beck airway airflow monitor device ( great plains ballistics , lubbock , tex ., usa ). the conduit preferably has a posteriorly directed round bevelled tip at the second / distal end ( fig1 # 2 ; 9 a , 9 b , 9 c ; 11 a , 11 b ). bevelling the tip improves air flow through the conduit for more effective triggering of the alarm member . the skilled person will appreciate that there may be several ways in which a nasogastric tube introducer device can be manufactured . one suitable method is by the use of 3d printing ; another is by extrusion . in a preferred embodiment of the invention , the nasogastric tube introducer device is comprised of a semi - rigid material and may have an elliptical cross - sectional profile . an elliptical profile provides an advantage because it more closely matches the elliptical shape of the inlet to the esophagus . it may be made of any suitable medical grade material such as plastic , polymers , latex , silicon or the like . preferably the device is engineered in a moderately stiff yet flexible silicone which confers steerability and a predictable landing at the desired target zone without overt discomfort to the patient . an example of a suitable silicone is nusil med - 4080 hcr ( nusil technology llc , ca 93013 usa ). the last two digits refer to the silicone hardness ( durometer , type a 80 , astm d2240 ). the tip of the posteriorly curved second / distal end ( fig9 a ; 11 a and 11 b ) is preferably comprised of a softer more compliant material to prevent mucosal injury . the compliant material may be silicone and an example of a suitable silicone is nusil med - 4930 ( nusil technology llc , ca 93013 usa ). the last two digits refer to the silicone hardness ( durometer , type a 30 , astm d2240 ). in a preferred embodiment , the nasogastric tube introducer device is coated on the inner ( luminal ) surface with a coating that reduces friction and can tolerate sterilization . an example of a suitable coating is nusil med - 6670 ( nusil technology llc , ca 93013 usa ). the last two digits refer to the silicone hardness ( durometer , type a 70 , astm d2240 ). preferably , the outer surface of the nasogastric tube introducer device is coated with a substance that reduces friction and can tolerate sterilization . an example of a suitable coating is a combination of nusil med - 6670 ( nusil technology llc , ca 93013 usa ) and parylene ( parylene coatings services , inc , tex . 77494 usa ). the alarm member may be composed of various suitable compounds , such as plastic and / or polymers and could be complex or simple in operation and readout . a simple version of the alarm member is whistle - like ( fig1 ; # 1 ), such as the disposable baam ยฎ beck airway airflow monitor device ( great plains ballistics , lubbock , tex ., usa ). a more complex alarm may be digital . the alarm may produce a distinct sound corresponding to the bidirectional airflow in the trachea of the subject ; wherein an audible signal indicates tracheal cannulation . the conduit preferably has a handle located at or near the first end ( fig1 # 4 ; 9 c ; 10 a , 10 b , 10 c and 10 d ). the ergonomic handle provides the user with more control over the device during insertion and positioning and prevents the proximal end from entering the nasal cavity . preferably , the conduit comprises a longitudinal slit ( see for example fig1 # 5 ), preferably in the form of a โ v - groove โ ( see for example , fig8 a , 8b and 10d ) defined in the peripheral wall of the conduit to enable the nasogastric tube to be moved out of the passageway defined by the conduit and separate the guide from the nasogastric tube . the purpose of this is to allow removal of the device from the subject without disturbing the nasogastric tube . the slit may be sealed in some way to prevent the nasogastric tube from inadvertently becoming dislodged from the device during the insertion and location procedure . preferably , the longitudinal slit comprises a tear - away mechanism to allow removal of the introducer once the ngt has passed through its hollow conduit into the esophagus ( fig8 a , 8b ; 10 d ). in a preferred embodiment the handle is configured to help the user insert and peel the guide with ease ( fig1 a , 10b , 10c and 10d ). it preferably has a curved design that allows placement of a thumb on either side to initiate the tearing of the guide to release it from the ngt . the skilled person would understand that other means for removing the device while leaving the nasogastric tube undisturbed in situ may be possible without deviating from the present invention . the conduit of the nasogastric tube introducer device may also comprise guide and / or depth markings ( fig1 # 9 ) and / or a reflective longitudinal line ( fig1 ; # 3 ). these markings assist the user to determine the position of the device within the nasal cavity , throat and esophagus during the insertion procedure . a reflective longitudinal line may help orientate the user as to which side should be facing upwards or downwards during the insertion . preferably the conduit is configured in shape and length so that its distal end is advanced to its position of intended use in the hypopharynx just above the cricopharyngeus muscle and enter the esophagus , to allow the ngt to be passed into the esophagus and reach the stomach . in a preferred embodiment , the device is manufactured using extrusion methods and the device is comprised of the following materials obtainable from nusil technology llc , ca 93013 usa and parylene coatings services , inc , texas 77494 usa : material for the guide : med - 4080 hcr ( durometer , type a 80 , astm d2240 ); material for the distal tip : med - 4930 ( durometer , type a 30 , astm d2240 ); material for the handle : med - 4950 lsr ( durometer , type a 50 , astm d2240 ); material for the over mold : med - 4950 lsr ( durometer , type a 50 , astm d2240 ); coating of inner surface : med 6670 ( durometer , type a 70 , astm d2240 ); coating of outer surface : med 6670 / parylene . an advantage of the present invention is that nurses would be incentivized to adopt this product because they could overcome the practical difficulties faced during insertion of nasogastric tubes , like coiling and poor maneuverability etc ., hence saving precious time . the present invention is suitable for stroke patients , elderly and the disabled with difficulty in swallowing . it should be best deployed in an inpatient setting , community hospitals or nursing homes . the nasogastric tube introducer device of the invention may be manufactured by 3d printing or by extrusion methods . in a preferred embodiment of the invention , the nasogastric tube introducer device is made from silicone by extrusion . the silicone extrusion process begins with blending a two - part silicone gumstock on a two - roll mill to produce a homogeneous medical - grade silicone . the silicone was then formed into strips and fed continuously into the extruder . once the required shape was acheived the medical grade tubing was passed through an oven to cure the product with radiant heat . for the device described herein a โ form fixture โ and โ over molds โ were developed to form and mold components . also , the soft tip was made as a separate mold and then fused together . suitable silicone material for the guide may be med - 4080 hcr ( high consistency rubber ) ( nusil technology llc , ca 93013 usa ) a two - part , high durometer ( type a 80 , astm d2240 ), tear resistant silicone elastomer . suitable material for the over mold and / or handle may be med - 4950 lsr ( liquid silicone rubber ) ( nusil technology llc , ca 93013 usa ), a two - part , translucent silicone system ( durometer , type a 50 , astm d2240 ) used with injection molding equipment . the inner surface of the silicone guide may be coated to decrease the coefficient of friction ( cof ) compared to the uncoated silicone and increase abrasion resistance . a suitable coating for the inner surface of the invention may be med 6670 ( nusil technology llc , ca 93013 usa ), a two - part silicone elastomer ( durometer , type a 70 , astm d2240 ) dispersed in xylene . the outer surface of the guide may also be coated with a protective polymeric substance . a suitable outer coating is known as parylene ( parylene coatings services , inc , texas 77494 usa ). a more preferred outer coating comprises a mixture of parylene and med 6670 . bedside clinical tests like the โ whoosh test โ and ph test have long been established to be inadequate for placement confirmation [ farrington m ., et al ., pediatr nurs 35 ( 1 ): 17 - 24 ( 2009 )]. the cxr is at present the most routinely used method to confirm placement inpatient , usually in combination with the previous tests . however , incidence of misplacement remains at 3 . 2 %, and reported deaths resulting from missed airway intubation are at 0 . 5 % [ de aguilar - nascimento , j . e . & amp ; kudsk , k . a . jpen j parenter enteral nutr 31 : 269 - 273 ( 2007 )]. colorimetry ( rightspot ) has not been formally trialled for safety and carries the risk of false negatives due to concurrent acid secretion or inability to aspirate gastric contents ( e . g . on an empty stomach , or a tube &# 39 ; s exit holes are against the stomach wall ) electromagnetic - guided placement ( cortrak ) is claimed to provide bedside direct visualization during ngt insertion , but it is costly and studies document success rates of only 80 %. in addition there have been 21 adverse events reported to the us fda manufacturer and user facility device experience ( maude ) database . ( conventional ) endoscopic placement of ngts allows direct visualization of the ngt in the esophagus but is costly , time - consuming and requires the expertise of a trained specialist . this method is reserved for patients with distorted anatomy , for example , by obstruction from a tumour . the iris system is essentially the same as endoscopic ngt placement without the steerability of an endoscope and shares the same problems of cost , time and requirement of specialist presence . capnography ( co2nfirm ) claims to provide immediate feedback but remains a somewhat costly option and also does not reliably rule out airway intubation [ melody ni et al ., emj gastroenterol 3 : 49 - 56 ( 2014 )]. the benefits or advantages of the present invention over other currently known methods were determined in a comparative study and are set out in table 2 . | 0 |
in cooperation with the attached drawings , the technical contents and detailed description of the present invention are described thereinafter according to preferable embodiment ( s ), being not used to limit its executing scope . any equivalent variation and modification made according to appended claims is all covered by the claims claimed by the present invention . fig2 shows the block diagram of the driving circuit for led ( hereinafter briefed as driving circuit ) according to the present disclosure . the driving circuit is used for led module 40 comprising a plurality of leds . the driving circuit mainly comprises a power source 10 , a voltage regulator 30 , a current control unit 50 and a switching control unit 70 . the power source 10 provides an input voltage vin . the voltage regulator 30 is electrically connected to the power source 10 and the led module 40 and comprises an energy - storing capacitor cd . depending on the input voltage vin , the voltage regulator 30 generates a charging current ic for charging energy - storing capacitor cd . alternatively , the energy - storing capacitor cd generates a discharging current id , depending on the input voltage vin . the current control unit 50 is electrically connected to the voltage regulator 30 and the led module 40 , and adapted to generate a driving current i led for the led module 40 when the discharging current id reaches a current threshold . the current control unit 50 is adapted to maintain constant current driving for the led module 40 . the switching control unit 70 is electrically connected to the power source 10 , the voltage regulator 30 and the current control unit 50 , and receives a feedback voltage vfb associated with the driving current i led for the led module 40 . the switching control unit 70 controls the voltage regulator 30 to stop generating the charging current ic when the feedback voltage vfb reaches a reference voltage . according to one example , the power source 10 receives an external ac power and employs a bridge rectifier and a filter to respectively rectify and filter the external ac power , thus providing the input voltage vin . namely , the input voltage vin is generated through voltage conversion , rectification and filtering . according to another example , the input voltage vin may be provided by a dc power source . the voltage regulator 30 is used to regulate the input voltage vin , namely the ac power source , to maintain constant current and constant voltage driving for the led module 40 , thus matching the input / output voltage for the led driving circuit . moreover , the driving circuit further comprises a feedback unit 60 electrically connected to the current control unit 50 and the switching control unit 70 , and used to convert the driving current i led to the feedback voltage vfb . more particularly , the feedback unit 60 senses the driving current i led flowing through the led module 40 and converts the sensed driving current i led to the feedback voltage vfb . the feedback unit 60 further provides the feedback voltage vfb to the switching control unit 70 and the switching control unit 70 correspondingly generates a control signal sc for controlling the voltage regulator 30 . in this manner , the voltage regulator 30 regulates the driving voltage for the led module 40 such that the requirement for constant current and constant voltage driving , and input / output matching can be met . the description of the driving circuit , especially the voltage regulator 30 , will be detailed later . fig3 shows the circuit diagram of the driving circuit according to the first embodiment the present disclosure . the voltage regulator 30 comprises a first transistor switch q 1 , a second transistor switch q 2 , an inductor ld , and an energy - storing capacitor cd . the voltage regulator 30 provides a voltage - increasing loop and a voltage - decreasing loop , where the voltage - increasing loop has a first voltage - increasing path and a second voltage - increasing path , and the voltage - decreasing loop has a first voltage - decreasing path and a second voltage - decreasing path . the more detailed description for the voltage - increasing loop and the voltage - decreasing loop will be made later with reference to fig4 to 7 . the first transistor switch q 1 is parallel connected to a first diode d 1 , and the second transistor switch q 2 is parallel connected to a second diode d 2 , where the first transistor switch q 1 and the second transistor switch q 2 are connected at a first common node p a and the first transistor switch q 1 and the second transistor switch q 2 are further connected , respectively through a first capacitor c 1 and a second capacitor c 2 to a second common node p b . the inductor ld has a first end connected to the first common node p a and a second end . the energy - storing capacitor cd has a first end connected to the second end of the inductor ld and the anode of the led module 40 and a second end connected to the second common node p b and the current control unit 50 . an intermediate voltage is defined between the first end and the second end of the energy - storing capacitor cd . the first transistor switch q 1 and the second transistor switch q 2 can be realized by mosfet or bjt . in the shown embodiment , the first transistor switch q 1 and the second transistor switch q 2 are mosfet switches and the gates of the first transistor switch q 1 and the second transistor switch q 2 are connected to each other to receive the control signal sc from the switching control unit 70 such that the first transistor switch q 1 and the second transistor switch q 2 can be controlled by the control signal sc . the switching control unit 70 mainly comprises a voltage comparator qpv and a voltage - division resistor network . the voltage - division resistor network comprises a first voltage - division resistor r 1 and a second voltage - division resistor r 2 in series with the first voltage - division resistor r 1 . the input voltage vin is applied to the series - connected first voltage - division resistor r 1 and second voltage - division resistor r 2 such that a reference voltage , which is a divided voltage of the input voltage vin , is present across the second voltage - division resistor r 2 . the invert input end of the voltage comparator qpv receives the feedback voltage vfb and the non - invert input end of the voltage comparator qpv receives the reference voltage vref such that the voltage comparator qpv compares the feedback voltage vfb with the reference voltage vref . the voltage comparator qpv outputs the control signal sc of high level when the reference voltage vref is larger than the feedback voltage vfb . the voltage comparator qpv outputs the control signal sc of low level when the reference voltage vref is equivalent to or smaller than the feedback voltage vfb . in this way , the switching control unit 70 controls the first transistor switch q 1 and the second transistor switch q 2 of the voltage regulator 30 to regulate the input voltage vin . therefore , the led module 40 can be adapted to input voltages of various magnitudes and maintain constant - voltage and constant - current operation . moreover , the first transistor switch q 1 can be an npn mosfet while the second transistor switch q 2 can be a pnp mosfet . alternatively , the first transistor switch q 1 can be a pnp mosfet while the second transistor switch q 2 can be an npn mosfet . in latter embodiment , the invert input end of the voltage comparator qpv receives the reference voltage vref and the non - invert input end of the voltage comparator qpv receives the feedback voltage vfb . in the embodiment shown in fig3 , the switching control unit 70 is realized by an led driver ic . the feedback unit 60 is realized by an optical coupler , which detects the driving current i led for the led module 40 and then generates corresponding feedback voltage vfb . the feedback voltage vfb is sent to the voltage comparator qpv to compare with the reference voltage vref . the current control unit 50 comprises a voltage - stabilization diode z d , and a voltage - stabilization resistor rv . the voltage - stabilization diode z d is , for example , a zener diode to stabilize the source of the switch qd . more particularly , the voltage - stabilization diode z d can provide a stabilization voltage of 2 . 5v . the current control unit 50 is electrically connected to the intermediate voltage through a resistor rd such that the driving current i led for the led module 40 is relevant to the intermediate voltage . more particularly , when the led module 40 is in normal lighting operation , the voltage - stabilization diode zd , and the voltage - stabilization resistor rv can be used to provide constant driving current i led for the led module 40 , which is the ratio between the stabilization voltage ( such as 2 . 5v ) and the voltage - stabilization resistor rv . fig4 to 7 show the circuit diagrams for the voltage regulator 30 in different operation modes . to simplify description , the first transistor switch q 1 is an npn mosfet while the second transistor switch q 2 is a pnp mosfet . moreover , in fig4 to 7 the symbol vin indicates an equivalent voltage of the ac input vac after rectifying and filtering , and the output control signal sc of the switching control unit 70 directly controls the gates of the first transistor switch q 1 and the second transistor switch q 2 . fig4 shows the voltage regulator 30 operated in the first mode , where the ac input vac starts to activate the driving circuit and no current flows through the led module 40 due to non - conduction of the led module 40 . at this time , the input voltage vin charges the inductor ld and the energy - storing capacitor cd as well as the resistor rd ( shown in fig3 ) such that a discharging current id through the resistor rd increases . at this time , the feedback voltage vfb sent to the voltage comparator qpv is smaller than the reference voltage vref ( voltage division of vin by the first voltage - division resistor r 1 and the second voltage - division resistor r 2 ) due to zero driving current i led through the led module 40 . therefore , the voltage comparator qpv output high - level control signal sc to turn on the first transistor switch q 1 and turn off the second transistor switch q 2 . as shown in fig4 , in this operation mode , the driving circuit provides a first voltage - increasing path lp 1 including , in sequence , the input voltage vin , the first transistor switch q 1 , the inductor ld , the energy - storing capacitor cd , the capacitor c 2 and then back to the input voltage vin . in this mode , the inductor ld and the energy - storing capacitor cd are in energy - storing operation and the voltage v led of the led module 40 increases gradually due to the continual charging of the inductor ld and the energy - storing capacitor cd . moreover , the voltage comparator qpv continues outputting high - level control signal sc to turn on the first transistor switch q 1 and turn off the second transistor switch q 2 when the feedback voltage vfb is still smaller than the reference voltage vref , thus still increasing the discharging current id . as shown in fig5 , the driving circuit is operated in the second operation mode . more particularly , the led module 40 starts to turn on and the driving current i led for the led module 40 starts to increase when the discharging current id such increases that the driving voltage ( the product of the discharging current id and the resistor rd ) is large enough to turn on the switch qd in serial connection with the led module 40 ( shown in fig3 ). at this time , the led module 40 is normally driven for lighting and the voltage comparator qpv outputs the control signal sc to turn off both the first transistor switch q 1 and the second transistor switch q 2 such that the inductor ld and the energy - storing capacitor cd are in energy - releasing operation . as shown in fig5 , in this operation mode , the driving circuit provides a second voltage - increasing path lp 2 including , in sequence , the inductor ld , the energy - storing capacitor cd , the capacitor c 2 , the second diode d 2 and then back to the inductor ld . as shown in fig6 , the driving circuit is operated in the third operation mode . more particularly , during the continual lighting of the led module 40 , the feedback unit 60 may sense an excessive driving current i led , which induces an excessive voltage v led . at this time , the feedback voltage vfb sent to the voltage comparator qpv is larger than the reference voltage vref and the voltage comparator qpv generates low - level control signal sc to turn off the first transistor switch q 1 and turn on the second transistor switch q 2 . the led module 40 in this mode is not conducted due to excessive voltage v led . as shown in fig6 , in this operation mode , the driving circuit provides a first voltage - decreasing path lp 3 including , in sequence , the input voltage vin , the capacitor c 1 , the energy - storing capacitor cd , the inductor ld , the second transistor switch q 2 and then back to the input voltage vin . in this mode , the voltage regulator 30 controls the voltage v led to decrease such that the led module 40 can be operated in constant driving voltage . as shown in fig7 , the driving circuit is operated in the fourth operation mode . more particularly , the voltage v led is such decreased that the led module 40 has normal lighting operation . the voltage comparator qpv generates the control signal sc to turn off both the first transistor switch q 1 and the second transistor switch q 2 . as shown in fig7 , in this operation mode , the driving circuit provides a second voltage - decreasing path lp 4 including , in sequence , the energy - storing capacitor cd , the inductor ld , the first diode d 1 , the capacitor c 1 , and then back to the energy - storing capacitor cd . the switching control unit 70 can use schemes other than those shown in fig4 to 7 to control the voltage regulator 30 . the other implementation ways can be exemplified as follows : ( 1 ) the first transistor switch q 1 is a pnp mosfet while the second transistor switch q 2 is an npn mosfet , and vice versa , while both switches are controlled by the control signal sc of the switching control unit 70 . ( 2 ) both of the first transistor switch q 1 and the second transistor switch q 2 can be the same type of mosfet , namely pnp mosfet or npn mosfet , while the switching control unit 70 generates control signals of opposite levels to respectively control the first transistor switch q 1 and the second transistor switch q 2 . ( 3 ) both of the first transistor switch q 1 and the second transistor switch q 2 can be the same type of mosfet , namely pnp mosfet or npn mosfet , while the switching control unit 70 generates a control signal used with a level inverter to control the first transistor switch q 1 and the second transistor switch q 2 with two signals of opposite levels . fig8 shows the circuit diagram of the driving circuit according to the second embodiment of the present disclosure . the second embodiment is similar to the first embodiment except that the second embodiment has a plurality of led modules 40 and each of the led modules 40 can keep constant - current and constant - voltage operation . in this embodiment , the transistor switch qd used by the current control unit 50 is realized by bipolar transistor . similarly , the voltage - stabilization diode z d also provide a stabilization voltage of 2 . 5v and cooperates with the voltage - stabilization resistor rv to provide a constant led driving current i led . the operation of the driving circuit shown in fig8 is similar to that of fig3 and the detailed description thereof is omitted here for brevity . to sum up , the driving circuit for led of the present disclosure has following advantages : 1 . the voltage regulator 30 can advantageously adjust the input voltage to maintain constant voltage and constant current driving for the led module , thus solving the matching issue between input and output of linear driving circuit . 2 . the voltage regulator 30 can adapt the driving circuit of the present disclosure to various input voltages such that the led lamp with the driving circuit can be used with worldwide voltage . 3 . the user can save the extra cost for led lamp and the led driver designer can save r & amp ; d labor and cost . as the skilled person will appreciate , various changes and modifications can be made to the described embodiment . it is intended to include all such variations , modifications and equivalents which fall within the scope of the present invention , as defined in the accompanying claims . | 8 |
fig1 . shows how a participant will understand the project , and begin to participate by uploading creative submissions to their chosen category . a total amount of money ( 10 ) ( subject or adjective ) is divided into three unequal categories or nouns ( 12 ) ( 14 ) ( 16 ) that together equal the sum of the total money ( 10 ); the money of each of the three nouns is then divided into five different possible verbs ( 18 ) that when read simultaneously together ( adjective , noun , verb ), create assignments for the users to submit art work to . there are five verbs to each of the three nouns for a total of fifteen verbs in a project . the three nouns equal the sum of the total project amount ( 10 ), and the five verbs equal the sum of the total nouns ( 12 )( 14 )( 16 ). the three nouns being unequal amounts of money create low to high amounts of money for all of the fifteen verbs ( if one noun is worth $ 25 . 00 and the other worth $ 50 . 00 , the verbs following the $ 25 . 00 noun will be worth less amount of money then the verbs following the $ 50 . 00 noun ). an even number of participants are accepted to participate in a daily project ( 20 )( 22 ), although rewarding only half of the participants ( 20 ) that signed up in a day , thus creating fair chances of being rewarded for each user , 50 / 50 or half and half . in operation the user will sign up free and play in any category long enough to be awarded up to the allowed amount of money available for free users . the user will upgrade his / her account for more access to the project . the user selects a category they want to participate in , thus reserving one of the ten available spots in that category . ten spots are available per category , so that each user has a fair chance at winning one of the five spots . after the user has reserved their spot in a category , they have up to one week to upload their artwork to be reviewed by an administrator in order to be rewarded . the five most creative submissions ( 18 ) per category win , ( one submission per verb ) a total of fifteen submissions are awarded per day . the user purchases a membership that allows more access to the other categories to earn more money available in the project , there are multiple memberships , a membership for each category ( 12 )( 14 )( 16 ), a membership for unlimited access to all three , a membership to be qualified for the end of the year scholarship drawing , and a membership to be qualified as an employee . the project provides people around the world with the chance to make more money off the website , while a portion of the profits are donated to charitable causes , and our very own scholarship foundation . there are many ways to build this website and have it operate according to fig1 . there are two scripting languages (. php and . net ) that can absolutely build this website to these functioning capabilities . there is no particular scripting language to use . it is a preference decided by a web developer . fig1 gets updated everyday with a new adjective , nouns and verbs . this maybe randomly selected or an administrator can select it . in order to keep the project fair for all users one user cannot win more than one of five spots ( 18 ) in a category ( 12 )( 14 )( 16 ). a user will enter a category and submit artwork to all five verbs , but the user may only win one of the five , leaving the four other spots available to four other users . depending on the users purchased membership they may be allowed access to more categories ( 12 )( 14 )( 16 ) per day . there are different levels of a membership based on the users desired amount of access . in operation the user signs up free , but is encouraged to purchase a membership . when their access to the project ( fig1 ) runs out the user may purchase a membership that allows more access to the richer categories ( 14 )( 16 ) all year in the project ( 10 ). a free user has numerous options to select from in order to keep playing . a returning user will log in and have instant access to the project ( 10 ). businesses will host a custom online store on their personal profile , and a portion of all the networks sales goes to charitable causes . any form of art may be entered , as long as it is uploaded within the due date of the project the most unique entries are awarded . in order for the user to begin to play he / she must have a way of receiving payment online , credit / debit , paypal account , or checking account . the website will be developed as a social network , in order for all the users to keep in contact with old friends or meet new and interesting people . the project ( 10 ) provides people around the world with the chances to make more money every day , while a portion of membership sales are donated to charitable causes . accordingly the reader will see that , according to one embodiment of the invention , i have provided the first type of economic stimulus in exchange for creative submissions to the project i developed . while the above description contains many specifics , these should not be construed as limitations on the scope of any embodiment , but as exemplifications of the presently preferred embodiments thereof . many other ramifications and variations are possible within the teachings of the various embodiments . for example , the adjective ( 10 ), nouns ( 12 ) ( 14 ) ( 16 ) and verbs ( 18 ) may be organized in whichever way to create criteria for the project . words may even be substituted by an activity , etc . the money being dispersed does not have to be of any particular amount , therefore creating room for expansion and more users to play per day . this project can be expanded thus to award more people each day when needed . thus the scope of the invention should be determined by the appended claims and their legal equivalents , and not by the examples given . | 6 |
to develop a new vaccinia vaccine strain , nyvac ( vp866 ), the copenhagen vaccine strain of vaccinia virus was modified by the deletion of six nonessential regions of the by the deletion of six nonessential regions of the genome encoding known or potential virulence factors . the sequential deletions are detailed below . all designations of vaccinia restriction fragments , open reading frames and nucleotide positions are based on the terminology reported in goebel et al ., 1990a , b . the deletion loci were also engineered as recipient loci for the insertion of foreign genes . the regions deleted in nyvac are listed below . also listed are the abbreviations and open reading frame designations for the deleted regions ( goebel et al ., 1990a , b ) and the designation of the vaccinia recombinant ( vp ) containing all deletions through the deletion specified : nyvac is a genetically engineered vaccinia virus strain that was generated by the specific deletion of eighteen open reading frames encoding gene products associated with virulence and host range . nyvac is highly attenuated by a number of criteria including i ) decreased virulence after intracerebral inoculation in newborn mice , ii ) inocuity in genetically ( nu + / nu + ) or chemically ( cyclophosphamide ) immunocompromised mice , iii ) failure to cause disseminated infection in immunocompromised mice , iv ) lack of significant induration and ulceration on rabbit skin , v ) rapid clearance from the site of inoculation , and vi ) greatly reduced replication competency on a number of tissue culture cell lines including those of human origin . nevertheless , nyvac based vectors induce excellent responses to extrinsic immunogens and provided protective immunity . trovac refers to an attenuated fowlpox that was a plaque - cloned isolate derived from the fp - 1 vaccine strain of fowlpoxvirus which is licensed for vaccination of 1 day old chicks . alvac is an attenuated canarypox virus - based vector that was a plaque - cloned derivative of the licensed canarypox vaccine , kanapox ( tartaglia et al ., 1992 ). alvac has some general properties which are the same as some general properties of kanapox . alvac - based recombinant viruses expressing extrinsic immunogens have also been demonstrated efficacious as vaccine vectors ( tartaglia et al ., 1993 a , b ). this avipox vector is restricted to avian species for productive replication . on human cell cultures , canarypox virus replication is aborted early in the viral replication cycle prior to viral dna synthesis . nevertheless , when engineered to express extrinsic immunogens , authentic expression and processing is observed in vitro in mammalian cells and inoculation into numerous mammalian species induces antibody and cellular immune responses to the extrinsic immunogen and provides protection against challenge with the cognate pathogen ( taylor et al ., 1992 ; taylor et al ., 1991 ). recent phase i clinical trials in both europe and the united states of a canarypox / rabies glycoprotein recombinant ( alvac - rg ) demonstrated that the experimental vaccine was well tolerated and induced protective levels of rabiesvirus neutralizing antibody titers ( cadoz et al ., 1992 ; fries et al ., 1992 ). additionally , peripheral blood mononuclear cells ( pbmcs ) derived from the alvac - rg vaccinates demonstrated significant levels of lymphocyte proliferation when stimulated with purified rabies virus ( fries et al ., 1992 ). nyvac , alvac and trovac have also been recognized as unique among all poxviruses in that the national institutes of health (โ nih โ)( u . s . public health service ), recombinant dna advisory committee , which issues guidelines for the physical containment of genetic material such as viruses and vectors , i . e ., guidelines for safety procedures for the use of such viruses and vectors which are based upon the pathogenicity of the particular virus or vector , granted a reduction in physical containment level : from bl2 to bl1 . no other poxvirus has a bl1 physical containment level . even the copenhagen strain of vaccinia virus โ the common smallpox vaccine โ has a higher physical containment level ; namely , bl2 . accordingly , the art has recognized that nyvac , alvac and trovac have a lower pathogenicity than any other poxvirus . both nyvac - and alvac - based recombinant viruses have been shown to stimulate in vitro specific cd8 + ctls from human pbmcs ( tartaglia et al ., 1993a ). mice immunized with nyvac or alvac recombinants expressing various forms of the hiv - 1 envelope glycoprotein generated both primary and memory hiv specific ctl responses which could be recalled by a second inoculation ( tartaglia et al ., 1993a ). alvac - env and nyvac - env recombinants ( expressing the hiv - 1 envelope glycoprotein ) stimulated strong hiv - specific ctl responses from peripheral blood mononuclear cells ( pbmc ) of hiv - 1 infected individuals ( tartaglia et al ., 1993a ). acutely infected autologous pbmc were used as stimulator cells for the remaining pbmc . after 10 days incubation in the absence of exogenous il - 2 , the cells were evaluated for ctl activities . nyvac - env and alvac - env stimulated high levels of anti - hiv activities . thus , these vectors lend themselves well to ex vivo stimulation of antigen reactive lymphocytes ; for example , adoptive immunotherapy such as the ex vivo expression of tumor reactive lymphocytes and reinfusion into the host ( patient ). immunization of the patient with nyvac -, alvac -, or trovac - based recombinant viruses expressing taas produced by the patient &# 39 ; s tumor cells can elicit anti - tumor immune responses more rapidly and to sufficient levels to impede or halt tumor spread and potentially eliminate the tumor burden . clearly based on the attenuation profiles of the nyvac , alvac , and trovac vectors and their demonstrated ability to elicit both humoral and cellular immunological responses to extrinsic immunogens ( tartaglia et al ., 1993a , b ; taylor et al ., 1992 ; konishi et al ., 1992 ) such recombinant viruses offer a distinct advantage over previously described vaccinia - based recombinant viruses . the immunization procedure for such recombinant viruses as immunotherapeutic vaccines or compositions may be via a parenteral route ( intradermal , intramuscular or subcutaneous ). such an administration enables a systemic immune response against the specific taa ( s ). alternatively , the vaccine or composition may be administered directly into the tumor mass ( intratumor ). such a route of administration can enhance the anti - tumor activities of lymphocytes specifically associated with tumors ( rosenberg , 1992 ). immunization of the patient with nyvac -, alvac - or trovac - based recombinant viruses expressing taas produced by the patient &# 39 ; s tumor cells can elicit anti - tumor immune responses more rapidly and to sufficient levels to impede or halt tumor spread and potentially eliminate the tumor burden . the heightened tumor - specific immune response resulting from vaccinations with these poxvirus - based recombinant vaccines can result in remission of the tumor , including permanent remission of the tumor . examples of known taas for which recombinant poxviruses can be generated and employed with immunotherapeutic value in accordance with this invention include , but are not limited to p53 ( hollstein et al ., 1991 ), p21 - ras ( almoguera et al ., 1988 ), her - 2 ( fendly et al ., 1990 ), and the melanoma - associated antigens ( mage - 1 ; mze - 2 ) ( van der bruggen et al ., 1991 ), and p97 ( hu et al ., 1988 ) and the carcinoembryonic antigen ( cea ) associated with colorecteal cancer ( kantor et al ., 1993 ; fishbein et al ., 1992 ; kaufman et al ., 1991 ). more generally , the inventive vaccines or compositions ( vaccines or compositions containing the poxvirus art . such vaccines or compositions can be administered to a patient in need of such administration in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age , sex , weight , and condition of the particular patient , and the route of administration . the vaccines or compositions can be co - administered or sequentially administered with other antineoplastic , anti - tumor or anti - cancer agents and / or with agents which reduce or alleviate ill effects of antineoplastic , anti - tumor or anti - cancer agents ; again taking into consideration such factors as the age , sex , weight , and condition of the particular patient , and , the route of administration . examples of vaccines or compositions of the invention include liquid preparations for orifice , e . g ., oral , nasal , anal , vaginal , etc ., administration such as suspensions , syrups or elixirs ; and , preparations for parental , subcutaneous , intradermal , intramuscular or intravenous administration ( e . g ., injectable administration ) such as sterile suspensions or emulsions . in such compositions the recombinant poxvirus may be in admixture with a suitable carrier , diluent , or excipient such as sterile water , physiological saline , glucose or the like . the recombinant poxvirus of the invention can be provided in lyophilized form for reconstituting , for instance , in isotonic aqueous , saline buffer . further , the invention also comprehends a kit wherein the recombinant poxvirus is provided . the kit can include a separate container containing a suitable carrier , diluent or excipient . the kit can also include an additional anti - cancer , anti - tumor or antineoplastic agent and / or an agent which reduces or alleviates ill effects of antineoplastic , anti - tumor or anti - cancer agents for co - or sequential - administration . additionally , the kit can include instructions for mixing or combining ingredients and / or administration . the poxvirus vector technology provides an appealing approach towards manipulating lymphocytes and tumor cells for use in cell - based immunotherapeutic modalities for cancer . characteristics of the nyvac , alvac and trovac vectors providing the impetus for such applications include 1 ) their apparent independence for specific receptors for entry into cells , 2 ) their ability to express foreign genes in cell substrates despite their species - or tissue - specific origin , 3 ) their ability to express foreign genes independent of host cell regulation , 4 ) the demonstrated ability of using poxvirus recombinant viruses to amplify specific ctl reactivities from peripheral blood mononuclear cells ( pbmcs ), and 5 ) their highly attenuated properties compared to existing vaccinia virus vaccine strains ( reviewed by tartaglia et al ., 1993a ; tartaglia et al ., 1990 ). the expression of specific cytokines or the co - expression of specific cytokines with taas by nyvac -, alvac -, and trovac - based recombinant viruses can enhance the numbers and anti - tumor activities of ctls associated with tumor cell depletion or elimination . examples of cytokines which have a beneficial effect in this regard include tumor necrosis factor - ฮฑ ( tnf - ฮฑ ). interferon - gamma ( inf - gamma ), interleukin - 2 ( il - 2 ), interleukin - 4 ( il - 4 ), and interleukin - 7 ( il - 7 ) ( reviewed by pardoll , 1992 ). cytokine interleukin 2 ( il - 2 ) plays a major role in promoting cell mediated immunity . secreted by the t h 1 subset of lymphocytes , il - 2 is a t cell growth factor which stimulates division of both cd4 + and cd8 + t cells . in addition , il - 2 also has been shown to activate b cells , monocytes and natural killer cells . to a large degree the biological effects of il - 2 are due to its role in inducing production of ifnฮณ . recombinant vaccinia virus expressing il - 2 is attenuated in mice compared to wild - type vaccinia virus . this is due to the ability of the vaccinia - expressed il - 2 to stimulate mouse nk cells to produce ifnฮณ , which limits the growth of the recombinant vaccinia virus ( karupiah et al ., 1990 ). similarly , it has been shown that inoculation of immunodeficient athymic nude mice with recombinant vaccinia virus expressing both il - 2 and the ha gene of influenza can protect these mice from subsequent challenge with influenza virus ( karupiah et al ., 1992 ). cytokine interferon ฮณ ( ifnฮณ ) is secreted by the t h 1 subset of lymphocytes . ifnฮณ promotes the t h 1 cell mediated immune response , while inhibiting the t h 2 ( antibody ) response . ifnฮณ induces the expression of major histocompatibility , complex ( mhc ) molecules on antigen presenting cells , and induces the expression of the b7 costimulatory molecule on macrophages . in addition to enhancing the phaqocytic activity of macrophages , ifnฮณ enhances the cytotoxic activity of nk cells . when expressed in replicating recombinant vaccinia virus , ifnฮณ limits the growth of the recombinant virus . this allows t cell immunodeficient mice to resolve the infection ( kohonen - corish et al ., 1990 ). cytokine interleukin 4 ( il - 4 ) is secreted by the t h 2 subset of lymphocytes . il - 4 promotes the t h 2 ( antibody ) response , while inhibiting the t h 1 cell mediated immune response . recombinant vaccinia virus expressing il - 4 shows increased pathogenicity in mice compared to wild - type vaccinia virus ( ramshaw et al ., 1992 ). cytokine granulocyte macrophage colony stimulating factor ( gmcsf ) is pleiotropic . in addition to stimulating the proliferation of cells of both the granulocyte and macrophage cell lineages , gmcsf , in cross - competition with interleukins 3 and 5 ( il - 3 and il - 5 ), influences many other aspects of hematopoiesis and may play a role in facilitation of tumor cell growth ( lopez et al ., 1992 ). gmcsf is used clinically for hematopoietic reconstitution following bone marrow transplantation . cytokine interleukin 12 ( il - 12 ), formerly known as natural killer ( nk ) cell stimulatory factor , is a heterodimer composed of 35 kda and 40 kda subunits . il - 12 is produced by monocytes , macrophages , b cells and other accessory cells . il - 12 has pleiotropic effects on both nk cells and t cells . partly through its role in inducing ifnฮณ production , il - 12 plays a major role in promoting the t h 1 cell mediated immune response , while inhibiting the t h 2 response ( reviewed in trinchieri , 1993 ). recently , recombinant murine il - 12 has been demonstrated to have potent antitumor and antimetastatic effects in mice ( brunda et al ., 1993 ). b7 ( bb - 1 ), a member of the immunoglobin superfamily , is present on the surface of antigen presenting cells . interaction of the b7 molecule on antigen presenting cells with its receptors on t cells provides costimulatory signals , including il - 2 , which are necessary for t cell activation ( schwartz , 1992 ). recently it was shown that experimental co - expression of b7 along with a tumor antigen on murine melanoma cells can lead to regression of tumors in mice . this was accomplished by the b7 - assisted activation of tumor - specific cytotoxic t cells ( chen et al , 1992 ). the c - erb - b - 2 gene , which is conserved among vertebrates , encodes a possible receptor protein . the 185 kda translation product contains a kinase domain which is highly homologous to the kinase domain of the epidermal growth factor ( egf ) receptor . the c - erb - b - 2 gene is conserved among vertebrates , and is the same as the rat neu gene , which has been detected in a number of rat neuro / glioblastomas . the human c - erb - b - 2 gene , also known as her2 , is amplified in certain neoplasias , most notably breast cancer . in the gastric cancer cell line , mkn - 7 , both the normal 4 . 6 kb transcript encoding c - erb - b - 2 and a 2 . 3 kb transcript which specifies only the extracellular domain of the putative receptor are synthesized at elevated levels ( yamamoto et al ., 1986 ). the extracellular domain has been suggested as a potential immunogen for active specific immunotherapy of breast cancer ( fendly et al ., 1990 ). utility of nyvac -, alvac -, and trovac - based recombinant viruses expressing taas plus or minus specific cytokines for adoptive immunotherapy can take several forms . for one , genetic modification of pbmcs can be accomplished by vector - mediated introduction of taas , cytokine genes , or other genes and then directly reintroduced into the patient . such administration relies on the drainage or movement of modified pbmcs to lymphoid tissue ( i . e . spleen ; lymph nodes ) via the reticuloendothelial system ( res ) for elicitation of the tumor - specific immune response . pbmcs modified by infection with the pertinent nyvac -, alvac -, and trovac - based recombinant can be employed , for instance , in vitro , to expand taa - specific ctls for reinfusion into the patient . tumor - infiltrating lymphocytes ( tils ) derived from the tumor mass can be isolated , expanded , and modified to express pertinent genes using nyvac -, alvac -, or trovac - based recombinants viruses prior to reinfusion into the patient . tils retain the capability of returning to tumors ( homing ) when re - introduced into the subject ( rosenberg , 1992 ). thus , they provide a convenient vehicle for delivery of cytotoxic or cytostatic cytokines to tumor masses . cell - based active immunotherapy can also take on several potential modalities using the nyvac -, alvac -, and trovac vectors . tumor cells can be modified to express taas , cytokines , or other novel antigens ( i . e . class i or class ii major histocompatibility genes ). such modified tumor cells can subsequently be utilized for active immunization . the therapeutic potential for such an administration is based on the ability of these modified tumor cells to secrete cytokines and to alter the presentation of taas to achieve systemic anti - tumor activity . the modified tumor cells can also be utilized to expand tumor - specific ctls in vitro for reinfusion into the patient . a better understanding of the present invention and of its many advantages will be had from the following examples , given by way of illustration . dna cloning and synthesis . plasmids were constructed , screened and grown by standard procedures ( maniatis et al ., 1982 ; perkus et al ., 1985 ; piccini et al ., 1987 ). restriction endonucleases were obtained from bethesda research laboratories , gaithersburg , md ., new england biolabs , beverly , mass . ; and boehringer mannheim biochemicals , indianapolis , ind . kienow fragment of e . coli polymerase was obtained from boehringer mannheim biochemicals . bal - 31 exonuclease and phage t4 dna ligase were obtained from new england biolabs . the reagents were used as specified by the various suppliers . synthetic oligodeoxyribonucleotides were prepared on a biosearch 8750 or applied biosystems 380b dna synthesizer as previously described ( perkus et al ., 1989 ). dna sequencing was performed by the dideoxy - chain termination method ( sanger et al ., 1977 ) using sequenase ( tabor et al ., 1987 ) as previously described ( guo et al ., 1989 ). dna amplification by polymerase chain reaction ( pcr ) for sequence verification ( engelke et al ., 1988 ) was performed using custom synthesized oligonucleotide primers and geneamp dna amplification reagent kit ( perkin elmer cetus , norwalk , conn .) in an automated perkin elmer cetus dna thermal cycler . excess dna sequences were deleted from plasmids by restriction endonuclease digestion followed by limited digestion by bal - 31 exonuclease and mutagenesis ( mandecki , 1986 ) using synthetic oligonucleotides . cells , virus , and transfection . the origins and conditions of cultivation of the copenhagen strain of vaccinia virus has been previously described ( guo et al ., 1989 ). generation of recombinant virus by recombination , in situ hybridization of nitrocellulose filters and screening for b - galactosidase activity are as previously described ( piccini et al ., 1987 ). the origins and conditions of cultivation of the copenhagen strain of vaccinia virus and nyvac has been previously described ( guo et al ., 1989 ; tartaglia et al ., 1992 ). generation of recombinant virus by recombination , in situ hybridization of nitrocellulose filters and screening for b - galactosidase activity are as previously described ( panicali et al ., 1982 ; perkus et al ., 1989 ). the parental canarypox virus ( rentschler strain ) is a vaccinal strain for canaries . the vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts . a master viral seed was subjected to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages after which the stock virus was used as the parental virus in in vitro recombination tests . the plaque purified canarypox isolate is designated alvac . the strain of fowlpox virus ( fpv ) designated fp - 1 has been described previously ( taylor et al ., 1988a ). it is an attenuated vaccine strain useful in vaccination of day old chickens . the parental virus strain duvette was obtained in france as a fowlpox scale from a chicken . the virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chicken embryo fibroblast cells . the virus was subjected to four successive plaque purifications . one plaque isolate was further amplified in primary cef cells and a stock virus , designated as trovac , established . nyvac , alvac and trovac viral vectors and their derivatives were propagated as described previously ( piccini et al ., 1987 ; taylor et al ., 1988a , b ). vero cells and chick embryo fibroblasts ( cef ) were propagated as described previously ( taylor et al ., 1988a , b ). referring now to fig1 plasmid psd406 contains vaccinia hindiii j ( pos . 83359 - 88377 ) cloned into puc8 . psd406 was cut with hindiii and pvuii , and the 1 . 7 kb fragment from the left side of hindiii j cloned into puc8 cut with hindiii / smai , forming psd447 . psd447 contains the entire gene for j2r ( pos . 83855 - 84385 ). the initiation codon is contained within an nlaiii site and the termination codon is contained within an sspi site . direction of transcription is indicated by an arrow in fig1 . to obtain a left flanking arm , a 0 . 8 kb hindiii / ecori fragment was isolated from psd447 , then digested with nlaiii and a 0 . 5 kb hindiii / nlaiii fragment isolated . annealed synthetic oligonucleotides mpsyn43 / mpsyn44 ( seq id no : 1 / seq id no : 2 ) smai mpsyn43 5 taattaactagctacccggg 3 โฒ mpsyn44 3 โฒ gtacattaattgatcgatgggcccttaa 5 โฒ nla iii eco ri were ligated with the 0 . 5 kb hindiii / nlaiii fragment into puc18 vector plasmid cut with hindiii / ecori , generating plasmid psd449 . to obtain a restriction fragment containing a vaccinia right flanking arm and puc vector sequences , psd447 was cut with sspi ( partial ) within vaccinia sequences and hindiii at the puc / vaccinia junction , and a 2 . 9 kb vector fragment isolated . this vector fragment was ligated with annealed synthetic oligonucleotides mpsyn45 / mpsyn46 ( seq id no : 3 / seq id no : 4 ) hindiii smai noti ssp i mpsyn45 5 โฒ agcttcccgggtaagtaatacgtcaaggagaaaacgaaacgatctgtagttagcggccgcctaattaactaat 3 โฒ mpsyn45 mpsyn46 3 โฒ agggcccattcattatgcagttcctcttttgctttgctagacatcaatcgccggcggattaattgatta 5 โฒ mpsyn46 to combine the left and right flanking arms into one plasmid , a 0 . 5 kb hindiii / smai fragment was isolated from psd449 and ligated with psd459 vector plasmid cut with hindiii / smai , generating plasmid psd460 . psd460 was used as donor plasmid for recombination with wild type parental vaccinia virus copenhagen strain vc - 2 . 32 p labelled probe was synthesized by primer extension using mpsyn45 ( seq id no : 3 ) as template and the complementary 20mer oligonucleotide mpsyn47 ( seq id no : 5 ) ( 5 โฒ ttagttaattaggcggccgc 3 โฒ) as primer . recombinant virus vp410 was identified by plaque hybridization . referring now to fig2 plasmid psd419 contains vaccinia sali g ( pos . 160 , 744 - 173 , 351 ) cloned into puc8 . psd422 contains the contiguous vaccinia sali fragment to the right , sali j ( pos . 173 , 351 - 182 , 746 ) cloned into puc8 . to construct a plasmid deleted for the hemorrhagic region , u , b13r โ b14r ( pos . 172 , 549 - 173 , 552 ), psd419 was used as the source for the left flanking arm and psd422 was used as the source of the right flanking arm . the direction of transcription for the u region is indicated by an arrow in fig2 . to remove unwanted sequences from psd419 , sequences to the left of the ncoi site ( pos . 172 , 253 ) were removed by digestion of psd419 with ncoi / smai followed by blunt ending with klenow fragment of e . coli polymerase and ligation generating plasmid psd476 . a vaccinia right flanking arm was obtained by digestion of psd422 with hpai at the termination codon of b14r and by digestion with nrui 0 . 3 kb to the right . this 0 . 3 kb fragment was isolated and ligated with a 3 . 4 kb hincii vector fragment isolated from psd476 , generating plasmid psd477 . the location of the partial deletion of the vaccinia u region in psd477 is indicated by a triangle . the remaining b13r coding sequences in psd477 were removed by digestion with clai / hpai , and the resulting vector fragment was ligated with annealed synthetic oligonucleotides sd22mer / sd20mer ( seq id no : 6 / seq id no : 7 ) cla i bam hi hpa i sd22 mer 5 โฒ cgattact atg aaggatccgtt 3 โฒ sd20 mer 3 โฒ taatgatacttcctaggcaa 5 โฒ generating psd479 . psd479 contains an initiation codon ( underlined ) followed by a bamhi site . to place e . coli beta - galactosidase in the b13 - b14 ( u ) deletion locus under the control of the u promoter , a 3 . 2 kb bamhi fragment containing the beta - galactosidase gene ( shapira et al ., 1983 ) was inserted into the bamhi site of psd479 , generating psd479bg . psd479bg was used as donor plasmid for recombination with vaccinia virus vp410 . recombinant vaccinia virus vp533 was isolated as a blue plaque in the presence of chromogenic substrate x - gal . in vp533 the b13r โ b14r region is deleted and is replaced by beta - galactosidase . to remove beta - galactosidase sequences from vp533 , plasmid psd486 , a derivative of psd477 containing a polylinker region but no initiation codon at the u deletion junction , was utilized . first the clai / hpai vector fragment from psd477 referred to above was ligated with annealed synthetic oligonucleotides sd42mer / sd40mer ( seq id no : 8 / seq id no : 9 ) cla i sac i xho i hpa i sd42mer 5 โฒ cgattactagatctgagctccccgggctcgagggatccgtt 3 โฒ sd40mer 3 โฒ taatgatctagactcgaggggcccgagctccctaggcaa 5 โฒ bgl ii sma i bam hi generating plasmid psd478 . next the ecori site at the puc / vaccinia junction was destroyed by digestion of psd478 with ecori followed by blunt ending with klenow fragment of e . coli polymerase and ligation , generating plasmid psd478e โ . psd478e โ was digested with bamhi and hpai and ligated with annealed synthetic oligonucleotides hem5 / hem6 ( seq id no : 10 / seq id no : 11 ) bam hi eco ri hpa i hem5 5 โฒ gatccgaattctagct 3 โฒ hem6 3 โฒ gcttaagatcga 5 โฒ generating plasmid psd486 . psd486 was used as donor plasmid for recombination with recombinant vaccinia virus vp533 , generating vp553 , which was isolated as a clear plaque in the presence of x - gal . referring now to fig3 psd414 contains sali b cloned into puc8 . to remove unwanted dna sequences to the left of the a26l region , psd414 was cut with xbai within vaccinia sequences ( pos . 137 , 079 ) and with hindiii at the puc / vaccinia junction , then blunt ended with klenow fragment of e . coli polymerase and ligated , resulting in plasmid psd483 . to remove unwanted vaccinia dna sequences to the right of the a26l region , psd483 was cut with ecori ( pos . 140 , 665 and at the puc / vaccinia junction ) and ligated , forming plasmid psd484 . to remove the a26l coding region , psd484 was cut with ndei ( partial ) slightly upstream from the a26l orf ( pos . 139 , 004 ) and with hpai ( pos . 137 , 889 ) slightly downstream from the a26l orf . the 5 . 2 kb vector fragment was isolated and ligated with annealed synthetic oligonucleotides ati3 / ati4 ( seq id no : 12 / seq id no : 13 ) nde i bgl ii eco ri hpa i ati3 5 โฒ tatgagtaacttaactcttttgttaattaaaagtatattcaaaaaataagttatataaatagatctgaattcgtt 3 โฒ ati3 ati4 3 โฒ actcattgaattgagaaaacaattaattttcatataagttttttattcaatatatttatctagacttaagcaa 3 โฒ ati4 reconstructing the region upstream from a26l and replacing the a26l orf with a short polylinker region containing the restriction sites bglii , ecori and hpai , as indicated above . the resulting plasmid was designated psd485 . since the bglii and ecori sites in the polylinker region of psd485 are not unique , unwanted bglii and ecori sites were removed from plasmid psd483 ( described above ) by digestion with bglii ( pos . 140 , 136 ) and with ecori at the puc / vaccinia junction , followed by blunt ending with klenow fragment of e . coli polymerase and ligation . the resulting plasmid was designated psd489 . the 1 . 8 kb clai ( pos . 137 , 198 )/ ecorv ( pos . 139 , 048 ) fragment from psd489 containing the a26l orf was replaced with the corresponding 0 . 7 kb polylinker - containing clai / ecorv fragment from psd485 , generating psd492 . the balii and ecori sites in the polylinker region of psd492 are unique . a 3 . 3 kb bglii cassette containing the e . coli beta - galactosidase gene ( shapira et al ., 1983 ) under the control of the vaccinia 11 kda promoter ( bertholet et al ., 1985 ; perkus et al ., 1990 ) was inserted into the bglii site of psd492 , forming psd493kbg . plasmid psd493kbg was used in recombination with rescuing virus vp553 . recombinant vaccinia virus , vp581 , containing beta - galactosidase in the a26l deletion region , was isolated as a blue plaque in the presence of x - gal . to generate a plasmid for the removal of beta - galactosidase sequences from vaccinia recombinant virus vp581 , the polylinker region of plasmid psd492 was deleted by mutagenesis ( mandecki , 1986 ) using synthetic oligonucleotide mpsyn177 ( seq id no : 14 ) ( 5 โฒ aaaatgggcgtggattgttaactttatataacttattttttgaatatac 3 โฒ). in the resulting plasmid , pmp494ฮด , vaccinia dna encompassing positions [ 137 , 889 - 138 , 937 ], including the entire a26l orf is deleted . recombination between the pmp494ฮด and the beta - galactosidase containing vaccinia recombinant , vp581 , resulted in vaccinia deletion mutant vp618 , which was isolated as a clear plaque in the presence of x - gal . referring now to fig4 vaccinia sali g restriction fragment ( pos . 160 , 744 - 173 , 351 ) crosses the hindiii a / b junction ( pos . 162 , 539 ). psd419 contains vaccinia sali g cloned into puc8 . the direction of transcription for the hemagglutinin ( ha ) gene is indicated by an arrow in fig4 . vaccinia sequences derived from hindiii b were removed by digestion of psd419 with hindiii within vaccinia sequences and at the puc / vaccinia junction followed by ligation . the resulting plasmid , psd456 , contains the ha gene , a56r , flanked by 0 . 4 kb of vaccinia sequences to the left and 0 . 4 kb of vaccinia sequences to the right . a56r coding sequences were removed by cutting psd456 with rsai ( partial ; pos . 161 , 090 ) upstream from a56r coding sequences , and with eagi ( pos . 162 , 054 ) near the end of the gene . the 3 . 6 kb rsai / eagi vector fragment from psd456 was isolated and ligated with annealed synthetic oligonucleotides mpsyn59 ( seq id no : 15 ), mpsyn62 ( seq id no : 16 ), mpsyn60 ( seq id no : 17 ), and mpsyn61 ( seq id no : 18 ) mpsyn59 rsa i 5 โฒ acacgaatgattttctaaagtatttggaaagttttataggt - mpsyn62 3 โฒ tgtgcttactaaaagatttcataaacctttcaaaatatcca - mpsyn59 agttgatagaacaaaatacataattt 3 โฒ mpsyn62 tcaactatct 5 โฒ mpsyn60 5 โฒ tgtaaaaataaatcactttttata - mpsyn61 3 โฒ tgttttatgtattaaaacatttttatttagtgaaaaatat - mpsyn60 bgl ii sma i pst i eaq i ctaagatctcccgggctgcagc 3 โฒ mpsyn61 gattctagagggcccgacgtcgccgg5 โฒ reconstructing the dna sequences upstream from the a56r orf and replacing the a56r orf with a polylinker region as indicated above . the resulting plasmid is psd466 . the vaccinia deletion in psd466 encompasses positions [ 161 , 185 - 162 , 053 ]. the site of the deletion in psd466 is indicated by a triangle in fig4 . a 3 . 2 kb bglii / bamhi ( partial ) cassette containing the e . coli beta - galactosidase gene ( shapira et al ., 1983 ) under the control of the vaccinia 11 kda promoter ( bertholet et al ., 1985 ; guo et al ., 1989 ) was inserted into the bglii site of psd466 , forming psd466kbg . plasmid psd466kbg was used in recombination with rescuing virus vp618 . recombinant vaccinia virus , vp708 , containing beta - galactosidase in the a56r deletion , was isolated as a blue plaque in the presence of x - gal . beta - galactosidase sequences were deleted from vp708 using donor plasmid psd467 . psd467 is identical to psd466 , except that ecori , smai and bamhi sites were removed from the puc / vaccinia junction by digestion of psd466 with ecori / bamhi followed by blunt ending with klenow fragment of e . coli polymerase and ligation . recombination between vp708 and psd467 resulted in recombinant vaccinia deletion mutant , vp723 , which was isolated as a clear plaque in the presence of x - gal . referring now to fig5 the following vaccinia clones were utilized in the construction of pmpcsk1ฮด . psd420 is sali h cloned into puc8 . psd435 is kpni f cloned into puc18 . psd435 was cut with sphi and religated , forming psd451 . in psd451 , dna sequences to the left of the sphi site ( pos . 27 , 416 ) in hindiii m are removed ( perkus et al ., 1990 ). psd409 is hindiii m cloned into puc8 . to provide a substrate for the deletion of the [ c7l โ k1l ] gene cluster from vaccinia , e . coli beta - galactosidase was first inserted into the vaccinia m2l deletion locus ( guo et al ., 1990 ) as follows . to eliminate the bglii site in psd409 , the plasmid was cut with bglii in vaccinia sequences ( pos . 28 , 212 ) and with bamhi at the puc / vaccinia junction , then ligated to form plasmid pmp409b . pmp409b was cut at the unique sphi site ( pos . 27 , 416 ). m2l coding sequences were removed by mutagenesis ( guo et al ., 1990 ; mandecki , 1986 ) using synthetic oligonucleotide the resulting plasmid , pmp409d , contains a unique bglii site inserted into the m2l deletion locus as indicated above . a 3 . 2 kb bamhi ( partial )/ bglii cassette containing the e . coli beta - galactosidase gene ( shapira et al ., 1983 ) under the control of the 11 kda promoter ( bertholet et al ., 1985 ) was inserted into pmp409d cut with bglii . the resulting plasmid , pmp409dbg ( guo et al ., 1990 ), was used as donor plasmid for recombination with rescuing vaccinia virus vp723 . recombinant vaccinia virus , vp784 , containing beta - galactosidase inserted into the m2l deletion locus , was isolated as a blue plaque in the presence of x - gal . a plasmid deleted for vaccinia genes [ c7l โ k1l ] was assembled in puc8 cut with smai , hindiii and blunt ended with klenow fragment of e . coli polymerase . the left flanking arm consisting of vaccinia hindiii c sequences was obtained by digestion of psd420 with xbai ( pos . 18 , 628 ) followed by blunt ending with klenow fragment of e . coli polymerase and digestion with bglii ( pos . 19 , 706 ). the right flanking arm consisting of vaccinia hindiii k sequences was obtained by digestion of psd451 with bglii ( pos . 29 , 062 ) and ecorv ( pos . 29 , 778 ). the resulting plasmid , pmp581ck is deleted for vaccinia sequences between the bglii site ( pos . 19 , 706 ) in hindiii c and the bglii site ( pos . 29 , 062 ) in hindiii k . the site of the deletion of vaccinia sequences in plasmid pmp581ck is indicated by a triangle in fig5 . to remove excess dna at the vaccinia deletion junction , plasmid pmp581ck , was cut at the ncoi sites within vaccinia sequences ( pos . 18 , 811 ; 19 , 655 ), treated with bal - 31 exonuclease and subjected to mutagenesis ( mandecki , 1986 ) using synthetic oligonucleotide mpsyn233 ( seq id no : 20 ) 5 โฒ- tgtcatttaacactatactcatattaataaaaataatatttatt - 3 โฒ. the resulting plasmid , pmpcsk1ฮด , is deleted for vaccinia sequences positions 18 , 805 - 29 , 108 , encompassing 12 vaccinia open reading frames [ c7l โ k1l ]. recombination between pmpcsk1ฮด and the beta - galactosidase containing vaccinia recombinant , vp784 , resulted in vaccinia deletion mutant , vp804 , which was isolated as a clear plaque in the presence of x - gal . construction of plasmid psd548 for deletion of large subunit , ribonucleotide reductanse ( i4l ) referring now to fig6 plasmid psd405 contains vaccinia hindiii i ( pos . 63 , 875 - 70 , 367 ) cloned in puc8 . psd405 was digested with ecorv within vaccinia sequences ( pos . 67 , 933 ) and with smai at the puc / vaccinia junction , and ligated , forming plasmid psd518 . psd518 was used as the source of all the vaccinia restriction fragments used in the construction of psd548 . the vaccinia i4l gene extends from position 67 , 371 - 65 , 059 . direction of transcription for i4l is indicated by an arrow in fig6 . to obtain a vector plasmid fragment deleted for a portion of the i4l coding sequences , psd518 was digested with bamhi ( pos . 65 , 381 ) and hpai ( pos . 67 , 001 ) and blunt ended using klenow fragment of e . coli polymerase . this 4 . 8 kb vector fragment was ligated with a 3 . 2 kb smai cassette containing the e . coli beta - galactosidase gene ( shapira et al ., 1983 ) under the control of the vaccinia 11 kda promoter ( bertholet et al ., 1985 ; perkus et al ., 1990 ), resulting in plasmid psd524kbg . psd524kbg was used as donor plasmid for recombination with vaccinia virus vp804 . recombinant vaccinia virus , vp855 , containing beta - galactosidase in a partial deletion of the i4l gene , was isolated as a blue plaque in the presence of x - gal . to delete beta - galactosidase and the remainder of the i4l orf from vp855 , deletion plasmid psd548 was constructed . the left and right vaccinia flanking arms were assembled separately in puc8 as detailed below and presented schematically in fig6 . to construct a vector plasmid to accept the left vaccinia flanking arm , puc8 was cut with bamhi / ecori and ligated with annealed synthetic oligonucleotides 518a1 / 518a2 ( seq id no : 21 / seq id no : 22 ) bam hi rsa i bgl ii eco ri 518a1 5 โฒ gatcctgagtactttgtaatataatgatatatattttcactttatctcatttgagaataaaaagatcttagg 3 โฒ 518a1 518a2 3 โฒ actcatgaaacattatattactatatataaaagtgaaatagagtaaactcttatttttctagaatccttaa 5 โฒ 518a2 forming plasmid psd531 . psd531 was cut with rsai ( partial ) and bamhi and a 2 . 7 kb vector fragment isolated . psd518 was cut with bglii ( pos . 64 , 459 )/ rsai ( pos . 64 , 994 ) and a 0 . 5 kb fragment isolated . the two fragments were ligated together , forming psd537 , which contains the complete vaccinia flanking arm left of the i4l coding sequences . to construct a vector plasmid to accept the right vaccinia flanking arm , puc8 was cut with bamhi / ecori and ligated with annealed synthetic oligonucleotides 518b1 / 518b2 ( seq id no : 23 / seq id no : 24 ) bam hi bgl ii sma i rsa i eco ri 518b1 5 โฒ gatccagatctcccgggaaaaaaattatttaacttttcattaatag - ggatttgacgtatgtagcgtactagg 3 โฒ 518b1 518b2 3 โฒ gtctagagggccctttttttaataaattgaaaagtaattatc - cctaaactgcatactacgcatgatccttaa 5 โฒ 518b2 forming plasmid psd532 . psd532 was cut with rsai ( partial )/ ecori and a 2 . 7 kb vector fragment isolated . psd518 was cut with rsai within vaccinia sequences ( pos . 67 , 436 ) and ecori at the vaccinia / puc junction , and a 0 . 6 kb fragment isolated . the two fragments were ligated together , forming psd538 , which contains the complete vaccinia flanking arm to the right of i4l coding sequences . the right vaccinia flanking arm was isolated as a 0 . 6 kb ecori / bglii fragment from psd538 and ligated into psd537 vector plasmid cut with ecori / bglii . in the resulting plasmid , psd539 , the i4l orf ( pos . 65 , 047 - 67 , 386 ) is replaced by a polylinker region , which is flanked by 0 . 6 kb vaccinia dna to the left and 0 . 6 kb vaccinia dna to the right , all in a puc background . the site of deletion within vaccinia sequences is indicated by a triangle in fig6 . to avoid possible recombination of beta - galactosidase sequences in the puc - derived portion of psd539 with beta - galactosidase sequences in recombinant vaccinia virus vp855 , the vaccinia i4l deletion cassette was moved from psd539 into prc11 , a puc derivative from which all beta - galactosidase sequences have been removed and replaced with a polylinker region ( colinas et al ., 1990 ). psd539 was cut with ecori / psti and the 1 . 2 kb fragment isolated . this fragment was ligated into prc11 cut with ecori / psti ( 2 . 35 kb ), forming psd548 . recombination between psd548 and the beta - galactosidase containing vaccinia recombinant , vp855 , resulted in vaccinia deletion mutant vp866 , which was isolated as a clear plaque in the presence of x - gal . dna from recombinant vaccinia virus vp866 was analyzed by restriction digests followed by electrophoresis on an agarose gel . the restriction patterns were as expected . polymerase chain reactions ( pcr ) ( engelke et al ., 1988 ) using vp866 as template and primers flanking the six deletion loci detailed above produced dna fragments of the expected sizes . sequence analysis of the pcr generated fragments around the areas of the deletion junctions confirmed that the junctions were as expected . recombinant vaccinia virus vp866 , containing the six engineered deletions as described above , was designated vaccinia vaccine strain โ nyvac .โ the gene encoding rabies glycoprotein g under the control of the vaccinia h6 promoter ( taylor et al ., 1988a , b ) was inserted into tk deletion plasmid psd513 . psd513 is identical to plasmid psd460 ( fig1 ) except for the presence of a polylinker region . referring now to fig7 the polylinker region was inserted by cutting psd460 with smai and ligating the plasmid vector with annealed synthetic oligonucleotides vq1a / vq1b ( seq id no : 25 / seq id no : 26 ) to form vector plasmid psd513 . psd513 was cut with smai and ligated with a smai ended 1 . 8 kb cassette containing the gene encoding the rabies glycoprotein g gene under the control of the vaccinia h6 promoter ( taylor et al ., 1988a , b ). the resulting plasmid was designated prw842 . prw842 was used as donor plasmid for recombination with nyvac rescuing virus ( vp866 ). recombinant vaccinia virus vp879 was identified by plaque hybridization using 32 p - labelled dna probe to rabies glycoprotein g coding sequences . the modified recombinant viruses of the present invention provide advantages as recombinant vaccine vectors . the attenuated virulence of the vector advantageously reduces the opportunity for the possibility of a runaway infection due to vaccination in the vaccinated individual and also diminishes transmission from vaccinated to unvaccinated individuals or contamination of the environment . the modified recombinant viruses are also advantageously used in a method for expressing a gene product in a cell cultured in vitro by introducing into the cell the modified recombinant virus having foreign dna which codes for and expresses gene products in the cell . construction of trovac - ndv expressing the fusion and hemagglutinin - neuraminidase glycoproteins of newcastle disease virus this example describes the development of trovac , a fowlpox virus vector and , of a fowlpox newcastle disease virus recombinant designated trovac - ndv and its safety and efficacy . a fowlpox virus ( fpv ) vector expressing both f and hn genes of the virulent ndv strain texas was constructed . the recombinant produced was designated trovac - ndv . trovac - ndv expresses authentically processed ndv glycoproteins in avian cells infected with the recombinant virus and inoculation of day old chicks protects against subsequent virulent ndv challenge . cells and viruses . the texas strain of ndv is a velogenic strain . preparation of cdna clones of the f and hn genes has been previously described ( taylor et al ., 1990 ; edbauer et al ., 1990 ). the strain of fpv designated fp - 1 has been described previously ( taylor et al ., 1988a ). it is a vaccine strain useful in vaccination of day old chickens . the parental virus strain duvette was obtained in france as a fowlpox scab from a chicken . the virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chicken embryo fibroblast cells . the virus was subjected to four successive plaque purifications . one plaque isolate was further amplified in primary cef cells and a stock virus , designated as trovac , established . the stock virus used in the in vitro recombination test to produce trovac - ndv had been subjected to twelve passages in primary cef cells from the plaque isolate . construction of a cassette for ndv - f . a 1 . 8 kbp bamhi fragment containing all but 22 nucleotides from the 5 โฒ end of the f protein coding sequence was excised from pndv81 ( taylor et al ., 1990 ) and inserted at the bamhi site of puc18 to form pce13 . the vaccinia virus h6 promoter previously described ( taylor et al ., 1988a , b ; guo et al ., 1989 ; perkus et al ., 1989 ) was inserted into pce13 by digesting pce13 with sali , filling in the sticky ends with klenow fragment of e . coli dna polymerase and digesting with hindiii . a hindiii - ecorv fragment containing the h6 promoter sequence was then inserted into pce13 to form pce38 . a perfect 5 โฒ end was generated by digesting pce38 with kpni and nrui and inserting the annealed and kinased oligonucleotides ce75 ( seq id no : 27 ) and ce76 ( seq id no : 28 ) to generate pce47 . in order to remove non - coding sequence from the 3 โฒ end of the ndv - f a smai to psti fragment from pce13 was inserted into the smai and psti sites of puci8 to form pce23 . the non - coding sequences were removed by sequential digestion of pce23 with saci , bamhi , exonuclease iii , si nuclease and ecori . the annealed and kinased oligonucleotides ce42 ( seq id no : 29 ) and ce43 ( seq id no : 30 ) were then inserted to form pce29 . the 3 โฒ end of the ndv - f sequence was then inserted into plasmid pce20 already containing the 5 โฒ end of ndv - f by cloning a psti - saci fragment from pce29 into the psti and saci sites of pce20 to form pce32 . generation of pce20 has previously been described in taylor et al ., 1990 . in order to align the h6 promoter and ndv - f 5 โฒ sequences contained in pce47 with the 3 โฒ ndv - f sequences contained in pce32 , a hindiii - psti fragment of pce47 was inserted into the hindiii and psti sites of pce32 to form pce49 . the h6 promoted ndv - f sequences were then transferred to the de - orfed f8 locus ( described below ) by cloning a hindiii - nrui fragment from pce49 into the hindiii and smai sites of pjca002 ( described below ) to form pce54 . transcription stop signals were inserted into pce54 by digesting pce54 with saci , partially digesting with bamhi and inserting the annealed and kinased oligonucleotides ce166 ( seq id no : 31 ) and ce167 ( seq id no : 32 ) to generate pce58 . a perfect 3 โฒ end for ndv - f was obtained by using the polymerase chain reaction ( pcr ) with pce54 as template and oligonucleotides ce182 ( seq id no : 33 ) and ce183 ( seq id no : 34 ) as primers . the pcr fragment was digested with pvuii and hpai and cloned into pce58 that had been digested with hai and partially digested with pvuii . the resulting plasmid was designated pce64 . translation stop signals were inserted by cloning a hindiii - hpai fragment which contains the complete h6 promoter and f coding sequence from pce64 into the hindiii and hpai sites of prw846 to generate pce71 , the final cassette for ndv - f . plasmid prw846 is essentially equivalent to plasmid pjca002 ( described below ) but containing the h6 promoter and transcription and translation stop signals . digestion of prw846 with hindiii and hvai eliminates the h6 promoter but leaves the stop signals intact . construction of cassette for ndv - hn . construction of plasmid prw802 was previously described in edbauer et al ., 1990 . this plasmid contains the ndv - hn sequences linked to the 3 โฒ end of the vaccinia virus h6 promoter in a puc9 vector . a hindiii - ecorv fragment encompassing the 5 โฒ end of the vaccinia virus h6 promoter was inserted into the hindiii and ecorv sites of prw802 to form prw830 . a perfect 3 โฒ end for ndv - hn was obtained by inserting the annealed and kinased oligonucleotides ce162 ( seq id no : 35 ) and ce163 ( seq id no : 36 ) into the ecori site of prw830 to form pce59 , the final cassette for ndv - hn . construction of fpv insertion vector . plasmid prw731 - 15 contains a 10 kb pvuii - pvuii fragment cloned from genomic dna . the nucleotide sequence was determined on both strands for a 3660 bp pvuii - ecorv fragment . the limits of an open reading frame designated here as f8 were determined . plasmid prw761 is a sub - clone of prw731 - 15 containing a 2430 bp ecorv - ecorv fragment . the f8 orf was entirely contained between an xbai site and an sspi site in prw761 . in order to create an insertion plasmid which on recombination with trovac genomic dna would eliminate the f8 orf , the following steps were followed . plasmid prw761 was completely digested with xbai and partially digested with sspi . a 3700 bp xbai - sspi band was isolated from the gel and ligated with the annealed double - stranded oligonucleotides jca017 ( seq id no : 37 ) and jca018 ( seq id no : 38 ). construction of double insertion vector for ndv f and hn . the h6 promoted ndv - hn sequence was inserted into the h6 promoted ndv - f cassette by cloning a hindiii fragment from pce59 that had been filled in with klenow fragment of e . coli dna polymerase into the hpai site of pce71 to form pce80 . plasmid pce80 was completely digested with ndei and partially digested with bglii to generate an ndei - bglii 4760 bp fragment containing the ndv f and hn genes both driven by the h6 promoter and linked to f8 flanking arms . plasmid pjca021 was obtained by inserting a 4900 bp pvuii - hindii fragment from prw731 - 15 into the smai and hindii sites of pbssk +. plasmid pjca021 was then digested with ndei and bglii and ligated to the 4760 bp ndei - bglii fragment of pce80 to form pjca024 . plasmid pjca024 therefore contains the ndv - f and hn genes inserted in opposite orientation with 3 โฒ ends adjacent between fpv flanking arms . both genes are linked to the vaccinia virus h6 promoter . the right flanking arm adjacent to the ndv - f sequence consists of 2350 bp of fpv sequence . the left flanking arm adjacent to the ndv - hn sequence consists of 1700 bp of fpv sequence . development of trovac - ndv . plasmid pjca024 was transfected into trovac infected primary cef cells by using the calcium phosphate precipitation method previously described ( panicali et al ., 1982 ; piccini et al ., 1987 ). positive plaques were selected on the basis of hybridization to specific ndv - f and hn radiolabelled probes and subjected to five sequential rounds of plaque purification until a pure indicate that expression of either hn or f alone is sufficient to elicit protective immunity against ndv challenge . work on other paramyxoviruses has indicated , however , that antibody to both proteins may be required for full protective immunity . it has been demonstrated that sv5 virus could spread in tissue culture in the presence of antibody to the hn glycoprotein but not to the f glycoprotein ( merz et al ., 1980 ). in addition , it has been suggested that vaccine failures with killed measles virus vaccines were due to inactivation of the fusion component ( norrby et al ., 1975 ). since both ndv glycoproteins have been shown to be responsible for eliciting virus neutralizing antibody ( avery et al ., 1979 ) and both glycoproteins , when expressed individually in a fowlpox vector are able to induce a protective immune response , it can be appreciated that the most efficacious ndv vaccine should express both glycoproteins . this example describes the development of alvac , a canarypox virus vector and , of a canarypox - rabies recombinant designated as alvac - rg ( vcp65 ) and its safety and efficacy . cells and viruses . the parental canarypox virus ( rentschler strain ) is a vaccinal strain for canaries . the vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts . a master viral seed was subjected to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages after which the stock virus was used as the parental virus in in vitro recombination tests . the plaque purified canarypox isolate is designated alvac . construction of a canarypox insertion vector . an 880 bp canarypox pvuii fragment was cloned between the pvuii sites of puc9 to form prw764 . 5 . the sequence of this fragment is shown in fig8 between positions 1372 and 2251 . the limits of an population was achieved . one representative plaque was then amplified and the resulting trovac recombinant was designated trovac - ndv ( vfp96 ). immunofluorescence . indirect immunofluorescence was performed as described ( taylor et al ., 1990 ) using a polyclonal anti - ndv serum and , as mono - specific reagents , sera produced in rabbits against vaccinia virus recombinants expressing ndv - f or ndv - hn . immunoprecipitation . immunoprecipitation reactions were performed as described ( taylor et al ., 1990 ) using a polyclonal anti - ndv serum obtained from spafas inc ., storrs , conn . the stock virus was screened by in situ plaque hybridization to confirm that the f8 orf was deleted . the correct insertion of the ndv genes into the trovac genome and the deletion of the f8 orf was also confirmed by southern blot hybridization . in ndv - infected cells , the f glycoprotein is anchored in the membrane via a hydrophobic transmembrane region near the carboxyl terminus and requires post - translational cleavage of a precursor , f 0 , into two disulfide linked polypeptides f 1 and f 2 . cleavage of f 0 is important in determining the pathogenicity of a given ndv strain ( homma and ohuchi , 1973 ; nagai et al ., 1976 ; nagai et al ., 1980 ), and the sequence of amino acids at the cleavage site is therefore critical in determining viral virulence . it has been determined that amino acids at the cleavage site in the ndv - f sequence inserted into fpv to form recombinant vfp29 had the sequence arg - arg - gln - arg - arg ( seq id no : 39 ) ( taylor et al ., 1990 ) which conforms to the sequence found to be a requirement for virulent ndv strains ( chambers et al ., 1986 ; espion et al ., 1987 ; le et al ., 1988 ; mcginnes and morrison , 1986 ; toyoda et al ., 1987 ). the hn glycoprotein synthesized in cells infected with virulent strains of ndv is an uncleaved glycoprotein of 74 kda . extremely avirulent strains such as ulster and queensland encode an hn precursor ( hno ) which requires cleavage for activation ( garten et al ., 1980 ). the expression of f and hn genes in trovac - ndv was analyzed to confirm that the gene products were authentically processed and presented . indirect - immunofluorescence using a polyclonal anti - ndv chicken serum confirmed that immunoreactive proteins were presented on the infected cell surface . to determine that both proteins were presented on the plasma membrane , mono - specific rabbit sera were produced against vaccinia recombinants expressing either the f or hn glycoproteins . indirect immunofluorescence using these sera confirmed the surface presentation of both proteins . immunoprecipitation experiments were performed by using ( 35 s ) methionine labeled lysates of cef cells infected with parental and recombinant viruses . the expected values of apparent molecular weights of the glycolysated forms of f 1 and f 2 are 54 . 7 and 10 . 3 kda respectively ( chambers et al ., 1986 ). in the immunoprecipitation experiments using a polyclonal anti - ndv serum , fusion specific products of the appropriate size were detected from the ndv - f single recombinant vfp29 ( taylor et al ., 1990 ) and the trovac - ndv double recombinant vfp96 . the hn glycoprotein of appropriate size was also detected from the ndv - hn single recombinant vfp - 47 ( edbauer et al ., 1990 ) and trovac - ndv . no ndv specific products were detected from uninfected and parental trovac infected cef cells . in cef cells , the f and hn glycoproteins are appropriately presented on the infected cell surface where they are recognized by ndv immune serum . immunoprecipitation analysis indicated that the f 0 protein is authentically cleaved to the f 1 and f 2 components required in virulent strains . similarly , the hn glycoprotein was authentically processed in cef cells infected with recombinant trovac - ndv . previous reports ( taylor et al ., 1990 ; edbauer et al ., 1990 ; boursnell et al ., 1990a , b , c ; ogawa et al ., 1990 ) would open reading frame designated as c5 were defined . it was determined that the open reading frame was initiated at position 166 within the fragment and terminated at position 487 . the c5 deletion was made without interruption of open reading frames . bases from position 167 through position 455 were replaced with the sequence ( seq id no : 39 ) gcttcccgggaattctagctagctagttt . this replacement sequence contains hindiii , smai and ecori insertion sites followed by translation stops and a transcription termination signal recognized by vaccinia virus rna polymerase ( yuen et al ., 1987 ). deletion of the c5 orf was performed as described below . plasmid prw764 . 5 was partially cut with rsai and the linear product was isolated . the rsai linear fragment was recut with bglii and the prw764 . 5 fragment now with a rsai to bglii deletion from position 156 to position 462 was isolated and used as a vector for the following synthetic oligonucleotides : oligonucleotides rw145 and rw146 were annealed and inserted into the prw 764 . 5 rsai and bglii vector described above . the resulting plasmid is designated prws31 . construction of insertion vector containing the rabies g gene . construction of prw838 is illustrated below . oligonucleotides a through e , which overlap the translation initiation codon of the h6 promoter with the atg of rabies g , were cloned into puc9 as prw737 . oligonucleotides a through e contain the h6 promoter , starting at nrui , through the hindiii site of rabies g followed by bglii . sequences of oligonucleotides a through e (( seq id no : 42 )-( seq id no : 46 )) are : a : ctgaaattatttcattatcgcgatatccgttaagtttgtatcgtaatggttcctcaggctctcctgtttgt ( seq id no : 42 ) b : cattacgatacaaacttaacggatatcgcgataatgaaataatttcag ( seq id no : 43 ) c : accccttctggtttttccgttgtgttttgggaaattccctatttacacgatcccagacaagcttagatctcag ( seq id no : 44 ) d : ctgagatctaagcttgtctgggatcgtgtaaatagggaatttcccaaaaca ( seq id no : 45 ) e : caacggaaaaaccagaaggggtacaaacaggagagcctgaggaac ( seq id no : 46 ) the diagram of annealed oligonucleotides a through e is as follows : a c -------------------------ยฆ--------------------------- -----------------ยฆ-------------------ยฆ--------------- b e d oligonucleotides a through e were kinased , annealed ( 95 ยฐ c . for 5 minutes , then cooled to room temperature ), and inserted between the pvuii sites of puc9 . the resulting plasmid , prw737 , was cut with hindiii and bglii and used as a vector for the 1 . 6 kbp hindiii - bglii fragment of ptg155pro ( kieny et al ., 1984 ) generating prw739 . the ptg155pro hindiii site is 86 bp downstream of the rabies g translation initiation codon . bglii is downstream of the rabies g translation stop codon in ptg155pro . prw739 was partially cut with nrui , completely cut with bglii , and a 1 . 7 kbp nrui - bglii fragment , containing the 3 โฒ end of the h6 promoter previously described ( taylor et al ., 1988a , b ; guo et al ., 1989 ; perkus et al ., 1989 ) through the entire rabies g gene , was inserted between the nrui and bamhi sites of prw824 . the resulting plasmid is designated prw832 . insertion into prw824 added the h6 promoter 5 โฒ of nrui . the prw824 sequence of bamhi followed by smai is ( seq id no : 47 ): ggatccccggg . prw824 is a plasmid that contains a nonpertinent gene linked precisely to the vaccinia virus h6 promoter . digestion with nrui and bamhi completely excised this nonpertinent gene . the 1 . 8 kbp prw832 smai fragment , containing h6 promoted rabies g , was inserted into the smai of prw831 , to form plasmid prw838 . development of alvac - rg . plasmid prw838 was transfected into alvac infected primary cef cells by using the calcium phosphate precipitation method previously described ( panicali et al ., 1982 ; piccini et al ., 1987 ). positive plaques were selected on the basis of hybridization to a specific rabies g probe and subjected to 6 sequential rounds of plaque purification until a pure population was achieved . one representative plaque was then amplified and the resulting alvac recombinant was designated alvac - rg ( vcp65 ) ( see also fig9 ). the correct insertion of the rabies g gene into the alvac genome without subsequent mutation was confirmed by sequence analysis . immunofluorescence . during the final stages of assembly of mature rabies virus particles , the glycoprotein component is transported from the golgi apparatus to the plasma membrane where it accumulates with the carboxy terminus extending into the cytoplasm and the bulk of the protein on the external surface of the cell membrane . in order to confirm that the rabies glycoprotein expressed in alvac - rg was correctly presented , immunofluorescence was performed on primary cef cells infected with alvac or alvac - rg . immunofluorescence was performed as previously described ( taylor et al ., 1990 ) using a rabies g monoclonal antibody . strong surface fluorescence was detected on cef cells infected with alvac - rg but not with the parental alvac . immunoprecipitation . preformed monolayers of primary cef , vero ( a line of african green monkey kidney cells atcc # ccl81 ) and mrc - 5 cells ( a fibroblast - like cell line derived from normal human fetal lung tissue atcc # ccl171 ) were inoculated at 10 pfu per cell with parental virus alvac and recombinant virus alvac - rg in the presence of radiolabelled 35 s - methionine and treated as previously described ( taylor et al ., 1990 ). immunoprecipitation reactions were performed using a rabies g specific monoclonal antibody . efficient expression of a rabies specific glycoprotein with a molecular weight of approximately 67 kda was detected with the recombinant alvac - rg . no rabies specific products were detected in uninfected cells or cells infected with the parental alvac virus . sequential passaging experiment . in studies with alvac virus in a range of non - avian species no proliferative infection or overt disease was observed ( taylor et al ., 1991b ). however , in order to establish that neither the parental nor recombinant virus could be adapted to grow in non - avian cells , a sequential passaging experiment was performed . the two viruses , alvac and alvac - rg , were inoculated in 10 sequential blind passages in three cell lines : ( 1 ) primary chick embryo fibroblast ( cef ) cells produced from 11 day old white leghorn embryos ; ( 2 ) vero cells โ a continuous line of african green monkey kidney cells ( atcc # ccl81 ); and ( 3 ) mrc - 5 cells โ a diploid cell line derived from human fetal lung tissue ( atcc # ccl171 ). the initial inoculation was performed at an m . o . i . of 0 . 1 pfu per cell using three 60 mm dishes of each cell line containing 2 ร 10 6 cells per dish . one dish was inoculated in the presence of 40 ฮผg / ml of cytosine arabinoside ( ara c ), an inhibitor of dna replication . after an absorption period of 1 hour at 37 ยฐ c ., the inoculum was removed and the monolayer washed to remove unabsorbed virus . at this time the medium was replaced with 5 ml of emem + 2 % nbcs on two dishes ( samples t0 and t7 ) and 5 ml of emem + 2 % nbcs containing 40 ฮผg / ml ara c on the third ( sample t7a ). sample t0 was frozen at โ 70 ยฐ c . to provide an indication of the residual input virus . samples t7 and t7a were incubated at 37 ยฐ c . for 7 days , after which time the contents were harvested and the cells disrupted by indirect sonication . one ml of sample t7 of each cell line was inoculated undiluted onto three dishes of the same cell line ( to provide samples t0 , t7 and t7a ) and onto one dish of primary cef cells . samples t0 , t7 and t7a were treated as for passage one . the additional inoculation on cef cells was included to provide an amplification step for more sensitive detection of virus which might be present in the non - avian cells , this procedure was repeated for 10 ( cef and mrc - 5 ) or 8 ( vero ) sequential blind passages . samples were then frozen and thawed three times and assayed by titration on primary cef monolayers . virus yield in each sample was then determined by plaque titration on cef monolayers under agarose . summarized results of the experiment are shown in tables 1 and 2 . the results indicate that both the parental alvac and the recombinant alvac - rg are capable of sustained replication on cef monolayers with no loss of titer . in vero cells , levels of virus fell below the level of detection after 2 passages for alvac and 1 passage for alvac - rg . in mrc - 5 cells , a similar result was evident , and no virus was detected after 1 passage . although the results for only four passages are shown in tables 1 and 2 the series was continued for 8 ( vero ) and 10 ( mrc - 5 ) passages with no detectable adaptation of either virus to growth in the non - avian cells . in passage 1 relatively high levels of virus were present in the t7 sample in mrc - 5 and vero cells . however this level of virus was equivalent to that seen in the t0 sample and the t7a sample incubated in the presence of cytosine arabinoside in which no viral replication can occur . this demonstrated that the levels of virus seen at 7 days in non - avian cells represented residual virus and not newly replicated virus . in order to make the assay more sensitive , a portion of the 7 day harvest from each cell line was inoculated onto a permissive cef monolayer and harvested at cytopathic effect ( cpe ) or at 7 days if no cpe was evident . the results of this experiment are shown in table 3 . even after amplification through a permissive cell line , virus was only detected in mrc - 5 and vero cells for two additional passages . these results indicated that under the conditions used , there was no adaptation of either virus to growth in vero or mrc - 5 cells . inoculation of macapues . four hiv seropositive macaques were initially inoculated with alvac - rg as described in table 4 . after 100 days these animals were re - inoculated to determine a booster effect , and an additional seven animals were inoculated with a range of doses . blood was drawn at appropriate intervals and sera analyzed , after heat inactivation at 56 ยฐ c . for 30 minutes , for the presence of anti - rabies antibody using the rapid fluorescent focus inhibition assay ( smith et al ., 1973 ). inoculation of chimpanzees . two adult male chimpanzees ( 50 to 65 kg weight range ) were inoculated intramuscularly or subcutaneously with 1 ร 10 7 pfu of vcp65 . animals were monitored for reactions and bled at regular intervals for analysis for the presence of anti - rabies antibody with the rffi test ( smith et al ., 1973 ). animals were re - inoculated with an equivalent dose 13 weeks after the initial inoculation . inoculation of mice . groups of mice were inoculated with 50 to 100 ฮผl of a range of dilutions of different batches of vcp65 . mice were inoculated in the footpad . on day 14 , mice were challenged by intracranial inoculation of from 15 to 43 mouse ld 50 of the virulent cvs strain of rabies virus . survival of mice was monitored and a protective dose 50 % ( pd 50 ) calculated at 28 days post - inoculation . inoculation of dogs and cats . ten beagle dogs , 5 months old , and 10 cats , 4 months old , were inoculated subcutaneously with either 6 . 7 or 7 . 7 log 10 tcid 50 of alvac - rg . four dogs and four cats were not inoculated . animals were bled at 14 and 28 days post - inoculation and anti - rabies antibody assessed in an rffi test . the animals receiving 6 . 7 log 10 tcid 50 of alvac - rg were challenged at 29 days post - vaccination with 3 . 7 log 10 mouse ld 50 ( dogs ) or 4 . 3 log 10 mouse ld 50 ( cats ) of the nygs rabies virus challenge strain . inoculation of squirrel monkeys . three groups of four squirrel monkeys ( saimiri sciureus ) were inoculated with one of three viruses ( a ) alvac , the parental canarypox virus , ( b ) alvac - rg , the recombinant expressing the rabies g glycoprotein or ( c ) vcp37 , a canarypox recombinant expressing the envelope glycoprotein of feline leukemia virus . inoculations were performed under ketamine anaesthesia . each animal received at the same time : ( 1 ) 20 ฮผl instilled on the surface of the right eye without scarification ; ( 2 ) 100 ฮผl as several droplets in the mouth ; ( 3 ) 100 ฮผl in each of two intradermal injection sites in the shaven skin of the external face of the right arm ; and ( 4 ) 100 ฮผl in the anterior muscle of the right thigh . four monkeys were inoculated with each virus , two with a total of 5 . 0 log 10 pfu and two with a total of 7 . 0 log 10 pfu . animals were bled at regular intervals and sera analyzed for the presence of antirabies antibody using an rffi test ( smith et al ., 1973 ). animals were monitored daily for reactions to vaccination . six months after the initial inoculation the four monkeys receiving alvac - rg , two monkeys initially receiving vcp37 , and two monkeys initially receiving alvac , as well as one naive monkey were inoculated with 6 . 5 log 10 pfu of alvac - rg subcutaneously . sera were monitored for the presence of rabies neutralizing antibody in an rffi test ( smith et al ., 1973 ). inoculation of human cell lines with alvac - rg . in order to determine whether efficient expression of a foreign gene could be obtained in non - avian cells in which the virus does not productively replicate , five cell types , one avian and four non - avian , were analyzed for virus yield , expression of the foreign rabies g gene and viral specific dna accumulation . the cells inoculated were : chicken embryo fibroblast cells produced from 11 day old white leghorn embryos were included as a positive control . all inoculations were performed on preformed monolayers of 2 ร 10 6 cells as discussed below . three dishes of each cell line were inoculated at 5 pfu / cell of the virus under test , allowing one extra dish of each cell line un - inoculated . one dish was incubated in the presence of 40 ฮผg / ml of cytosine arabinoside ( ara c ). after an adsorption period of 60 minutes at 37 ยฐ c ., the inoculum was removed and the monolayer washed twice to remove unadsorbed virus . medium ( with or without ara c ) was then replaced . cells from one dish ( without ara c ) were harvested as a time zero sample . the remaining dishes were incubated at 37 ยฐ c . for 72 hours , at which time the cells were harvested and used to analyze dna accumulation . each sample of 2 ร 10 6 cells was resuspended in 0 . 5 ml phosphate buffered saline ( pbs ) containing 40 mm edta and incubated for 5 minutes at 37 ยฐ c . an equal volume of 1 . 5 % agarose prewarmed at 42 ยฐ c . and containing 120 mm edta was added to the cell suspension and gently mixed . the suspension was transferred to an agarose plug mold and allowed to harden for at least 15 min . the agarose plugs were then removed and incubated for 12 - 16 hours at 50 ยฐ c . in a volume of lysis buffer ( 1 % sarkosyl , 100 ฮผg / ml proteinase k , 10 mm tris hcl ph 7 . 5 , 200 mm edta ) that completely covers the plug . the lysis buffer was then replaced with 5 . 0 ml sterile 0 . 5 ร tbe ( 44 . 5 mm tris - borate , 44 . 5 mm boric acid , 0 . 5 mm edta ) and equilibrated at 4 ยฐ c . for 6 hours with 3 changes of tbe buffer . the viral dna within the plug was fractionated from cellular rna and dna using a pulse field electrophoresis system . electrophoresis was performed for 20 hours at 180 v with a ramp of 50 - 90 sec at 15 ยฐ c . in 0 . 5 ร tbe . the dna was run with lambda dna molecular weight standards . after electrophoresis the viral dna band was visualized by staining with ethidium bromide . the dna was then transferred to a nitrocellulose membrane and probed with a radiolabelled probe prepared from purified alvac genomic dna . dishes were inoculated exactly as described above , with the exception that input multiplicity was 0 . 1 pfu / cell . at 72 hours post infection , cells were lysed by three successive cycles of freezing and thawing . virus yield was assessed by plaque titration on cef monolayers . dishes were inoculated with recombinant or parental virus at a multiplicity of 10 pfu / cell , allowing an additional dish as an uninfected virus control . after a one hour absorption period , the medium was removed and replaced with methionine free medium . after a 30 minute period , this medium was replaced with methionine - free medium containing 25 uci / ml of 35 s - methionine . infected cells were labelled overnight ( approximately 16 hours ), then lysed by the addition of buffer a lysis buffer . immunoprecipitation was performed as previously described ( taylor et al ., 1990 ) using a rabies g specific monoclonal antibody . results : estimation of viral yield . the results of titration for yield at 72 hours after inoculation at 0 . 1 pfu per cell are shown in table 5 . the results indicate that while a productive infection can be attained in the avian cells , no increase in virus yield can be detected by this method in the four non - avian cell systems . analysis of viral dna accumulation . in order to determine whether the block to productive viral replication in the non - avian cells occurred before or after dna replication , dna from the cell lysates was fractionated by electrophoresis , transferred to nitrocellulose and probed for the presence of viral specific dna . dna from uninfected cef cells , alvac - rg infected cef cells at time zero , alvac - rg infected cef cells at 72 hours post - infection and alvac - rg infected cef cells at 72 hours post - infection in the presence of 40 ฮผg / ml of cytosine arabinoside all showed some background activity , probably due to contaminating cef cellular dna in the radiolabelled alvac dna probe preparation . however , alvac - rg infected cef cells at 72 hours post - infection exhibited a strong band in the region of approximately 350 kbp representing alvac - specific viral dna accumulation . no such band is detectable when the culture is incubated in the presence of the dna synthesis inhibitor , cytosine arabinoside . equivalent samples produced in vero cells showed a very faint band at approximately 350 kbp in the alvac - rg infected vero cells at time zero . this level represented residual virus . the intensity of the band was amplified at 72 hours post - infection indicating that some level of viral specific dna replication had occurred in vero cells which had not resulted in an increase in viral progeny . equivalent samples produced in mrc - 5 cells indicated that no viral specific dna accumulation was detected under these conditions in this cell line . this experiment was then extended to include additional human cell lines , specifically wish and detroit - 532 cells . alvac infected cef cells served as a positive control . no viral specific dna accumulation was detected in either wish or detroit cells inoculated with alvac - rg . it should be noted that the limits of detection of this method have not been fully ascertained and viral dna accumulation may be occurring , but at a level below the sensitivity of the method . other experiments in which viral dna replication was measured by 3 h - thymidine incorporation support the results obtained with vero and mrc - 5 cells . analysis of rabies gene expression . to determine if any viral gene expression , particularly that of the inserted foreign gene , was occurring in the human cell lines even in the absence of viral dna replication , immunoprecipitation experiments were performed on 35 s - methionine labelled lysates of avian and non - avian cells infected with alvac and alvac - rg . the results of immunoprecipitation using a rabies g specific monoclonal antibody illustrated specific immunoprecipitation of a 67 kda glycoprotein in cef , vero and mrc - 5 , wish and detroit cells infected with alvac - rg . no such specific rabies gene products were detected in any of the uninfected and parentally infected cell lysates . the results of this experiment indicated that in the human cell lines analyzed , although the alvac - rg recombinant was able to initiate an infection and express a foreign gene product under the transcriptional control of the h6 early / late vaccinia virus promoter , the replication did not proceed through dna replication , nor was there any detectable viral progeny produced . in the vero cells , although some level of alvac - rg specific dna accumulation was observed , no viral progeny was detected by these methods . these results would indicate that in the human cell lines analyzed the block to viral replication occurs prior to the onset of dna replication , while in vero cells , the block occurs following the onset of viral dna replication . in order to determine whether the rabies glycoprotein expressed in alvac - rg was immunogenic , a number of animal species were tested by inoculation of the recombinant . the efficacy of current rabies vaccines is evaluated in a mouse model system . a similar test was therefore performed using alvac - rg . nine different preparations of virus ( including one vaccine batch ( j ) produced after 10 serial tissue culture passages of the seed virus ) with infectious titers ranging from 6 . 7 to 8 . 4 log 10 tcid 50 per ml were serially diluted and 50 to 100 ฮผl of dilutions inoculated into the footpad of four to six week old mice . mice were challenged 14 days later by the intracranial route with 300 ฮผl of the cvs strain of rabies virus containing from 15 to 43 mouse ld 50 as determined by lethality titration in a control group of mice . potency , expressed as the pd 50 ( protective dose 50 %), was calculated at 14 days post - challenge . the results of the experiment are shown in table 6 . the results indicated that alvac - rg was consistently able to protect mice against rabies virus challenge with a pd 50 value ranging from 3 . 33 to 4 . 56 with a mean value of 3 . 73 ( std 0 . 48 ). as an extension of this study , male mice were inoculated intracranially with 50 ฮผl of virus containing 6 . 0 log 10 tcid 50 of alvac - rg or with an equivalent volume of an uninfected cell suspension . mice were sacrificed on days 1 , 3 and 6 post - inoculation and their brains removed , fixed and sectioned . histopathological examination showed no evidence for neurovirulence of alvac - rg in mice . in order to evaluate the safety and efficacy of alvac - rg for dogs and cats , a group of 14 , 5 month old beagles and 14 , 4 month old cats were analyzed . four animals in each species were not vaccinated . five animals received 6 . 7 log 10 tcid 50 subcutaneously and five animals received 7 . 7 log 10 tcid 50 by the same route . animals were bled for analysis for anti - rabies antibody . animals receiving no inoculation or 6 . 7 log 10 tcid 50 of alvac - rg were challenged at 29 days post - vaccination with 3 . 7 log 10 mouse ld 50 ( dogs , in the temporal muscle ) or 4 . 3 log 10 mouse ld 50 ( cats , in the neck ) of the nygs rabies virus challenge strain . the results of the experiment are shown in table 7 . no adverse reactions to inoculation were seen in either cats or dogs with either dose of inoculum virus . four of 5 dogs immunized with 6 . 7 log 10 tcid 50 had antibody titers on day 14 post - vaccination and all dogs had titers at 29 days . all dogs were protected from a challenge which killed three out of four controls . in cats , three of five cats receiving 6 . 7 log 10 tcid 50 had specific antibody titers on day 14 and all cats were positive on day 29 although the mean antibody titer was low at 2 . 9 iu . three of five cats survived a challenge which killed all controls . all cats immunized with 7 . 7 log 10 tcid 50 had antibody titers on day 14 and at day 29 the geometric mean titer was calculated as 8 . 1 international units . the immune response of squirrel monkeys ( saimiri sciureus ) to inoculation with alvac , alvac - rg and an unrelated canarypox virus recombinant was examined . groups of monkeys were inoculated as described above and sera analyzed for the presence of rabies specific antibody . apart from minor typical skin reactions to inoculation by the intradermal route , no adverse reactivity was seen in any of the monkeys . small amounts of residual virus were isolated from skin lesions after intradermal inoculation on days two and four post - inoculation only . all specimens were negative on day seven and later . there was no local reaction to intra - muscular injection . all four monkeys inoculated with alvac - rg developed anti - rabies serum neutralizing antibodies as measured in an rffi test . approximately six months after the initial inoculation all monkeys and one additional naive monkey were re - inoculated by the subcutaneous route on the external face of the left thigh with 6 . 5 log 10 tcid 50 of alvac - rg . sera were analyzed for the presence of anti - rabies antibody . the results are shown in table 8 . four of the five monkeys naive to rabies developed a serological response by seven days post - inoculation with alvac - rg . all five monkeys had detectable antibody by 11 days post - inoculation . of the four monkeys with previous exposure to the rabies glycoprotein , all showed a significant increase in serum neutralization titer between days 3 and 7 post - vaccination . the results indicate that vaccination of squirrel monkeys with alvac - rg does not produce adverse side - effects and a primary neutralizing antibody response can be induced . an amnanestic response is also induced on re - vaccination . prior exposure to alvac or to a canarypox recombinant expressing an unrelated foreign gene does not interfere with induction of an anti - rabies immune response upon re - vaccination . the immunological response of hiv - 2 seropositive macaques to inoculation with alvac - rg was assessed . animals were inoculated as described above and the presence of anti - rabies serum neutralizing antibody assessed in an rffi test . the results , shown in table 9 , indicated that hiv - 2 positive animals inoculated by the subcutaneous route developed anti - rabies antibody by 11 days after one inoculation . an anamnestic response was detected after a booster inoculation given approximately three months after the first inoculation . no response was detected in animals receiving the recombinant by the oral route . in addition , a series of six animals were inoculated with decreasing doses of alvac - rg given by either the intra - muscular or subcutaneous routes . five of the six animals inoculated responded by 14 days post - vaccination with no significant difference in antibody titer . two chimpanzees with prior exposure to hiv were inoculated with 7 . 0 log 10 pfu of alvac - rg by the subcutaneous or intra - muscular route . at 3 months post - inoculations both animals were re - vaccinated in an identical fashion . the results are shown in table 10 . no adverse reactivity to inoculation was noted by either intramuscular or subcutaneous routes . both chimpanzees responded to primary inoculation by 14 days and a strongly rising response was detected following re - vaccination . [ 0238 ] table 2 sequential passage of alvac - rg in avian and non - avian cells cef vero mrc - 5 pass 1 sample t0 a 3 . 0 2 . 9 2 . 9 t7 b 7 . 1 1 . 0 1 . 4 t7a c 1 . 8 1 . 4 1 . 2 pass 2 sample t0 5 . 1 0 . 4 0 . 4 t7 7 . 1 n . d . d n . d . t7a 3 . 8 n . d . n . d . pass 3 sample t0 5 . 1 0 . 4 n . d . t7 7 . 2 n . d . n . d . t7a 3 . 6 n . d . n . d . pass 4 sample t0 5 . 1 n . d . n . d . t7 7 . 0 n . d . n . d . t7a 4 . 0 n . d . n . d [ 0239 ] table 3 amplification of residual virus by passage in cef cells cef vero mrc - 5 a ) alvac pass 2 a 7 . 0 b 6 . 0 5 . 2 3 7 . 5 4 . 1 4 . 9 4 7 . 5 n . d . c n . d . 5 7 . 1 n . d . n . d . b ) alvac - rg pass 2 a 7 . 2 5 . 5 5 . 5 3 7 . 2 5 . 0 5 . 1 4 7 . 2 n . d . n . d . 5 7 . 2 n . d . n . d . [ 0240 ] table 4 schedule of inoculation of rhesus macaques with alvac - rg ( vcp65 ) animal inoculation 176l primary : 1 ร 10 8 pfu of vcp65 orally in tang secondary : 1 ร 10 7 pfu of vcp65 plus 1 ร 10 7 pfu of vcp82 a by sc route 185 l primary : 1 ร 10 8 pfu of vcp65 orally in tang secondary : 1 ร 10 7 pfu of vcp65 plus 1 ร 10 7 pfu of vcp82 by sc route 177 l primary : 5 ร 10 7 pfu sc of vcp65 by sc route secondary : 1 ร 10 7 pfu of vcp65 plus 1 ร 10 7 pfu of vcp82 by sc route 186l primary : 5 ร 10 7 pfu of vcp65 by sc route secondary : 1 ร 10 7 pfu of vcp65 plus 1 ร 10 7 pfu of vcp82 by sc route 178l primary : 1 ร 10 7 pfu of vcp65 by sc route 182l primary : 1 ร 10 7 pfu of vcp65 by im route 179l primary : 1 ร 10 6 pfu of vcp65 by sc route 183l primary : 1 ร 10 6 pfu of vcp65 by im route 180l primary : 1 ร 10 6 pfu of vcp65 by sc route 184l primary : 1 ร 10 5 pfu of vcp65 by im route 187l primary 1 ร 10 7 pfu of vcp65 orally [ 0241 ] table 5 analysis of yield in avian and non - avian cells inoculated with alvac - rg sample time cell type t0 t72 t72a b expt 1 cef 3 . 3 a 7 . 4 1 . 7 vero 3 . 0 1 . 4 1 . 7 mrc - 5 3 . 4 2 . 0 1 . 7 expt 2 cef 2 . 9 7 . 5 & lt ; 1 . 7 wish 3 . 3 2 . 2 2 . 0 detroit - 532 2 . 8 1 . 7 & lt ; 1 . 7 [ 0242 ] table 6 potency of alvac - rg as tested in mice test challenge dose a pd 50 b initial seed 43 4 . 56 primary seed 23 3 . 34 vaccine batch h 23 4 . 52 vaccine batch i 23 3 . 33 vaccine batch k 15 3 . 64 vaccine batch l 15 4 . 03 vaccine batch m 15 3 . 32 vaccine batch n 15 3 . 39 vaccine batch j 23 3 . 42 [ 0243 ] table 7 efficacy of alvac - rg in dogs and cats dogs cats dose antibody a survival b antibody survival 6 . 7 11 . 9 5 / 5 2 . 9 3 / 5 7 . 7 10 . 1 n . t . 8 . 1 n . t . [ 0244 ] table 8 anti - rabies serological response of squirrel monkeys inoculated with canarypox recombinants monkey previous rabies serum - neutralizing antibody a # exposure โ 196 b 0 3 7 11 21 28 22 alvac c nt 9 & lt ; 1 . 2 & lt ; 1 . 2 & lt ; 1 . 2 2 . 1 2 . 3 2 . 2 51 alvac c nt & lt ; 1 . 2 & lt ; 1 . 2 1 . 7 2 . 2 2 . 2 2 . 2 39 vcp37 d nt & lt ; 1 . 2 & lt ; 1 . 2 1 . 7 2 . 1 2 . 2 n . t . g 55 vcp37 d nt & lt ; 1 . 2 & lt ; 1 . 2 1 . 7 2 . 2 2 . 1 n . t . 37 alvac - rg e 2 . 2 & lt ; 1 . 2 & lt ; 3 . 2 3 . 2 3 . 5 3 . 5 3 . 2 53 alvac - rg e 2 . 2 & lt ; 1 . 2 & lt ; 1 . 2 3 . 6 3 . 6 3 . 6 3 . 4 38 alvac - rg f 2 . 7 & lt ; 1 . 7 & lt ; 1 . 7 3 . 2 3 . 8 3 . 6 n . t . 54 alvac - rg f 3 . 2 & lt ; 1 . 7 & lt ; 1 . 5 3 . 6 4 . 2 4 . 0 3 . 6 57 none nt & lt ; 1 . 2 & lt ; 1 . 2 1 . 7 2 . 7 2 . 7 2 . 3 [ 0245 ] table 9 inoculation of rhesus macaques with alvac - rg a route of primary inoculation days post - or / tang sc sc sc im sc im sc im or inoculation 176l b 185l 177l 186l 178l 182l 179l 183l 180l 184l 187l b โ 84 โ โ โ โ 9 โ โ โ โ โ โ 3 โ โ โ โ 6 โ โ ยฑ ยฑ 11 โ โ 16 d 128 19 โ โ 32 128 โ โ 35 โ โ 32 512 59 โ โ 64 256 75 โ โ 64 128 โ โ 99 c โ โ 64 256 โ โ โ โ โ โ 2 โ โ 32 256 โ โ โ โ โ โ โ 6 โ โ 512 512 โ โ โ โ โ โ โ 15 16 16 512 512 64 32 64 128 32 โ โ 29 16 32 256 256 64 64 32 128 32 โ โ 55 32 32 32 16 โ 57 16 128 128 16 16 โ [ 0246 ] table 10 inoculation of chimpanzees with alvac - rg weeks post - animal 431 animal 457 inoculation i . m . s . c . 0 & lt ; 8 a & lt ; 8 1 & lt ; 8 & lt ; 8 2 8 32 4 16 32 8 16 32 12 b / 0 16 8 13 / 1 128 128 15 / 3 256 512 20 / 8 64 128 26 / 12 32 128 alvac - rg ( vcp65 ) was generated as described in example 9 and fig9 a and 9b . for scaling - up and vaccine manufacturing alvac - rg ( vcp65 ) was grown in primary cef derived from specified pathogen free eggs . cells were infected at a multiplicity of 0 . 01 and incubated at 37 ยฐ c . for three days . the vaccine virus suspension was obtained by ultrasonic disruption in serum free medium of the infected cells ; cell debris were then removed by centrifugation and filtration . the resulting clarified suspension was supplemented with lyophilization stabilizer ( mixture of amino - acids ), dispensed in single dose vials and freeze dried . three batches of decreasing titer were prepared by ten - fold serial dilutions of the virus suspension in a mixture of serum free medium and lyophilization stabilizer , prior to lyophilization . quality control tests were applied to the cell substrates , media and virus seeds and final product with emphasis on the search for adventitious agents and innocuity in laboratory rodents . no undesirable trait was found . preclinical data . studies in vitro indicated that vero or mrc - 5 cells do not support the growth of alvac - rg ( vcp65 ); a series of eight ( vero ) and 10 ( mrc ) blind serial passages caused no detectable adaptation of the virus to grow in these non avian lines . analyses of human cell lines ( mrc - 5 , wish , detroit 532 , hel , hnk or ebv - transformed lymphoblastoid cells ) infected or inoculated with alvac - rg ( vcp65 ) showed no accumulation of virus specific dna suggesting that in these cells the block in replication occurs prior to dna synthesis . significantly , however , the expression of the rabies virus glycoprotein gene in all cell lines tested indicating that the abortive step in the canarypox replication cycle occurs prior to viral dna replication . the safety and efficacy of alvac - rg ( vcp65 ) were documented in a series of experiments in animals . a number of species including canaries , chickens , ducks , geese , laboratory rodents ( suckling and adult mice ), hamsters , guinea - pigs , rabbits , cats and dogs , squirrel monkeys , rhesus macaques and chimpanzees , were inoculated with doses ranging from 10 5 to 10 8 pfu . a variety of routes were used , most commonly subcutaneous , intramuscular and intradermal but also oral ( monkeys and mice ) and intracerebral ( mice ). in canaries , alvac - rg ( vcp65 ) caused a โ take โ lesion at the site of scarification with no indication of disease or death . intradermal inoculation of rabbits resulted in a typical poxvirus inoculation reaction which did not spread and healed in seven to ten days . there was no adverse side effects due to canarypox in any of the animal tests . immunogenicity was documented by the development of anti - rabies antibodies following inoculation of alvac - rg ( vcp65 ) in rodents , dogs , cats , and primates , as measured by rapid fluorescent focus inhibition test ( rffit ). protection was also demonstrated by rabies virus challenge experiments in mice , dogs , and cats immunized with alvac - rg ( vcp65 ). volunteers . twenty - five healthy adults aged 20 - 45 with no previous history of rabies immunization were enrolled . their health status was assessed by complete medical histories , physical examinations , hematological and blood chemistry analyses . exclusion criteria included pregnancy , allergies , immune depression of any kind , chronic debilitating disease , cancer , injection of immune globins in the past three months , and seropositivity to human immunodeficiency virus ( hiv ) or to hepatitis b virus surface antigen . study design . participants were randomly allocated to receive either standard human diploid cell rabies vaccine ( hdc ) batch no e0751 ( pasteur merieux serums & amp ; vaccine , lyon , france ) or the study vaccine alvac - rg ( vcp65 ). the trial was designated as a dose escalation study . three batches of experimental alvac - rg ( vcp65 ) vaccine were used sequentially in three groups of volunteers ( groups a , b and c ) with two week intervals between each step . the concentration of the three batches was 10 3 . 5 , 10 4 . 5 , 10 5 . 5 tissue culture infectious dose ( tcid 50 ) per dose , respectively . each volunteer received two doses of the same vaccine subcutaneously in the deltoid region at an interval of four weeks . the nature of the injected vaccine was not known by the participants at the time of the first injection but was known by the investigator . in order to minimize the risk of immediate hypersensitivity at the time of the second injection , the volunteers of group b allocated to the medium dose of experimental vaccine were injected 1 h previously with the lower dose and those allocated to the higher dose ( group c ) received successively the lower and the medium dose at hourly intervals . six months later , the recipients of the highest dosage of alvac - rg ( vcp65 ) ( group c ) and hdc vaccine were offered a third dose of vaccine ; they were then randomized to receive either the same vaccine as previously or the alternate vaccine . as a result , four groups were formed corresponding to the following immunization scheme : 1 . hdc , hdc - hdc ; 2 . hdc , hdc - alvac - rg ( vcp65 ); 3 . alvac - rg ( vcp65 ), alvac - rg ( vcp65 )- hdc ; 4 . alvac - rg ( vcp65 ), alvac - rg ( vcp65 ), alvac - rg ( vcp65 ). monitoring of side effects . all subjects were monitored for 1 h after injection and re - examined every day for the next five days . they were asked to record local and systemic reactions for the next three weeks and were questioned by telephone two times a week . laboratory investigators . blood specimens were obtained before enrollment and two , four and six days after each injection . analysis included complete blood cell count , liver enzymes and creatine kinase assays . antibody assays . antibody assays were performed seven days prior to the first injection and at days 7 , 28 , 35 , 56 , 173 , 187 and 208 of the study . the levels of neutralizing antibodies to rabies were determined using the rapid fluorescent focus inhibition test ( rffit ) ( smith & amp ; yaeger , in laboratory techniques on rabies ). canarypox antibodies were measured by direct elisa . the antigen , a suspension of purified canarypox virus disrupted with 0 . 1 % triton x100 , was coated in microplates . fixed dilutions of the sera were reacted for two hours at room temperature and reacting antibodies were revealed with a peroxidase labelled anti - human igg goat serum . the results are expressed as the optical density read at 490 nm . analysis . twenty - five subjects were enrolled and completed the study . there were 10 males and 15 females and the mean age was 31 . 9 ( 21 to 48 ). all but three subjects had evidence of previous smallpox vaccination ; the three remaining subjects had no typical scar and vaccination history . three subjects received each of the lower doses of experimental vaccine ( 10 3 . 5 and 10 4 . 5 tcid 50 ), nine subjects received 10 5 . 5 tcid 50 and ten received the hdc vaccine . safety ( table 11 ). during the primary series of immunization , fever greater than 37 . 7 ยฐ c . was noted within 24 hours after injection in one hdc recipient ( 37 . 8 ยฐ c .) and in one vcp65 10 5 . 5 tcid 50 recipient ( 38 ยฐ c .). no other systemic reaction attributable to vaccination was observed in any participant . local reactions were noted in 9 / 10 recipients of hdc vaccine injected subcutaneously and in 0 / 3 , 1 / 3 and 9 / 9 recipients of vcp65 10 3 . 5 , 10 4 . 5 , 10 5 . 5 tcid 50 , respectively . tenderness was the most common symptoms and was always mild . other local symptoms included redness and induration which were also mild and transient . all symptoms usually subsided within 24 hours and never lasted more than 72 hours . there was no significant change in blood cell counts , liver enzymes or creatine kinase values . immune responses : neutralizing antibodies to rabies ( table 12 ). twenty eight days after the first injection all the hdc recipients had protective titers (โง 0 . 5 iu / ml ). by contrast none in groups a and b ( 10 3 . 5 and 10 4 . 5 tcid 50 ) and only 2 / 9 in group c ( 10 5 . 5 tcid 50 ) alvac - rg ( vcp65 ) recipients reached this protective titer . at day 56 ( i . e . 28 days after the second injection ) protective titers were achieved in 0 / 3 of group a , 2 / 3 of group b and 9 / 9 of group c recipients of alvac - rg ( vcp65 ) vaccine and persisted in all 10 hdc recipients . at day 56 the geometric mean titers were 0 . 05 , 0 . 47 , 4 . 4 and 11 . 5 iu / ml in groups a , b . c and hdc respectively . at day 180 , the rabies antibody titers had substantially decreased in all subjects but remained above the minimum protective titer of 0 . 5 iu / ml in 5 / 10 hcd recipients and in 5 / 9 alvac - rg ( vcp65 ) recipients ; the geometric mean titers were 0 . 51 and 0 . 45 iu / ml in groups hcd and c , respectively . antibodies to the canarydox virus ( table 13 ). the pre - immune titers observed varied widely with titers varying from 0 . 22 to 1 . 23 o . d . units despite the absence of any previous contact with canary birds in those subjects with the highest titers . when defined as a greater than two - fold increase between preimmunization and post second injection titers , a seroconversion was obtained in 1 / 3 subjects in group b and in 9 / 9 subjects in group c whereas no subject seroconverted in groups a or hdc . booster injection . the vaccine was similarly well tolerated six months later , at the time of the booster injection : fever was noted in 2 / 9 hdc booster recipients and in 1 / 10 alvac - rg ( vcp65 ) booster recipients . local reactions were present in 5 / 9 recipients of hdc booster and in 6 / 10 recipients of the alvac - rg ( vcp65 ) booster . observations . fig1 shows graphs of rabies neutralizing antibody titers ( rapid fluorescent focus inhibition test or rffit , iu / ml ): booster effect of hdc and vcp65 ( 10 5 . 5 tcid 50 ) in volunteers previously immunized with either the same or the alternate vaccine . vaccines were given at days 0 , 28 and 180 . antibody titers were measured at days 0 , 7 , 28 , 35 , 56 , 173 , and 187 and 208 . as shown in fig1 a to 13 d , the booster dose given resulted in a further increase in rabies antibody titers in every subject whatever the immunization scheme . however , the alvac - rg ( vcp65 ) booster globally elicited lower immune responses than the hdc booster and the alvac - rg ( vcp65 ), alvac - rg ( vcp65 )- alvac - rg ( vcp65 ) group had significantly lower titers than the three other groups . similarly , the alvac - rg ( vcp65 ) booster injection resulted in an increase in canarypox antibody titers in 3 / 5 subjects who had previously received the hdc vaccine and in all five subjects previously immunized with alvac - rg ( vcp65 ). in general , none of the local side effects from administration of vcp65 was indicative of a local replication of the virus . in particular , lesions of the skin such as those observed after injection of vaccine were absent . in spite of the apparent absence of replication of the virus , the injection resulted in the volunteers generating significant amounts of antibodies to both the canarypox vector and to the expressed rabies glycoprotein . rabies neutralizing antibodies were assayed with the rapid fluorescent focus inhibition test ( rffit ) which is known to correlate well with the sero neutralization test in mice . of 9 recipients of 10 5 . 5 tcid 50 , five had low level responses after the first dose . protective titers of rabies antibodies were obtained after the second injection in all recipients of the highest dose tested and even in 2 of the 3 recipients of the medium dose . in this study , both vaccines were given subcutaneously as usually recommended for live vaccines , but not for the inactivated hdc vaccine . this route of injection was selected as it best allowed a careful examination of the injection site , but this could explain the late appearance of antibodies in hdc recipients : indeed , none of the hdc recipients had an antibody increase at day 7 , whereas , in most studies where hdc vaccine is give intramuscularly a significant proportion of subjects do ( klietmann et al ., int &# 39 ; l green cross โ geneva , 1981 ; kuwert et al ., int &# 39 ; l green cross โ geneva , 1981 ). however , this invention is not necessarily limited to the subcutaneous route of administration . the gmt ( geometric mean titers ) of rabies neutralizing antibodies was lower with the investigational vaccine than with the hdc control vaccine , but still well above the minimum titer required for protection . the clear dose effect response obtained with the three dosages used in this study suggest that a higher dosage might induce a stronger response . certainly from this disclosure the skilled artisan can select an appropriate dosage for a given patient . the ability to boost the antibody response is another important result of this example ; indeed , an increase in rabies antibody titers was obtained in every subject after the 6 month dose whatever the immunization scheme , showing that preexisting immunity elicited by either the canarypox vector or the rabies glycoprotein had no blocking effect on the booster with the recombinant vaccine candidate or the conventional hdc rabies vaccine . this contrasts findings of others with vaccinia recombinants in humans that immune response may be blocked by pre - existing immunity ( cooney et al ., lancet 1991 , 337 : 567 - 72 ; etlinger et al ., vaccine 9 : 470 - 72 , 1991 ). thus , this example clearly demonstrates that a non - replicating poxvirus can serve as an immunizing vector in humans , with all of the advantages that replicating agents confer on the immune response , but without the safety problem created by a fully permissive virus . mice . male outbred swiss webster mice were purchased from taconic farms ( germantown , n . y .) and maintained on mouse chow and water ad libitum until use at 3 weeks of age (โ normal โ mice ). newborn outbred swiss webster mice were of both sexes and were obtained following timed pregnancies performed by taconic farms . all newborn mice used were delivered within a two day period . viruses . alvac was derived by plaque purification of a canarypox virus population and was prepared in primary chick embryo fibroblast cells ( cef ). following purification by centrifugation over sucrose density gradients , alvac was enumerated for plaque forming units in cef cells . the wr ( l ) variant of vaccinia virus was derived by selection of large plaque phenotypes of wr ( panicali et al ., 1981 ). the wyeth new york state board of health vaccine strain of vaccinia virus was obtained from pharmaceuticals calf lymph type vaccine dryvax , control number 302001b . copenhagen strain vaccinia virus vc - 2 was obtained from institut merieux , france . vaccinia virus strain nyvac was derived from copenhagen vc - 2 . all vaccinia virus strains except the wyeth strain were cultivated in vero african green monkey kidney cells , purified by sucrose gradient density centrifugation and enumerated for plaque forming units on vero cells . the wyeth strain was grown in cef cells and enumerated in cef cells . inoculations . groups of 10 normal mice were inoculated intracranially ( ic ) with 0 . 05 ml of one of several dilutions of virus - prepared by 10 - fold serially diluting the stock preparations in sterile phosphate - buffered saline . in some instances , undiluted stock virus preparation was used for inoculation . groups of 10 newborn mice , 1 to 2 days old , were inoculated ic similarly to the normal mice except that an injection volume of 0 . 03 ml was used . all mice were observed daily for mortality for a period of 14 days ( newborn mice ) or 21 days ( normal mice ) after inoculation . mice found dead the morning following inoculation were excluded due to potential death by trauma . the lethal dose required to produce mortality for 50 % of the experimental population ( ld 50 ) was determined by the proportional method of reed and muench . comparison of the ld 50 of alvac and nyvac with various vaccinia virus strains for normal . young outbred mice by the ic route . in young , normal mice , the virulence of nyvac and alvac were several orders of magnitude lower than the other vaccinia virus strains tested ( table 14 ). nyvac and alvac were found to be over 3 , 000 times less virulent in normal mice than the wyeth strain ; over 12 , 500 times less virulent than the parental vc - 2 strain ; and over 63 , 000 , 000 times less virulent than the wr ( l ) variant . these results would suggest that nyvac is highly attenuated compared to other vaccinia strains , and that alvac is generally nonvirulent for young mice when administered intracranially , although both may cause mortality in mice at extremely high doses ( 3 . 85 ร 10 8 pfus , alvac and 3 ร 10 8 pfus , nyvac ) by an undetermined mechanism by this route of inoculation . comparison of the ld 50 of alvac and nyvac with various vaccinia virus strains for newborn outbred mice by the ic route . the relative virulence of 5 poxvirus strains for normal , newborn mice was tested by titration in an intracranial ( ic ) challenge model system ( table 15 ). with mortality as the endpoint , ld 50 values indicated that alvac is over 100 , 000 times less virulent than the wyeth vaccine strain of vaccinia virus ; over 200 , 000 times less virulent than the copenhagen vc - 2 strain of vaccinia virus ; and over 25 , 000 , 000 times less virulent than the wr - l variant of vaccinia virus . nonetheless , at the highest dose tested , 6 . 3 ร 10 7 pfus , 100 % mortality resulted . mortality rates of 33 . 3 % were observed at 6 . 3 ร 10 6 pfus . the cause of death , while not actually determined , was not likely of toxicological or traumatic nature since the mean survival time ( mst ) of mice of the highest dosage group ( approximately 6 . 3 ld 50 ) was 6 . 7 ยฑ 1 . 5 days . when compared to wr ( l ) at a challenge dose of 5 ld 50 , wherein mst is 4 . 8 ยฑ 0 . 6 days , the mst of alvac challenged mice was significantly longer ( p = 0 . 001 ). relative to nyvac , wyeth was found to be over 15 , 000 times more virulent ; vc - 2 , greater than 35 , 000 times more virulent ; and wr ( l ), over 3 , 000 , 000 times more virulent . similar to alvac , the two highest doses of nyvac , 6 ร 10 8 and 6 ร 10 7 pfus , caused 100 % mortality . however , the mst of mice challenged with the highest dose , corresponding to 380 ld 50 , was only 2 days ( 9 deaths on day 2 and 1 on day 4 ). in contrast , all mice challenged with the highest dose of wr - l , equivalent to 500 ld 50 , survived to day 4 . immunoprecipitations . preformed monolayers of avian or non - avian cells were inoculated with 10 pfu per cell of parental nyvac ( vp866 ) or nyvac - rg ( vp879 ) virus . the inoculation was performed in emem free of methionine and supplemented with 2 % dialyzed fetal bovine serum . after a one hour incubation , the inoculum was removed and the medium replaced with emem ( methionine free ) containing 20 ฮผci / ml of 35 s - methionine . after an overnight incubation of approximately 16 hours , cells were lysed by the addition of buffer a ( 1 % nonidet p - 40 , 10 mm tris ph7 . 4 , 150 mm nacl , 1 mm edta , 0 . 01 % sodium azide , 500 units per ml of aprotinin , and 0 . 02 % phenyl methyl sulfonyl fluoride ). immunoprecipitation was performed using a rabies glycoprotein specific monoclonal antibody designated 24 - 3f10 supplied by dr . c . trinarchi , griffith laboratories , new york state department of health , albany , n . y ., and a rat anti - mouse conjugate obtained from boehringer mannheim corporation ( cat . # 605 - 500 ). protein a sepharose cl - 48 obtained from pharmacia lkb biotechnology inc ., piscataway , n . j ., was used as a support matrix . immunoprecipitates were fractionated on 10 % polyacrylamide gels according to the method of dreyfuss et . al . ( 1984 ). gels were fixed , treated for fluorography with 1m na - salicylate for one hour , and exposed to kodak xar - 2 film to visualize the immunoprecipitated protein species . sources of animals . new zealand white rabbits were obtained from hare - marland ( hewitt , n . j .). three week old male swiss webster outbred mice , timed pregnant female swiss webster outbred mice , and four week old swiss webster nude ( nu + nu + ) mice were obtained from taconic farms , inc . ( germantown , n . y .). all animals were maintained according to nih guidelines . all animal protocols were approved by the institutional iacuc . when deemed necessary , mice which were obviously terminally ill were euthanized . evaluation of lesions in rabbits . each of two rabbits was inoculated intradermally at multiple sites with 0 . 1 ml of pbs containing 10 4 , 10 5 , 10 6 , 10 7 , or 10 8 pfu of each test virus lys gln asp thr ile gln val lys ser ala leu leu lys asp tyr met gly leu lys val thr gly pro cys asn glu asn phe ile met phe leu ala asn gly pro asp ser pro thr val lys pro pro arg asn leu gln asn ile cys glu thr gly lys asn phe lys leu val val tyr ile lys glu asn thr leu ile ile lys trp lys val tyr gly glu thr lys asp lys glu thr pro phe thr ser ile leu ile his ala tyr lys glu his asn gly thr asn leu ile glu ser lys asn tyr ala leu gly ser asp ile pro glu lys cys asp thr leu ala ser asn cys phe leu ser gly tyr his ser glu glu asn ile asn thr leu lys asn lys phe arg asn arg leu lys asp glu asn asn cys ile ser asn leu gln val glu asp gln gly asn cys asp thr ser trp ile phe ala ser lys tyr his leu glu thr ile arg cys met lys gly tyr glu pro thr lys ile ser ala leu tyr val ala asn cys tyr lys gly glu his lys asp arg cys asp glu gly ser ser pro met glu phe leu gln ile ile glu asp tyr gly phe leu pro ala glu ser asn tyr pro tyr asn tyr val lys val gly glu gln cys pro lys val glu asp his trp met asn leu trp asp asn gly tyr thr ala tyr glu ser glu arg phe his asp asn met asp ala ala tyr ile lys ala glu asn val met gly tyr glu phe ser gly lys lys val gln asn leu cys gly asp asp thr ala asp his ala val asn tyr trp ile val arg asn ser trp gly pro tyr trp gly asp glu gly tyr phe lys val asp met tyr gly pro thr his cys his phe asn phe ile his ser val val ile phe asn val asp leu pro met asn asn lys val asn lys lys his ser cys thr arg ser tyr ala phe asn pro glu | 2 |
what is disclosed is a system and method for estimating minute ventilation by analyzing distortions in reflections of structured illumination patterns captured in a video of a thoracic region of a subject of interest being monitored for respiratory function . a โ subject of interest โ refers to a subject being monitored for respiratory function such that a respiratory minute volume can be determined in accordance with the teachings hereof . fig1 shows an anterior ( frontal ) view 101 of an adult human as well as a posterior ( rear ) view 102 . target region 103 outlines the subject &# 39 ; s anterior thoracic region . target region 104 outlines the subject &# 39 ; s posterior thoracic region . a target region , as used herein , also refers to any view of a region of the subject &# 39 ; s body which performs a respiratory function from which respiratory minute volume can be derived . it should be appreciated that the use of the terms โ human โ, โ person โ, or โ patient โ herein is not to be viewed as limiting the scope of the appended claims solely to human subjects of interest . the teachings hereof apply equally to other subjects of interest which also have a respiratory function . such additional subjects include , for example , mammals , birds , fish , reptiles , and even certain insects . a โ respiratory function โ is a multi - stage process involving inhaling air into the lungs ( inspiration ), gas exchange , and exhaling air out of the lungs ( expiration ) followed by a post - expiratory pause . inhalation causes the lungs contained within the chest cavity to fill with air thereby expanding chest volume . inhalation is initiated by a diaphragm muscle and supported intercostal muscles . under normal conditions , the diaphragm is the primary driver of inhalation . when the diaphragm contracts , the rib cage expands and the contents of the abdomen are moved downward . this results in a larger thoracic volume and negative pressure ( with respect to atmospheric pressure ) inside the thorax . gas exchange is a primary function of the respiratory system . molecules of gases are exchanged between the external environment and a blood system . this exchange facilitates oxygenation of the blood and removal of carbon dioxide and other metabolic wastes from the body . gas exchange also helps maintain the acid - base balance of the body . the cellular mechanism of gas exchange is carried out by the simple phenomenon of pressure difference . when the atmospheric pressure is low outside , air from the lungs flow out into the environment . when the air pressure is low inside the lungs , the opposite occurs . exhalation is generally a passive process due to the natural elasticity of lung tissue which causes them to recoil from the stretch of inhalation thus forcing air out until the pressures in the chest and the pressure of the outside atmosphere reach equilibrium . during forced exhalation , as when blowing out a candle , expiratory muscles including abdominal muscles and internal intercostal muscles , generate abdominal and thoracic pressure which helps force air out of the lungs . during forced inhalation , as when taking a deep breath , external intercostal muscles and accessory muscles aid in expanding the thoracic cavity and bringing more air into the lungs . during vigorous inhalation ( at rates exceeding 35 breaths per minute ), or in an approaching respiratory failure , accessory muscles such as the sternocleidomastoid , platysma , the scalene muscles of the neck as well as the pectoral muscles and latissimus dorsi of respiration are recruited for support . a post - expiratory pause occurs when there is an equalization of pressure between the lungs and the atmosphere . the duration of the post - expiratory pause reduces with increased physical activity and may even fall to zero at high rates of exertion . when the subject is at rest , the duration of the post - expiratory pause is relatively long . the subject &# 39 ; s respiration cycle is the time interval between the beginning of inhalation and the end of the post - expiratory pause . immediately following the post - expiratory pause is the start of the next cycle . the subject &# 39 ; s respiration rate is the number of breaths a subject takes within a certain amount of time ( typically in breaths / minute ). respiration rate is often measured when a subject is at rest and simply involves counting the number of breaths taken in a minute . a resting adult human takes about 12 - 20 breaths per minute depending on the overall condition of the cardio - vascular and respiratory systems . restrictive pulmonary diseases such as pulmonary fibrosis , pneumothorax , infant respiratory distress syndrome , and the like , decrease lung volume , whereas obstructive pulmonary diseases such as asthma , bronchitis , and emphysema , obstruct airflow . fig2 shows the output from a spirometer of a normal person taking seven tidal breaths , followed by maximal inspiration and expiration . expiratory reserve volume ( erv ) is the maximal volume of air that can be exhaled from the end - expiratory position . residual volume ( rv ) is the volume of air remaining in the lungs after maximal exhalation ( residual air remains in the lungs no matter how hard one tries to expel all their air ). inspiratory reserve volume ( irv ) is the maximal volume of air that can be inhaled at the end - inspiratory level . vital capacity ( vc ) is the maximum amount of air a person can expel from the lungs after maximum inhalation . inspiratory capacity ( ic ) is the volume of air that can be inhaled after normal inspiration . functional residual capacity ( frc ) is the volume in the lungs at the end - expiratory position . total lung capacity ( tlc ) is the total volume of air in the lungs at maximal inflation . โ respiratory minute volume โ or โ minute ventilation โ is the amount of air exchanged by the lungs in one minute . it can also refer to the amount of air inhaled in one minute ( inhaled minute volume ) or the amount of air exhaled in one minute ( exhaled minute volume ). although the name implies a volume , minute ventilation is actually a flow because it represents a volume change over time . minute ventilation is an important parameter in respiratory medicine due to its relationship with blood carbon dioxide levels ( paco 2 ) which varies inversely with minute ventilation . for example , a person with increased minute volume due , for instance , to hyperventilation , should demonstrate a lower blood carbon dioxide level . the healthy human body alters respiratory minute volume in an attempt to maintain physiologic homeostasis . a normal minute volume while resting is about 5 - 8 liters per minute in adult humans . minute volume generally decreases at rest , and increases with exercise as waste gases will build up more quickly in the blood stream and must be more rapidly expelled through increased exhalation . a โ video โ, as is generally understood , is a time - varying sequence of image frames captured over time using a video camera . a fully populated 2d image captured using , for example , a 3 - channel color video camera is a 2d array of pixels with each pixel in the array having color values collected for pixels from each of those channels . a fully populated 2d image captured using , for example , a single channel video camera is a 2d array of pixels with each pixel in the array having an intensity value measured for that pixel location at a desired wavelength band of interest . the video may also contain other components such as , audio , time reference signals , and the like . the size of the video data may get large for longer video sequences . the video may also be processed or pre - processed to compensate for non - uniform illumination due to a curvature of a surface of the skin , for motion induced blur due to body or surface motion , imaging blur , and slow illuminant variation . motion in the video may be compensated for using , for example , a video - based 2d image or 3d surface stabilization techniques . โ receiving a video โ is intended to be widely construed and means to retrieve , receive , capture with a video camera , or otherwise obtain a video for processing for minute ventilation estimation in accordance with the present method . the video can be received from a memory or internal storage of the video camera system , or obtained from a remote device over a network . the video may also be retrieved from a media such as a cdrom or dvd . the video may be received by being downloaded from a website which makes such videos available for pre - processing or post - processing . one such web - based system is disclosed in the above - incorporated us patent application entitled : โ web - based system and method for video analysis โ by piratla et al . the video can also be retrieved using an application such as those which are widely available for handheld cellular devices and processed on the user &# 39 ; s cellphone or other handheld computing device such as an ipad . a โ video system โ refers to a video camera for capturing a video and a structured illumination source which projects light through a patterned grid or window . the pattern may be a pseudo - random pattern with known spatial characteristics . accurate 3d surface profiles of objects in a scene can be computed using structured - light principles and triangulation - based image reconstruction techniques . fig3 shows a single 2d image frame 300 being captured of a target region 303 of the subject of interest of fig1 . video camera 310 captures reflected energy off the target region emitted by structured illumination source 311 . video camera 310 is shown having a communication element 313 to effectuate a bi - directional communication with a remote device , such as a computer workstation , wherein the video is received for processing . a video imaging system may further comprise a video analysis module . controllers 314 and 315 are shown to effectuate a manipulation of structured illumination source 311 and 312 , respectively , to reduce artifacts . one method for reducing such artifacts is disclosed in the above - incorporated reference : โ enabling hybrid video capture of a scene illuminated with unstructured and structured illumination sources โ, by xu et al . a โ video analysis module โ, in one embodiment , comprises a hardware device such as an asic with at least one processor capable of executing machine readable program instructions for analyzing video images on a frame - by - frame basis for minute ventilation estimation . such a module may also comprise , in whole or in part , a software application working alone or in conjunction with one or more hardware resources . software applications may be executed by processors on different hardware platforms or emulated in a virtual environment . aspects of the video analysis module may leverage off - the - shelf software . a โ remote sensing environment โ refers to a non - contact , unobtrusive non - invasive means of acquiring data from a subject , i . e ., the sensing device does not physically contact the subject being sensed . the sensing device can be any distance away from the subject , for example , as close as less than an inch to as far as miles in the case of telemedicine . the teachings hereof find their intended uses in such a remote sensing environment such that the resting cardiac patient remains undisturbed . a โ depth map โ is a map containing depth values based upon an analysis of the amount of distortion of a structured light pattern reflected from surfaces in that region of the image . once the depth map has been generated , a volume can be calculated . in fig4 , structured illumination source 403 projects sinusoidal gratings 404 onto an object 405 and the reflection of the impinging sinusoidal gratings is captured by the camera system 402 as they bounce off the object . the sinusoidal gratings have known spatial characteristics of undistorted projected patterns . camera system 402 is shown having a communication element 406 for bi - directional communication with a remote device , such as a workstation ( not shown ) wherein the captured video is communicated for processing . if the scene is a planar surface without any 3d surface variation and oriented approximately parallel to the camera sensor , the pattern shown in the acquired image will be similar to that of the projected structured - light pattern . however , when the surface is non - planar and contains a 3d object 405 , the shape of the object distorts the projected structured light pattern . such light distortions can be detected by camera 402 . the geometric relationship between camera 402 , a structured illumination source 403 , and a point p on the surface of 3d object 405 can be expressed in terms of a triangulation as follows : accurate 3d image reconstruction can be based on a phase - shifting or phase modulation technique which measures phases at different locations on the object &# 39 ; s surface and computes depth information from these phases . fig5 shows the phase shift with three projection patterns , collectively at 501 , projected onto the object surface , and an example fringe image 502 . phase shift is a well - known method wherein intensities for each pixel ( x , y ) of the three projected fringe patterns are described by the following relationships : i 1 ( x , y )= i 0 ( x , y )+ i mod ( x , y ) cos ( ฯ ( x , y )โ ฮธ ), ( 2 ) i 2 ( x , y )= i 0 ( x , y )+ i mod ( x , y ) cos ( ฯ ( x , y )), ( 3 ) i 3 ( x , y )= i 0 ( x , y )+ i mod ( x , y ) cos ( ฯ ( x , y )+ ฮธ ), ( 4 ) where i 1 ( x , y ), i 2 ( x , y ) and i 3 ( x , y ) are the intensities of three fringe patterns , i 0 ( x , y ) is the dc component ( background ), i mod ( x , y ) is the modulation signal amplitude , ฯ ( x , y ) is the phase , and ฮธ is the constant phase - shift angle . phase unwrapping is the process that converts the wrapped phase to the absolute phase . the phase information ฯ ( x , y ) can be retrieved ( i . e ., unwrapped ) from the intensities in the three fringe patterns : the discontinuity of the arc tangent function at 2ฯ can be removed by adding or subtracting multiples of 2ฯ on the ฯ โฒ( x , y ) value ( of fig6 ): where k is an integer representing projection period . note that unwrapping methods only provide a relative unwrapping and do not solve for the absolute phase . the 3d ( x , y , z ) coordinates can be calculated based on the difference between measured phase ฯ ( x , y ) and the phase value from a reference plane . reference is now being made to the system of fig8 which utilizes a video camera 802 to sense reflected light emitted ( at 804 ) by patterned illumination source projector 805 being reflected off point p of object 806 , i . e ., a location in the subject &# 39 ; s thoracic region . detector 808 generates pixel intensity values for pixel locations in the image . pixel intensity values and wavelength data are provided to storage media 809 . in fig8 , depth z is calculated by geometries given by : the camera and the illuminator form a stereo pair with a baseline distance b = 7 . 5 cm . the projector sends out a fixed pattern of light and dark speckles . since the spatial characteristics of the pattern are known and the pattern warps as the depth of the target surface changes , distances to the target can be estimated by determining the shape of the warping locally . local correlation operations are performed between the captured and the stored pattern . the best match gives an offset from the known depth in pixels called disparity , d . the relationship between disparity and depth is given by : where z is the estimated depth in meters , f is the focal length of the camera in pixels , and b is the baseline distance . stripe indexing can also be used to achieve robust 3d surface reconstruction because the order in which the stripes are observed is not necessarily the same as the order in which the stripes are projected due to the inherent parallax existing in triangulation - based 3d surface imaging systems and the possibility to have stripes missing from the acquired image due to occlusion of 3d surface features . fig7 shows an example stripe projection system wherein structured source light 701 is projected through stripped projector 702 with stripe 703 being illustrated for explanatory purposes . the pattern is projected onto object 704 whereon light stripe 705 illuminates the object at pixel location 706 . pixel element 708 of camera matrix 707 detects the reflected source light at this pixel location . the collection of pixels forms the image . use of color for stripe indexing in the projection patterns helps alleviate the ambiguity problem faced by phase - shift or multiple - stripe techniques using monochromatic patterns . this type of system enables encoding of multiple patterns into a single color projection image with each pattern possessing a unique color value . in order to reduce the decoding error rate , one can select a color set in which each color has a maximum distance from any other color in the set . the maximum number of colors is limited to a distance between colors that generates a minimal crosstalk in the acquired images . it should be appreciated that if the target 3d object is static and the application does not impose stringent constraints on the acquisition time , multiple - shot ( sequential ) techniques can be used and may often result in more reliable and accurate results . on the other hand , if the target is moving , single - shot techniques are used to acquire a snapshot 3d surface image of the 3d object at a particular time instance . single - shot techniques can be classified into techniques using continuously varying structured - light patterns , those using 1d encoding schemes ( strip indexing ), and those using 2d encoding schemes ( grid indexing ). each technique has its own advantages and disadvantages , depending on the specific applications . some techniques can be combined . for further information on 3d imaging techniques , the reader is respectfully directed to the above - incorporated reference entitled : โ structured - light 3 d surface imaging : a tutorial โ, by jason geng . in order to convert the device - dependent depth readouts ( in bytes ) to device - independent quantities ( in inches or meters ), a calibration needs to be performed . the calibration of the spatial coordinates of the device ( from pixels to meters or inches ) can be performed in a manner which is substantially similar to the way a traditional rgb camera is calibrated . for example , the reference : โ a flexible new technique for camera calibration โ, z . zhang , ieee trans . on pattern analysis and machine intelligence , vol . 22 ( 11 ), 1330 - 1334 , ( 2000 ), teaches a method to estimate a spatial calibration model with 11 unknown parameters . calibration of the depth output requires knowledge of the geometric configuration of the stereo pair ( illumination and imaging modules ). as discussed , both the spatial coordinates and the depth readouts from the 3d imaging sensor can be translated into device independent units of length ( such as meters or inches ). this , however , does not guarantee that the estimated volumes correspond to the volume being measured , given the fact that the changes in chest cage volume may not be identical to the changes in lung volume due to differences in elasticity between the two . thus , additional calibration may be desirable . assuming a linear relation between estimated and actual volume , a proportionality constant can be estimated via laboratory tests conducted for different breathing levels over a range required for the measurements . the actual volume can be measured using a spirometer . the slope of the linear regression line between the measurements of the spirometer and those obtained with the 3d imaging system would provide the calibration constant . before minute ventilation is estimated , the region of the depth map corresponding to the subject &# 39 ; s body is preferably segmented in the images . this can be achieved in a plurality of ways . for example , since the distance from the camera to the bed &# 39 ; s surface is known , the location of the subject &# 39 ; s body can be extracted by detecting pixels surrounded by the bed &# 39 ; s surface and located closer to the camera than the bed itself . another method is to perform localization and then region - grow the target area to include pixels with similar depth information . this produces a resulting binary mask . chest cage localization can be performed by judicious application of morphological operations on the binary mask that results from the body segmentation stage . for example , morphological opening of the mask with an appropriate size structuring element will remove pixels corresponding to the extremities and head given their relative size with respect to the chest area . another way is to apply morphological skeletonization to the mask and determine the branch points of the resulting skeleton . these branch points will be approximately located at the neck and shoulders , thus providing indication of the location of the subject &# 39 ; s thoracic region . reference is now being made to the flow diagram of fig9 which illustrates one example embodiment of the present method for estimating respiratory minute volume from video captured of a subject of interest being monitored for respiratory function in a remote sensing environment . flow processing begins at step 900 and immediately proceeds to step 902 . at step 902 , receive a video of a target region of a chest area of a subject of interest being monitored for respiratory function . the video has been captured using a video camera and an illuminator configured to project a pattern of structured illumination . example target regions of a subject of interest are shown and discussed with respect to the subject of interest of fig1 . at step 904 , process the video to obtain a depth map at inspiration and expiration within the same breathing cycle over a plurality of contiguous breathing cycles over time . in one embodiment , the depth maps are determined by comparing the captured images of the video to known spatial characteristics of undistorted patterns such that an amount of distortion of the captured patterns can be characterized at both inspiration and expiration over a plurality of breathing cycles . at step 906 , estimate chest volume at inspiration and at expiration from the respective depth maps . a chest volume is estimated after both inspiration and expiration for each breathing cycle over a predetermined amount of time such as one minute . in one embodiment , chest volume is estimated by tessellating surface points at various locations of the surface of the depth map and computing a reference point location which , in various embodiments , comprises either a centroid , a weighted arithmetic mean , or a rank - ordered statistic of surface point locations . tessellation is a technique for covering ( or tiling ) a surface with flat patterns ( or surfaces ) so that there are no overlaps and no gaps . tetrahedrons are created by connecting triangles in the tessellation with the reference point . a tetrahedron is a polygon having four vertices with each face being formed by connecting three of the vertices to form a triangle . three points of each triangle define a plane . there are four faces of a tetrahedron . a volume is computed for each tetrahedron . the total volume is the aggregate of all the tetrahedral volumes . at step 908 , estimate a minute ventilation for the subject based upon the estimated chest volumes . in one embodiment , the minute ventilation โ v e is given by : where v i and v m are estimated chest volumes at maximum inspiration and maximum expiration , respectively , in each breathing cycle . in another embodiment , the minute ventilation โ v e is given by : โ v e = f rr ร( v i โ v m ), where v i and v m are estimated chest volumes at maximum inspiration and maximum expiration , respectively , in each breathing cycle , and f rr is the subject &# 39 ; s respiration rate ( preferably in cycles per minute ). at step 910 , communicate the minute ventilation to a memory . in this embodiment , further processing stops . the flow diagrams depicted herein are illustrative . one or more of the operations illustrated in the flow diagrams may be performed in a differing order . other operations may be added , modified , enhanced , or consolidated . variations thereof are intended to fall within the scope of the appended claims . reference is now being made to fig1 which illustrates a block diagram of one example video processing system 1000 for implementing various aspects of the present method as described with respect to the flow diagram of fig9 . in fig1 , workstation 1004 is placed in communication with communication element 1002 for receiving detected grid patterns from , for instance , video camera 303 of fig3 , and for otherwise effectuating communication between various devices and computer workstation 1004 via network 1001 . computer 1004 comprises monitor device 1003 and user interface 1005 for enabling a display of information for a user and for effectuating a user input or selection . an operator of the present system may use the graphical user interface 1003 to identify or otherwise select images of the captured video for processing or re - processing , and provide user input as may be required for the implementation hereof . pixels and / or regions identified or otherwise detected in the received video may be retrieved from a remote device over network 1001 . various portions of the video may be stored to a memory or storage device 1011 in communication with workstation 1004 or may be communicated to a remote device over network 1001 via a communications interface ( not shown ) for remote storage or further processing . workstation 1004 and communications interface 1002 are in communication with image processing unit 1006 for processing the video in accordance with the teachings hereof . video processing unit 1006 is shown comprising a buffer 1007 . such a buffer may be used for queuing information about the received image such as , for instance , one or more target regions within the image frames , size of the video , time / date information , and the like . the buffer may be configured to also store data , mathematical formulas and other representations to facilitate processing of the image in accordance with the teachings hereof . video pre - processor 1008 performs any pre - processing of the video as may be desired or required to compensate for non - uniform illumination due to a curvature of a surface of the skin , for motion induced blur due to body or surface motion , imaging blur , and slow illuminant variation . processor 1008 may further be programmed to reduce the dimensionality of the data and performing independent component analysis ( ica ) on the video signal . light distortion determinator 1009 determines an amount of distortion in the received pattern . the distortion is the determined amount of 3d surface variation . converter 1010 converts the determined amount of distortion to a depth value , on a pixel - by - pixel basis , for each image frame of the video and generates a depth map for each of the inspiration and expiration cycles of the subject . depth map generator 1012 retrieves the depth map values from storage device 1011 and generates a depth map at inspiration and expiration for each breathing cycle . 3d volume processor 1013 receives the generated depth maps and generates a 3d volume for each respective depth map . minute ventilation calculator 1014 retrieves the 3d volumes generated for each inspiration and expiration cycle for a predetermined amount of respiratory cycles , and estimates the subject &# 39 ; s minute ventilation over those respiratory cycles . information as required to perform any of the functions of any of the modules may be retrieved from storage device 1011 or may be received via a user input using the user interface of workstation 1004 . processor 1014 is shown in communication with transmitter 1015 which is used to communicate the subject &# 39 ; s estimated minute ventilation to a third party such as , for example , the patient &# 39 ; s physician , nurse , or respiratory therapist . such a communication may take include some or all of the original video . transmitted images may , in turn , be displayed on a graphical display device , such as that of workstation 1004 , for visual review and further processing . the modules and processing units of fig1 are in communication with monitor 1003 to present thereon information for a user selection . any of the modules and / or processing units of fig1 are in communication with storage device 1011 via pathways shown and not shown and may store / retrieve data , parameter values , functions , pages , records , and machine readable / executable program instructions required to perform their various functions . each of the modules and processing units of the video processing system 1006 is also in communication with workstation 1004 via pathways not shown and may further be in communication with one or more remote devices over network 1001 . it should be appreciated that some or all of the functionality for any of the modules may be performed , in whole or in part , by components internal to the workstation . it should also be appreciated that the workstation has an operating system and other specialized software configured to display a variety of numeric values , text , scroll bars , pull - down menus with user selectable options , and the like , for entering , selecting , or modifying information displayed on display device 1003 . various modules of the embodiments hereof may designate one or more components which may , in turn , comprise software and / or hardware designed to perform the intended function . a plurality of modules may collectively perform a single function . each module may have a specialized processor capable of executing machine readable program instructions . a module may comprise a single piece of hardware such as an asic , electronic circuit , or special purpose processor . a plurality of modules may be executed by either a single special purpose computer system or a plurality of special purpose computer systems in parallel . connections between modules include both physical and logical connections . modules may further include one or more software / hardware modules which may further comprise an operating system , drivers , device controllers , and other apparatuses some or all of which may be connected via a network . it is also contemplated that one or more aspects of the present method may be implemented on a dedicated computer system and may also be practiced in distributed computing environments where tasks are performed by remote devices that are linked through a network . one or more aspects of the methods described herein are intended to be incorporated in an article of manufacture , including one or more computer program products , having computer usable or machine readable media . for purposes hereof , a computer usable or machine readable media is , for example , a floppy disk , a hard - drive , memory , cd - rom , dvd , tape , cassette , or other digital or analog media , or the like , which is capable of having embodied thereon a computer readable program , one or more logical instructions , or other machine executable codes or commands that implement and facilitate the function , capability , and methodologies described herein . furthermore , the article of manufacture may be included on at least one storage device readable by a machine architecture or image processing system embodying executable program instructions capable of performing the methodology described in the flow diagrams . various presently unforeseen or unanticipated alternatives , modifications , variations , or improvements therein may become apparent and / or subsequently made by those skilled in the art , which are also intended to be encompassed by the following claims . accordingly , the embodiments set forth above are considered to be illustrative and not limiting . various changes to the above - described embodiments may be made without departing from the spirit and scope of the invention . the teachings of any printed publications including patents and patent applications , are each separately hereby incorporated by reference in their entirety . | 0 |
referring mainly to fig6 , a device 1 according to the invention can be seen represented , with an inverter 2 and switching means 4 comprising three h - shaped bridges , 3 , 3 โฒ, 3 โณ. each bridge 3 , 3 โฒ, 3 โณ comprises four switches ( consisting , in the present example , of power transistors ) distributed on arms referenced a to f . the device 1 also comprises energy energy energy storage means 5 , a motor 6 , represented partially , the windings 7 of which serve as inductance . the device 1 also comprises a connector system 8 making it possible to connect to the outlet of the electrical network 11 . the switching from the power supply mode to the charging mode is managed by a control circuit 9 ( in fig6 , the link between the control circuit 9 and the switches 12 has not been represented to make it easier to read the figure ). referring to fig6 , it can be seen that the device 1 also comprises a dc / dc converter 10 arranged between the h - shaped bridges and the energy energy energy storage means 5 , the latter makes it possible to adapt the voltages and consequently optimize the dimensioning of the inverter without degrading efficiency . fig1 targets an embodiment combining a three - phase motor and a single - phase charging electrical network , the compensation being performed by rectification of the network . fig1 represents an inverter 2 with a control circuit 9 and a single - phase electrical source or network 11 . the single phase of the network 11 is connected to the first phase of the motor 6 to make it possible to charge the energy energy energy storage means 5 . more specifically , the phase of the network 11 is connected so as to use the first coil 7 of the stator of the motor 6 as inductance during charging . during this charging step , a magnetic field is created in the motor that includes a homopolar component which attracts and repels in succession the poles of the rotor of the motor 6 . depending on the rotor types , it is thus possible for the rotor to vibrate or start rotating during the charging of the energy storage means 5 and , in particular , in the case of use of a permanent - magnet rotor . even in the case of a wound rotor , if the latter is not insulated from its power supply , spurious induced currents can appear in the rotor and set the latter in motion . the use of a diode bridge 14 as compensation means makes it possible to create a unipolar field that varies only in amplitude . these compensation means prevent the appearance of the attraction repulsion phenomena in a permanent - magnet rotor . fig2 a and 2b target an embodiment combining a three - phase motor and a single - phase charging electrical network , the compensation being performed by current injection . fig2 a represents an inverter 2 with a control circuit 9 and a single - phase electrical network 11 . in this example , the compensation consists in injecting into the remaining phase a current identical to that used for charging . the compensation consequently makes it possible to thus inhibit the effect of the charge current with respect to the rotor . the compensation of the magnetic fields during the charging step is in this case performed by a compensation operation during which the control circuit 9 drives the switches 12 so as to inject , into each of the two phases of the motor that have remained free ( that is to say , into the two coils of the stator of the motor 6 that are not linked to the network 11 ), a compensation current determined by the control circuit 9 so that the vector sum of the magnetic fields created by each of the three coils 7 is zero . this makes it possible to reduce or eliminate the movements of the rotor due , for example , to dissymmetries of the motor . as an example , compensation currents identical to the charging current can be injected , thus inhibiting the effect of the charging current with respect to the rotor . the control circuit 9 thus determines the compensation current by slaving it to the charge current . as a variant , or in addition , the compensation currents can also be determined by the control circuit 9 according to the position of the rotor of the motor 6 supplied , for example , by a sensor . the compensation current is then slaved to the physical position of the rotor , that is to say that it is modified until the rotor is immobilized or exhibits an acceptable movement . fig2 b shows a variant in the connection of the single - phase network to the h - shaped bridges ( 3 , 3 โฒ, 3 โณ). the link from the control circuit 9 to the transistors of the h - shaped bridges has not been represented to keep the figure simple . these links are identical to those of fig1 and 2a . in all the figures , the points that can be seen in proximity to the motor windings 7 define the winding direction of the winding in the notches provided for this purpose . the winding is such that if balanced three - phase currents supply the coils 7 of the motor 6 via each of the terminals indicated by the point , the magnetomotive force system is a balanced three - phase system . in a misuse of language , it is said that the terminal of coil 7 marked by a point is the positive terminal . in fig2 b , the single - phase network is connected so that the neutral of the network is on a coil 7 terminal that is said to be positive and the phase is on a negative terminal . thus , from the viewpoint of the motor 6 , the currents passing through its first two coils are in phase . it is then sufficient to inject into the remaining coil 7 a current that is in phase . thus , the fields generated on the stator of the motor 6 are in fact on the rotor because the vector sum of the currents of the coils 7 of the motor taking into account their spatial offset is zero . during charging , one of the possible commands is to drive the arms b and c in phase opposition . for example , the arms b and c can be controlled according to a conventional pwm ( pulse width modulation ) control in order to produce the pfc ( power factor corrector ) function . there will be no more detailed discussion here concerning how to control the current to produce all the functionalities of a battery charger , which is known to those skilled in the art . to produce the compensation , the arms e and f are driven in the present example so as to generate a current equal in amplitude and in phase on the corresponding coil 7 , the role of which is to compensate for the stator field created by the first two coils 7 . the arms a and d are represented in dotted lines because they are not controlled during this charging phase . the compensation is thus produced by the arms e and f . a variant of the embodiment of fig1 consists in complementing the compensation by rectification of the network with a compensation by current injection into the remaining free phase of the motor , as in the embodiment of fig2 a and 2b . fig3 targets an embodiment combining a three - phase motor and a single - phase charging electrical network , the compensation being performed by current injection at the mid - points of the windings 7 of the motor 6 . fig3 represents an inverter 2 with a control circuit 9 and a single - phase electrical network 11 . in this example , the compensation means are produced by connecting the terminals 15 of the electrical network 11 via the mid - points 16 of two coils of the stator of the motor 6 . during the charging step , the current is input at the mid - points 16 . this introduction means that the charge currents are balanced between each half - coil and consequently do not create any magnetomotive force . the arms a and b as well as c and d are driven in the present example so as to generate currents that are equal in amplitude but in phase opposition from the viewpoint of the motor 6 . for example , the arms b and c can be controlled according to a conventional pwm control in order to produce the pfc function . since the currents of each half - coil flow in the same notches but in opposite directions , as indicated in the figure , the magnetomotive force is therefore zero . there is no field created on the stator by virtue of this compensation . nevertheless , these currents are in phase from the viewpoint of the battery charger . the battery charging is handled , as in a conventional charger , by the arms a , b , c and d and by the leakage inductances of each pair of half - coils . in practice , the coupling of the two half - coils is not perfect even though they pass through the same notches , this being due to the inevitable shape imperfections of the coils . these imperfections therefore form an inductive element for the charger function . the arms e and f are not controlled during this charging phase . as a variant , the coils can be arranged so that the currents of each half - coil do not flow in the same notches . fig4 targets an embodiment combining a three - phase motor and a three - phase charging electrical network , the compensation being performed by rectification of the network . fig4 represents an inverter 2 with a control circuit 9 and three - phase electrical network 11 . in this exemplary embodiment , the compensation means comprise diode bridges 14 . to improve the compensation and prevent any rotation of the rotor , the compensation may include an additional step consisting in reversing a phase of the rotor of the motor 6 . this reversal can be produced simply by reversing the connection of one of the inductive windings of the stator ( see fig4 in which , for the leftmost winding 7 in the figure , the point is to the right of this winding whereas , for the other two windings 7 , the point is to the left of the corresponding winding ). fig5 targets an embodiment combining a three - phase motor and a three - phase charging electrical network , the compensation being performed by current injection at the mid - points of the windings 7 of the motor 6 . fig5 represents an inverter 2 with a control circuit 9 and a three - phase electrical network 11 . in this exemplary embodiment , the compensation means are produced by connecting the electrical network 11 to the mid - points 16 of the coils of the stator of the motor 6 . all the arms a to f are in this case controlled according to a conventional pwm control in order to produce the pfc function . the input of the current , during the energy energy energy storage means charging mode , at the mid - points means , in the same way as was described in the example of fig3 for a single - phase electrical network , that the charge currents are balanced between each half - coil and consequently do not create any magnetomotive force . this solution for compensation by current injection into the mid - points of the coils has the advantage of advantageously reducing the apparent inductance of the charger ( this is also valid for the embodiment of fig3 ). in practice , in order to produce a device producing the pfc function , the inductance of the coils must not be too great so as not to distort the wave of the current . when the power factor is unitary , the current is in phase with the voltage . the slope of the current is maximum when the voltage is zero . if the inductance is high , the rise of the current will take longer and will reach its maximum slope with a delay . the consequence is a distortion of the current during the transition to zero . this distortion is a source of harmonics . as it happens , the leakage inductance is much less than the magnetizing inductance . generally , the ratio of the leakage inductance to the magnetizing inductance is from 1 to 10 %. in the case of a high - voltage machine , the value of the inductance increases with the square of the control voltage . for high - voltage systems , the inductances of the stator coils of the electric machines are too high to produce a charger with control of the power factor . the solution of fig3 and 5 makes it possible to divide this inductance by 10 or even 100 . for example , a 50 kw machine engineered for an inverter with a 900 v h - shaped bridge may exhibit an inductance of 4 mh . this value is not suitable for a 3 kw charger at 230 v . the use of the leakage inductance makes it possible to reduce this value between 400 and 40 ฮผh . the drawback may be a ripple on the current that is greater than the chopping frequency . this ripple can be reduced by increasing the chopping frequency . bearing in mind that the 3 to 6 kw charger does not use the full capacity of the electronics engineered for a 50 kw inverter , there is no drawback in increasing the switching losses in battery charging mode . consequently , in the case of a current injection at the mid - points of one or more coils of the stator ( fig3 and 5 ), and when the same current is injected into the two half - coils ( formed by the existence of the mid - point ), the inductances of the two half - coils are canceled out . only the leakage inductance associated with the imperfections of the coils remains apparent , this inductance being much lower and better suited to use in a charger . other features of the invention could also have been envisaged without thereby departing from the scope of the invention defined by the claims below . thus , in the various examples taken up in the description the compensation means are detailed with a three - phase motor , but the teachings of this description can be transposed and extended generally to polyphase electric machines . as in the examples cited the inverter has an h - shaped bridge structure , the invention however is not limited to this structure and notably can be extended to a conventional structure with an inverter produced with three - phase bridges and switching means of power contactor type to switch from a battery charging mode to a motor power supply mode . moreover , the various embodiments described here can be combined , just as the compensation step can be performed by a combination of the various compensation means described . in the examples cited , the expression โ mid - point โ, when it relates to a coil , may designate not only the point of connection of two half - coils with the same number of turns , but also the point of connection of two half - coils with different numbers of turns . the expression โ mid - point โ is therefore used here in accordance with its usual meaning in electronics , equally covering a point taken at the exact middle of a coil , and a point dividing the coil into two unequal portions ( for example , one portion comprising two thirds of the total number of turns and another portion comprising one third of the total number of turns ). in the same spirit , the terms โ half โ or โ half - coil โ designate one of these portions , even if the latter comprises a number of turns that is different from half the total number of turns of the coil . the charge currents are then distributed in each half - coil in such a way as to reflect the ratio between the number of turns of the half - coil concerned and the total number of turns of the coil . | 8 |
fig1 illustrates a gas turbine engine 10 of a type preferably provided for use in subsonic flight , generally comprising in serial flow communication a fan 12 through which ambient air is propelled , a multistage compressor 14 for pressurizing the air , a combustor 16 in which the compressed air is mixed with fuel and ignited for generating an annular stream of hot combustion gases , and a turbine 18 for extracting energy from the combustion gases . referring to the fig . 2 , the vane assembly 20 is located downstream of the fan 12 . the vane assembly 20 includes an inner shroud 26 and a plurality of vanes 22 extending radially between the inner shroud 26 and an engine casing or an outer shroud 21 . the inner shroud 26 includes a shroud ring 34 and a shroud web 36 . each of the vanes 22 has an airfoil portion 23 extending between the vane tip 24 and the vane root 25 . the vane root 25 is attached to the outer shroud 21 and the vane tip 24 is retained in a grommet 28 inserted into an opening 54 ( see fig . 5 ) of the shroud ring 34 . throughout this description , the axial , radial and circumferential directions are defined respectively with respect to the central axis , radius and circumference of the shroud ring 34 . as seen in fig2 and 3 , the airfoil portion 23 of each vane 22 defines a leading edge 27 and a trailing edge 29 , such that an airflow passing through the vane assembly 20 will flow from the leading edge 27 to the trailing edge 29 . the vane tip 24 includes a slot 38 defined therein and located between the leading and trailing edges 27 , 29 . the slot 38 has a generally rectangular shape and extends radially from the vane tip 24 . at the opposite extremity of the vane 22 proximate the vane root 25 is disposed a button portion 31 , which corresponds generally to the shape of the airfoil portion 23 however is slightly enlarged relative thereto , but nevertheless remains smaller than the adjacent vane root 25 . the button portion 31 includes relatively blunt leading and trailing ends . as seen in fig2 , the button 31 is received within an outer grommet 33 disposed within the outer shroud 21 proximate the root end of the vane 22 . the blunt vane button 31 accordingly helps to prevent the relatively sharp leading and trailing edges 27 and 29 of the vane airfoil 23 from tearing the outer grommet 33 during the assembly and / or disassembly process of the vane assembly or in the event of a bird strike . referring to fig . 4 , each grommet 28 includes a base portion 50 connected to a lip 46 by a recessed portion 48 . the base portion 50 defines two opposite elongated lateral surfaces 49 extending generally along the axial direction . two spaced apart tongues 40 extend perpendicularly from the lip 46 along the circumferential direction and define a slit 42 therebetween . a cutout 44 corresponding in shape to the vane tip 24 is defined within the grommet 28 , extends through the base and recessed portions 50 , 48 , and is bordered by the lip 46 . the grommet 28 also has a leading edge 30 and a trailing edge 32 connecting the lateral surfaces 49 and corresponding to the leading and trailing edges 27 , 29 of the associated vane 22 , as can be seen in fig . 2 . the grommets 28 are preferably made of a flexible material , such as rubber or the like , in order to be able to dampen vibrations of the assembly . referring to fig2 and 5 , the shroud ring 34 has an inner surface 35 and an outer surface 37 defining a circumference of the shroud 26 . the shroud web 36 is circular and extends generally radially from the inner surface 35 of the shroud ring 34 around the entire circumference thereof . the openings 54 are distributed along the circumference of the shroud ring 34 . each opening 54 corresponds in shape to the recessed portion 48 of one of the grommets 28 and is oriented according to a desired orientation of the vane 22 within the airflow . thus , a grommet 28 is receivable within each opening 54 , with the base portion 50 thereof abutting the outer surface 37 and the lip 46 abutting the inner surface 35 . adjacent to each opening 54 , a mating slot 56 is defined within the shroud web 36 . referring to figs . 2 , 4 and 6 , each of the openings 54 of the shroud ring 34 receives the recessed portion 48 of a grommet 28 . the shroud web 36 , at the mating slot 56 , is received within the slit 42 of the grommet 28 , with one of the tongues 40 abutting each side of the web 36 . the vane tip 24 is inserted into the grommet cutout 44 , the tongues 40 and shroud web 36 being received within the vane slot 38 . alternately , it is also possible to provide a deeper grommet slit 42 and vane slot 38 such as to eliminate the need for the mating slot 56 . referring to fig4 and 7 , the base portion 50 of each grommet 28 is shaped so that upon installation of the grommets 28 , the lateral surfaces 49 of each grommet 28 will be in close contact with the lateral surfaces 49 of adjacent grommets 28 , such that the base portions 50 together form a continuous gas path surface 52 along the entire circumference and at least an axial portion of the shroud 26 . this configuration eliminates the need to use adhesives or similar measures to maintain the grommets in position , since the gas flows over the grommets , โ pushing โ them radially inward , instead of flowing between them and producing a lifting force thereon . the airflow is also smoother since it is not perturbed by an uneven surface which would be produced with conventional grommets having free spaces therebetween . alternatively , it is possible to provide an annulus portion or an entire annulus formed by the combined base portions 50 of the grommets 28 , which are integrally connected to each other through the lateral surfaces 49 to form a single unit . in the case of an entire annulus , the grommets 28 would have to be made of a material sufficiently elastic to be able to stretch the annulus for insertion of the grommet lips 46 in into the shroud openings 54 . the vane assembly 20 thus efficiently retains the vane tip in the axial direction , providing additional stability to the vane position which reduces the risk of rearward movement of the vane tip 24 upon impact of a foreign object . this , in turn , reduces the risk of damage to the grommet 28 and adjacent components upon the impact of the foreign object . the vane slot 38 and mating slot 56 are easy to machine , and the grommet 28 with tongues 40 and slit 42 can be manufactured using the same process as other types of grommets . the vane assembly 20 eliminates the need for adhesives or the like to maintain the grommets in place , which reduces costs and simplifies production and maintenance operations . the above description is meant to be exemplary only , and one skilled in the art will recognize that changes may be made to the embodiments described without department from the scope of the invention disclosed . for example , the vane assembly 20 can be used for other types of engine stators as well as in different fields , such as in ventilation systems . the grommets 28 can be used in outer shrouds as well as other types of vanes or rotor blades . still other modifications which fall within the scope of the present invention will be apparent to those skilled in the art , in light of a review of this disclosure , and such modifications are intended to fall within the appended claims . | 5 |
with reference to fig1 - 2 , the principles of operation of a bubble leak tester in accordance with the present invention are illustrated . generally , the bubble leak tester is used to test for leaks in a test part having a test volume 10 by comparing the pressure in the test volume 10 with the pressure in a reference volume 12 across a bubble chamber 14 having a quantity of liquid 16 , such as water , therein . when the test and reference volumes 10 , 12 are positively pressurized ( i . e . pressure greater than atmospheric pressure ), which is the case shown in fig1 the pressure in the test volume 10 ( i . e . test pressure ) will be greater than atmospheric pressure . any leak in the test part will permit test pressure to escape from the test volume 10 , as shown by the arrows , thereby causing the test pressure to become lower than the pressure in the reference volume ( i . e . reference pressure ). since the test volume 10 and the reference volume 12 are connected to each other through the bubble chamber 14 by flow passages 17 and 18 , respectively , the test pressure and reference pressure will tend to equalize . thus air will move toward the test volume to account for the loss in pressure . this movement of air is in the form of bubbles in the liquid 16 in the bubble chamber 14 , thus signifying a leak in the test part . in the case where the test volume and reference volume are negatively pressurized ( i . e . pressure less than atmospheric pressure ), such as shown in fig2 the test volume 10 and reference volume 12 are switched such that test volume 10 is connected to flow passage 18 and reference volume 12 is connected to flow passage 17 , with a flow of air occurring in the opposite direction . if the test part leaks , atmospheric pressure enters the test volume 10 , as shown by the arrows , causing the test pressure to rise . this again causes a difference in pressure between the test pressure and reference pressure , such that the pressures tend to equalize thereby causing bubbles in the liquid 16 of the bubble chamber 14 . prior to testing , the test and reference volumes should be allowed to stabilize for a period of time , to ensure that the starting pressures within the volumes are the same . however , during pressurization of the test and reference volumes 10 , 12 thermal effects can alter the pressures within each volume , thereby adversely affecting the leak test . to minimize thermal effects , the test volume 10 and the reference volume 12 are preferably about the same size . since the volumes are about equal , they will have substantially mirrored thermal effects , and due to their interconnection , the thermal effects are always counteracting , thereby minimizing the time needed to stabilize the volumes . however , the test and reference volumes could be of unequal size if desired , although a longer stabilizing time would be needed . turning now to fig3 a and 3b , the bubble leak tester 20 of the invention is illustrated . the tester 20 includes a housing 22 having a front wall 24 , a first side wall 26 , a second side wall 28 , and a rear wall 30 , as well as top and bottom walls to thereby give the housing 22 a box - like shape . a bubble chamber 32 is mounted to one of the walls of the housing 22 on the exterior thereof , such as on the second side wall 28 , to allow the bubble chamber 32 to be watched for the presence of bubbles during testing . if desired , the bubble chamber 32 could be disposed within the interior of the housing 22 , with one or more of the housing walls being suitably modified to permit viewing of the bubble chamber 32 through the wall . for instance , the second side wall 28 could be wholly or partially made of a transparent material , such that the bubble chamber 32 disposed within the housing can be viewed . alternatively , an electronic sensor could be incorporated into the housing 22 to electronically sense and count the bubbles such that the presence of a leak could be detected automatically without the need for a person to watch the bubble chamber 32 . the data gathered by the electronic sensor could be dumped to a central computer located externally of the tester 20 for analysis of the data . the tester 20 is provided with a variety of switches that control operation of the tester 20 , including a start switch 34 to start operation of the tester , a system reset switch 36 that is used with the start switch 34 to set the initial operating conditions of the tester , and a mass leak reset switch 38 which is actuated in the event of a mass leak in the tester and / or in the test volume and / or in the reference volume to reset the operating conditions of the tester . a variety of gauges are also disposed on the front wall 24 of the tester 20 so as to provide an indication of operating conditions of the tester . the gauges include a pressure gauge 40 to provide an indication of pressure in the tester , an auxiliary indicator light 42 which indicates whether an auxiliary valve v8 of the tester is in use , a system stabilizing indicator light 44 which indicates when the tester 20 is in a stabilizing mode , a system testing indicator light 46 which illuminates when the tester is actually performing a test , and a mass leakage indicator light 48 which illuminates during a mass leak . the tester 20 is further designed to allow connection with the test volume 10 , the reference volume 12 , and a source of pressure ( referenced by reference numeral 50 in staring in fig6 a ) that is used to pressurize the volumes 10 , 12 . in particular , the side wall 26 of the tester 20 is provided with a test port 52 to which the test part , and thus the test volume 10 , is to be connected to perform a test . in addition , a reference port 54 is provided to which the reference volume 12 is connected , and an input port 56 permits connection of the pressure source to the tester . fig4 illustrates a tester 20 &# 39 ; that is similar to the tester 20 of fig3 a , 3b . however , the tester 20 &# 39 ; includes a keypad 150 and liquid crystal display ( lcd display ) 152 on the front wall 24 . the keypad 150 allows a user to enter data into the main controller for the tester 20 &# 39 ;, thereby allowing the operation of the tester 20 &# 39 ; to be changed by the user . the lcd display 152 is able to display the data that is being entered by the user on the keypad , in addition to displaying data or messages concerning the operation of the tester 20 &# 39 ;. as will be described in detail later in the description , the bubble chamber 32 , the test port 52 , the reference port 54 and the input port 56 are interconnected by a series of flow passages disposed within the interior of the housing 22 . a valve arrangement is also provided for selectively controlling flow between the bubble chamber , the test port , the reference port and the input port . thus , by connecting the test volume 10 to the test port 52 , the reference volume 12 to the reference port 54 , and the pressure source 50 to the input port 56 , the valve arrangement can be suitably controlled to perform a bubble leak test to check for leaks in the test part . however , prior to describing the valve arrangement in detail , reference is made to fig5 which illustrates a preferred form of the bubble chamber 32 . the bubble chamber 32 includes a housing 60 made of glass , clear plastic or other transparent material . the housing 60 is partially filled with a liquid 62 , such as water , in which bubbles will form when there is a difference in pressure between the test and reference volumes . the housing 60 is generally tubular in shape , and is closed at one end and open at the opposite end . the end of the housing 60 that is open is threaded , and a cap 64 is removably screwed onto the open end of the housing by engaging with the housing threads , so as to close off the open end of the housing 60 . the cap 64 is preferably made of aluminum , however other metals as well as plastic materials could be used if desired . the bottom of the cap 64 includes a central bore 66 formed therein which communicates with the interior of the housing 60 above the level of the liquid 62 , and a port 68 extends through the side of the cap 64 and into the bore 66 whereby the port 68 is in communication with the interior of the housing . the cap 64 further includes a reservoir 70 formed therein above the bore 66 and separated therefrom by a wall 72 . a passageway 74 extends between the reservoir 70 and the bottom of the cap 64 , and one end of a tube 76 is fit within the passageway and the opposite end of the tube 76 extends into the housing below the surface of the liquid 62 . therefore , the reservoir 70 is placed into communication with the liquid below the surface thereof . a further port 78 is formed in the side of the cap 64 to place the reservoir 70 in communication with the exterior of the cap . the port 68 is connected , via the flow passages and valve arrangement mentioned previously , to either the test volume 10 or the reference volume 12 , while the port 78 is connected , via the flow passages and valve arrangement , to either the reference volume 12 or the test volume 10 , depending upon whether there is positive pressure or negative pressure . in the event of a change in pressure in the test volume , air will tend to flow into the reservoir 70 through the port 78 , and then through the tube 76 in order to equalize pressure with the reference volume 12 . since the tube 76 extends beneath the surface of the liquid 62 , air exiting therefrom is in the form of bubbles , thus providing a visual indication of the presence of a leak in the test part . during a test , a person could mistakingly disconnect the reference or test volume , thereby causing a sudden large shift in pressure between the two volumes that could cause the fluid 62 in the housing 60 to be forced backwards up the tube 76 . the reservoir 70 in the cap 64 collects such backflowing liquid and prevents it from exiting the port 78 , to prevent contamination of the valve ( to be later described ) between the bubble chamber 32 and the reference or test volume . while a specific bubble chamber 32 has been described herein , it is to be realized that other bubble chambers could be used as well , such as a bubble chamber that does not include a reservoir . with reference to fig1 , a manometer 200 is shown that can be used in combination with , or in place of , the bubble chamber 32 . since there is a shift in volume when the test volume 10 leaks , the volume change can be measured by the manometer 200 . for positive pressures , one end 202 of the manometer apparatus 200 would be in communication with the reference port 54 , while the other end 204 of the manometer apparatus 200 would be in communication with the test port 52 . the manometer 200 includes a scale 206 on the side thereof that is reflective of the change in volume when a leak occurs . a liquid 208 is disposed within the manometer 200 , and when a leak occurs in the test part , the pressure is higher at the end 202 than at the end 204 , thereby causing the liquid 208 to rise up the scale 206 . a reservoir 210 is formed in the manometer 200 prior to the end 204 to collect liquid 208 and prevent it from being forced out of the end 204 . further , like the bubble chamber 32 , the manometer 200 could be disposed either inside or outside the housing 22 , and a sensor could be used to electronically measure the change in liquid height at the scale 206 . turning now to fig6 a - 6i , a first embodiment of the flow passages and valve arrangement 80 that are used to control flow within the bubble leak tester 20 or 20 &# 39 ; is illustrated . the flow passages and valve arrangement 80 are disposed inside of the housing 22 of the leak tester . fig6 a illustrates the valve arrangement 80 in a relaxed state , i . e . prior to testing , for positive pressure situations , with the valves of the valve arrangement being in their normal operating state . however , for negative pressure situations , the connection of the bubble chamber 32 with the test volume 10 and reference volume 12 would be switched as shown in fig7 which illustrates the valve arrangement 80 in a relaxed state for negative pressure situations . thus , the systems shown in fig6 a and 7 are substantially similar , except for the connection of the test and reference volumes with the bubble chamber 32 and the direction of fluid flow that occurs within the flow passages . in order to facilitate the description of the invention , fig6 b - 6i will be described in relation to positive pressure . however , it is to be realized that a valve arrangement of the type shown in fig7 operates in a similar manner , except for the direction of flow within the flow passages . as fig6 a shows , the test and reference volumes 10 , 12 are schematically illustrated as being connected to the leak tester 20 , by connecting to the test port and the reference port , 52 and 54 , respectively . a flow line 82 interconnects the test port 52 and the port 68 on the bubble chamber 32 , and a flow line 84 interconnects the reference port 54 and the port 78 on the bubble chamber 32 , to thereby achieve a system similar to that shown in fig1 . for negative pressure , i . e . vacuum , the bubble chamber 32 is essentially flipped such that the test port 52 is connected to the port 78 on the bubble chamber 32 , while the reference port 54 is connected to the port 68 as shown in fig7 in order to achieve a system similar to that shown in fig2 . a vent line 86 connects to the flow line 82 and communicates with a vent , such as ambient air outside of the housing 22 , to allow venting of pressure . an input line 88 extends from the input port 56 and branches into two lines 88a , 88b , with the line 88a joining with the line 82 leading to the test port 52 , and with the line 88b joining with the line 84 leading to the reference port 54 . a further vent line 90 is connected to the input line 88 and communicates with a vent , such as ambient air outside of the housing 22 , to allow further venting of the pressure in the flow passages . the pressure gauge 40 that is mounted on the front wall 24 of the housing 22 is connected to the flow line 84 adjacent the reference port 54 so as to measure the pressure adjacent the reference port 54 and reference volume 12 . further , a pair of pressure switches 92 , 94 are disposed in the flow line 82 adjacent the test port 52 for sensing pressure at the test port 52 and test volume 10 . the pressure switch 92 watches ( i . e . senses ) for the pressure to reach a predetermined set pressure before allowing the tester 20 to start . the pressure switch 94 on the other hand , senses if the pressure has fallen significantly , such as would occur in the case of a mass leak or removal of the test volume 10 , and shuts the tester 20 down in the event of a rapid loss in pressure . thus , the pressure switches 92 , 94 are integrated into the control of the tester 20 to ensure that if the tester never pressurizes up , the tester will not start , and if the system does pressure up , but experiences a subsequent rapid loss in pressure , the tester will shut down . each pressure switch 92 , 94 is preferably adjustable , and they are preferably accessible by the user whereby they can be adjusted so as to allow control of the pressure set point at which each switch activates . alternatively , in the tester 20 &# 39 ; of fig4 the pressure switches 92 , 94 would be replaced by a single pressure transducer ( not shown ) disposed within the housing . the pressure transducer would perform the same functions as the pressure switches 92 , 94 , i . e . waiting for a predetermined set pressure to be reached and sensing a significant reduction in pressure , and the pressure transducer would be integrated into the main controller of the tester 20 &# 39 ; to allow the user to change the pressure set points of the pressure transducer by entering the new pressure set points via the keypad 150 . with reference to fig6 a , the valve arrangement 80 includes a plurality of valves v1 - v7 for controlling the flow within the flow passages of the tester 20 . the valves v1 - v7 are preferably solenoid operated , bubble tight valves , such as in - line poppet valves , although other types of bubble tight valves could be used if desired . one such alternative valve will be described in relation to fig1 a - f later in the description . an auxiliary valve v8 is also provided that operates a pneumatic connector that may be used to connect the test and reference volumes 10 , 12 to the ports 52 , 54 , respectively . typically , the reference volume 12 would be generally permanently connected to the tester 20 , such that only the test volume 10 need be connected to the port 52 by controlling the auxiliary valve v8 . however , the test and reference volumes could each be manually connected to their respective ports 52 , 54 if desired , in which case the auxiliary valve v8 could be eliminated . fig6 a illustrates the valves v1 - v7 in their initial states , where valve v1 is normally closed and forms a means for selectively controlling the flow of positively pressurized fluid into the input line 88 through the input port 56 . valve v2 is normally open and is disposed in the vent line 90 and thereby forms a means for selectively controlling flow through the vent line 90 to the vent . the valves v3 and v5 are normally open and are disposed in the lines 88a , 88b , thereby forming a means for selectively controlling flow to the test port 52 and reference port 54 , respectively , and for selectively controlling flow between the test port and reference port . the valves v4 and v6 are normally closed and are disposed in the flow lines 82 , 84 , thereby forming a means for selectively controlling flow between the test port 52 and the bubble chamber 32 and between the reference port 54 and the bubble chamber 32 , respectively . the valve v7 is normally closed and is disposed in the vent line 86 , thereby forming a means for selectively controlling flow to the vent . as fig6 a further shows , a valve 100 , such as a needle valve , is also disposed in the vent line 86 , downstream of the valve v7 , for selectively controlling flow through the vent line 86 . the valve 100 is manually preset by the manufacturer to allow a predetermined rate of fluid flow through the vent line 86 when the valve v7 is actuated open . the valve 100 is preferably preset by the manufacturer , and the end user would not alter the setting of the valve , so that the valve 100 acts as a fixed orifice in allowing a preset rate of fluid flow therethrough . the user would typically control the time that the valve v7 is open to control the amount of venting that is allowed to occur . it should be realized that the valve 100 could be replaced by a fixed orifice if desired . the tester 20 is preferably provided with suitable controls to control the operation of the valves v1 - v8 during the operation of the tester 20 . the tester 20 is capable of performing at least three separate procedures during its operation : a testing procedure ; a startup procedure ; and a mass leak restart / pressurizing procedure . an example of each procedure will now be described in detail below . the testing procedure is conducted by the tester 20 during the performance of an actual leak test . fig6 b - 6i illustrate the state of the valves v1 - v7 , as well as the pressure conditions in the flow passages , at certain stages during the testing procedure for positive pressure conditions . in fig6 a - 6i , a line ----- represents a flow passage at source pressure , a line ------ represents a flow passage at atmospheric pressure , a line ------ represents a flow passage at a pressure less than source pressure , and a line ------ represents a flow passage at a pressure between source pressure and the initial pressure across the bubble chamber 32 . fig8 illustrates a timeline related to the testing procedure . during the testing procedure , as well as during the other procedures , many timers are used to control the operation of the tester . the procedures have to be designed to ensure that there is always a pressure across the bubble chamber 32 . this will cause the bubble chamber 32 to be on the verge of showing bubbles when testing by always allowing an initial surge of air to go through the tube 76 of the bubble chamber 32 to clear the bubble chamber 32 of backflow . with reference to fig6 b and fig8 after turning the tester 20 on and pushing the start button 34 , the auxiliary valve v8 energizes thereby actuating a connector to connect to the test volume 10 . simultaneously , the auxiliary valve indicator light 42 illuminates , indicating that the valve v8 is in use . further , once the start button 34 is pushed , an auxiliary timer t 1 starts . the auxiliary timer t 1 causes a delay to prevent the procedure from continuing before the connector connects to the test volume 10 . after the delay caused by the timer t 1 the valve v2 energizes ( i . e . closes ) and after a predetermined delay , such as about 0 . 1 seconds , to ensure that the valve v2 properly energizes , the valve v1 energizes ( i . e . opens ). thus , as shown in fig6 b , the pressure source 50 is in communication with the test and reference volumes 10 , 12 to bring the two volumes up to the desired test pressure . provided that the test volume 10 is able to pressurize , the pressure switch 94 closes first and then the pressure switch 92 closes . alternatively , when a pressure transducer is used , the system waits for the pressure transducer to sense that the test volume 10 has achieved the proper pressure and remains pressurized . the valve v1 then closes as shown in fig6 c , thereby closing off the pressure source , and the system stabilizing indicator light 44 comes on . a system stabilizer timer t 2 then starts , which delays the procedure for a period of time to allow the two volumes 10 , 12 to come to an equilibrium state , thereby negating all thermal effects that are present in the two volumes due to the pressurization . as was mentioned previously , one way to minimize thermal effects is to make the test and reference volumes 10 , 12 equal in size . by making the volumes equal in size , or nearly so , the two volumes will have mirrored thermal effects , and any thermal effects in one volume will be counteracted by a counteracting thermal effect in the other volume , thereby minimizing the time needed to stabilize the two volumes . however , in the event that one volume is larger than the other , it may take several minutes or more for the two volumes to stabilize . in addition , for filling large volumes , it would be beneficial to incorporate a bypass into the leak tester , in which the same or different source of pressure is directly connected to the two volumes , thereby bypassing the remainder of the system until pressurizing was complete . the bypass would allow large volumes to be pressurized in a shorter period of time , thereby speeding up the testing procedure . returning now to the preferred testing procedure , after the end of the stabilizing time , the valves v3 and v5 energize ( i . e . close ), as shown in fig6 d , so that the test volume and the reference volume are isolated from each other . after delaying for another predetermined period of time , such as about 0 . 25 seconds , to ensure that the valves v3 and v5 are closed , the valve v2 is opened , as shown in fig6 e , so as to vent the input line 88 and the lines 88a , 88b . further , the valves v4 and v6 are energized ( i . e . opened ) as shown in fig6 e to communicate the test volume 10 and the reference volume 12 with the bubble chamber 32 . after the valves v4 and v6 are opened , the procedure again delays for a predetermined period of time , such as about 0 . 25 seconds , and then the valve v7 is energized ( i . e . opened ) to drop the pressure on one side of the bubble chamber 32 , as shown in fig6 f , to provide a surge of air to clear out the bubble chamber 32 of any backflow . when the test volume and reference volume are connected with the bubble chamber 32 , there could be a small amount of flow that could occur through the bubble chamber 32 . the stabilizing timer t 3 delays for a period of time to allow the system to drop pressure on the one side and send a surge of air through the bubble chamber 32 to clean out the tube 76 of any liquid therein due to liquid backflow . after this delay period , the valve v7 is again closed for testing as shown in fig6 g , and the system delays for a period of time , such as about 2 . 0 seconds . in certain circumstances , it would be beneficial to be able to pause the procedure at this point . for instance , it may be beneficial for the user to utilize two testers at the same time , in order to increase the amount of tests performed . thus , the user could be setting - up one tester while the other is already set - up and ready for testing . however , while the user is occupied setting - up one tester , the test on the other tester may be missed . therefore , it would be desirable to be able to pause the procedure at this point on one tester , just prior to testing , thus allowing the user to continue the set - up on the other tester without having to worry about missing the actual leak test . to allow for this , the tester 20 is provided with a switch 102 , such as a dip switch or the like , which must be thrown by the user prior to the start of the procedure if the user wants the procedure to automatically pause after the expiration of the 2 . 0 sec . delay so as to temporarily pause the procedure until the user again pushes the start button 34 to continue . alternatively , for the tester 20 &# 39 ;, the switch 102 would be eliminated , and the functions of the switch would be integrated into the system control of the tester 20 &# 39 ;, such that the system automatically pauses the procedure after the expiration of the 2 . 0 sec . delay , with the procedure continuing once the start button is pushed by the user . the user can preferably turn on and off the automatic stoppage of the procedure through inputs entered on the keypad 150 . thus , the switch in the tester 20 , as well as the switch - like functions in the tester 20 &# 39 ;, allows the user to set - up the second tester without having to worry about missing the test on the first tester . in the event that the switch 102 is not thrown on the tester 20 before beginning the procedure , or the switch - like functions in the tester 20 &# 39 ; are not turned on , then the procedure will automatically continue after the 2 . 0 sec . delay ends . provided that the procedure has been paused , the start button 34 is pressed to continue the procedure , the system stabilizing indicator light 44 turns off and the system testing light 46 comes on initiating the actual leak test . the leak test is performed for a period of time determined by a test timer t 4 . the test timer t4 can be manually set to however long the bubble chamber 32 is to be monitored for the presence of bubbles in the liquid . the presence of bubbles during the test time provides an indication that there may be a leak in the test volume . in this event , further testing can then be done on the test volume to determine the actual source and location of the leak . once the test time is completed , the test light 46 goes out , the valves v4 and v6 close , as shown in fig6 i , and after a predetermined period of delay , such as about 0 . 25 seconds , the valves v3 and v5 open to allow the two volumes to vent , as shown in fig6 . an auxiliary timer t 5 then starts , which delays actuation of the valve v8 and thus prevents disconnection of the connector from the test part until the system goes to atmospheric pressure . after completion of this delay time , valve v8 actuates and the system is back to its initial state shown in fig6 a . the testing procedure outlined above is thus used to test for a leak in the test volume . as is evident from fig6 a - i , the valves v4 and v6 not only allow a pressure to be maintained across the bubble chamber 32 , but the valves v4 and v6 also prevent the liquid 16 in the bubble chamber 32 from backflowing through the lines 82 , 84 and into the volumes 10 , 12 . it is to be realized that the testing procedure could vary from that specifically described above . for instance , if the test volume 10 was manually connected to the test port 52 , thereby eliminating the need for the valve v8 , then the steps relating to the valve v8 could be eliminated . as mentioned above with respect to the testing procedure , there should always be a pressure maintained across the bubble chamber 32 . by maintaining a pressure across the bubble chamber 32 , the pressure difference between the two volumes and the bubble chamber 32 when the valves v4 and v6 are opened will be minimized . thus , when the two volumes 10 , 12 are communicated with the bubble chamber 32 , faster stabilization is achieved . in order to achieve a pressure across the bubble chamber 32 , the leak tester of the invention performs a startup procedure each time the start button 34 and the system reset button 36 are pushed at the same time , and the power to the tester is turned &# 34 ; on &# 34 ;. the startup procedure need be performed only once at some point prior to performing the testing procedure , and will only be re - performed if the start button 34 and the system reset button 36 are pushed at the same time and the power to the tester is turned &# 34 ; on &# 34 ;. like the testing procedure , the startup procedure will be described for a positive pressure condition . fig9 illustrates a timeline related to the startup procedure , showing the state of each valves v1 - v8 during the procedure . the system is set up with a good test volume and a good reference volume . the incoming air line is set to a pressure of 5 % lower than the desired test pressure . ( or 5 % higher for vacuum ) the &# 34 ; start &# 34 ; and &# 34 ; system reset &# 34 ; buttons are pushed simultaneously and held in , and the power switch is turned on . the buttons are then released . ( the system will go into start - up mode . all led &# 39 ; s will be blinking .) the two led &# 39 ; s on the back of the tester should be on . if they are not , then the pressure gauges were not backed out far enough . ( when a pressure transducer is used instead of the two pressure switches , the two led &# 39 ; s will not be present ). the user then turns the pressure switch 94 in until its led goes out . the pressure switch 94 is rotated back and forth slowly to find the point at which the switch is activating . once this point is found , the switch is backed off just slightly until the led light comes on . this will set the pressure switch . for a pressure transducer , the pressures are set by the user through the user interface , i . e . keypad 150 , on the tester 20 &# 39 ;. the incoming air line pressure is then set to 5 % above the desired test pressure . the pressure switch 92 is adjusted the same way as switch 94 . once the pressure switches are set , the start button is pushed by the user . the system checks both pressure switches to make sure they are on . if they are not , the system waits for the start switch . the pressure switch 94 is monitored by the system , until the end of the procedure . with reference to fig9 the startup procedure begins by connecting a test volume and reference volume to the tester 20 . the incoming air pressure provided by the pressure source 50 is set to a pressure 5 % lower ( or 5 % higher for vacuum conditions ) than the desired testing pressure . once this is done , the start button 34 and system reset button 36 are simultaneously pressed and held in , the power is turned on and then the buttons 34 , 36 are released . the tester 20 will then automatically go into its startup mode . the tester 20 is preferably provided with a pair of led &# 39 ; s on the rear wall 30 thereof , with one led providing an indication of the operation of the pressure switch 92 and the second led providing an indication of the operation of the pressure switch 94 . the two led &# 39 ; s are preferably on after the buttons 34 , 36 are released . these two led &# 39 ; s are eliminated when a pressure transducer is used in place of the two pressure switches . the valve v8 then energizes , and the auxiliary timer t 1 delays for a period of time before the valves v1 , v2 and v7 energize . then , the user adjusts the pressure switch 94 back and forth to find the point at which the switch is activating . once this point is found , the pressure switch 94 is backed off slightly until its led comes on . this sets the pressure switch 94 . the pressure source is then set to a pressure 5 % higher than the desired test pressure and the pressure switch 92 is then set in the same manner that pressure switch 94 is set . after setting the pressure switches , the start button 34 must again be pressed . if the start button is not pressed , the procedure will not continue . once the procedure starts , it is important that the system monitor the pressure switch 94 until the end of the procedure to check for a mass leak in the system . the valves v4 and v6 are then energized for a period of time , such as for about 10 . 0 seconds , and then de - energized . after waiting for a period of time , such as about 1 . 0 - 2 . 0 seconds , valves v4 and v6 are again energized , this time for a shorter period of time , such as about 1 . 0 seconds , after which the valve v4 and v6 are de - energized . the system then waits for a period of time , such as about 0 . 25 seconds , and then the valves v1 , v2 and v7 are de - energized . the auxiliary timer t 5 then starts , delaying the time before the auxiliary valve v8 de - energizes . once valve v8 de - energizes , the tester 20 is ready to perform the testing procedure . the startup procedure set forth above , and illustrated in fig9 pressurizes the bubble chamber 32 to a pressure that is less than source pressure but greater than ambient so that the pressure difference between the two volumes 10 , 12 and the bubble chamber 32 during the testing procedure is minimized , thereby reducing the time needed to stabilize the system once the two volumes are communicated with the bubble chamber . it is to be realized that the startup procedure could vary from that specifically described above , particularly when a pressure transducer is used . the use of a pressure transducer will allow the system to automatically perform the majority of the startup procedure , thereby reducing the amount of user interaction required during the startup procedure . in the event the pressure switch 94 senses that the pressure has fallen below the pressure set point of the switch 94 , which is set in the startup procedure , thereby indicating that there is a mass leak in the system , the mass leak indicator light 48 will turn on , and the tester 20 will shut down . next time the tester is run , the bubble chamber 32 will be pressurized and then the tester 20 will go directly into testing . this procedure is again described in relation to positive pressure conditions . fig1 illustrates a timeline of the mass leak restart / pressurize procedure . the system is started as normal by pushing the start button . ( the system will automatically go into start - up mode . all led &# 39 ; s will be blinking .) the system monitors and waits for pressure switch 92 to activate once the pressure set by switch 92 has been reached , the system turns off the mass leak timer . the system monitors pressure switch 94 until the end of the procedure . the system then energizes v4 / v6 / v7 for about 5 . 0 sec ., and the system monitors the pressure and energizes v1 as needed to maintain the pressure . the system waits for switch 92 to go off . max about 1 . 0 min . the system checks if switch 92 is on . if not , the system goes to *. * go directly to the beginning of the system stabilize timer t 2 in the main program . the procedure is initiated by starting the tester as normal , whereby the tester will automatically go into its startup procedure and all led &# 39 ; s will be blinking . the valve v8 then energizes and the auxiliary timer t 1 delays for a period of time after which a mass leak timer starts . the valves v1 and v2 are then energized and the system monitors and waits for pressure switch 92 to activate . once pressure switch 92 activates , the valve v1 is de - energized and the mass leak timer is turned off . again , pressure switch 94 is monitored by the system until the end of the procedure . the valves v4 , v6 and v7 are then energized for a period of time , such as about 5 . 0 seconds . during this time , the system monitors the pressure switch 92 or the pressure transducer to check whether it has activated , thereby indicating that the pressure has dropped . in the event that pressure has dropped , v1 is again energized so as to bring the pressure back up . if the pressure does not drop , v1 need not be re - energized . in the event that v1 energizes to bring the pressure back up , the procedure de - energizes v1 after the 5 . 0 sec . delay so that the rest of the procedure can resume . valves v3 and v5 are then energized , at which point the system monitors the pressure switch 92 , waiting for it to go off . the maximum time for waiting for the switch 92 is about 1 . 0 minute . valves v4 and v6 are then de - energized , and after a predetermined delay time , such as about 0 . 25 seconds , valves v3 , v5 and v7 are de - energized . at this point , the system checks to see if switch 92 is on . if it is not on , the procedure goes directly to the beginning of the system stabilizer timer t 2 in the testing procedure . if the switch is on , valve v2 is de - energized and the system waits for the switch 92 to go off . once the switch 92 is off , valve v2 is energized and the procedure goes directly to the beginning of the system stabilizer timer t 2 in the testing procedure . the mass leak restart / pressurize procedure thus re - pressurizes the bubble chamber 32 in the event of a mass leak , and returns back to the testing procedure to resume testing . it is to be realized that the mass leak procedure could vary from that specifically described above . with reference now to fig1 a - f , an alternative valve arrangement 110 is illustrated that utilizes three - way valves v9 - v11 , a valve v12 , and a valve 100 , such as a needle valve . this arrangement 110 is similar to the arrangement 80 , except that the two - way valves v5 and v6 are replaced by the single three - way valve v9 , the valves v3 and v4 are replaced by the single three - way valve v10 , and the valves v1 and v2 are replaced by the single three - way valve v11 . the valve v12 and the valve 100 are the similar to the valves v7 and valve 100 , respectively , in fig6 a . this embodiment is simpler in design than the embodiment in fig6 a - i , and requires fewer valves than the first embodiment . the pressure designations in the flow passages is the same as is used for fig6 a - i . like the first embodiment , the valves v9 - v11 selectively control flow between a bubble chamber 112 , the test port 52 , the reference port 54 and the input port 56 . the bubble chamber 112 is preferably the same type of bubble chamber as used in the first embodiment , however , the bubble chamber 112 could be different if desired . in addition , fig1 a - f illustrate the valve arrangement 110 under positive pressure conditions . however , like the first embodiment , this embodiment can be used for negative pressure as well . referring now to fig1 a , flow lines 114a , 114b extend from the bubble chamber 112 to the valves v9 , v10 , respectively . a vent line 116 connects to the flow line 114b and communicates with a vent , such as ambient air outside of the housing 22 , to allow venting of pressure . the valve v12 is disposed in the vent line 116 and allows flow therethrough , with the valve 100 being adjustable so as to control the amount of flow through the vent line 116 . in addition , flow lines 118a , 118b extend between the valves v9 , v1 and the reference port 54 and test port 52 , respectively . a further flow line 120 extends from the valve v11 and branches into two lines 120a , 120b , with the line 120a connecting to the valve v9 and the line 120b connecting to the valve v10 . an input line 122 extends from the input port 56 to the valve v11 , and a further vent line 124 extends from the valve v11 and connects to a vent . in this embodiment , the pressure switches 92 , 94 and the pressure gauge 40 are all disposed in the flow line 118b leading to the test port 52 and test volume 10 for sensing the pressure in this line . further , as in the first embodiment , the flow lines 114a , 114b are initially under pressure to ensure that there is a pressure across the bubble chamber 112 . thus , in the initial , relaxed state of the valve arrangement 110 shown in fig1 a , the valves v9 , v10 , v11 are positioned so as to communicate the test volume 10 and reference volume 12 with the vent line 124 so as to vent the two volumes . the two volumes 10 , 12 are also in communication with each other at this point . additionally , the valve v12 is closed , so that the flow lines 114a , 114b remain under pressure . the valve v11 thus forms a means for selectively controlling the flow of positively pressurized fluid through the input port 56 and into the system , as well as forming a means for selectively controlling flow through the vent line 124 to the vent . the valves v9 and v10 form a means for selectively controlling flow to the test port 52 and reference port 54 , respectively , for selectively controlling flow between the test port and reference port , and for selectively controlling flow between the test port 52 and the bubble chamber 112 and between the reference port 54 and the bubble chamber 112 , respectively . the valve v12 is normally closed and is disposed in the vent line 116 , and with the valve 100 , forms a means for selectively controlling flow to the vent . turning to fig1 b , to pressurize the two volumes 10 , 12 , the valve v11 is actuated so as to communicate the input line 122 , and thus the source of pressure 50 , with the flow line 120 and thus with the two volumes 10 , 12 . pressurization continues until the pressure switch 92 activates at the desired test pressure , as in the first embodiment . once the desired test pressure is reached , the two volumes 10 , 12 are isolated from the pressure source by suitably positioning the valves v9 , v10 to close off communication with the source , and placing the two volumes in communication with the bubble chamber , as shown in fig1 c . as shown in fig1 d , the valve v11 is then activated to vent pressure in the lines 120 , 120a , 120b , and the valve v12 is activated momentarily prior to testing to allow a surge of air to clear the tube in the bubble chamber , as in the first embodiment . the valve v12 is then closed , and the system performs the leak test , as shown in fig1 e . once testing is completed , the valves v9 , v10 are positioned as shown in fig1 f so as to vent the two volumes 10 , 12 and the system is returned to its initial state , ready to conduct a new test . a testing procedure , a startup procedure and a mass leak restart / pressurizing procedure would also be used with the embodiment of fig1 a - f . these procedures would be similar to the corresponding procedures used for the embodiment of fig6 a - i , but the procedures would be slightly modified to account for the difference in the valving used for each embodiment . the details of the procedures and timelines for use with the embodiment of fig1 a - f would be readily apparent from the description of the procedures and timelines given for the embodiment of fig6 a - i , and thus the details of the procedures and timelines are not discussed herein . the above specification , examples and data provide a complete description of the manufacture and use of the composition of the invention . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended . | 6 |
the embodiment of the invention will be described below , referring to the drawings . fig2 shows the schematic structure of the optical pick - up apparatus of the embodiment of the present invention . the optical pick - up apparatus shown in fig2 is structured in such a way that : concerning both cd ( second optical disk 32 ) having 1 . 2 mm protective substrate 32 b , and dvd ( first optical disk 31 ) having 0 . 6 mm protective substrate 31 b , recording and / or reproduction of information can be performed on information recording surfaces 31 a and 32 a of first optical disk 31 and second optical disk 32 , by the light fluxes of wavelengths of 655 nm and 785 nm from the first and the second light sources , respectively . as shown in fig2 , the optical pick - up apparatus is provided with the optical system , including : coupling lens 16 which refracts both light rays coming from first semiconductor ( a first light source ) laser 11 which emits light flux at a wavelength of 655 nm for dvd use , and light rays coming from second semiconductor ( a second light source ) laser 12 which emits light flux at a wavelength of 785 nm for cd use , to make nearly parallel fluxes of infinite - point rays , and objective lens 18 which brings the infinite - point rays from coupling lens 16 to a focal point on information recording surfaces 31 a and 32 a of optical disks 31 and 32 , respectively . further , between each of light sources 11 and 12 and coupling lens 16 , arranged are : beam splitter 13 , through which the light flux coming from first light source 11 passes , and by which the light flux coming from second light source 12 is reflected , beam splitter 14 , through which each of the light fluxes coming from both of light sources 11 and 12 passes , and further , the light flux is reflected by information recording surfaces 31 a and 32 a of each of optical disks 31 and 32 , then the optical paths of the light flux are changed by beam splitter 14 , and the light flux travels to optical detector 21 . objective lens 18 has flange section 18 a on its outermost side , by which it is possible to attach objective lens 18 on the optical pick - up apparatus . flange section 18 a has a surface projecting perpendicularly to the optical axis of objective lens 18 so that it is possible to be mounted precisely . objective lens 18 is driven toward the focusing direction and the tracking direction by double shaft actuator 22 . still further , the ring - shaped diffractive structure for the correction of the spherical aberration is formed to correct the spherical aberration caused by the difference of the thickness between protective substrates 31 a and 32 b of each of optical disks 31 and 32 , at the central area on the optical surface of objective lens 18 , which is used for recording and / or reproduction of information on both first optical disk 31 and second optical disk 32 . the ring - shaped diffractive structure is one which compensates for spherical aberration of the focal point on information recording surface 31 a to be in a range where effective recording and / or reproduction of first optical disk 31 can be performed , when the refractive indexes of coupling lens 16 and objective lens 18 and the emission wavelength of first light source 11 are changed due to change of temperature of the optical pick - up apparatus during use . the above - mentioned ring - shaped diffractive structure is formed on the peripheral area of objective lens 18 which is used mainly for reproduction or recording of information for first optical disk 31 . the central area of objective lens 18 includes the optical axis of the lens , and is a common area for dvd and cd use , whereas the peripheral area is positioned around the central area , and is used exclusively for dvd . in case of information reproduction from first optical disk ( dvd ) 31 , a light beam is emitted from first semiconductor laser 11 , which passes through beam splitters 13 and 14 , quarter wavelength plate 15 , and coupling lens 16 to become a parallel light beam . the parallel light beam passes through diaphragm 17 , and is converged on information recording surface 31 a by objective lens 18 , through protective substrate 31 b of first optical disk 31 . then , the light beam is modulated by information pits on information recording surface 31 a and is reflected , passes back through objective lens 18 , diaphragm 17 , coupling lens 16 , and quarter wavelength plate 15 , next , the light beam is reflected by beam splitter 14 , and is given astigmatism by cylindrical lens 19 , after that , the light beam passes through concave lens 20 , and enters optical detector 21 . then , information recorded on first optical disk 31 is read - out , and information read - out signals are produced . still further , focal detection and track detection are performed by detecting a change in the amount of light caused by the change of position and the change of shape of specific spot on optical detector 21 , yet further , based on the above - mentioned detection , double shaft actuator 22 moves objective lens 18 in the focusing direction so that the light beam from first semiconductor laser 11 is brought into focus on information recording surface 31 a of first optical disk 31 , and double shaft actuator 22 also moves objective lens 18 in the tracking direction so that the light beam from first semiconductor laser 11 is brought into focus on a predetermined track . the information recording on first optical disk 31 is performed in the same way as mentioned above . next , in case of information reproduction from second optical disk ( cd ) 32 , a light beam is emitted from first semiconductor laser 12 , which is reflected by beam splitter 13 , and passes through beam splitter 14 , quarter wavelength plate 15 , and coupling lens 16 , to become a parallel light beam . the parallel light beam passes through diaphragm 17 , and is converged on information recording surface 32 a by objective lens 18 , through protective substrate 32 b of second optical disk 32 . the light beam is modulated by information pits on information recording surface 32 a and is reflected , passes back through objective lens 18 , diaphragm 17 , coupling lens 16 , and quarter wavelength plate 15 , next , the light beam is reflected by beam splitter 14 , and is given astigmatism by cylindrical lens 19 , after that , passes through concave lens 20 , and enters optical detector 21 . further , information recorded on second optical disk 32 is read - out , and information read - out signals are produced . focal detection and track detection are performed by detecting a change in the amount of light caused by the change of position and the change of shape of the specific spot on optical detector 21 , then , based on the above - mentioned detection , double shaft actuator 22 moves objective lens 18 in the focusing direction so that the light beam from second semiconductor laser 12 is brought into focus on information recording surface 32 a of second optical disk 32 , and double shaft actuator 22 also moves objective lens 18 in the tracking direction so that the light beam from first semiconductor laser 12 is brought into focus on a predetermined track . the information recording on second optical disk 32 is performed in the same way as mentioned above . in case of the above - mentioned reproduction and / or recording on first optical disk 31 , when the refractive indexes of coupling lens 16 and objective lens 18 and the emission wavelength of first optical light source 11 change , due to temperature change of the optical pick - up apparatus , the focal point on information recording surface 31 a changes so that any spherical aberration occurs largely during use of dvds than cds . any spherical aberration is corrected by the diffractive structure arranged on the peripheral area of objective lens 18 so that spherical aberration remains in a range in which reproduction and / or recording on first optical disk 31 can be optimally performed . due to this , when relatively short wavelength laser rays and an objective lens with a high numerical aperture are used , as in the case of dvd usage , it is possible to reduce adverse influence of spherical aberrations , caused by temperature change , during the recording and / or reproduction , and thereby , an optical pick - up apparatus exhibiting high reliability can be realized . next , the present invention will be described in detail below , showing examples 1 and 2 of the optical systems in which the objective lens and the coupling lens are paired , however , the present invention is not limited to these examples . in the present example , the first optical information recording medium is a dvd ( design base wavelength : 655 nm ), and the second optical information recording medium is a cd ( design base wavelength : 785 nm ). the optical systems shown in examples 1 and 2 can be applied to the optical pick - up apparatus shown in fig2 . when the optical surfaces of the objective lens and the coupling lens in the present example are structured to be aspheric surfaces , each aspheric surface has the aspheric shape shown in expression 4 , in which โ z โ is parallel to the optical axis , โ h โ is perpendicular to the optical axis , โ r โ is a paraxial radius of curvature , โ k โ is a cone coefficient , and โ a โ is an aspheric coefficient . the diffractive structure formed on the objective lens is shown by the following expression 5 , using ฯ b as the optical path difference function , and radian units . example 1 features an optical system in which the light rays , parallel to the optical axis , enter the objective lens from the coupling lens , in both cases of dvd and cd . fig3 ( a ) shows the optical path for dvd usage , and fig3 ( b ) shows the optical path for cd usage . table 1 shows lens data of example 1 . example 2 is the optical system in which the light rays parallel to the optical axis enter the objective lens from the coupling lens , in the case both for dvd and cd . the optical path for dvd usage is the same as that shown in fig3 ( a ), and the optical path for cd usage is the same as that shown in fig3 ( b ). table 2 shows lens data of example 2 . in examples 1 and 2 , spherical aberration , caused by the thickness difference between the protective substrates , is corrected by the ring - shaped diffractive structure formed in the common area for dvd and cd of the objective lens , and the spherical aberration caused by the temperature change is corrected by the ring - shaped diffractive structure formed in the exclusive dvd area . further , temperature characteristics of the objective lens and the temperature characteristics of the whole optical system in example 1 are shown below in table 3 . further , temperature characteristics of the objective lens and temperature characteristics of the whole optical system in example 2 are shown below in table 4 . as shown in tables 3 and 4 , concerning each of the objective lenses in examples 1 and 2 , among the spherical aberration variation amounts of the converged light spot on the information recording surface due to the temperature change ฮดt , the 3rd spherical - aberration variation amount ฮดsa 3 [ ฮป rms ]/ ฮดt [ยฐ c .] and the 5th spherical aberration variation amount ฮดsa 5 [ ฮป rms ]/ ฮดt [ยฐ c .] satisfy the conditions shown by the above - mentioned formulas ( 7 ) and ( 8 ), respectively . further , they satisfy the condition shown by the above - mentioned formulas ( 9 ) and ( 10 ), respectively . further , concerning each of the optical systems in examples 1 and 2 , among the spherical aberration variation amounts of the converging spot on the information recording surface due to the temperature change ฮดt , the 3rd spherical aberration variation amount ฮดsa 3 [ ฮป rms ]/ ฮดt [ยฐ c .] and the 5th spherical aberration variation amount ฮดsa 5 [ ฮป rms ]/ ฮดt [ยฐ c .] satisfy the conditions shown by the above - mentioned formulas ( 1 ) and ( 2 ), respectively . further , they also satisfy the conditions shown by the above - mentioned formulas ( 4 ) and ( 6 ), respectively . setting the height of the rays to be h l ( mm ), when the rays pass through the surface of the diffractive structure of the exclusive dvd area which is adjacent to the common area on the objective lens , setting the height of the rays of the outermost section of the effective light beam to be h h ( mm ), when the rays pass through the surface on which the diffractive structure exists for the exclusive use of dvd , and setting the wavelength to be ฮป ( mm ), the values ( unit : 1 / mm 2 ) of the expression , shown in following expression 6 using the above - mentioned optical pass difference function ฯ ( h ) shown in expression 1 , satisfy the conditions of the above - mentioned expressions 2 and 3 for the objective lens and the optical system , respectively . the satisfaction of the condition shown in expression 2 satisfactorily correct the deterioration of the spherical aberration due to temperature change , by the wavelength dependence of the diffractive structure . in tables 1 and 2 , f 1 is the focal length ( mm ) of the objective lens on the information recording surface for a dvd , f 2 is the focal length ( mm ) of the objective lens on the information recording surface for a cd , na 1 is the numerical aperture of the image side of the objective lens for the dvd usage , and na 2 is the numerical aperture of the image side of the objective lens for the cd usage . further , in the above - mentioned tables or figs , โ e โ ( or โ e โ) shows powers of 10 , that is , e - 02 or e - 2 means 10 โ 2 . according to the present invention , in the optical pick - up apparatus which performs at least either recording or reproduction for a plurality of information recording media which are of various types , it is possible to provide for a pick - up apparatus and an objective lens for the pick - up apparatus which can correct for the spherical aberration caused by a temperature change in the optical system , when recording or reproduction is performed by shorter wavelength light beams . | 6 |
the present invention relates to backward diodes , as well as to apparatus incorporating them therein . the following description is presented to enable one of ordinary skill in the art to make and use the invention and to incorporate it in the context of particular applications . various modifications to the preferred aspect , as well as a variety of uses in different applications will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other aspects . thus , the present invention is not intended to be limited to the aspects shown , but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . a band diagram of a conventional implementation of a typical backward esaki diode is shown in fig1 and its current - voltage i ( v ) curve is shown in fig2 . the backward esaki diode includes a conventional heavily doped p - n junction of ge or other semiconductor . the heavy doping bends the valence bands 100 and 102 sufficiently to allow electrons in the n - doped side to tunnel through the relatively thin band - bending region into the p - doped side . if the doping is very heavy on both sides , a negative resistance peak 200 in the i / v curve is produced for positive bias as the electrons tunnel from the n - doped side to the holes in the p - doped side . the vertical arrows in fig1 indicate the direction of the shift of valence band edges 100 and 102 with positive bias . for sufficient positive bias the electron energies are too high for tunneling into the hole states , and negative differential resistance results , as demonstrated by the downward slope 202 with increasing voltage in fig2 . for negative bias , if the doping is high , the band - bending region is short , and electrons from the p - doped side at energies below the fermi level 104 can tunnel from left to right into the n - doped side . this current can be large and increases exponentially with reverse bias , as demonstrated by the i ( v ) curve to the left of the origin 204 in fig2 . if the p - type doping is not too large , the fermi level 104 , in fig1 will be close to the valence band edge on the p - type side 102 . in this situation , there are relatively few hole states for the electrons to tunnel into with forward bias . the peak current of the negative resistance i ( v ) will be small , while the tunneling current in the negative bias direction 204 is relatively unaffected and large , as shown in fig2 . the desirable characteristic is the highly non - linear i ( v ) near zero bias , represented by the origin in the i ( v ) curve shown in fig2 . this characteristic makes the backward diode an extremely useful device for mixing and detecting of rf signals . ge diodes have become established as the most useful semiconductor choice for backward diodes . this is mainly due to the band gap , about 0 . 67 ev , at room temperature , which is small enough so that the amount of tunneling is large for small negative bias . at the same time it is large enough to block normal p - n diode - type thermally activated tunneling over the built - in junction voltage for small positive bias . thus the desirable characteristic of large backward current and small forward current for small bias is achieved . ge is rarely grown with modem epitaxial growth technology such as molecular beam epitaxy ( mbe ) due to the rarity of other ge semiconductor device applications . ingaas in particular , by contrast , has increasing application for type iii - v semiconductor circuits and ingaas epitaxial growth facilities are easily accessible . ingaas grown with lattice match to inp is a natural substitute for ge , as it has a small room temperature band gap of 0 . 75 ev . attempts have been made to grow heavily doped p - n junctions of ingaas in order to duplicate the i ( v ) of a comparison ge diode . although backward diodes were easily achievable , initial results were not as good as the comparison ge diode . either high backward currents or low forward currents could be achieved depending on the particular sample , but not both in the same sample . this problem is attributable to two features . first , the slightly greater band gap of the ingaas reduces the backward current compared to ge . second , ingaas is a direct semiconductor , which causes it to have a significantly smaller density - of - states conduction band effective mass than ge ; 0 . 043 versus 0 . 22 in units of the free electron mass . this means that for a similar n - type doping , the fermi level in ingaas is significantly higher as compared with ge . this results in an extended positive voltage range in which the tunneling current increases , i . e ., a high peak voltage ( see fig2 ), with an undesirable linear i ( v ) near the origin . to overcome this limitation , the ability to tailor the ingaas semiconductor layers on a nanometer scale is required . control of the p - doped side is not as critical as that of the n - doped side due to the high density - of - states effective mass of holes as compared with conduction electrons , so it may be kept as highly doped and homogeneous . in the present invention , a thin , highly doped region in the n - side near the p - n junction is used to increase the local electric field , while a lower doped region further away keeps the fermi level adequately low . this significantly enhances the backward tunneling current , while only moderately increasing the undesirable forward current . the highly doped region must be thin enough so that the fermi level does not re - acquire the value associated with the bulk material with that corresponding doping . fig3 ( a ) and fig3 ( b ) show the results of a simulation of the band profile and carrier concentration profile , respectively , where the p - side is uniform with a doping level of 7 ร 10 18 cm โ 3 , a 100 รฅ layer n - doped to 1 ร 10 19 cm โ 3 is present at the junction , and a wide contact layer n - doped with to a doping level of n = 3 ร 10 18 cm โ 3 produces a sufficiently low fermi level for the contact layers . the effect of the 100 รฅ region can be seen in the band profile in that it steepens the voltage drop at the junction and thereby increases the electric field . the fermi level relative to the conduction band is slightly increased , but not significantly . the plot of the concentration versus distance shows a corresponding increase in the number of conduction electrons in the added thin layer . conventional diode manufacturing techniques afford insufficient control to produce a consistent thin layer . therefore , epitaxial - growth techniques such as mbe provide the means for consistent , controlled production of a thin layer . fig4 provides a diagram showing the layer structure of an aspect of the present invention utilizing a thin layer similar to that described relative to fig3 ( a ) and fig3 ( b ). as can be seen from the diagram , the fabrication begins with a substrate 400 of inp n + or other semi - insulating material having a thickness that may be chosen suitable to the particular application . next , a first ingaas layer 402 is deposited and n + doped to generally between 1 ร 10 18 to 1 ร 10 19 cm โ 3 , typically 3 ร 10 18 cm โ . the thickness of the first ingaas layer is shown in the figure as typically about 5000 รฅ . subsequently , a second , thin and highly n + doped ingaas layer 404 is deposited , with the n + doping level generally between 3 ร 10 18 and 3 ร 10 19 cm โ 3 ; typically 1 ร 10 19 . it is important that the doping level of the second ingaas layer is greater than that of the first ingaas layer . the thickness of the second ingaas layer is generally between 25 รฅ and 200 รฅ , typically 100 รฅ . next , a third ingaas layer 406 is deposited with a p + doping generally between 5 ร 10 18 and 2 ร 10 19 cm โ 3 , and typically 1 ร 10 19 cm โ 3 , and with a thickness generally ranging from from 200 รฅ to over 1000 รฅ , and typically 500 รฅ . subsequently , a fourth ingaas layer 408 is deposited with a p + doping generally ranging from 2 ร 10 19 to 5 ร 10 9 cm โ 3 , and typically 3 ร 10 19 cm โ 3 and a thickness generally ranging from 100 รฅ to 1000 รฅ , and typically 200 รฅ . finally , the structure is etched to provide the desired electrical isolation and contact regions , and contacts 410 and 412 are deposited onto the structure . note that fig4 provides a cutaway view of what typically is formed as a circular mesa - type structure , and that contact 412 would generally be formed as a ring . utilizing epitaxial - growth techniques such as molecular beam epitaxy ( mbe ) and metal - organic molecular beam epitaxy ( mombe ) to produce the ingaas structure of fig4 allows for improved control over the manufacturing process , resulting in a more consistent diode . without the control afforded by these techniques , tailoring the second ingaas layer in particular would not be feasible . thus , it is important that the second ingaas layer be formed by an epitaxial - growth technique or a method which achieves a similar result . furthermore , although ingaas has been chosen for the material structure of this example , there are other material structures to which it could apply . fig5 and 6 provide measurements from samples including three ingaas fabricated diodes and a ge diode . fig5 provides current - voltage curves generated for each of the samples . fig6 provides pertinent numerical data regarding each of the samples in units contained in the same data as the current - voltage ( i ( v )) diagram of fig5 . in fig6 v v provides the voltage in volts , v , at the local minimum of the valley toward the right hand side of the figure for each samples , j p provides the current in amps / cm 2 at the local maximum of the current peak located near the middle of the chart for each of the samples , r j provides the resistance in ohms , ฯ , at zero bias , and ฮณ is the curvature coefficient , where ฮณ = โ 2 ๎ข i โ v 2 โ i โ v the last column in fig6 labeled d provides the thickness , in angstroms , รฅ , of a thin ingaas layer with a doping level of 1 ร 10 19 cm โ 3 corresponding to the ingaas layer 304 of fig3 . of the samples , a conventional diode , 2025 , was fabricated without the thin ingaas layer , providing a curvature coefficient ฮณ of approximately 13 and a low current density of 60 , resulting in a relatively slow operational speed . the best diode with the thin ingaas layer was 2026 , which had a higher current density j p and a lower curvature ฮณ than 2089 , demonstrating the ability to trade off desirable features . sample 2026 also provided a lower resistance r j of approximately 155 ฯ . it is important to note that these samples are provided merely for illustrative purpose and not to infer any limitations to the present invention . a figure of particular importance for the voltage sensitivity of square law power measurement applications is ฮณ , the i ( v ) curvature divided by the slope . values comparable to the ge diode were obtained . without the extra thin layer , ฮณ was limited to less than 20 . thus , the ingaas diode of the present invention which provides a controllable profile designed to maximize curvature near the origin of the i ( v ) curve is useful for many applications , especially those requiring highly specific characteristics such as detectors . | 7 |
fig1 - 10 are for the purposes of illustrating the preferred embodiments of the present invention and not for limiting the same . the preferred embodiments of the present invention , as will be discussed below and as discussed in the summary of the invention , is generally related to z - pins 10 having a unique configuration . for example , the z - pins 10 may have a cylindrical middle flange section 16 so as to evenly distribute shearing forces . the present invention is additionally generally related to the position of the z - pins 10 within attached layers 12 , 14 , the orientation of the z - pins 10 in relation to an applied force , and a strip 20 to allow the attachment of a wide selection of materials from which the first and second layers 12 , 14 may be manufactured . the following is a brief discussion of the z - pins 10 and its relationship to the two attached layers 12 , 14 . generally , fig1 illustrates a z - pin 10 which has three flange sections 16 . fig2 illustrates the z - pins 10 before it 10 is embedded into first and second layers 12 , 14 , and subsequently , fig3 illustrates the z - pins 10 once they are embedded into the first and second layers 12 , 14 . the flange sections 16 of the z - pin 10 may be radially extending and have arcuately contoured peripheral edges . at least one of the flange sections 16 a of the z - pin 10 may be embedded into the first layer 12 , and at least one of the flange sections 16 b of the z - pin 10 may be embedded into the second layer 14 . the first and second layers 12 , 14 may have a mating surface 18 which is a portion of a surface of the first or second layers 12 , 14 in contact with the radially extending flange sections 16 of the z - pins 10 . referring now to fig4 , a strip 20 is shown which is used to attach the first and second layers 12 , 14 . the attachment of the first and second layers 12 , 14 as shown in fig4 is different compared to the attachment of the first and second layers 12 , 14 shown in fig3 . in particular , fig3 illustrates a plurality of z - pins 10 embedded into the first layer 12 which are subsequently embedded into the second layer 14 . in fig4 , the plurality of z - pins 10 embedded into the first layer 12 are not subsequently embedded into the second layer 14 . rather , they are embedded into the strip 20 , and a plurality of z - pins 10 are embedded into the second layer 14 which are subsequently embedded into the strip 20 . in this way , the plurality of z - pins 10 which are embedded into the first layer 12 and the plurality of z - pins 10 which are embedded into the second layer 14 are subsequently embedded into the common strip 20 to thereby attach the first and second layers 12 , 14 . the advantage of the strip 20 is that a wide range of materials may be attached to each other . for example , the material of the first layer 12 may be of a chemically incompatible material compared to the material of the second layer 14 . in this way , the intermediate strip 20 may isolate the chemical reactivity between the first and second layers 12 , 14 . whereas , in the prior art , the two incompatible materials of the first and second layers 12 , 14 could not be attached to each other , now , the two incompatible materials may be attached to each other . as will be discussed below , the use of various materials in the manufacture of attaching the first and second layers 12 , 14 is advantageous . for example , the failure mode of the attached first and second layers 12 , 14 may controlled such that failure of the attachment between the first and second layers 12 , 14 may be at the z - pins 10 through failure of the z - pin 10 and not at the interface surface 22 of the attached layers 12 , 14 through delamination . the failure of the attached first and second layers 12 , 14 may be preferable at the z - pin 10 because the z - pin 10 may be more easily replacable compared to the layers 12 , 14 . by adding the strip 20 between the first and second layers 12 , 14 , the volume of the attached first and second layers 12 , 14 is increased by the thickness of the strip 20 because the strip 20 must encapsulate the portion of the z - pin 10 which protrudes from the first and second layers 12 , 14 . in this regard , the thickness of the strip 20 may be greater than the sum of the heights of the z - pins 10 externally protruding from respective interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . alternatively , the thickness of the strip 20 may be less than the sum of the heights of the protruding z - pins 10 from respective interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . this embodiment which is illustrated in fig4 shows the z - pins 10 embedded within the first layer 12 offset from the z - pins 10 embedded within the second layer 14 so as to form a more compact attached first and second layers 12 , 14 . in another aspect of the present invention , a longitudinal axis 24 of the z - pins 10 used to attach the first and second layers 12 , 14 may be aligned with an applied force โ f โ which acts upon the first and second layers 12 , 14 . as a preliminary matter , definitionally , the longitudinal axis 24 is located centrally along the length of the z - pin 10 , and the applied force is the sum of all forces acting upon the first and second layers 12 , 14 . the alignment between the applied force and the longitudinal axis 24 of the z - pin 10 aids in controlling the failure mode of the attachment between the first and second layers 12 , 14 by ensuring that the summation of forces acting on the z - pin 10 is only in tension which is preferable over other forces such as torsion and moment . fig5 illustrates z - pins 10 with its longitudinal axis 24 in alignment with the applied force โ f1 .โ in particular , the applied force โ f1 โ acts upon the first and second layers 12 , 14 at an angle which is 70 ยฐ from the interface surfaces 22 a , 22 b of the first and second layers 12 , 14 , and accordingly , the longitudinal axis 24 is also oriented within the first and second layers 12 , 14 to be at an angle which is 70 ยฐ from the interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . as such , the z - pin 10 may experience only a tensile force . if the plurality of z - pins 10 had its longitudinal axis 24 perpendicular to the interface surfaces 22 of respective first and second layers 12 , 14 , as shown in fig4 , and the first and second layers 12 , 14 are subjected to a force โ f2 โ at an angle of 70 ยฐ with respect to the interface surfaces 22 of the first and second layers 12 , 14 , then the plurality of z - pins 10 would be subjected to a variety of forces in addition to the tension force such as a shearing force , and a torsion force . hence , the z - pins 10 embedded within the first and second layers 12 , 14 may fail in other modes such as in shear , torsion or moment , whereas , the z - pins 10 having its longitudinal axis 24 aligned with the direction of the applied force โ f โ may fail only in tension . as such , the z - pins 10 having a longitudinal axis 24 aligned with the direction of the applied force have a greater degree of predictability and controllability compared to z - pins 10 having a longitudinal axis 24 misaligned with the direction of the applied force โ f โ subjected upon the first and second layers 12 , 14 . in another aspect of the present invention , instead of a separate and distinct z - pin 10 which attaches the first and second layers 12 , 14 , unitary nubs 26 may be formed as part of the either the first or second layer 12 , 14 , as shown in fig6 and 7 . in fig6 , the nubs 26 are formed as part of the second layer 14 which is a matter of convenience in explaining the various aspects of the present invention . more particularly , the first layer 12 may have mating surfaces 18 to receive the nubs 26 , and the second layer 14 may be manufactured as a unitary structure with the nubs 26 . the second layer 14 may have a plurality of nubs 26 with each nub 26 having at least one radially extending flange section 16 . in this regard , the nubs 26 may be embedded into first layer 12 and received by the mating surfaces 18 of the first layer 12 through the various manufacturing processes described in this specification . additionally , the longitudinal axis 24 of the nubs may be aligned with the applied force . still yet in another aspect of the present invention , the density of the z - pin material may be selected to be lower than the density of the materials of the first and second layers 12 , 14 so as to lower the overall density and weight of the attached first and second layers 12 , 14 and / or strip 20 compared to first and second layers 12 , 14 attached through other means such as welding or adhesive bonding . the advantage of making a structure 28 ( i . e ., attached first and second layers 12 , 14 ) lighter is obvious for many reasons such as reduced fuel consumption if the structure 28 was used on an airplane or car with the added benefit of being strong . in another aspect of the present invention , the shape of the flange sections 16 of the z - pin 10 may be re - contoured so as to more evenly distribute a shearing force that may be loaded onto the z - pin 10 . in particular , the middle flange section 16 may have a cylindrically contoured peripheral edge as shown in fig8 instead of an arcuately contoured peripheral edge as shown in fig3 . in fig3 , the z - pin 10 is embedded within first and second layers 12 , 14 wherein the z - pin 10 has three radially extending flange sections 16 a , 16 b , 16 c . the middle flange section 16 c is shown as being disposed at the interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . the middle flange section 16 c is arcuately contoured at its peripheral edge and defines a width 30 . in contrast , fig8 illustrates a z - pin 10 embedded within the first and second layers 12 , 14 where the middle flange section 16 c of the z - pin 10 is cylindrically configured at its peripheral edge and the middle flange section 16 c is disposed at the interface surfaces 22 a , 22 b of the first and second layers 12 , 14 . in this regard , this z - pin 10 may bear a greater shear force โ f4 โ compared to a z - pin 10 embedded within the first and second layers 12 , 14 wherein the middle flange section 16 c of the z - pin 10 is accurately contoured at its peripheral edge . the reason stems from the shape of the middle flange section 16 c . if middle flange section 16 c is arcuately contoured then the first and second layers 12 , 14 may slip over the arcuate configuration when a shear force is applied to the first and second layers 12 , 14 . in contrast , if the middle flange section 16 c is cylindrically configured then the first and second layers 12 , 14 will exert an evenly distributed force on the cylindrical surface which is capable of bearing a greater shear force compared to the former arcuately configured flange section 16 . in another aspect of the present invention , the depth to which the flange sections 16 are embedded within the first and second layers 12 , 14 may be controlled so as to control the failure mode of the attachment between the first and second layer 12 , 14 . preferably , the flange sections 16 of the z - pin 10 are embedded within the first and second layers 12 , 14 at least to the width 30 of the flange section 16 . this aspect of the present invention is illustrated in fig3 which illustrates a z - pin 10 a having two radially extending flange sections 16 a , 16 b with each flange section 16 a , 16 b being embedded within respective first and second layers 12 , 14 . preferably , each flange section 16 a , 16 b is embedded within respective first and second layers 12 , 14 to a depth equivalent to the width 30 of the flange section 16 . in this regard , the first and second layers 12 , 14 have a greater amount of material which retains the flange sections 16 a , 16 b within the first and second layers 12 , 14 . in another aspect of the present invention , the number of flange sections 16 embedded within the first and second layers 12 , 14 may be adjusted as a function of the strengths of the first and second layers 12 , 14 . as a preliminary matter , definitionally , the strengths of the first and second layers 12 , 14 in conjunction with the z - pin 10 may be associated with a pull out force . the pull out force is the force required to pull the z - pin 10 out from the first or second layers 12 , 14 through delamination of the first or second layers . additionally , the z - pin 10 has an ultimate and / or yield strength . if the ultimate or yield strength of the z - pin 10 is less than the pull out force of the first and second layers 12 , 14 , then the attached first and second layers 12 , 14 will tend to fail at the z - pin 10 itself . if the ultimate or yield strength of the z - pin 10 is greater than the pull out force of the first and second layers 12 , 14 , then the attached first and second layers 12 , 14 will tend to fail at the first or second layers 12 , 14 with the lower pull out force . if the preferred mode of failure is at the z - pin 10 , then additional flange sections 16 formed on distal ends of the z - pin 10 may be embedded within the first and second layers 12 , 14 to increase the pull out force of the first and second layers 12 , 14 to a level greater than a force required to break the z - pin 10 . alternatively , if the preferred failure mode is at the first layer 12 , then the number of flange sections 16 embedded within the first layer 12 may be reduced such that the pull out force of the z - pin 10 from the first layer 12 is lower than the pull out force of the z - pin 10 from the second layer 14 and is lower than the force required to break the z - pin 12 . in another aspect of the present invention , the z - pin material may be selected to have a unique physical characteristic in relation to the physical characteristics of the materials from which the first and second layers 12 , 14 are manufactured . for example , the first layer 12 , second layer 14 and z - pin 20 may be manufactured with materials that have different or equivalent coefficients of thermal expansion ( cte ), hardness , melting temperature , chemical reactivity and density . by way of example and not limitation , to achieve the various unique physical relationships , the first layer 12 , second layer 14 , strip 20 and z - pin 10 may be manufactured from materials selected from the group consisting of plastic , composite , metallic , ceramic , graphite epoxy , thermosetting material and thermoplastic material . in relation to the cte relationship , the cte of the z - pin 10 may be less than the cte of the first and second layers 12 , 14 . in this regard , when the structure 28 comprising the z - pin 10 , first layer 12 and second layers 14 is heated , the z - pin 10 will expand at a slower rate compared to the rate of expansion of the first and second layers 12 , 14 . as such , the z - pins 10 will not exert a force on the mating surface 18 of the first and second layers 12 , 14 . preferably , the cte of the z - pin 10 is equal to the cte of the first and second layers 12 , 14 . in this regard , when the structure 28 is heated , the z - pins 10 will expand or contract at the same rate compared to the first and second layers 12 , 14 . as such , the z - pins 10 maintain a constant pressure between the z - pins and mating surfaces of respective first and second layers . in relation to the hardness relationship , the hardness of the z - pin 10 may be less than the hardness of the first and second layers 12 , 14 . in this way , the z - pin 10 may be drilled out when there is a failure in the z - pin 10 and there are remains of the z - pin 10 within the mating surface 18 of the first and second layers 12 , 14 . in relation to the melting temperature relationship , the melting temperature of the z - pin 10 may be greater than the melting temperature of the first and second layers 12 , 14 . in this regard , the z - pin 10 may be embedded into the first and second layers 12 , 14 through various manufacturing processes which may use heat . for example , the z - pin 10 may be embedded into the first layer 12 through investment casting . in investment casting , the z - pin ( s ) 10 may be embedded in the investment with a portion of the z - pin 10 protruding into the cavity after the wax has been removed therefrom . in this way , the z - pin ( s ) 10 may be embedded within the layer 12 , 14 after the investment material is removed from the casting or layer 12 , 14 . alternatively , the z - pin 10 may be embedded into the first layer 12 through methods such as injection , resin transfer and resin infusion . in relation to the chemical reactivity relationship , the chemical reactivity of the z - pin 10 with various chemicals may be different compared to the chemical reactivity of the first and second layers 12 , 14 with those chemicals . in this regard , the z - pin 10 may be embedded into the first and second layers 12 , 14 through various manufacturing processes which may use a chemical reaction such as resin transfer molding . referring now to fig9 , the same illustrates a z - pin 10 c as described in the &# 39 ; 593 patent . the z - pin 10 c may be embedded into first and second layers 12 , 14 by injecting the z - pin material in a liquid form through a channel 32 formed in one of the layers 12 , 14 . in fig1 , the channel 32 is formed in the first layer 12 . the first and second layers 12 , 14 have mating surfaces 18 configured in the shape of the z - pin 10 c shown in fig9 . the first and second layers 12 , 14 are attached to each other and the mating surfaces 18 of the first and second layers 12 , 14 are aligned with each other . the z - pin material in liquid form in injected into the channel 32 and allowed to fill the mating surfaces 18 of the first and second layers 12 , 14 . thereafter , the liquid z - pin material may be solidified to form the z - pin 10 c within the first and second layers 12 , 14 . this same technique may be used to attached the first and second layers 12 , 14 with z - pins 10 of various shapes and sizes such as the shape of the z - pins 10 shown in fig3 . this description of the various embodiments of the present invention is presented to illustrate the preferred embodiments of the present invention , and other inventive concepts may be otherwise variously embodied and employed . the appended claims are intended to be construed to include such variations except insofar as limited by the prior art . | 1 |
as starting material , standard sponge zirconium with about 40 % recycling material is used , which is at least double melted in a conventional manner . during the ingot manufacture , the alloying elements are added to form zircaloy - 2 or zircaloy - 4 . the manufactured ingot is forged in the beta - phase region , at a temperature of around 1150 ยฐ c ., to dissolve and distribute phases containing silicon . thereafter , a heat treatment at 450 to 500 ยฐ c . may be made for the purpose of precipitating small suicides and secondary - phase particles comprising the alloying elements . this heat treatment may also be omitted . conventional forging to reduce the dimensions of the material is made in the alpha - phase region to prevent the silicides from growing . the forging is reduced additionally by hot rolling for example after preheating at 950 ยฐ c . for 15 minutes or 750 ยฐ c . for 45 minutes to a thickness of about 30 to 20 mm followed by a second hot - rolling operation to a plate thickness of about 6 mm at a maximum temperature of 650 ยฐ c . a 1020 ยฐ c . solution treatment for 5 to 10 minutes followed by rapid cooling may be added at 30 / 20 mm thickness in order to homogenize the alloying elements , such as tin , iron , chromium or nickel . the temperature during the hot - rolling steps is kept relatively low to avoid the growth of silicides and other impurities . thereafter , the substance is cold - rolled in a number of steps down to the finished dimension . between each cold - rolling step , a heat treatment is carried out at about 630 ยฐ c . in a static furnace or 730 ยฐ c . in a continuous furnace . during the finishing beta quenching , a structure which improves the corrosion properties and the ductility is to be achieved . the material is heat - treated by allowing a band of the material to pass through a heat source , for example an infrared lamp , and thus be heated to about 1050 ยฐ c . for about 10 seconds . thereafter , the material is cooled when the band leaves the heating zone . the cooling occurs at a rate of about 25 ยฐ c . per second . the plate material exhibits a microstructure which is characterized by a finely lamellar basketweave structure . the material is heat - treated after the beta quenching at a temperature above 600 ยฐ c . in a static furnace or 700 ยฐ c . in a continuous furnace , and in both cases not above 800 ยฐ c . to manufacture boxes , the plates shall first be bent into u - shape . the bending may be made without preheating of the plate . crossplates for boxes with an internal water cross may be preheated at about 200 ยฐ c . before being bent and embossed . to prevent the risk of cracking during the bending operation , the plates must have a good ductility . the occurrence of even very small cracks in the material leads to the material having to be rejected . microcracks may constitute a problem since they may be difficult to detect . the ductility of the material must thus be sufficiently good to prevent the occurrence of cracking . the bent box halves are joined together by means of tig welding along the respective sides . the box is shaped to obtain the desired straightness and square dimension . the shaping is performed in a conventional manner by fitting the box onto a mandrel of stainless steel , which is true to gauge , and thereafter heating the package to about 600 ยฐ c . since the steel expands more than the zirconium alloy , the dimensions of the mandrel are imparted to the box . | 6 |
fig1 illustrates an example of a power supply according to the present invention . the power supply 10 comprises a primary cell 11 , which is a conventional battery of the type having an anode , a cathode current collector and an electrolyte . the primary cell 11 is further of the type which comprises a passivation layer on a surface of the anode , formed as a result of a chemical reaction between the anode and the electrolyte . in the example shown , the primary cell is a 3 . 6 v lithium thionyl chloride battery . such batteries are particularly suitable for reliably providing power , preferably continuous power ( particularly at low current levels ), to a device for a long duration . such batteries also have a long shelf life , due to the passivation layer , which layer largely prevents self discharge of the battery . although lithium batteries are often designated as long - life batteries , the inventors have found that when connected to a device such as e . g . a machine condition monitor , the battery ( or batteries ) does not always last as long as expected , even at low continuous currents . the reduced battery duration can be due to leakage currents , particularly self discharge which continues to occur during battery operation . as mentioned , the passivation layer largely prevents self - discharge and it is thought that the rate of self discharge increases when the passivation layer breaks down . it has been found that at discharge current densities of less than 10 ฮผa / cm 2 , the passivation layer remains essentially unaffected . as the rate of discharge increases , so does the porosity of the passivation layer , until a level is reached at which the parts of the passivation layer are torn off . this is thought to occur at current densities of around 100 ฮผa / cm 2 and greater . if the battery is then subjected to a much lower rate of discharge ( or if no current is drawn ), a chemical reaction will again take place between the anode and the electrolyte and the passivation layer will be rebuilt . this rebuilding of the passivation layer requires energy and consequently occurs at loss of battery capacity . the present inventors believe that even a spike of current drawn from the primary cell 11 which leads to a discharge current density significantly greater than 10 ฮผa / cm 2 can cause a deterioration in the passivation layer that results in : i . an increase in the self discharge rate of the primary cell and / or ii . a loss of battery capacity after the passivation layer has been repaired . thus , in a power supply according to the invention , the power supply 10 further comprises a current limiter 12 , which prevents the current drawn from the primary cell 11 exceeding a predetermined primary current threshold value and thereby prevents the current density exceeding a value at which the passivation layer starts to break down . the current limiter 12 can be either active , i . e . capable of being regulated , or can be passive , e . g . a resistor . preferably , the primary current threshold value corresponds to a current density of 10 ฮผa / cm 2 or less . more preferably , the threshold value corresponds to a current density of approximately 5 ฮผa / cm 2 or less . the primary current threshold value depends on the battery design . some lithium primary cells have a spiral anode with a relatively high surface area in the region of 14 cm 2 . for this design of lithium battery , the primary current threshold value can be set at ห 70 ฮผa , which limits the discharge current density to ห 5 ฮผa / cm 2 . using the given example of a 3 . 6 v lithium thionyl chloride battery , the current limiter 12 can suitably be a 50 kฯ resistor . other commercially available lithium cells have an anode surface area of approximately 6 cm 2 . assuming the same battery voltage , the current limiter 12 can then , for example , be a 100 kn resistor , which sets the primary cell threshold current at 36 ฮผa and limits the discharge current density to ห 6 ฮผa / cm 2 . the above calculations are based on the maximum short - circuit current . the primary current threshold can also be set lower than the values calculated above , depending on the power requirement of the application in question . because the passivation layer remains unbroken , the primary cell 11 has an extremely low self - discharge rate , which extends the life of a power supply according to the invention in comparison with conventional power supplies . a power supply according to the invention is therefore suited to long - life applications where it is desirable to delay battery replacement as long as possible ; for example , in the case of a battery for a pacemaker or for an autonomous sensor that is mounted in an inaccessible location . it is envisaged that a power supply according to the invention can achieve a service life of 30 years . for example , commercially available aa - size lithium thionyl chloride batteries with a nominal capacity of ห 2 . 6 ah can be used in the invention . assuming 30 years of operation at an average self - discharge loss of 1 % per year , the expected capacity of a power supply according to the invention comprising this type of battery is then 70 % of the nominal capacity : 1 . 82 ah . there are approximately 263000 hours in 30 years , meaning that the battery can supply a continuous current of ห 6 . 9 ฮผa for the duration of its 30 - year life . a primary cell current of 6 . 9 ฮผa is sufficient to continuously power e . g . a microprocessor . a power supply according to the invention can therefore supply a continuous low current to a device for an extremely long duration . in some applications , the device powered by a power supply may require a continuous low - level current and have an intermittent need for a current that is higher than the primary cell current . one example of a device with this kind of power requirement is a machine condition monitor comprising a microprocessor , a sensor and a data store . a primary cell current of e . g . 10 ฮผa is sufficient to continuously power the microprocessor and the data store , but a higher load current of e . g . 20 ma is intermittently required to perform measurements . fig2 illustrates an example of a further development of a power supply according to the invention that is suitable for a device as described above . in this example , the power supply 20 comprises a primary cell 21 of a type described with reference to fig1 , i . e . a 3 . 6 v lithium thionyl chloride battery with an anode surface area of 6 cm 2 and a nominal capacity of 2 . 6 ah . the current limiter 22 in the example shown is a 120 kฯ resistor , meaning that the primary current threshold value is 30 ฮผa , corresponding to a maximum primary current density of 5 ฮผa / cm 2 . according to the further development of the invention , the power supply 20 additionally comprises an energy storage device 23 , suitably a capacitor . the capacitor 23 is configured to be charged using current drawn from the primary cell 21 ( the primary cell current ) and to periodically provide a load current at a magnitude greater than the primary current threshold value . the arrangement is such that the primary cell current never exceeds the primary current threshold value , neither when the primary cell is first put in to operation nor during operation of the device , thereby ensuring a long and reliable service life of the power supply 20 . when the power supply 20 is used to power a machine condition monitor comprising a microprocessor , a data store and a sensor , a continuous current of approximately 10 ฮผa is needed to power the processor and the data store . therefore , around 20 ฮผah / h remains available for charging the capacitor . as the primary cell current charges the capacitor 23 , the voltage across the capacitor will rise with an rc type curve . the efficiency of the power supply circuit could be improved , for example , by using semiconductors in the current limiter . nevertheless , a circuit as described with respect to fig2 , and also with respect to fig1 , has the benefit of simplicity . when the capacitor 23 has charged , it can supply a load current greater than the primary threshold current in short bursts . for example , if the sensor in the machine condition monitor is a strain sensor , a measurement can be performed by drawing a load current of e . g . 20 ma for 10 milliseconds . in the given example , this allows several measurements per hour . furthermore , if the condition monitor is provided with means for wireless transmission of data , a packet of data can be transmitted by drawing a load current of e . g . 25 ma for 100 milliseconds . even at a substantially empty battery condition , the primary cell current is preferably sufficient to provide a small charge surplus to charge the capacitor 23 , for example if a processor drawing part of the primary cell current is in a sleep state . the time required to provide a desired amount of charge to the capacitor 23 will depend upon the energy level of the primary cell 21 . if this time exceeds a preset limit , the device may indicate impending depletion of the primary cell , for example by transmitting an end of battery life indication . a processor , for example a microcontroller , of the device may determine when it should become active for the first time , for example using a brown out circuit . the processor may use a sleeping mode to conserve power ; it may be configured to wake up to : carry out housekeeping tasks ; and / or carry out a sensing and / or transmission task when sufficient power is available from the energy storage device 23 . one benefit of the illustrated embodiment is that some battery power is always available , for example , at a current of at least about 10 ฮผa . continuous availability of battery current may be used to ensure that the processor state and / or memory contents are secure at all times . this may avoid the need for non - volatile memory which generally requires a lot of energy for writing data into it . the processor may be configured to optimise use of the power available ; it may be configured to control the frequency or point in time at which a component requiring a load current is in operation . the periodic provision of the load current may be controlled or programmed , for example by a processor ; this may be used to control the time and / or conditions at which the load current is made available , as opposed to the load current being drawn simply upon demand from a power consuming device . a number of aspects / embodiments of the invention have been described . it is to be understood that each aspect / embodiment may be combined with any other aspect / embodiment unless indicated to the contrary . moreover , the invention is not restricted to the described embodiments , but may be varied within the scope of the accompanying patent claims . | 7 |
the detailed embodiments of the present invention are disclosed herein . it should be understood , however , that the disclosed embodiments are merely exemplary of the invention , which may be embodied in various forms . therefore , the details disclosed herein are not to be interpreted as limited , but merely as the basis for the claims and as a basis for teaching one skilled in the art how to make and / or use the invention . referring to the drawings , the golf training apparatus takes the general form of a golf ball hitting platform 10 . the platform 10 includes a main support frame 12 having an upper planar support surface 14 . the upper planar support surface 14 is preferably formed of a simulated grass mat 16 which is generally rectangular in shape , approximately 2 โฒร 3 โฒ in size and formed in one or two sections . the mat 16 is supported by overlapping flanges 18 of the main support frame 12 and is replaceable with another mat if it becomes worn . the underside ( not shown ) of the platform 10 is recessed inwardly for purposes described hereinbelow . one lateral edge of the main support frame 12 is formed with a lowered , or recessed , planar surface 20 and a slotted channel 22 formed by the main support frame 12 and upper flanges 21 in order to receive a selected one of a plurality of teeing area panels 24 . the teeing area panels 24 are interchangeably connected to the main support frame 12 by slidably fitting into the channel 22 such that the teeing panel 24 rests on the planar support surface 20 . preferably , the channel 22 is sized to provide a loose friction fit with the teeing area panel 24 . teeing area panel 24 is a planar simulated grass support surface , which is used as a teeing area for hitting golf balls . fig3 shows a plurality of interchangeable teeing area panels 26 , 28 and 30 which may be used in accordance with the present invention . teeing area panel 26 is a simulated grass , planar support surface having a slot 46 along an outer longitudinal edge 32 to accommodate another accessory as described hereinbelow . teeing area panel 28 is a simulated grass , planar support surface having a bunker board accessory 34 . teeing area panel 30 is a simulated grass , planar support surface having a bunker tray accessory 36 . a knee brace accessory 38 , described in detail hereinbelow , is removably mountable to the main support frame 12 . in addition , an upright wall accessory 40 is removably attachable to the main support frame 12 when used in combination with teeing area panel 26 , as described in detail hereinbelow . it will be appreciated that each of the teeing area panels 24 , 26 , 28 and 30 are identically sized so as to be interchangeable and frictionally fit into the channel 22 . as such , different panels may be used to present a golfer with a variety of simulated conditions such as would be found on a golf course , without departing from the spirit of the present invention . another feature of the practice platform 10 is portability . with this in mind , an edge of the main support frame 12 of the platform 10 is provided with wheel casters 42 . side edges of the platform 10 are provided with handles 44 to enable the platform 10 to be placed upon its side and rolled , for example , from a storage to a use position . referring to fig4 teeing area panel 26 is shown in detail . the teeing panel 26 is generally rectangular in shape and includes a slot 46 along an outer lateral edge 32 for positioning of an upright swing path wall accessory 40 described hereinbelow . preferably , the teeing area panel 26 is provided with a simulated grass , mat surface 48 and may also include an opening 50 to accommodate a conventional rubber driving range tee ( not shown ) which would project upwardly through the opening 50 to present a raised tee upon which a ball may be placed . it will be appreciated that the simulated grass may be short to simulate a fairway cut or it may be longer to simulate rough . fig5 illustrates in detail the second teeing area panel 28 , which is identical in peripheral size to the other panels and fits onto the recessed planar surface 20 on the platform 10 in the same way as described hereinabove . this teeing panel 28 includes an integrally formed bunker board 34 having a slightly concave upper surface 52 . the concave upper surface 52 is designed to accommodate natural sand so that it may be used to simulate a sand trap environment for the execution and practice of sand shots . fig6 shows still another interchangeable teeing area panel 30 in detail . the teeing area panel 30 includes a shallow sand tray 36 . this panel 30 is also interchangeable with the other panels and fits onto the recessed planar surface 20 of the platform 10 . the tray 36 is structured to receive sand so that a golfer may practice sand shots . the platform 10 may be used with several training attachments . fig7 illustrates a swing guide attachment in the form of an upright swing path wall 40 . the upright wall 40 is shaped and positioned to prevent shanking of golf shots caused by a golf ball being hit by the hosel of the club head . the upright wall 40 has one side covered in mat fabric 54 . the upright wall further includes a pair of support brackets 56 extending downwardly from a lower edge 58 thereof . each support bracket includes an aperture 57 shaped and dimensioned to receive a locking bolt 59 which may be passed through the aperture 57 and screwed into holes ( not shown ) formed along the edge of the main support frame 12 to lock the upright wall 40 in position adjacent the hitting area . while a specific attachment structure is disclosed in accordance with a preferred embodiment of the present invention , various attachment structures may be employed without departing from the spirit of the present invention . when properly positioned , the mat surface 54 of the wall 40 prevents outward movement of a club head as it is being swung . by properly locating a ball to be struck , the possibility of a golfer hitting a shanked shot is totally eliminated . fig8 and 9 illustrate a training attachment which serves as a knee brace attachment 38 to prevent a golfer &# 39 ; s knee from moving laterally forward during the execution of a golf shot . the knee brace attachment 38 is formed by three flat planar members 60 configured into a triangle and extending upwardly against a golfer &# 39 ; s leading leg . this prevents the golfer &# 39 ; s leg from moving laterally during the execution of a golf swing and promotes weight shift and a leg turn . the flat planar members 60 of the knee brace attachment 38 is preferably lightweight aluminum . the knee brace attachment 38 has a base 68 , an upright leg 70 formed at 90 ยฐ thereto and an angular support member 72 . the members 60 are attached at 90 ยฐ, 60 ยฐ and 30 ยฐ, respectively , although these angles may be increased or decreased , depending upon the overall height of the upright knee brace 38 . a soft flexible shock absorbing material 74 , such as a piece of carpet or synthetic turf , is attached to the outer side of the upright leg 70 to form a cushion for the golfer &# 39 ; s leg . the knee brace attachment 38 is mounted to a support bracket 76 by connectors 78 and , in turn , is supported to the main support frame 12 by the support bracket 76 . while a specific attachment structure is disclosed in accordance with the present invention , various attachment structures may be employed without departing from the spirit of the present invention . for example , it is contemplated in accordance with a preferred embodiment of the present invention that the base 68 be formed with multiple holes to permit ready adjustment of the knee brace &# 39 ; s position . fig1 illustrates another training attachment for use in accordance with the present invention . a swing plane attachment 80 is used to train a golfer the proper inside swing plane position a golf club should traverse through the impact area when striking a golf ball . the swing plane attachment 80 is formed of a solid , rectangular reference board 82 preferably having an upper padded surface . referred to fig1 a , the swing plane attachment 80 is pivotally mounted to a bracket 84 shaped and dimensioned for secure attachment to the main support frame 12 of the platform 10 . the bracket 84 is secure to the main support frame 12 by a pair of locking bolts 86 . the swing plane attachment 80 rotates to accommodate all sizes and swing shapes of golfers . using the swing plane attachment 80 , a golfer having an excessive inside - out or outside - in swing plane will be given immediate feedback as the club strikes the padded surface of the rectangular reference board 82 . with this in mind , the reference board 82 is pivotally supported for angular adjustment . specifically , a support bar 83 extends between the bracket 84 and the reference board 82 with a first end 83 a of the support bar 83 being pivotally attached to the bracket 84 and a second end 83 b of the support bar 83 being releaseably secured to the reference board 82 to allow for attachment of the second end 83 b at various points along the reference board 82 . in this way , the support bar 83 may be adjusted along the reference board 82 to facilitate angular adjustment of the reference board 82 . while a specific attachment structure and pivoting structure are disclosed in accordance with the present invention , various attachment and pivoting structures may be employed without departing from the spirit of the present invention . fig1 shows a swing limiter attachment 90 made of a padded cylindrical stop member 92 which is supported and positioned on an l - shaped , upright rod 94 so as to lie across the swing plane . the upright rod 94 is releaseably secured to the main support frame 12 in much the same manner as the upright wall accessory 40 , although a variety of mounting structures may be employed without departing from the spirit of the present invention . preferably , the upright rod 94 is telescoping to allow the height of the stop member 92 to be readily adjusted . the padded cylindrical stop member 92 of the swing limiter attachment 90 acts as a stop to engage the shaft of a golf club as the golfer executes the backswing portion of a golf swing . the padded cylindrical stop member 92 may be placed in various backswing positions to provide feedback to the golfer as to the length of a particular backswing . the teeing panels and attachments described above may be used alone or in combination . for example , a golfer using a simulated grass teeing panel 24 may also use the knee brace 38 , the swing slot guide 80 , the swing limiter 90 and the anti - shank wall 40 at the same time to perfect a golf swing . referring to fig1 to 15 , the platform 10 is designed to be positioned at a variety of support angles by using a pair of support blocks 99 which may be placed on adjacent , inner corners of the support platform to raise a particular edge depending upon the ground angle to be simulated . by selecting the location of the support blocks 99 , it will be appreciated that the platform 10 may be sloped upwardly , downwardly and to either side depending upon the location of the blocks 99 . this enables a golfer to hit golf shots simulating uphill lies , downhill lies , lies where the ball is below the golfer &# 39 ; s feet , and lies where the ball is above the golfer &# 39 ; s feet . the blocks 99 may be of a variety of sizes to simulate a smaller or greater slope of the simulated ground surface . fig1 illustrates a practice platform 10 wherein the elevating blocks 99 are positioned on a forward edge of the practice platform 10 , thereby simulating an uphill lie condition for the golfer . fig1 illustrates a practice platform 10 wherein the elevating blocks 99 are located along a rearward edge of the platform 10 , thereby simulating a downhill lie condition for the golfer . fig1 illustrates a golf practice platform 10 of the present invention using a pair of support blocks 99 which elevate a side of the platform 10 above ground surface to simulate a lie condition where a golf ball is above the feet of a player . fig1 illustrates a practice platform wherein the elevating blocks 99 are located on the opposite side of the platform 10 , thereby simulating a position where a golf ball is below the feet of the golfer . fig1 illustrates a corner 100 of the underside of the platform 10 . the edges 102 of the main support frame 12 cooperate with a corner bracket 104 to locate a supporting block ( not shown ) in position . each corner 100 has the same structure permitting any two corners to be used with supporting blocks to simulate the lie conditions described with reference to fig1 to 15 hereinabove . while various preferred embodiments have been shown and described , it will be understood that there is no intent to limit the invention by such disclosure , but rather , is intended to cover all modifications and alternate constructions falling within the spirit and scope of the invention as defined in the appended claims . | 0 |
fig1 shows an illustrative computing environment 100 in which the present extensible system action for sharing may be implemented that includes a number of users 105 1 , 2 . . . n interacting with respective computing platforms 110 1 , 2 . . . n . the computing platforms 110 may , in this illustrative example , include any of a variety of devices such as desktop and laptop pcs , game consoles , mobile phones , smart phones , personal e - mail devices , personal media players , personal digital assistants , gps ( global positioning system ) devices , tablet computers , digital cameras , and the like . as shown , the users 105 may communicate among each other and interact with various services on the world wide web using public network infrastructure such as the internet 115 . the services in this example include a news service 120 1 , a social networking service 120 2 , photo sharing service 120 3 , and various other services or websites as representatively indicated by reference numeral 120 n . fig2 shows various illustrative functional components 205 that commonly execute on one or more of the computing platforms 110 . it is noted that the components shown in fig2 are not intended to be exhaustive and other components may be supported or executed on a given platform as needed to meet the requirements of a particular implementation . in many cases , the components 205 are implemented using code expressed in software instructions that is stored on one or more machine - readable media , however , the components may also be implemented using firmware , hardware , or various combinations or sub - combinations of software , firmware , and hardware . as shown , the components 205 include applications 210 and an operating system 215 . the applications 210 illustratively include web applications 210 1 , local applications 210 2 , client - server applications 210 3 , and other applications 210 n . the operating system 215 is configured , in this illustrative example , to perform various actions 220 and expose various interfaces 225 . the actions 220 are described in more detail in the text accompanying fig3 . the interfaces 225 may include , for example , drivers to enable the applications 210 to communicate with local capture devices 230 such as a digital camera 230 1 , a web cam , 230 2 , and a scanner 230 n . it is noted that the operating system 215 will not typically be identically configured in each instance of a computing platform 110 . in other words , differences in features , functionalities , structures , and methods implemented by the operating system 215 , among other differences , can be expected according to the needs of a given platform . however , principles of the present system action for sharing may be adapted to various operating systems . that is , the share action may be readily adapted to a variety of operating systems , computing platforms , usage scenarios , and environments . fig3 shows a set of illustrative system actions 220 that may be implemented by the operating system 215 ( fig2 ). as shown , some of the system actions 220 are included in a group ( i . e ., a subset of the system actions 220 ), as indicated by reference numeral 305 , that provides consistent entry points to particular workflows which are exposed to the user 105 via an action space as described in more detail below . these system actions illustratively include share 305 1 , favorite 305 2 , search 305 3 , and other actions 305 n . these actions respectively facilitate a user to implement sharing ; connecting to different devices ; searching ; and performing other actions . this subset 305 of system actions exposed in the action space may typically be invoked by the user 105 from anywhere on the computer at any time . the operating system 215 will typically implement other actions 310 that are outside the scope of the present disclosure . fig4 shows an illustrative arrangement 400 in which discovered content 405 or locally produced / captured content 410 is provided as shared content 415 from the user 105 with sharing endpoints , as collectively identified by reference numeral 420 , as facilitated by the operating system 215 and share action 305 1 . for example , discovered content 405 could be identified by the user 105 when surfing the web , while locally produced / captured content 410 could be captured by a digital camera or produced on the computing platform 110 using applications such as a word processor or drawing application . accordingly , the shared content 415 could include links 415 1 such as html ( hypertext markup language ) links , photographs 415 2 , videos 415 3 , documents 415 4 , and other files of various types as indicated by reference numeral 415 n . as shown in fig5 , the applications 210 can include both source applications 505 and target applications 510 . depending on the desires of a given application developer , an application 210 can be a source application 505 as well as a target application 510 , be one or the other , or be neither a source application nor a target application . to be a source application 505 , an application can simply register that it can provide shareable content in response to the user &# 39 ; s choice to share . such registration may be implemented , for example , as a runtime declaration in which the source application can respectively register and unregister depending on its state at any given instant . for example , in one state , the source application may have content that can be shared , while in another state it lacks such shareable content . in some cases , a source application 505 does not even need to produce the shareable content itself because the operating system 215 can provide content capture using a system option or action such as a screen shot . target applications 510 will also register the content types they can accept so that a filtered list of target applications can be presented to the user 105 during the course of the share workflow as shown in fig6 and described in the accompanying text . typically , such registration may occur when the target application 510 is installed on the computing platform 110 . as shown in fig5 , the operating system 215 essentially acts as a broker ( as indicated by reference numeral 515 ) via invocation of the share action 305 1 to facilitate passing of a reference 520 to the shared content 415 from the source application 505 to the target application 510 . such brokerage advantageously eliminates the need for the source application 505 and the target application 510 to have knowledge of the other . content sharing can be implemented simply through registration of the shareable content types as described above . in addition , by implementing the sharing as a functionality supported by the operating system , the present share action is native to the computing platform in which the operating system installed and , other than installing sharing applications on the computing platform ( which may come preinstalled in some cases ), the user typically will not have to install any special programs or engage in complex configuration settings in order to utilize sharing . furthermore , instantiating the sharing feature in the operating system ensures extensibility to other communication mechanisms that may be developed or implemented in the future so long as they conform to the present sharing paradigm . in this illustrative example , the shared content 415 is referred to by a data bundle reference 520 so that properties and / or metadata ( indicated by reference numeral 525 ) associated with the shared content 415 may also be passed to the target application 510 . such property / metadata 525 may include , for example , the title of the linked webpage or other descriptive data . the reference 520 is received by the operating system 215 and passed to the target application 510 which then reads the data bundle . fig6 shows an illustrative share workflow 600 for enabling the user 105 ( fig1 ) to share content while remaining in context without the need to switch to another application . when working with a source application 505 , the user 105 can open the action space , as indicated by reference numeral 605 , in order to expose the consistent entry points to workflows 305 ( as shown in fig3 and described in the accompanying text ) to the user . in some cases , the action space may be opened using a dedicated hardware key , for example , while in other cases the action space may be opened using a software command , using a predefined gesture such as a finger swipe on a predefined portion of a touchscreen on a computing platform , or it may be automatically opened via an action of a sharing application when it detects that sharing might be desired by the user 105 . the action space will typically graphically display the available system actions , including the share action in this example . the source application 505 may be optionally configured in some cases to enable the user 105 to explicitly specify content to be shared . however , it is noted that such optional configuration may not often be needed because it may be expected that the shared content exposed by the source application can be readily identified without an explicit action from the user 105 . in some cases , for example , the user &# 39 ; s interaction with the source application 505 will provide sufficient context by itself to enable accurate shared content identification . in an alternative implementation , a share button can be hosted by a source application . in this case , sharing can be initiated by the user 105 from within that source application rather than through use of the action space of consistent entry points supported by the operating system . when the user selects the share action , as indicated by reference numeral 610 , a target picker 620 is exposed so that the user 105 can specify a sharing end point 420 ( fig4 ). typically , the user can specify a sharing endpoint by picking a selection from a displayed list of shortcuts ( as described in more detail below ) and target applications 510 ( fig5 ), as indicated by reference numeral 625 . the shortcuts and target applications 510 are filtered by the operating system 215 so that only shortcuts and target applications that are registered to receive the content type provided by the source application 505 are displayed on the target picker 620 . when the user 105 selects the sharing shortcut / target application , the target application 510 will launch its companion application that will present a share screen 630 ( i . e ., ui ) to the user . as shown in fig7 , the operating system 215 will provide a drawing window 705 in which the companion application ( indicated by reference numeral 710 ) can draw its ui . enabling the target application to draw its own ut through the companion application 710 can be expected to further enhance the extensibility of the present share action to future communication applications and mechanisms . in many typical implementations of the share action , the companion application 710 is configured as small , lightweight and focused application that operates quickly with little impact on system resources . returning to fig6 , the share screen 630 may provide a preview of the shared content to the user 105 and ui control objects ( collectively indicated by reference numeral 640 ) that may be utilized , for example , to enable the user to execute the sharing or , in some cases provide annotations , comments , or other input to accompany the shared content . optionally , as indicated by reference numeral 635 , the share screen 630 may also expose an interface to enable the user 105 to choose a particular person to receive the shared content . when the user executes the sharing of the content , as indicated by reference numeral 645 , the share screen 630 provided by the companion application is collapsed and the workflow control is returned to the source application 505 , as indicated by reference numeral 650 . thus , the present share action enables the user 105 to take a few simple steps to share content without having to leave the context provided by the source application 505 . fig8 shows an illustrative ui 800 supported on a display screen 805 of a tablet computer 1103 . while a tablet computer is illustratively shown , it is noted that the ui for other devices could be expected to appear and function in a substantially similar way . the ui 800 includes a set of icons 810 arranged in an action space 815 for launching a set of system actions , one of which is a share action that may be invoked by the user through manipulation of button 820 . in this example , as shown , the action space 815 is located along the right edge of the ui window . however other configurations for the action space may also be utilized according to the needs of a particular implementation . in this example , the user 105 is interacting with a source application 505 that implements an image viewer using a viewer window 825 . the viewer window 825 shows a photograph of a group of pyramids which thus represents the content that the user 105 wishes to share . when the share button 820 is actuated from the action space 815 , the target picker is displayed on the ui 800 as indicated by reference numeral 905 in fig9 . as with the action space 815 ( fig8 ), a graphical configuration of the target picker 905 can vary from what is illustrated . in this example , a thumbnail 910 is displayed to provide a visual confirmation to the user 105 of the selected content to be shared . additional information may also be displayed such as a content title 915 and descriptive information or metadata as indicated by reference numeral 920 . the target picker 905 also displays a list of shortcuts indicated by reference numeral 925 and a list of sharing applications indicated by reference numeral 930 . the presentation of the shortcuts in sharing applications can vary but may typically include an icon and some associated descriptive text . for example , shortcut 935 ( shown in an enlarged view in fig9 ) represents a share action that the user 105 has taken in the past by sharing content that is posted to the user &# 39 ; s wall on a social networking site such as facebook . similarly , a sharing application 940 ( shown in an enlarged view in fig9 ) represents a share action that the user 105 can take to send the selected content to a sharing endpoint using e - mail , which in this case is supported by the hotmail application . the facebook and hotmail target applications are displayed in the target picker 905 because they have registered as being capable of receiving photo content . by comparison , a target application that is not capable of receiving photo content ( for example , a text - based instant messaging application ) would not be displayed by the target picker 905 in this illustrative example . fig1 shows an illustrative workflow 1000 associated with one of the sharing shortcuts 925 ( fig9 ). here , the source application 505 passes shared content to the target application 510 , as indicated by reference numeral 1005 . the target application 510 will in turn report a detailed action about the user &# 39 ; s action to the operating system 215 , as indicated by reference numeral 1010 . the operating system will use the reporting from the target application 510 in order to generate a list of frequently used actions , as indicated by reference numeral 1015 , which may then be used for the sharing shortcuts 925 . fig1 shows a series of ui screens 1105 , 1110 , and 1115 supported by the companion application to the hotmail application shown in fig9 . the companion application is launched when the icon 940 is selected by the user 105 ( fig1 ) and first displays ui screen 1105 to expose a list of recipients 1120 that the user 105 has recently e - mailed . if the intended sharing endpoint is not shown in the list 1120 , then the user 105 can actuate button 1125 to pull up the user &# 39 ; s hotmail address book shown in the ui screen 1110 . in this example , the address book includes the typical icons 1130 to enable the user to locate e - mail addresses alphabetically . accordingly , a number of e - mail addresses 1135 are displayed which , in this case are associated with the letter โ a โ 1140 , as shown in an enlarged view . by working through the address book , the user 105 can pick recipients for the shared content which are confirmed in the ui screen 1115 , as indicated by reference numeral . the companion application may support additional interfaces to enable the user 105 to provide annotations , comments , or other input to accompany the shared content . in this case as indicated by reference numeral 1150 , the user 105 has input a short note into a text entry window that is provided by the companion application . when the user 105 is ready to share the content , the user can actuate the share button 1155 to complete the share action . as shown in the workflow 1200 depicted in fig1 , upon actuation of the share button 1155 , the ui supported by the companion application closes ( as indicated by reference numeral 1205 ) and the target application 510 will upload the data bundle associated with the shared content to the selected sharing endpoint 420 typically as a background process ( as indicated by reference numeral 1210 ). by implementing the uploading as a background process , the user 105 can quickly be returned back to the source application 505 ( fig5 ) so that context of the user experience associated with the source application is maintained . as shown in fig1 , in order to ensure that the background uploading is completed to thus meet the expectations of the user 105 with regard to the behavior of the share action , the identity of a target application 510 that is currently engaged in uploading to a sharing endpoint 420 is added to a list 1305 of processes that are exempt from shutdown via action of the operating system 215 . the associated source application 505 may also be added to the list 1305 . for example , if the target application 510 is reading a large data bundle , it is not interrupted by having the source application get shut down prematurely . the source application 505 and target application 510 are removed from the list 1305 when the uploading is complete . although the subject matter has been described in language specific to structural features and / or methodological acts , it is to be understood that the subject matter defined in the appended claims is not necessarily limited to the specific features or acts described above . rather , the specific features and acts described above are disclosed as example forms of implementing the claims . | 6 |
metal workpieces to be treated in accordance with the method of the invention may be in the widest variety of forms , e . g ., foreign bodies , pipes , rods , wires , sheet metal or strip metal . however , preferred shapes are those which permit uniform mechanical distribution of the film of solution , e . g ., by squeegee - rolling , brushing or centrifuging . the method is particularly easy to use on sheet and strip metal . metals most commonly treated are iron , zinc and aluminum , pure or in the form of alloys , the said metals constituting either the whole workpiece or merely a thin surface layer thereon , e . g ., coatings of al , al - zn or zn on iron . for the application of the treatment according to the invention , the surface of the metal must be clean , since films of oil , for instance , prevent uniform wetting of the surface . coatings of dust and dirt would lead to defective areas of lower quality in the coating after the treatment . the formation of the coating is also impaired by thick layers of oxide , although thin oxide layers , like temper colours or less , are generally acceptable . the essential components of the acid aqueous solutions used according to the invention are chromium iii ions , phosphate ions and finely divided silicic acid ( silica ). the chromium iii ions may be introduced into the solution in the form of chromium iii salts with non - detrimental anions , e . g ., acetate , maleate , or phosphate . introduction is also possible , for example , by reducing chromium vi ions with sugar , starch , methanol , oxalic acid and the like . the phosphate is preferably added in the form of phosphoric acid and / or chromium iii phosphate . satisfactory sources of finely divided silicic acid have been found to be , for example , silicic acid obtained pyrogenically from silicon tetrachloride , and silicic acid precipitated in an aqueous medium from alkali silicates . silicic acid of small grain size is essential since this ensures a uniform stable suspension in the aqueous acid reaction solution . wetting of the metal surfaces may be achieved in any conventional manner , for example , by immersion and subsequent draining , flooding and centrifuging , brushing , spraying with compressed air , &# 34 ; air - less &# 34 ; and also electrostatic , sprinkling , and rolling with structured and smooth rolls running in the same direction or in the opposite direction . the solutions used according to the invention contain the components in amounts such as to produce a residue from evaporation of between 5 and 150 g / l . the film of liquid used for wetting is preferably between 2 . 5 and 25 ml per square meter of workpiece surface . satisfactory technical results may be obtained , for example , with a dried layer weighing between 0 . 03 and 0 . 6 g / m 2 of workpiece surface . the film of solution is then dried on the surface of the metal . although this may be done at room temperature , better results are obtained with a higher temperature , preferably with the specimens at a temperature of between 70 and 300 ยฐ c . the solutions used according to the invention may contain zinc and / or manganese ions as additional components . the quantities of the individual components of the solution are preferably such that the molar ratio cr - iii : po 4 :( acetate and / or maleate ): sio 2 is as 1 :( 0 . 3 to 30 ):( 0 to 5 ):( 0 . 5 to 10 ), and that the molar ratio cr - iii :( po 4 + acetate and / or maleate ) is of the order of 1 :( 0 . 7 to 30 ). zinc ions and / or manganese ions are preferably added in a molar ratio of cr - iii :( zn and / or mn )= 1 :( 0 to 3 ). the method according to the invetnion is now explained by means of the following examples : 2 . 1 g / l . cr - iii ( trivalent chromium ); 48 g / l . po 4 ( phosphate ); 2 . 1 g / l . ch 3 co 2 ( acetic acid ); 10 g / l . sio 2 3 . 6 g / l . cr - iii ; 29 g / l . po 4 ; 3 . 5 g / l . ch 3 co 2 ; 10 g / l . sio 2 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 10 g / l . sio 2 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 0 . 9 g / l . ch 3 co 2 ; 15 g / l . sio 2 5 g / l cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 20 g / l . sio 2 5 g / l . cr - iii ; 29 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 10 g / l . sio 2 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 5 . 5 g / l . (: ch - co 2 ) 2 ( maleate ); 10 g / l . sio 2 ( a ) cr - iii : po 4 : ( ch 3 co 2 +(: ch - co 2 ) 2 ): sio 2 = 1 : 1 . 04 : 1 . 4 : 1 . 7 ( b ) cr - iii :( po 4 + ch 3 co 2 +(: ch - co 2 ) 2 )= 1 : 2 . 44 3 . 6 g / l . cr - iii ; 29 g / l . po 4 ; 10 g / l . sio 2 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 10 g / l . sio 2 ; 1 . 7 g / l . zn 5 g / l . cr - iii ; 9 . 7 g / l . po 4 ; 4 . 9 g / l . ch 3 co 2 ; 10 g / l . sio 2 ; 1 . 4 g / l . mn with the exception of example 8 , the cr - iii was introduced into the solutions in the form of basic chromium acetate , the po 4 in the form of thermal phosphoric acid , the sio 2 in the form of pyrogenic finely divided silicic acid , the mn in the form of mno and the zn in the form of zno . the maleic acid was introduced as such . solutions 1 to 10 were applied , by means of a roll - frame with counter - rotating rolls , to sheets of metal previously subjected to alkaline spray degreasing , rinsing in water and squeezing between rubber rolls . the sheets were raised to a temperature of 80 ยฐ c . by placing them for 17 sec . in a 220 ยฐ c . furnace ; they were then raised to a temperature of 200 ยฐ c . by placing them for 90 sec . in a 240 ยฐ c . furnace . the coatings produced weighed between 0 . 1 and 0 . 2 g / m 2 . the color of the coatings on steel was blue - gray and , on aluminum and galvanized steel , grey . the test pieces thus pretreated were coated with an acrylate lacquer and a polyester &# 34 ; coil - coating &# 34 ; lacquer and were tested for adhesion by means of a bend - test and , for resistance to corrosion by means of the astm b 117 salt - spray test . these tests produced technological values showing results , with the method according to the invention , at least equivalent to , and some even rather better than , those obtained with solutions based upon the known cr - vi / cr - iii / sio 2 . | 2 |
although specific embodiments of the invention will now be described with reference to the drawings , it should be understood that such embodiments are by way of example only and are merely illustrative of but a small number of the many possible specific embodiments to which the principles of the invention may be applied . various changes and modifications obvious to one skilled in the art to which the invention pertains are deemed to be within the spirit , scope and contemplation of the invention as further defined in the appended claims . a preferred embodiment of a shaker 1 in accordance with the present invention is respectively shown in diagrammatic perspective , side plan , and top plan views in fig1 - 3 . during operational use the shaker 1 is normally covered with a case ( shown in fig6 ) exposing only ( i ) the control panel ( shown and discussed hereinafter in conjunction with fig6 ) of the motor 15 , and ( ii ) the upwards extending tops , or knobs , or attachment features 181 a , 181 b and 181 b , 182 b of the reciprocating pistons , or oscillating shafts 18 a , 18 b ( as hereinafter discussed ). the shaker 1 , which is built of metal and most commonly aluminum , is based on a substantial and strong rectilinear frame , or stanchion , 11 affixed to a first , or upper , tie plate 12 . this first , upper , tie plate 12 is held in suspension roughly level and equidistant from a second , lower , base plate 13 by springs 14 a and 14 b held on threaded shafts 14 c by spring retainers 14 d . normally four lower springs 14 a , and four upper springs 14 b , are used . two upstanding , left and right , frame portions , or stanchions , 11 a , 11 b are defined . the overall size of the preferred embodiment of a shaker 1 in accordance with the present invention is nominally 10 . 75 โณ w by 17 . 6 โณ d by 12 โณ h โ although a practitioner of the mechanical arts will understand that the shaker 1 may be otherwise scaled . a motor 15 is held fixed within the frame 11 , specifically on frame stanchions 11 a and 11 b , and upon the upper base plate 12 by a motor bracket 151 . the motor 15 is preferably alternating current ( a . c .) available as a modified 4910 series motor from gs electronics , carlisle , pa . the motor is controlled by a microprocessor controller ( behind a control panel shown in fig6 ). an accessible control panel ( exposed to the exterior of the case , shown in fig6 and discussed hereinafter ) may be set to operate the motor under any load up to full load from 300 - 6000 revolutions per minute ( rpm ) for nominal durations from 1 to 300 seconds . the motor 15 has oppositely - extending extensions 151 a , 151 b of its central shaft 151 , of which extension 151 a is most clearly visible in fig3 . although the motor 15 has internal bearings , the shaft extensions 151 a , 151 b preferably pass through bearings ( not shown ) in the stanchions 11 a , 11 b of the frame 11 . the preferred bearing is fafnir type sk5pp . the most preferred bearing has an od of 1 . 1250 inches , a bore of 0 . 5000 inches , and a 0 . 312 inch width . each shaft extension 151 a , 151 b ( shaft extension 151 a shown in fig3 shaft extension 151 b not shown ) fits to an associated flywheel 16 a , 16 b ( flywheel 16 a shown in fig1 and 2 , flywheel 16 b not shown ). the flywheels 16 a , 16 b are preferably round , and are concentrically mounted to the associated shaft extensions 151 a , 151 b โ although each flywheel 16 a , 16 b has eccentric peripheral weighing . each flywheel 16 a , 16 b affixes a corresponding eccentric post , or crank pin , 161 a , 161 b ( crank pin 161 a shown in fig1 and 2 , crank pin 161 b not shown ). the displacement of the eccentric posts , or crank pins , 161 a , 161 b from the center line of the central shaft 151 determines the magnitude of the oscillation imparted to the sample containers and samples , and this displacement is preferably from ยผ โณ to ยฝ โณ as imparts an oscillation cycle length from ยฝ โณ to 1 โณ, and is more preferably โ
โณ as imparts an oscillation cycle length of ยพ โณ. the crank pins 161 a , 161 b are normally sturdy and of substantial , โ
โณ diameter , as best suits the substantial forces that they transmit . in accordance with the present invention , the flywheels 16 a , 16 b , although concentrically mounted to shaft extensions 151 a , 151 b , are not mounted so that their eccentric posts , or crank pins , 161 a , 161 b are at the same angular displacement . in fact , the crank pins 161 a , 161 b of the two flywheels 16 a , 16 b are diametrically angularly opposite , with one being bottom dead center , or 180 ยฐ, while the other is at top dead center , or 0 ยฐ, and vice versa . this angular relationship is shown in fig1 ( and again in fig6 ) where the top 182 a of piston 18 a is maximally elevated simultaneously that the top 182 b of piston 18 b is maximally depressed โ as is a direct consequence of this โ out of phase โ positioning of the crank pins 161 a , 161 b on the two flywheels 16 a , 16 b . one of the flywheels 16 a , 16 b โ illustrated to be flywheel 16 a โ mounts at its periphery an encoder disk 16 c . this encoder disk 16 presents a pattern of alternating light and dark areas , normally 180 such sectors , which can be detected by optical sensor , or interrupter switch 80 that is mounted opposite the rotating encoder disk 16 c on the frame stanchion 11 a ( or 11 b ) of the frame 11 . the electrical signal output of the interrupter switch 80 , which will be further seen in fig7 is a pulse train in respect of the rotation of the encoder disk 16 c , the flywheels 16 a and 16 b , and the motor 15 ; and also of the reciprocating motion of the shaker 1 . a linkage 17 a , 17 b connects the respective crank pins 161 a , 161 b of flywheels 16 a , 16 b to respective pistons 18 a , 18 b . ( linkage 17 a is shown in fig1 and 2 ; linkage 17 b is not shown ). each linkage 17 a , 17 b connects to its respective crank pin 161 a , 161 b though a needle bearing 171 a , 171 b . ( needle bearing 171 a is shown in fig1 and 2 ; needle bearing 171 b is not shown ). the preferred linkage or connecting rod , to crank pin bearing is type av24k40 of the abec - 5t series available from torrington . the preferred bearing has an od of 0 . 5620 inches , a bore of 0 . 3750 inches , and a 0 . 3120 inch width . a wrist pin 172 a , 172 b at the other end of the linkages 17 a , 17 b rotationally connects to the base of the pistons 18 a , 18 b through bearings 181 a , 181 b . ( linkage and wrist pin 172 a are shown in fig1 and 2 ; linkage 17 b and wrist pin 172 b are not shown . neither bearing 181 a , 181 b is shown , but each fits about a respective wrist pin 172 a , 172 b .) the preferred bearings 181 a , 181 b are torrington type b34 having an o . d . of 0 . 343 and i . d . of 0 . 1875 ({ fraction ( 3 / 16 )}) inches each piston 18 a , 18 b is guided for strictly straight - line linear reciprocating motion by a respective linear motion bearing 19 a , 19 b . the preferred motion bearing is type mlf 500 - 875 - 1 available from rotalin of england . this bearing is , and in accordance with the stresses of the shaker of the present invention must be , high performance , and is most preferably a very high performance bearing . both linear motion bearings 19 a , 19 b are firmly mounted in bearing carriers 20 a , 20 b , and to the frame 11 . the tops , or butt ends , of the shafts , or pistons , 18 a , 18 b have and present features 181 a , 182 a and 181 b , 182 b to which the sample containers may strongly attach . the feature 181 a , 181 b is in the form of two oppositely opposed , relieved , areas of the tops , or butt ends , of the shafts , or pistons , 18 a , 18 b which relieved areas are complimentary with a bore in the bottom of each jig fixture 4 , next discussed . the relieved areas at the tops , or butt ends , of the shafts , or pistons , 18 a , 18 b align the fixtures 4 , and keep them from angularly turning . the feature 182 a , 182 b is in the form of a threaded bore into the tops , or butt ends , of the shafts , or pistons , 18 a , 18 b . these threaded bores 182 a , 182 b receive a bolt , or screw ( not shown ) extending from the bottom of each jig fixture 4 , which bolt , or screw , holds each jig fixture 4 , next discussed , removably affixed to a top , or butt end , of a respective shaft , or piston , 18 a , 18 b . two exemplary specimen - container - holding jig fixtures 4 suitable for use with the shaker of the present invention ( as has just been seen and explained ) are shown in perspective view in fig4 . exploded views of a number of externally identical jig fixtures 4 as hold various contents are shown in fig5 . each jig fixture 4 , of which a pair are shown in fig4 and one in each of fig5 a through 5 d , removably mounts to one top 182 a , 182 b of one piston 18 a , 18 b at one time . the jig fixtures preferably so mount by screwing to threaded shaft at the tops 182 a , 182 b of the piston 18 a , 18 b . each jig fixture 4 has a turning radius whereby it may be removed and replaced independently of the other . normally the jig fixtures 4 remain mounted indefinitely and removed only for cleaning , with their contents only being replaced as will be illustrated in fig5 . it will be recognized that the jig fixtures 4 , and the particular jig fixtures 4 that are illustrated , are not integral to the shaker of the present invention , but are illustrated only so as to shown the environment of the invention , and the holding within specimen containers of those samples on which the shaker of the present invention serves to operate . each of the exemplary pair of jig fixtures 4 shown in fig4 is in the substantial shape of rectilinear boxes , and closes shut such as by lid hinges 41 to contain diverse specimens , including specimens as are contained in small test tube and / or micro specimen containers ( not shown in fig4 shown in fig5 ). various embodiments of internal holders , or fixtures , 51 - 54 us usable with , and inside , the single jig fixture 4 , and also with the preferred embodiment of the shaker 1 in accordance with the present invention , are respectively shown in fig5 a through 5 d . the internal holder , or fixture , 51 shown in fig5 a is in the substantial shape of a tray which fits to a complementary recess in the jig fixture 4 . the tray fixture 51 holds , by way of example , small test tubes or containers 61 , as illustrated . the internal holder , or fixture , 52 shown in fig5 b is in the substantial shape of a rack with vertical apertures . the rack fixture 52 holds , by way of example , small test tubes or containers ( not shown ). the internal holders , or fixtures , 53 and 54 respectively shown in fig5 c and 5 d are in the substantial shape of racks with horizontal apertures . these rack fixtures 53 . 54 holds , by way of example , large test tubes or containers , as shown . in all applications the jig fixture 4 in the substantial shape of a rectilinear box is preferably universal , and made of plastic , with an inner holder , or frame , 51 - 54 it suffices to hold diverse containers and test tubes . the internal holders 51 - 54 need not be unique to the shaker 1 of the present invention . a standard laboratory well plate that holds ninety - six ( 96 ) two - milliliter ( 2 ml .) test cells , of a standard well plate that holds four fifteen - milliliter ( 15 ml ). test tubes , can both be used as grid array holders 55 with the shaker 1 of the present invention . yet another holder ( not shown ) holds one single fifty milliliter ( 50 ml .) test tube . it will be recognized that the two pistons , or shafts , 18 a , 18 b of the shaker 1 permit that two jig fixtures 4 , each with an internal holder 51 - 51 , to be used simultaneously . accordingly , the nominal capacity of the shaker is 2 ร 96 = 194 two milliliter ( 2 ml .) test cells , or 2 ร 4 = 8 fifteen milliliter ( 15 ml .) test tubes , or one fifty milliliter ( 50 ml .) test tube . most generally , the fixtures 4 , 51 - 54 should be considered to be comprised of 1 ) a grid array holder , tailored to hold one or more sample containers of a particular configuration , such as the grid array holder 51 - 54 shown in fig5 . it will be recognized by a practitioner of the mechanical arts that the grid array holder could look quite different depending upon the particular specimen , or sample , containers held . the jig fixtures 4 , 5 - 54 also are also suitable to contain boxes directly holding samples , in contour much like the interior fixture 52 shown in fig5 b . finally , the jig fixtures 4 , 51 - 54 preferably comprise 3 ) an external space frame holding and clamping shut the 2 ) box with the at least one 1 ) grid array holder holding one or more sample containers held within the box . this external space frame is most clearly visible as the hinge 41 in fig4 . in fig4 the external frame is partially combined with the box . the space frame of the jig fixture has and presents an engagement feature complimentary to the engagement feature of the top region of each piston . the jig fixture is thus mountable by its engagement feature to a piston for oscillatory shaking during operation of the shaker . the preferred embodiment of a shaker 1 in accordance with the present invention located within its case 21 is shown in fig6 . the case 1 has an opaque bottom portion 211 that is permanently attached by screws to the base plate 13 ( shown in fig1 ) in the manner of the case of a personal computer . the interior of the bottom portion 211 of the case 21 is lined with airborne and structureborne noise - suppressing tuftane sm polyurethane foam ( not shown ) available as item number tcom24block from architectural surfaces , inc . of chaska , minn . a transparent top portion 212 is removable or , preferably , hinged at hinge joint 213 , to enclose the two jigs 4 as are mounted to the tip ends of the pistons , or shafts , 18 a , 18 b ( not shown in fig6 shown in fig1 - 3 ). an on / off switch 214 , indicators 215 , and a push button control panel 216 permit control of the shaker 1 . the indicators 215 and control panel 216 are in particular connected to a microprocessor ( not shown ) within the case 21 which microprocessor controls , through appropriate power circuitry , actuation of the motor 15 ( now shown in fig6 shown in fig1 ). a block diagram of the preferred embodiment of the shaker 1 in accordance with the present invention , previously seen in fig1 - 6 , is shown in fig7 . external a . c . power 71 is provided through a fuse e stop 72 to phase angle motor drive & amp ; instrumentation power supply 74 . this phase angle motor drive & amp ; instrumentation power supply 74 supplies ( i ) 9 v dc power to the instrumentation and processor controller 75 , and , under control of a main control signal received from the instrumentation and processor controller 75 , ( ii ) power drive to the series wound motor 76 . ( the series wound motor 76 is the drive motor part of the motor 15 shown in fig1 which motor 15 also includes frame and mounting elements .) the instrumentation and processor controller 75 , which is the core of the shaker 1 control , receives inputs from ( i ) an interrupter switch 80 ( as was previously seen in fig1 and 32 , and described in association with these figures ) essentially acting as a tachometer speed sensor 80 . as will be recalled , the interrupter switch , or tachometer speed sensor 80 generates a pulse train , illustrated in fig7 that is respective of the rotation of the shaft ( not shown ) of the series wound motor 76 . the instrumentation and processor controller 75 also receives ( ii ) a binary door open signal responsive to the position of the cover , or transparent top portion 212 previously seen in fig6 and ( iii ) key press signals from a keyboard 77 ( also shown in fig6 ). the instrumentation and processor controller 75 produces outputs to ( i ) display 78 ( also shown in fig6 ), and , as the main control signal , a motor drive control signal to the ( ii ) phase angle motor drive & amp ; instrumentation power supply 74 . a schematic diagram of the instrumentation and processor controller section 75 of the preferred embodiment of a shaker 1 in accordance with the present invention is shown in fig8 a - 8 e . u 3 integrated circuit , 8 bit microprocessor , microprocessor part no . atml / at89c55 - 33jc ( requires programming ) it will be understood by a practitioner of the electrical arts that various additional resistors may attach to various signal lines to perform a โ pull - up โ function , and that various additional capacitors may be used for signal smoothing , all as is routine in consideration of circuit board layout , signal noise environment , etc . considering the schematic diagram of the instrumentation and processor controller section 75 shown in fig8 a - 8 e , although some major signals are traced between drawings sheets , many signals will seen to appear unconnected . a practitioner in the art will recognize that these apparently unconnected signals are all named , and that the names of the signals may readily be located at various places in the schematic . the signals are of course connected , and common , at all points of occurrence , it simply being unwieldy to . trace every signal through all points of its distribution . continuing in the schematic diagram of the instrumentation and processor controller section 75 shown in fig8 a - 8 e , besides power and ground inputs , signal inputs are received at jack j 3 pin 3 ( see fig8 b ) from the tachometer speed sensor 80 ( shown in fig7 ); at jack j 7 ( see fig8 d ) from the door open switch 79 ( shown in fig7 ), and at jack j 6 ( see fig8 e ) from the keyboard 77 ( shown in fig7 ). a further signal bus selectably of the rs - 232c , rs - 422 , or rs - 485 type is presented at jack j 4 ( see fig8 a ). the instrumentation and processor controller section 75 produces outputs ( i ) at jack j 1 pin 3 ( see fig8 a ) as the main control signal to the phase angle motor drive & amp ; instrumentation power supply 74 ( shown in fig7 ), and ( ii ) at jack j 6 ( see fig8 e ) from the keyboard 77 ( shown in fig7 ). the main control signal at jack j 1 pin 3 ( see fig8 a ) is a d . c . signal of 0 to 5 v . d . c . amplitude , which signal serves to control the speed of the drive by the series wound motor 76 ( shown in fig7 ). in operation , and starting at fig8 a , any communication signals from , by way of example , an external computer received at the jack j 1 upon an interface that is programmably controlled to be any of the rs - 232c , rs - 422 , or rs - 485 types is converted to ttl logic levels in level converter / translator u 6 and communicated through the watchdog timer u 7 to the microprocessor u 3 . the watchdog timer u 7 serves to ( i ) monitor power , including so as to ( ii ) guarantee a reset on power up . also shown in fig8 a is the amplification and shaping of the speed signal output from the microprocessor u 3 to produce the main signal output . this process uses an inverted amplifier u 15 f , diode isolation realized by photodiode d 1 , and amplification in power amplifier u 5 . the final signal output is gated by enablement signal ena as amplified by level converter u 15 e and transistor q 1 . the timing parameters for the particular motor in use are contained in eeprom u 9 , readable and writable by microprocessor u 3 , which stores these parameters plus any shaking sequences that are programmed into the shaker 1 ( by use of the keyboard interface , to be discussed ) by its user - operators . for those persons unfamiliar with digitally - based motor control , motor timing parameters essentially relate to how much control signal , translated into motor drive current , must be applied for how long to effect a desired change in the motor and in the shaking rate , for example to increase from 1000 cpm to 2000 cpm . the ability to store user - defined shaking sequences even when the shaker 1 is powered down is one of the features of the present invention . continuing in fig8 b , a quite conventional connection of a microprocessor to its memory is shown therein . namely , microprocessor u 3 communicates through address decoder u 2 to read information from , and write information to , sdram u 4 . of greater interest in fig8 b is the receipt at plug jack j 5 pin 3 of the speed sensor signal from the tachometer speed sensor 80 ( shown in fig7 ). after amplification in inverters u 15 a and u 15 c , the signal is supplied for further use . continuing in fig8 c , the left / upper display u 8 and the right / lower display u 10 , both part of d 78 shown in fig7 are shown therein . these eight - character displays are conventionally addressed by the microprocessor u 3 with and address held in address latch u 1 , and are loaded with data from the microprocessor data bus , all under program control . most typically the left / upper display u 8 presents a prompt for a user - operator input when the shaker 1 is not operating , and the right / lower display u 10 presents the user / operator data as and when entered . when the shaker 1 is operating , the left / upper display u 8 preferably presents the remaining shaking time while the right / lower display u 10 presents the instantaneous shaking rate . also in fig8 c is the jack j 7 where is received the door open signal from the door open sensor 79 shown in fig7 . as indicated by the naming of signal int 0 and int 1 , this signal is distributed , most particularly to the microprocessor u 3 , as an interrupt . the program running in the microprocessor u 3 will , quite naturally , interpret this interrupt to stop any shaking . any re - start after the cover is closed demands user - operator intervention at the keyboard . finally shown in fig8 c is the buzzer buz 1 . the buzzer is primarily used as an audible confirmation ( under program control ) of the press of each key ( as enters control or data ) at the keyboard , but may also , optionally , be used ( still under program control ) as an alarm when , for example , an applied main control signal fails to produce ( after reasonable interval ) motor rotation ( as evidenced by the speed sensor signal ) and shaking . such an error or failure condition might occur if the motor or drive mechanism had failed , or the shaker was jammed . remaining fig8 d and 8 e show the conventional multiplexed selection logic by which a single microprocessor u 3 communicates upon a data bus , in the present case , with three separate addressable components . namely , the microprocessor u 3 can selectively communicate , under program control as translated in the logic of fig8 d and 8 e , with each of two displays u 8 , u 10 seen in fig8 c , and one keyboard 77 ( seen in fig7 ). in particular , both the display 78 and the keyboard 77 ( both seen in fig7 ) are connected to , and through , the plugjack j 6 shown in fig8 e . a flow chart of the software program run in the control microprocessor u 3 , seen in fig8 a and 8 b , or the instrumentation and processor controller section , seen in fig7 of the shaker 1 in accordance with the present invention is shown in fig9 . the control microprocessor u 3 executes this software program upon start - up , and continuously thereafter . the program provides for operator input of parameters at the keyboard 77 ( shown in fig7 ) part of control panel 216 ( shown in fig6 ), storage of these parameters in the volatile memory u 4 ( shown in fig8 b ) and non - volatile memory u 9 ( shown in fig8 a ), and selective activation of the series wound motor 76 ( shown in fig7 ) part of motor 15 ( shown in fig1 ) and the display 78 ( shown in fig7 ) part of control panel 216 ( shown in fig6 ) including , generically , the indicators 215 of control panel 216 ( shown in fig6 ). the actions diagrammed in the flow chart are self - explanatory . accordingly , the best mode presently contemplated for the carrying out of the invention has been described . this description was made for the purpose of illustrating the general principles of the invention , and is not to be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . in fact , and in accordance with the preceding explanation , variations and adaptations of the shaker in accordance with the present invention will suggest themselves to a practitioner of the mechanical design arts . for example , there could be more than two shaker trays or containers supported , each on a separate piston connected to a separate linkage to a separate , angularly staggered , point on a camshaft . in other words , the shaker of the present invention could be expanded from being analogous to a two - cylinder engine to a engine of three , four , or even more cylinders . in accordance with these and other possible variations and adaptations of the present invention , the scope of the invention should be determined in accordance with the following claims , only , and not solely in accordance with that embodiment within which the invention has been taught . | 1 |
electrospinning is a well - known method of fabricating thin threads or fibers from dissolved polymers . in one embodiment , the polymer solution ( the โ precursor โ of the nanofibers ) is expressed from a syringe driven by a syringe pump . the solution is forced through a hollow needle and exits as tiny droplets . each droplet immediately traverses a field of high voltage . the potential applied to the solution as it emerges from the needle - tip induces an accumulation of charges on the surface of the droplet , which changes the surface tension of the droplet , causing the surface to โ break โ such that the droplet becomes a jet - stream of charged fibers that can be collected as a charged active matrix , which can build up to form a mat ( bishop et al . 2007 ; bishop et al . 2005 ; sawicka et al . 2006 ; gouma โ sensor materials โ us - japan workshop 2004 ; haynes et al . 2008 ; haynes phd dissertation , โ electrospun conducting polymer composites for chemo - resistive environmental and health monitoring applications ,โ 2008 ; each of which is herein incorporated by reference in its entirety , together with u . s . pat . no . 7 , 592 , 277 to andrady et al . any surface that is โ at ground โ relative to the potential on a droplet whose surface has just been charged in an electric field can serve as a โ collector โ for the spun fibers . this provides an opportunity to fabricate oil - absorbing mats in situ . adjustments to the properties of the electric field , the concentration of polymer in the precursor solution , the solvent and the polymer used , the pressure and flow - rate of the precursor solution from the needle tip , the distance from needle - tip to collection surface , and ambient conditions ( temperature , pressure , ambient gases ) allow persons of skill in the art to generate fibers of pre - determined thickness at pre - determined rates to build up mats of predetermined density , porosity and thickness . u . s . pat . no . 7 , 901 , 611 to wincheski , incorporated herein in its entirety for all purposes , is exemplary . nanofiber diameters ranging from about 1 micrometer to about 1 nanometer may be useful in certain embodiments of the invention . generally , a range from about 1 micrometer to about 10 nanometers is preferred . a range from about 50 to 500 nanometers is more preferred , and a range from about 100 to 300 nanometers is most preferred . an environment of air comprising gases at about standard partial pressures and temperatures ( 0 - 30 ยฐ c .) is suitable for generating the nanofibers used in embodiments of the invention , but higher temperatures , such as those used for thermoset processes , are not to be excluded . neither are non - standard mixtures of air gases , or gases not normally present in air , or non - standard pressures . as noted above , the hydrophilicity of cellulose acetate and other cellulosic fibers such as cotton promotes water uptake and a concomitant reduction in oleophilicity , together with loss of buoyancy . accordingly , cellulosics tend not to be used to remove oil from water unless they are first treated to substantially increase their hydrophobicity ( u . s . pat . no . 3 , 667 , 982 to marx ; u . s . pat . no . 6 , 852 , 234 to breitenbeck ; u . s . pat . no . 7 , 544 , 635 to liang et al .). surprisingly , the inventors have found that no such treatment is required of the forming nanofibers , the spun nanofibers , or the nanofiber mats to create a buoyant product that does not become waterlogged before it can take up hydrocarbonaceous liquids . this fact obviates all need to consider the expense of substance ( s ) used to treat , the complexity of the treatment , and the environmental or public health implications of the treatment . photocatalytic decomposition of organic pollutants in water is receiving increased attention in recent years because of its reliance on solar energy . specifically , n - type semiconductors , such as titania ( tio 2 ), when illuminated with light having a higher energy than the semiconductor &# 39 ; s band gap , are capable of decomposing organic compounds ( nair et al ., 1993 ). crude oil consists primarily of hydrocarbons , such as alkanes ( e . g . butane , pentane ), cycloalkanes , and aromatic hydrocarbons ( benzene , toluene ). photocatalytic oxidation of crude oil on salt water has been studied by heller &# 39 ; s group ( nair et al ., 1993 ) who used titania pigment for these studies . titania as a photocatalyst absorbs and is excited by light of wavelengths shorter than 387 nm for the anatase polymorph having a 3 . 2 รฅ bandgap ( nair et al ., 1993 ). the underlying physical chemistry of oil decomposition , as explained in detail in reference ( nair et al ., 1993 ) and as presented below , involves the generation of an electron - hole pair for each absorbed photon ( i . e . an electron moving from the valence to the conduction band leaving a hole or โ electron vacancy โ in the former as presented in equation 1 : the diffusion of the hole to the titania particle &# 39 ; s surface , upon reaction with an adsorbed water molecule , produces an oh radical and a proton ( see equation 2 ): equation 3 explains how charge neutrality is maintained during this process ( resulting in the production of hydrogen peroxide ): the hydroxyl radicals then initiate the oxidation of hydrocarbon to carbon dioxide , water , and water - soluble organics ( aldehydes , ketones , phenolates , carboxylates ) products that may โ rapidly biodegrade by marine bacteria โ ( nair et al ., 1993 ), for example see equation 5 , through photocatalytic oxidation , which has been defined as โ a free - radical catalyzed thermodynamically spontaneous process . . . that proceeds at ambient temperature โ ( nair et al ., 1993 ). titania photoassisted oxidation eliminates polycyclic aromatic hydrocarbons ( some of which are known carcinogens ) and also phenols ( products of natural photo - oxidation ) that further decompose to polymeric tars that are difficult to biodegrade ( nair et al ., 1993 ). thus , oxide - based photoassisted oxidation is a most promising route to effective and eco - friendly oil decomposition . the efficiency of the photocatalytic oxidation of anatase particles ( uv collectors ) is reduced by electron - hole recombination and water formation , which slows the rate of solar assisted oxidation ( nair et al ., 1993 ). however , โ approximately 96 . 0 - 97 . 0 % of the sea - level solar irradiance consists of photons that are not sufficiently energetic to promote valence band electrons to the conduction band of tio 2 ( anatase )โ air et al ., 1993 ). for this reason , embodiments of the current invention use oxide photocatalysts that absorb in the visible range of solar radiation to improve cleaning efficiency in terms of oil decomposition rate and fast response . wo 3 is a visible - light - responsive photocatalyst for oxygen generation , and has a valence band potential similar to that of titania , suggesting that the โ oxidative ability of a hole on the wo 3 valence band is almost the same as that on tio 2 โ ( chai et al , 2006 ). however , it is known that wo 3 exhibits poor activity as far as the decomposition of organic compounds is concerned ( chai et al , 2006 ). while pd and pt are effective as co - catalysts for the complete photo - degradation of organic compounds under visible light , they are too expensive to be practical for use in environmental remediation . cupric oxide ( cuo ) has been considered as an economical and easy to make alternative for the noble metal co - catalysts ( chai et al , 2006 ) but the art teaches ( arai et al , 2009 ) that , in order for cuo to enhance the photocatalytic activity of wo 3 , the particles of the different oxides need to be in contact with each other . this is impossible to achieve to any useful effect by mixing the powders alone . surprisingly , the inventors have found that such contact โ a virtual โ bicrystal โ of cuo and wo3 โ can be created by methods disclosed herein . embodiments of the invention combine two synthesis methods to form novel 3d nanogrids of a cuo / wo3 system that performs as a bicrystal . wo 3 sol - gel โ polymer , ( preferably either cellulose acetate ( ca ) or polyvinylpyrolidone ( pvp ), is deposited on cu grids by means of electrospinning , followed by thermal treatment ; the latter step oxidizes cu to cuo while crystallizing the amorphous wo 3 so as to form crystalline wo 3 particles . the resulting structure consists of self - supported 3d mats of a 1 : 1 wo 3 and cuo particle configuration in a โ photocatalytic screen โ or โ net โ of high aspect ratio and an extremely high surface area for surface - driven reactions . the โ nanofibers โ comprising the network are lined up clusters of metal oxides but they create a structure that is easy to handle and is strong enough to sustain vibrations and shaking , and stable enough to prevent particle dissolution in ( salt ) water environments . these examples present representative protocols used in describing the invention disclosed herein . these protocols are not to be considered limiting as any analogous or comparable protocol measuring the same end - points within the skill of an ordinary artisan would also be sufficient . cellulose acetate ( mw =ห 29 , 000 ) precursor solution ( 15 wt %) was prepared in 4 : 6 acetic acid : acetone mixture with 1 hour of ultrasonication . electrospinning was carried out using a 10 ml syringe with a 20 gauge stainless steel needle at applied voltage 19 kv over a distance of 15 cm . the syringe pump was set to deliver the solution at a flow rate of 9 . 6 ml / h and all the spinning was carried out at ambient condition . fig1 is a scanning electron microscopy ( sem ) image of the deposited nanofibers . fig2 is a photograph of an ordinary cotton ball ( on left ) and a cellulose acetate mat ( on right ) weighing about half as much as the cotton ball . benzene was dyed with unisol blue as to help visualize the absorption activity of the cellulose acetate mats . two ml of dyed benzene solution was mixed with 10 ml of water in two vials ( fig3 ). approximately 0 . 4 g of cotton was floated atop the benzene and water mixture at left . approximately 0 . 2 g of matting was floated atop the benzene and water mixture at right . the cotton rapidly sank through the benzene layer into the water below . the matting instantly soaked up the benzene , remained afloat , and held the benzene as shown in the right panel of fig3 . fig4 is a photograph of the recovered cotton ball ( in the dish in foreground on left ) and the recovered cellulose acetate mat . the container in the background at left has retained all of its benzene ; there is no dye in the cotton ball . at the right in fig4 . ( in the dish in foreground ) is the blue - dyed nano - fiber mat recovered from the container in the background . no dyed benzene is evident in the container . the sol gels for the solutions were made by adding water to 1 . 5 g of tungsten isopropoxide ( c 18 h 42 o 6 w ). the hydrolysis was done in a glove box in a controlled atmosphere and the resulting solution was mechanically agitated inside the glove box for 5 minutes . the solution was then ultrasonicated for 2 hours and then aged for 24 hours to ensure complete hydrolysis of the solution . 1 . 5 g of wo 3 sol - gel was mixed with 3 ml of acetic acid and 3 ml of ethanol in a nitrogen - filled glovebox . then the mixed solution was removed from the glovebox and added to 10 % wt / vol polyvinylpyrolidone pvp ( aldrich , mw ห 1 , 300 , 000 ) in ethanol , followed by ห 30 min of ultrasonic bath . the mixture was immediately loaded into a syringe fitted with 22 gauge needle . the needle was connected to a high voltage power supply and positioned vertically 7 cm above a piece of a copper mesh ( twp inc ., 200 mesh , wire dia . 51 ฮผm ) which acts as a ground electrode . the syringe pump was programmed to dispense 5 ml of pvp solution at a flow rate of 30 ฮผl / min . upon application of a high voltage ( 25 kv ), a solution jet was formed at the needle tip . the solvent evaporated during flight and a nonwoven mat of fibers was deposited on the cu mesh . thermal oxidation of the composite cu mesh - nanofibers was carried out at 500 ยฐ c . for 5 h for complete calcination of pvp . the thermal oxidation process first drives cuo crystals into the pvp nanofibers , which already contain amorphous wo 3 . as the thermal process evolves , crystals of wo 3 form between and among the cuo crystals . at about 500 ยฐ c ., the pvp calcinates as can be seen in the differential scanning calorimeter traces shown in fig8 , leaving a network of โ fibers โ ( fig5 ) made of crystals of wo 3 in contact with crystals of cuo ( fig6 ). this network of metal oxide fibers , or โ nanogrid ,โ now has photocatalytic properties . photocatalytic degradation of benzene proceeded in a glass vial ( fig7 ). 2 . 6 ml of dyed benzene ( dyed with unisol blue as , sigma - aldrich ) was poured into each of three vials , synthesized wo 3 / cuo was added to vial ( b ) and tio 2 ( sigma - aldrich , degussa p - 25 ) to vial ( c ). the bottom of each vial was irradiated with light from a xenon lamp ( newport , 300 w ). an am 1 . 5 filter was used solar - light - simulating irradiation , respectively . after 50 h of exposure in full spectrum light , a โ smoky โ residue persists , but little or no benzene remains in vial ( b ), whereas a substantial amount of ( discolored ) benzene remains in vial ( c ). fig5 is an exemplary scanning electron microscopic image of a nanogrid . at the higher resolution provided by the transmission electron microscopic image of nanogrid elements in fig6 , crystals arranged within nanometers of one another can be seen . | 8 |
referring now to the drawings , fig1 and 2 illustrate the recirculating water bath toy and an associated water flow schematic according to one embodiment of the present invention . the water bath toy 10 includes an outer body 12 , a pump system 14 , and an outlet system 16 . the outer body 12 includes an interface portion 20 , a pump housing 22 , a pump inlet 24 ( fig3 ), a battery compartment 26 , and mounting means 28 . the interface portion 20 houses the outlet system 16 including the associated controls . the pump inlet 24 is below the surface of the water and faces the wall of a bath tub or pool when the water bath toy 10 is properly installed . thus the pump inlet 24 is not accessible to a child . the pump inlet 24 may include a screen or other means for preventing objects from being taken up into the pump inlet 24 . the battery compartment 26 is best shown in fig3 and 7 and is a water resistant compartment in the present embodiment . fig4 demonstrates that the shape of the outer body 12 is configured to fit over the wall of a bath tub or pool . the mounting means 28 , shown in fig1 , aid in securing the outer body 12 to the wall of the bath tub or pool . the mounting means 28 may be rubber pads , adhesive pads , suction cups , clamps , or any combination thereof . referring to fig2 , the pump system 14 includes a battery operated pump 30 , a pump inlet line 32 , and a pump outlet line 34 , the pump 30 is powered by batteries in the battery compartment 26 via electrical wires . alternatively , the pump 30 is a hand operated pump . the pump inlet line 32 facilitates fluid communication between the pump inlet 24 and the pump 30 . the pump outlet line 34 facilitates fluid communication between the pump 30 and the outlet system 16 . the pump system 14 further includes a power toggle switch 36 ( fig1 ) that penetrates the outer body 12 . in the present embodiment the power toggle switch 36 is remotely located in relation to the interface portion 20 and the water . referring to fig2 , 5 , and 6 , the outlet system 16 is shown to include a selector valve 38 , a selector valve actuator knob 40 , and a variety of output features 42 . the selector valve 38 includes a valve inlet 44 in fluid communication with the pump outlet line 34 and a plurality of valve outputs 46 configured such that only one of the valve outputs 46 is open at any particular time . each of the valve outputs 46 is in fluid communication with an output feature 42 . the selector valve actuator knob 40 is operable to select which of the valve outputs 46 is open . in the present embodiment , the output features 42 include a wide spray feature 48 having a wide spray nozzle 50 , a narrow spray feature 52 having a narrow spray nozzle 54 , and a waterfall feature 56 having a variety of configurable obstructions 58 . the output features 42 are disposed on the surface 64 a of the front arm 64 . the obstructions 58 engage support holes 60 and may be moved around to change the affect of the obstructions 58 on the water exiting the water bath toy 10 through the waterfall feature 56 . many further output features can be imagined that are within the scope of the invention , for example a directional hose - type outlet . in use , the outer body 12 is mounted on a sidewall of a pool or a bath tub such that the mounting means 28 engages the sidewall . the distal end of front arm 64 of the outer body 12 is partially submerged in water such that the pump inlet 24 is at least partially submerged below water line 62 while outlet system 16 is disposed above water line 62 . such a configuration permits the child to observe the water flowing from outlet system 16 . the back arm 66 is joined to the front arm 64 by connecting arm 68 that joints the arms at their respective ends . the water level 62 or the positioning of the outer body 12 may be adjusted to achieve this . a supervising parent activates the pump 30 by actuating the power toggle switch 36 . fig2 shows that the pump 30 draws water through the pump inlet line 32 and supplies pressurized water to the selector valve 38 via the pump outlet line 34 . a child or supervising parent selects the output feature 42 by turning the selector valve actuator knob 40 to a corresponding position having an appropriate label on the face of the interface portion 20 . the pressurized water travels through the selector valve 38 to the selected output feature 42 . the selected output feature 42 in fig1 is the waterfall feature 56 . the user may arrange the obstructions 58 and observe the affect that different shapes and configurations have on the water flow in the waterfall feature . to ensure the safe use of the bath toy the pump is configured to delivery water at a predetermined rate . this predetermined rate is selected to cause the water to gently trickle out of the outlet feature 42 without substantial pressure . in one embodiment , the rate of water delivery is less than about 200 ml per second . in another embodiment , the rate of water delivery is less than about 100 ml per second . in yet another embodiment , the rate of water delivery is less than about 50 ml per second . graphics that are pleasing to children , such as cartoon characters , comic book characters , and television personalities , may be included on the surface of the outer body 12 . further , pleasing shapes such as cartoon characters may be incorporated into the output features 42 such that the liquid appears to be emitted from the graphic . for example , the graphic may in the shape of an elephant and the water may appear to be emitted from the elephant &# 39 ; s trunk . the graphic may be fixably joined to the outer body using any conventional technique including adhesives or making the graphic monolithic with respect to the outer body . for example , in fig8 , a graphic of an elephant head is disposed over spray nozzle 54 ( see fig5 ) such that water appears to be coming from a hole in the end of the elephant &# 39 ; s trunk . in fig8 , the graphic is monolithic with the interface portion 20 . in the present embodiment , durable and corrosion resistant materials such as high impact plastics and elastomers are used whenever possible . while this invention has been described as having a preferred design , the present invention can be further modified within the spirit and scope of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the present invention using the general principles disclosed herein . further , this application is intended to cover such departures from the present disclosure as come within the known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims . | 0 |
referring now to drawings , various preferred embodiments of the present invention will be described . fig1 shows a structural block diagram of an frs / atm converting function unit according to an embodiment of the present invention . in an upper - half drawing portion of this frs / atm converting function unit , a data conversion along a direction defined from an atm cell format to a frame relay format is carried out . in this figure , reference numeral 401 indicates an atm cell receiving unit , namely corresponding to an interface for receiving an atm cell sent from an atm network . reference numeral 402 shows a data expanding unit . in this data expanding unit 402 , data of an atm cell is expanded , and then , this expanded data is used to constitute frame relay data . reference numeral 403 represents an efci saving unit for extracting an efci ( explicit forward congestion indication ) from atm data to save this extracted efci . the value of this efci is compared with a value of an fecn ( forward explicit congestion notification ) produced from the expanded data derived from the data expanding unit 402 by an fecn producing unit ( in the case of forward direction ) by a comparing unit 406 . then the comparison result is converted into a congestion bit by a congestion bit converting unit 407 . the congestion bit is supplied via the congestion bit converting unit 407 to an hdlc producing unit 412 . it should be noted that the comparing unit 406 contains a mode setting unit 410 . an fecn of a q . 922 - dll frame is set to either โ congestion occurs โ or โ no congestion โ in accordance with a setting mode of this mode setting unit 410 . the function of this mode setting unit 410 will be later discussed more in detail . an abort producing unit 408 owns a function capable of producing an abort signal in the case that such a recognition is made of โ congestion occurs โ based on an efci extracted from an atm cell . in response to this abort signal , a transmission frame is deleted in the hdlc producing unit 412 . also , a becn producing unit 405 owns a function capable of producing a becn ( backward explicit congestion notification ) along a backward direction . a selector ( sel ) has a function capable of selectively sending expanded data derived from the data expanding unit 402 and a conversion result of the congestion bit converting unit 407 to the hdlc producing unit 412 . a buffer amount monitoring unit 414 monitors a buffer state of the data expanding unit 402 to notify the monitored buffer state to a read control unit 413 . in response to the notification issued from this buffer amount monitoring unit 414 and a read reinitiating unit 415 , the read control unit 413 controls the data reading operation from the data expanding unit 402 . on the other hand , in a lower - half drawing portion of this frs / atm converting function unit , a data conversion along a direction defined from a frame relay format to an atm cell format is carried out . a hdlc receiving unit 417 receives an hdlc of frame relay data , and transfers this received hdlc to a data saving unit 418 . the data saving unit 418 extracts congestion information from this frame relay data , and then sends the extracted congestion information to both a becn producing unit 420 and the fecn producing unit 421 . the becn produced from the becn producing unit 420 is supplied to a mode setting unit 426 . in accordance with a mode set by this mode setting unit 426 , an efci is produced from an efci information producing unit 425 , and this efci is inserted into an atm cell . also , a selector ( sel ) 422 selectively supplies the outputs derived from the data saving unit 418 and the becn producing unit 420 to an sar - pdu producing unit 423 . then , finally , such an atm cell to which the congestion information has been set in the above manner is transmitted from an atm cell transmitting unit 424 to an atm network . next , frame structures of the respective layers ( see fig3 ) from a frame relay up to an atm cell employed in this embodiment will now be explained in detail . as indicated in fig5 , with respect to a q . 922 - dll - pdu format , โ 0 โ bit is stuffed in fields other than a flag field ( bit stuffing ). accordingly , after a flag is detected , โ 0 โ located immediately after โ 1 โ continued by 5 octets is a extracted to format it as a frame relay . similar to a header format of an fr - sscs - pdu format ( which will be discussed later ), there are 3 types ( namely , 2 octets , 3 octets , and 4 octets ) of address fields . the format structure of q . 922 - dll - pdu shown in fig5 is such a format structure from which โ 0 โ bit has been deleted . also , the address field shown in this drawing is 2 octets . in this drawing , the congestion information along the forward direction is stored into the fecn ( forward explicit congestion indication ), and the congestion information along the backward direction is stored into the becn ( backward explicit congestion notification ). as illustrated in fig6 , an fr - sscs - pdu format is identical to the q . 922 - dll - pdu format except for the flag , the โ 0 โ- bit stuffing portion , and the fcs . fig7 represents a cpaal5 - pdu format . in the cpaal5 , a variable length frame ( namely , 1 to 65535 - octet lengths ) transmission is performed . as a consequence , in the cpaal5 - pdu format , there are provided a pad ( pad : packet assembly / disassembly ) used to multiply an atm cell by an integer , extracting of a frame portion , and a length field for detecting an error which is not detected by crc - 32 . fig8 represents contents of the respective fields contained in the cpaal5 - pdu . fig9 represents a format of an atm cell . in this drawing , congestion information which is transmitted as efci information is stored into a pti ( payload type identifier ). this pti is arranged by 3 octets . it should be noted that either โ 000 โ or โ 001 โ implies โ no congestion โ, and either โ 010 โ or โ 011 โ implies โ congestion occurs โ. referring now to fig1 to fig1 , congestion information along a forward direction and also a backward direction will be described . in this specification , the following definition is made : with respect to a transmission direction of congestion information , an indication of a congestion condition occurred in an up stream is defined as a โ forward direction โ, whereas an indication of a congestion condition occurred in a down stream is defined as a โ backward โ direction . in this case , it is practically difficult to specify an actually existing congestion point with employment of the feci information , the fecn information , and the becn information . however , it is possible to clarify a direction along which congestion is present . fig1 represents a format direction defined from a frame relay network to an atm network . a fact as to whether or not congestion is present in the upper stream , namely on the side of a frame relay network 205 is transmitted as an fecn of a q . 922 core frame . this fecn information of the q . 922 core frame is converted into an fecn of an fr - sscs ( see fig6 ) by an frs / atm converting function unit ( iwf ) 202 . then , the converted fecn information of the fr - sscs is stored into the efci which is stored into the pti of the atm cell ( see fig9 ), depending upon each of various modes . as a result , it is possible to recognize as to whether or not the congestion is present on the upper stream side ( namely on the frame relay network side ) in the atm network 201 . fig1 indicates a backward direction defined from the frame relay network to the atm network . a q . 922 becn indicative of congestion occurred from the upper stream side ( frame relay network side ) along the backward direction is acquired , and furthermore , an efci of an atm cell arrived from the down stream direction ( atm network side ) is read . as a result , these q . 922 becn and efci of the atm cell are reflected to becn of fr - sscs in accordance with the respective modes , and the congestion information on the down stream side ( atm network side ) can be transmitted . fig1 represents a forward direction defined from the atm network to a frame relay network . a fact as to whether or not congestion is present in the upper stream , namely on the side of the atm network 201 is transmitted as an efci stored in a pti of an atm cell . this efci information is converted into an fecn of an fr - sscs ( see fig6 ) by the frs / atm converting function unit ( iwf ) 202 in combination with the congestion information of the original fecn of the fr - sscs in accordance with the respective modes . furthermore , this converted fecn information is transmitted as an fecn of a q . 922 core frame to the frame relay network 205 side . as a result , it is possible to recognize as to whether or not the congestion is present on the upper stream side ( namely on the atm network side ) in the frame relay network 205 . fig1 indicates a backward direction defined from the atm network to the frame relay network . a becn of an fr - sscs arrived from the down stream direction ( i . e ., frame relay network side ) is read into the frs / atm converting function unit ( iwf ) 202 , and then this becn information is converted into a becn of the q . 922 core frame in accordance with the respective modes . as a result , the congestion information occurred on the down stream side ( frame relay network side ) can be transmitted . in this embodiment , the mode setting units 410 and 426 as explained with reference to fig1 may prepare several modes . in accordance with these modes , a decision is made how congestion information occurred in one network is transferred to another network , depending upon a combination of a group of the above - described frame relay network to atm network and the above - explained atm network to frame relay network , and another group of the above - described forward direction and backward direction . fig1 to fig1 illustratively show types of mode setting operations along the forward / backward directions . mode setting operation of forward direction : frame relay network to atm network fig1 is a flow chart for showing a control sequence in the forward direction defined from the frame relay network to the atm network . in this flow chart , when the frs / atm converting function unit ( iwf ) 202 receives the q . 922 core frame , if the value of fecn information is equal to โ 0 โ ( step 1401 ), namely no congestion occurs on the side of the upper stream ( i . e ., frame relay network side ), then โ 0 โ is set to the fecn value of fr - sscs , and furthermore , โ 0 โ is set to the efci value of the atm cell ( step 1402 ). on the other hand , in such a case that the fecn value of the q . 922 core frame is not equal to โ 0 โ at the above - described step 1401 , three modes are selectable . that is , a first mode ( step 1404 ) corresponds to such a mode similar to the conventional mode . in this first mode , the fecn field of the q . 922 core frame is directly duplicated to the fecn field of fr - sscs without any conditions . however , this value is not reflected to the atm cell . as a consequence , in this first mode , the fecn value of fr - sscs is set to โ 1 โ, and the efci value of the atm cell is set to โ 0 โ. a second mode ( step 1405 ) corresponds to a mode specific to this preferred embodiment . in this specific second mode , the fecn information of the q . 922 core frame is mapped to all of the efci information of the atm cells belonging to this core frame ( namely , converted from this frame ). by using this second mode , the congestion information of the q . 922 core frame will be directly reflected to all of the atm cells . a third mode ( step 1406 ) also corresponds to a mode specific to this preferred embodiment . in this specific third mode , the fecn information of the q . 922 core frame is mapped only to the efci information of the last atm cell belonging to this core frame ( namely , converted from this frame ). by using this third mode , the congestion information is merely processed only in the last atm cell . as a consequence , it is possible to avoid such a problem that the transfer process operation is delayed by executing the cumbersome congestion information processing operation . fig1 indicates the contents of these first to third modes , and fig1 represents the setting conditions of the fecn of fr - sscs and the efci of the atm cells in the respective modes . mode setting operation of forward direction : atm network to frame relay network fig1 is a flow chart for showing a control sequence in the forward direction defined from the atm network to the frame relay network . in this flow chart , when โ 0 โ is set to a value of efci of an atm cell received by the frs / atm converting function unit ( iwf ) 202 ( step 1501 ), a determination is made as to whether or not a value of fecn of fr - sscs is also equal to โ 0 โ ( step 1502 ). when both values are equal to โ 0 โ, โ 0 โ is set to a value of fecn of a q . 922 core frame ( step 1503 ). on the other hand , when only a value of fecn of fr - sscs is equal to โ 1 โ, โ 1 โ is set to a value of fecn of the q . 922 core frame ( step 1507 ). also , when the value of efci of the atm cell is equal to a value other than โ 0 โ, two modes are selectable ( step 1504 ). in a first mode ( step 1505 ), a determination is made as to whether or not a value of efci of the last atm cell corresponding to the q . 922 core frame is equal to โ 1 โ ( step 1505 ). when this value is equal to โ 1 โ, โ 1 โ is similarly set to a value of fecn of the q . 922 core frame ( step 1507 ). in such a case that a value of efci of the last atm cell is not equal to โ 1 โ, โ 0 โ is set to a value of fecn of the q . 922 core frame ( step 1503 ). a second mode ( step 1506 ) corresponds to a mode specific to this preferred embodiment . in the case that an efci field of any atm cell belonging to a segment frame to be received is set to โ 1 โ, โ 1 โ is set to the value of fecn of the q . 922 core frame . also , when the values of efci of any atm cells are equal to โ 0 โ, โ 0 โ is set to the value of fecn of the q . 922 core frame ( step 1503 ). in accordance with this second mode , such information for indicating that the congestion occurs in any atm cell will be reflected to the frame relay network side . fig2 indicates the contents of the mode operations . fig2 shows the set values of fecn of the q . 922 core frame in the respective modes . mode setting operation of backward direction : atm network to frame relay network fig1 is a flow chart for showing a control sequence in the backward direction defined from the atm network to the frame relay network . in this flow chart of fig1 , a determination is made as it to whether or not a value of becn of fr - sscs received by the frs / atm converting function unit ( iwf ) 202 is equal to โ 0 โ ( step 1601 ). when this value of becn of fr - sscs is equal to โ 0 โ, โ 0 โ is similarly set to the value of becn of the q . 922 core frame ( step 1602 ). to the contrary , when the value of becn of fr - sscs is not equal to โ 0 โ, two modes are selectable ( step 1603 ). a first mode ( step 1604 ) corresponds to such a mode that a value of a becn field of fr - sscs is directly duplicated to the q . 922 core frame without any conditions . a second mode ( step 1602 ) corresponds to such a mode that the value of becn of the q . 922 core frame is always set to โ 0 โ. in accordance with this second mode , the congestion information in the backward direction can be neglected . this becomes effective in such a case that the congestion information is not required , depending upon service conditions . fig2 indicates the contents of the mode operations . fig2 shows the set values of becn of the q . 922 core frame in the respective modes . fig1 is a flow chart for showing a control sequence in the backward direction defined from the frame relay network to the atm network . in this mode setting operation , the state transition of either โ congestion occurs โ or โ no congestion โ is judged with providing a protection time period in accordance with the vcc congestion state transition diagram shown in fig4 . a state monitoring operation of this vcc is carried out by a vcc state monitoring unit 416 shown in fig1 . in fig4 , โ no vcc congestion โ is set as an initial setting condition ( step 2601 ). then , when efci = 1 is received ( step 2606 ), the timer t starts its time counting operation ( step 2603 ). while the time counting operation is commenced by this timer t , the present state is moved to โ vcc congestion occurs โ ( step 2604 ). then , when efci = 0 is received by time out ( step 2605 ), or time out is taken place ( step 2606 ), the present state is again moved to โ no vcc congestion โ state . next , in the below - mentioned mode 1 , or mode 3 , the state transition occurs at timing when efci = 1 of a final atm cell . in the below - mentioned mode 2 , or mode 4 , the state transition occurs at timing when efci = 1 of any one of atm cells . in the case that โ vcc congestion occurs โ is found based upon the state transition as explained in fig4 ( step 1701 ), the value of becn of fr - sscs is set to โ 0 โ ( step 1702 ). on the other hand , when there is no congestion of vcc and furthermore such a q . 922 core frame is received , the becn value of which is set to โ 0 โ, the becn value of fr - sscs is set to โ 0 โ ( step 1702 ). in any cases that the becn value of the received q . 922 core frame is equal to any value other than โ 0 โ, modes 1 to 4 can be set . in the first mode , an efci value of an atm cell in a โ last โ segment frame is employed in a vcc congestion transition , and furthermore , the congestion state of vcc is set to โ congestion occurs โ. the final segment frame is received along an atm network to frame relay network direction used in a bi - directional connection . in this case , โ 1 โ is set to the becn value of fr - sscs . a second mode corresponds to such a mode in which a becn value of a q . 922 core frame transmitted along a frame relay network โ atm network direction is set , or an efci value of an atm cell in any one of segment frames is employed in a vcc congestion transition , and furthermore , the congestion state of vcc is set to โ congestion occurs โ. this any segment frame is received along the atm network to frame relay network direction used in the bi - directional connection . in this case , โ 1 โ is set to the becn value of fr - sscs . in a third mode , a becn value of a received q . 922 core frame is negligible . then , in this third mode , an efci value of an atm cell in a โ final โ segment frame is employed in a vcc congestion transition , and furthermore , the congestion state of vcc is set to โ congestion occurs โ. the final segment frame is received along the atm network to frame relay network direction used in the bi - directional connection . in this case , โ 1 โ is set to the becn value of fr - sscs . similarly , in a fourth mode , a becn value of a received q . 922 core frame is negligible . then , this fourth mode corresponds to such a mode in which an efci value of an atm cell in any one of segment frames is employed in a vcc congestion transition , and furthermore , the congestion state of vcc is set to โ congestion occurs โ. this any segment frame is received along the atm network to frame relay network direction used in the bi - directional connection . in this case , โ 1 โ is set to the becn value of fr - sscs . as a consequence , in this case , the mode 3 and the mode 4 are additionally provided , by which there is no mutual compatibility between the congestion information in fr - sscs and the congestion information in the q . 922 core frame . as a result , it is possible to select such a flexible transmission system for the congestion information . fig2 indicates the contents of these first to fourth modes , and fig2 represents the setting values of the becn of fr - sscs in the respective modes . | 7 |
the following terms will be used throughout this description and shall have the meaning associated therewith : computer generated object ( cgo ): a computer data structure containing values which describe a geometry and a display attribute . application program ( ap ): a computer process , task , thread of control or job , such as for example a unix process or ums job . association : an identification process whereby a computer data structure , such as an application program identifier , identifies an application program of a cgo . application program identifier ( apid ): a unique computer data structure which correlates to a unique application program . list : a collection of data for at least one cgo and a application program identifier corresponding to the application program responsible for said cgo data . scene : a display of the geometric attributes of at least one cgo wherein the displayed cgo coincides with the cgo data contained in the list . geometric attributes : include , but are not limited to , color , transparency , shininess , line style or fill style . scene manipulation instruction ( smi ): a command to edit , alter or modify the scene , and furthermore , wherein said command edits , alters or modifies at least one cgo or a scene depicting at least one cgo . referring again to the drawings , and more particularly to fig6 there is shown graphics interaction method 600 in accordance with the present invention . as illustrated in fig6 the graphics interaction method 600 includes application program a ( apa ) 602 and application program b ( apb ) 604 . it will be understood by those skilled in the art that the present invention may suitably function with a single application program or a plurality of application programs . but for convenience , the present invention is illustrated and described herein with reference to two application programs . data objects a 606 and data objects b 608 are input to apa 602 and apb 604 respectively . data objects provide information , generally in a digitized format , for processing by an appropriate application program . for example , if data objects a consisted of seismic data and data objects b consisted of well log data , an appropriate application program ( apa ) for processing seismic data would include a seismic interpretation program . an appropriate application program ( apb ) for processing well log data would include a well log interpretation program . once the data objects a 606 and data objects b 608 are received by apa 602 and apb 604 respectively , the data objects are transformed to computer generated object data a and b ( cgoa and cgob ). the process of transforming the data objects a 606 by apa 602 is represented by box 610 . the process of transforming the data objects b 608 by apb 604 is represented by box 610 &# 39 ;. cgo data from 610 and 610 &# 39 ; are input to corresponding cgo output processes represented by boxes 612 and 612 &# 39 ; respectively . output from the cgo output processes 612 and 612 &# 39 ; respectively is transmitted , using transmission methods 622 and 622 &# 39 ;, by conduits 620 and 620 &# 39 ; to a list generating process 624 . such transmission methods 622 and 622 &# 39 ; may be inter - process communication methods such as posix message queue which is known by those skilled in the art to be standard inter - process communication methods . the list generating process 624 generates a list 626 . list 626 stores computer generated object data a and b ( cgoa and cgob ) and the corresponding application program identifier for application program a and b . the application program identifier for application program a and b are represented in list 626 by notations apa &# 39 ; and apb &# 39 ; respectively . as mentioned previously , the present invention may include a plurality of application programs in addition to apa and apb . the notations ( apn &# 39 ;) and ( cgon ) represent the application program identifier and computer generated object data from such additional application programs which could be stored in list 626 . conduit 628 then provides the computer generated object data a and b to a scene generation process 630 . the scene generation process 630 preferably creates a scene in response to the all computer generated object data stored in list 626 . conduit 636 provides output from the scene generation process 630 , i . e ., the scene , to a dimension rendering process 638 . for purposes of the present invention , the dimension rendering process is preferably a 3 - d dimension rendering process . the dimension rendering process 638 transforms the scene into instructions recognizable by a computer display system . such dimension rendering process instructions may further integrate all computer generated object data present in the scene such that the computer display system may display an integrated visual scene . the computer display system instructions are then input via conduit 640 to a computer display system 642 . those skilled in the art will appreciate the requirements for the computer display system 642 . however , generally , an appropriate computer display system may include an operating system ( not shown ) and appropriate operating system software , a display means , such as screen 644 for displaying the scene , and an input instruction means 646 , such as a mouse or light pen , for preferably imputing user instructions to modify , alter or edit the displayed scene . once displayed , the scene may now be modified , altered or edited , preferably by an input instruction selected by a user ( user input event ). as previously discussed the user input event is communicated to the computer display system 642 by the input instruction means 646 . the computer display system 642 communicates , via conduit 648 , the user input event to a user interface process 650 . utilizing user interface methods , the user interface process 650 transforms the user input event into a scene manipulation instruction ( smi ). the preferred user interface methods for use with the present are motif user interface methods , a product of the open software foundation . the smi from the user interface process 650 is communicated , via conduit 652 , to a smi transformation process 654 . as will be discussed in greater detail below , the smi transformation process 654 ultimately converts the smi into a message processable by the application programs . ultimately , in response to such message , one or more affected application programs create new computer generated object data responsive to the user input event . the smi transformation process 654 includes an object identification process 656 . using the smi input to the smi transformation process 654 , the object identification process 656 interrogates the list 626 and identifies the computer generated object data relative to or affected by the user input instruction . in other words , if the user input instruction was to merge b with a by moving only b , the object identification process 656 would interrogate the list 626 , via conduit 657 , at which time the computer generated object data relative to image b would be identified . the smi and identification data for the affected computer generated object are communicated , via conduit 658 , to an application program identification process 660 . using the identification data for the affected computer generated objects , the application program identification process 660 interrogates the list 626 , via conduit 657 , and identifies application program identifiers ( apa &# 39 ; and apb &# 39 ;). the application program identifiers identified by process 660 correspond the application programs of the affected computer generated objects . in this way , the application program identification process can be said to create an association between an affected computer generated object and the application program of the affected computer generated object . the smi , the identification data for the affected computer generated object and the application program identifiers associated with the affected computer generated objects are communicated , via conduit 662 to a message building process 664 . the message building process 664 transforms the input data from the application identification process 660 into discrete messages or sets of instructions . these messages are ultimately routed to and are recognizable by the application programs which correspond to the identified application program identifiers . once constructed , these discrete messages are communicated , via conduit 666 to a message sending process 668 . the message sending process 668 directs each such message to the appropriate application program . in the method illustrated in fig6 messages responsive to the application program 602 are communicated , via conduit 670 , to application program 602 . messages responsive to the application program 604 are communicated , via conduit 670 &# 39 ; to application program 604 . as previously discussed , messages are relayed between processes by conventional inter - process communication methods . for conduit 670 , an inter - process communication method 672 , such as posix message queues , is preferred for conduit 670 &# 39 ; an inter - process communication method 672 &# 39 ;, such as posix message queues , is preferred . however , it will be understood by one skilled in the art that communication between process may be accomplished by other conventional inter - process communication methods . messages via conduits 670 and 670 &# 39 ; are communicated to scene manipulation input processes 614 and 614 &# 39 ; of application programs 602 and 604 respectively . output from input processes 614 and 614 &# 39 ; is communicated to the scene manipulation response processes 618 and 618 &# 39 ;. responsive to and dependent upon the messages imputed by conduits 670 and 670 &# 39 ;, processes 618 and 618 &# 39 ; may cause the retransmission of a new computer generated object from processes 610 and 610 &# 39 ; to corresponding computer generated object output processes 612 and 612 &# 39 ;. the computer generated contents of the list are updated to reflect the new computer generated objects input thereto via conduits 620 and 620 &# 39 ;. conduit 628 provides the new computer generated data to the scene generation process 630 which , via processes previously described , updates the scene responsive to the user input event . it will be clear that the present invention is well adapted to carry out the objects and attain the ends and advantages mentioned as well as those inherent therein . while a presently preferred embodiment of the invention has been described for purposes of this disclosure , changes may be made which will readily suggest themselves to those skilled in the art and which are encompassed within the spirit of the invention disclosed and as defined in the appended claims . | 6 |
at the starting positions which are shown in fig1 and 3 there is obtained in the respective cases , both for the work rolls a 1 / 1 and a 1 / 2 having a third order grind which are used in the new state ( fig1 , 2 ), and for the work rolls a 2 / 1 and a 2 / 2 having a fifth order grind ( fig3 , 4 ), a linear roll - gap contour which ensures optimized flatness for the steel strip s which is being rolled at the time . if differences in the shape of the strip s leaving the roll gap which go beyond the range of tolerances occur or , as a precaution , before each occasion on which a new steel strip is going to be rolled , the work rolls a 1 / 1 , a 1 / 2 or a 2 / 1 , a 2 / 2 , as the case may be , are moved together , as a pair , in the same direction in the manner according to the invention along their axes of rotation l 1 , l 2 in a direction r โ or r +. even though the center of the pair of work rolls a 1 / 1 , a 1 / 2 or a 2 / 1 , a 2 / 2 moves relative to the center axis m of the steel strip s when this is done , there is , surprisingly , no disruption ( curving ) of the movement of the steel strip s which would adversely affect its shape . instead , because the shift of the pairs of work rolls a 1 / 1 , a 1 / 2 and a 2 / 1 , a 2 / 2 takes place in parallel , the roll gap maintains its optimum shape which was set in the starting position ( fig1 , fig3 ). the shift of the pairs of work rolls in the same direction follows , in this case , the shift strategy which is shown by way of example in fig5 . what are shown , in the co - ordinate system represented in fig5 , are the shifted positions v 1 - v 53 which were set , in the hot rolling of steel strips s 1 - s 53 respectively which were cast by a strip casting machine of the twin - roller type , for the work rolls which were used in this case , which are not shown in this case and which may for example be shaped to correspond to the work rolls a 1 / 1 , a 1 / 2 and a 2 / 1 , a 2 / 2 which are shown in fig1 - 4 . all the steel strips s 1 - s 53 were of the same width . in fig5 , the position on the abscissa ( the x - axis ) indicates the starting position at which the work rolls were located in the position shown in fig1 and 3 ( the โ 0 โ position of the work rolls ). shown on the ordinate axis ( the y axis ) are the respective shifted positions v 1 - v 53 which the work rolls occupied after respective shifts in a positive direction r + ( pointing to the right in fig1 - 4 ) or a negative direction r โ ( pointing to the left in fig1 - 4 ) relative to the starting position . in the case of the shift strategy described here , the work rolls were in each case shifted , in the manner according to the invention , in parallel in the same direction on completion of the hot rolling of one of the steel strips s 1 - s 53 , because after each passage through of a steel strip the state of wear which had been reached was one which made it necessary for there to be an appropriate shift . accordingly , the first steel strip s 1 was hot rolled with the work rolls in the starting position v 1 ( the โ 0 โ position ). on completion of the hot rolling of steel strip s 1 , the work rolls were shifted in the positive direction of shift r + until a first shifted position v 2 was reached . with the work rolls in this shifted position v 2 , steel strip s 2 was rolled in its entirety . basically , it would have been possible , starting from the shifted position v 2 , for a further shift to have been made in the direction of shift r + ( a shift towards the right ). in the present case however , the shifted position v 2 was considered to be a first maximum shifted position at which a first change was made in the direction of shift . accordingly , on completion of the hot rolling of steel strip s 2 , the work rolls were shifted in the direction of shift r โ, which was in the negative range of shift relative to the starting position v 1 . the hot rolling of steel strip s 3 took place with the work rolls situated in this shifted position v 3 . because the shifted position v 3 which was in the negative range relative to the starting position ( which was a shift to the left ) was a shorter distance away from the starting position v 1 than the shifted position v 2 reached previously , i . e . was smaller in size than the shifted position v 2 , the work rolls were again shifted in the negative direction of shift r โ on completion of the hot rolling of steel strip s 3 until the shifted position v 4 was reached . this latter position was situated at the same distance from the starting position v 1 as the maximum shifted position v 2 which was previously reached in the direction of shift r +. accordingly , after the hot rolling of steel strip s 4 , the work rolls , at the shifted position v 4 , which was now the maximum position for the direction of shift r โ, were shifted together in the direction of shift r + until the shifted position v 5 was reached . because this shifted position v 5 was at a distance from the starting position v 1 which was smaller in size than the distance at which the shifted position v 4 reached previously was situated , the work rolls continued to be moved in the direction of shift r +, after the hot rolling of steel strip s 5 had taken place in the shifted position v 5 , until the shifted position v 6 was reached . the distance between this latter and the starting position v 1 was larger in size than the distance between shifted position v 4 and the starting position and a fresh change in the direction of shift was therefore made on completion of the hot rolling of steel strip s 6 , which took place at shifted position v 6 . the procedure elucidated above was continued for steel strips s 7 - s 26 ( shifted positions v 7 - v 26 ). a point which should be noted in this case is that shifted positions v 15 , v 19 , v 21 , v 23 and v 25 of the work rolls at which the steel strips s 15 , s 19 , s 21 , s 23 were hot rolled were the same as the starting position v 1 . when the adjusted position v 26 was reached , the travel of the work rolls in adjustment had reached a maximum value from which the sequence of shift of the work rolls reversed . accordingly , on completion of the hot rolling of steel strip s 26 which took place at shifted position v 26 , the work rolls were first shifted in the direction of shift r โ until the shifted position v 27 was reached . this latter coincided with the starting position v 1 . even though it was true that the adjusted position v 27 was already smaller in size relative to the starting position than the adjusted position v 28 , the work rolls continued to be shifted , on completion of the hot rolling of steel strip s 27 at this adjusted position v 27 , in the direction of shift r โ to a shifted position v 28 , because the adjusted position v 27 as such did not constitute a maximum value of shift due to its not being at any distance at all from the starting position v 1 . the distance between the shifted position v 28 and the starting position v 1 was the same as the distance between the shifted position v 26 indicating the maximum value of shift and the starting position v 1 . the direction of shift was therefore changed after the hot rolling of steel strip s 28 which took place at the shifted position v 28 . the work rolls were therefore once again shifted in the direction of shift r + until the shifted position v 29 was reached , which once was the same as the starting position v 1 . after the hot rolling of steel strip s 29 at the shifted position v 29 , the work rolls therefore continued to be shifted in the direction of shift r + until the shifted position v 30 was reached . this latter corresponded to the shifted position v 22 and was therefore at a distance from the starting position v 1 which was smaller in size than distance at which the shifted position v 28 was situated . it was therefore considered a maximum shifted position at which a further reversal of the direction of shift took place . the above procedure was continued until the shifted position v 53 was reached , which position coincided with the starting position v 1 and , at it , there no longer appeared to be any purpose in any further shortening of the travel in shift in view of the state of wear of the work rolls . the shifted position v 53 itself constituted a minimum value at which it had to be decided whether the same cycle of shifts as has been described had to be repeated , possibly with different , and in particular shorter , travels in shift but in principle with the same sequence of changes of direction , or whether at least one of the work rolls a 1 / 1 , a 1 / 2 or a 2 / 1 , a 2 / 2 had to be replaced due to its state of wear , which would have been reflected in unacceptably large differences in the shape of the rolled metal strip s . in the case of the shift strategy which has been described above , the adjusted positions v 1 - v 26 which are reached between the starting position v 1 and the shifted position v 26 which represents the maximum value of the shift are arranged , about the shifted position v 27 , with mirror - image symmetry to the shifted positions which are set between the shifted positions v 28 to v 54 , i . e . in the case of the shift strategy which has been explained here , the increase in the size of each of the maximum shifted positions v 2 , v 4 , v 6 , v 8 , v 10 , v 12 , v 14 , v 16 , v 18 , v 20 , v 22 , v 24 , v 26 , which increase starts from the starting position v 1 , takes place in the same way as the reduction in the size of the maximum shifted positions v 28 , v 30 , v 32 , v 34 , v 36 , v 38 , v 40 , v 42 , v 44 , v 48 , v 50 , v 52 , which reduction starts from the adjusted position v 28 and continues until the last shifted position v 53 is reached which indicates the minimum value of the shift . the cycle described above can be repeated until such time as there is a difference in the shape of the metal strip , particularly in the edge regions of the strip , which is outside the permitted tolerances or is undesirable . the travel in shift then has to be shortened in the appropriate way or the cyclic shift has to be stopped completely . the shift strategy which has been described here has proved particularly successful with roll stands which are part of a strip casting or thin slab system . different strategies , and in particular ones in which the increase and decrease in the respective shifted positions which initiate a change in the direction of the shift are not symmetrically arranged in the way described , may be necessary particularly if metal strip of different widths is being rolled in the roll stand . ideally , the complete rolling schedule covered by a rolling campaign is then taken into account in this connection , in the way described in ep 0 953 384 a2 . the wear x on the work rolls has an effect on the results of the rolling and so too does their crowning b which occurs as a result of heating - up and fig6 shows how these effects are compensated for by the shift strategy according to the invention . it should be pointed out in this case that , with the procedure according to the invention , not only is optimized flatness achieved for the steel strip s obtained in the given case but the formation of tight edges k is also avoided . the range of shift e of the work rolls which is traversed by means of the adjustment cycle which has been explained by reference to fig5 is also shown in fig6 . as a comparison , what is shown in fig7 is the strip profile which comes into being with increasing wear x on the work rolls and increasing crowning b of them if no adjustment is made to the work rolls . | 1 |
fig1 shows a known transmission housing 1 , which is connected by means of a flange 3 to a flywheel housing 2 . the transmission housing 1 is divided by further flanges 4 , 5 , 6 into individual housing components or sections 7 , 8 , 9 , 9 a . by means of the flange joints , on the one hand , the housing components are sealed and , on the other hand , the flange joints enable transverse forces and / or torques to be transmitted from one part of the housing to another . in this connection , with a view to more precise details reference is made to the previously mentioned , older application by the present applicant with official file number de 10 2011 003 324 . 6 , whose entire content is subsumed in the disclosure content of the present application . fig2 shows a first example embodiment of the invention for a flange joint 10 , which comprises a first housing component 11 having a first flange 11 a and a second housing component 12 having a second flange 12 a . the flanges 11 a , 12 a are flat and have depressions or recesses 11 b , 12 b distributed around the periphery of the flanges 11 a , 12 a . in this example embodiment the recesses 11 b , 12 b are in the form of blind bores , i . e . of circular - cylindrical shape . between the flanges 11 a , 12 a is arranged a separate insert 13 , which has projections 13 a , 13 b in the form of raised collars or perforations on both sides , i . e . on the side facing the first flange 11 a and on the side facing the second flange 12 a . in this case the insert 13 is a sheet - metal component , i . e . made from a metallic material ; the collars 13 a , 13 b are produced by punching and drawing through , and are therefore formed integrally with the insert 13 . the collars 13 a , 13 b positively engage , without play , in the recesses 11 b , 12 b and thus form an interlocked joint between the first housing component 11 and the second housing component 12 , so that transverse forces and / or torques can be transmitted . thus , the insert 13 acts as an interlocking transmission element between the housing components 11 , 12 . fig3 shows a second example embodiment of the invention for a flange joint 20 between a first housing component 21 having a first flange 21 a and a recess 21 b , and a second housing component 22 having a second flange 22 a and a recess 22 b . between the two flanges 21 a , 22 a is clamped a separate insert 23 which has on both sides projections in the form of protuberances 23 a , 23 b that engage , with interlock , in the recesses 21 b , 22 b . in contrast to the open perforations 13 a , 13 b in the first example embodiment , the protuberances 23 a , 23 b are closed , so that including its projections the insert 23 has an unbroken surface . by virtue of the protuberances 23 a , 23 b the insert transfers transverse forces and / or torques from the first housing component 21 to the second housing component 22 and thus โ as in the first example embodiment โ it acts as a transmission element . fig4 shows a third example embodiment of the invention for a flange joint 30 , which connects a first housing component 31 having a first flange 31 a and a second housing component 32 having a second flange 32 a . in the first flange 31 a are formed cylindrical recesses 31 b , 31 c in the form of blind bores , and in the second flange 32 a corresponding recesses 32 b , 32 c are formed , which are aligned coaxially with the bores 31 b , 32 c in the first flange 31 a . between the two flanges 31 a , 32 a is clamped a separate insert 33 , which has on both sides projections 33 a , 33 b and 33 c , 33 d respectively opposite one another . the insert 33 consists of a metallic material and the projections 33 a to 33 d are produced by solid deformation such that on both sides of the insert the material is thickened to form cylindrical studs . the solid projections 33 a to 33 d engage , with interlock and without play , in the recesses 31 b 31 c on one side and in the recesses 32 b , 32 c on the other side . as in the previous example embodiments , the insert 33 acts as a transmission element between the two housing components 31 , 32 . fig5 shows a variant of the example embodiment in fig4 , i . e . a fourth example embodiment of the invention for a flange joint 40 between a first housing component 41 and a second housing component 42 , in which recesses 41 b and 42 b are formed . an insert has , in alternation , projections or raised areas 43 a on one side and projections or raised areas 43 b on the other side , which engage respectively , with interlock and without play , in the recesses 41 b of the first housing component 41 and in the recesses 42 b of the second housing component 42 . like the insert 33 in fig4 , the insert 43 is produced by solid deformation so that solid cylindrical studs 43 a , 43 b are obtained . fig6 shows a fifth example embodiment of the invention for a flange joint 50 between a first housing component 51 and a second housing component 52 , between which a separate insert 53 is clamped . the first housing component 51 has a recess in the form of a bore 51 a leading into a threaded bore 51 b which is a threaded blind bore . the insert 53 has a projection 53 a in the form of a raised collar or perforation , which engages with interlock in the bore 51 a . the second housing component 52 has a through - going bore 52 a aligned coaxially with the threaded bore 51 b and the raised collar 53 a , through which a screw - bolt 54 passes . by virtue of the screw - bolt 54 , of which a plurality can be distributed around the circumference of the two housing components , the two housing components are clamped and held together by friction force . in this example embodiment the raised collar or perforation 53 a of the insert 53 has a dual function : on the one hand it acts as an interlock element between the two housing components 51 , 52 ( additional projections as in the previous example embodiments can in this case be omitted ), and on the other hand the perforation 53 a provides a through - passage for the screw - bolt 54 . fig7 shows a section along the plane 7 - 7 in fig6 . the insert 53 is coated on both sides with a sealant 55 , which can be vulcanized to form an elastomer layer on both sides of the insert 53 . to improve the sealing action the insert 53 has bumps or bead - like elevations 53 b , 53 c on both sides . thus , between the housing components 51 , 52 there in formed a joint which is both interlocked and sealed . | 8 |
referring now to fig1 therein is shown the patient , or the person under examination , p , recumbent on the bed 10 comprising a recording mattress 11 and thereupon , most properly a foamed plastic mattress 28 . the patient has normal bedclothes and clothing . the recording mattress 11 comprises two metal plates 12a and 12b of the same size and shape , or equivalent metal nets , rods or gratings , and which serve as antennas . between the metal plates 12a and 12b lies an insulating plate 13 , which serves as insulation between the antenna plates 12a and 12b as well as their mechanical support so that the antenna plates 12a and 12b can be made in the form of comparatively thin films affixed on the surface of the insulating board 13 . the metal plates 12a and 12b have been connected by a shielded lead 14 to a pre - amplifier 17 , which is for instance a conventional differential amplifier of the kind used in ecg techniques , characterized by a high input impedance . as shown in fig1 the differential amplifier 17 has been connected by a shielded cable to the monitoring and recording means 19 . even the smallest movement of the patient p lying on the bed 10 , for instance the adduction of one finger , will cause in the clothing of the patient p , or of the person under monitoring or examination , in the bedclothes and / or in the active layer 29 of the mattress , quantitative and local changes of static charges , which generate potential differences between the antenna plates 12a and 12b , which plates have been placed as close as possible to the patient or to the active layer 29 in view of accomplishing the closest possible coupling between the antenna means 12 and the sources which produce the said change of charges . in the embodiment presented , the active layer 29 consists of two juxtaposed , insulating materials 29a and 29b with different dielectric constants . suitable materials are for instance plastics having mutually different dielectric constants . it is also a characteristic feature of the construction of the active layer 29 : that its courses are able to move with reference to each other , however maintaining their contact . the movement takes place so that the points of contact between the materials change . to this purpose , in the embodiment presented , the layer 29a consists of blister plastic , its air - filled blisters constituting &# 34 ; anti - friction elements &# 34 ; by virtue of which the courses 29a and 29b can move lightly with reference to each other . under the active layer 29 are located the above - described antenna means 12 for measurement of the charge distribution in the active layer . furthermore , the active layer 29 and the antenna means 12 have been inserted in a shield 30 consisting of conductive , flexible material and which is connected to the ground of the measuring amplifier 17 . in practice , the shield 30 may be made of a bag of plastic film metallized on the outside . since the antenna equipment 12 as well may be made of plastic film 13 of which the opposite faces have been provided with metallic films 12a and 12b , the recording mattress can be made thin and foldable . the mode of operation of the recording mattress above described is as follows . the body movements of the patient p are transmitted through the foamed plastic mattress 28 to the active layer 29 , where the materials 29a and 29b of different dielectric , insulating substances are set in motion with reference to each other so that their points of contact vary by effect of the movement . it is well known that this results in the generation of electrical superficial charges of different signs on said material courses 29a and 29b . these superficial charges constitute electrical dipoles , of which the electric fields are transmitted to the antenna means 12 , the signal therefrom obtained being recorded with the aid of the amplifier 17 . the recorded signal conforms to the patient &# 39 ; s movements because the orientation and number of dipoles , and consequently also their fields , vary under effect of the movement . on the other hand , the metallic surfaces of the shield 30 and the antenna plates 12a and 12b form between themselves capacitors , and since the active layer 29 consists of a resilient material , the capacitance of the metal plates on either side thereof will vary , and this causes changes of voltage in the statically charged capacitors . based hereon , the recording mattress of the invention may also be constructed as follows ( fig1 b ). the antenna means 12a , 12b have been so disposed that upon them is an active layer 29 , and these have been placed in a continuous shield 30 which is internally electrically insulating but has been coated with a conductive substance . the active layer 29 is an insulating layer fitting the purpose . the structure will then operate as follows . the antenna means consist , as has been described above , of two mutually insulated , conductive material courses 12a and 12b , which together form a capacitance c . the conductive shield 30 then forms a capacitance c2 with the course 12b and the capacitance c1 with the course 12a . the capacitances c2 and c1 differ in magnitude and , moreover , due to the construction so that c2 is far greater than c1 . upon this structure the foamed plastic mattress 28 is placed , on which the experimental subject p lies down . the subject &# 39 ; s movements are transmitted through the foamed plastic 28 into the arrangement thereinunder so that , first of all , c1 changes because the layer 29 consists of a highly resilient material . with an active layer 29 as shown in fig1 a , the distance of the charged courses from the antenna means 12 and from the bag 30 serving as shield will also change . in addition , the movement gives rise to static charges in the active layer , and to local changes in them . in the case of fig1 b , the capacitance c1 may also be charged by means of an external voltage source , or one may for the insulator 29 use a substance on which the charges have been permanently imposed . by effect of the factors enumerated above , the voltage across the capacitor c1 changes in the first place , and these changes are transmitted to the antenna means and to the capacitor c constituted by them . by the aid of the construction described , the following advantages are gained , among others . the plates 12a and 12b acting as antenna means and which become coupled to the input terminals of the amplifier are symmetrical with reference to external interference fields but they are asymmetric regarding the changes of charge taking place in the active layer 29 . the bag 30 serving as shield transmits the changes of the charge field induced by the movements , to the antenna plates , acting at the same time as an efficient shielding against external interference fields . this protective bag 30 is connected to the ground terminal , or to a potential &# 34 ; guard &# 34 ; terminal , of the measuring amplifier 17 . in fig2 is shown a hospital monitoring and control system applying the means of the invention . this system comprises the patient room 20 , where beds 10a , 10b , 10c etc . provided with antennas of the kind described have been placed , their antennas being connected by cable to the pre - amplifiers 17a , 17b , 17c etc ., and these in turn by shielded cables 18a , 18b , 18c to the monitoring and recording equipment 19 . since it is frequently unavoidable that the patient room 20 is quite far away from the control room 27 , a special electric transmission system must be used between these rooms , wherein modulation is employed and , for instance , the time sharing principle . such systems are known in the art in themselves and their closer description shall therefore be omitted . fig2 displays , of components belonging to this system : a line driver 21 , multiplex 22 , and line receiver 23 . the signals derived from the receiver 23 are conducted to a signal processing means 24 with among other things , a 50 hertz tank circuit and adjustable band pass , which is selected suitably for each particular application ; for instance , in respiration monitoring the band is in the range from 0 . 2 to 3 hz , for the movement pick - up in the night - time it is 0 . 5 to 100 hz . the signal processing circuit may perform , for instance , a frequency analysis of the incoming signal . after the signal processing circuit 24 , the signals are carried to the monitor or recorder 25 , both of which are devices known in themselves in the art . one may use , for monitor 25 : an oscilloscope , conventional recorders , e . g . an ecg recorder . with the monitor 25 has been connected an alarm device 26 , which actuates an alarm for instance in case the patient &# 39 ; s respiration or heart movements stop completely , or if these movements display a remarkable deviation from normal . the alarm device 26 is preferably arranged to be triggered by the signal amplitude e . g . when the respiration amplitude falls below a given limit or the ballistographic undulation falls below a given limit or drops out . triggering of the alarm device is , for instance , on the basis of the pulse display triggered by the ballistographic undulation when this pulse falls below a predetermined limit . fig3 displays three different signals recorded by the method of the invention . the recording a is the unfiltered scsb signal according to the invention , and the figure b presents the same signal after its conduction through a low pass or band pass filter , for instance a filter having its band in the range from 0 . 2 to 3 hz . hereby the undulation caused by the respiratory movements will show up with emphasis in the record . the record reproduced in fig3 c illustrates the principle of ballistographic triggering . in connection with the recording function , a given voltage level l has been set , by default of which the triggering events t1 , t2 , t3 etc . are obtained . the number of such triggerings per unit time is a measure e . g . for the heart rate , and when this quantity falls below a pre - set limit , triggering of the alarm device 26 ensues . the record c in fig3 illustrates the above - described principle of ballistographic triggering in its application in the method of the invention . in fig4 has been illustrated a ballistograph ( record b ) of the invention together with a simultaneous recording ( record a ) obtained with the ecg lead i of prior art . in fig5 have been reproduced several records produced by various movements of the patient p . the record a represents the completely motionless state , whereby the periodic fluctuations visible in this record reflect the vibrations caused by the patient &# 39 ; s heartbeat and breathing . the record a1 duplicates the record a on a larger scale . the record b represents the record produced by the index finger , c that produced by movement of the wrist , d of the ankle , e of the head , f by the patient turning about , g by movement of all fingers , h by shoulder movement , i by movement of the knee , j by isometric contraction , and k by speech . in the following , the claims are stated , and various details of the invention may vary within the scope of the inventive idea thereby defined . | 0 |
referring to fig1 a , 1b and 2a , removable hinge 100 comprises hinge cup 102 pivotally connected to attachment mechanism 104 by hinge arm 106 . typically , hinge cup 102 is affixed to cabinet door 103 with screws through mounting holes 107 . attachment mechanism 104 is removably attached to cabinet carcass 105 as will be described below . removable hinge 100 is repositionable between a โ locked โ position to cabinet carcass 105 and an โ unlocked โ position . in the locked position , the attachment mechanism is securely affixed to the cabinet carcass . in the unlocked position , the attachment mechanism can be removed from attachment to the cabinet carcass . in a preferred embodiment , the components of removable hinge 100 are typically constructed of metal such as cast aluminum or steel alloy plate stock . attachment mechanism 104 comprises base 110 , dog 112 , pressure plate 114 , lever 116 , and opposing links 118 and 119 . base 110 is attached to cabinet carcass 105 at faces 111 and 113 . base 110 is slidably engaged with dog 112 . thumbscrew 120 is threaded into dog 112 at hole 166 . thumbscrew 120 includes shoulder 121 which abuts washer 101 . the thumbscrew also includes end rivet 131 . end rivet 131 fits into mounting hole 176 in pressure plate 114 and is secured by peening during manufacture . pressure plate 114 includes stanchions 174 and 175 which fit into guide holes 164 and 165 . the clearance level between the stanchions and the guide holes is about 1 / 16 โณ and should allow for axial movement of the stanchions without binding . lever 116 is pivotally attached to base 110 with pins 126 and 127 . lever 116 is pivotally attached to links 118 and 119 with pins 122 and 123 . links 118 and 119 are pivotally attached to dog 112 with pins 124 and 125 . referring to fig2 a , 2b , and 2c , the horizontal , vertical , and lateral adjustment mechanisms will be described . adjustment plate 200 includes positioning extensions 204 and 226 . positioning extension 204 abuts slot 146 in base 110 . positioning extension 226 abuts slot 145 in base 110 . adjustment plate 200 includes pivot hole 241 and follower hole 244 . adjustment plate 200 also includes alignment slot 202 which is positioned between positioning extensions 226 . alignment slot 202 is open on one end and includes retaining shoulder 227 . the top surface of adjustment plate 200 also includes guide slot 248 . hinge arm 106 is generally sized to fit over and retain adjustment plate 200 . hinge arm 106 includes sides 229 and 231 which extend over adjustment plate 200 . guide rail 246 is sized to fit within guide slot 248 of adjustment plate 200 . hinge arm 106 includes threaded hole 228 for receipt of the threads of lateral adjustment screw b . hinge arm 106 includes generally square access hole 240 and oblong follower hole 242 . hinge arm 106 also includes step down 245 which is designed to engage guide shelf 243 of adjustment plate 200 . hinge arm 106 includes extension arm 254 . extension arm 254 is manufactured to include pivot hole 260 . pivot hole 260 is designed to engage pin 250 of hinge cup 102 . extension arm 254 includes cam surfaces 256 and 258 . cam surfaces 256 and 258 are sized to engage spring arms 264 and 266 of bias spring 262 . lateral adjustment screw b is threaded through threaded hole 228 of the hinge arm . head 230 of the adjustment screw fits within alignment slot 202 and engages retaining shoulder 227 . engagement of head 230 and retaining shoulder 227 restrains relative vertical movement between hinge arm 106 and adjustment plate 200 , but allows horizontal movement between the two components . vertical adjustment cam a is sized to fit through follower hole 244 and engage pivot hole 142 in base 110 . cam shoulder 232 engages the interior surface of follower hole 244 . offset cam extension 234 is sized to fit within pivot hole 142 while allowing free rotation between the two . during manufacture , offset cam extension 234 is peened after insertion into pivot hole 142 to prevent extraction . offset cam extension 234 is intentionally located flush with an edge of cam shoulder 232 . horizontal adjustment cam c includes cam shoulder 236 . cam shoulder 236 is sized to fit within follower hole 242 . horizontal adjustment cam c includes offset cam extension 238 . offset cam extension 238 is sized to fit within pivot hole 241 to allow free rotation . during manufacture offset cam extension 238 is peened after insertion into pivot hole 241 to prevent extraction . offset cam extension 238 is intentionally located flush with an edge of cam shoulder 236 . in use , lateral adjustment screw b is rotated whereby retaining head 230 moves retaining shoulder 227 and results in lateral movement , in direction 206 , of hinge arm 106 relative to adjustment plate 200 . vertical adjustment cam a is rotated in access hole 240 , which results in cam shoulder 232 engaging follower hole 244 . follower hole 244 and adjustment plate 200 are moved vertically , sliding positioning extensions 226 and 204 vertically within slots 145 and 146 of base 110 . the positioning extensions prevent angular movement of adjustment plate 200 and hinge arm 106 with respect to base 110 . adjustment plate 200 abuts sides 229 and 231 thereby moving hinge arm 106 with adjustment plate 200 vertically with respect to base 110 , in direction 208 . horizontal adjustment cam c is rotated whereby offset cam extension 238 rotates in pivot hole 241 . cam shoulder 236 engages follower hole 242 , thereby moving hinge arm 106 horizontally with respect to adjustment plate 200 in direction 210 . alignment slot 202 allows retaining head 230 to also move horizontally with respect to adjustment plate 200 . sides 229 and 231 prevent rotational movement of hinge arm 106 with respect to adjustment plate 200 . referring to fig1 a , 2b , and 2c , the connection of hinge cup 102 to hinge arm 106 will be described . hinge cup 102 comprises cup body 263 including coil indentions 268 and 270 . hinge cup 102 includes mounting tabs 259 and 261 . mounting tabs 259 and 261 include mounting holes 107 for securing the hinge cup to a cabinet door . hinge cup 102 includes through hole 252 in which is positioned pin 250 . pin 250 also engages pivot hole 260 and retains extension arm 254 in the hinge cup . coil indentions 268 and 270 form a housing for bias spring 262 . bias spring 262 includes spring arms 264 and 266 . spring arms 264 and 266 engage cam surfaces 256 and 258 respectively . the spring arms provide a greater bias to the cam surfaces when the hinge is in a closed position than they do when the hinge is in open position . referring to fig3 a and 3b , base 110 includes flanges 132 and 133 which extend at right angles from bridge 130 . bridge 130 includes a centrally located pivot hole 142 sized to engage adjustment cam a . a set of extensions 129 and 134 extend from bridge 130 opposite flanges 132 and 133 . extension 129 includes pivot hole 128 . extension 134 includes pivot hole 135 . pivot hole 135 is sized to engage pin 127 . pivot hole 128 is sized to engage pin 126 . rails 136 and 149 extend from opposite edges of bridge 130 . rail 136 includes tab 138 and slot 140 . rail 149 includes tab 148 and slot 141 . slot 145 is positioned between flanges 132 and 133 along an edge of bridge 130 . slot 146 is a generally rectangular shaped cut - out in bridge 130 . as shown in fig2 a and 4 , dog 112 is comprised of transverse portion 150 and jaw portion 152 . jaw portion 152 includes guide holes 164 and threaded hole 166 . threaded hole 166 is sized to engage the thumbscrew . extending from transverse portion 150 are arms 154 and 155 . arm 154 includes slot 160 , tab 162 , and extension 156 . extension 156 includes pivot hole 158 . pivot hole 158 is sized to engage pin 124 . arm 154 is slidably engaged with rail 149 . slot 160 is sized to slidably engage tab 148 . tab 162 is sized to slidably engage slot 141 . arm 155 includes slot 161 , tab 163 and extension 159 . extension 159 includes pivot hole 157 . pivot hole 157 is sized to engage pin 125 . arm 155 and is slidably engaged with rail 136 . slot 161 is sized to slidably engage tab 138 . tab 163 is sized to slidably engage slot 140 . referring to fig2 a and 5 , pressure plate 114 is shown . pressure plate 114 is generally rectangular and comprises face 170 and includes stanchions 174 and 175 extending from opposite sides . stanchions 174 and 175 are sized to slidably engage guide holes 164 and 165 . pressure plate 114 further includes hole 176 . thumbscrew 120 engages hole 176 such that thumbscrew 120 is free to rotate with respect to pressure plate 114 while shoulder 121 abuts washer 101 adjacent pressure plate 114 . face 170 includes a recess space surrounding hole 168 to allow attachment of the thumbscrew to the pressure plate without the thumbscrew extending beyond the plane of face 170 . face 170 further includes opposing triangular cleats 172 . in a preferred embodiment , cleats 172 are integrally formed with face 170 . in an alternate embodiment , cleats 172 are comprised of flexible plastic or rubber materials and are affixed to face 170 with a suitable adhesive . in another embodiment , the face includes a knurled surface . as shown in fig2 a and 6 , lever 116 comprises arms 182 and 183 extending from bridge 180 . arm 182 includes pivot hole 184 and pivot hole 186 . arm 183 includes pivot hole 185 and pivot hole 187 . pivot holes 184 and 185 are aligned with and sized to engage pins 126 and 127 , respectively . pivot holes 186 and 187 are aligned with and sized to engage pins 122 and 123 , respectively . lever 116 is pivotally connected to base 110 by pin 126 through pivot holes 184 and 128 and by pin 127 through pivot holes 185 and 135 . referring to fig4 and 7a , link 118 is shown . link 118 comprises body 190 integrally formed with standoff 192 . standoff 192 is generally cylindrical and includes a centrally positioned pivot hole 194 . pivot hole 194 is sized to engage pin 122 . body 190 includes pivot hole 196 . pivot hole 196 is sized to engage pin 124 . body 190 forms stop surface 198 . lever 116 is pivotally connected to link 118 by pin 122 through pivot holes 194 and 186 . link 118 is pivotally connected to dog 112 by pin 124 through pivot holes 196 and 158 . referring to fig4 and 7b , link 119 is shown . link 119 comprises body 191 integrally formed with standoff 193 . standoff 193 is generally cylindrical and includes a centrally positioned pivot hole 195 . pivot hole 195 is sized to engage pin 123 . body 191 includes pivot hole 197 . pivot hole 197 is sized to engage pin 125 . body 191 forms stop surface 199 . lever 116 is pivotally connected to link 119 by pin 123 through pivot holes 195 and 187 . link 119 is pivotally connected to dog 112 by pin 125 through pivot holes 197 and 157 . referring to fig8 a , 8b , and 8c , the preferred method of installing the hinge to the cabinet carcass will be described . fig8 a and 8b show the hinge in an unlocked position . to install removable hinge 100 , base 110 is positioned adjacent face 111 of cabinet carcass 105 . flanges 132 are positioned adjacent face 113 of cabinet carcass 105 . thumbscrew 120 is rotated and advances in direction 201 through threaded hole 166 thereby urging pressure plate 114 towards cabinet carcass 105 and away from jaw portion 152 . stanchions 174 and 175 similarly advance through guide holes 164 and 165 . thumbscrew 120 is advanced until cleats 172 abut face 115 of cabinet carcass 105 . lever 116 is pivoted in direction 200 toward base 110 . as the lever pivots , links 118 and 119 pivot with respect to the lever and dog 112 thereby forcing dog 112 towards cabinet carcass 105 . arms 154 and 155 slide on rails 136 and 139 , while tabs 138 and 148 engage slots 161 and 160 and tabs 163 and 162 engage slots 140 and 141 . the engagement prevents torsional rotation of dog 112 relative to base 110 . the lever in conjunction with the dog and links form a classic mechanical toggle which amplifies the compressive force applied to the pressure plate . as a result , cleats 172 are driven into face 115 , clamping attachment mechanism 104 to cabinet carcass 105 in a locked position . once in the locked position , minor vertical , horizontal , and lateral adjustments are made by rotating vertical adjustment cam a , horizontal adjustment cam c , and lateral adjustment screw b . to release the hinge from the cabinet carcass , lever 116 is pivoted away from base 110 , thereby urging dog 112 away from cabinet carcass 105 . thumbscrew 120 is reversed in threaded hole 166 causing cleats 172 to disengage from face 115 . as a result , the hinge can be removed completely or quickly adjusted to an alternate location . as lever 116 is moved away from base 110 , the stop surfaces provide a stop which abuts dog 112 and restricts rotational movement of the lever to prevent damage . it will be appreciated by those skilled in the art that modifications can be made to the embodiments disclosed and remain within the inventive concept . therefore , this invention is not limited to the specific embodiments disclosed , but is intended to cover changes within the scope and spirit of the claims . | 5 |
fig1 shows a top perspective view of disc drive 12 , which includes voice coil motor ( vcm ) 13 , actuator arm 14 , suspension 16 , flexure 18 , slider 20 , head mounting block 22 , and disc or media 24 . slider 20 is connected to the distal end of suspension 16 by flexure 18 . suspension 16 is connected to actuator arm 14 at head mounting block 22 . actuator arm 14 is coupled to vcm 13 . as shown on the right side of fig1 , disc 24 has a multiplicity of tracks 26 and rotates about axis 28 . during operation of disc drive 12 , rotation of disc 24 generates air movement which is encountered by slider 20 . this air movement acts to keep slider 20 aloft a small distance above the surface of disc 24 , allowing slider 20 to fly above the surface of disc 24 . vcm 13 is selectively operated to move actuator arm 14 around axis 30 , thereby moving suspension 16 and positioning the transducing head ( not shown ) carried by slider 20 over tracks 26 of disc 24 . proper positioning of the transducing head is necessary for reading and writing data on concentric tracks 26 of disc 24 . fig2 is a cross - sectional view of an embodiment of a magnetic writer 36 of the present invention . medium 24 for recording comprises thin storage layer 32 having high coercivity and perpendicular anisotropy ( the magnetization is held in a direction substantially normal to the surface of medium 24 ) and soft magnetic underlayer or keeper 34 having high permeability and in - plane orientation of the easy axis . in an exemplary embodiment , writer 36 comprises main pole 38 and return pole 40 , connected to each other by back gap closure 42 at a distal end and separated from each other by write gap 46 at the abs . at least one write coil 44 positioned proximate main pole 38 conducts current around main pole 38 , thereby intermittently inducing a magnetic field in main pole 38 . transducer main pole 38 serves as a trailing pole for the given direction of motion 47 of medium 24 . magnetization transitions on medium 24 are recorded by trailing edge 49 of main pole 38 . main pole 38 includes laminated main pole tip 45 partially embedded in yoke 48 . main pole 38 includes a first end including main pole tip 45 and a second , opposite end . in one embodiment , the first end of main pole 38 defines a plane at the air bearing surface . yoke 48 has a first end , a second end , and four sides ( see fig3 ). in the illustrated embodiment , main pole tip 45 is attached to the first end of yoke 48 . however , main pole tip 45 could also be attached to any of the four sides of yoke 48 . in an exemplary embodiment , magnetic layer 50 , shown here as the top layer of main pole tip 45 , contains trailing edge 49 . generally , the abs surface of main pole tip 45 is also an external surface of the transducer . in an exemplary embodiment , main pole tip 45 has a submicron width at the abs , to provide recording of ultra - narrow tracks on medium 24 . in an exemplary embodiment , main pole 38 is at least partially embedded in yoke 48 . the portions of yoke 48 surrounding main pole tip 45 help to direct the magnetic flux from relatively wide yoke 48 to relatively narrow pole tip 45 . the proposed structure of main pole tip 45 increases the uniaxial anisotropy of magnetic layers 50 and 54 , thereby rendering main pole 38 more magnetically stable . lamination of only pole tip 45 of main pole 38 may lead to savings in production costs and materials as well as an efficient writer 36 . flux easily travels through the bulk magnetic material of yoke 48 without disruption from lamination interfaces in the length of yoke 48 . to write data to perpendicular magnetic medium 24 , a time - varying write current is caused to flow through coil 44 , which in turn produces a time - varying magnetic field through main pole tip 45 and return pole 40 . medium 24 is then passed by the abs of writer 36 at a predetermined distance such that medium 24 is exposed to the magnetic field . with perpendicular writer 36 , the soft magnetic keeper 34 of magnetic medium 24 in essence acts as a third pole of the writer . a closed path for magnetic flux from writer 36 to medium 24 travels from main pole 38 through storage layer 32 of medium 24 to soft magnetic keeper 34 and returns to writer 36 through return pole 40 , again passing through storage layer 32 . to ensure that the magnetic field does not write data on this return path , the surface area of return pole 40 at the abs is preferably substantially larger than the surface area of main pole tip 45 at the abs . thus , the strength of the magnetic field affecting storage layer 32 under return pole 40 will not be sufficient to overcome a nucleation field of storage layer 32 . in a preferred embodiment , the thickness of main pole tip 45 is between about 0 . 05 and about 1 micrometer . the total cross - sectional area at the abs of return pole 40 is preferably greater than 10 times and more preferably greater than 100 times the total cross - sectional area of all the magnetic layers of main pole tip 45 . in an exemplary embodiment , main pole tip 45 has a multilayer structure . further , in one embodiment , main pole tip 45 is partially embedded in yoke 48 . multilayer main pole tip 45 preferably comprises magnetic layer 50 ; non - magnetic spacer layer 52 ; and magnetic layer 54 ( shown here as an underlayer ). this multilayer pole structure induces anisotropy in both magnetic layers 50 and 54 parallel to the external surface or abs , thereby enhancing the magnetic stability of main pole tip 45 while suppressing on - track erasure and increasing switching speed and ultimately increasing the data recording rate and reliability . when top magnetic layer 50 is coupled with magnetic underlayer 54 across non - magnetic layer 52 according to the present invention , the properties of the coupled multilayer system improve the performance of main pole tip 45 compared with a main pole tip made of a single layer of high magnetic moment material . while the layers of main pole tip 45 are illustrated as planar layers , it is contemplated that they may follow other contours . additionally , the illustrations are not rendered to scale . any suitable ferromagnetic materials may be used for magnetic layer 50 and magnetic underlayer 54 . the materials for each layer may be the same or they may be different . the materials are preferably magnetically soft , with a preferred coercivity less than about 5 oersted and more preferably less than about 1 oersted . the chosen materials preferably have well defined magnetic anisotropy , meaning that they have a stable orientation of the easy axis of magnetization parallel to the abs . in a preferred embodiment , magnetic layers 50 and 54 are made of cofe , conife , fecon , conifen , fealn , fetan , fen , nife ( e . g . ni 80 fe 20 , ni 45 fe 55 , etc . ), nifecr , nifen , cozr , cozrnb , fealsi , a permalloy , cozrta or another suitable material . magnetic layers 50 and 54 can be of any suitable thickness for use in writer 36 ; they are preferably each between about 0 . 01 and about 1 micrometer thick , and more preferably between about 0 . 1 to about 0 . 5 micrometer thick . non - magnetic spacer 52 may be composed of any non - magnetic material which is mechanically and chemically compatible with the magnetic materials used for top magnetic layer 50 and magnetic underlayer 54 . in an exemplary embodiment , non - magnetic spacer 52 between top magnetic layer 50 and magnetic underlayer 54 results in formation of an antiferromagnetic ( afm ) exchange coupling between top magnetic layer 50 and magnetic underlayer 54 . this coupling reinforces the anisotropy of top magnetic layer 50 and magnetic underlayer 54 oriented parallel to the abs , resulting in a more stable main pole tip 45 due to a reduction in magnetic energy of the parallel state . according to the rkky ( ruderman - kittel - kasuya - yosida ) interaction , non - magnetic spacer 52 composed of some materials induces a periodic coupling between top magnetic layer 50 and magnetic underlayer 54 . the coupling alternates characteristics between antiferromagnetic and ferromagnetic as a function of the thickness of non - magnetic spacer 52 and depends upon the crystallographic orientation of the material of non - magnetic spacer 52 . suitable non - magnetic materials for non - magnetic spacer 52 include , for example , copper , ruthenium , gold , tantalum , aluminum , rhodium , chromium , copper - silver alloys , nitride , carbide and various oxides , including aluminum oxide and silicon dioxide . preferred non - magnetic materials are those which provide for antiferromagnetic exchange coupling between the adjacent magnetic layers , such as copper , ruthenium , gold , rhodium , chromium , and copper - silver alloys . in a preferred embodiment , the thickness of non - magnetic spacer 52 is chosen to induce an antiferromagnetic coupling between top magnetic layer 50 and magnetic underlayer 54 . if the thickness in the proximity corresponding to the first antiferromagnetic peak results in a non - magnetic spacer which is too thin to be practical , then the thickness of non - magnetic spacer 52 in the proximity corresponding to the next antiferromagnetic peak can be used , and so on . in one embodiment , cu or ru spacer 52 has a thickness of about 1 to about 200 angstroms ( รฅ ), more preferably a thickness of about 3 to about 30 รฅ , and most preferably a thickness of about 6 to about 25 รฅ . any suitable material may be used for yoke 48 , which is used in one embodiment to increase efficiency of writer 36 , as well as enhance the anisotropy and structural and magnetic integrity of multilayer main pole tip 45 . a length of main pole tip 45 is preferably about 0 . 02 to about 4 . 0 micrometers . thus , yoke 48 is preferably recessed from the abs by a distance of about 0 . 02 to about 4 . 0 micrometers so that yoke 48 does not contribute to an increased track width of main pole tip 45 at the abs . a narrow track width of main pole tip 45 at the abs allows for high track density recording and a narrow thickness of main pole tip 45 reduces skew - related side writing effects . in one embodiment , a length of yoke 48 is preferably about 8 to about 50 times the length of main pole tip 45 . in one embodiment , yoke 48 is made of a magnetic material such as conife , fecon , conifen , fealn , fetan , fen , nife ( e . g . ni 80 fe 20 , ni 45 fe 55 , etc . ), nifecr , nifen , cozr , cozrnb , cozrta , fealsi , or other suitable materials . the chosen material preferably has well defined magnetic anisotropy , meaning that it has well defined easy and hard magnetic axes . the material is preferably magnetically soft , with a preferred coercivity less than about 5 oersted and more preferably less than about 1 oersted . yoke 48 preferably has a relatively large magnetic permeability more than about 500 , and more preferably more than about 1000 . in an exemplary embodiment , the portions of yoke 48 surrounding main pole tip 45 are shown as tapered wedges ; however , they can also embody other configurations , such as graduated layers , for example . additionally , while portions of yoke 48 are illustrated as being positioned above and below main pole tip 45 , they can also be disposed on either side of main pole tip 45 in a case where yoke 48 is wider than main pole tip 45 in a lateral dimension . any suitable magnetic material may be used for back gap closure 42 . in a preferred embodiment , back gap closure 42 is constructed of a soft magnetic material such as conife , nife , ni 80 fe 20 , ni 45 fe 55 , nifecr , cozr , fen , fealsi , or other suitable materials . fig3 is a partial perspective view of an embodiment of a main pole of the present invention , viewed from a bottom of the pole tip . main pole 38 includes main pole tip 45 partially embedded in yoke 48 . main pole tip 45 is preferably centered on yoke 48 to most efficiently conduct the flux flowing from yoke 48 and through pole tip 45 . main pole tip 45 of the present invention has first magnetic layer 50 with a first magnetic moment orientation and second magnetic layer 54 with a second magnetic moment orientation . while the terms โ first โ and โ second โ are used for discussion purposes , it is to be understood that the order of the layers may be reversed or otherwise altered . in an exemplary embodiment of main pole tip 45 , the magnetic moment orientations or anisotropies of magnetic layers of 50 and 54 are fixed in a direction parallel to the bottom or external surface of the pole tip when the write current is off , thereby reducing unwanted erasure by reducing the remanent magnetization . this directional bias can be accomplished by means including but not limited to the choices of materials for the magnetic and non - magnetic layers , the thicknesses of the magnetic and non - magnetic layers , the application of stress or magnetostriction , the directional deposition of the materials of the magnetic and non - magnetic layers with low glancing angles , and the use of antiferromagnets or permanent magnets . by orienting the moments of magnetic layers 50 and 54 in a direction parallel to the abs , for example , residual magnetization and the remanence charge left on the tip 45 of main pole 38 of perpendicular writer 36 are minimized when the writing current is off . in one exemplary embodiment , the material of magnetic layer 50 , which is proximate trailing edge 49 , is made of a material with a higher saturation magnetic moment than the material of magnetic underlayer 54 . because the strength of the write field in the media is proportional to the magnetic moment of the main pole material , it is desirable to use a material with a high magnetic moment ( or high flux density saturation ) for construction of main pole tip 45 for ultra high track density recording . when the magnetic moment of the main pole material is increased , a track width and thickness of the main pole tip can be reduced for increasing the storage capacity of the disc drive while reducing skew - related effects . in an exemplary embodiment , magnetic layers 50 and 54 are antiferromagnetically exchanged coupled through nonmagnetic layer 52 . the antiferromagnetic coupling of the high magnetic moment material of top magnetic layer 50 by lower magnetic moment material 54 leads to greater overall stability in main pole tip 45 while retaining the high writability and high data rate advantages of using the high magnetic moment material . fig4 is a partial perspective view of another embodiment of a main pole tip of the present invention . in the illustrated embodiment of main pole tip 45 having trailing edge 49 , anisotropy in magnetic layers 50 and 54 parallel to the plane of the abs is induced by antiferromagnetic pinning layer or anisotropy inducing magnetic layer 62 contacting magnetic layer 50 . magnetic layer 62 induces the magnetic moment orientations of magnetic layers 50 and 54 into orientations substantially parallel to the abs in the absence of a write current . anisotropy inducing layer 62 is composed of an antiferromagnet or permanent magnet , for example . examples of suitable antiferromagnets include cr , nio , mno , irmn , ptmn , nimn , irmnx , ptmnx , and nimnx ; where x represents a third element . examples of suitable permanent magnets include co ; cocr ; copt ; cocrpt ; mfe 2 o 4 , where m represents any one of several metallic elements ; fe 3 o 4 ; ab 12 o 19 , where a is a divalent metal such as ba , sr , or pb , and b is a trivalent metal such as al , ga , cr or fe ; and m 3 fe 5 o 12 , where m is a rare earth ion such as sm , eu , gd or y . fig5 is a partial perspective view of another embodiment of a main pole tip of the present invention . in the illustrated embodiment of main pole tip 45 , anisotropy inducing layers 62 are disposed adjacent to the magnetic layer 50 and magnetic layer 54 . this configuration is useful where stronger pinning coupling is desirable to induce the orientations of the magnetic moments of magnetic layers 50 and 54 into directions parallel to the abs . fig6 is a partial perspective view of another embodiment of a main pole tip of the present invention . in this embodiment , anisotropy inducing layers 62 are disposed on one or both sides of main pole 38 , spaced apart from main pole tip 45 , but in close proximity so that the magnetic fields of anisotropy inducing layers 62 act upon magnetic layers 50 and 54 in the absence of a write current . those skilled in the art will appreciate that anisotropy inducing layers 62 could be disposed above or below main pole 38 . in these embodiments , a distance between main pole tip 45 and each layer 62 is between about 10 nm and about 80 nm . these configurations are especially useful when it is desirable to keep the surface area of pole tip 45 as small as possible for increasing efficiency and reducing skew - related effects . in an exemplary embodiment , a cross sectional area of main pole tip 45 at the abs is less than about 10 , 000 nm 2 . the anisotropy inducing layers 62 switch the direction of the magnetic moments in main pole tip 45 into directions parallel to the abs after the writing current is switched off , thereby decreasing or eliminating on - track erasure . in one embodiment , the longitudial biasing field provided by the biasing layers 62 is between about 5 oe and about 2000 oe , which is generally larger than the coercivity of the materials of writer 36 and generally smaller than the perpendicular field generated by coils 44 , resulting in a decrease in on - track erasure while resulting in minimal interference with the recording process . fig7 is a partial perspective view of another embodiment of a main pole tip of the present invention . main pole tip 45 of fig7 is similar to main pole tip 45 of fig3 , except that the embodiment illustrated in fig7 includes additional magnetic layers 66 , 70 , 74 and 78 and additional non - magnetic layers 64 , 68 , 72 and 76 . in the illustrated embodiment , each magnetic layer 50 , 54 , 66 , 70 , 74 and 78 is antiferromagnetically coupled to an adjacent magnetic layer so that the moments of adjacent layers align anti - parallel to each other . in one exemplary embodiment , a magnetic moment gradient from trailing edge 49 is created by disposing magnetic layers of higher moment closer to trailing edge 49 and lower moment layers further away from trailing edge 49 . while the multilayer structure of fig7 leads to better performance uniformity than the structure of fig3 , due to the stronger overall levels of coupling between the magnetic layers 50 , 54 , 66 , 70 , 74 and 78 , a large magnetic field is needed to saturate main pole 38 during the writing process . in order to make it easier to saturate main pole 38 , different materials can be chosen for non - magnetic layers 52 , 64 , 68 , 72 and 76 to selectively determine the strength of coupling between the magnetic layers in one embodiment . for example , a conductive material such as a transition metal such as copper , ruthenium , gold , rhodium , or chromium , for example , can be used in non - magnetic layers 52 , 68 and 76 to promote a relatively strong anti - parallel exchange coupling between magnetic layers 52 and 54 , between magnetic layers 66 and 70 , and between magnetic layers 74 and 78 . other non - magnetic materials , including transition metals of certain thicknesses , will cause only a weak antiferromagnetic exchange coupling between the two magnetic layers on either side of the non - magnetic layer . for example , an electrically insulating material such as tantalum , aluminum oxide , nitride , carbide , or silicon dioxide , for example , can be used for non - magnetic layers 64 and 72 to separate the sets of strongly coupled magnetic layers . in another example , ru with a thickness of about 5 รฅ to about 10 รฅ is used in non - magnetic layers 52 , 68 and 76 to promote a relatively strong anti - parallel exchange coupling between magnetic layers 52 and 54 , between magnetic layers 66 and 70 , and between magnetic layers 74 and 78 . ru with a thickness of about 12 รฅ to about 18 รฅ , which causes only a weak antiferromagnetic exchange coupling between the two magnetic layers on either side of the non - magnetic layer , is used in non - magnetic layers 64 and 72 to separate the sets of strongly coupled magnetic layers . with such configurations , each magnetic layer is antiferromagnetically coupled to an adjacent magnetic layer , but main pole 38 is easier to saturate during the writing process because the overall coupling strength of main pole tip 45 is decreased . this leads to higher writer efficiency while reducing on - track erasure . fig8 is a partial perspective view of yet another embodiment of a main pole tip of the present invention . non - magnetic layer materials 64 and 72 couple but do not antiferromagnetically couple the magnetic layers on either side of the non - magnetic layers . therefore , the moments of magnetic layers 54 and 66 point in the same direction , and the moment of magnetic layers 70 and 74 point in the same direction in the illustrated example . however , the magnetic layers are still arranged so that each pair of magnetic layers is antiferromagnetically coupled . for example , magnetic layers 50 and 54 are antiferromagnetically coupled by non - magnetic layer 52 ; magnetic layer 66 and 70 are antiferromagnetically coupled by non - magnetic layer 68 ; and magnetic layer 74 and 78 are antiferromagnetically coupled by non - magnetic layer 76 . since each magnetic layer has only one of its surfaces relatively strongly antiferromagnetically exchange coupled , the overall effective coupling strength of main pole tip 45 is reduced , making it easier to saturate main pole 38 during the writing process by requiring a smaller magnetic field , thereby leading to greater efficiency . fig9 is a partial perspective view of another embodiment of a main pole tip of the present invention . main pole tip 45 of fig9 is similar to main pole tip 45 of fig7 except that the embodiment of fig9 includes a trapezoidal shape of main pole tip . in this embodiment a magnetic moment gradient from trailing edge 49 is created by disposing wider layers of magnetic materials closer to trailing edge 49 and narrower layers of magnetic materials further away from trailing edge 49 . thus , a gradient can be created even if each magnetic layer is made of materials with similar magnetic moment values . fig1 is a partial cross - sectional view of another embodiment of the writer of the present invention . writer 82 of fig1 is similar to writer 36 of fig2 , except that the embodiment illustrated in fig1 includes an additional return pole 40 connected to main pole 38 by an additional back closure 42 . this configuration reduces side erasure because the flux flowing through main pole 38 is directed to both return poles 40 , effectively reducing the side flux effects by half . writer 82 thereby increases writer efficiency while reducing both remanent erasure and side erasure effects . although the present invention has been described with reference to exemplary embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention . | 6 |
the invention will now be described with reference to the drawing figures , in which like reference numerals refer to like parts throughout . an embodiment in accordance with the present invention provides an apparatus is provided that in some embodiments provides a locking mechanism for hold open rods that functions over long periods of time , holds large loads and is durable . an embodiment of the present inventive apparatus is illustrated in fig1 . fig1 is a perspective view of a hold open rod system 10 . the hold open rod system 10 includes an inner 12 and outer 14 tube and a locking mechanism 16 . fasteners 15 , are connected to the inner 12 and outer 14 tubes . in this view , the system 10 is shown in a retracted , resting position . fig2 is a perspective view of the hold open rod system 10 of fig1 . in this view , an inner tube 12 is shown extending out from an outer tube 14 . fasteners 15 are connected to the inner tube 12 and the outer tube 14 . the fasteners 15 permit the hold open rod system 10 to attach doors or hatches of an aircraft which are to be held open . the fasteners 15 may be threaded , press fit or otherwise attached to the inner 12 and outer rods 14 . fasteners 15 are connected to the inner tube 12 and the outer tube 14 . a locking mechanism 16 is shown in an a locking state , as will be described herein . fig3 is a cross - sectional view of the locking mechanism 16 in a retracted , unlocked position . in this position , the inner tube 12 is disposed circumferentially within an outer tube 14 . the locking mechanism 16 includes a release collar 40 having an outer housing 17 , and locking dogs 18 disposed around the inner tube 12 . the dogs 18 may be disposed circumferentially around the inner tube 12 contacting an outside wall 20 of the inner tube 12 . as in the embodiment shown there may be two locking dogs 18 that are located opposite to each other . the locking dogs 18 can have a variety of geometries as will be discussed further . as shown in fig3 and 4 , dogs 18 have a sloped surface 19 in that corresponds with a sloped surface 21 on the outer housing 17 . the sloped surface 19 on the dogs 18 and the sloped surface 21 on the outer housing 17 interact to compress the locking dogs 18 which will be discussed further later below . a lock body 22 surrounds the inner and outer tubes 12 , 14 respectively . specifically , the lock body 22 is a tubular structure that has a first end 24 and a second end 26 . the first end 24 and second end 26 have varying diameters , such that the second end 26 has a larger diameter than the first end 24 . in some embodiments the second end 26 may have internal threads that permit the inner tube 12 to threadably attach to the release collar 40 . proceeding longitudinally from the first end 24 to the second end 26 , the locking body 22 has a tubular shape . there is at least one larger diameter opening 28 for placement of the locking dogs in the lock body 22 . in the cross - sectional illustration depicted in fig3 , there are least two such openings 28 . thereafter , the lock body 22 geometry flares outwardly towards the second end 26 . this flare is characterized by inner seat 30 formed on an inside surface 32 of the lock body 22 and an outer seat 34 formed on an outer surface 36 of the lock body 22 . proceeding further toward the second end 26 , the lock body has a depression 38 and a lip 39 defined by the depression 38 and the second end 26 for connecting with the outer tube 14 . in some embodiments the connection may be via threads . the geometry of the lock body 22 may have a smaller diameter adjacent the first end 24 to accommodate the diameter of just the inner tube that it retains at the first end 24 and a larger diameter adjacent the second end 26 to accommodate the diameters of both the inner tube 12 and the outer tube 14 that it retains at the second end 26 . the lock body 22 and the locking dogs 18 are themselves circumferentially contained within a release collar 40 . the release collar 40 generally tubular in shape , has a first end 42 and a second end 44 remote therefrom . adjacent the first end 42 of the release collar 40 is a release collar cavity 46 for providing a space for locking dogs 18 when the locking dogs 18 are not in a locking position . the release collar cavity 46 has a first portion 48 disposed toward the first end 42 and a second portion 50 . further , the cavity 46 includes the sloped surface 21 that allows the locking dogs 18 to be fed into the second portion 50 . the first portion 48 has a larger diameter and geometry than the second portion 50 , such that the first portion 48 of the cavity 46 can accommodate the size and shape of the locking dogs 18 when the locking system 10 is in a relaxed , unlocked and retracted state . the second portion 50 of the release collar cavity 46 has a smaller diameter so as to capture and retain the locking dogs 18 when the inner and outer tubes , 12 , 14 , respectively , are placed in an extended , locked position as shown in fig4 . the release collar 40 further includes a lip 54 for preventing the locking dogs 18 from sliding down the outer wall 20 of the inner tube 12 . a spring 56 is positioned inside the release collar 40 to surround the lock body 22 . in particular , the spring 56 is retained inside the release collar 40 by the outer seat 34 of the locking collar 22 . the spring 56 retracts and contracts as the locking mechanism 16 is locked and unlocked . fig4 is a depiction of the locking mechanism 16 in an extended , locked position . in fig3 , a first end 58 of the inner tube 12 was visible and positioned adjacent the locking mechanism 16 . however , in fig4 , illustrating the extended , locked position , a second end 60 of the inner tube 12 is visible . the second end 60 of the inner tube 12 includes at least one inner tube groove 62 having a geometry to accommodate the locking dogs 18 . the inner tube groove 62 is formed on an outer wall 20 of the inner tube 12 . the groove 62 is dimensioned such that the locking dogs 18 will fit between the groove 62 and the second portion 50 of the release collar 40 . the groove 62 is formed at a location near the second end 60 so that when the locking mechanism 16 is in the extended locked position , the inner and outer tubes 12 , 14 respectively , can have the longest length possible . the second end 60 also includes a circumferential protrusion or stop 64 . the stop 64 catches against the inner seat 30 of the locking body 22 and prevents the inner tube 12 from sliding all the way through the lock body 12 . the stop 64 may be formed integrally with the inner tube 12 or be formed separately and attached to the second end of the 60 of the inner tube 12 . in operation , during the relaxed , retracted and unlocked position , the locking dogs 18 are circumferentially spaced about the outer wall 20 of the inner tube 12 and are located adjacent the first portion 48 of the release collar 40 as shown in fig3 . an example of when the hold open rod system 10 is in this unlocked position is when a door held open by the hold open rod system 10 is in a closed position . to extend and lock the hold open rod system in place , the inner tube 12 is extended out from the outer tube 14 . as the inner tube 12 is extended out , the locking dogs 18 ride on the outer wall 20 of the inner tube 12 until they approach the groove 62 of the inner tube 12 . then , the locking dogs 18 are angled radially inward by the angled surface 21 such that the locking dogs 18 fall into the groove 62 and are held in place by the second portion 50 of the release collar 40 . the locking dogs 18 stay thusly situated until an operator releases the locking mechanism . to release the locking dogs 18 , an operator slides the release collar 40 and compresses the spring 56 such that the locking dogs 18 are angled upward and outward , radially by the wall 21 , allowing the locking dogs 18 to return to the first portion 48 of the release collar cavity 46 . the release collar 40 can be configured such that the locking dogs 18 are released with a pull or slide motion or a turn - and - pull ( or slide ) motion . then the locking dogs 18 slide on the outer wall 20 of the inner tube 12 as the inner tube 12 is retracted back into the outer tube 14 . fig5 - 7 provide depictions of alternate embodiments of locking dogs 18 . in particular , fig5 shows a perspective view of a locking dog 18 having a generally elongated block like structure with rounded ends . fig6 illustrates yet another embodiment of a locking dog 18 . this embodiment has a shape similar to a torridal section ( a section of a torus ) with champhered ends . fig7 illustrates a generally spherical structure . in the embodiments shown in fig5 , the locking dog 18 has sloped surface 19 for sliding along the sloped surface 17 on the outer housing 21 as discussed above . the embodiments shown in fig6 and 7 have general curved surfaces 66 . the general curved surfaces 66 perform the function of sliding along the sloped surface 21 of the outer housing 17 . the arched sections 68 as shown in fig5 and 6 allow the dogs 18 to engage the ached groove 62 . thus the locking dogs 18 can have a variety of geometries and are within the scope of the present invention . further , in a preferred embodiment of the present invention , the locking dogs 18 are formed of a reinforced plastic material , such as but not limited to , glass or carbon reinforced torlon ยฎ polymer available from solvay plastics . this material is a strong material that can withstand the large loads that the locking mechanism 10 will be subjected to but will not cause wear on the outer wall 20 of the inner tube 12 . the many features and advantages of the invention are apparent from the detailed specification , and thus , it is intended by the appended claims to cover all such features and advantages of the invention which fall within the true spirit and scope of the invention . further , since numerous modifications and variations will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation illustrated and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . | 8 |
aspects of the present invention relate to a communications network having an intermediary security gateway computer and one or more intermediary third part gateway computers , where the third party gateway computers do not need to inspect the data content they receive and send . using embodiments of the present invention , the connection between a client and a server is split into two ssl connections , and two or more non - ssl connections . one of the two ssl connections is used for communication between the client and a first security gateway computer , and the other of the two ssl connections is used for communication between the server and a second security gateway computer . the two or more non - ssl connections are used for communications between a security gateway computer and a third party gateway computer , and for communications between two third party gateway computers . the first and second security computers operative cooperatively to authenticate signed certificates that are provided by the server during an ssl handshake . the second security computer transmits to the first security computer the certificate attributes received from the server , and the first security computer acts as a certificate authority , and creates a certificate for the client based on the attributes of the server certificate . reference is now made to fig2 , which is a diagram of a client - server system with two security gateways and a third party caching gateway , using only two ssl connections , in accordance with an embodiment of the present invention . shown in fig2 is a client computer 100 that communicates with a server computer 200 within a network in which a first security gateway computer 300 a , a third party gateway computer 400 , and a second security gateway computer 300 b intermediate . third party gateway computer 400 does not need to inspect that data content that it receives and sends . in some instances the data content passing through third party gateway computer 400 may need to be encrypted . it will be appreciated by those skilled in the ensuing description that embodiments of the present invention apply as well to a topology wherein third party gateway computer 400 is a plurality of networked third party gateway computers . notable in fig2 is the use of two ssl connections and two non - ssl connections . as such , establishing a connection between client computer 100 and server computer 200 requires only two ssl handshakes . specifically , security gateway computer 300 a establishes an ssl connection with client computer 100 , and security gateway computer 300 b establishes an ssl connection with server computer 200 . the connections between security gateway computer 300 a and security gateway computer 300 b are non - ssl connections , which are higher performance and lower latency connections than ssl connection . using the network topology of fig2 , client computer 100 and server computer 200 are still connected over ssl , and a certificate is exchanged and validated . if the communication between security gateway computers 300 a and 300 b is required to be encrypted , an encrypted tunnel / pipe is established between the security gateway computers , such as an open - vpn tunnel in cases where there are many connections between security gateway computers 300 a and 300 b , a permanent encrypted tunnel / pipe is established between them . for the network topology of fig2 to support ssl certificate validation , security gateway computers 300 a and 300 b perform special processing , as described hereinbelow regarding the methods of fig3 and 4 . reference is now made to fig3 , which is a simplified flowchart of a method for establish an ssl connection between a client and server computer intermediate between the client and the server computers , in accordance with an embodiment of the present invention . the flowchart of fig3 is divided into five columns . starting from the left , the first column includes steps performed by client computer 100 (โ client โ), the second column includes steps performed by security gateway computer 300 a (โ security gateway a โ), the third column includes steps performed by third party gateway computer 400 (โ third party gateway โ), the fourth column includes steps performed by security gateway computer 300 b (โ security gateway b โ), and the fifth column includes steps performed by server computer 200 (โ server โ). at step 1105 , the client computer sends an ssl request to security gateway a , to establish a connection , using the connect request method . at step 1110 security gateway a establishes a connection to the third party gateway . if an encrypted connection is desired , then security gateway a establishes an encrypted connection to the third party gateway using , for example , open - vpn . if subsequent connection requests are anticipated , then the connection between security gateway a and the third party gateway remains as a tunnel / pipe , in order not to disconnect . at step 1115 the third party gateway accepts the connection with security gateway a . at step 1120 the third party gateway establishes a connection to security gateway b . as above , if an encrypted connection is desired , then the third party gateway establishes an encrypted connection to security gateway b using , for example , open - vpn . also as above , if subsequent connection requests are anticipated , then the connection between the third party gateway and security gateway b remains as a tunnel / pipe , in order not to disconnect . at step 1125 security gateway b sends an ssl request to the server , to establish a connection , using the connect request method . at step 1130 security gateway band the server perform an ssl handshake to authenticate a server certificate . upon success of the handshake , an ssl connection is established between security gateway b and the server . at step 1135 security gateway b appends the server certificate attributes to a header in the protocol , such as an http reply header . certificate attributes generally include inter alia a domain name and a validity date . at step 1140 security gateway b replies to the third party gateway with a connect reply message . the reply includes the server certificate attributes in its header . at step 1145 the third party gateway forwards the reply received from security gateway b to security gateway a . at step 1150 security gateway a creates an ssl certificate using the attributes of the server certificate . finally , at step 1155 security gateway a and the client perform an ssl handshake to authenticate the certificate created by security gateway a . upon success of the handshake , an ssl connection is established between security gateway a and the client . at this stage , subsequent requests from the client to the server may be communicated over the established connections . in accordance with an embodiment of the present invention , the method of fig3 may be enhanced by maintaining a local certificate cache at security gateway a . such a cache obviates the need to security gateway b to send the server certificate attributes to security gateway a . instead , a cached server certificate is used . however , certificates often expire and are renewed . in order that the certificate cache at security gateway a be up - to - date , security gateway b sends updated server certificates to security gateway a when the server certificates change . in this regard , deference is now made to fig4 a and 4b , which are a simplified flowchart of an enhancement for the method of fig3 , using a certificate cache , in accordance with an embodiment of the present invention . the flowchart of fig4 a and 48 is divided into five columns , as described above with reference to fig3 . at step 1205 the client sends an ssl request to security gateway a , to establish a connection , using the connect request method . at step 1210 security gateway a checks its local certificate cache to determine if a certificate for the requested server name is already available in cache . if so , then at step 1215 security gateway a generates a fingerprint or hash of the server certificate , and at step 1220 security gateway a appends the fingerprint / hash to a connection request . otherwise , if it is determined at step 1210 that a certificate for the requester server name if not available in cache , then processing advances directly to step 1225 , by - passing steps 1215 and 1220 . at step 1225 security gateway a establishes a connection to the third party gateway . the connection request will include the fingerprint / hash of the server certificate if steps 1215 and 1220 were performed . if encryption between security gateway a and the third party gateway is desired , then an encrypted connection is established , using , for example , open - vpn . if subsequent requests are anticipated , then the connection between security gateway a and the third party gateway remains as a tunnel / pipe , in order that it not disconnect . at step 1230 the third party gateway accepts the connection with security gateway a . at step 1235 the third party gateway establishes a connection to security gateway b . the connection request received by security gateway b from the third party gateway will include the server certificate attributes if steps 1215 and 1220 were performed . as above , if encryption between the third party gateway and security for example , open - vpn . also as above , if subsequent requests are anticipated , then the connection between the third party gateway and security gateway b remains as a tunnel / pipe , in order that it not disconnect . at step 1240 security gateway b sends a ssl request to the server , to establish a connection , using the connect request method . at step 1245 security gateway b and the server perform an ssl handshake to authenticate a server certificate . upon success of the handshake , an s sl connection is established between security gateway b and the server . at step 1250 security gateway b determines whether a fingerprint / hash of the server certificate was included in the request made at step 1235 . if so , then at step 1255 security gateway b generates a fingerprint or hash of the certificate it received from the server during the ssl handshake at step 1245 . at step 1260 security gateway b compares the fingerprint / hash received at step 1235 with the fingerprint / hash generated at step 1255 . if the two fingerprints / hashes do not match , then the server certificate was recently updated , and the server certificate cached at security gateway a is no longer valid . at step 1265 security gateway b appends the certificate attributes from the server certificate received at step 1245 , to a header in the protocol , such as an http reply header . otherwise , if the two fingerprints / hashes compared at step 1260 do match , then the server certificate cached at security gateway a is still valid . in this case , processing advances directly to step 1270 , by - passing step 1265 , and no certificate attributes are appended to the reply message . if security gateway b determines at step 1250 that a fingerprint / hash was not included in the request received at step 1235 , then processing advances directly to step 1265 , by - passing steps 1255 and 1260 . at step 1270 security gateway b replies to the third party gateway with a connection reply message . at step 1275 the third party gateway forwards the reply received from security gateway b to security gateway a . at step 1280 security gateway a determines whether server certificate attributes are included in the reply message received from the third party gateway computer at step 1275 . if so , then at step 1285 security gateway a creates an ssl certificate using the attributes included in the reply message , and stores the created certificate in its local cache for subsequent access . otherwise , at step 1290 security gateway a retrieves its cached certificate . finally , at step 1295 security gateway a and the client perform an ssl handshake to authenticate the certificate created at step 1285 or the cached certificate , as appropriate . upon success of the ssl handshake , an ssl connection between gateway server a and the client is established . at this stage , subsequent requests from the client to the server are communicated over the established connections . reference is now made to fig5 , which is a simplified block diagram of security gateway computers 300 a and 300 b that cooperate in ssl certificate validation , in accordance with an embodiment of the present invention . security gateway computers 300 a and 300 b are operative to perform the steps in fig3 a and 48 that apply to security gateways a and b , respectively . in addition to the components shown in fig5 , each of security gateway computers 300 a and 300 b includes standard computer hardware ( not shown ), including inter alia one or more processors , one or more hard disk drives , ram , a communication bus , one or more network interfaces , and i / o drivers display . as shown in fig5 , security gateway computer 300 a includes an ssl connector 310 a , for establishing an ssl connection between security gateway computer 300 a and a client computer . ssl connector 310 a is used in performing step 1155 of fig3 and step 1295 of fig4 . security gateway computer 300 a also includes a non - ssl connector 320 a , for establishing a non - ssl encrypted or non - encrypted connection between security gateway computer 300 a and a third party gateway computer . non - ssl connector 320 a is used in performing step 1110 of fig3 and step 1225 of fig4 a . security gateway computer 300 a also includes a certificate creator 330 a , for creating a signed certificate for attributes of a server certificate . certificate creator 330 a is used in performing step 1150 of fig3 and step 1285 of fig4 . security gateway computer 300 b includes an ssl connector 310 a , for establishing an ssl connection between security gateway computer 300 b and a server computer . ssl connector 310 b is used in performing step 1130 of fig3 and step 1245 of fig4 a . security gateway computer 300 b also includes a non - ssl connector 320 b , for establishing a non - ssl encrypted or non - encrypted connection between security gateway computer 300 b and a third party gateway computer . non - ssl connector 320 b is used in performing step 1120 of fig3 and step 1235 of fig4 . security gateway computer 300 b also includes a protocol appender 340 a , for appending certificate attributes within a protocol request . protocol appender 340 a is used in performing step 1135 of fig3 and step 1265 of fig4 . for use in the enhanced method of fig4 , security gateway computer 300 a also includes a local certificate cache 350 for storing and retrieving attributes of signed server certificates . in addition , security gateway computer 300 a includes a certificate encoder 360 a for deriving a hash value for cached certificate attributes , and a protocol appender 340 a for appending the hash value to a protocol message . certificate encoder 360 a is used in performing step 1215 of fig4 a , and protocol appender 340 a is used in performing step 1220 of fig4 a . further for use in the enhanced method of fig4 a and 8 , security gateway computer 300 b also includes a certificate encoder 360 b for deriving a hash value for attributes of a certificate provided by the server computer , and a certificate comparator 370 b for comparing hash values generated by certificate encoder 360 a with a hash value generated by certificate encoder 360 b . certificate encoder 360 a is used in performing step 1255 of fig4 , and certificate comparator 370 b is used in performing step 1260 of fig4 . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made to the specific exemplary embodiments without departing from the broader spirit and scope of the invention as set forth in the appended claims . accordingly , the specification and drawings are to be regarded in an illustrative rather than a restrictive sense . | 7 |
the embodiments of the present invention will now be explained by referring to the accompanying drawings . the first embodiment of the present invention is characterized by using a liquid crystalline material which comprises a compound represented by the structural formula ( 1 ), compounds represented by the structural formulas ( 1 ) and ( 2 ), compounds represented by the structural formulas ( 1 ) and ( 3 ), or compounds represented by the structural formulas ( 1 ), ( 2 ) and ( 3 ) in an amount of 90 % by weight or more of the total weight of liquid crystalline components contained therein , provided that the weight of the compound represented by the structural formula ( 1 ) is 60 % or more of the total weight of the liquid crystalline components . as defined previously , each one of the molecules represented by the structural formulas ( 1 ), ( 2 ) and ( 3 ) has three fluorine atoms bonded to benzene ring which is positioned at the terminal end thereof . in order to further lower the operating voltage , the inventors carried out experiments by changing the proportion of a predetermined liquid crystalline component in a given liquid crystalline material which comprises as its main components ( for example , 90 % by weight or more of all of the liquid crystalline components contained therein ) the compounds having the structural formulas ( 1 ), ( 2 ) and ( 3 ). by making the proportion of the component represented by the structural formula ( 1 ) to 60 % by weight or more of the total weight of the components , voltage required to operate a liquid crystal display panel was lowered to a low value that had never been attained until then . the following can be considered as the reason why the operating voltage was lowered : under the condition that only the molecules represented by the structural formulas ( 1 ), ( 2 ) and ( 3 ) are used as liquid crystalline components , a conventionally - known liquid crystalline material in which the proportion of the molecule having the structural formula ( 1 ) is less than 60 % by weight , and a liquid crystalline material of the present invention in which the proportion of the molecule having the structural formula ( 1 ) is 60 % by weight or more were compared . as a result , the conventional liquid crystalline material and the liquid crystalline material of the present invention were found to be almost the same in anisotropy of dielectric constant ฮดฮต . it is therefore considered that voltage required to operate a liquid crystal display panel was lowered because of a decrease in elastic modulus of the liquid crystalline components . a tft driven liquid crystal display panel having 640 ร 400 pixels was prepared . the partial cross - sectional view of this display panel is as shown in fig3 . as shown in fig3 a tft 2 , a drain bus line 3 , a transparent pixel electrode 4 , and a gate bus line ( not illustrated ) are provided on a first transparent substrate 1 . a first alignment film 5 is formed at least on the transparent pixel electrode 4 . the tft 2 has , for example , a structure of stagger type ; it has a source electrode 2s connected to the pixel electrode 4 , a drain electrode 2d connected to the drain bus line 3 , an operating semiconductor layer 2a connected to a part of the source electrode 2s and to a part of the drain electrode 2d , and a gate electrode 2g which is provided on a gate insulating layer 2b formed on the active semiconductor layer 2a . further , a first polarizer 6 is provided on the other surface of the first transparent substrate 1 . on a second transparent substrate 7 , a transparent common electrode 8 and a second alignment film 9 are provided in the mentioned order . the second transparent substrate 7 faces the first transparent substrate 1 with the second alignment film 9 and the first alignment film 5 faced each other . the first and second transparent substrates 1 , 7 are made of glass , quartz or the like . in the gap between the first and second alignment films 5 , 9 , a liquid crystalline material 11 having the composition shown in fig4 was charged . the n - i transition temperature of the liquid crystalline material used was 59 ยฐ c . in this example , liquid crystalline molecules of a plurality of types were used in order to control the temperature characteristics . in fig4 and in fig6 which will be described later , the liquid crystalline molecules 1 and 2 correspond to the molecule represented by the structural formula ( 1 ), the liquid crystalline molecules 3 to 8 correspond to the molecule represented by the structural formula ( 2 ), and the liquid crystalline molecule 9 corresponds to the molecule presented by the structural formula ( 3 ). a chiral material was further incorporated into the liquid crystalline material . the amount of the chiral material was adjusted so that the angle of the liquid crystalline molecules would be changed in approximately 90 ยฐ to be a spiral form with a pitch of approximately 90 micrometers . the amount of the chiral material added was approximately 0 . 15 % by weight of the liquid crystalline material . the liquid crystal display panel having the above - described structure is of a normally white type . the relationship between applied voltage and relative transmittance in this display panel was examined . as a result , a characteristic curve as shown in fig5 was obtained . the applied voltage means a voltage between the pixel electrode 4 and the common electrode 8 , and the relative transmittance is defined as a transmittance taken under the condition that the amount of transmitted light is set to be 100 % when the applied voltage is 0 v . when the voltage at which the relative transmittance is 1 % is referred to as a saturation voltage v sat , the saturation voltage v sat of the liquid crystal display panel made by using the liquid crystalline material of this example is 2 . 46 v , which is lower than 2 . 5 v although the degree of lowering is small . it is noted that the saturation voltage v sat is defined as a voltage by which a contrast of 200 can be attained . on the other hand , four types of liquid crystalline materials , each containing less than 60 % by weight of the molecule represented by the structural formula ( 1 ) were prepared as shown in fig6 . each of these materials was charged between the first and second substrates 1 , 7 shown in fig3 and the saturation voltage v sat was measured . it is noted that the chiral pitch of each of the materials ( 1 ) to ( 4 ) shown in fig6 is approximately 90 micrometers . the results of this experiment were as follows : the saturation voltage v sat of the material ( 1 ) was 2 . 73 v , that of the material ( 2 ) was 2 . 71 v , that of the material ( 3 ) was 2 . 63 v , and that of the material ( 4 ) was 2 . 61 v . for reference , the relationship between applied voltage and relative transmittance obtained by using the liquid crystalline material ( 1 ), and this relationship obtained by using the liquid crystalline material ( 4 ) are shown in fig7 and fig8 respectively . as is clear from the above experimental results , when the proportion of the molecule having the structural formula ( 1 ) is less than 60 % by weight , the saturation voltage v sat falls in the range of 2 . 6 to 2 . 8 v , and a desired low voltage of 2 . 5 v cannot be attained . in contrast , when the proportion of the molecule having the structural formula ( 1 ) is 60 % by weight or more , a saturation voltage v sat of 2 . 5 v or lower can be successfully attained . in this example , the liquid crystalline material shown in fig4 having an n - i transition temperature of 59 ยฐ c . was used . for reference , liquid crystalline materials having an n - i transition temperature of 55 ยฐ to 57 ยฐ c ., prepared by changing the proportions of the molecules represented by the structural formulas ( 1 ), ( 2 ) and ( 3 ) were also subjected to the determination of saturation voltage . as a result , it was found that the saturation voltage v sat of any of these materials never exceeded 2 . 5 v . the reason of this fact may be such that these liquid crystalline materials were to have a lower elastic modulus as the n - i transition temperature thereof became lower , and , as a result , a lower saturation voltage was obtained . a liquid crystal display panel of tft - operated type , having the same structure as shown in fig3 was prepared also in this example , provided that the direction of rubbing the first alignment film 5 and that of rubbing the second alignment film 9 were made different from those in example 1 ; these alignment films were rubbed so that the twist angle would be 100 ยฐ. a liquid crystalline material 11 charged between the first and second alignment films 5 , 9 was also the same as the material used in example 1 , shown in fig4 . when the twist angle is made wider , a negatively - twisted area tends to be formed . in order to prevent negative twisting , a chiral pitch was adjusted to approximately 60 micrometers by controlling the amount of a chiral material added to the liquid crystalline material . in order to ensure sufficient contrast , polarizers 6 , 10 provided on the first and second substrates 1 , 7 , respectively , were so arranged that the directions of polarization thereof can make a right angle with each other . the direction of rubbing the first alignment film 5 and that of rubbing the second alignment film 9 relatively make an angle of 100 ยฐ, so that the direction of polarization of each of the polarizers is fixed as shown in fig9 . namely , the direction of rubbing the first alignment film 6 provided on the first substrate 1 was relatively shifted in 5 ยฐ from the direction of polarization of the polarizer 6 ; the direction of rubbing the second alignment film 9 provided on the second substrate 7 was relatively shifted in 5 ยฐ from the direction of polarization of the polarizer 10 . thereafter , the relationship between applied voltage and relative transmittance was examined . as a result , a characteristic curve as shown in fig1 was obtained , and the saturation voltage v sat was found to be 2 . 25 v , which is lower than the saturation voltage v sat obtained in example 1 . it is considered that the following principle can be applied to this result : one of the reasons why a high voltage is required to operate a liquid crystal display panel is such that liquid crystalline molecules existing at a position closest to the surface of the first and second alignment films 5 , 9 , by which the liquid crystalline material is sandwiched , do not immediately change the tilt angle thereof even when voltage is applied . the twist angle of the liquid crystalline molecules is adjusted to 95 ยฐ to 110 ยฐ, and , at the same time , the relative angle of the polarizing axis of a pair of the polarizers 6 , 10 is fixed to a value different from the twist angle of the liquid crystalline molecules . by this , incident light is to enter the liquid crystal display panel from the direction which is shifted from the direction of alignment of the liquid crystalline molecules . as a result , the effect of the liquid crystalline molecules which are late in response can be decreased . by making the twist angle as wide as 95 ยฐ to 110 ยฐ, the saturation voltage becomes lower than 2 . 5 v , and the margin of voltage upon operation with 2 . 5 v becomes wider . next , a liquid crystal display panel according to a second embodiment of the present invention is described . because there is not any constitutional difference between the conventional active element type liquid crystal display panel and the liquid crystal display panel according to the second embodiment , except for alignment films , alignment films according to the second embodiment and an alignment processing for the alignment films are mainly described . as shown in fig1 ( a ) and 11 ( b ), in a liquid crystal display panel according to the second embodiment , the plurality of scanning bus lines ( or scanning wiring lines ) 14 formed out of a metal such as cr are spaced at first regular intervals on the first plane of the first transparent substrate 11 , and the plurality of data bus lines ( or data wiring lines ) 19 are spaced at second regular intervals on the scanning bus lines 14 through an insulating film ( not shown ) to cross over the lines 14 . the data bus lines 19 extend in a direction perpendicular to another direction in which the scanning bus lines 14 extend . each of the pixel electrodes 13 is arranged on a portion of the first transparent substrate 11 surrounded by one of the scanning bus lines 14 and one of the data bus lines 19 . therefore , the pixel electrodes 13 are arranged in matrix shape . each of the pixel electrodes 13 is connected to one of the data bus lines 19 through the active element 20 , and each of the active elements 20 is operated by a voltage applied from one of the scanning bus lines 14 . a thin - film transistor ( tft ) or a metal - insulator - metal ( mim ) diode is used as the active element 20 . in cases where the tft is used , the scanning bus line 14 is sometimes called a gate bus line , and the data bus line 19 is sometimes called a drain bus line . the scanning bus lines 14 , the data bus lines 19 , the active elements 20 and the pixel electrodes 13 are covered by a first alignment film 25a . as shown in fig1 ( a ) to 12 ( d ), a surface of the first alignment film 25a is rubbed with a rubbing role 21 , so that an alignment processing is performed for the first alignment film 25a . in detail , the surface of the first alignment film 25a is rubbed with a piece of rubbing cloth 21a formed out of silk or rayon which is attached to a surface of the rubbing role 21 . the first alignment film 25a is rubbed to orient main axes of a plurality of liquid crystal molecules placed on the film 25a toward the same axial direction . also , on a first plane of the second transparent substrate 12 , the counter electrode ( or transparent electrode ) 16 and a second alignment film 25b are arranged in that order . in this case , it is applicable that a color filter be additionally arranged between the second alignment film 25b and the second transparent substrate 12 . a surface of the second alignment film 25b is rubbed with the rubbing cloth 21a of the rubbing role 21 , so that another alignment processing is performed for the second alignment film 25b . the first transparent substrate 11 and the second transparent substrate 12 are arranged on condition that the rubbed surface of the first alignment film 25a face the rubbed surface of the second alignment film 25b , and the liquid crystal 17 is packed in a region between the first alignment film 25a and the second alignment film 25b . therefore , the liquid crystal 17 are in contact with the rubbed surfaces of the first and second alignment films 25a and 25b . in addition , the polarizing plate 18a is arranged on a second plane of the first transparent substrate 11 , and the polarizing plate 18b is arranged on a second plane of the second transparent substrate 12 . a manufacturing method of the liquid crystal display panel according to the second embodiment is described in brief . the first alignment film 25a not rubbed is formed on the first transparent substrate 11 , and the second alignment film 25b not rubbed is formed on the second transparent substrate 11 . thereafter , the surfaces of the first and second alignment films 25a and 25b are rubbed , the first and second alignment films 25a and 25b are arranged on condition that the rubbed surfaces of the films 25a and 25b face each other , and the liquid crystal 17 are packed in a region between the first and second alignment films 25a and 25b . next , the alignment processing performed for the first alignment film 25a and the alignment processing performed for the second alignment film 25b are described with reference to fig1 ( a ) to 12 ( d ). because the films 25a and 25b are rubbed according to rubbing methods which differ from a conventional rubbing method , the inventors ascertain that the liquid crystal display panel according to the second embodiment can be operated by applying a lower voltage to the display panel . fig1 ( a ) and 12 ( b ) show a first rubbing method according to the second embodiment of the present invention , and fig1 ( a ) and 12 ( b ) show a second rubbing method according to the second embodiment of the present invention . as shown in fig1 ( a ) to 12 ( d ), in case of the rubbing of the first alignment film 25a , the first alignment film 25a formed on the first transparent substrate ( or a glass substrate ) 11 is placed on a stage 22 , and the rubbing role 21 to which the rubbing cloth 21a formed out of rayon is attached . the rubbing role 21 formed in a cylindrical shape has a diameter of almost 15 cm , and a moving speed of the stage 22 which is equivalent to a moving speed of the first transparent substrate 11 is about several tens mm / sec . also , in cases where the rubbing role 21 is moved in place of the stage 22 , the moving speed of the rubbing role 21 is about several tens mm / sec . when the first or second alignment film 25a or 25b is rubbed , the rubbing role 21 is rotated at a high speed of several hundreds rotations per minute by a driving mechanism ( not shown ), and a surface of the first or second alignment film 25a or 25b is rubbed with the rubbing cloth 21a . in this case , there are two types of rubbing methods . in case of a first rubbing method , as shown in fig1 ( a ) and 12 ( b ), the rubbing role 21 is not moved over the stage 22 , but the stage 22 placed under the rubbing role 21 is moved to rub a surface of the first or second alignment film 25a or 25b . in the first rubbing method , a moving direction of the transparent substrate 11 or 12 and the alignment film 25a or 25b is the same as that of the stage 22 . a rotational direction rd of the rubbing role 21 shown in fig1 ( a ) is set to make a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b agree with a moving direction dd of the transparent substrate 11 or 12 . a rubbing condition ( or method ) that the rubbing direction sr of the rubbing role 21 on the surface of the alignment film 25a or 25b set by the rotational direction rd of the rubbing role 21 agrees with a moving direction dd of the stage 22 ( or the moving direction dd of the transparent substrate 11 or 12 ) is called a same - directional rubbing in this specification . in contrast , a rotational direction rd of the rubbing role 21 shown in fig1 ( b ) is set to make a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b be opposite to a moving direction dd of the transparent substrate 11 or 12 . a rubbing condition ( or method ) that the rubbing direction sr of the rubbing role 21 on the surface of the alignment film 25a or 25b set by the rotational direction rd of the rubbing role 21 is opposite to a moving direction dd of the stage 22 ( or the moving direction dd of the transparent substrate 11 or 12 ) is called an opposite - directional rubbing in this specification . in case of a second rubbing method , as shown in fig1 ( c ) and 12 ( d ), the stage 22 is not moved , but the rubbing role 21 is moved in a moving direction hd over the stage 22 while rotating the rubbing role 21 on a surface of the alignment film 25a or 25b . a rotational direction rd of the rubbing role 21 shown in fig1 ( c ) is set to make a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b be opposite to the moving direction hd of the rubbing role 21 . a rubbing condition shown in fig1 ( c ) is the same - directional rubbing because a relative moving relationship between the rubbing role 21 and the stage 22 is the same as that shown in fig1 ( a ). in contrast , a rotational direction rd of the rubbing role 21 shown in fig1 ( d ) is set to make a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b agree with the moving direction hd of the rubbing role 21 . a rubbing condition shown in fig1 ( d ) is the opposite - directional rubbing because a relative moving relationship between the rubbing role 21 and the stage 22 is the same as that shown in fig1 ( b ). in fig1 ( a ) to 12 ( d ), a direction of a relative movement between the rubbing role 21 and the stage 22 is perpendicular to a rotational axis of the rubbing role 21 . however , the second embodiment is not limited to the rubbing methods shown in fig1 ( a ) to 12 ( d ). that is , as shown in fig1 ( a ) and 13 ( b ), even though a direction of a relative movement between the rubbing role 21 and the stage 22 is not perpendicular to the rotational axis of the rubbing role 21 , the rubbing condition is judged to be the same - directional rubbing or the opposite - directional rubbing . in detail , as shown in fig1 ( a ), in cases where a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b set by the rotation of the rubbing roll 21 includes the same directional component as that of a moving direction of the stage 22 , the rubbing condition is judged to be the same - directional rubbing . also , as shown in fig1 ( b ), in cases where a rubbing direction sr of the rubbing role 21a on a surface of the alignment film 25a or 25b set by the rotation of the rubbing roll 21 includes a directional component opposite to that of a moving direction of the stage 22 , the rubbing condition is judged to be the opposite - directional rubbing . the inventors of the present invention examined a relationship between a potential difference between the counter electrode 16 and the pixel electrode 13 and a light transmittance for a first liquid crystal panel having the first alignment film 25a rubbed according to the same - directional rubbing and a second liquid crystal panel having the first alignment film 25a rubbed according to the opposite - directional rubbing . as a result , the inventors discovered that a saturation value ( hereinafter , called a saturation voltage ) of the voltage applied to the scanning bus lines 14 , denoting a voltage value at which the light transmittance is saturated , in the first liquid crystal panel having the alignment film rubbed according to the same - directional rubbing differs from that in the second liquid crystal panel having the alignment film rubbed according to the opposite - directional rubbing . experimental results indicating the difference in the saturation voltage between the first liquid crystal panel according to the same - directional rubbing and the second liquid crystal panel according to the opposite - directional rubbing are described . the saturation voltage v sat is defined as a voltage value at which the light transmittance is 1 % on condition that the light transmittance is set to 100 % when any voltage is not applied to the scanning bus lines 14 of the crystal panel ( a normal white display ). fig1 shows experimental results obtained by examining the relationship between the number of rubbing operations and the saturated voltage v sat for the first and second liquid crystal display panels . in this case , polyimide called a trade name &# 34 ; al1054 &# 34 ; and manufactured in nippon goseigomu ( synthetic rubber ) corp . is used as a material of the first and second alignment films 25a and 25b . also , the configurations of the first and second liquid crystal display panels are the same as the liquid crystal display panel shown in fig1 according to the second embodiment . also , the liquid crystal 17 includes fluorine ( f ) as a polar group , a dielectric constant ฮต 1 of the liquid crystal in a direction of its major axis is 12 . 5 , and a dielectric constant ฮต 2 of the liquid crystal in a direction of its minor axis is 3 . 8 . as shown in fig1 , the saturation voltage v sat in the first liquid crystal display panel having the first alignment film 25a rubbed according to the same - directional rubbing is about 3 . 1 v on average . in contrast , the saturation voltage v sat in the second liquid crystal display panel having the first alignment film 25a rubbed according to the opposite - directional rubbing is about 2 . 7 v on average and is about 0 . 4 v lower than that in the first liquid crystal display panel . therefore , it is ascertained that the saturation voltage v sat in the display panel according to the opposite - directional rubbing is lowered as compared with that in the display panel according to the same - directional rubbing . to examine the reason of the difference in the saturation voltage v sat , a difference in an inclined angle of a liquid crystal molecule placed just on the rubbed surface of the alignment film 25a or 25b when any voltage is not applied , in other words a difference in a so - called pre - tilt angle , is examined . however , the pre - tilt angle of the liquid crystal molecule in the second display panel according to the opposite - directional rubbing is almost the same as that in the first display panel according to the same - directional rubbing . therefore , a difference between an anchoring energy of liquid crystal molecules placed on the first display panel according to the same - directional rubbing and another anchoring energy of liquid crystal molecules placed on the second display panel according to the opposite - directional rubbing is examine . an anchoring energy for the second liquid crystal display panel ( the opposite - directional rubbing ) is on the order of 10 - 4 j / m 2 , and an anchoring energy for the first liquid crystal display panel ( the same - directional rubbing ) is on the order of 10 - 3 j / m 2 . therefore , it is ascertained that the difference of one figure in the anchoring energy exists between the second liquid crystal display panel ( the opposite - directional rubbing ) and the first liquid crystal display panel ( the same - directional rubbing ). in this case , the measurement of the anchoring energy is performed by referring a method disclosed in &# 34 ; h . yokoyama et al ., j . appl . phys . 61 ( 9 ), may 1 , 1987 , pp . 4501 - 4518 &# 34 ;. therefore , in cases where the alignment film 25a or 25b is rubbed according to the same - directional rubbing , the anchoring energy of the liquid crystal molecules placed on the alignment film 25a or 25b becomes high , and liquid crystal molecules placed in the neighborhood of the rubbed surface of the alignment film 25a or 25b slowly rise when an voltage is applied to the alignment film 25a or 25b . as a result , the saturated energy in the first display panel according to the same - directional rubbing becomes high . also , the same - directional rubbing and the opposite - directional rubbing are alternately performed for the alignment film 25a or 25b to repeatedly rub the alignment film 25a or 25b , and it is examined which rubbing condition influences on the alignment film 25a or 25b . a relationship between the number of rubbing operations and the saturation voltage v sat obtained as a result of the examination is shown in fig1 . as shown in fig1 , the opposite - directional rubbing is first performed , and the same - directional rubbing , the opposite - directional rubbing , the same - directional rubbing and the opposite - directional rubbing are repeatedly performed in that order . that is , the rubbing condition performed in an odd - numbered repeated rubbing is the opposite - directional rubbing , and the rubbing condition performed in an even - numbered repeated rubbing is the same - directional rubbing . the saturation voltage v sat changes each time the rubbing operation is performed . by comparing the fig1 and 15 with each other , the saturation voltage v sat in the odd - numbered repeated rubbing is almost the same as that in the opposite - directional rubbing shown in fig1 , and the saturation voltage v sat in the even - numbered repeated rubbing is almost the same as that in the same - directional rubbing shown in fig1 . therefore , it is ascertained that the saturation voltage v sat in the display panel is determined by the rubbing condition finally performed for the alignment film 25a or 25b . therefore , the judgement whether the rubbing condition performed for the alignment film 25a or 25b is the same - directional rubbing or the opposite - directional rubbing is performed by considering only the rubbing operation finally performed . as is described above , to operate the liquid crystal display panel by applying a low voltage to the display panel , it is effective that the anchoring energy for the alignment film 25a or 25b is made small by finally performing the opposite - directional rubbing , as well as the improvement of the liquid crystal material . however , in cases where the opposite - directional rubbing is performed over the entire surface of an alignment film , there is a case that the arrangement of liquid crystal molecules placed in the neighborhood of a peripheral portion of the pixel electrode 13 in the liquid crystal display panel is put out of order . for example , in case of an active device type liquid crystal display panel , because a high negative voltage is applied to the scanning bus lines 14 respectively arranged between a pair of pixel electrodes 13 , a potential difference occurs between each of the scanning bus lines 14 and each of the pixel electrodes 13 , and an electric field e having a component parallel to the surface of the alignment film 25a is generated for each of the scanning bus lines 14 ( refer to fig1 ( b )). therefore , a peculiar region of the first alignment film 25a on which a pre - tilt angle of each of liquid crystal molecules becomes too large or too small is locally generated just above a peripheral portion of each of the scanning bus lines 14 because of the generation of the electric field e . because a saturation voltage v sat in each of the peculiar regions differs from those in other regions , an image is displayed on the active device type liquid crystal display panel in disturbed condition , and the active device type liquid crystal display panel cannot be operated by applying a low voltage to the display panel . to solve the above problem , as shown in fig1 , portions of the first alignment film 25a arranged in pixel regions 13a are rubbed according to the opposite - directional rubbing , and the other portions of the first alignment film 25a arranged out of the pixel regions 13a are rubbed according to the same - directional rubbing . each of the pixel regions 13a is defined as a region placed just over one of the pixel electrodes 13 . each of shadowed portions surrounded by a dot - dash - line in fig1 denotes one of the pixel regions 13a . therefore , the anchoring energy in the portions of the first alignment film 25a placed just over the pixel electrodes 13 is made small , the anchoring energy in the other portions of the first alignment film 25a which are not placed on any pixel electrode 13 and are placed in the neighborhood of the bus lines 14 and 19 is made large , and the generation of the peculiar regions can be prevented . in the same manner , portions of the second alignment film 25b placed just above the pixel electrodes 13 are rubbed according to the opposite - directional rubbing , and the other portions of the second alignment film 25b not placed above any pixel electrode 13 are rubbed according to the same - directional rubbing . accordingly , because the anchoring energy in the portions of the alignment films 25a and 25b placed in the neighborhood of the bus lines 14 and 19 and not placed in any pixel region 13a is made large , liquid crystal molecules in the neighborhood of the bus lines 14 and 19 are not influenced by the electric field e , and the liquid crystal molecules can be reliably oriented toward the same direction and can reliably have the same pre - tilt angle . in this embodiment , the second alignment film 25b is rubbed according to the opposite - directional rubbing and the same - directional rubbing in the same manner as the first alignment film 25a . however , because the influence of the electric field e on the second alignment film 25 is small , it is applicable that all surface of the second alignment film 25b is rubbed according to the opposite - directional rubbing . a rubbing method in which the portions of the alignment films 25a and 25b are rubbed according to the opposite - directional rubbing and the other portions of the alignment films 25a and 25b are rubbed according to the same - directional rubbing is described with reference to fig1 ( a ) and 17 ( b ). as shown in fig1 ( a ), portions of the first alignment film 25a placed just over the pixel electrode 13 are covered with a plurality of first resist masks 23 , the other portions of the first alignment film 25a not covered with any first resist mask 23 are rubbed according to the same - directional rubbing , and the first resist masks 23 are removed . thereafter , as shown in fig1 ( b ), the other portions of the first alignment film 25a are covered with a second resist mask 24 having a plurality of windows 24a placed just over the pixel electrodes 13 , the other portions of the first alignment film 25a are rubbed through the windows 24a according to the opposite - directional rubbing , and the second resist mask 24 are removed . therefore , a plurality of first rubbing regions relating to the opposite - directional rubbing and a plurality of second rubbing regions relating to the same - directional rubbing are formed on the surface of the first alignment film 25a . next , a plurality of examples of the liquid crystal display panel manufactured according to the above - described technique are described in detail . as shown in fig1 ( a ) and 16 , the first transparent substrate 11 on which the plurality of pixel electrodes 13 are longitudinally and latitudinally arranged to form a plurality of pixels of 600 ร 400 is used , and a normally white mode of liquid crystal display panel of which the cross sectional structure is shown in fig1 ( b ) is manufactured . in this case , a tft is used as each of the active elements 20 . each of the pixel electrodes 13 has a size of about 150 ร 150 ฮผm 2 , and a distance between the pixel electrode 13 and the scanning bus line 14 ( or the data bus line 19 ) is about 10 ฮผm . as a material of the liquid crystal 17 , a liquid crystal having fluorine ( f ) on its end portion is used . polyimide called a trade name &# 34 ; al1054 &# 34 ; manufactured in nippon goseigomu ( synthetic rubber ) corp . is used as materials of the first and second alignment films 25a and 25b . the first and second alignment films 25a and 25b are formed by spin - coating the polyimide on the first and second transparent substrates 11 and 12 . the rubbing operation for the first alignment film 25a placed on the first transparent substrate 11 with the tft 20 is performed as follows . the rubbing operation is performed according to the method shown in fig1 ( a ) and 12 ( b ), and the rubbing role 21 of which a surface is covered with the rayon cloth 21a is used . as a condition of the rubbing operation , a pushing degree of the rayon cloth 21a in the first alignment film 25a is set to 0 . 3 mm , the number of repeated rubbing operations is set to five , a moving speed of the first transparent substrate 11 is set to 350 mm / sec , and a rotational speed of the rubbing role 21 is set to 300 rpm . thereafter , the portions of the first alignment film 25a placed in the pixel regions 13a are repeatedly rubbed five times according to the opposite - directional rubbing shown in fig1 ( b ), and the other portions of the first alignment film 25a not placed in any pixel region 13a are repeatedly rubbed five times according to the same - directional rubbing shown in fig1 ( a ). also , the rubbing operation is performed for the second alignment film 25b placed on the second transparent substrate 12 , on which any tft is not arranged , on the same condition . the portions of the second alignment film 25b placed just above the pixel electrodes 13 are repeatedly rubbed five times according to the opposite - directional rubbing shown in fig1 ( b ), and the other portions of the second alignment film 25b not placed above any pixel electrode 13 are repeatedly rubbed five times according to the same - directional rubbing shown in fig1 ( a ). thereafter , the saturation voltage v sat of the liquid crystal display panel manufactured as the first example is examined . also , a defective ratio r of pixels in the display panel is examined . in cases where one or more liquid crystal molecules placed just above a pixel ( or a pixel electrode 13 ) or placed in the neighborhood of the pixel abnormally rise on the alignment film 25a or 25b , it is judged that the pixel is defective . a result of the examination for the first example is shown in table 1 . in table 1 , the saturation voltage v sat in the normally white mode of liquid crystal display panel is defined as a voltage at which the light transmittance is 1 % on condition that the light transmittance is set to 100 % when a potential difference between the pixel electrode 13 and the counter electrode 16 is zero . also , the defective ration r is expressed by the number of pixels judged to be defective among 500 pixels . also , a first liquid crystal display panel ( not shown ) having the first alignment film 25a of which all surface is rubbed according to the same - directional rubbing is manufactured as a first comparing sample , and a second liquid crystal display panel ( not shown ) having the first alignment film 25a of which all surface is rubbed according to the opposite - directional rubbing is manufactured as a second comparing sample . thereafter , the saturation voltage v sat and the defective ration r of the pixels are examined for the first and second liquid crystal display panels . results of the examination for the first and second comparing samples are also shown in table 1 . the configurations of the first and second liquid crystal display panels are the same as that of the liquid crystal display panel manufactured as the first example , except for the rubbing direction of the first alignment film 25a . table 1______________________________________ first second first comparing comparing example sample sample______________________________________v . sub . sat 2 . 75 v 3 . 16 v 2 . 72 vr 0 0 120______________________________________ as is apparent in table 1 , in case of the first liquid crystal display panel ( the first comparing sample ), though the defective ratio r of the pixels is zero , the saturation voltage v sat is not lowered . also , in case of the second liquid crystal display panel ( the second comparing sample ), though the saturation voltage v sat is lowered , the defective ratio r of the pixels is high . in contrast , in case of the liquid crystal display panel manufactured as the first example , the defective ratio r of the pixels is zero , and the saturation voltage v sat is lowered . therefore , a merit that the saturation voltage v sat is lowered by the opposite - directional rubbing and another merit that the orientation of the liquid crystal molecules is stabilized by the same - directional rubbing can be obtained in the liquid crystal display panel according to the second embodiment . a distance between each of the pixel electrodes 13 ( or pixels ) and each of the bus lines 14 and 19 in the liquid crystal display panel manufactured as the first example is shortened to 5 ฮผm in a second example . in this case , the defective ratio r of the pixels is undesirably increased to about 250 . therefore , as shown in fig1 ( a ), a peripheral portion of each pixel region 13a which is placed in a range from a boundary line of a pixel region 13a to an inside line placed inward from the boundary line of the pixel region 13a by 10 ฮผm is defined as a frame - shaped region 13b of the first alignment film 25a , and a central portion of each pixel region 13a which is placed inside of the frame - shaped region 13b is defined as an inside region 13c of the first alignment film 25a . the inside regions 13c of the first alignment film 25a are denoted by shadowed portions shown in fig1 ( a ). the frame - shaped regions 13b of the first alignment film 25a are rubbed according to the same - directional rubbing as well as the other portions of the first alignment film 25a not placed over any pixel electrode 13 , and the inside regions 13c of the first alignment film 25a are selectively rubbed according to the opposite - directional rubbing . in the same manner , inside regions of the second alignment film 25b narrower than the portions of the second alignment film 25b arranged just above the pixel electrodes 13 are defined , frame - shaped regions of the second alignment film 25b surrounding the inside regions of the second alignment film 25 are defined , the frame - shaped regions of the second alignment film 25b are rubbed according to the same - directional rubbing as well as the other portions of the second alignment film 25b not placed above any pixel electrode 13 , and the inside regions of the second alignment film 25b are selectively rubbed according to the opposite - directional rubbing . as a result , a liquid crystal display panel is manufactured as a second example . the defective ratio r of the pixels in the second example is reduced to zero . in this case , the saturation voltage v sat is 2 . 8 v . the reason that the defective ratio r is reduced is as follows . when the anchoring energy in the frame - shaped regions 13b of the first alignment film 25a which are placed in the neighborhood of the bus lines 14 and 19 is large , it becomes difficult to change the pre - tilt angle of liquid crystal molecules placed on the frame - shaped regions 13b of the first alignment film 25a even though the electric field e caused by the bus lines 14 and 19 influences on the liquid crystal molecules . therefore , the orientation of the major axes of the liquid crystal molecules is not disturbed by the electric field e . a distance between each of the pixel electrodes 13 ( or pixels ) and each of the bus lines 14 and 19 in the liquid crystal display panel manufactured as the first example is shortened to 8 ฮผm in a third example . in this case , the defective ratio r of the pixels is increased to about 60 . therefore , the first alignment film 25a placed on the first transparent substrate 11 on which the tft 20 is arranged is rubbed according to the same - directional rubbing and the opposite - directional rubbing , in the same manner as in the second example . in contrast , all surface of the second alignment film 25b placed on the second transparent substrate 12 on which any tft is not arranged is rubbed according to the opposite - directional rubbing . as a result , a liquid crystal display panel is manufactured as a third example . the defective ratio r of the pixels in the third example is reduced to zero . in this case , the saturation voltage v sat is 2 . 8 v . the reason that the defective ratio r is reduced is that a strength of the electric field e caused by a potential difference between the pixel electrode 13 and the bus lines 14 and 19 is low on the surface of the second alignment film 25b . a difference between the liquid crystal display panel manufactured as the first example and a liquid crystal display panel manufactured as a fourth example is that the number of rubbing operations is changed in the fourth example . that is , the rubbing operations are performed twice for the portions of the first and second alignment films 25a and 25b according to the opposite - directional rubbing , and the rubbing operations are repeatedly performed five times for the other portions of the first and second alignment films 25a and 25b according to the same - directional rubbing . in this case , the other rubbing conditions such as the pushing degree of the rayon cloth 21a in the alignment films 25a and 25b , the moving speed of the transparent substrates 11 and 12 and the rotational speed of the rubbing role 21 are the same as those in the first example . as a result , a liquid crystal display panel is manufactured as a fourth example . the defective ratio r of the pixels in the third example is reduced to zero . in this case , the saturation voltage v sat is reduced to 2 . 71 v which is lower than that in the first example . the same effect is obtained by changing the pushing degree of the rayon cloth 21a in the alignment films 25a and 25b , the moving speed of the transparent substrates 11 and 12 or the rotational speed of the rubbing role 21 . also , following conditions can be selected to lower the anchoring energy for the purpose of lowering the saturation energy , as well as the selection of the same - directional rubbing and the opposite - directional rubbing . that is , when at least one of selective conditions such as the decrease of the pushing degree of the rayon cloth 21a , the decrease of the moving speed of the transparent substrates 11 and 12 and the decrease of the rotational speed of the rubbing role 21 is adopted , the display panel can be operated by applying a low voltage to the display panel . also , in cases where at least one of the selective conditions is additionally adopted when the alignment film 25a or 25b is rubbed according to the opposite - directional rubbing , the anchoring energy for the alignment film 25a or 25b can be more over lowered , and the display panel can be operated by applying a lower voltage to the display panel . in the second and third examples , as shown in fig1 ( a ), the liquid crystal molecules being prevented from abnormally rising on the first alignment film 25a because of the electric field e by rubbing the frame - shaped regions 13b of the first alignment film 25a according to the same - directional rubbing . in this case , the electric field e influencing the liquid crystal molecules placed on the frame - shaped regions 13b of the first alignment film 25a is not generated so much by a potential difference between the data bus line 19 and the pixel electrode 13 but is mainly generated by a potential difference between the scanning ( or gate ) bus line 14 and the pixel electrode 13 . therefore , as shown in fig1 ( b ), two peripheral portions of each pixel region 13a placed in the neighborhood of the gate bus line 14 are defined as gate - side regions 13d , and the gate - side regions 13d of the first alignment film 25a are rubbed according to the same - directional rubbing . also , a plurality of central regions 13e of the first alignment film 25a respectively placed between the two gate - side regions 13d are rubbed according to the opposite - directional rubbing . as a result , a liquid crystal display panel is manufactured as a fifth example . in this case , the defective ratio r and the saturation voltage v sat are the same as those in the second and third examples , and the same effect can be obtained . in the second embodiment , an active element type twisted nematic ( tn ) liquid crystal display panel is used as the liquid crystal display panel . however , even though another type tn liquid crystal display panel is used , the same effect can be obtained . in the above first embodiment of the present invention , a direction for rubbing the surfaces of the alignment films 25a and 25b is the same as or opposite to a moving direction of the alignment film 25a or 25b , and the saturation voltage v sat in the display panel according to the second embodiment is lowered as compared with that in a conventional display panel . the reason that the saturation voltage v sat is lowered is that the energy in the alignment film 25a or 25b is lowered . therefore , the inventors tried to change the anchoring energy in the alignment film 25a or 25 by using orientation methods other than the change of the rubbing condition . as the orientation methods , three orientation methods are known . first , an orientation method for orienting liquid crystal molecules on an alignment film toward the same direction by forming a plurality of grooves in the alignment film is disclosed in a literature &# 34 ; sid digest 93 digest , 1993 , pp . 957 - 960 &# 34 ;. secondly , an orientation method for orienting liquid crystal molecules on an alignment film toward the same direction by radiating electro - magnetic wave to the alignment film is disclosed in a literature &# 34 ; martin schadt et al ., japan , j . apply . phys . vol . 31 , 1992 , pp . 2155 - 2164 &# 34 ;. thirdly , an orientation method for orienting liquid crystal molecules on an alignment film toward the same direction by using a langnuir - blodgett ( lb ) film as the alignment film is disclosed in a literature &# 34 ; makoto murata et al ., japan , j . apply . phys . vol . 31 , 1992 , pp . l189 - l192 &# 34 ;. the direction of the orientation is set to an extension direction of the lb film . the decrease of the anchoring energy in the alignment film according to each of the orientation methods is examined by the inventors . that is , the anchoring energy of the order of 10 - 5 to 10 - 4 j / m 2 is observed , as is described in the literature . therefore , it is apparent that the anchoring energy in the alignment film according to each of the orientation methods is lowered by one or more figures as compared with the change of the rubbing condition . in this case , the measuring method of the anchoring energy is the same as that adopted in the second embodiment . in cases where the alignment films 25a and 25b of the active element type liquid crystal display panel shown in fig1 ( a ) and 11 ( b ) are processed according to one of the three orientation methods , an orientation defective region is generated on the alignment films 25a and 25b . the reason of the generation of the orientation defective region is as follows . in cases where the anchoring energy of a portion of the alignment film 25a or 25b placed in the neighborhood of the scanning bus line 14 or the data bus line 19 is low , a plurality of liquid crystal molecules placed on the portion of the alignment film 25a or 25b rise up in various directions in disorder because of a component of the electric field e extending from the bus line 14 or 19 in a lateral direction , and a so - called reverse tilt region equivalent to the orientation defective region is generated on the portion of the alignment film 25a or 25b placed in the neighborhood of the bus line 14 or 19 . the electric field e is generated by a potential difference between the bus line 14 or 19 and each pixel electrode 13 as is described in the second embodiment . to prevent the generation of the reverse tilt region , it is effective that the anchoring energy in portions of the alignment films 25a and 25b placed just over the pixel electrodes 13 is lowered and the anchoring energy in other portions of the alignment films 25a and 25b placed just over the bus lines 14 and 19 or placed in the neighborhood of the bus lines 14 and 19 is heightened . therefore , after the alignment films 25a and 25b of the liquid crystal display panel shown in fig1 ( a ) and 11 ( b ) are processed according to one of the three orientation methods , the portions of the alignment films 25a and 25b placed just over the pixel electrodes 13 are covered with resist masks , and the other portions of the alignment films 25a and 25b not covered with any resist mask are rubbed , for example , according to the same - directional rubbing described in the second embodiment . therefore , the anchoring energy of other portions of the alignment films 25a and 25b is heightened . in the third embodiment , both the alignment films 25a and 25b are processed according to one of the three orientation methods . however , because the reverse tilt region caused by the electric field e is not generated so much on the second alignment film 25b placed on the second transparent substrate 12 on which any active element is not arranged but is mainly generated on the first alignment film 25a placed on the first transparent substrate 11 on which the active element 20 is arranged , it is applicable that only the second alignment film 25b be processed according to one of the three orientation methods . in this case , though the voltage applied to the scanning bus lines 14 of the liquid crystal panel for the purpose of operating the display panel is heightened a little , it is sufficient to prevent the generation of the reverse tilt region . also , it is preferred that the pre - tilt angle of liquid crystal molecules placed on portions of the alignment film 25a or 25b which are not arranged on any pixel electrode 13 be large . as a first reason , because the pre - tilt angle of liquid crystal molecules which are placed on the portions of the alignment films 25a and 25b processed according to one of the orientation methods is almost zero and small , when the pre - tilt angle of liquid crystal molecules which are placed on the other portions of the alignment films 25a and 25b not arranged on any pixel electrode 13 is enlarged , an average pre - tilt angle of the liquid crystal molecules placed on all surface of the alignment film 25a or 25b can be increased to a value more than zero . as a second reason , the larger the pre - tilt angle of the liquid crystal molecules on the alignment film 25a or 25b , the more effectively the generation of the reverse tilt region is prevented . accordingly , it is required to set the pre - tilt angle of the liquid crystal molecules placed on portions of the alignment film 25a or 25b which are not arranged on any pixel electrode 13 to 5 degrees or more , or preferably 10 degrees or more , by selecting the rubbing condition . in general , a pre - tilt angle of liquid crystal molecules ranges from 2 to 3 degrees . in this first example , a normally white mode type liquid crystal display panel is used . the configuration of the display panel is the same as that manufactured according to the first example of the second embodiment , except for the alignment films 25a and 25b . a liquid crystal having fluorine ( f ) on its end portion is used as the liquid crystal 17 . therefore , a fundamental configuration of the display panel is the same as that shown in fig1 ( a ) and 11 ( b ). as a material composing the alignment films 25a and 25b , a resin which is called rn1046 ( trade name ) manufactured by nissan kagaku ( or chemistry ) corp . is used in the first example . the resin is spin - coated , heated and formed in a film shape . a plan view of the first alignment film 25a arranged on the first transparent substrate 11 on which the active element 20 is arranged is shown in fig1 . after the first alignment film 25a is formed on the first transparent substrate 11 , as shown in fig2 ( a ), the pixel regions 13a of the first alignment film 25a placed just over the pixel electrodes 13 are covered with first resist films 26 . thereafter , remaining surfaces of the first alignment film 25a not covered with any first resist mask 26 are rubbed in a particular rubbing direction , and the first resist masks 26 are removed . therefore , the pre - tilt angle of liquid crystal molecules placed on the remaining surfaces of the first alignment film 25a rubbed is set to about 6 degrees . thereafter , as shown in fig2 ( b ), a photomask 27 arranged on a polarizing plate 28 is prepared . the photomask 27 has a plurality of windows 27a placed just above the pixel regions 13a of the first alignment film 25a , thereafter , the pixel regions 13 a of the first alignment film 25a are radiated by ultra - violet light representing electro - magnetic wave through the polarizing plate 28 and the windows 27a of the photomask 27 . in this case , the ultra - violet light passing through the polarizing plate 28 is linearly polarized in a polarization direction perpendicular to the particular rubbing direction . also , the strength of the ultra - violet light is set to about 15 j / cm 2 . therefore , major axes of liquid crystal molecules placed on the pixel regions 13 a of the first alignment film 25a which are radiated by the ultra - violet light linearly polarized in the polarization direction are oriented in the same polarization direction . the above rubbing processing and the radiation of the ultra - violet light are also performed for the second alignment film 25b arranged on the second transparent substrate 11 on which any active element is not arranged , in the same manner . that is , portions of the second alignment film 25b placed just above the pixel electrodes 13 are radiated by the ultra - violet light linearly polarized in the polarization direction to orient major axes of liquid crystal molecules placed on the portions of the second alignment film 25b in the same polarization direction , and remaining portions of the second alignment film 25b are rubbed in a rubbing direction perpendicular to the polarization direction according to a normal rubbing . thereafter , the liquid crystal 17 is packed between first and second alignment films 25a and 25b , and a liquid crystal display panel manufactured as the first example of the third embodiment is obtained . the saturation voltage v sat of the liquid crystal display panel and the defective ratio r of the pixels are examined and listed on table 2 as the first example . in this case , the saturation voltage v sat is defined as a voltage value at which the light transmittance is 1 % on condition that the light transmittance is set to 100 % when any voltage is not applied to the scanning bus lines 14 of the normally white mode type crystal panel . also , the defective ratio r is expressed by the number of pixels judged to be defective among 500 pixels . also , a first liquid crystal display panel ( not shown ) in which all surfaces of the first and second alignment films 25a and 25b are rubbed according to the same - directional rubbing is prepared , and the saturation voltage v sat of the first liquid crystal display panel and the defective ratio r of the pixels are listed in table 2 as a first comparing sample . also , a second liquid crystal display panel ( not shown ) in which all surfaces of the first and second alignment films 25a and 25b are radiated by the ultra - violet light linearly polarized is prepared , and the saturation voltage v sat of the second liquid crystal display panel and the defective ratio r of the pixels are listed in table 2 as a second comparing sample . the configurations and manufacturing conditions of the first and second liquid crystal display panels are the same as those of the liquid crystal display panel manufactured as the first example of the third embodiment . table 2______________________________________ first second first comparing comparing example sample sample______________________________________v . sub . sat 2 . 71 v 3 . 16 v 2 . 7 vr 0 0 180______________________________________ as is apparent in table 2 , in case of the first liquid crystal display panel ( the first comparing sample ), though the defective ratio r of the pixels is zero , the saturation voltage v sat is not lowered . also , in case of the second liquid crystal display panel ( the second comparing sample ), though the saturation voltage v sat is lowered , the defective ratio r of the pixels is high . in contrast , in case of the liquid crystal display panel manufactured as the first example of the third embodiment , the defective ratio r of the pixels is zero , and the saturation voltage v sat is lowered . therefore , a merit that the saturation voltage v sat is lowered by the decrease of the anchoring energy caused by the radiation of the ultra - violet light and another merit that the orientation of the liquid crystal molecules toward the same direction is stabilized by the rubbing processing can be obtained in the liquid crystal display panel according to the third embodiment . also , after all surfaces of the first and second alignment films 25a and 25b are rubbed in a rubbing direction according to the same - directional rubbing , the pixel regions 13a of the first alignment film 25a and the portion of the second alignment film 25b arranged just above the pixel electrodes 13 are radiated by the ultra - violet light linearly polarized in the polarization direction perpendicular to the rubbing direction through the windows 27a of the photomask 27 . in this case , the saturation voltage v sat is 2 . 75 v which is sufficiently low , and the defective ratio r of the pixels is zero . therefore , because the formation of the resist mask 26 is not required , the manufacturing method of the display panel according to the third embodiment can be simplified , and a throughput of the display panels can be improved . a distance between each of the pixel electrodes 13 ( or pixels ) and each of the bus lines 14 and 19 in the liquid crystal display panel manufactured as the first example is shortened to 5 ฮผm in a second example . in this case , the defective ratio r of the pixels is undesirably increased to about 280 . therefore , the first alignment film 25a on the first transparent substrate 11 on which the active element 20 is arranged is not radiated by the ultra - violet light , but all surface of the first alignment film 25a is rubbed according to the same - directional rubbing . also , as for the second alignment film 25b on the second transparent substrate 12 on which any active element is not arranged , the portions of the second alignment film 25b placed just above the pixel electrodes 13 is radiated by the ultra - violet light linearly polarized in the same manner as in the first example , and remaining portions of the second alignment film 25b are rubbed according to a normal rubbing . in this case , the saturation voltage v sat of the liquid crystal display panel is 2 . 85 , and the defective ratio r of the pixels is zero . therefore , the display panel can be operated by applying a lower voltage to the display panel as compared with the applied voltage in the conventional display panel . a distance between each of the pixel electrodes 13 ( or pixels ) and each of the bus lines 14 and 19 in the liquid crystal display panel manufactured as the first example is also shortened to 5 ฮผm in a third example . in this case , the defective ratio r of the pixels is undesirably increased to about 280 . therefore , the defective ratio r of the pixels is reduced by changing the pre - tilt angle of liquid crystal molecules arranged on the other portions of the first or second alignment film 25a or 25b which are not placed just over or above any pixel electrode 13 . in detail , as a material of the first and second alignment films 25a and 25b , jals - 214 ( trade name ) manufactured by a nippon gosei gomu ( japan synthetic rubber ) corp . is used . the pre - tilt angle can be easily adjusted by using the material . the adjustment of the pre - tilt angle is performed by changing one of the rubbing conditions . for example , the pre - tilt angle is lowered as the number of rubbing operations repeated is increased , and the pre - tilt angle is lowered as the pushing degree of the rubbing cloth 21a in the alignment film 25a or 25b is increased . when the pre - tilt angle ฮธ of the liquid crystal molecules on the alignment film 25a or 25b is changed by changing the number of rubbing operations repeated , a relationship between the defective ratio r of the pixels and the pre - tilt angle ฮธ is shown in fig2 . a numeral written in parentheses indicates the number of rubbing operations repeated . as shown in fig2 , when the pre - tilt angle ฮธ is set to 10 degrees or more , the defective ratio r is reduced to zero . in this case , the saturation voltage v sat of the liquid crystal display panel is lowered to values ranging from 2 . 70 to 2 . 75 v regardless of the change of the pre - tilt angle ฮธ . in the above first to third examples , electro - magnetic wave such as ultra - violet light is radiated to the portions of the first or second alignment film 25a or 25b placed just over or above the pixel electrodes 13 , and the anchoring energy of the portions of the first or second alignment film 25a or 25b is lowered . to lower the anchoring energy of the portions of the first or second alignment film 25a or 25b according to other methods , as shown in fig2 ( a ), a method for forming a plurality of grooves 25c direction on upper surfaces of the first or second alignment film 25a or 25b placed just over or above the pixel electrodes 13 is applicable . in this method , major axes of liquid crystal molecules placed on the upper surfaces of the first or second alignment film 25a or 25b are oriented toward a direction in which the grooves 25c extend . also , as shown in fig2 ( b ), another method for using the lb film as a material of the first or second alignment film 25a or 25b is applicable . in this method , major axes of liquid crystal molecules placed on the first or second alignment film 25a or 25b are oriented toward a direction in which the lb film is pulled . in the above methods , the other portions of the first or second alignment film 25a or 25b not arranged on or above any pixel electrode 13 are rubbed according to a normal rubbing . in the fourth embodiment , the anchoring energy of the portions of the first or second alignment film 25a or 25b placed just over or above the pixel electrodes 13 is lowered . however , in cases where the electric field e caused by a potential difference between the bus line 14 or 19 and the pixel electrode 13 greatly influences liquid crystal molecules placed on the first or second alignment film 25a or 25b , it is preferred that the frame - shaped regions 13b of the first alignment film 25a and the frame - shaped regions of the second alignment film 25b defined in the second example of the second embodiment ( refer to fig1 ( a )) be rubbed according to the same - directional rubbing as well as the other portions of the alignment films 25a and 25b . also , in cases where the electric field e caused by a potential difference between the scanning bus line 14 and the pixel electrode 13 greatly influences liquid crystal molecules placed on the first alignment film 25a , it is preferred that the gate - side regions 13d of the first alignment film 25a defined in the fifth example of the second embodiment ( refer to fig1 ( b )) be rubbed according to the same - directional rubbing . in the third embodiment , the active element type twisted nematic ( tn ) liquid crystal display panel is used . however , even though another type liquid crystal display panel such as a simple matrix type tn liquid crystal display panel is used , the same effect can be obtained . fig2 ( a ) is a plan view of a simple matrix type tn liquid crystal display panel according to a third embodiment of the present invention . fig2 ( b ) is a cross sectional view of the simple matrix type tn liquid crystal display panel shown in fig2 ( a ). as shown in fig2 ( a ) and 23 ( b ), a plurality of scanning wiring lines 34 spaced at regular intervals are arranged in parallel on a first surface of a first transparent substrate 31 , and the first surface of the first transparent substrate 31 and the plurality of scanning wiring lines 34 are covered with a first alignment film 35a . also , a plurality of data wiring lines 39 spaced at regular intervals are arranged in parallel on a first surface of a second transparent substrate 32 facing the first surface of the first transparent substrate 31 . the first surface of the second transparent substrate 32 and the data wiring lines 39 are covered with a second alignment film 35b . the first surfaces of the first and second alignment films 35a and 35b face each other through a liquid crystal 37 packed , and an extending direction of the scanning wiring lines 34 is perpendicular to that of the data wiring lines 39 . in addition , a polarizing plate 38a is arranged on a second surface of the first transparent substrate 31 , and a polarizing plate 38b is arranged on a second surface of the second transparent substrate 32 . in the above configuration of a simple matrix type tn liquid crystal display panel , each of the pixel regions 13a is placed in a region of the first alignment film 35a in which one scanning wiring line 34 and one data wiring line 39 cross over each other . also , each of the pixel regions is placed in a region of the second alignment film 35b in which one scanning wiring line 34 and one data wiring line 39 cross over each other . the anchoring energy of liquid crystal molecules placed on the pixel regions 13a of the first alignment film 35a is lowered by rubbing the pixel regions 13a according to the opposite - directional rubbing , by radiating the ultra - violet light linearly polarized to the pixel regions 13a , by arranging a plurality of grooves on the first surface of the first alignment film 35a or by using the lb film as a material of the first surface of the first alignment film 35a . also , the anchoring energy of liquid crystal molecules placed on other portions of the first alignment film 35a is heightened by rubbing the other portions of the first alignment film 35a according to the same - directional rubbing . therefore , the liquid crystal molecules placed on the pixel regions 13a can easily rise up when a voltage is applied to the scanning wiring lines 34 , so that an operation voltage required to operate the simple matrix type tn liquid crystal display panel according to the fourth embodiment can be lowered . also , because a rising motion of the liquid crystal molecules placed on the other portions of the first alignment film 35a is slowly performed , the generation of defective pixels can be prevented . it is applicable that the distribution of the anchoring energy in the second alignment film 35b be formed in the same manner as that in the first alignment film 35a . in this case , the liquid crystal molecules placed on the second alignment film 35b rise up in the same manner as those on the first alignment film 35a . | 2 |
in a diagrammatic , perspective view , fig1 shows a gas cooking appliance 1 of the first version , installed in a sill plate 3 . the gas cooking appliance has a glass - ceramic plate 2 as a cooking surface , which is attached to a cooking area frame 8 , generally by gluing with a silicone adhesive . in the embodiment according to fig1 the gas cooking appliance has three cooking zones 4 that are heated by means of gas - radiation burners ( not shown ) that are arranged under the glass - ceramic plate . as indicated overall by the above - cited de 43 26 945 c2 , an insulating part 9 , which can also be seen partially from the cutaway view of fig2 of this application , is provided below glass - ceramic plate 2 to provide a gap therebetween . this insulating part 9 has recesses ( not shown ) for the gas - radiation burners , but also exhaust gas ducts 6 for discharging exhaust gases from the individual gas - radiation burners . exhaust gas ducts 6 are joined below a cooking - surface zone 5 that is often used for boiling off and finally end in an exhaust gas opening 8a that is designed according to the invention . to form exhaust gas opening 8a , cooking surface 2 is beveled upward around a line 2a in the rear part in such a way that unitary beveled portion 2b projects upward like a panel . there is a back wall provided by the frame 8 which is in fig1 spaced from the rear edge of the bent area 2b . here , cooking surface 2 is glued in cooking surface - frame housing 8 in such a way that a slot - shaped , adhesive - free opening 8a is formed as an outlet opening for hot exhaust gases 7 at the rear of the cooking surface 2 and gas cooking appliance 1 . the control knobs c are shown at the right side of the cooking surface but may be at the front of the cooking surface as is shown in fig1 . according to the corresponding cutaway view , hot exhaust gases 7a of several hundred degrees flow into exhaust gas ducts 6 that are made from insulating elements 9 to outlet opening 8a and , shortly before this , are mixed with cold air 7b that a fan produces , so that overall a considerably colder exhaust gas stream 7 leaves the gas cooking appliance . to protect the bent cooking surface edge , optionally a metal contour 8b can be mounted mechanically . this contour must not be glued with silicone since in this case it would not seal . the overflow protection in this design is ensured by the portion of cooking surface 2b that is beveled upward . the advantage of the design of exhaust gas opening 8a lies in the fact that , on the one hand , no adhesive compounds are located in the hot exhaust gas stream and in that overflow protection is automatically ensured by the shape of the cooking surfaces . in addition , the ventilation lattices are omitted from the metal frame , which , on the one hand , have a negative impact on the overall design , and , on the other hand , impede cleaning . this type of design according to the invention can also be used for gas cooking appliances of the second version with atmospheric burners . in this case , opening 8a is used as a fresh air opening for primary air . fig3 shows a diagram of such a gas cooking appliance 1 with an atmospheric burner 10 , which is recessed in the conventional way in glass - ceramic plate 2 . generally , a cooking area has three to four such open burners 10 . glass - ceramic plate 2 is glued into cooking area frame housing 8 , whereby the gas cooking appliance itself is installed in sill plate 3 . unlike in fig1 only to indicate the possible variations , bending edge 2a with bent area 2b lies on the ( right ) side of cooking surface 2 . in this case , as in fig1 a slot - shaped opening 8a is made between the upper edge of bent area 2b and frame 8 , via which fresh air or primary air 11 flows into the cooking area . as in fig1 bending edge 2a can , of course , also be arranged on the rear side or on the left side of the cooking surface . which alternative is selected depends on the design and the appliances that are arranged in the vicinity of the gas cooking appliance in sill plate 3 . fig4 shows another embodiment of the invention with respect to the design of the opening for fresh air or exhaust air , whereby the case of exhaust air is depicted . parts that are identical to those according to fig1 - 3 are given the same reference numbers . in fig4 beveled area 2b has a partial recess 2c that forms exhaust gas opening 8a , through which cooled exhaust gases 7 flow out . in addition , the upper edge of bent area 2b is embedded in cooking area frame 8 . in the case of fig4 opening 8a is thus not formed by a space ( gap ) in other appliance parts , as in fig1 - 3 , but by a recess in bent area 2b itself . fig5 shows another embodiment according to this principle . accordingly , bent area 2b has recesses 2d that are arranged like a line , through which the exhaust air or fresh air flows . the circular recess is indicated only by way of example . if design considerations so dictate , other geometric configurations can also be used . the line - like arrangement is also given only by way of example . recesses 2d can also be arranged in an offset pattern , for example . recesses 2d are invariably to be arranged in such a way that they are sufficiently far from the cooking surface plane , thus ensuring overflow protection . otherwise , the upper edge of bent area 2b is completely embedded in cooking area frame 8 ; this stresses an overall closed impression . fig5 a shows an arrangement similar to that of fig5 . in this case , glass - ceramic plate 2 of the cooking surface is bent over two bending edges 2a , in such a way that the area 2b with recesses 2d is raised by a portion 2h that extends at an obtuse angle ฮธ relative to the cooking surface to extend horizontal plane and is arranged plane parallel to the cooking surface . in this embodiment , the exhaust gas flows vertically upward , which has an advantageous effect for catching exhaust gases in the exhaust hoods that are usually present in the kitchen . also advantageously , the exhaust gases cannot gradually discolor any wall parts of the kitchen appliance . fig6 shows an arrangement analogous to that according to fig2 whereby , however , outlet opening 8a is not made , as in the case of fig2 between the upper edge of the bent area that is protected by a contour 8b and an elevation of cooking area frame 8 , but between this edge and a lowered side of frame 8 , so that exhaust air 7 flows toward the rear . fig7 shows a partial area 2b that is formed bent concentrically toward the rear as a ventilation duct ( fresh air or exhaust air ), in contrast to the preceding embodiments with a bent area 2b , which extends completely over one side of the cooking surface . in this case , partial area 2b also does not have to be located concentrically to the cooking surface side , as in fig7 ; it can also be molded on eccentrically , i . e ., on one side , as depicted in fig8 specifically , relative to the cooking surface , either behind or to the right or else to the left . fig9 and 10 also show widely differing possible variations for the design of bent area 2b in the example of an upright range 12 at front and rear edge areas 14 and 15 . in upright range 12 according to fig9 which is designed with an integrated switch part 13 as a gas cooking appliance with open gas burners 10 ( as in fig3 ), glass - ceramic plate 2 is bent downward toward the front , adjacent edge 14 whereby the opening for fresh air 11 is made in area 2b . upright range 12 according to fig1 can be designed as desired as a gas cooking appliance with gas - radiation burners or as an appliance with atmospheric burners . the glass - ceramic plate is therefore partially bent both forward adjacent from edge 15 and toward the rear at rear edge 5 , with the formation of an area 2b in each case . in this case , front area 2b forms the intake opening for the primary - fresh air in the case of open burners ; conversely , rear partial bend 2b forms the opening for the discharge of exhaust air 7 in the case where upright range 12 is equipped with gas - radiation burners . in the previous embodiments , the opening for exhaust air and fresh air was formed between the upper edge of the bend and a cooking area or range device part . in fig1 and 12 , embodiments are depicted in which the opening is made in a part of another type of cooking appliance . fig1 shows a recessed tray with glass - ceramic cooking surfaces , composed of an electric part a and a gas part b . glass - ceramic plate 2 of electric part a has cooking zones 14 and a lip 2e that is bent downward by 90 ยฐ and has a lower edge . glass - ceramic plate 2 of gas part b , which is lower than electric part a , has open burners 10 and a rectangular lip 2b that is bent upward and has an upper edge , whereby a certain distance is left between bent areas 2b and 2e that acts as an intake opening for fresh air 11 in gas burner part b . in a corresponding way , fig1 shows a cooking table that is composed of an electric part a with a glass - ceramic plate 2 , which has a rectangular beveled area 2e and cooking zones 14 , as well as a gas part b , which is lower than electric part a , with a glass - ceramic plate 2 , which has a rectangular partial area 2b that is bent upward ( covered partially by beveled edge 2e in the drawing ), as well as atmospheric gas burners 10 . as in the case of fig1 , two bent areas 2e and 2b that are arranged some distance apart also form an opening here with a guideway for fresh air 11 to gas part b . the entire disclosure of all applications , patents and publications , cited above and below , and of corresponding german application no . 197 03 301 . 6 , filed jan . 30 , 1997 , is hereby incorporated by reference . from the foregoing examples , one skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . | 5 |
in the following detailed description , reference is made to various specific embodiments in which the invention may be practiced . these embodiments are described with sufficient detail to enable those skilled in the art to practice the invention , and it is to be understood that other embodiments may be employed , and that structural and logical changes may be made without departing from the spirit or scope of the present invention . fig2 shows an embodiment of a page configuration for a page - based memory device , for example , nand flash memory , capable of accommodating varying ecc and redundancy byte requirements according to the present invention . a memory array 85 is partitioned into a main array 20 , a column redundancy array 50 , and an additional cells array 90 . memory cells 5 in the main array 20 are used for storing user data 22 and ecc bytes 24 . memory cells 5 in the column redundancy array 50 are used for replacing malfunctioning cells . memory cells 5 in the additional cells array 90 may be designated for use as either additional ecc bytes or additional column redundancy cells . the additional cells array 90 designation is controlled by the output of a multiplexer 100 . the main decoder 30 and the column redundancy decoder 60 send channel signals 45 and 75 , respectively , to the multiplexer 100 . a select signal 120 is used to select which channel will be presented to the output 110 of the multiplexer 100 . for example , as illustrated , the channel select signal 120 is set to ecc . accordingly , a decoded address signal 45 from the main array 30 is sent through the multiplexer as output 110 and the cells 5 in the additional cells array 90 are designated for use as additional ecc bytes . memory array 85 is not limited to fixed amounts of redundancy cells and ecc bytes . by controlling which decoded address signal is sent to the additional cells array 90 , ecc bytes or column redundancy cells may be augmented as needed . the select signal 120 may be controlled at various operating levels , such as at a user - level , an operating system level or a manufacturer level . since redundancy cell needs are typically determined at the manufacturing level , the additional cells array 90 designation may be set exclusively as part of a preset manufacturing setting . fig3 shows an example of a page configuration of nand flash memory according to the invention . the total number of bytes is equal to the data bytes ( n )+ redundancy bytes ( m )+ ecc bytes ( l )+ additional bytes ( k ). the total number of redundancy bytes ( m ) or ecc bytes ( l ) available depends on the designation of the additional bytes ( k ). fig3 a shows a configuration in which the additional cells array 90 is designated for use as additional ecc bytes . the total number of ecc bytes ( l ) available is equal to ecc bytes ( l )+ additional bytes ( k ). fig3 b shows a page configuration in which the variable array is designated for use as additional redundancy bytes . the total number of redundancy bytes ( l ) available is equal to redundancy bytes ( m )+ additional bytes ( k ). in this manner additional ecc bytes may be made available as needed for stronger ecc algorithms , or additional redundancy bytes may be made available when implementing a weaker ecc algorithm . fig4 is a block diagram of a processing system 400 utilizing a memory device , e . g ., a flash memory device 410 , constructed in accordance with an embodiment of the present invention . the system 400 may be a computer system , a process control system , camera system or any other system employing a processor and associated flash memory . the system 400 includes a central processing unit ( cpu ) 420 , e . g ., a microprocessor , that communicates with the flash memory device 410 and an i / o device 430 over a bus 440 . it must be noted that the bus 440 may be a series of buses and bridges commonly used in a processor system , but for convenience purposes only , the bus 440 has been illustrated as a single bus . a second i / o device 450 is illustrated , but is not necessary to practice the invention . the processor system 400 may also include random access memory ( ram ) device 460 and may include a read - only memory ( rom ) device ( not shown ), and peripheral devices such as a floppy disk drive 470 and a compact disk ( cd ) rom drive 480 that also communicate with the cpu 420 over the bus 440 as is well known in the art . while the invention has been described in conjunction with specific embodiments , it is evident that many alternatives , modifications , permutations and variations will become apparent to those of ordinary skill in the art in light of the foregoing description . accordingly , it is intended that the present invention embrace all such alternatives , modifications , permutations and variations as fall within the scope of the appended claims . | 6 |
the method for manufacturing a light - transmissive metal oxide sintered body according to the invention is described below . the method for manufacturing a light - transmissive metal oxide sintered body according to the invention by subjecting a sintered body composed mainly of metal oxide to hot isostatic pressing ( hip ) treatment at a hip heat treatment temperature t set in a range of 1 , 000 to 2 , 000 ยฐ c . to form a light - transmissive sintered body , is characterized in that the hip treatment includes the step of heating at a ramp rate over a temperature range from room temperature to the hip heat treatment temperature t , the temperature range is divided into a plurality of stages , the ramp rate is controlled in each divided stage , and the ramp rate of at least a final stage inclusive of the hip heat treatment temperature t is 10 ยฐ c ./ h to 180 ยฐ c ./ h . the detail is described below . the method of the invention preferably involves furnishing a preselected metal oxide in particle form as raw material powder ( or starting material ), press molding the powder into a predetermined shape , burnout and sintering into a sintered body consolidated to a relative density of at least 95 % by weight . the sintered body is then subjected to hot isostatic pressing ( hip ) treatment . thereafter , post - treatment such as annealing may be optionally carried out . as the raw material powder , any particulate metal oxides which exhibit light transmission when sintered may be utilized . that is , particles of one or more type selected from metal oxides which exhibit light transmission when sintered may be utilized as the raw material powder . for example , particles of ysz ( yttria - stabilized zirconia ), spinel ( al 2 o 3 - 26 wt % mgo ), plzt ( lead lanthanum zirconate titanate ), alumina , yag ( y 3 al 5 o 12 ), luag ( lu 3 al 5 o 12 ), tgg ( tb 3 ga 5 o 12 ), sesquioxides , bgo ( bi 4 ge 3 o 12 ), and gso ( gd 2 sio 5 ) are preferred as well as particles of oxides of constituent elements of metal oxides which are generally confirmed or expected to have light transmission , for example , particles of oxides of one or more metal elements selected from the group consisting of mg , y , sc , lanthanides , ti , zr , al , ga , si , ge , pb , and bi . any of these particulate metal oxides are weighed so as to meet an appropriate ratio and used as the raw material powder . when it is desired to manufacture a m 2 o 3 type sesquioxide sintered body wherein m is one or more rare earth elements selected from the group consisting of y , sc , and lanthanide series elements , use may be made of particulate oxides of one or more rare earth elements selected from the group consisting of y , sc , and lanthanide series elements , specifically a powder consisting of particulate oxides of one or more rare earth elements selected from the group consisting of y , sc , lu , tb , yb , gd , nd , eu , ho , dy , tm , sm , pr , ce , and er and particulate zr oxide . the amount of zro 2 powder added is preferably up to 1 % by weight ( exclusive of 0 % by weight ), more preferably up to 0 . 5 % by weight . if zro 2 powder is not at all added , bubble coalescence is promoted in the sintering step so that bubble growth may take place to form coarse bubbles of micron size , detracting from light transmission . if more than 1 % by weight of zro 2 powder is added , undesirably part of zro 2 may segregate in the m 2 o 3 type sesquioxide sintered body as a second phase during the sintering step , detracting from light transmission . the aforementioned particulate metal oxides preferably have a purity of at least 99 . 9 % by weight . their particle shape is not particularly limited , and particles of angular , spherical or plate shape , for example , are advantageously used . even a powder having undergone secondary agglomeration may be advantageously used , and a granular powder granulated by atomization treatment such as spray drying may also be advantageously used . the process of preparing the raw material powder is not particularly limited , and a raw material powder prepared by co - precipitation , pulverization , spray pyrolysis , or any other synthesis techniques may be advantageously used . if desired , the raw material powder thus prepared may be treated in a wet ball mill , bead mill , jet mill , dry jet mill , hammer mill or the like . in the practice of the invention , the raw material powder of metal oxide particles preferably has such a particle size distribution ( or particle size distribution of secondary particles if particles agglomerate into secondary particles ) that a particle diameter ( d 2 . 5 ) corresponding to an accumulation of 2 . 5 % from the minimum side may fall in a range of 180 nm to 2 , 000 nm . if d 2 . 5 value is less than 180 nm , bubbles may coalesce and grow in the sintering step into coarse bubbles of micron size , detracting from light transmission . if d 2 . 5 value exceeds 2 , 000 nm , there is a possibility that voids formed between particles during molding become too large , which cooperates with the constituent particles of already sufficiently enlarged size , so that the free energy on the particle surface is reduced . this prevents effective progress of sintering and makes it difficult to produce a dense light - transmissive sintered body . although the measurement of particle size is not particularly limited , reference is preferably made to the value obtained by dispersing the raw material particles in a liquid medium and measuring a diameter by the light scattering or light diffraction method , because the particle size distribution can also be evaluated . to the raw material powder used herein , a sintering inhibitor may be added if desired . for a particularly high light transmission , it is preferred to add a sintering inhibitor compatible with each light - transmissive metal oxide . the inhibitor should preferably have a purity of at least 99 . 9 % by weight . where the sintering inhibitor is not added , it is recommended to choose the raw material powder whose primary particles are of nano size and have very high sintering activity . such a choice is optional . further , for the purpose of improving the quality stability and yield in the manufacture process , various organic additives are preferably added . in the practice of the invention , no particular limits are imposed on these additives , and various dispersants , binders , lubricants , plasticizers and the like may be advantageously utilized . to the raw material powder used herein , an optical function activator may be added , if desired , so as to comply with the desired optical application . for example , there may be added a laser material capable of creating a population inversion state for laser oscillation at the desired wavelength , a scintillator material capable of fluorescence upon receipt of ionization radiation at high sensitivity , or a supersaturation absorber capable of imparting supersaturation absorption function for pulse laser oscillation , such as neodymium , praseodymium , chromium or the like . in the practice of the invention , these activators may be added if desired . the activator , if added , should preferably have a purity of at least 99 . 9 % by weight . in the manufacture method of the invention , a conventional press molding step is advantageously used . that is , a quite common pressing step of filling a mold with powder and applying pressure in a certain direction , or a cold isostatic press ( cip ) step of closely packing a waterproof deformable container with powder and applying hydrostatic pressure may be utilized . notably , the applied pressure may be adjusted as appropriate while monitoring the relative density of the molded body . though not critical , it is recommended to manage the pressure in a range of 300 mpa or less that can be handled by a commercially available cip system , because the manufacture cost is reduced . alternatively , a hot press step capable of achieving molding and sintering straight through the molding step , discharge plasma sintering step , microwave heating step or the like may also be advantageously utilized . in the manufacture method of the invention , a conventional binder burnout step may be advantageously utilized . that is , the method may involve the step of burning out the binder by heating in a heating furnace . the type of the atmosphere gas is not particularly limited , and air , oxygen , hydrogen or the like may be used . although the burnout temperature is not particularly limited , where an organic component such as binder is added , heating up to the temperature at which the organic component is decomposed off is preferred . in the manufacture method of the invention , a general sintering step may be advantageously utilized . that is , a heating / sintering step of resistance heating or induction heating mode may be advantageously utilized . the type of the atmosphere gas is not particularly limited , and an inert gas , oxygen , hydrogen or the like may be used , or even vacuum is acceptable . in the sintering step , the sintering temperature is adjusted as appropriate depending on the preselected starting material . in general , a temperature which is lower by several tens of degrees of centigrade to 100 ยฐ c . or 200 ยฐ c . than the melting point of a sintered body to be prepared from the preselected starting material is preferably selected . it is preferred to select the temperature which is as high as possible within the range so that the material may be consolidated to a relative density of at least 95 % by weight . when it is intended to produce a metal oxide sintered body in which a temperature zone inducing a phase change to a phase other than the cubic crystal system is present in proximity to the selected temperature , sintering at the temperature which is strictly managed to be lower than that temperature gives the advantage that optical strain or cracking is unlikely to occur in the material because a phase shift from non - cubic to the cubic crystal system does not substantially take place . the sinter holding time is adjusted as appropriate depending on the preselected starting material . while several hours of holding is generally satisfactory in many cases , it is recommended to ensure a time until the metal oxide sintered body is consolidated to a relative density of at least 95 % by weight . in the manufacture method of the invention , the sintering step should be followed by the hot isostatic pressing ( hip ) treatment step . the hip apparatus used in this step may be of general construction . the hip treatment is carried out by placing the sintered body having completed treatments until the sintering step in a pressure vessel , applying a uniform pressure across the entire sintered body by means of a pressurizing gas medium , and concurrently heating the sintered body at the predetermined hip heat treatment temperature t by means of an electric resistance heating unit mounted within the pressure vessel . the hip apparatus includes a crucible ( carbon vessel ) with a perforated carbon lid in which the sintered body is received , and a hip furnace in which the carbon vessel is placed , the hip furnace having heating means in the form of a carbon heater , wherein the sintered body is heated by the carbon heater while it is entirely compressed by introducing a pressurizing gas medium into the hip furnace . the pressurizing gas medium used herein may be an inert gas such as argon or ar โ o 2 . it is convenient and preferable that the applied pressure is equal to or less than 196 mpa which can be managed by a commercial hip apparatus . the hip heat treatment temperature t may be set as appropriate , depending on the type of metal oxide of the sintered body and / or the sintered state of the sintered body , for example , in the range of 1 , 000 to 2 , 000 ยฐ c ., preferably 1 , 400 to 1 , 900 ยฐ c . like the sintering step , it is essential that the hip temperature t be equal to or lower than the melting point and / or the phase transition point of metal oxide of the sintered body . if the hip temperature t exceeds 2 , 000 ยฐ c . and hence , exceeds the melting point and / or the phase transition point of metal oxide of the sintered body , it becomes difficult to perform adequate hip treatment . if the hip temperature t is lower than 1 , 000 ยฐ c ., an effect of improving the light transmission of the sintered body is not available . in the disclosure , the temperature associated with the hip treatment always refers to the temperature of the metal oxide sintered body . in the actual hip apparatus wherein the metal oxide sintered body is received in the carbon vessel disposed inside the carbon heater in the hip furnace , it is difficult to measure the temperature of the sintered body directly . since the difference in temperature between the carbon heater and the carbon vessel during the heating and cooling steps is equal to or less than 10 ยฐ c ., and the temperature of the carbon vessel is substantially equal to the temperature of the metal oxide sintered body therein , it is acceptable to consider the measured temperature of the carbon heater in the hip furnace to be the temperature of the metal oxide sintered body . accordingly , once the temperature of the carbon heater in the hip furnace is measured by a thermocouple ( e . g ., platinum - rhodium ), the hip apparatus controls the steps of heating and cooling the metal oxide sintered body on the basis of the measured temperature . the manufacture method of the invention is characterized in that the hip treatment includes the step of heating at a ramp rate over a temperature range , the temperature range of the heating step is divided into a plurality of stages , the ramp rate is controlled in each divided stage , and the ramp rate of at least a final stage inclusive of the hip heat treatment temperature t is 10 ยฐ c ./ h to 180 ยฐ c ./ h , preferably 10 ยฐ c ./ h to 150 ยฐ c ./ h , more preferably 10 ยฐ c ./ h to 60 ยฐ c ./ h , and most preferably 20 ยฐ c ./ h to 40 ยฐ c ./ h . if the ramp rate exceeds 180 ยฐ c ./ h , an effect of improving the light transmission of the sintered body is not available . a ramp rate of less than 10 ยฐ c ./ h is unacceptable from the aspect of productivity because the hip treatment takes a too long time . the temperature control in the heating step is preferably conducted by a proportional - integral - derivative ( pid ) controller on the basis of the measurement results . in the hip treatment , the pressure applied by the pressurizing gas medium is preferably 50 to 300 mpa , more preferably 100 to 300 mpa . at a pressure of less than 50 mpa , a light transmission improving effect may not be available . if the pressure is increased beyond 300 mpa , no further improvement in light transmission is available , and an excessive load may be imposed on the apparatus , causing damage to the apparatus . figure illustrates an exemplary temperature profile of metal oxide sintered body during hip treatment step in the method for manufacturing a light - transmissive metal oxide sintered body according to the invention . the temperature profile illustrated herein includes heating , temperature holding , and cooling steps , provided that the hip heat treatment temperature t is 1 , 625 ยฐ c . the temperature profiles p 11 , p 12 , p 21 , and p 22 belong to the invention whereas the temperature profile p 99 belongs to the prior art . referring to the temperature profiles p 11 as a typical example , it is described how to control the temperature during the hip treatment according to the invention . according to the invention , once the hip heat treatment temperature t is set at 1 , 625 ยฐ c ., the temperature range s from room temperature to the hip heat treatment temperature t in the heating step of the hip treatment is divided into a plurality of stages . the mode of division may be determined from a balance of the efficiency of hip treatment with the light transmission improving effect of sintered body . for example , the temperature range s may be equally divided into 2 to 20 stages . in figure , the temperature range s from room temperature ( 25 ยฐ c .) to 1 , 625 ยฐ c . is equally divided into 14 stages . next , the ramp rate for each divided stage is set , and specifically , the ramp rate of at least a final stage inclusive of the hip heat treatment temperature t is set in a range from 10 ยฐ c ./ h to 180 ยฐ c ./ h . as long as this requirement is met , the ramp rates of the remaining stages are set arbitrary . for example , with the productivity of hip treatment taken into account , it is recommended that the ramp rate of the final stage of the heating step be set in a range from 10 ยฐ c ./ h to 180 ยฐ c ./ h and the ramp rates of the remaining stages be set in a range from 200 ยฐ c ./ h to 800 ยฐ c ./ h . the temperature profile p 11 in figure shows that the ramp rate of the final stage ( 14 ) of the heating step is 60 ยฐ c ./ h and the ramp rates of the remaining stages ( 1 ) to ( 13 ) are 400 ยฐ c ./ h , equal to the conventional temperature profile p 99 . next , the sintered body is held at the hip heat treatment temperature t for a certain time ( temperature holding step ). the holding time is not particularly limited and may be set as appropriate for the selected material ( type of metal oxide of the sintered body ). the temperature profile p 11 in figure includes a holding time of 3 hours . next , the sintered body is cooled down to room temperature ( cooling step ). the temperature drop rate of the cooling step is not particularly limited , and the step may be either air cooling or spontaneous cooling . it is unnecessary to select an intentionally slow rate like the heating step . notably , an excessive drop rate and / or an excessive pressure withdrawal is undesirable because an incidental impact is applied to the metal oxide sintered body being manufactured , becoming the cause of cracks . the temperature profile p 11 in figure includes a drop rate of 400 ยฐ c ./ h , equal to the conventional temperature profile p 99 . by carrying out hip treatment according to the temperature profile p 11 set as above , the sintered body is improved in light transmission . with respect to the temperature profile of hip heat treatment , since it suffices that the ramp rate of at least the final stage inclusive of the hip heat treatment temperature t is in the range from 10 ยฐ c ./ h to 180 ยฐ c ./ h , for example , the ramp rates of all stages in the heating step of hip treatment may be 10 ยฐ c . to 180 ยฐ c ./ h . the temperature profile p 12 in figure shows that the ramp rates of all stages ( 1 ) to ( 14 ) in the heating step are equal to 60 ยฐ c ./ h while other steps ( temperature holding and cooling steps ) are the same as in temperature profile p 11 . the temperature profile p 21 in figure shows that the ramp rates of stages ( 1 ) to ( 13 ) in the heating step are equal to 400 ยฐ c ./ h and the ramp rate of the final stage ( 14 ) is 30 ยฐ c ./ h while other steps ( temperature holding and cooling steps ) are the same as in temperature profile p 11 . the temperature profile p 22 in figure shows that the ramp rates of all stages ( 1 ) to ( 14 ) in the heating step are equal to 30 ยฐ c ./ h while other steps ( temperature holding and cooling steps ) are the same as in temperature profile p 11 . in the conventional temperature profile p 99 , the ramp rates of all stages ( 1 ) to ( 14 ) in the heating step are equal to 400 ยฐ c ./ h while other steps ( temperature holding and cooling steps ) are the same as in temperature profile p 11 . in the manufacture method of the invention , once the metal oxide sintered body has passed the series of steps until the hip treatment step , the sintered body is preferably subjected to optical polishing on its axially opposed end surfaces with respect to an optical axis of utilization . the optical surface is polished at an accuracy of up to ฮป / 8 , more preferably up to ฮป / 10 , provided that the measurement wavelength ฮป is 633 nm . notably , more precise optical measurement becomes possible when an antireflective coating is deposited on the optically polished surface . by the method for manufacturing a light - transmissive metal oxide sintered body according to the invention , a metal oxide sintered body having very high light transmission is provided . in the practice of the invention , if desired , the sintered body may be assembled into a device compliant with the intended optical application . examples and comparative examples are given below by way of illustration and not by way of limitation . the average particle size of powder is a weight average value determined by the laser light diffraction method . in the hip apparatus , the temperature of the carbon heater inside the hip furnace was measured by a platinum - rhodium thermocouple . the heating and cooling steps were controlled on the assumption that the measured temperature was the temperature of a metal oxide sintered body . an example using y 2 o 3 powder as the raw material powder is described . there was furnished y 2 o 3 powder with a purity of at least 99 . 9 wt %, available from shin - etsu chemical co ., ltd ., to which was added 0 . 5 wt % of zro 2 powder , available from daiichi kigenso kagaku kogyo co ., ltd . further an organic dispersant and organic binder were added to the powders , which were dispersed and mixed in ethanol in a zirconia ball mill . the milling time was 24 hours . subsequent spray drying yielded a granular raw material ( starting material ) having an average particle size of 20 ฮผm . next , a mold having a diameter of 10 mm was filled with the starting material . using a uniaxial press molding machine , the material was preliminary molded into a rod of 20 mm long , which was hydrostatically pressed under a pressure of 198 mpa into a cip compact . the cip compact was placed in a muffle furnace where it was heat treated in air at 800 ยฐ c . for 3 hours for binder burnout . next , the compact as burned - out was placed in a vacuum heating furnace where it was heated at a ramp rate of 100 ยฐ c ./ h to a temperature of 1 , 500 - 1 , 700 ยฐ c ., held at the temperature for 3 hours , and cooled at a drop rate of 600 ยฐ c ./ h , yielding a sintered body . in the step , the sintering temperature and holding time were adjusted such that the sintered sample might have a relative density of 96 %. the sintered body was then subjected to hip heat treatment at a temperature t of 1 , 500 - 1 , 800 ยฐ c . and a pressure of 190 mpa using ar gas as pressurizing medium , for a holding time of 3 hours . in this example , heat treatment was carried out while the temperature ramp rate was set at nine levels as shown in table 1 and the drop rate was fixed at 400 ยฐ c ./ h . a comparative sample was prepared under conditions according to the temperature profile p 99 in figure . the hip treated samples were ground and polished to a length of 14 mm . the opposite optical end surfaces of each sample were subjected to final optical polishing to an optical surface accuracy of ฮป / 8 wherein measurement wavelength ฮป = 633 nm . the sample was further coated with an antireflective coating designed to a central wavelength of 1 , 064 nm before a transmittance at wavelength 1 , 064 nm was measured , from which a visible region transmission loss per sintered body unit length was computed . the bubble state inside each optical surface was observed under an electron microscope ( sem ). further , the samples of examples 1 - 1 , 1 - 5 , 1 - 7 and 1 - 9 and comparative example 1 on their optical surface were subjected to mirror etching treatment with hydrochloric acid at constant temperature until sintered grain boundary was definitely seen . the sample was observed under sem and sintered grain size was measured . an average of 400 grains is reported as average sintered grain size . a burnout cip compact was prepared as in example 1 aside from using lu 2 o 3 powder with a purity of at least 99 . 9 wt %, available from shin - etsu chemical co ., ltd . next , the burnout compact was placed in a vacuum heating furnace where it was heated at a ramp rate of 100 ยฐ c ./ h to a temperature of 1 , 600 - 1 , 800 ยฐ c ., held at the temperature for 3 hours , and cooled at a drop rate of 600 ยฐ c ./ h , yielding a sintered body . in the step , the sintering temperature and holding time were adjusted such that the sintered sample might have a relative density of 96 %. the sintered body was then subjected to hip heat treatment at a temperature t of 1 , 600 - 1 , 850 ยฐ c . and a pressure of 190 mpa using ar gas as pressurizing medium , for a holding time of 3 hours . in this example , heat treatment was carried out while the temperature ramp rate was set at nine levels as shown in table 2 and the drop rate was fixed at 400 ยฐ c ./ h . a comparative sample was prepared under conditions according to the temperature profile p 99 in figure . the hip treated samples thus obtained were ground and polished to a length of 14 mm . the opposite optical end surfaces of each sample were subjected to final optical polishing to an optical surface accuracy of ฮป / 8 wherein measurement wavelength ฮป = 633 nm . the sample was further coated with an antireflective coating designed to a central wavelength of 1 , 064 nm before a transmittance at wavelength 1 , 064 nm was measured , from which a visible region transmission loss per sintered body unit length was computed . the bubble state inside each optical surface was observed under an electron microscope ( sem ). further , the samples of examples 2 - 1 , 2 - 5 , 2 - 7 and 2 - 9 and comparative example 2 on their optical surface were subjected to mirror etching treatment with hydrochloric acid at constant temperature until sintered grain boundary was definitely seen . the sample was observed under sem and sintered grain size was measured . an average of 400 grains is reported as average sintered grain size . a burnout cip compact was prepared as in example 1 aside from using sc 2 o 3 powder with a purity of at least 99 . 9 wt %, available from shin - etsu chemical co ., ltd . next , the burnout compact was placed in a vacuum heating furnace where it was heated at a ramp rate of 100 ยฐ c ./ h to a temperature of 1 , 600 - 1 , 800 ยฐ c ., held at the temperature for 3 hours , and cooled at a drop rate of 600 ยฐ c ./ h , yielding a sintered body . in the step , the sintering temperature and holding time were adjusted such that the sintered sample might have a relative density of 96 %. the sintered body was then subjected to hip heat treatment at a temperature t of 1 , 600 - 1 , 850 ยฐ c . and a pressure of 190 mpa using ar gas as pressurizing medium , for a holding time of 3 hours . in this example , heat treatment was carried out while the temperature ramp rate was set at nine levels as shown in table 3 and the drop rate was fixed at 400 ยฐ c ./ h . a comparative sample was prepared under conditions according to the temperature profile p 99 in figure . the hip treated samples thus obtained were ground and polished to a length of 14 mm . the opposite optical end surfaces of each sample were subjected to final optical polishing to an optical surface accuracy of ฮป / 8 wherein measurement wavelength ฮป = 633 nm . the sample was further coated with an antireflective coating designed to a central wavelength of 1 , 064 nm before a transmittance at wavelength 1 , 064 nm was measured , from which a visible region transmission loss per sintered body unit length was computed . the bubble state inside each optical surface was observed under an electron microscope ( sem ). further , the samples of examples 3 - 1 , 3 - 5 , 3 - 7 and 3 - 9 and comparative example 3 on their optical surface were subjected to mirror etching treatment with hydrochloric acid at constant temperature until sintered grain boundary was definitely seen . the sample was observed under sem and sintered grain size was measured . an average of 400 grains is reported as average sintered grain size . as seen from the results of tables 1 to 3 , independent of the type of starting material , that is , for all of y 2 o 3 powder , lu 2 o 3 powder and sc 2 o 3 powder , when the ramp rate of the final stage ( 14 ) in the temperature range s is set at 60 ยฐ c ./ h , as in examples 1 - 1 to 1 - 4 , 2 - 1 to 2 - 4 , and 3 - 1 to 3 - 4 , the transmission loss per unit length is reduced ( or improved ) to about 2 / 5 as compared with comparative examples 1 to 3 corresponding to the conventional ramp rate ( 400 ยฐ c ./ h , i . e ., ramp rate is not slowed down ). also , when the ramp rate of the final stage ( 14 ) in the temperature range s is reduced to 30 ยฐ c ./ h , as in examples 1 - 5 , 1 - 6 , 2 - 5 , 2 - 6 , 3 - 5 and 3 - 6 , the transmission loss per unit length is significantly reduced ( or improved ) to about โ
as compared with comparative examples 1 to 3 corresponding to the conventional ramp rate ( 400 ยฐ c ./ h , i . e ., ramp rate is not slowed down ). it is further demonstrated that when the ramp rate of the final stage ( 14 ) in the temperature range s is reduced to 150 ยฐ c ./ h , as in examples 1 - 7 , 1 - 8 , 2 - 7 , 2 - 8 , 3 - 7 and 3 - 8 , the transmission loss per unit length is reduced ( or improved ) to about ยฝ as compared with comparative examples 1 to 3 corresponding to the conventional ramp rate ( 400 ยฐ c ./ h , i . e ., ramp rate is not slowed down ). for those metal oxide sintered bodies in which the transmission loss per unit length is improved as in examples 1 - 1 to 1 - 8 , 2 - 1 to 2 - 8 , and 3 - 1 to 3 - 8 , the amount of residual bubbles inside the optical surface is dramatically reduced . it is seen from the above results that when the ramp rate of the final stage in the temperature range s of hip treatment step is reduced to 150 ยฐ c ./ h or lower , there are obtained light - transmissive oxide sintered bodies featuring a significantly reduced amount of residual bubbles in the metal oxide sintered body , an extremely low transmission loss , and true clarity , as compared with the hip treatment at the conventional ramp rate . the results of examples 1 - 9 , 2 - 9 and 3 - 9 demonstrate that the upper limit of ramp rate below which an effect of improving transmission loss per unit length begins to appear is 180 ยฐ c ./ h . it is also seen that grain growth is promoted during the hip treatment step at the conventional ramp rate of 400 ยฐ c ./ h , whereas grain growth is suppressed during the hip treatment step where the ramp rate of the final stage in the temperature range s is reduced to 150 ยฐ c ./ h or lower . the results of examples 1 - 9 , 2 - 9 and 3 - 9 demonstrate that the upper limit of ramp rate below which an effect of suppressing grain growth begins to appear is 180 ยฐ c ./ h . it is seen from the above results that when the ramp rate of the heating step during the hip treatment is selected to a sufficient condition to suppress the growth of sintered grains , there is obtained a truly clear light - transmissive oxide sintered body in which the amount of bubbles remaining in the metal oxide sintered body is significantly reduced by a certain cause - and - effect relationship and the transmission loss is minimized . it is evident that the sufficient condition to suppress the growth of sintered grains is attainable when the ramp rate of at least the final stage in the temperature range s is reduced to a rate of 180 ยฐ c ./ h or lower , which is remarkably lower than the conventional ramp rate . next , a terbium base sesquioxide faraday cell obtained by sintering a mixture of tb 4 o 7 powder and y 2 o 3 powder is described as an exemplary metal oxide sintered body having an optical function . there were furnished tb 4 o 7 powder and y 2 o 3 powder , both with a purity of at least 99 . 9 wt % and available from shin - etsu chemical co ., ltd . these raw material powders were mixed in a volume ratio 1 : 1 , to which was added 0 . 5 wt % of zro 2 powder , available from daiichi kigenso kagaku kogyo co ., ltd . further an organic dispersant and organic binder were added to the powders , which were dispersed and mixed in ethanol in a zirconia ball mill . the milling time was 24 hours . subsequent spray drying yielded a granular raw material ( starting material ) having an average particle size of 20 ฮผm . next , a mold having a diameter of 10 mm was filled with the starting material . using a uniaxial press molding machine , the material was preliminary molded into a rod of 20 mm long , which was hydrostatically pressed under a pressure of 198 mpa into a cip compact . the cip compact was placed in a muffle furnace where it was heat treated in air at 800 ยฐ c . for 3 hours for binder burnout . next , the compact as burned - out was placed in a vacuum heating furnace where it was heated at a ramp rate of 100 ยฐ c ./ h to a temperature of 1 , 500 - 1 , 700 ยฐ c ., held at the temperature for 3 hours , and cooled at a drop rate of 600 ยฐ c ./ h , yielding a sintered body . in the step , the sintering temperature and holding time were adjusted such that the sintered sample might have a relative density of 96 %. the sintered body was then subjected to hip heat treatment at a temperature t of 1 , 500 - 1 , 800 ยฐ c . and a pressure of 190 mpa using ar gas as pressurizing medium , for a holding time of 3 hours . in this example , heat treatment was carried out while the temperature ramp rate was set at nine levels as shown in table 4 and the drop rate was fixed at 400 ยฐ c ./ h . a comparative sample was prepared under conditions according to the temperature profile p 99 in figure . the hip treated samples were ground and polished to a length of 10 mm . the opposite optical end surfaces of each sample were subjected to final optical polishing to an optical surface accuracy of ฮป / 8 wherein measurement wavelength ฮป = 633 nm . the sample was further coated with an antireflective coating designed to a central wavelength of 1 , 064 nm before a transmittance at wavelength 1 , 064 nm was measured , from which a visible region transmission loss per sintered body unit length was computed . the bubble state inside each optical surface was observed under an electron microscope ( sem ). further , the samples of examples 4 - 1 , 4 - 5 , 4 - 7 and 4 - 9 and comparative example 4 on their optical surface were subjected to mirror etching treatment with hydrochloric acid at constant temperature until sintered grain boundary was definitely seen . the sample was observed under sem and sintered grain size was measured . an average of 400 grains is reported as average sintered grain size . as described above , like examples 1 to 3 , when the ramp rate of at least the final stage ( 14 ) in the temperature range s is set at 60 ยฐ c ./ h as in examples 4 - 1 to 4 - 4 , the transmission loss per unit length is reduced ( or improved ) to about 10 / 22 as compared with comparative example 4 corresponding to the conventional ramp rate ( 400 ยฐ c ./ h , i . e ., ramp rate is not slowed down ). also , when the ramp rate of the final stage ( 14 ) in the temperature range s is reduced to 30 ยฐ c ./ h as in examples 4 - 5 and 4 - 6 , the transmission loss per unit length is significantly reduced ( or improved ) to about โ
as compared with comparative example 4 corresponding to the conventional ramp rate ( 400 ยฐ c ./ h , i . e ., ramp rate is not slowed down ). it is further demonstrated that when the ramp rate of the final stage ( 14 ) in the temperature range s is reduced to 150 ยฐ c ./ h as in examples 4 - 7 and 4 - 8 , the transmission loss per unit length is reduced ( or improved ) to about ยฝ as compared with comparative example 4 corresponding to the conventional ramp rate ( 400 ยฐ c ./ h , i . e ., ramp rate is not slowed down ). for those metal oxide sintered bodies in which the transmission loss per unit length is improved as in examples 4 - 1 to 4 - 8 , the amount of residual bubbles inside the optical surface is dramatically reduced . the results of example 4 - 9 demonstrate that the upper limit of ramp rate below which an effect of improving transmission loss per unit length begins to appear is 180 ยฐ c ./ h . it is also seen that like examples 1 to 3 , grain growth is promoted during the hip treatment step at the conventional ramp rate of 400 ยฐ c ./ h , whereas grain growth is suppressed during the hip treatment step where the ramp rate of the final stage in the temperature range s is reduced to 150 ยฐ c ./ h or lower . the results of example 4 - 9 demonstrate that the upper limit of ramp rate below which an effect of suppressing grain growth begins to appear is 180 ยฐ c ./ h . it is seen from the above results that in the case of a terbium base sesquioxide faraday cell as well , when the ramp rate of the heating step during the hip treatment is selected to a sufficient condition to suppress the growth of sintered grains , there is obtained a truly clear terbium base sesquioxide faraday sintered body in which the amount of bubbles remaining in the metal oxide sintered body is significantly reduced by a certain cause - and - effect relationship and the transmission loss is minimized . it is evident that the sufficient condition to suppress the growth of sintered grains is attainable when the ramp rate of at least the final stage in the temperature range s is reduced to a rate of 180 ยฐ c ./ h or lower , which is remarkably lower than the conventional ramp rate . finally , each of the sintered bodies of examples 4 - 1 to 4 - 9 thus obtained was constructed as a terbium base sesquioxide faraday cell , the periphery of which was covered with a smco magnet of a sufficient size to saturate magnetization . this optical function unit was set on an optical axis between a polarizer and an analyzer . next , light of wavelength 1 , 064 nm was directed from both forward and backward directions to confirm a faraday rotation effect . as a result , all the cells showed a transmission loss of less than 0 . 1 db in the forward direction and an extinction ratio of at least 40 db in the backward direction . it is demonstrated that when the manufacture method of the invention is applied to a metal oxide sintered body having optical function , a truly clear oxide sintered body having a minimized transmission loss is obtained . although the invention has been described with reference to the embodiments , the invention is not limited thereto , and other embodiments may occur to , or various additions , changes and deletions may be made by those skilled in the art . all such embodiments fall in the scope of the invention as long as the advantages and results of the invention are obtainable . | 2 |
examples 1 - 4 of the inventive imaging optical system are given below . fig1 , 5 and 7 are illustrative in lens arrangement section of examples 1 , 2 , 3 and 4 , respectively , upon focused on an object point at infinity . in these drawings , an aperture stop is indicated by s , a first lens by l 1 , a second lens by l 2 , a plane - parallel plate for an electronic image pickup device &# 39 ; s cover glass or the like by cg , and an image plane by i . it is noted that the plane - parallel plate cg could be provided on its surface with a wavelength band limiting multilayer film or , alternatively , it could be designed to have a low - pass filter function . as shown in fig1 , this example is directed to an imaging optical system comprising , in order from its object side , an aperture stop s , a negative first lens l 1 that is convex on its object side and has both its surfaces defined by aspheric surfaces and weak power , a second lens l 2 that is convex on its object side and has both its surfaces defined by aspheric surfaces and positive power , and a cover glass cg . the specifications for the wide angle - of - view optical system according to example 1 are : as shown in fig2 , this example is directed to an imaging optical system comprising , in order from its object side , an aperture stop s , a negative ,ยฅ first lens l 1 that is convex on its object side and has both its surfaces defined by aspheric surfaces and weak power , a second lens l 2 that is convex on its object side and has both its surfaces defined by aspheric surfaces and positive power , and a cover glass cg . the specifications for the wide angle - of - view optical system according to example 2 are : as shown in fig3 , this example is directed to an imaging optical system comprising , in order from its object side , an aperture stop s , a positive first lens l 1 that is convex on its object side and has both its surfaces defined by aspheric surfaces and weak power , a second lens l 2 that is convex on its object side and has both its surfaces defined by aspheric surfaces and positive power , and a cover glass cg . the specifications for the wide angle - of - view optical system according to example 3 are : as shown in fig4 , this example is directed to an imaging optical system comprising , in order from its object side , an aperture stop s , a negative first lens l 1 that is convex on its object side and has both its surfaces defined by aspheric surfaces and weak power , a second lens l 2 that is convex on its object side and has both its surfaces defined by aspheric surfaces and positive power , and a cover glass cg . the specifications for the wide angle - of - view optical system according to example 4 are : numerical data on each example will be enumerated later . it is noted that the symbols used hereinafter but not hereinbefore mean : r 1 , r 2 , . . . : radius of curvature of each lens , n d1 , n d2 , . . . : d - line refractive index of each lens , and [ heading - 0172 ] here let x represent an optical axis with the proviso that the direction of propagation of light is taken as positive , and y represent a direction orthogonal with respect to the optical axis . then , aspheric configuration is given by x =( y 2 / r )/[ 1 +{ 1 โ( k + 1 ) ( y / r ) 2 } 1 / 2 ]+ a 4 y 4 + a 6 y 6 + a 8 y 8 + a 10 y 10 where r is an axial radius of curvature , k is a conical coefficient , and a 4 , a 6 , a 8 and a 10 are the 4 th , 6 th , 8 th and 10 th aspheric coefficients . fig2 , 6 and 8 are aberration diagrams for examples 1 , 2 , 3 and 4 , respectively , upon focused at infinity , wherein โ ฯ โ stands for a half angle of view . the values of conditions ( 1 ) to ( 7 ) in examples 1 - 4 are tabulated below . condition example 1 example 2 example 3 example 4 ( 1 ) โ 0 . 001 โ 0 . 001 0 . 034 โ 0 . 058 ( 2 ) โ 0 . 059 0 . 000 โ 0 . 064 โ 0 . 031 ( 3 ) 0 . 66 0 . 81 0 . 66 0 . 78 ( 4 ) 0 . 62 0 . 59 0 . 61 0 . 59 ( 5 ) 0 . 10 0 . 11 0 . 09 0 . 14 ( 6 ) โ 0 . 96 โ 0 . 93 โ 0 . 91 โ 1 . 00 ( 7 ) โ 1 . 15 โ 1 . 27 โ 1 . 13 โ 1 . 24 while the aspheric lenses in examples 1 - 4 are all formed of plastics , it is understood that the plastic lenses could be replaced by glass lenses . for instance , much higher performance could be achieved by use of glass having a refractive index higher than that of the plastic material used in any of the above examples . likewise , the use of special low - dispersion glass could be more effective at correction of chromatic aberrations . the use of a plastic material of low hygroscopicity is particularly preferable because degradation of performance due to environmental changes is substantially reduced ( for instance , zeonex made by nippon zeon co ., ltd .). with a view to cutting off unnecessary light such as ghosts and flares , it is acceptable to rely upon a flare stop in addition to the aperture stop s . in examples 1 - 4 , that flare stop could be located at any desired position between the aperture stop s and the first lens l 1 , the first lens l 1 and the second lens l 2 , and the second lens l 2 and the image plane i . alternatively , the lens frame could be used to cut off flare light rays or another member may be used as the flare stop . such flare stops could be obtained by direct printing , coating , seal bonding on the optical system , etc ., and configured in any desired form such as circular , oval , rectangular , polygonal forms or forms surrounded with functional curves . the flare stop used could be designed to cut off not only harmful light beams but also light beams such as coma flare around the screen . each lens could have been provided with an antireflection coating for the purpose of reducing ghosts and flares . multicoatings are preferred because of having the ability to reduce ghosts and flares effectively . alternatively , infrared cut coatings may have been applied on lens surfaces , cover glass surfaces or the like . focus adjustment could be carried out by focusing . focusing could be performed by moving the whole lenses or extending or retracting some lenses . a drop , if any , of brightness of the peripheral area of an image could be reduced by the shifting of the ccd microlenses . for instance , the design of ccd microlenses could be changed in association with the angle of incidence of light rays at each image height , or decreases in the quantity of light at the peripheral area of the image could be corrected by image processing . throughout examples 1 - 4 , the first lens l 1 is formed of any material capable of absorbing near infrared radiation , and the plane - parallel plate is thinned without use of an ir cut filter or coating . in the plane - parallel plate cg shown in fig1 , 5 , and 7 , a low - pass filter is integral with a ccd cover glass . for further compactness , it is not always necessary to use a focusing mechanism . to secure focusing precision in a frequently used object point distance range in this case , the receiving plane of the ccd could be located at an image - formation position having a finite object point distance ( of , e . g ., 2 m to 0 . 3 m ). the imaging system according to the invention constructed as described above may be applied to phototaking systems where object images formed through image - formation optical systems are received at image pickup devices such as ccds , in particular , digital cameras or video cameras as well as pcs and telephone sets that are typical information processors , in particular , easy - to - carry cellular phones . given below are some such embodiments . fig9 - 11 are conceptual illustrations of a phototaking optical system 41 for digital cameras , in which the imaging optical system according to the invention is incorporated . fig9 is a front perspective view of the external appearance of a digital camera 40 , and fig1 is a rear perspective view of the same . fig1 is a sectional view of the construction of the digital camera 40 . in this embodiment , the digital camera 40 comprises a phototaking optical system 41 including a phototaking optical path 42 , a finder optical system 43 including a finder optical path 44 , a shutter 45 , a flash 46 , a liquid crystal display monitor 47 and so on . as the shutter 45 mounted on the upper portion of the camera 40 is pressed down , phototaking takes place through the phototaking optical system 41 , for instance , the imaging optical system according to example 1 . an object image formed by the phototaking optical system 41 is formed . on the image pickup plane of a ccd 49 via a cover glass cg provided with a near - infrared cut coating and having a low - pass filter function . an object image received at ccd 49 is shown as an electronic image on the liquid crystal display monitor 47 via processing means 51 , which monitor is mounted on the back of the camera . this processing means 51 is connected with recording means 52 in which the phototaken electronic image may be recorded . it is here noted that the recording means 52 may be provided separately from the processing means 51 or , alternatively , it may be constructed in such a way that images are electronically recorded and written thereon by means of floppy discs , memory cards , mos or the like . this camera may also be constructed in the form of a silver - halide camera using a silver - halide film in place of ccd 49 . moreover , a finder objective optical system 53 is located on the finder optical path 44 . an object image formed by the finder objective optical system 53 is in turn formed on the field frame 57 of a porro prism 55 that is an image - erecting member . in the rear of the porro prism 55 there is located an eyepiece optical system 59 for guiding an erected image into the eyeball e of an observer . it is here noted that cover members 50 are provided on the entrance sides of the phototaking optical system 41 and finder objective optical system 53 as well as on the exit side of the eyepiece optical system 59 . with the thus constructed digital camera 40 , it is possible to achieve high performance and compactness , because the phototaking optical system 41 is of high performance and compactness . in the embodiment of fig1 , plane - parallel plates are used as the cover members 50 ; however , it is acceptable to use powered lenses . fig1 , 13 and 14 are illustrative of a personal computer that is one example of the information processor in which the imaging optical system according to the invention is built as an objective optical system . fig1 is a front perspective view of a personal computer 300 in use , fig1 is a sectional view of a phototaking optical system 303 in the personal computer 300 , and fig1 is a side view of the state of fig1 . as shown in fig1 , 13 and 14 , the personal computer 300 comprises a keyboard 301 via which an operator enters information therein from outside , information processing or recording means ( not shown ), a monitor 302 on which the information is shown for the operator , and a phototaking optical system 303 for taking an image of the operator and surrounding images . for the monitor 302 , use may be made of a transmission type liquid crystal display device illuminated by backlight ( not shown ) from the back surface , a reflection type liquid crystal display device in which light from the front is reflected to show images , or a crt display device . while the phototaking optical system 303 is shown as being built in the upper right portion of the monitor 302 , it may be located somewhere around the monitor 302 or keyboard 301 . this phototaking optical system 303 comprises , on a phototaking optical path 304 , an objective lens 112 comprising , for instance , the imaging optical system of example 1 of the invention ( roughly shown ) and an image pickup device chip 162 for receiving an image . these are built in the personal computer 300 . here a cover glass cg having a low - pass filter function is additionally applied onto the image pickup device chip 162 to form an integral imaging unit 160 , which can be fitted into the rear end of the lens barrel 113 of the objective lens 112 in one - touch operation . thus , the assembly of the objective lens 112 and image pickup device chip 162 is facilitated because of no need of alignment or control of surface - to - surface spacing . the lens barrel 113 is provided at its end with a cover glass 114 for protection of the objective lens 112 . an object image received at the image pickup device chip 162 is entered via a terminal 166 in the processing means of the personal computer 300 , and shown as an electronic image on the monitor 302 . as an example , an image 305 taken of the operator is shown in fig1 . this image 305 may be shown on a personal computer on the other end via suitable processing means and the internet or telephone line . fig1 ( a ), 15 ( b ) and 15 ( c ) are illustrative of a telephone set that is one example of the information processor in which the imaging optical system according to the invention is built , especially a convenient - to - carry cellular phone . fig1 ( a ) and fig1 ( b ) are a front and a side view of a cellular phone 400 , respectively , and fig1 ( c ) is a sectional view of a phototaking optical system 405 . as shown in fig1 ( a ), 15 ( b ) and 15 ( c ), the cellular phone 400 comprises a microphone 401 for entering the voice of an operator therein as information , a speaker 402 for producing the voice of the person on the other end , an input dial 403 via which the operator enters information therein , a monitor 404 for displaying an image taken of the operator or the person on the other end and indicating information such as telephone numbers , a phototaking optical system 405 , an antenna 406 for transmitting and receiving communication waves , and processing means ( not shown ) for processing image information , communication information , input signals , etc . here the monitor 404 is a liquid crystal display device . it is noted that the components are not necessarily arranged as shown . the phototaking optical system 405 comprises , on a phototaking optical path 407 , an objective lens 112 comprising , for instance , the imaging optical system of example 1 and an image pickup device chip 162 for receiving an object image . these are built in the cellular phone 400 . here a cover glass cg having a low - pass filter function is additionally applied onto the image pickup device chip 162 to form an integral imaging unit 160 , which can be fitted into the rear end of the lens barrel 113 of the objective lens 112 in one - touch operation . thus , the assembly of the objective lens 112 and image pickup device chip 162 is facilitated because of no need of alignment or control of surface - to - surface spacing . the lens barrel 113 is provided at its end with a cover glass 114 for protection of the objective lens 112 . an object image received at the image . pickup device chip 162 is entered via a terminal 166 in processing means ( not shown ), so that the object image can be displayed as an electronic image on the monitor 404 and / or a monitor on the other end . the processing means also include a signal processing function for converting information about the object image received at the image pickup device chip 162 into transmittable signals , thereby sending the image to the person on the other end . many modifications could be made to the examples and embodiments as described above according to what is recited in the claims . | 6 |
in most countries , the mobile network is completely diverse from the wireline network except for some shared transport links , which have very high availability . fig1 is a block diagram of a high availability broadband access link , illustrating various aspects of the invention . the primary configuration is shown in full lines ; optional blocks for additional functionality are shown in dotted lines . as seen in the embodiment of fig1 , a customer is connected to a wireline access network 20 over customer premises equipment ( cpe ) illustrated at 5 . the direction of the arrows in fig1 shows traffic flow โ upstream โ from the user to the network , although traffic will actually flow in both directions . a ha ( high availability ) interface between the customer and the cpe 5 is denoted with 10 , and the broadband interface between the cpe 5 and the wireline network 20 is denoted with 15 . a wireline channel has generally superior performance characteristics such as high throughput , low cost per bit , and low packet loss , latency ( packet delay ), and jitter ( variability in packet delay ), as compared to a wireless channel , so that the wireline link is normally set as the โ default โ link . fig1 also illustrates a wireless network 25 that covers the location of cpe 5 . the invention enables cpe 5 to automatically and transparently restore the broadband wireline service in the case of a failure of link 15 , by establishing a wireless connection 30 through wireless network 25 . at the other end of the connection , a diverse link into the destination server ( not shown ) ensures connectivity will not be lost in the event of almost any single point failure . because the data will normally traverse the wireline link 15 , except under problem conditions , it normally places no load on the wireless network 30 . under failure conditions the customer node 5 automatically diverts traffic to the wireless data link . since the wireless connection is already established through signaling , switching of traffic along the redundant wireless link is performed very fast ( e . g . 50 ms ). cpe 5 includes a link monitoring mechanism ( link monitor ) 51 and a data switching mechanism 52 . the link monitor 51 monitors the integrity of link 15 and generates a fault signal when the broadband access connection on the wireline link under - performs . note that the fault signal is a generic term used to define the signal that triggers operation of the data switching mechanism 52 to begin transmitting data received from the customer over the wireless link 30 . the term โ under - performance โ as used in this specification refers to link 15 being failed , performing poorly , or being overloaded . the wireline link is for example declared โ failed โ when no traffic is received at the far end . this may happen for example upon detection of a loss of signal , or the failure to respond out of a period in which traffic was expected , or failure of the far - end network device to respond to an active inquiry . the wireline link is declared as โ performing poorly โ when the bit error rate of the received traffic is higher than a configured limit , or the packet loss is too high , or the flow of packets has excessive latency , or jitter . still further , the wireline link is declared โ overloaded โ on detection that all the available bandwidth is fully occupied , ( e . g . the measured throughput is at or near wireline link capacity ). in addition , link monitor 51 monitors link 15 for detecting recovery to normal conditions . that is , it detects the conditions that allow a return to โ normal โ wireline transmission after diversion to the wireless link has occurred . this monitoring may be for example performed using test signals transmitted from the user site to the network at specific time intervals and the success of carrying that traffic is used to determine if switching back to the wireline link is possible . the frequency with which the wireline link is tested may be increased progressively between tests to avoid the testing from impacting on a connection which is suffering from a long duration problem . still further , a small amount of the low priority user traffic may be used as a test signal . as indicated above , data switching mechanism 52 switches the data path from the wireline link 15 to wireless link 30 and back , after the fault signal clears . by adding the backup wireless data link 30 to a dsl or fibre access link 15 , the customer is provided with the ability to restore connectivity for low volume and speed , critical services without over - engineering either network . this results in high availability for these critical services at low cost . a wireline link processor 53 ( a modem ) performs data formatting and signalling according to the protocol used on wireline link 15 . as discussed above , this could be a broadband communication link such as dsl , cable modem , or optical ethernet transceiver , etc . similarly , a wireless link processor 55 performs data formatting and signalling according to the protocol used on wireless link 30 . some examples of the possible technologies which could be used for the wireless link include a cdma 1x network , a cellular โ 3g โ network , a 802 . 11 network , or a 802 . 16 or โ wimax โ network . fig1 shows processing of forward traffic that accesses networks 20 or 25 from cpe 5 . the traffic processing for the reverse direction ( from network 20 or 25 to cpe 5 ) is performed in a similar manner . namely , the switch receives the traffic from one of the two links 15 , or 30 , as established by adequate signalling , and routes it to the customer over ha interface 10 . as noted above , the invention allows the wireless channel to be activated not just on failure of the wireline channel , but also in the situations where the wireline channel is suffering from performance impairment , such as inadequate throughput , excessive bit error rate or packet loss , or excessive delay . the nature and number of link performance parameters that trigger the switch , as well as the level of acceptable values may be configured by the user in the link monitoring mechanism 51 . fig1 is drawn showing the key decision to switch to the alternate path as being determined by the link monitoring mechanism 51 and implemented in the data switching mechanism 52 . in this instance , the network link reconfiguring mechanism 61 plays no active role in switching to the alternate link . mechanism 61 simply passively learns ( eg . by ethernet mac bridging ) which link is active . alternatively , the network link reconfiguring mechanism 61 may determine that switching to the backup link is required , and the customer premise equipment ( cpe ) can be made passive . in general it is assumed that one end only will be responsible for making the switching decision to avoid the need for coordination between cpe 5 and network provider equipment ( npe ) 6 , although the decision making could be split between the cpe function 51 and the npe function 61 . for example , npe 6 could make switching decisions on factors such as bit error rate or capacity loading , while cpe 5 could make switching decision based on loss of signal or latency . in the event of failure or performance degradation , cpe 5 delivers the upstream traffic identified as high priority to the wireless link 30 in preference to other traffic types , for example in accordance with the diffserve qos model . traffic prioritization is useful because the backup link 30 through the wireless network typically has lower capacity than the wireline network link 15 and also has a relatively high cost per bit . it is also common for wireless based networks to have more variable performance than is typically the case for wireline networks . it is therefore useful in most instances to have a means of identifying which traffic is most important and treating it differently . an analogous prioritization of downstream traffic is performed by the network link downstream filtering mechanism 62 . the invention provides for additional functionality , shown in dotted lines , for better controlling which traffic on a wireline link should be backed up to a wireless link of lower capacity . the identification of important traffic may be set by the customer , and may also be a function of the cpe 5 and network provider equipment 6 . the identification of high priority traffic may be based on one or more of the following factors : the source or destination mac address , the 802 . 1q vlan id , the 802 . 1q ethernet priority marking , the source or destination ip address , or the ip class of service identifier ( eg . diffserve code point ). to select the high reliability traffic from the respective flow , additional data filtering mechanisms need to be employed at the customer premise and at a network provider premise , as shown in dotted line of fig1 by units 58 and 62 . the data filtering function is preferably provided for the forward direction in the cpe 5 between the ha interface 10 and data switching mechanism 52 , and is provided for the reverse traffic ( from the network to cpe 5 ) in the network link downstream filtering mechanism 62 within the network provider equipment npe 6 . a further variant of the invention allows the wireless channel to be activated not just on failure or degradation of the wireline channel , but also in the situation where the wireline channel has reached maximum capacity , that is wireless becomes the โ overflow โ channel and both channels 15 and 30 operate simultaneously . link monitor 51 detects this condition based e . g . on flow rate measurement . in this โ overflow โ mode , the two connections operate simultaneously . this is in contrast to the โ backup โ mode where the wireline network does not carry traffic when traffic is switched to the wireless link and the wireless link does not carry traffic when traffic is switched to the wireline link . the โ overflow &# 39 ; mode โ, unlike existing link aggregation mechanisms such as 802 . 3ad and ml ppp , keeps all possible traffic on the primary wireline link , and the minimum possible traffic on the wireless link . to deliver this overflow function , a mechanism must be implemented at both sides of the link to distribute the traffic between the two links . in the forward traffic direction ( user to network ), a link splitting functionality is performed by the data switching mechanism 52 and the split traffic is merged back into a single stream by the link reconfiguring mechanism 61 , shown in dotted line at network provider equipment 6 . for the reverse traffic ( network to user ), the link reconfiguring mechanism 61 splits the traffic streams for distribution along the multiple links , and the traffic is merged into as single stream again at the data switching mechanism 52 in the cpe . if traffic filtering functions are to be performed on traffic upstream to the network which exceeds the link capacity , ( i . e . to drop low priority packets or buffer traffic to keep it within the available capacity ), these must be implemented within the mechanism 58 . if traffic filtering functions are to be performed on traffic downstream to the customer which exceeds the link capacity , these must be implemented within the mechanism 62 . three alternative approaches are proposed in this invention for the basic management of the parallel wireline and wireless links , i . e . for implementing the data switching mechanism 52 and network link reconfiguration mechanism 61 and link monitor 51 . only one of these approaches would be employed in any given physical implementation . the first alternative mechanism employs osi โ layer 1 โ mechanisms . specifically , the link monitor 51 observes activity on the wireline link 15 . if a problem condition is detected , e . g . no traffic received within a defined time - out interval , or one or more traffic parameters are degrade to below an acceptable threshold , a โ layer 1 switch โ ( e . g . electrical switch ) occurs , diverting the physical connection to the wireless link . this mechanism is extremely inexpensive to implement , but will typically cause any session in progress to fail during the switchover . as a result , re - authentication may be required after the switchover . the second mechanism for switching to the backup wireless link at the data switching mechanism 52 would use osi layer 2 switching . for example , this could be implemented using an adaptation of 802 . 3ad ethernet link bonding . if a problem condition is observed by the link monitor 51 on the wireline link 15 , traffic is diverted to the wireless link 30 , using the mechanisms defined within the 802 . 3ad specification . for example this could occur by rewriting the โ operational key โ which then reassigns the mac address of the outgoing interface in accordance with the 802 . 3ad standard . the network link reconfiguring mechanism 61 implements the other end of the 802 . 3ad link aggregation mechanism . the second diversion mechanism allows switching to the wireless link without loss of ip session continuity . the adaptation consists of link monitor 51 sensing total failure , partial failure or overloading of the wireline link and modifying the 802 . 3ad attributes to switch traffic to or from the wireless link . the use of the 803 . 3ad switching mechanism requires that both wireless and wireline link channels have an ethernet interface . in the event that either link is not ethernet , a layer 3 mechanism , such as that described below will be usable instead . the third mechanism for diversion to the backup wireless link at the data switching mechanism 52 uses osi layer 3 and 4 protocols , for example via an adaptation of the ml - ppp ( multi - link point to point protocol ) as defined in ietf rfc1990 / 1717 . again , ml - ppp is normally designed to make multiple links appear to be a single virtual communication channel . ml - ppp operates at osi layers 3 and 4 and therefore can be implemented with across any layer 2 link type including atm and frame relay . however standard ml - ppp does not allow one link to be used as โ primary โ and another link as โ backup only โ. this invention proposes an adaptation of this standard mechanism to force the traffic to take one path or the other based on defined criteria such as failure of a primary link as described above . this would typically be implemented as a variant of the ml - ppp software in both cpe 5 and a network based gateway 61 , and use the link control protocol ( lcp ) to signal the switch to move to one of the three states : โ wireline available / wireless unavailable โ or โ wireline unavailable / wireless available โ, or โ both links available โ, as in fig1 . | 7 |
the following description is provided to enable any person skilled in the art to make and use the invention and sets forth the best modes contemplated by the inventors of carrying out their invention . various modifications , however , will remain readily apparent to those skilled in the art , since the generic principles of the present invention have been defined herein specifically to provide an improved calibration feature to a conductivity meter . the preferred embodiments of the present invention will now be described with reference to the drawings . referring to fig1 and 2 , showing the essential components of the electromagnetic induction - type conductivity meter of the present invention , reference numeral 1 designates a case made of plastic resins which have superior insulation and corrosion resistance characteristics , such as pfa ( per fluoro alkyl vinyl ether ), pvc ( poly vinyl chloride ), and pvdf ( poly vinyliden fluoride ). the case or housing 1 is provided with a liquid - flowing passageway 7 consisting of a longitudinal vertical passageway 3 having an opening 2 at its lower end portion and a horizontal passageway 6 having openings 4 and 5 on its respective right and left sides and communicated traversely with the vertical passageway 3 . a transformer chamber 10 houses an exciting or primary transformer 8 and a detecting or secondary transformer 9 therein under a condition that they are electrically insulated from each other and are formed at a pointed end of the housing 1 . the transformers 8 and 9 have the same size circular iron cores 11 and 12 . an exciting coil 13 and a detecting coil 14 are wound around the iron core 11 and the iron core 12 , respectively . the vertical passageway 3 is arranged so as to pass through the respective centers of the iron cores 11 and 12 of both transformers 8 and 9 . reference numerals 15 and 16 designate lead wires connected with the exciting transformer 8 and connected with an alternating power source 17 at end portions thereof . in addition , reference numerals 18 and 19 designate a lead wire extending from the detecting transformer 9 and provided with an output terminals 20 and 21 at an end portion thereof , respectively , and thus connected with an operation - controlling portion ( not shown ). the operation - controlling portion can sense the induced current as a signal representative of a condition of the sample liquid . the value of the signal can be used to both monitor the operability of the meter on a display 36 and also to calibrate the instrument based on the assumption of a linear relationship of a ratio of the measured signal to a predetermined output . reference numeral 22 designates a loop - like stationary resistance circuit extending through the respective iron cores 11 and 12 in a parallel manner to the passageway 3 . the stationary resistance circuit 22 includes a lead wire 23 , a resistance or resistor 24 having an appointed resistance value , and an on - off switch 25 so as to open or close the circuit 22 . as can be seen , the lead wire 23 need not be in the fluidic passageway 3 . in one embodiment , the operation - controlling portion can constitute an appropriate conversion of the voltage signal , e c , across the output terminals 20 and 21 by an a / d converter 30 , and a storing of that value through an i / o interface circuit ( not shown ) into an operating cpu 32 with appropriate memory 34 . the cpu can also control the alternating power source 17 . the voltage signal , e s ., across the switch 25 is also converted into a digital value and stored for subsequent processing . next , an operation of an electromagnetic induction - type conductivity meter having the above - described construction will be described with reference to fig3 . if the on - off switch 25 is open or closed under a condition that a sample liquid , to be measured , flows in the direction shown by an arrow in fig2 a voltage is output between the output terminals 20 and 21 of the detecting transformer 9 . when the on - off switch 25 is opened , the voltage e c generated by an electrical current i c , depending upon a conductivity of the liquid to be measured , is output between the output terminals 20 and 21 . this is quite similar to that in the conventional electromagnetic induction - type conductivity meter . however , when the on - off switch 25 is closed , a different voltage value is obtained by adding a voltage e s generated by an electrical current i s , depending upon the value of the resistance 24 to the voltage e c , is output between the output terminals 20 and 21 . these output voltages are expressed as follows : a differential voltage ( e on - e off = e s ) between the voltage e on and the voltage e off has a constant value as long as the exciting coil 13 and the detecting coil 14 remain in a normal operating condition . however , if the respective parts deteriorate in a manner so as to change the voltage e on and the voltage e off , the voltage e s is also changed . in the case where values of the above - described respective voltages are changed , a check of the detecting system sensitivity , a calibration of the measured value in sensitivity , and a judgment of the existence of an abnormal situation and the like can be achieved by suitably monitoring these values in an operating - controlling portion and comparing the measured value with a predetermined value in a comparator circuit ( not shown ). as mentioned above , a software program can alternatively perform these operations in an operating cpu 32 and display the results on display 36 . provided that the voltage e off between the output terminals 20 and 21 during the time when the on - off switch 25 is opened is e c , and the voltage e on between the output terminals 20 and 21 during the time when the on - off switch 25 is closed is e c &# 39 ;+ e s &# 39 ;, the difference between both voltages at that time becomes e s &# 39 ;. thus , voltage e s can be compared with the voltage e s &# 39 ; to obtain e s &# 39 ;/ e s . a value of this e s &# 39 ;/ e s is compared with an appointed value to be able to determine the sensitivity of the detecting system . if the ratio e s &# 39 ;/ e s is within a permissible range , then e c &# 39 ;ร d s &# 39 ;/ e s can be used as an electrical conductivity coefficient for calibrating the sensitivity . in addition , when the voltage e s &# 39 ; is nearly equal to zero , it is judged that at least one of the exciting coil 13 and the detecting coil 14 is disconnected . moreover , when the voltage e s &# 39 ; is larger than the standard value , it can be judged that the exciting coil 13 is short - circuited . in addition , if the resistance value of the stationary resistance circuit 22 is constant , the resistance 24 is not always required . also , although the resistance 24 is provided within the case 1 in the above - described preferred embodiment , it may alternatively be provided in the operating - controlling portion . in the case of a sample having a relatively high conductivity ( 10 to 1 , 000 ms / cm ), the full scale of the conductivity meter is 1 , 000 ms / cm , and a fixed resistance of 5ฯ corresponds to 1 , 000 ms / cm . according to the present invention , a check of the detecting system sensitivity , a calibration of the measured value in sensitivity , and a judgment of the existence of any disconnection and short - circuit in the coils and the like can be achieved while the electrical conductivity of the sample liquid is measured . accordingly , the sensitivity of the instrument can be checked without using a calibration liquid and interrupting the measurement of electrical conductivity . as a result , the measuring efficiency of electrical conductivity can be improved and calibration liquid will not contaminate the sample liquid . in addition , a superior effect is obtained in that the calibration of the measured value in sensitivity and the judgment of the existence of any disconnection or short - circuit in the coils and the like can be conducted at the same time as a check of the detecting system sensitivity . those skilled in the art will appreciate that various adaptations and modifications of the just - described preferred embodiment can be configured without departing from the scope and spirit of the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein . | 6 |
although the disclosure hereof is detailed and exact to enable those skilled in the art to practice the invention , the physical embodiments herein disclosed merely exemplify the invention which may be embodied in other specific structures . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . turning now to the figures , fig1 is the basic schematic of an embodiment 100 of an improved voltage regulator circuit 100 according to the present invention . generally , the circuit 100 includes a rectifier circuit 110 , a microprocessor 52 , a voltage reference u 1 , and one or more switching circuits , such as an scr control circuit 120 . the circuit also includes a positive battery connection 101 , a ground connection 102 , a first ac input 103 , a second ac input 104 , and a third ac input 105 . the voltage reference u 1 is preferably a stable voltage reference , such as a shunt regulator , that provides power 161 for the microprocessor u 2 . the microprocessor u 2 contains an analog - to - digital converter ( not shown ) which uses the applied power 161 from the voltage reference u 1 as its reference voltage . a voltage divider 130 formed by resistors r 1 , r 2 may be used to divide the battery voltage 162 down to within an acceptable range of the microprocessor u 2 for sensing purposes . the phase timing of three ac signals , provided on the ac inputs 103 , 104 , 105 from an ac generator ( acg ) 300 is monitored by the microprocessor u 2 through dropping resistors r 5 , r 6 , r 7 . the scr control circuit 120 may or comprised of a transistor q 2 operatively coupled to diodes d 1 , d 2 , d 3 , wherein drive resistors r 8 , r 9 provide the gate drive current necessary to control the scrs scr 1 , scr 2 , scr 3 . that is , q 2 may be a pnp bipolar junction transistor , or a common collector cascade arrangement of same , wherein the collector is in electric communication , through one or more drive resistors r 9 , with the anodes of the diodes d 1 , d 2 , d 3 . the cathode of each diode d 1 , d 2 , d 3 is then electrically coupled to a gates of a respective scr . the rectifier 110 is comprised of three scrs scr 1 , scr 2 , scr 3 in respective combination with three diodes d 4 , p 5 and d 6 , thereby forming a three - phase full - wave rectifier which converts the ac signals of the acg 300 into the at least substantially direct current voltage that may used to charge a battery 302 , which is electrically coupled as is known between the positive battery connection 101 and the ground connection 102 , and operate the electrical devices that may be selective coupled to the battery 302 . such devices may include , by way of nonlimiting examples , a light 304 , a radio 306 , and a heater 308 , which may be electrically coupled to the battery 302 through switches 310 . in this arrangement , the microprocessor u 2 may monitor the ac inputs 103 , 104 , 105 , monitor the battery voltage 162 , or divided representation thereof , and may control the provision of rectified electricity in a controlled manner when required or desired . a preferred microprocessor is a pic12f510 , 8 - bit flash microcontroller , available from microchip technology , inc ., of chandler , ariz . furthermore , although the regulator circuit 100 is shown to include functional components , is to be understood that further components may be included or substituted . for instance the switching circuit 120 will likely require proper transistor biasing , and the transistor q 2 may be provided , as mentioned , as a cascade arrangement . furthermore , transient voltage suppression and other circuit components may be desirable , but are generally circuit design techniques that are presently known in the art . additionally , the operation of the microprocessor u 2 may also be achieved by using a combination of discrete electronic components , but the microprocessor u 2 is preferred due to space and ease of minor functional alterations through programming . in prior three - phase voltage regulator designs , three scrs in a rectifier circuit were sized to handle slightly over one - third of the total current that is expected to be received from an acg . however , it has been discovered that due to large current pulses received from the acg , in combination with wiring and connector losses , there are many times when an r - c filter will trigger a single scr , and then delay for a time period equal to almost a full cycle of the ac signals provided . this can result in repeated triggering of the same scr , or same two scrs , thus ultimately leaving one or more scrs unused for some period of time . this situation can occur at any acg speed with the proper loading on the regulator and occurs much more often as the power output of a given acg increases . the result may be an over - heating of the repeatedly triggered scrs , which may result in a lock - up condition which may be reset by dropping the output of the acg or reducing the load to a point where the locked scr temperature drops below the critical lock - up temperature . comparisons between prior analog regulators and regulators according to the present invention which provide scr load sharing have shown a substantial difference in performance with similar scrs . in many tests , the differences were dramatic . a circuit provided and operated according to the present invention can ensure that the scrs of a 3 - phase regulator are triggered such that the load current will be shared at least substantially equally between the three scrs scr 1 , scr 2 , scr 3 that are coupled to the respective ac inputs 103 , 104 , 105 . the microprocessor u 2 examines the three ac inputs , preferably at a sampling rate of at least 20 to 1 , more preferably of at least 36 to 1 , and even more preferably at about 50 to 1 . at the falling edge of each signal 103 , 104 , 105 , the microprocessor u 2 determines whether an scr should be triggered , such as by sensing that the battery voltage 162 , or a representation thereof , has dropped below a demand threshold voltage level , the microprocessor u 2 examines a three - state counter to determine whether the scr connected to the currently examined ac input is the next scr that should be fired . once the determined scr is fired , the counter is advanced to the next state , in preparation to fire the next scr in sequence , when the next voltage demand arises . to determine the proper scr sequence , the microprocessor u 2 preferably analyzes the phase relationships of the ac signals provided on the ac inputs ac 1 , ac 2 , ac 3 . by sampling the ac inputs received at the microprocessor u 2 , a process for determining phase relationships can be used , as seen in fig3 . in determining phase relationships , ac 1 , which is coupled to scr 1 is always specified as phase - 1 , or the first phase . then , it is preferable to analyze ac 2 , to determine whether the phase relationship of the ac signals is ac 1 - ac 2 - ac 3 or ac 1 - ac 3 - ac 2 . if the former , then ac 2 will be defined as phase - 2 and ac 3 will be defined as phase - 3 . if the latter , then ac 3 will be defined as phase - 2 and ac 2 will be defined as phase - 3 . in a quality assurance step 814 , it is determined if a subsequent cycle has the same phase order . if not , the process is repeated until two consecutive cycles have been found to have the same phase relationship . this step is especially useful to trigger all three scrs in desired order during heavy loading . for instance , if the acg phase relationship is 1 - 3 - 2 and the counter triggers the scrs in a 1 - 2 - 3 order , when scr - 1 is triggered , there will be a 120 degree gap before scr - 2 is triggered . this will be followed by a 120 degree gap before scr - 3 is triggered . the result will be a loss in overall power handling because the acg will only be able to provide current for 50 percent of the time . an alternate method of controlling the scrs involves a complete cycling of all scrs after power demand has been determined and prior to analyzing power demand . in this method , when the microprocessor u 2 determines that power is required or desired , such as by sensing that the battery voltage 162 , or a representation thereof , has dropped below a demand threshold voltage level , the microprocessor u 2 generates a drive pulse which lasts for approximately the time period of one complete ac signal cycle . this ensures that all three scrs are triggered once . at the end of such pulse , the microprocessor u 2 may then determine whether continued power is required or desired . if so , then another cycle - long drive pulse can be initiated or maintained . however , this technique may result in excess output voltage ripple at low engine speeds or light loads , where power demand is sporadic . however , at high speeds such cycling may be desirable , as such ripple is likely to be minimized . turning now to fig2 , representative oscilloscope traces are shown . in the scope traces , the top trace ch3 represents the voltage change physically measured at the battery 302 as the acg 300 applies output current at various times . the middle tract ch2 represents the voltage physically measured at a physical distance from the battery 302 , such as at the positive battery connection 101 of the regulator circuit 100 . theoretically , assuming ideal conduction between the battery 302 and the regulator 100 , ch2 should directly correspond and overlap ch3 . however , as can be seen , the voltage ch3 at the battery 302 , measured at point 302 a , rises about 1 . 1 volts between time zero at the center of the tract arid 1 . 00 milliseconds or one time division . however , measured at the other end of the cabling , at point 101 a , and through connectors used in a system , the voltage ch2 measured at the output of the regulator rises 3 . 0 volts during that same time period . thus , if only the voltage ch2 at the regulator , 101 a , is considered in the regulation process , the average will be skewed high . without compensating for cabling and connector loss , the battery voltage ch3 could actually drop by 1 . 9 volts . note the vertical voltage scale setting on the oscilloscope trace for ch3 is half the scale for ch2 . a circuit according to the present invention may clip peak voltage levels in the feedback path between the regulator output terminals and the regulator software low - pass filter when the regulator has activated the scrs between the acg 300 and the battery 302 . these peaks occur due to the losses in the cable and connectors and are not representative of the actual battery voltage . as a result , the voltage on the low - pass filter will more closely represent the actual battery voltage , thereby ignoring connection losses . the microprocessor reads the output voltage of the regulator with an analog - to - digital converter on a periodic basis and averages the readings using the following formula : where old_avg equals the previously calculated new_avg and new_reading is a digital representation of a voltage level sensed by the a - d converter , preferably an 8 - bit digital value . this is a commonly used low - pass algorithm . however , it has been discovered that when the scrs in the voltage regulator are active , the new_reading values may adversely affect the filtering and manipulation of the new_reading value during active voltage regulation provides adaptive voltage droop compensation . during normal operation , the microprocessor u 2 waits until it is time to trigger an scr . it does this by monitoring the respective ac signal for a high - to - low transition . for instance , if scr 1 is to be fired , then the microprocessor u 2 analyzes the ac signal through r 5 from the first ac input 103 for a high - to - low transition . then , the microprocessor u 2 compares the present old_avg value to a predetermined variable , but preferably fixed , number which represents a desired battery voltage . if the old_avg is below the desired value , the scr is triggered and a โ conduction flag โ is set in the microprocessor &# 39 ; s onboard random access memory ( ram ). if the old_avg is above the desired value , no trigger pulse occurs and the โ conduction flag โ is preferably cleared . as the microprocessor u 2 waits for the next high - to - low phase transition of the acg phase , or ac input , which has been determined to be the next phase adjacent in time to the current phase , it continues to monitor the voltage provided by the voltage divider 130 . but , if the โ conduction flag โ is set and the new_reading value exceeds a predetermined clipping threshold amount , which is greater than or equal to the predetermined desired battery voltage , predetermined clipping threshold is substituted for the new_reading in the averaging algorithm . therefore , despite the voltage loss in the electric cabling and connectors , the averaging algorithm compensates by ignoring excessive voltage levels that may occur during regulation , thereby limiting the effects of such losses . this may be especially advantageous in systems in which the losses are expected or predicted to change over time , such as through corrosion or fracture . an example 917 of a method of performing this adaptive voltage droop compensation 917 can be seen in fig5 . this figure also depicts the general voltage averaging process . in a timer check step 902 , a timer is evaluated to determine if the programmable time constant of the software low pass filter has expired . such time constant may be selectively chosen for circuit performance , but is preferably on the order of 100 microseconds to 200 microseconds , and more preferably about 128 microseconds . furthermore , if an overvoltage condition arises , the over - voltage counter is set 916 with a counter value to delay a desired amount of time , preferably about five seconds . it has also been discovered that upon addition of a demanding load to the circuit of the battery 302 , thus rapidly increasing power demand and decreasing perceived battery voltage 162 , the extremely low voltage level sensed by the microprocessor may skew the averaging algorithm of the software low - pass filter , thereby causing an apparent power shortage that would otherwise demand significant voltage from the regulator . thus , if the demanding load is removed from the circuit , the battery voltage 162 may overshoot the desired level because the average provided by the low - pass filter has been skewed low . a circuit according to the present invention may clip voltage levels presented to the microprocessor u 2 software low - pass filter which are much lower than the predetermined desired battery voltage level . since any voltage on the low pass filter which is below a desired voltage level generally would activate the scrs located between the acg 300 and the battery 302 , a very low level voltage provided to the software low - pass filter is an indication that the system current demands have exceeded the output current of the acg 300 . by limiting the floor voltage presented to the low - pass filter to a predetermined , variable but preferably static level , a low clipping threshold , which is below the desired voltage level , the battery voltage 162 will not over - shoot above the predetermined desired voltage level when the excessive load is removed . before the microprocessor u 2 compares the old_avg to the predetermined desired value , the old_avg is compared to the predetermined low clipping threshold . if the old_avg value is below the low clipping threshold , the value of the old_avg is set to the low clipping threshold value . because the low clipping threshold is below the desired value , the scrs will be driven on until the new_avg increases to above the predetermined desired value . this clipping generally only occurs if the system load exceeds the maximum acg output capability . instead of a protracted recovery in the event of a fast removal of the load , the clipping will result in a very short duration between the time that the load is removed and the time when the new_avg value rises above the predetermined desired value and turns off the scrs . the result is a reduction in the maximum peak battery voltage . this reduces stresses in sensitive electrical equipment . an example 883 of a method of performing this voltage rebound compensation can be seen in fig4 . the foregoing is considered as illustrative only of the principles of the invention . furthermore , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . | 7 |
a detailed description will be given below on an embodiment of the present invention with reference to the accompanying drawings . fig1 is a block diagram showing the system structure of an image pickup apparatus according to this embodiment . the image pickup apparatus of fig1 is capable of picking up and recording moving image data that is made up of 30 frames of image data per second as well as reproducing a recorded moving image . the apparatus can take still pictures in addition to moving images . a central processing unit ( cpu ) 100 controls the entire image pickup apparatus . denoted by 101 is an interface circuit ( i / f ) for the cpu 100 , 102 denotes a recording medium such as a memory card , and 103 denotes an interface circuit ( i / f ) for the recording medium 102 . reference numeral 106 denotes a dynamic random access memory ( dram ) where image data , program and the like are stored . reference numeral 104 denotes a system controller , which is engaged in sequential control , bus arbitration control , and the like . reference numeral 107 denotes an image pickup lens , and 108 denotes an image pickup element composed of a one - chip charge - coupled device ( ccd ). denoted by 109 is an a / d conversion circuit to convert an analog signal into a digital signal . reference numeral 110 denotes a signal processing circuit and 111 , a magnification circuit to reduce or enlarge image data in a horizontal or vertical direction through thinning - out processing , linear interpolation processing , or the like . reference numeral 112 denotes a raster - block conversion circuit , which converts raster scan image data magnified by the magnification circuit 111 into block scan image data . denoted by 113 is a buffer memory for raster - block conversion . the memory 113 is used to convert raster data into block scan data . reference numeral 114 denotes a compression circuit , which employs jpeg to encode image data outputted block by block from the raster - block conversion circuit 112 and to thereby compress the amount of the data . when a moving image is picked up , the raster - block conversion circuit 112 denotes frames of moving image data that are in raster scan order into an order of blocks having predetermined number of pixels in length and width , and outputs the converted data . the compression circuit 114 encodes , when a moving image is picked up , frames of image data outputted from the raster - block conversion circuit 112 by jpeg . jpeg is , as well known , an intraframe encoding method which encodes image data are using only image data in the same frame . the raster - block conversion circuit 112 at this point reads out frames of image data stored in the buffer memory 113 starting from a block 501 , which is located at the upper left corner of the screen as shown in fig5 . the raster - block conversion circuit 112 next reads out the block to the right of the block 501 on the screen , and then continues on in this way until the rightmost block on the screen is reached . after the rightmost block is read out , blocks immediately below the current row of blocks are read out in a similar manner starting from the leftmost block . a memory control circuit 105 transfers , during recording , by dma transfer , image data outputted from the compression circuit 114 to the dram 106 , and transfers image data stored in the dram 106 via the system controller 104 and the i / f 103 to the recording medium 102 , where the transferred image is recorded . when image data is to be reproduced , the memory control circuit 105 reads out compressed image data from the recording medium 102 , transfers , by dma transfer , the read data to the dram 106 via the interface circuit 103 and the system controller 104 , and transfers , by dma transfer , the image data in the dram 106 to a reproduction circuit 121 , which will be described later . the cpu 100 uses a predetermined program to create decoded image data through software processing in which jpeg - encoded image data is decoded . the cpu 100 performs thinning - out processing and linear interpolation processing to reduce and enlarge , respectively , a decoded image . the reproduction circuit 121 performs modulation , addition of synchronized signals , digital / analog conversion and the like on image data that is reproduced from the recording medium 102 and decoded , to thereby convert the reproduced and decoded data into a form suitable for display on a monitor 122 . the number of pixels of an image that can be outputted to and displayed on the liquid crystal monitor 122 , which serves as a display unit , is smaller than the number of pixels of the image pickup element . denoted by 123 is an operation unit , which is composed of a switch splay , a switch sfwd , a switch srev , a switch szup , a switch szdown , and a switch sstop . denoted by 124 is a four - way operational key composed of a switch sup , a switch sdown , a switch sright , and a switch sleft . the functions of the switches of the operation unit 123 will be described . the switch splay is a switch used to command that an image be played . when the switch splay is turned on , an image recorded on the recording medium 102 is displayed on the liquid crystal monitor . the switch sfwd is a switch for playing one still image ahead , and the switch srev is a switch for playing one still image back . the switch szup is a switch used to command the apparatus to enlarge an image being played , and the switch szdown is a switch used to command the apparatus to reduce in size an image being played . the switch sstop is a switch used to command the apparatus to pause a moving image that is being played . each time the switch sstop is operated , one of an instruction to resume playing a moving image and an instruction to pause playing is outputted in an alternating manner . the switch sup , the switch sdown , the switch sright and the switch sleft correspond to the upper , lower , right and left portions of the four - way operational key 124 , respectively . the four - way operational key 124 is , as will be described later , effective when a reproduced image is displayed enlarged . the switch sup is a switch used to command the apparatus to scroll up over an enlarged image , the switch sdown is a switch used to command the apparatus to scroll down , the switch sright is a switch used to command the apparatus to scroll to the right , and the switch sleft is a switch used to command the apparatus to scroll to the left . fig4 a to 4c are diagrams showing a reproduced image and how the image is displayed on the monitor . fig4 a shows frames of a moving image before the image is enlarged and displayed . fig4 b shows areas of the moving image data of fig4 a that are decoded and stored in the dram 106 to extract and enlarge a part of each frame of the moving image data . fig4 c shows the screen of the monitor 112 which is displayed when the monitor 112 displays the moving image of fig4 a . described next with reference to fig2 and 3 is processing for playing a moving image . in this embodiment , a frame of moving image data before encoded has an aspect ratio of 4 : 3 , and 1280 pixels ( h )ร 960 ( v ). such moving image data is reproduced from the recording medium 102 and is displayed on the monitor 122 , which has a resolution of 640 pixels ( h )ร 480 pixels ( v ). as has been described , each frame of moving image data is encoded by jpeg and , to reproduce the moving image data , data of a frame is decoded by jpeg separately from data of another frame . the cpu 100 goes into a play mode when it is detected that the switch splay has been turned on . in step s 201 , the cpu 100 controls the interface circuit 103 and the system controller 104 to start reading out a desired moving image file from of the recording medium 102 . the image data read out from the recording medium 102 is transferred to and stored in the dram 106 in order . in step s 202 , the display magnification is initialized and ร 1 display magnification is set to display the whole image on the monitor 122 . in step s 203 , the cpu 100 sets a still image stored at the head of the moving image file , and starts a timer set in accordance with a desired frame rate . in step s 204 , a state of the switch splay is judged . when the switch splay is off , the cpu 100 ends the play mode whereas the play mode is maintained and the cpu 100 moves to the next step when the switch splay is on . in step s 205 , a state of the switch sstop is judged . when the switch sstop is on , the cpu 100 pauses playing a moving image and moves to step s 206 . when the switch sstop is off , the moving image is kept played and the cpu 100 moves to the next step . stop mode processing in step s 206 will be described later . in step s 207 , states of the zoom switches szup and szdown , which are used to specify a display magnification , are judged . as a user operates either one of the zoom switches , the cpu 100 moves to step s 208 . in the case where neither of the switches szup and szdown is operated , the cpu moves to step s 217 . in step s 217 , whether the display magnification is ร 1 magnification or not is judged . when an image is displayed enlarged , the cpu 100 moves to step s 218 , and to step s 220 when the display magnification is ร 1 magnification . in step s 220 , the display magnification is set to ร 1 . in step s 221 , the original image size , namely , 1280 pixels ( h )ร 960 pixels ( v ), is set as the size in which the image data is to be read out from the dram 106 in accordance with the display magnification set in step s 220 . in step s 222 , the cpu 100 sequentially reads out , via the memory control circuit 105 , from the dram 106 , image data in the head frame of the moving image file set in step s 203 , and decodes the read image data . the decoded image data is sequentially written in the dram 106 block by block via the memory control circuit 105 . in step s 223 , whether decoding processing has been completed for one frame of image data or not is checked . in the case where decoding processing for one frame of image data has been completed , the cpu 100 moves to step s 224 . in step s 224 , the cpu 100 changes the resolution of decoded image data from the original image size to the resolution of the monitor 122 . specifically , the cpu 100 reads out stored image data from the dram 106 via the memory control circuit 105 and converts the resolution of the image data . when the display magnification is ร 1 , the original image size , 1280 pixels ( h )ร 960 pixels ( v ), is reduced by ยฝ in width and by ยฝ in height . the converted image data is sequentially written in a display area in the dram 106 . thus 640 pixels ( h )ร 480 pixels ( v ) image data for display is stored in the dram 106 . the stored image data is displayed as shown in screens 60 and 61 of fig4 c . in step s 214 , whether the frame that is currently displayed is the last frame of the moving image data or not is judged . in the case where it is the last frame , the moving image play mode is ended . in the case where it is not the last frame , the cpu 100 moves to step s 215 . in step s 215 , which frame is to receive reproduction processing next is set . in step s 216 , the timer set in step s 203 is checked to determine whether a predetermined period of time has passed or not . in the case where the predetermined time has passed , the cpu 100 proceeds to processing the next frame of the image data . described next is the operation of displaying a moving image that is being played enlarged . a user operates the switch szup for enlarged display while a moving image is being played at ร 1 magnification . then the cpu 100 judges in step s 207 that the switch szup has been operated , and moves to step s 208 . in step s 208 , a larger magnification is set each time the user operates the switch szup ( to ร 2 at one flick of the switch szup , ร 4 at the next flick ) whereas a smaller magnification is set each time the user operates the switch szdown ( to ร 2 at one flick of the switch szdown , ร 1 at the next flick ). in this embodiment , the display magnification is changed to ร 2 by operating the switch szup while a moving image is being displayed at ร 1 magnification . in this embodiment , an area of the original image is extracted in accordance with the enlarging magnification , and the extracted portion of image data is subjected to enlarging processing in accordance with the number of pixels of the monitor 122 . in step s 209 , the size of the area to be extracted is obtained from the original image size and the magnification set in step s 208 , to set a range to be extracted for enlarged display on the original screen . for instance , when the display magnification set in step s 208 is ร 2 , the size of the extracted area is set to 640 pixels ( h )ร 960 pixels ( v ) by multiplying 1280 pixels ร 960 pixels by ยฝ in width and length , respectively . similarly , the display magnification set in step s 208 is ร 4 , the size of the extracted area is set to 320 pixels ( h )ร 240 pixels ( v ) by multiplying the original image size by ยผ in width and length , respectively . here , the display magnification set in step s 208 is 2 . in step s 210 , the cpu 100 reads out one frame of stored image data from the dram 106 via the memory control circuit 105 , and decodes the read - out image data block by block . at this point , the cpu 100 sequentially reads out one frame of image data stored in the dram 106 starting from a block at the upper left corner of the screen as shown in fig5 , and decodes the read - out image data . the decoded image data is sequentially transferred to and stored in the dram 106 via the memory control circuit 105 . after decoding processing is started in order from the upper left corner block on the screen in this way , the cpu 100 compares in step s 211 the position on the screen of the decoded image data against the extraction range set in step s 209 . the cpu 100 continues the processing of reading out encoded image data from the dram 106 and the processing of decoding the read - out image data until the position of the decoded image data exceeds the extraction range . when it is judged that the extraction range is exceeded , the cpu 100 moves to step s 212 . in step s 212 , the processing of decoding encoded image data is stopped . as a result , the dram 106 now stores image data of the range shown in 52 of fig4 b in a decoded state whereas image data of an area below this range on the screen remains encoded . in fig4 b , 520 indicates the extraction range set in step s 209 . in step s 213 , the cpu 100 converts the resolution of the image data in the extracted area set in step s 209 into the resolution of the monitor 122 . in other words , the cpu 100 has the memory control circuit 105 read out image data of an extraction area , specifically , image data in the extraction range 520 of fig4 b , from the dram 106 , and converts the resolution of the read image data into the resolution of the monitor 122 in accordance with a set display magnification . for instance , when the display magnification is ร 4 , image data of 320 pixels ( h )ร 240 pixels ( v ) extraction area is doubled in the horizontal direction and the vertical direction each . when the display magnification is ร 2 , there is no need to convert the resolution and the image data is displayed as it is since the size of the extraction range is 640 pixels ( h )ร 480 pixels ( v ). the image data with the resolution thus converted is written in a display memory area of the dram 106 in order . in this way , enlarged image data having 640 pixels ( h )ร 480 pixels ( v ) is stored in the display memory area of the dram 106 , and the stored image data is displayed as a ร 2 magnification image on the monitor as shown in a screen 62 of fig4 c . subsequently , steps s 214 to s 207 are repeated to set the next frame . in the case where the switches szup and szdown are found to be off in step s 207 , the cpu 100 moves to step s 217 . in step s 217 , the display magnification is checked to judge whether it is ร 1 magnification or not . when the display magnification is judged to be larger than ร 1 magnification , the cpu 100 moves to step s 218 . when the display magnification is judged as ร 1 magnification , the cpu 100 moves to step s 220 . in step s 218 , the cpu 100 judges states of the switches sup , sdown , sright and sleft of the four - way operational key 124 . when the user operates any one of the four switches to instruct the apparatus to change the display position , the cpu 100 moves to step s 219 . when none of the switches sup , sdown , sright and sleft is operated , the cpu 100 moves to step s 210 . in the case where the four - way operational key is not operated while the screen 62 of fig4 c is displayed , a screen 63 is displayed without changing the current display range . subsequently , steps s 210 to 218 are repeated to display the continuous frames 62 and 63 of a moving image enlarged . on the other hand , when the user operates the four - way operational key 124 to change the display position while a moving image is being played enlarged , the cpu 100 checks the states of the switches sup , sdown , sright and sleft and moves to step s 219 . in step s 219 , the cpu 100 sets a new area to be extracted for enlarged display in a direction that is designated via the switches . for example , in the case where the switch sleft is operated while a screen 53 of fig4 b is displayed , the extraction range is moved to the left of the range 530 to set a new extraction range 540 . as a result , the display screen of the monitor 122 is switched to a screen 64 of fig4 c . the user operates the switch sstop in step s 205 to pause a moving image that is being played enlarged . this causes the cpu 100 to move into a stop mode where playing of a moving image is paused . fig3 is a flow chart showing processing of the stop mode in step s 206 . in step s 301 , the cpu 100 initializes display settings and sets a parameter disp to 0 . in step s 302 , the cpu 100 reads out one frame of image data stored in the dram 106 via the memory control circuit 105 , and decodes the read - out image data in order . the decoded image data is sequentially transferred to and stored in the dram 106 via the memory control circuit 105 . in step s 303 , completion of decoding one frame of image data is waited . image data stored at this point in the dram 106 is as shown in a screen 55 of fig4 b . in other words , when instructed to pause playing , the cpu 100 decodes all of image data of one frame , including an area of image data below the extraction range 550 for enlarged display , and stores the decoded image data in the dram 106 . when decoding one frame of image data is completed , the cpu 100 judges in step s 304 states the zoom switches szup and szdown , which are used to specify a display magnification . in the case where the user operates either one of the zoom switches , the cpu 100 moves to step s 305 . in the case where the user operates neither the switch szup nor the switch szdown , the cpu 100 moves to step s 310 . in step s 310 , the state of the display magnification is judged . when the display magnification is judged to be larger than ร 1 magnification , the cpu 100 moves to step s 311 . when the display magnification is judged as ร 1 magnification , the cpu 100 moves to step s 314 . in step s 311 , the cpu 100 judges the states of the switches sup , sdown , sright and sleft of the four - way operational key 124 . when the user operates any one of the four switches to instruct the apparatus to shift the display range , the cpu 100 moves to step s 313 . when none of the switches sup , sdown , sright and sleft is operated , the cpu 100 moves to step s 312 . in step s 312 , the value of the variable disp is checked . when it is judged that a still image is being displayed at a pause command ( disp = 1 ), the cpu 100 moves to step s 309 . on the other hand , when it is judged that a moving image , not a still image , is being displayed ( disp = 0 ), the cpu 100 moves to step s 307 . in step s 307 , the cpu 100 converts the resolution of image data in the extraction range that is stored in the dram 106 , in accordance with the resolution of the monitor 122 . in other words , of image data stored in the dram 106 , the cpu 100 reads image data in the extraction range and converts the resolution of the read image data in accordance with a set display magnification . for instance , when the display magnification is ร 4 , 320 pixels ( h )ร 240 pixels ( v ) extraction range image data is doubled in the horizontal direction and the vertical direction each . when the display magnification is ร 2 , the 640 pixels ( h )ร 480 pixels ( v ) extraction range image data is outputted as it is . the converted data is written in a display memory area of the dram 106 in order . thus 640 pixels ( h )ร 480 pixels ( v ) image data is stored in the display memory area of the dram 106 . while the pause playing command is effective , the one frame of moving image data stored in the display memory area is repeatedly read out and outputted to the monitor 122 , to thereby display an enlarged image as a still image as shown in a screen 65 of fig4 c . in step s 308 , the parameter disp indicating whether a moving image or a still image is being displayed is set to 1 . in the case where the user operates the switch sstop in step s 309 in order to cancel the pause command while playing is paused , the cpu 100 ends the stop mode to resume playing a moving image in response . when the sstop is off , the cpu 100 moves to step s 304 . when it is judged in step s 310 that the display magnification is ร 1 magnification , the original image size , namely , 1280 pixels ( h )ร 960 pixels ( v ), is set in step s 314 as a size in which image data is read out from the dram 106 . in step s 315 , the cpu 100 converts the resolution of the decoded image data from the original image size to the resolution of the monitor 122 . then the cpu 100 sets the parameter disp to 1 and moves to step s 309 . in the case where an instruction made by the user to change the display position is detected by detecting in step s 311 that any one of the switches sup , sdown , sright and sleft of the four - way operational key 124 has been operated , the cpu 100 moves to step s 313 . in step s 313 , the cpu 100 sets moves the extraction range in a direction designated through the four - way operational key 124 . specifically , in the case where the switch sright is operated while the screen 65 of fig4 c is displayed , the extraction range is changed from 550 of fig4 b to 560 , with the result that a screen 66 of fig4 c is displayed on the monitor 122 . during the change , the monitor 122 keeps displaying a still image . as has been described , according to this embodiment , one frame of encoded image data stored in the dram 106 is read out and decoded sequentially starting from an upper end of the screen in response to an enlargement command given while a moving image is played . as image data in an extraction range necessary in enlarged display is decoded , processing of reading out encoded image data from the dram 106 is ended , and decoding processing on this frame is stopped to proceed to processing of the next frame . in this way , there is no need to read out a portion of encoded image data that is unnecessary for enlarged display , from the dram 106 , and to process decoding on this portion . accordingly , the dram is accessed less frequently and the load of the cpu is thus lightened . in addition , an enlarged play function can be obtained without increasing the load of the cpu even when the number of pixels per frame is increased , and at the same time , the power consumption can be reduced . another technological advantage of this embodiment is improved ease of use in pausing an enlarged moving image since the display position can be moved as processing of expanding a still image is completed . the above embodiment describes a case of playing a moving image , but similar processing can be performed when a still image is to be played . the expansion processing and magnification processing of a still image , which are performed by the cpu in the above - described example , may be carried out by hardware . the object of the present invention can also be achieved by providing a storage medium storing program codes for performing the aforesaid processes to a reproduction apparatus , reading out the program codes , by a cpu or mpu of the reproduction apparatus , from the storage medium , then executing the program . in this case , the program codes read out from the storage medium realize the functions according to the embodiments , and the storage medium storing the program codes constitutes the invention . further , the storage medium , such as a floppy disk , a hard disk , an optical disk , a magneto - optical disk , cd - rom , cd - r , a magnetic tape , a non - volatile type memory card , and rom , and computer network , such as lan ( local area network ) and wan ( wide area network ), can be used for providing the program codes . furthermore , besides aforesaid functions according to the above embodiments are realized by executing the program codes which are read out by a cpu from the reproduction apparatus , the present invention includes a case where an os ( operating system ) or the like working on the computer performs a part or entire processes in accordance with designations of the program codes and realizes functions according to the above embodiments . furthermore , the present invention also includes a case where , after the program codes read from the storage medium are written in a function expansion card which is inserted into the reproduction apparatus or in a memory provided in a function expansion unit which is connected to the reproduction apparatus , cpu or the like contained in the function expansion card or unit performs a part or entire process in accordance with designations of the program codes and realizes functions of the above embodiments . in a case where the present invention is applied to the aforesaid storage medium , the storage medium stores program codes corresponding to the flowchart of fig2 and 3 described in the embodiments . the present invention is not limited to the above embodiments and various changes and modifications can be made within the spirit and scope of the present invention . therefore to apprise the public of the scope of the present invention , the following claims are made . this application claims priority from japanese patent application no . 2004 - 213788 filed jul . 22 , 2004 , which is hereby incorporated by reference herein . | 7 |
since diffusion from the endplate 105 is crucial for maintaining the intervertebral disc , effort is made to re - establish nutrient and waste exchange between the nucleus pulposus and circulation within the vertebral body . guided by anteroposterior and lateral views from fluoroscopes , a trocar 103 enters posteriolaterally , 45 ยฐ from mid - line into the disc 100 , as shown in fig5 . this guiding technique is similar to the one used in diagnostic injection of radiopaque dye for discography or chymopapain injection for nucleus pulposus digestion . a dilator 230 is inserted over the trocar 103 , as shown in fig6 . the trocar 103 is then withdrawn . the dilator 230 remains as a passage leading into the disc 100 , as shown in fig7 . fig8 shows the distal end of the dilator 230 near the nucleus pulposus 128 of the degenerating disc 100 . an elastically curved needle 101 , as shown in fig9 , is resiliently straightened in a rigid sleeve 220 indicated in fig1 . the round cross section of the straightened needle 101 and sleeve 220 is shown in fig1 . the resiliently straightened needle 101 within the rigid sleeve 220 is inserted into the dilator 230 and the disc 100 , as shown in fig1 . a longitudinal view of the needle 101 insertion into the degenerating disc 100 is indicated in fig1 . the elastically curved needle 101 is deployed by holding the rigid sleeve 220 stationary while pushing the needle 101 inward . the needle 101 resumes the curved configuration as it exits the distal opening of the sleeve 220 , puncturing upward as shown in fig1 , through the cartilage 106 and calcified layers 108 into the vertebral body 159 , as indicated in fig1 . multiple endplate 105 punctures 224 can be accomplished to re - establish the exchange of nutrients and waste between the disc 100 and bodily circulation . after retrieving the elastically curved needle 101 into the sleeve 220 , the assembly of needle 101 and sleeve 220 can be further advanced into or slightly withdrawn from the disc 100 to puncture more holes 224 through the calcified cranial endplate 105 . by turning the assembly of needle 101 and sleeve 220 180 ยฐ, the caudal endplate 105 can also be punctured , as shown in fig1 , to re - establish the exchange of nutrients , oxygen and waste through the superior and inferior endplates 105 . fig1 indicates restoration of swelling pressure within the nucleus pulposus 128 enabling the disc 100 to sustain compressive loads . with the presence of oxygen within the disc 100 , production of lactic acid may also decrease and ease chemical irritation and pain . endplate 105 puncturing can also be accomplished by electronic devices 134 , such as a laser , cutting or abrading device . fig1 depicts an electronic device 134 powering a cutter 127 to puncture , drill , abrade or cauterize the endplate 105 to re - establish the exchange of nutrients and waste . the electronic device 134 can be a cautery , laser , or drill . re - establishing the exchange of nutrients and waste through the calcified endplate 105 can also be accomplished using a conduit 126 . a conduit 126 can be an elastic tube 125 with a lumen or channel 104 and tissue - holding flanges 113 at both ends , as shown in fig1 . the orientations of the flanges 113 located at both ends of the conduit 126 are counter gripping to anchor onto the endplate 105 . the tube 125 is inserted over the elastically curved needle 101 and abutting a sliding plunger 109 , as shown in fig2 . the needle 101 carrying the elastic tube 125 is resiliently straightened within the rigid sleeve 220 , as depicted in fig2 . the assembly of the straightened needle 101 , tube 125 , sleeve 220 and plunger 109 is inserted into the dilator 230 , as shown in fig2 , and into the disc 100 . as the resilient needle 101 carrying the tube 125 is deployed from the rigid sleeve 220 , the curvature of the needle 101 resumes and punctures through the calcified endplate 105 , as shown in fig2 . the needle 101 is withdrawn while the plunger 109 is held stationary to dislodge the tube 125 from the needle 101 into the endplate 105 , as shown in fig2 . the lumen 104 of the tube 125 acts as a passage for exchanging nutrients , gases and waste between the vertebral body 159 and the inner disc 100 . a portion of the tube 125 is in the nucleus pulposus 128 or inner disc 100 , while the remaining portion is within the vertebral body ( not shown ) in fig2 . the handle 130 of the curved needle 101 and the handle 132 of the rigid sleeve 229 are used to maintain the direction of needle 101 deployment . the square handle 130 of the curved needle 101 is stacked within the handle 132 of the rigid sleeve 220 , as shown in fig2 , to avoid rotation between the needle 101 and sleeve 220 . the handle 130 of the needle 101 can also contain guide rails 131 , as shown in fig2 . the guide rails 131 are sized and configured to fit within the sunken tracks 133 on the handle 132 of the rigid sleeve 220 , as indicated in fig2 . direction of the needle &# 39 ; s curvature is indicated by the orientation lines 153 on the handle 130 of the needle 101 , as shown in fig2 , and on the rigid sleeve 220 as shown in fig2 . to indicate depth of insertion into the body , penetration markers 116 are labeled on the sleeve 220 , as shown in fig2 . the guide rails 131 within the tracks 133 keep the handles 130 , 132 from rotating around each other , as shown in fig2 . as the resiliently straightened needle 101 advances and protrudes from the rigid sleeve 220 , the curvature of the needle 101 resumes , as shown in fig3 . since the handle 130 of the needle 101 and the handle 132 of the sleeve 220 are guided by the rails 131 in tracks 133 , the direction of needle 101 puncturing is established and predictable for the operator or surgeon . non - circular cross - sections of the needle 101 and rigid sleeve 220 can also prevent rotation . fig3 shows a needle 101 and a sleeve 220 with oval cross - section . fig3 indicates a square cross - section . fig3 depicts a rectangular cross - section . fig3 shows a triangular cross - section . conduits 126 can also be made small enough to fit within the lumen of the elastically curved needle 101 . a conduit 126 can be a small tube 125 with a longitudinal channel 104 , as shown in fig3 , for transporting nutrients , oxygen and waste dissolved in fluid . the tubular conduit 126 with a lumen 104 can be braided or weaved with filaments , as shown in fig3 . the fluid can be transported through the lumen 104 as well as permeated through the braided filaments of the tube 125 . the tubular conduit 126 can also be molded or extruded with porous or spongy material , as shown in fig3 , to transport nutrients , oxygen and waste dissolved in fluid through the lumen 104 as well as through the pores . nutrients , oxygen , lactate , metabolites , carbon dioxide and waste can also be transported in fluid through capillary action of multi - filaments or braided filaments 122 , as shown in fig3 . a conduit 126 may not require the longitudinal lumen 104 as mentioned . a strand of braided filaments 122 can be a suture with channels formed among weavings of the filaments , capable of transporting fluid with nutrients , gases and waste . the braided filaments 122 can be coated with a stiffening agent , such as starch , to aid deployment using the plunger 109 . similar to the channels formed by the braided filaments 122 , a conduit 126 made as a spongy thread 124 , as shown in fig3 , can also transport fluid with nutrients , gases and wastes through the pores and channels formed within the porous structure . a conduit 126 is inserted into a longitudinal opening 269 of an elastically curved needle 101 abutting a plunger 109 , as shown in fig4 . to minimize friction between the curved needle 101 and the rigid sleeve 220 , the distal end of the lumen 268 of the sleeve 220 is angled or tapered with a bevel 102 or an indentation , conforming to the concave curvature of the needle 101 , as shown in fig4 . a lubricant or coating to lower friction can also be applied on the surface of the elastically curved needle 101 and / or within the lumen 268 of the rigid sleeve 220 . the elastically curved needle 101 carrying the conduit 126 is resiliently straightened within a rigid sleeve 220 , as shown in fig4 . the assembly is then inserted into a dilator 230 , as indicated in fig4 , which leads into the disc 100 . as the resiliently straightened needle 101 is deployed from the sleeve 220 , the needle 101 carrying the conduit 126 resumes the curved configuration and punctures into the cartilaginous endplate 105 through the calcified layers 108 , as shown in fig4 . the elastically curved needle 101 is then retrieved into the sleeve 220 while the plunger 109 is held stationary to deploy the conduit 126 at the calcified endplate 105 , as shown in fig4 . fig4 depicts insertion of the needle 101 , conduit 126 , plunger 109 , sleeve 220 and dilator 230 into the disc 100 . the resiliently straightened needle 101 carrying the conduit 126 is deployed from the sleeve 220 , resumes the curvature and punctures through the endplate 105 and calcified layers 108 , as shown in fig4 . while the plunger 109 behind the conduit 126 is held stationary , the elastically curved needle 101 is withdrawn from the calcified endplate 105 and retrieved into the sleeve 220 to deploy , expel or dislodge the conduit 126 at the calcified endplate 105 , as shown in fig4 . the conduit 126 acts as a channel or a passage , bridging between the bone marrow of the vertebral body 159 and the disc 100 to re - establish the exchange of fluid , nutrients , gases and wastes . fig4 shows the general location of the conduit 126 between the disc 100 and the vertebral body through the calcified endplate ( both not shown ). multiple conduits 126 can be loaded in series into the curved needle 101 , as shown in fig5 . each conduit 126 is deployed sequentially at the calcified endplate 105 by retrieving the curved needle 101 and holding the plunger 109 stationary . in essence , the plunger 109 is advanced toward the distal end of the needle 101 one conduit - length at a time . after deploying the first conduit 126 at the cranial endplate 105 , the rigid sleeve 220 is rotated 180 ยฐ to deploy the second conduit 126 into the caudal endplate 105 , as shown in fig5 . multiple conduits 126 within the elastically curved needle 101 allow surgeons to implant multiple conduits through calcified endplates 105 without having to withdraw the needle 101 assembly , reload additional conduits 126 and re - insert the assembly into the disc 100 . in the supine position , disc pressure is low . during sleep , fluid is drawn in by the water absorbing glycosaminoglycans within the nucleus pulposus 128 . by bridging the calcified endplate 105 , the glycosaminoglycans draw fluid with sulfate , oxygen and other nutrients through the conduits 126 into the nucleus pulposus 128 during sleep by ( 1 ) capillary action , and ( 2 ) imbibing pull of the water - absorbing glycosaminoglycans . the flow of sulfate , oxygen and nutrients is channeled within the conduit 126 unidirectionally toward the nucleus pulposus 128 , rather than via the dispersion mechanism in diffusion . it is generally accepted that disc 100 degeneration is largely related to nutritional and oxygen deficiency . by re - establishing the exchange , a renewed and sustained supply of sulfate may significantly increase the production of sulfated glycosaminoglycans and restore swelling pressure . restoration of swelling pressure within the nucleus pulposus 128 reinstates the tensile stresses within the collagen fibers of the annulus , thus reducing the inner bulging and shear stresses between the layers of annulus , as shown in fig5 . similar to a re - inflated tire , disc 100 bulging is reduced and nerve impingement is minimized . thus , the load on the facet joints 129 is also reduced to ease pain , the motion segment is stabilized , and disc 100 space narrowing may cease . the progression of spinal stenosis is halted and / or reversed , as shown in fig5 to ease pain . in daily activities , such as walking and lifting , pressure within the disc 100 greatly increases . direction of the convective flow then reverses within the conduit 126 , flowing from high pressure within the disc 100 to low pressure within vertebral bodies 159 . the lactic acid and carbon dioxide dissolved in the fluid within the nucleus pulposus 128 is slowly expelled through the conduit 126 into the vertebral bodies 159 , then to bodily circulation . as a result , the lactic acid concentration decreases , and ph within the disc 100 is normalized . furthermore , due to the abundance of oxygen in the disc 100 supplied through the conduit 126 , lactic acid normally produced under anaerobic conditions may drastically decrease . hence , the pain caused by acidic irritation at tissues , such as the posterior longitudinal ligament 195 , superior 142 and inferior 143 articular processes of the facet joint , shown in fig5 , is anticipated to quickly dissipate . buffering agents , such as bicarbonate , carbonate or others , can be loaded or coated on the conduits 126 to neutralize the lactic acid upon contact and spontaneously ease the pain . the elasticity of the curved needle 101 still can twist within the rigid sleeve 220 during endplate 105 puncturing , as shown in fig5 . the likelihood of twisting increases with the length of the elastic needle 101 . the twisting is depicted in a cross - sectional view of the sleeve 220 , needle 101 and conduit 126 in fig5 . the elastic twisting between the shafts of the needle 101 and sleeve 220 allows directional shift at the tip of the needle 101 during contact with the calcified endplate 105 . as a result , puncturing of the endplate 105 may fail . to avoid twisting , the cross - sections of the needle 101 and sleeve 220 can be made non - round , such as oval in fig5 with a cross - sectional view in fig5 . a square cross - section is shown in fig5 . a rectangular cross - section is shown in fig5 . a triangular cross - section is in fig6 . the elastic property of the curved needle 101 may bend and fail to penetrate through the calcified endplate 105 , as shown in fig6 . the direction of the bend or droop is at the convex side of the curvature of the needle 101 . to minimize the droop , the distal end of the rigid sleeve 220 is cut at an angle , providing an extension to support the convex side of the curved needle 101 during endplate 105 puncturing , as shown in fig6 . the angled cut of the rigid sleeve 220 functions as a rigid needle 220 with a sharp tip supporting the convex side of the curved needle 101 , as shown in fig6 . the supporting structure can be further extended by cutting an indentation near the distal end of the rigid needle 220 , as shown in fig6 , to increase support of the convex side of the curved needle 101 during endplate 105 puncturing . to further support the elastically curved needle 101 , a window 270 may be located near the distal end of the rigid sleeve 220 with an oval cross - section , as shown in fig6 . the distal side of the window 270 is open slanted at an angle . the slant can also be formed with multiple angles into a semi - circular - like pocket , sized and configured to fit the convex side of the elastically curved needle 101 . fig6 shows protrusion of the elastically curved needle 101 from the window 270 of the rigid sleeve 220 . the sharp tip of the curved needle 101 is located on the concave side of the curvature to avoid scraping or snagging on the distal portion of the window 270 during deployment . fig6 shows deployment of the elastically curved needle 101 from the window 270 of the rigid sleeve 220 . the semi - circular pocket of the distal window 270 supports and brackets around the base of the convex curvature to minimize bending , twisting and / or deflection of the curved needle 101 during endplate 105 puncturing . in essence , the slanted portion of the window 270 provides a protruded pocket to direct and support the curved needle 101 . the distal end of the rigid sleeve 220 can be sharpened to function as a rigid needle 220 with the window 270 , as shown in fig6 . when a substantial amount of bone is formed , puncturing through the bony endplate 105 with a small curved needle 101 can be challenging . increasing the size of the needle 101 and creating a large hole 224 at the endplate 105 may cause leakage of nucleus pulposus 128 into the vertebral bodies 159 . to support a small curved needle 101 , a shape memory extension 271 containing a curvature similar to the curved needle 101 is added to strengthen and support the elastically curved needle 101 , as shown in fig6 . the shape memory extension 271 can be indented , as shown in fig6 , or tubular at the distal end . the curved needle 101 and shape memory extension 271 are capable of sliding independently within the rigid sleeve or needle 220 . fig6 shows resiliently straightening of both the curved needle 101 and shape memory extension 271 within the rigid sleeve 220 . both the curved needle 101 and shape memory extension 271 apply stresses on the rigid sleeve 220 . to minimize potential bending of the rigid sleeve 220 , the stresses are distributed over a larger area by positioning the tip of the needle 101 proximal to the curvature of the shape memory extension 271 , as shown in fig6 - 69 . spreading of the stresses also helps to ease the deployment and retrieval of both the needle 101 and shape memory extension 271 . for tissue puncturing , the shape - memory extension 271 is deployed from the rigid sleeve 220 , as shown in fig6 , followed by the curved needle 101 gliding along the curvature of the shape - memory extension 271 and puncturing into the calcified endplate 105 , as shown in fig7 . the shape memory extension 271 provides support to the needle 101 to minimize bending and twisting during puncturing without increasing the size of the puncture . the shape memory extension 271 can also be non - indented and sharpened to facilitate tissue piercing , as shown in fig7 . to dislodge the conduit 126 at the endplate 105 , the plunger 109 behind the conduit 126 is held stationary , while the curved needle 101 is retrieved into the shape memory extension 271 . the shape memory extension 271 is then withdrawn into the rigid sleeve 220 . the outer diameter of the curved needle 101 can be made non - uniform , being small at the distal end for creating a small opening , as shown in fig7 . the adjoining curved portion of the needle 101 contains a thick wall and a larger outer diameter to support and strengthen the process of endplate 105 puncturing . the transition between the small and large outer diameters is gradual , as shown in fig7 , or in steps . the curved needle 101 with varying outer diameters can be made by grinding , machining or injection molding . the lumen 268 of the rigid needle 220 may have a bevel 102 and a double - sided ramp 272 , as shown in fig7 . the bevel 102 or tapering at the distal end of the lumen 268 minimizes friction against the concave side of the curved needle 101 during deployment and retrieval . the double - sided ramp 272 is protruded at the side opposite to the bevel 102 with the distal side in continuation with the sharp tip or extended end of the rigid needle 101 . the proximal side of the ramp 272 or protrusion can be shaped to conform to and support the convex side of the curved needle 101 during endplate 105 puncturing . the ramp 272 can be made with epoxy , solder or other hardened material , then shaped by machining . the ramp 272 can also be created during a molten process to seal the lumen 268 at the distal end . the sealed end is then cut , the ramp 272 and bevel 102 are shaped , and the lumen 268 is re - opened by machining . sections of the conduit 126 are made to optimize the exchange of nutrients and waste . fig7 shows a conduit 126 with braided filaments 122 connected to a porous tube 125 with a lumen 104 . the tubular 125 portion acts as a funnel , collecting nutrients from capillaries within the vertebral body 159 and funneling the nutrients into braided filaments 122 within the nucleus pulposus 128 . especially at the endplate 105 , mineralization within the pores or channels of the conduit 126 may occlude or block the exchange of nutrients and waste between the vertebral body 159 and disc 100 . fig7 shows a tube 125 covering or wrapped around the mid - section of the conduit 126 to prevent ingrowth of minerals or tissue into the pores or channels . the material for making the tube 125 can also have swelling , expanding or sealing characteristics to seal the puncture at the endplate 105 and prevent formation of schmorl &# 39 ; s node . the swelling , expanding or sealing material can be polyethylene glycol , polyurethane , silicon or others . an anti - ingrowth film or coating at the mid - section of the conduit 126 may also discourage mineralization or occlusion within the channels or pores to ensure long lasting exchange of nutrients and waste . especially within the vertebral body 159 or outer annulus , formation of fibrous tissue over the conduit 126 may occur , hindering the exchange of nutrient and waste . a portion of the conduit 126 can be coated , grafted , covalently bonded or ionic bonded with a drug to minimize fibrous formation . the drug can be actinomycin - d , paclitaxel , sirolimus , cell - growth inhibitor or fibrous tissue inhibitor . due to the soft or pliable characteristic , conduits 126 made with braided filaments 122 are difficult to deploy with the retrieving needle 101 and stationary plunger 109 . a conduit 126 made with braided filament can be stiffened with water soluble agents , such as starch , collagen , hyaluronate , chondroitin , keratan or other biocompatible agents . after deployment , the soluble stiffening agent dissolves within the body , exposing the filaments to transport nutrients , oxygen and waste . fig7 shows a monofilament 110 used as a stiff core within the braided conduit 126 to assist deployment . the monofilament 110 can be made with degradable material to maximize transport area after deployment of the conduit 126 . degradable tubes 125 , indicated in the shaded area of fig7 , can also be used to wrap and stiffen the braided filaments 122 . the degradable tube 125 or the degradable monofilament 110 can be made with poly - lactide , poly - glycolide , poly - lactide - co - glycolide or others . since nutrients are relatively abundant within the peripheral 1 cm of the disc 100 , the conduit 126 can also draw nutrients from the outer annulus through capillary action into the nucleus pulposus 128 . a needle 101 carrying the starch - stiffened conduit 126 ( not shown ) and a plunger 109 is punctured into a disc 100 with calcified endplates 105 , as shown in fig7 . the needle 101 guiding technique is similar to the one used in diagnostic injection of radiopaque dye for discography or chymopapain injection for nucleus pulposus 128 digestion to treat herniated discs 100 . guided by anteroposterior & amp ; lateral views from fluoroscopes , the needle 101 enters posteriolaterally , 45 ยฐ from mid - line into the disc 100 . a longitudinal view of the needle 101 carrying the stiffened conduit 126 puncturing through the disc 100 with calcified endplates 108 is shown in fig7 . by holding the plunger 109 stationary while the needle 101 is being withdrawn , the conduit 126 is dislodged from the lumen of the needle 101 and deployed across the disc 100 , as shown in fig7 - 80 . at least one end of the conduit 126 is placed less than 1 cm from the periphery of the disc 100 to draw nutrients and drain lactic acid . to enhance imaging , the section of the needle 101 containing the conduit 126 can be coated with a radiopaque , echogenic or magnetic coating 163 , as shown in fig8 . multiple conduits 126 can be safely and accurately deployed into different areas of a degenerating disc 100 . fig8 shows two conduits 126 deployed across a degenerating disc 100 , exchanging nutrients and waste between the inner and outer disc 100 . in locations lacking any major blood vessel and organ , the tip of the needle 101 can be guided beyond the disc 100 , as shown in fig8 , to deploy the conduit 126 beyond the disc 100 , as shown in fig8 . the extended conduit 126 may draw significantly more nutrients into the disc 100 . in addition , the extended conduit 126 may be more effective in disposing the waste generated within the disc 100 and expediting the repair and / or regeneration of the disc 100 , as shown in fig8 . psoas major muscles 193 are located adjacent to the lumbar segment of the spine . the needle 101 carrying the conduit 126 can puncture beyond the disc 100 into the muscle 193 . as a result , the conduit 126 can draw nutrients from the muscle 193 into the disc 100 , as shown in fig8 . muscles 193 are well supplied with nutrients and oxygen , and muscles 193 dissipate lactic acid well . by extending into the muscles 193 , the conduits 126 can draw an abundant amount of nutrients and safely deposit the waste from the inner disc 100 to repair or regenerate the degenerating disc 100 , as shown in fig8 . the supple and tensionless conduits 126 are expected to be free from interfering with the functions of the disc 100 and muscles 193 . methods and devices for conduit 126 deployments can also be in various combinations . the conduits 126 can be delivered into the endplates 105 , as shown in fig5 , and transverse the annulus , as shown in fig8 or 87 . an accelerated disc degeneration model was developed using rat tails . a tail section involving three discs was twisted or rotated 45 ยฐ and held for 2 weeks . the section was then compressed by coil springs and held for an additional period of time . all discs within the section degenerated . discs that had received additional nucleus pulposus from donor discs by injection experienced a delay in degeneration . furthermore , insertions of the additional nucleus pulposus prior to the destructive loads provided the longest delay against disc degeneration . after lumbar fusion procedures , the intervertebral discs 100 of adjacent free motion segments degenerate quickly . the degenerative process leads to more pain and possibly more surgery ; following each new fusion is a new vulnerable segment adjacent to it . accelerated degeneration of segments adjacent to a lumbar fusion may be the result of additional post - fusion stress and load . in the rat model , the added volume within the nucleus pulposus had a protective function against the destructive load . in conjunction with spinal fusion procedures , implanting conduits 126 within discs 100 adjacent to the fused segment may provide adequate swelling pressure contributed by an abundant supply of sulfate and oxygen to delay and hopefully prevent adjacent disc 100 degeneration . device migration with time is always a concern . the average age of patients undergoing back surgery is 40 - 45 years old . the conduit 126 is expected to remain in place within the patients for fifty or more years . migration of the tensionless conduits 126 may result in loss of effectiveness , but it is not likely to be detrimental to nerves , ligaments , muscles or organs . to minimize migration , knots 161 can be tied on the braided conduit 126 , as shown in fig8 , to anchor within the annulus , endplate 105 and / or muscle 193 . similar to knots 161 , rings 162 or protruded components 162 can be crimped on the conduit 126 , as shown in fig8 . both the knots 161 and the protrusions 162 are small enough to fit within the needle 101 . tissue ingrowth can also limit or prevent device migration . indentations 160 or tissue ingrowth holes 160 can be created on the conduit 126 , as shown in fig9 , to discourage migration with time . the conduit 126 can also be used as a delivery vehicle to introduce healing elements for maintaining or regenerating the disc 100 . the conduit 126 can be coated or seeded with growth factor , stem cells , donor cells , nutrients , buffering agent or minerals . cells sensitive to sterilization can be loaded aseptically . installations of conduits 126 can be in multiple stages , separated by days , weeks , months or even years . initial conduit 126 deployment prepares the biological conditions , including ph , electrolytic balance and nutrients , to favor cell proliferation . subsequent deployments may contain seeded cells within the conduit 126 . since cellularity within the inner disc 100 is low , cell migration from the outer annulus or vertebral bodies 159 can be helpful in regenerating the degenerating disc 100 . cells can be transported along the convective flow within the conduit 126 into the nucleus pulposus 128 . the channels or pores within the conduit 126 need to be sufficiently large , about 50 to 200 microns . for minerals , nutrients , lactic acid and gas exchange alone , the channels or pore size can be much smaller . hence , the useful range of the channel or pore size of the conduit 126 is about 200 microns to 10 nanometers . potentially useful coating for the conduit 126 include antibiotic , anti - occlusive coating , lubricant , growth factor , nutrient , sulfate , mineral , buffering agent , sodium carbonate , sodium bicarbonate , alkaline , collagen , hydroxyapatite , analgesic , sealant , humectant , hyaluronate , proteoglycan , chondroitin sulfate , keratan sulfate , glycosamino - glycans , heparin , starch , stiffening agent , radiopaque coating , echogenic coating , cells or stem cells . the tube 125 for preventing occlusion from mineralization or tissue ingrowth can be made with a biocompatible polymer , such as polytetrafluoroethylene , polypropylene , polyethylene , polyamide , polyester , polyurethane , silicon , poly - ether - ether - ketone , acetal resin , polysulfone , polycarbonate or polyethylene glycol . similar material can be used to coat or partially coat the conduit 126 to prevent blockage of nutrient and waste transport . the coating should be able to withstand sterilization by gamma , electron beam , autoclave , eto , plasma or uv light to prevent infection . especially for investigative purposes , a biodegradable conduit 126 may provide evidence within weeks or months . since the conduit 126 degrades within months , any unforeseen adverse outcome would be dissipated . if the investigative - degradable conduit 126 shows promise , a permanent conduit 126 can then be installed to provide continuous benefits . the biodegradable conduit 126 can be made with polylactate , polyglycolic , poly - lactide - co - glycolide , polycaprolactone , trimethylene carbonate , silk , catgut , collagen , poly - p - dioxanone or combinations of these materials . other degradable polymers , such as polydioxanone , polyanhydride , trimethylene carbonate , poly - beta - hydroxybutyrate , polyhydroxyvalerate , poly - gama - ethyl - glutamate , poly - dth - iminocarbonate , poly - bisphenol - a - iminocarbonate , poly - ortho - ester , polycyanoacrylate or polyphosphazene can also be used . similar biodegradable material can be used to make the biodegradable monofilament 110 in fig7 . a wide range of non - degradable materials can be used to fabricate the conduit 126 . biocompatible polymers , such as polytetrafluoroethylene , polypropylene , polyethylene , polyamide , polyester , polyurethane , silicon , poly - ether - ether - ketone , acetal resin , polysulfone , polycarbonate , silk , cotton , or linen are possible candidates . fiberglass can also be a part of the conduit 126 to provide capillarity for transporting nutrients and waste . conduits 126 can also be made with metal , such as nickel - titanium alloy or stainless steel . both non - degradable and degradable conduits 126 can be formed by molding , extruding , braiding , weaving , coiling , spiraling or machining . the conduits 126 can have a longitudinal lumen 104 , pores and / or channels for fluid exchange . the conduit 126 can be a suture with a proven safety record . the conduit 126 can also be called or classified as a shunt , wick , tube , braided suture , braided filaments , thread or sponge . the disc 100 with the conduits 126 installed can be called the shunted disc 100 . the rigid needle 101 , trocar 103 , dilator 230 and plunger 109 can be made with stainless steel or other metal or alloy . the elastically curved needle 101 , shape memory extension 271 and plunger 109 can be formed with nickel - titanium alloy . the needle 101 , rigid needle 220 , dilator 230 , shape memory extension 271 and plunger 109 can be coated with lubricant , tissue sealant , analgesic , antibiotic , radiopaque , magnetic and / or echogenic agents . since nutrients and oxygen are extremely low particularly in degenerating discs 100 , cell death is common , and healthy cells capable of producing glycosaminoglycans are few . healthy cells 277 can be drawn from another disc 100 within the patient to inject with a syringe 276 into the degenerated disc 100 , as shown in fig9 . exchange of nutrients and waste is re - established through the newly installed conduits 126 through the cranial and caudal endplates 105 to nourish both the donor cells 277 and the remaining cells within the degenerating disc 100 . similarly , donor cells 277 can also be injected into the disc 100 with transverse conduits 126 to revitalize the disc 100 , as shown in fig9 . since cellularity within the degenerative disc 100 is low , introduction of donor cells 277 may expedite the process of halting or reversing disc degeneration . the avascular disc 100 is well sealed . even small ions , such as sulfate , and small molecules , such as proline , are greatly limited from diffusing into the nucleus pulposus 128 . the well sealed disc 100 may be able to encapsulate donor cells 277 from a disc 100 of another person , cadaver or animal without triggering an immune response . for disc 100 regeneration , the donor cells 277 can also be stem cells 277 , notochord 277 or chondrocytes 277 . the semi - permeable conduits 126 are permeable to nutrients and waste but impermeable to cells , proteins , glycoproteins and / or cytokines responsible for triggering an immune reaction . the cells of the immune system include giant cells , macrophages , mononuclear phagocyts , t - cells , b - cells , lymphocytes , null cells , k cells , nk cells and / or mask cells . the proteins and glycoproteins of the immune system include immunoglobulins , igm , igd , igg , ige , other antibodies , interleukins , cytokines , lymphokines , monokines and / or interferons . the molecular weights of nutrients and waste are usually much smaller than the immuno - responsive cells , proteins and glycoproteins . the transport selectivity can be regulated or limited by the size of the pores or channels within the semi - permeable conduit 126 . the upper molecular weight cut - off of the conduit 126 can be 3000 or lower to allow the passage of nutrients and waste but exclude the immuno - responsive cells , proteins , immunoglobulins and glycoproteins . the semi - permeable conduit 126 may also contain ionic or affinity surfaces to attract nutrients and waste . the surfaces of the semi - permeable conduit 126 can be selected or modified to repel , exclude or reject immuno - responsive components . in recent years , cell transplants from cadavers or live donors have been successful in providing therapeutic benefits . for example , islet cells from a donor pancreas are injected into a type i diabetic patient &# 39 ; s portal vein , leading into the liver . the islets begin to function as they normally do in the pancreas by producing insulin to regulate blood sugar . however , to keep the donor cells alive , the diabetic patient requires a lifetime supply of anti - rejection medication , such as cyclosporin a . in addition to the cost of anti - rejection medication , the long - term side effects of these immuno - suppressive drugs are uncertain . the benefit of cell transplant may not out weigh the potential side effects . the intervertebral disc 100 with semi - permeable conduits 126 can be used as a semi - permeable capsule to encapsulate therapeutic donor cells 277 or agents , as shown in fig9 and 92 , and evade the immune response ; hence no life - long immuno - suppressive drug would be required . a variety of donor cells 277 or agent can be harvested and / or cultured from the pituitary gland ( anterior , intermediate lobe or posterior ), hypothalamus , adrenal gland , adrenal medulla , fat cells , thyroid , parathyroid , pancreas , testes , ovary , pineal gland , adrenal cortex , liver , renal cortex , kidney , thalamus , parathyroid gland , ovary , corpus luteum , placenta , small intestine , skin cells , stem cells , gene therapy , tissue engineering , cell culture , other gland or tissue . the donor cells 277 are immunoisolated within the discs 100 , the largest avascular organs in the body , maintained by nutrients and waste transport through the semi - permeable conduits 126 . the donor cells 277 can be from human , animal or cell culture . in the supine sleeping position , nutrients and oxygen are supplied through the conduits 126 to the donor cells 277 . during waking hours while the pressure within the disc 100 is high , products biosynthesized by these cells 277 are expelled through the conduit 126 into the vertebral bodies 159 , outer annulus or muscle 193 , then into the veins , bodily circulation and target sites . the product biosynthesized by the cells 277 within the shunted disc 100 can be adrenaline , adrenocorticotropic hormone , aldosterone , androgens , angiotensinogen ( angiotensin i and ii ), antidiuretic hormone , atrial - natriuretic peptide , calcitonin , calciferol , cholecalciferol , calcitriol , cholecystokinin , corticotropin - releasing hormone , cortisol , dehydroepiandrosterone , dopamine , endorphin , enkephalin , ergocalciferol , erythropoietin , follicle stimulating hormone , ฮณ - aminobutyrate , gastrin , ghrelin , glucagon , glucocorticoids , gonadotropin - releasing hormone , growth hormone - releasing hormone , human chorionic gonadotrophin , human growth hormone , insulin , insulin - like growth factor , leptin , lipotropin , luteinizing hormone , melanocyte - stimulating hormone , melatonin , mineralocorticoids , neuropeptide y , neurotransmitter , noradrenaline , oestrogens , oxytocin , parathyroid hormone , peptide , pregnenolone , progesterone , prolactin , pro - opiomelanocortin , pyy - 336 , renin , secretin , somatostatin , testosterone , thrombopoietin , thyroid - stimulating hormone , thyrotropin - releasing hormone , thyroxine , triiodothyronine , trophic hormone , serotonin , vasopressin , or other therapeutic products . the products ( hormones , peptides , neurotransmitter , enzymes , catalysis or substrates ) generated within the shunted disc 100 may be able to regulate bodily functions including blood pressure , energy , neuro - activity , metabolism , activation and suppression of gland activities . some hormones and enzymes govern , influence or control eating habits and utilization of fat or carbohydrates . these hormones or enzymes may provide weight loss or gain benefits . producing neurotransmitters , such as dopamine , adrenaline , noradrenaline , serotonin or ฮณ - aminobutyrate , from the donor cells 277 within the shunted disc 100 can treat depression , parkinson &# 39 ; s disease , learning disability , memory loss , attention deficit , behavior problems , metal or neuro - related disease . release of the products biosynthesized by the donor cells 277 within the shunted disc 100 is synchronized with body activity . during activities of daily living , the pressure within the shunted disc 100 is mostly high to expel the products biosynthesized by the donor cells 277 into circulation to meet the demands of the body . in the supine position , the flow within the shunts 126 is reversed , bringing nutrients and oxygen into the disc 100 to nourish the cells 277 . using islets of langerhans from the donor &# 39 ; s pancreas as an example , production of insulin is induced in the shunted disc 100 during sleeping hours when glucose enters into the disc 100 . during waking hours when disc pressure is high , insulin is expelled through the conduits 126 into circulation to draw sugars into cell membranes for energy production . at night , the insulin released from the shunted disc 100 is minimal to prevent the hypoglycemia . in essence , products biosynthesized by the donor cells 277 are released concurrent with physical activity to meet the demands of the body . some biosynthesized products from the donor cells 277 are appropriately deposited through the vertebral body 159 , as shown in fig9 , then into bodily circulation . other products may be more effectively transported through the outer annulus , as in fig8 , and diffused through the abdomen into bodily circulation . some other products may be far more effective by entering into the muscles 193 , as shown in fig9 . growth factors , buffering agents , hormones , gene therapeutic agents , nutrients , minerals , analgesics , antibiotics or other therapeutic agents can also be injected into the shunted discs 100 , similar to fig9 - 92 . it is to be understood that the present invention is by no means limited to the particular constructions disclosed herein and / or shown in the drawings , but also includes any other modification , changes or equivalents within the scope of the claims . many features have been listed with particular configurations , curvatures , options , and embodiments . any one or more of the features described may be added to or combined with any of the other embodiments or other standard devices to create alternate combinations and embodiments . the conduit 126 can also have a gate to regulate rate and / or flow direction of nutrient , gas and waste exchange . it is also possible to connect a pump to the conduit 126 to assist the exchange between the disc 100 and the bodily fluid . a ph electrode may be exposed near the tip of the rigid needle 220 to detect the acidity within the disc 100 . it should be clear to one skilled in the art that the current embodiments , materials , constructions , methods , tissues or incision sites are not the only uses for which the invention may be used . different materials , constructions , methods or designs for the conduit 126 can be substituted and used . nothing in the preceding description should be taken to limit the scope of the present invention . the full scope of the invention is to be determined by the appended claims . for clarification in claims , sheath is a rigid tubular member . the elastically curved needle 101 can be called the elastic needle . | 0 |
the page lifting spring of fig3 is not a stand - alone device . it must be used in combination with the page lifters of prior art as described in fig2 . together the page lifting spring and the page lifter form a page lifting system . the page lifting system essentially eliminates the loose - leaf binder closing problems . the page lifting spring is made of a sheet of relatively stiff durable material such as , but not limited to , plastic or polymer . the typical durometer of this material is 69 b . the page lifting spring is a single sheet of material that spans both covers and the center section of a loose - leaf binder . the page lifting spring may cover part of each loose - leaf binder cover or it may cover each cover completely . the page lifting spring has slots created in it so that it can be installed over the loose - leaf binder rings . there are two slots for each binder ring . the page lifting spring slots are sized and located such that the center section of the page lifting spring is flat when the binder is open , and each cover and the center section , is lying on a flat surface such as a table . the page lifting spring is not attached to the binder center section of the binder or the binder covers , but is kept in place by its slots sliding on the binder rings . the page lifting spring is first installed on the loose - leaf binder rings . the page lifters of prior art are installed next on the binder rings . the loose - leaf pages are then installed on the rings and then the rings are closed . as the binder begins to close , several simultaneous actions begin to take place . region 1 of fig2 begins to slide toward the outside edges of region 3 of fig3 and simultaneously region 4 of fig2 begins to slide toward the edge of region 5 of fig3 . regions 1 and 4 of fig2 are in contact with region 2 of fig3 . also as the binder begins to close , region 6 of fig2 begins to slide on region 7 toward region 3 of fig3 . simultaneously region 8 of fig2 begins to slide on region 21 toward region 5 of fig3 . also as the binder begins to close , region 3 of fig3 begins to slide on region 9 toward region 10 of fig1 . simultaneously region 5 of fig3 begins to slide on region 11 toward region 12 of fig1 . also as the binder begins to close , the left stack of pages , see fig5 , begins to slide on region 13 of the page lifting spring and region 14 which is the left binder cover toward region 15 which is the left edge of the binder cover of fig4 . simultaneously the right stack of pages of fig5 begins to slide on region 16 of the page lifting spring and region 17 , which is the right binder cover toward region 18 , which is the right edge of the binder cover of fig4 . a significant feature of the page lifting system is that the page lifting spring will not allow the edges of the page lifters of prior art , regions 1 and 4 of fig2 to fall into the position shown in regions 19 and 20 of fig6 . when the page lifting spring is not used the page lifter of prior art can assume the position shown in fig6 . when the page lifter is not used with the page lifting spring , there is no lifting action on regions 1 and 4 of fig2 . all of the lifting action comes from the page lifters of prior art riding up the ring . when the page lifting system is used , the lifting action occurs at the regions 1 and 4 of fig2 as well as the lifting action provided by the rings in the slots of the page lifter of prior art . | 1 |
this invention is described in the context of a radiotelephone or mobile terminal that operates in accordance with an analog ( fm ) mode and a time division multiple access ( tdma ) digital mode of operation ( dual - mode ), as specified in the dual - mode interim standard is - 136 and its future revisions . however , it should be realized that the teaching of this invention may be employed in an all - digital radiotelephone , and may also be employed in a radiotelephone that operates with spread spectrum ( ss ) and code division multiple access ( cdma ) techniques , such as that described in the is - 95 standard . fig1 illustrates a block diagram of a dual - mode mobile terminal ( is - 136 compatible ) that is constructed in accordance with the invention . an antenna ( 1 ) receives a signal from a base station ( not shown ). the received signal has a center frequency of 885 mhz . the received signal is fed through a bandpass filter ( 2 ) to a mixer ( 3 ). the receiver &# 39 ; s first local oscillator signal is generated with an rx - synthesizer ( 7 ) which is tuned above the received frequency by an amount equal to , by example , 45 mhz . the receiver block ( 4 ) demodulates and processes the received signal and provides the processed received signal , for voice information , to an audio processing block ( 5 ). the required audio processing is accomplished digitally ( using a digital to analog converter ) or in an analog manner , depending on the operating mode . the output of the audio processor 5 drives a loudspeaker ( 6 ) whereby a user is enabled to hear the speech of another party during a conversation . for the case where the short message service broadcast channel ( s - bcch ) is being received , the s - bcch information is extracted from the received signal by the receiver block ( 4 ), and the extracted digital information is input to a controller ( 20 ) on a path ( 4a ). in this regard the controller ( 20 ) manages various counters to maintain synchronization with the hyperframe and superframe counters and indicators of the b - sms , as described previously . having described the receiving side , a description is now given of the transmitting side of the dual - mode mobile terminal . a voice signal is fed from a microphone ( 8 ) to an analog to digital ( a / d ) converter ( sa ) and thence to a vocoder ( 9 ), in the digital mode , or to an audio processing block ( 14 ) for audio shaping and companding in the analog mode . after audio processing , the analog signal is fed to a digital to analog converter ( d / a ) ( 15 ) for conversion back to an analog signal . the operation of the d / a converter ( 15 ) is controlled by the controller ( 20 ), preferably implemented as one or more microprocessors that operate under a control program . in a presently preferred embodiment of this invention there are two microprocessors . one is a high speed digital signal processor ( dsp ) that manages the layer 1 and layer 2 real - time interface to the radio channel . the second microprocessor ( mcu ) is a slower speed device that is responsible for managing the user interface , via a keypad ( 22 ) and a user display ( 19 ), and also the layer 3 and above real - time interface to the radio channel . the layers 1 , 2 and 3 are illustrated in , by example , fig2 - 1 and 2 - 2 of the is - 136 rev . 0 specification . for simplicity , the dsp and the mcu are collectively illustrated in fig1 as the controller ( 20 ). in the digital mode of operation the controller ( 20 ) causes the output signal from the d / a converter ( 15 ) to assume a predetermined level , or to be switched out and replaced by a predetermined potential . in the analog mode of operation the controller ( 20 ) causes the output of the d / a converter ( 15 ) to be coupled to the input of a programmable oscillator of a transmitter synthesizer ( tx synth ) ( 16 ). that is , the output frequency of the tx - synthesizer ( 16 ) is varied in accordance with the input audio signal , thereby achieving a frequency modulation of the tx - synthesizer ( 16 ) output frequency . the controller ( 20 ) also operates to frequency modulate the tx - synthesizer ( 16 ) output frequency in accordance with signalling information to be transmitted . the tx - synthesizer ( 16 ) output frequency is also controlled to achieve channel switching . the output frequency of the tx - synthesizer ( 16 ) is applied to a mixer ( 17 ) wherein it is mixed with the output of an offset oscillator ( 18 ) to generate a transmitter injection signal ( lo ) at the final transmitter frequency ( 840 mhz ). the offset oscillator ( 18 ) is typically set to 90 mhz . a further oscillator ( not shown ) may provide a synchronizing frequency to the rx synth ( 7 ), the tx synth ( 16 ), and the offset oscillator ( 18 ). it should be realized that the exact frequencies of the transmitter and receiver synthesizers ( 7 ) and ( 16 ) and the offset oscillator ( 18 ) are adjustable according to application specific requirements . the values given above are suitable for use in the dual - mode interim standard specified in is - 136 , and are not intended to be read in a limiting sense upon the practice of the invention . as was indicated previously , the mobile terminal also includes the user display ( 19 ) and the keypad ( 22 ), each of which is coupled to the controller ( 20 ). although the user display ( 19 ) and keypad ( 22 ) may be used in a conventional manner to place a call , their use is extended by the teaching of this invention to provide a novel interface for short message service ( sms ) functions of a type referred to in the background portion of the specification . a message memory ( 21 ) is also provided . the message memory ( 21 ) may be a part of the random access memory of the controller ( 20 ), and / or may be implemented with a non - volatile memory ( e . g ., eeprom ). referring to fig2 a user of the mobile terminal of fig1 employs the keypad ( 22 ) to enter information into the controller ( 20 ). this preferably occurs during a time that the controller ( 20 ) displays a b - sms menu on the display ( 19 ). at block a the user interface is initialized and the b - sms menu is displayed . at block b a first menu function can be invoked by the user for enabling / disabling b - sms reception . if this menu function is invoked control passes to block c where the controller ( 20 ) sets a flag to either enable or disable the reception of the b - sms information . it may be desirable to disable the reception of the b - sms information to maximize the battery life of the mobile terminal . control then passes to the block labeled done . alternately , an enable / disable b - sms display menu function can be enabled at block d . if this function is selected control passes to block e where the controller ( 20 ) sets a flag to selectively enable or disable the display of b - sms message data on the user display ( 19 ). alternately , at block f an enable / disable of a first b - sms audible tone is selected . if this function is enabled the controller ( 20 ) at block g sets a flag to enable or disable the generation of an audible tone on the occurrence of a new b - sms message . the audible tone can be generated by the controller ( 20 ) by programming a digital to analog converter that forms a portion of the audio processor block ( 5 ). the audible tone is generated when , after all b - sms channels have been scanned by the controller ( 20 ), a new message ( with a new message id ) is located . the new message is then displayed if the display has not been disabled at block e . in this regard the controller ( 20 ) may store the header portion of all received messages . the stored header contains the start strings from all messages currently being transmitted on the b - sms channels . the controller ( 20 ) may then monitor the b - sms continuously and update the stored header information as appropriate . deleted messages can be removed from the header list while new messages are added to the header list . alternately , at block h a scan for selected messages function can be enabled . if this function is enabled control passes to block i where the controller ( 20 ) sets a flag to enable or disable the scanning of the b - sms for selected message ids . during the operation of this function , all message headers belonging to a user - selected category list ( e . g ., news information , financial information , etc .) are indicated to the controller ( 20 ). after selection of a specific message id the controller ( 20 ) will receive and store the complete message and , optionally , also some predetermined number ( e . g ., 5 ) of subsequent messages . after the messages have been stored in the message memory 21 , the user is enabled to read the stored messages using a scroll key function found on the keypad ( 22 ). this scroll key function forms a portion of the conventional user interface . messages remain stored until the user chooses another message id to be displayed . alternately , at block j an enable / disable second b - sms audible tone can be enabled . if this function is enabled control passes to block k where the controller ( 20 ) sets a flag to enable or disable the generation of an audible tone to indicate when the controller ( 20 ) has received and stored a user selected message from the b - sms channel . if the second audible tone is disabled the controller ( 20 ) instead displays the beginning of the received message without audibly notifying the user . alternately , at block l the user is enabled to select b - sms scan categories for the controller ( 20 ). if enabled , the controller ( 20 ) displays a list of b - sms category types and the user employs the keypad ( 22 ) to select one or more category types . in response , the controller ( 20 ) sets flags to enable only the selected b - sms category types for reception . all messages that belong to a selected category will be either displayed or stored in the message memory ( 21 ). the second audible tone , if enabled at block k , is generated to alert the user that the controller ( 20 ) has received a message that matches one of the selected categories , after which the received message is displayed . in addition to the category selection menu a menu may also be displayed enabling keyword selection for messages that fall under the selected category . by example , if the financial message category is selected , the user may enter a keyword , such as the name of a particular company or stock . if the controller ( 20 ) receives a financial category message , and if the indicated keyword occurs within the message , then the message is displayed and the second audible tone generated , if enabled at block k . if the broadcast b - sms has been enabled on any combination of , or on all , sms categories and channels , the controller ( 20 ) will receive all messages for this combination . these messages are then either displayed , stored , or discarded . after all messages on user selected channels and categories have been received once , the controller ( 20 ) will thereafter only respond to updated messages . in this mode the controller ( 20 ) displays as much of the new message as it is able to display to enable the user time to read the message . in this reception mode the display ( 19 ) is scrolled to show all messages being received . if more messages are received than can be displayed with enough time for the user to read the message ( e . g ., 2 seconds ), the controller ( 20 ) may truncate the messages before display . in this regard all messages can be truncated by some predetermined amount . alternatively , selected message types can be prioritized by the user at block m , such as by the order of selection , and higher priority messages truncated less than lower priority messages . if the mobile terminal is connected via an adapter ( 24 ) ( fig1 ) to an external data processor or other device capable of message storage , all received messages can be output through the adapter ( 24 ) for storage and subsequent later display . in this regard it is noted that the above - described user interface functions illustrated in fig2 can also be accomplished through the adapter ( 24 ), wherein the display of an attached data processor is used in place of the display ( 19 ), and wherein the keyboard or pointing device of the attached data processor is used in place of the keypad ( 22 ). a command or a keystroke ( s ) sequence , if received by the controller ( 20 ) through the adapter ( 24 ), can be employed to cause the controller ( 20 ) to direct data to the adapter for external display , and to respond to information entered through the adapter ( 24 ). it is noted that the b - sms functions in a manner analogous to a videotext service , and periodically transmits all messages selected for broadcast . all broadcast messages are specified in a header type of message which gives the message id and category . all changes to the contents of a broadcast cycle on any of the four b - sms channels can thus be given in the header message information . in addition , all changes can be indicated by a change flag on a paging channel which the controller ( 20 ) constantly monitors . in order to conserve battery power it is preferred that the mobile terminal read only once the unchanged content of the b - sms , and thereafter only by request of the user . thus , if the b - sms has been enabled for certain categories of messages , the mobile terminal will only read the selected category messages once and thereafter only in the case where new or updated message is received in the user - selected category or categories . although not shown in fig2 a further menu function can be employed to control the scrolling of messages on the display 19 . while the invention has been particularly shown and described with respect to a preferred embodiment thereof , it will be understood by those skilled in the art that changes in form and details may be made therein without departing from the scope and spirit of the invention . | 7 |
the following examples are given to illustrate the present invention but are not to be construed as limiting . dehydrated paprika ( 5 . 5 % moisture ) is ground in a hammer mill and the resulting ground paprika ( 95 % passing us 40 mesh ) is admixed with about 10 % by weight of soy bean oil and processed in a countercurrent extraction system involving three ( 3 ) pressing stages , each using an egon keller model kek - 100 screw press , with the extracts from the second and third stages being returned to the preceding mixing stage before being removed from the process at the end of the first press stage . a high shear , high speed pin mixer or equivalent is used to mix the soy oil or extracts from the second and third press stages into the ground spice or residual solid from the preceding stage . this recycling is continuous . the raw material paprika solids are continuously fed at a rate of about 240 lbs . per hour with a total contact time in each mixing stage of about 15 - 60 seconds . the residence time in each press is 5 - 60 seconds . the pressing stages are operated at about 10 , 000 psi internal pressure and about 200 degrees fahrenheit , which is maintained by cooling with water through the bore of the press shafts . the starting color value of the ground paprika solids is 200 asta . the principal components extracted and standardized in both the extract and the residual solid are the carotenoid pigments . the resulting final soy - paprika extract has a color value of about 1 , 375 asta and the reground paprika residual solid from the final ( 3rd ) press stage has a color value of about 85 asta . by varying the percentage of edible solvent employed from about 5 % to 20 %, the pressure from about 6 , 000 to 30 , 000 psi , the number of countercurrent mixing and pressing stages from 2 to 5 , with return of the extract from each press stage to the preceding mix stage before final removal from the process in the first press stage , varying the temperature from about 130 ยฐ f . to 280 ยฐ f ., and removing the seed from the paprika solids prior to grinding , the resulting extract ranges in color value from about 2 , 700 asta to about 800 asta and the residual solids range in color value from 180 asta to 35 asta . by regrinding the residual solids ( from the final stage ) just as is done with fresh , dehydrated paprika , a product in every way comparable to commercially available ground paprika solids is produced . after filtering or centrifuging off the fine particulate solids , the extract can be directly substituted for commercially available paprika oleoresin in every respect . by varying the pressing temperature of the process from about 130 ยฐ f . to 325 ยฐ f ., the hue of the reground residual solid is varied from slightly browned to a dark chocolate brown , demonstrating that the degree of brownness can be controlled by the pressing temperature employed . the degree of &# 34 ; brownness &# 34 ; is measured using a hunter labscan spectrocolorimeter with 0 degree illumination , 45 degree circumferential viewing , illuminant d65 , 10 degree observer , ceilab coordinate system . the hue of the paprika powder is measured by placing the powder in a 2 . 5 - inch diameter cuvette , shaking gently to ensure even coverage , and measuring through the bottom of the cuvette . the results of the varied operating temperatures of the process are shown in table i . the designation l * is indicative of the &# 34 ; lightness &# 34 ; of the sample with the higher numbers being lighter or less browned , and the lower numbers being darker or more browned . table i______________________________________processing temperature visual appearance l * values______________________________________130 ยฐ f . red 40 . 18150 ยฐ f . tan - red 37 . 25200 ยฐ f . light brown red 33 . 22280 ยฐ f . dark brown red 29 . 16325 ยฐ f . chocolate red 22 . 85______________________________________ the data clearly demonstrate that the degree of browning can be controlled by varying the press temperature at which the process is conducted . this broadens the applications or uses of the residual solid to include a base for toasted chili powder and as a replacement for browned , caramelized paprika . the residual solid can be substituted for ground paprika or chili powder in many common applications and a separate processing step for browning to a desired degree is not required . the starting ground paprika solids have an aerobic plate count ( analysis run according to bacterial analytical manual by aoac , 8th edition , 1995 , and iso - grid methods manual , 3rd edition , 1989 ) of about 14 , 000 , 000 . the residual solids exiting the extraction system have a count of about 2 , 000 to 200 , 000 , with the lower count being achieved at the higher temperatures . this is a significant reduction and makes the residual solids per se suitable for any application where treatment with ethylene oxide or irradiation would normally be required . the foregoing example is repeated with all materials and conditions being the same , except that the soybean oil edible solvent is supplemented with an antioxidant blend at a concentration of 3 % by weight of the original ground paprika solids . the blend consists of about 29 % lecithin , 20 % powdered ascorbic acid , 5 % citric acid , 15 % tocopherol , and 1 % rosemary extract ( in accordance with chang and wu u . s . pat . no . 5 , 077 , 069 ). the stability of ( 1 ) the resulting extract and ( 2 ) the residual solids is compared in each case with an untreated control . in such evaluation , the paprika extracts are plated on flour salt to an extent of 2 . 4 % by weight with a mortar and pestle . two - gram samples are weighed into 13 ร 100 mm test tubes . the test tubes are stored in a thermostatically - controlled oven at 65 ยฐ c . samples are withdrawn periodically , extracted with acetone , and the color at 460 nm of a standard (%) dilution in acetone is determined spectrophotometrically . in the evaluation of the residual solids , two - gram samples of the reground residual solid are substituted for the flour salt dispersions . the procedure for the &# 34 ; standard dilution &# 34 ; is as follows : the initial color of the dispersion is determined by pouring two grams of the original dispersion into a 100 - ml flask . acetone is added up to the 100 - ml level . the flask is inverted several times . the flour salt is allowed to settle for five minutes . then three ml of the dilution is pipetted into a 25 - ml flask and diluted up to the 25 - ml level . the absorbance is read at 460 nm . the 460 nm color is determined by the formula : ## equ1 ## where the percent dispersion is determined by the formuls : ## equ2 ## to translate to asta color , multiply the 460 nm color by 820 . the color is plotted against time and the time for 1 / 3 of the starting color to fade is reported as the 2 / 3 life . this is a highly - reproducible measurement , which is sufficiently accurate to evaluate the effectiveness of the antioxidants and will assist the practitioner to optimize formulations for specific uses . the final extract from the first press stage of the unprotected or unstabilized process has a color value of about 1375 asta and a 2 / 3 life of 6 . 5 hours as compared to a color value of about 1600 asta and a 2 / 3 life of 63 hours for the extract from the protected material . the color value of the unprotected or unstabilized residual solids is about 85 asta with a 2 / 3 life of 54 hours , compared to the protected solids which have a color value of about 95 asta and a 2 / 3 life of 155 hours . this clearly demonstrates that inclusion of antioxidants can improve not only the color yields from the extraction process but also at the same time improve the color stability of both the extract and the residual solids . other suitable antioxidants ( e . g ., lecithin , ethoxyquin , butylated hydroxy anisole ( bha ), butylated hydroxy toluene ( bht ), tertiary butyl hydroxy quinone ( tbhq ), sesame , tea catechins , and labiatae herb antioxidant activity , finely - divided ascorbic acid , tocopherol , citric acid ) can be substituted in whole or in part for the specific antioxidant mixture employed with similar desirable color - protective results , preferably a naturally - occurring antioxidant from an herb of labiatae family , e . g ., rosemary , sage , or thyme , or powdered ascorbic acid . dehydrated paprika solids ( 2 . 5 % moisture ) were ground in a hammer mill and the resulting ground paprika ( 95 % passing us 40 mesh ) was processed with about 15 % by weight of soy bean oil in a countercurrent extraction system as in example 1 involving two ( 2 ) pressing stages , with extracts from the second press stage being returned to the preceding ( first ) mix stage before being removed from the process at the first press stage . upon exiting the first press stage , distilled water was metered continuously into the crude extract at a rate of 75 % by weight of the gums and solids by means of an inline static mixer . the weight of the gums and fine particulate solids in the extract was determined by diluting one gram of the crude extract in nine grams of acetone . the mixture was spun down for three minutes at 2000 g &# 39 ; s in a laboratory centrifuge . the solids separated were air dried and the weight of the gums and solids was calculated as a percentage of the weight of the starting extract . the hydrated gums and solids removed from the extract were continuously returned to the final residual press solids via a high shear , continuous pin mixer installed immediately following a water - jacketed cooling screw which received the residual solids from the second press stage . prior to hydration and centrifugation , the extract contained approximately 10 % by weight of gums and fine particulate solids as determined by the above - described method . following hydration and centrifugation the gums and particulate solids amounted to no more than 1 % by weight of the extract and the extract was a crystal clear solution , free of any suspended insoluble materials . the color value of the starting ground paprika was about 150 asta . the pressing stages were operated at about 20 , 000 to 30 , 000 psi . the extraction process was started with the presses operating at about 80 ยฐ f . as measured by the temperature of the cake exiting the presses . the temperature of the presses was controlled by the rate of flow of cooling water through the bore of the press shafts and the screen cages to keep the operating temperatures in the range of 80 ยฐ to 180 ยฐ f . over the time of the extraction run , the operating temperatures of the presses , as measured by the temperature of the cake exiting the presses , was gradually increased to about 255 ยฐ f . by first slowing and then stopping the flow of cooling water to obtain operating temperatures of 180 - 200 ยฐ f ., and then by substituting steam for the water in the shaft and cages at gradually increasing pressures to achieve temperatures of 200 - 255 ยฐ f . samples of the extracted oil and press residual solids were pulled at various temperature intervals as the temperatures were increased . samples of the residual solids were pulled at two points , the first ( non - rehydrated ) immediately after exiting the cake - cooling screw following the final ( second ) pressing stage , and the second after the thus - cooled residual press solids were rehydrated to a moisture content of about 10 %. the samples were assayed for asta color , aerobic and anaerobic plate count , and color stability over time using methods employed in examples 1a and 1b . the advantages of operating the process at a temperature above 130 ยฐ f ., as indicated by the temperature of the cake exiting the presses , can clearly be seen . the plate count of both the extract and the cake are progressively reduced as the temperatures are increased . ( tables 2 & amp ; 3 ) table 2______________________________________effect of increasing temperatureson the plate count of the extracttemperature degree f . aerobic plate count anaerobic plate count______________________________________ 80 1 , 900 , 000 790 , 000130 1 , 700 , 000 800 , 000150 1 , 700 , 000 660 , 000170 1 , 600 , 000 500 , 000175 1 , 500 , 000 425 , 000180 1 , 300 , 000 380 , 000190 360 , 000 150 , 000200 300 , 000 200 , 000215 240 , 000 150 , 000225 190 , 000 65 , 000235 170 , 000 32 , 000245 69 , 000 8 , 600255 3 , 800 830______________________________________ table 3______________________________________effect of increasing temperatures on the platecount of the press solidstemperature degree f . aerobic plate count anaerobic plate count______________________________________ 80 220 , 000 55 , 000130 160 , 000 35 , 000150 160 , 000 25 , 000170 100 , 000 20 , 000175 32 , 000 15 , 000180 80 , 000 7 , 400190 3 , 500 800200 9 , 800 3 , 400215 5 , 800 2 , 300225 4 , 100 500235 1 , 900 1 , 100245 5 , 400 100255 800 100______________________________________ the efficiency of extraction is dramatically improved as evidenced by the progressively decreasing asta values and the progressively decreasing residual extractable yields of the press residual solids . it is apparent that , to achieve residual extractable yields of less than about 20 % by weight of the cake , it is necessary to operate the presses at 130 ยฐ f . or higher . ( table 4 ) moreover , for obvious reasons of efficiency , temperatures above 180 ยฐ f ., and especially between about 180 ยฐ f . and about 235 ยฐ f ., are greately preferred . table 4______________________________________press cake asta and residual yields atprogressively increasing temperaturestemperature degree f . press solids asta press solids residual yield______________________________________ 80 87 28 . 28 % 130 76 16 . 40 % 150 65 15 . 72 % 170 61 15 . 72 % 175 53 12 . 36 % 180 43 13 . 88 % 190 42 10 . 84 % 200 44 10 . 72 % 215 41 9 . 96 % 225 39 9 . 50 % 235 33 9 . 28 % 245 32 9 . 00 % 255 35 9 . 80 % ______________________________________ most importantly , the stability of the extract is not adversely affected and is in fact increased . the results , from example 2 , of an accelerated study on the stability of the extract , generated at varying press operating temperatures , can be seen in table 5 . the accelerated study was done according to the procedures described in example 1b with the colors reported as a percent of the starting color for each respective sample to adjust for the varying color yields at the respective temperatures . these results demonstrate that the extract produced at higher operating temperatures exhibits increased resistance to oxidative color deterioration . this is surprising , as explained in the following . table 5______________________________________press oleoresin ( extract ) stability , accelerated , 65 ยฐ c . temperature hour hour hour hour hourdegree f . 2 4 8 12 17______________________________________ 80 94 % 88 % 81 % 73 % 62 % 130 94 % 89 % 82 % 75 % 64 % 170 93 % 89 % 82 % 76 % 65 % 225 94 % 90 % 82 % 78 % 67 % 235 94 % 90 % 82 % 77 % 69 % 255 95 % 90 % 84 % 78 % 72 % ______________________________________ it is commonly believed that lipid - containing systems , exposed to heat , will exhibit an increased rate of lipid oxidation that , once initiated , will proceed at an ever - increasing rate . ( rancidity and its measurement in edible oils and snack foods , a review , robards , kerr , and patsalides , analyst , february 1988 , vol 113 ). in fact , prior art ( u . s . pat . no . 4 , 681 , 769 ) claims a process for counter - current , high pressure extraction of capsicums at less than 100 ยฐ f . and less than 500 psi for the express reason of protecting the extracted oil from oxidation . to confirm the positive effect of high temperature treatment in more controlled conditions , a forty gram sample of hexane - extracted oleoresin paprika , with no diluents added , was heated in a beaker on a heated stir plate at 100 ยฐ c . for eight and one - half hours . a control sample which was unheated , a sample pulled from the heated beaker after four hours , and a sample of the material heated for the full eight and one - half hours were dispersed on flour salt to make dispersions of 1 . 2 % oleoresin by weight of flour salt . two gram - portions of the dispersions were weighed into test tubes and placed in a 65 ยฐ c . oven . an initial asta color was run on each dispersion and then asta colors were run periodically and the results were plotted versus time to determine the relative stability of the heated and unheated samples . the results are shown in table 6 . it can be readily observed that the heat - treated samples , although they lose some initial color during the heating process , have improved stability over time , thus confirming the improved resistance to oxidation observed in table 5 . table 6______________________________________asta values of heated & amp ; unheated oleoresinpaprika ( extract ) over timehours unheated heated 4 @ 100 ยฐ c . heated 8 @ 100 ยฐ c . ______________________________________ 0 32 . 5 31 . 5 26 . 0 2 29 . 0 29 . 0 25 . 8 4 26 . 0 28 . 0 25 . 7 6 24 . 0 27 . 0 25 . 5 8 22 . 5 25 . 8 25 . 310 21 . 0 24 . 5 25 . 012 20 . 0 23 . 0 24 . 814 19 . 0 22 . 3 24 . 516 18 . 0 21 . 8 24 . 018 17 . 0 21 . 0 23 . 520 16 . 0 20 . 0 23 . 022 15 . 1 19 . 0 22 . 524 14 . 2 18 . 5 22 . 126 13 . 4 18 . 0 21 . 828 12 . 9 17 . 5 21 . 430 12 . 5 17 . 0 21 . 0______________________________________ the non - rehydrated press residual solids produced in example 2 exhibit decreased resistance to oxidative color loss as the press operating temperatures are increased as predicted by prior art ( bennett et al , u . s . pat . no . 4 , 681 , 769 ) and as seen in table 7 . table 7______________________________________stability of non rehydrated press solids at variouspress operating temperatures , expressed as percentof starting color retainedtemperature degree f . week 2 week 4 week 6______________________________________ 80 86 . 7 % 82 . 2 % 85 . 5 % 130 89 . 6 % 85 . 5 % 84 . 6 % 170 73 . 3 % 65 . 3 % 58 . 1 % 225 61 . 7 % 35 . 8 % 32 . 5 % 245 68 . 2 % 31 . 0 % 19 . 3 % ______________________________________ but , very importantly , it can be seen that the press residual solids which are rehydrated immediately after exiting the second press stage of the process ( example 2 ) exhibit significantly increased stability ( table 8 ) relative to the non - rehydrated solids , thus overcoming the claimed disadvantages from operating at temperatures above 100 ยฐ f . as set forth in u . s . pat . no . 4 , 681 , 769 . table 8______________________________________stability of rehydrated press solids at variouspress operating temperatures , expressed as percentof starting color retainedtemperature degree f . week 2 week 4 week 6______________________________________ 80 90 % 92 % 91 % 130 93 % 91 % 92 % 170 92 % 92 % 91 % 225 94 % 93 % 91 % 245 95 % 94 % 93 % ______________________________________ in fact , after discounting for the effect on pigment stability of increasing residual extractable yields in the press solids ( tables 4 & amp ; 11 ) obtained at the lower temperatures , the carotenoid pigments in the residual solids would show enhanced stability for a given residual extractable yield . these are surprising and unexpected results and clearly overcome the supposed obstacle of operating at elevated press temperatures and pressures . it is further surprising that the color stability of the residual press solids is significantly improved by controlling the water activity ( a w ) of the solids in ranges above those suggested for the stabilization of lipidcontaining systems by extensive studies and particularly by nelson and labuza , water activity and food polymer science : implications of state on arrhenius and wlf models in predicting shelf life , k . a . nelson & amp ; t . p . labuza , journal of food engineering 22 , 271 - 289 ( 1994 ). water activity is defined as the ratio of the vapor pressure of water in a food to the vapor pressure of pure water at the same temperature . prior art suggests that maximum stability of lipid systems should be attained at water activities of about 0 . 3 with decreasing stability developing as the water activity is increased above this level . in this example we find precisely the inverse effect on stability of the carotenoid pigments for a given water activity . in order to confirm the effect of high temperatures in the pressing operation , and to confirm the effect of added moisture , a controlled test was performed on a laboratory scale where the effect of levels of extractable yield in the cake could be controlled to eliminate the effect of variable press cake residual yields on the stability of the carotenoids . a 3 , 000 gram sample of ground paprika solids ( 175 asta , 9 . 8 % extractable yield ) was dried in a lab tray dryer at 100 ยฐ f . for 16 hours to a moisture content of about 2 %. one half of this sample was then heated in an oven at 220 ยฐ f . for twenty minutes to approximate the temperature in a pressing operation according to the invention . the other unheated sample served as a control . one hundred gram samples of each of the two materials were rehydrated at approximately 1 % intervals up to about 12 % moisture . the water activity a w of each was determined using a rotronics hygroskop dt , model dt2 / 1 - 00iv , water activity instrument . samples were weighed into sealed test tubes , stored at ambient temperatures of about 72 ยฐ f . in the dark , and the asta colors were determined over a period of eighteen weeks to determine the relative rates of color degradation . the color retained ( as a percentage of the starting color for each sample to compensate for the effect of color dilution with the rehydration water ) was plotted against time . table 9______________________________________percent color retained of unheated ground paprikaat various water activity rangeswater activity a . sub . w week 1 week 5 week 18______________________________________0 . 15 74 % 57 % 42 % 0 . 30 50 % 45 % 12 % 0 . 40 68 % 50 % 43 % 0 . 60 83 % 68 % 55 % ______________________________________ table 10______________________________________percent color retained of heated ground paprikaat various water activity rangeswater activity a . sub . w week 1 week 5 week 18______________________________________0 . 15 66 % 56 % 41 % 0 . 30 60 % 50 % 45 % 0 . 40 80 % 62 % 57 % 0 . 60 98 % 82 % 78 % ______________________________________ it can be seen in tables 9 & amp ; 10 that the stability of the carotenoid pigments follows almost precisely the inverse of the curve predicted by nelson & amp ; labuza ( fig2 ). it can also be seen from these tables that controlled temperature ( with concurrent browning ) significantly enhances the stability of the carotenoids above a water activity of 0 . 3 and particularly in the water activity range of 0 . 4 to 0 . 6 . water activity ranges higher than 0 . 6 were not tested as levels marginally higher than this range will support microbial growth which is not acceptable in a dry spice product . it can be concluded that the stability of the carotenoid pigments found in capsicums unpredictably does not follow the commonly - accepted and predicted pattern for lipid oxidation with respect to temperature and water activity as suggested in u . s . pat . no . 4 , 681 , 769 , or in the cited literature ( nelson and labuza , water activity and food polymer science : implications of state on arrhenius and wlf models in predicting shelf life , k . a . nelson & amp ; t . p . labuza , journal of food engineering 22 , 271 - 289 ( 1994 ); rancidity and its measurement in edible oils and snack foods , a review , robards , kerr , and patsalides , analyst , february 1988 , vol 113 ); describing the stability of lipid systems . in fact , high temperature treatment , combined with rehydration of the press solids to a water activity above 0 . 3 , preferably of 0 . 4 to 0 . 6 , significantly improves stability rather than decreases it . this is a very surprising and unpredicted result . it is well known that the lipid profile of capsicum and its extracts , without the addition of any diluents , comprises a mixture of saturated and unsaturated fatty acids , 60 - 70 % being unsaturated linoleic and linolenic , lipid and antioxidant content of red pepper , daood , biacs , et al ., central food research institute , budapest , hungary ( 1989 ) and the nature of fatty acids and capsanthin esters in paprika , nawar et al ., journal of food science , vol . 36 ( 1971 ). in fact , daood et al suggest that &# 34 ; . . . the presence of triglycerides containing high amounts of unsaturated fatty acids may be an important factor contributing to the fading of paprika during processing and storage .&# 34 ; the present findings are just the opposite . without in any way being limited by theoretical considerations , it is hypothesized that the presently - discovered surprising and unpredicted inverse relationship shown ( in tables 9 & amp ; 10 ) between the stability of carotenoid pigments at given water activities is due to the fatty acids in the substrate being preferentially attacked by the oxidation reaction at the low ( from about 0 . 05 to 0 . 2 a w ,) and higher water activity ranges ( above 0 . 3 , preferably about 0 . 4 to 0 . 6 a w ,), thus protecting the carotenoids . at the intermediate water activity ranges ( 0 . 2 to 0 . 4 a w ,), where the lipids are best protected , the carotenoids are more readily and preferentially attacked and exhibit low resistance to oxidative degradation . another controlled test was conducted to demonstrate the effect of different extractable yields in the residual solid press cake . the effect of higher amounts of unsaturated fatty acids is evident from the results illustrated in table 11 where fresh , refined , bleached , and deodorized soybean oil with no antioxidants was added at various percentages based on the weight of the paprika . the color over time was compared to the untreated control in an accelerated study at 65 ยฐ c . a typical refined , bleached , and deodorized soy oil has a fatty acid composition of 22 . 3 % oleic ( 18 : 1 ), 51 % linoleic ( 18 : 2 ), and 6 . 8 % linolenic ( 18 : 3 ). ( riecel &# 39 ; s handbook of industrial chemistry , 9th edition , pg 278 ). it can be concluded that higher levels of unsaturated fatty acids , such as oleic , linolenic , and linoleic , which are found in most vegetable oils , will improve the color stability of the press residual solids . levels of extractable yield in the residual solids above about 15 - 20 % by weight of the residual solids is undesirable as the residual capstcum solids become difficult to handle for most uses and the efficiency of extraction is reduced , i . e ., less color can be removed from the spice as the residual yield is allowed to increase by decreasing either the pressure or temperature employed . table 11______________________________________percent color retained with varying amountsof soy oil added to ground paprikapercent addition hour 2 hour 4 hour 6 hour 8______________________________________ 0 % 65 % 59 % 52 % 50 % 5 % 90 % 83 % 74 % 72 % 10 % 92 % 84 % 75 % 74 % 15 % 94 % 87 % 80 % 78 % 20 % 96 % 91 % 83 % 81 % ______________________________________ it is readily apparent , comparing the results of the controlled test ( tables 9 & amp ; 10 ) on stability of heated vs unheated material , where oil is controlled at a constant level that , at a given added soy oil content in the press residual solids , the color stability of the residual press solids is significantly improved when the capsicum has been exposed to higher temperatures . this conclusion is not readily apparent in the results shown in table 8 where the amount of residual vegetable oil left in the press residual solids is higher in the low temperature ranges due to the decreased efficiency of the extraction process at lower temperatures ( table 4 ). the presence of higher amounts of residual oils there offers some protection which overshadows the increased protective effect at higher temperatures so evident in tables 9 & amp ; 10 . it can therefore be concluded that much , if not all , of the protection offered by operating the presses at temperatures lower than 100 ยฐ f . ( as claimed in u . s . pat . no . 4 , 681 , 769 ) as compared to temperatures above 100 ยฐ f . is simply due to the higher residual oil levels ( reduced extraction efficiency ) and that , for any given residual oil content , and with rehydrated residual solids , the operating temperatures above 130 ยฐ f . give superior results , not only in an increased extraction efficiency which allows for a continuous , high speed process with increased throughput rates and significantly reduced microbial activity , but most surprisingly in an increased color stability of both the extract and the residual press solids , particularly when the press solids are rehydrated . as can be seen in table 4 , the press solids residual yield is much higher at temperatures below 100 ยฐ f . and much higher ( 28 . 3 % residual yield ) than disclosed in u . s . pat . no . 4 , 681 , 769 ( 10 - 15 % residual yield ). in example 2 , table 4 , the model kek 100 screw press used for the test was operated at about 100 % of its rated capacity of 240 pounds per hour for typical oil seeds . in an effort to more closely model the residual yields of 10 - 15 % ( oil ) in the cake as disclosed in u . s . pat . no . 4 , 681 , 769 , the feed rate for this test was set at about 95 pounds per hour , thus allowing more residence time in the press to expel more extract and to reduce the residual yield of the press residual solids to 10 - 15 %. the following example according to bennett is a two - step production run . one lot , comprising about 300 lbs of 160 asta chili , ground to pass 20 mesh ( usss ), was transferred to a ribbon blender and blended with 13 . 7 % by starting weight of the ground chili of fortified soybean oil having 500 asta oleoresin for about 15 minutes and then allowed to stand for about 16 hours at room temperature ( 75 ยฐ f .) before transfer to the feed hopper of an egon keller model kek - 100 screw press . the feed hopper provides for a controlled flow of the mixture of chili and fortified oil to the press at a rate of about 95 lbs per hour of fresh ground chili , the equivalent of about 800 lbs per hour in a french oil mill machinery company f - 44 press . both these feed rates represent about 40 % of the rated capacity of the respective screw presses on whole oil seeds . the production run was started with a cone setting of about 0 . 030 inches and with the internal worms configured so as to provide a pressure gradient of essentially little or no pressure up to about 500 pounds per square inch of pressure . at these low pressures and feed rates , effluent oil temperatures were maintained at less than 100 ยฐ f . with cooling water as in bennett , and the residual yield ( oil ) in the press residual solids averaged about 12 . 5 %, just as prescribed by bennett , who states that : &# 34 ; temperatures above 100 ยฐ f . should be avoided inasmuch as higher temperatures cause oxidation with a resultant destruction of delicate flavor and / or color principle .&# 34 ; with the press operating as described , the oil extracted , after centrifugation to remove the residual spice fines , assayed at about 1000 asta and the press cake residual solids fraction had a corresponding reduction in asta to about 115 . the press cake of the once - extracted ground fresh spice from the first pressing is further processed following the same procedure above described for the first blending / pressure extraction sequence using , however , fresh soybean oil as an additive in place of the fortified oleoresin soybean oil . the fortified soybean oil extracted assayed at approximately 500 asta . this 500 asta fortified soybean oil extract is recycled as an extractant on fresh ground chili . the extracted chili powder cake from this extraction step had a corresponding reduction in asta value to an average of about 65 asta ( ranged from 41 to 95 asta ). the results of this low temperature , low pressure test are compared to results of high temperature , high pressure conditions in example 2 and are shown in table 12 . table 12______________________________________comparison of low temperature / low pressure and hightemperature / high pressure low temp / low high temp / high pressure , 16 hour pressure continuous batch mixing from example 2______________________________________temperature , deg f . 95 235pressure , psi & lt ; 500 20 , 000 - 30 , 000final residual solids asta 65 33final residual solids yield 12 . 5 % 9 . 3 % final residual solids asta as a 41 . 5 % 22 % percent of fresh chili astaasta loss in 1st mixing stage 7 % 0 % asta loss in 2nd mixing stage 10 . 5 % 0 % final oleoresin asta 1 , 000 1 , 000______________________________________ it can clearly be seen , as is also shown in example 2 ( effect of varying operating temperatures ), that the low temperature / low pressure batch process with extended contact times incurs significant color loss during the extended contact times necessary for low temperature / pressure extraction . in addition , the low temperature / pressure batch process does not remove the color as efficiently as with higher temperatures and pressures for any given size pressing operation . the foregoing example can scientifically be scaled up or extrapolated into a comparative two - stage production run using two model 44 - f french oil mill machinery company presses , as follows : one lot comprising about 3 , 840 lbs of 5 % moisture , 160 asta , 20 mesh , fresh ground chili solids ( capsicum annum ) is passed through a high speed , high shear , steam - jacketed paddle mixer on a continuous basis and fed directly into the press feed hopper at stage one , through the 1st stage press , into a 2nd stage paddle mixer , and then to the 2nd stage press . soybean oil is added continuously through a metering pump into the paddle mixer at stage 2 at the rate of 13 . 7 % by weight of the starting ground chili solids ( 525 lbs of oil for the 3840 lb run ). the raw material chili solids are continuously fed at a rate of about 2 , 500 lbs per hour to the system with a total contact time in each paddle mixer of about 15 seconds . the temperature of the chili / oil mix exiting the paddle mixer is maintained at about 180 ยฐ f . at stage 2 and about 150 ยฐ f . at stage 1 . the oil / extract expelled from the second pressing stage is returned on a continuous basis to the paddle mixer at stage one wherein the oil / extract and fresh ground paprika are mixed in preparation for the first pressing stage . the oil / extract and fresh ground paprika exit the first stage paddle mixer and enter the first stage press at about 150 ยฐ f ., the temperature being controlled by the amount of steam on the paddle mixer jacket . the concentrated oil / extract expelled from the first pressing stage is hydrated with water to about 75 % by weight of the fines ( fine particulate solids ) and gums and is then centrifuged and the hydrated fines and gums are added to the residual press solids from the final ( second ) pressing stage in a high shear mixer , after the solids have passed through a water - jacketed cooling screw . the internal shaft and collar arrangements of the press are configured so as to provide internal pressures of about 20 , 000 to 30 , 000 psi and cooling water is maintained at a flow rate through the bore of the shaft and through the cage cooling jackets so as to maintain an exit oil temperature at the external cage surface of about 180 to 200 ยฐ f . and an exiting residual solid cake temperature of about 235 ยฐ f . the residual cake solid is cooled in a water - jacketed screw conveyor to about 85 ยฐ f . and water , in addition to the hydration water used to remove the fines and gums from the extract , is injected into the high shear , continuous mixer to rehydrate the cake to a water activity of about 0 . 6 . the concentrated extract exiting press stage one has an asta value of about 1 , 000 and the residual press solid cake exiting stage two has an asta value of about 45 . the residual press solid cake has a reddish - brown appearance typical of lightly toasted chili powder . the aerobic plate count of the residual solid cake is about 70 , 000 . the same test is repeated ( according to the bennett example ). no heat is applied during the mixing stages and the press internals are reconfigured so as to provide for minimal friction and compression and the resultant minimal heat generation during the pressing operations . the working compression is supplied primarily by the cone at the cake discharge and is maintained at about 500 psi . oil is added at a rate of about 13 . 7 % by weight of the starting paprika solids ( 525 lbs for the 3840 lb batch ) and mixed in a ribbon blender for sixteen hours and then fed at ambient temperature ( about 75 ยฐ f .) to the pressing system . the feed rate through the pressing stages is maintained at 800 pounds per hour . cooling water is supplied to the internal bore of the shafts and the cooling jackets to maintain exit oil temperatures of less than 100 ยฐ f ., on both the expelled oil and the residual press cake . the extract exiting the first pressing stage of the press is centrifuged without hydration of the gums and fine particulate solids . the concentrated extract exiting press stage one has an asta value of about 1 , 000 and the residual cake solid has an asta value of about 65 . the appearance of the cake is lacking the brownness characteristic of commercially - available ground paprika and chili powder and would require a separate browning step to make it acceptable for common uses . the material is difficult to regrind due to the high level of residual extractable yield left in the cake , it is not flowable , and it must be combined with other solid materials to make an acceptable product for sale . the aerobic plate count is about 220 , 000 . a comparison of the results of the two tests is shown in table 13 . table 13______________________________________ high temperature low temperature pressing pressing______________________________________mixing time , soy oil continuous , 16 hours ( seconds ) fresh oil temp , ยฐ f . 75 75oil / chili stage 1 at press feed , 150 75 ยฐ f . oil / chili stage 2 at press feed , 180 75 ยฐ f . cake after stage 1 pressing , ยฐ f . 225 95cake after stage 2 pressing , ยฐ f . 235 95asta value , extract 1000 9952 / 3 life , extract , 65 ยฐ c ., hours 25 16asta value , press cake 45 652 / 3 life , cake , 72 ยฐ f ., weeks 32 10color recovery , extract 75 % 51 % aerobic plate count , extract 70 , 000 2 , 000 , 000aerobic plate count , cake 2 , 000 220 , 000overall color recovery ( extract 98 % 91 % and cake ) visual appearance , cake red - brown red - tanthroughput rate , lbs per hour 2 , 500 800______________________________________ it is readily apparent that there are substantial advantages to higher temperatures and pressures . the color recovery is enhanced , there is a 50 % increase in yield to the extract , the rate for a given press size is increased by over 300 %, the color stability of the extract is improved by 65 %, the color stability of the residual solids cake is improved by 300 %, and the aerobic plate count is reduced by a factor of greater than 30 in both the extract and the residual cake ; all without the oxidative color losses that are alleged to be an obstacle in u . s . pat . no . 4 , 681 , 769 . it is thereby seen that an improved countercurrent process for the extraction of capsicum solids using an edible solvent , whereby improved yields of both extract and residual solids are obtained , whereby both the extract and the residual solids have improved color stability and freedom from bacterial contamination due to the higher temperatures employed , whereby due to optional advantageous rehydration of residual solids and level of water activity employed an improved color stability in the residual solids is attained , whereby an extract in the form of a clear solution can be obtained by removal of gums and particulate solids in the form of their insoluble hydrates , whereby even greater color stability can be effected by the employment of edible antioxidants in the solvent utilized , and whereby controlled browning of the residual solids may be conveniently effected , all without the expected disadvantages of employing higher temperatures as clearly indicated by the prior art , and whereby all of the stated objects of the invention have been accomplished , has been provided . it is to be understood that the invention is not to be limited to the exact details of operation , or to the exact compositions , methods , procedures , or embodiments shown and described , as obvious modifications and equivalents will be apparent to one skilled in the art , and the invention is therefore to be limited only by the full scope which can be legally accorded to the appended claims . | 0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.